#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
IL22RA1	58985	broad.mit.edu	37	1	24465122	24465122	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:24465122G>T	ENST00000270800.1	-	2	164	c.126C>A	c.(124-126)gaC>gaA	p.D42E		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	42	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		CCGGCCCGCTGTCCCACGTCA	0.592																																					p.D42E													.	IL22RA1-91	0			c.C126A						.						95.0	90.0	91.0					1																	24465122		2203	4300	6503	SO:0001583	missense	58985	exon2			CCCGCTGTCCCAC	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.126C>A	1.37:g.24465122G>T	ENSP00000270800:p.Asp42Glu	117	0		86	4	NM_021258	0	0	3	3	0	A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	ENST00000270800.1	37	CCDS247.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720222	0.30503	.	.	ENSG00000142677	ENST00000270800	T	0.72051	-0.62	5.11	-4.84	0.03151	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.653399	0.15693	N	0.249302	T	0.40743	0.1129	N	0.21545	0.675	0.18873	N	0.999988	B	0.02656	0.0	B	0.06405	0.002	T	0.44097	-0.9350	10	0.02654	T	1	-26.1547	4.4884	0.11801	0.0834:0.4551:0.2255:0.2361	.	42	Q8N6P7	I22R1_HUMAN	E	42	ENSP00000270800:D42E	ENSP00000270800:D42E	D	-	3	2	IL22RA1	24337709	0.000000	0.05858	0.105000	0.21289	0.781000	0.44180	-0.962000	0.03841	-0.414000	0.07495	-0.234000	0.12200	GAC	.		0.592	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1		
TEKT2	27285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	36552574	36552574	+	Silent	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:36552574C>T	ENST00000207457.3	+	6	802	c.675C>T	c.(673-675)aaC>aaT	p.N225N	ADPRHL2_ENST00000373178.4_5'Flank	NM_014466.2	NP_055281.2	Q9UIF3	TEKT2_HUMAN	tektin 2 (testicular)	225					cell projection organization (GO:0030030)|inner dynein arm assembly (GO:0036159)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)|skin(2)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GTCGGTTCAACAAGGACCGAG	0.592																																					p.N225N		.											.	TEKT2-90	0			c.C675T						.						58.0	54.0	55.0					1																	36552574		2203	4300	6503	SO:0001819	synonymous_variant	27285	exon6			GTTCAACAAGGAC	AB033823	CCDS401.1	1p34.3	2008-02-05			ENSG00000092850	ENSG00000092850			11725	protein-coding gene	gene with protein product		608953				12029069, 11751288	Standard	NM_014466		Approved	TEKTB1	uc001bzr.3	Q9UIF3	OTTHUMG00000007629	ENST00000207457.3:c.675C>T	1.37:g.36552574C>T		65	0		47	17	NM_014466	0	0	5	8	3	A6NIS6|O60638	Silent	SNP	ENST00000207457.3	37	CCDS401.1																																																																																			.		0.592	TEKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020200.1	NM_014466	
SLC35D1	23169	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	67519574	67519574	+	Silent	SNP	C	C	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:67519574C>A	ENST00000235345.5	-	1	208	c.123G>T	c.(121-123)ctG>ctT	p.L41L	SLC35D1_ENST00000506472.2_5'Flank	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	41					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						CCAGCAGCTTCAGAAACACGG	0.612																																					p.L41L		.											.	SLC35D1-90	0			c.G123T						.						47.0	50.0	49.0					1																	67519574		2203	4300	6503	SO:0001819	synonymous_variant	23169	exon1			CAGCTTCAGAAAC	AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.123G>T	1.37:g.67519574C>A		194	0		115	35	NM_015139	0	0	0	0	0	A8K185|B7Z3X2|Q52LU5|Q92548	Silent	SNP	ENST00000235345.5	37	CCDS636.1																																																																																			.		0.612	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025948.1	NM_015139	
ERICH3	127254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	75037280	75037280	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:75037280C>A	ENST00000326665.5	-	14	4332	c.4114G>T	c.(4114-4116)Gca>Tca	p.A1372S	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1372	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GCTTTATTTGCTATTGTTTTC	0.522																																					p.A1372S		.											.	C1orf173-94	0			c.G4114T						.						130.0	133.0	132.0					1																	75037280		2203	4300	6503	SO:0001583	missense	127254	exon14			TATTTGCTATTGT																												ENST00000326665.5:c.4114G>T	1.37:g.75037280C>A	ENSP00000322609:p.Ala1372Ser	149	0		97	37	NM_001002912	0	0	0	0	0	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	8.132	0.783370	0.16189	.	.	ENSG00000178965	ENST00000326665	T	0.14516	2.5	5.0	3.1	0.35709	.	.	.	.	.	T	0.02688	0.0081	N	0.24115	0.695	0.09310	N	1	B	0.15473	0.013	B	0.16289	0.015	T	0.45789	-0.9237	9	0.18710	T	0.47	-4.6121	10.2042	0.43103	0.0:0.7597:0.0:0.2403	.	1372	Q5RHP9	CA173_HUMAN	S	1372	ENSP00000322609:A1372S	ENSP00000322609:A1372S	A	-	1	0	C1orf173	74809868	0.148000	0.22702	0.009000	0.14445	0.260000	0.26232	0.903000	0.28475	0.528000	0.28580	-1.134000	0.01955	GCA	.		0.522	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
USP33	23032	broad.mit.edu;bcgsc.ca	37	1	78194350	78194350	+	Silent	SNP	T	T	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:78194350T>C	ENST00000370793.1	-	11	1204	c.858A>G	c.(856-858)gaA>gaG	p.E286E	USP33_ENST00000370792.3_Silent_p.E286E|USP33_ENST00000370794.3_Silent_p.E255E|USP33_ENST00000357428.1_Silent_p.E286E	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	286	USP.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						GCTCTTTCAATTCTTCATGAA	0.368																																					p.E286E	Melanoma(152;72 1870 11110 26780 42647)												.	USP33-659	0			c.A858G						.						125.0	110.0	115.0					1																	78194350		2203	4300	6503	SO:0001819	synonymous_variant	23032	exon11			TTTCAATTCTTCA	AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.858A>G	1.37:g.78194350T>C		44	1		37	16	NM_201626	0	0	0	0	0	Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Silent	SNP	ENST00000370793.1	37	CCDS678.1																																																																																			.		0.368	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017	
ABCA4	24	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94546179	94546179	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:94546179G>A	ENST00000370225.3	-	8	1040	c.954C>T	c.(952-954)atC>atT	p.I318I	ABCA4_ENST00000535735.1_Silent_p.I318I	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	318					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGTCAGACAGGATGCCCATCA	0.542																																					p.I318I		.											.	ABCA4-162	0			c.C954T						.						99.0	91.0	94.0					1																	94546179		2203	4300	6503	SO:0001819	synonymous_variant	24	exon8			AGACAGGATGCCC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.954C>T	1.37:g.94546179G>A		138	0		97	30	NM_000350	0	0	0	0	0	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																			.		0.542	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
SLC30A7	148867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	101387350	101387350	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:101387350A>G	ENST00000370112.4	+	8	982	c.795A>G	c.(793-795)atA>atG	p.I265M	SLC30A7_ENST00000357650.4_Missense_Mutation_p.I265M	NM_001144884.1|NM_133496.4	NP_001138356.1|NP_598003.2	Q8NEW0	ZNT7_HUMAN	solute carrier family 30 (zinc transporter), member 7	265					cellular protein metabolic process (GO:0044267)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	cation transmembrane transporter activity (GO:0008324)			endometrium(3)|large_intestine(2)|lung(10)	15		all_epithelial(167;0.000445)|all_lung(203;0.00645)|Lung NSC(277;0.0119)		Epithelial(280;0.0437)|all cancers(265;0.0498)|COAD - Colon adenocarcinoma(174;0.162)|Colorectal(144;0.19)|Lung(183;0.201)		GTCTGATGATAGCAGATCCTA	0.328																																					p.I265M	NSCLC(91;473 1491 3102 16827 21633)	.											.	SLC30A7-90	0			c.A795G						.						166.0	157.0	160.0					1																	101387350		2202	4299	6501	SO:0001583	missense	148867	exon8			GATGATAGCAGAT	AF233345	CCDS776.1	1p21.1	2013-05-22			ENSG00000162695	ENSG00000162695		"""Solute carriers"""	19306	protein-coding gene	gene with protein product		611149				12446736	Standard	NM_133496		Approved	ZnTL2, ZNT7	uc001dto.2	Q8NEW0	OTTHUMG00000011815	ENST00000370112.4:c.795A>G	1.37:g.101387350A>G	ENSP00000359130:p.Ile265Met	59	0		31	11	NM_133496	0	0	2	2	0	B2R949|D3DT61|Q8TCH2	Missense_Mutation	SNP	ENST00000370112.4	37	CCDS776.1	.	.	.	.	.	.	.	.	.	.	A	18.12	3.552196	0.65311	.	.	ENSG00000162695	ENST00000370112;ENST00000357650	T;T	0.64803	-0.12;-0.12	5.62	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.69477	0.3115	M	0.83692	2.655	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.72232	-0.4353	10	0.48119	T	0.1	-9.0402	7.9394	0.29950	0.721:0.1427:0.0:0.1363	.	265	Q8NEW0	ZNT7_HUMAN	M	265	ENSP00000359130:I265M;ENSP00000350278:I265M	ENSP00000350278:I265M	I	+	3	3	SLC30A7	101159938	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.388000	0.34442	0.920000	0.36970	0.533000	0.62120	ATA	.		0.328	SLC30A7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032711.1	NM_133496	
FCGR3A	2214	broad.mit.edu	37	1	161559585	161559585	+	Intron	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:161559585C>T	ENST00000540048.1	-	2	94				FCGR2B_ENST00000367962.4_Intron|FCGR2C_ENST00000466542.2_RNA|FCGR2B_ENST00000403078.3_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000428605.2_Intron|RP11-25K21.6_ENST00000537821.2_RNA|FCGR2C_ENST00000473530.2_RNA			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCTCAGCGACCCTGTGCATCT	0.587																																					.													.	.	0			.						.						27.0	28.0	28.0					1																	161559585		2149	4150	6299	SO:0001627	intron_variant	9103	.			AGCGACCCTGTGC	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+40572G>A	1.37:g.161559585C>T		504	1		369	56	.	0	0	23	23	0	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	RNA	SNP	ENST00000540048.1	37																																																																																				.		0.587	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569	
IRF2BP2	359948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	234743060	234743060	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:234743060G>A	ENST00000366609.3	-	2	1617	c.1587C>T	c.(1585-1587)ttC>ttT	p.F529F	IRF2BP2_ENST00000366610.3_Silent_p.F513F|IRF2BP2_ENST00000491430.1_5'UTR|RP4-781K5.2_ENST00000436039.1_RNA	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	529	Cys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			AAGGGAAGCAGAACTTGTGCG	0.587																																					p.F529F		.											.	IRF2BP2-90	0			c.C1587T						.						81.0	87.0	85.0					1																	234743060		2203	4300	6503	SO:0001819	synonymous_variant	359948	exon2			GAAGCAGAACTTG	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1587C>T	1.37:g.234743060G>A		99	0		99	38	NM_182972	0	0	36	73	37	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	37	CCDS1602.1																																																																																			.		0.587	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
DHTKD1	55526	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	12160902	12160902	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr10:12160902T>C	ENST00000263035.4	+	15	2619	c.2557T>C	c.(2557-2559)Tac>Cac	p.Y853H	U6_ENST00000606801.1_RNA	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	853					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GATGAGCAAATACAAACATGT	0.433																																					p.Y853H													.	DHTKD1-515	0			c.T2557C						.						124.0	119.0	121.0					10																	12160902		2203	4300	6503	SO:0001583	missense	55526	exon15			AGCAAATACAAAC	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.2557T>C	10.37:g.12160902T>C	ENSP00000263035:p.Tyr853His	65	1		43	16	NM_018706	0	0	6	10	4	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.049542	0.75846	.	.	ENSG00000181192	ENST00000263035	T	0.09538	2.97	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.35451	0.0932	M	0.92169	3.28	0.80722	D	1	D	0.57571	0.98	P	0.54856	0.762	T	0.51466	-0.8702	10	0.87932	D	0	-7.7955	14.7709	0.69679	0.0:0.0:0.0:1.0	.	853	Q96HY7	DHTK1_HUMAN	H	853	ENSP00000263035:Y853H	ENSP00000263035:Y853H	Y	+	1	0	DHTKD1	12200908	1.000000	0.71417	0.699000	0.30290	0.831000	0.47069	7.619000	0.83057	1.955000	0.56771	0.379000	0.24179	TAC	.		0.433	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
PTPLA	9200	broad.mit.edu	37	10	17636308	17636308	+	Missense_Mutation	SNP	T	T	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr10:17636308T>A	ENST00000361271.3	-	6	717	c.680A>T	c.(679-681)cAt>cTt	p.H227L		NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	227			H -> Y (in dbSNP:rs1053926). {ECO:0000269|PubMed:10644438, ECO:0000269|PubMed:11054553}.		fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						TTTCTTCACATGCGGCAAGGC	0.323																																					p.H227L													.	PTPLA-226	0			c.A680T						.						69.0	70.0	70.0					10																	17636308		2203	4294	6497	SO:0001583	missense	9200	exon6			TTCACATGCGGCA	AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.680A>T	10.37:g.17636308T>A	ENSP00000355308:p.His227Leu	127	0		106	3	NM_014241	0	0	8	8	0	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Missense_Mutation	SNP	ENST00000361271.3	37	CCDS7121.1	.	.	.	.	.	.	.	.	.	.	T	14.46	2.540937	0.45280	.	.	ENSG00000165996	ENST00000361271	T	0.28255	1.62	5.72	5.72	0.89469	.	0.165083	0.56097	D	0.000036	T	0.26702	0.0653	L	0.31752	0.955	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.02877	-1.1099	10	0.62326	D	0.03	-17.2091	16.2962	0.82776	0.0:0.0:0.0:1.0	.	227	B0YJ81	HACD1_HUMAN	L	227	ENSP00000355308:H227L	ENSP00000355308:H227L	H	-	2	0	PTPLA	17676314	0.998000	0.40836	0.703000	0.30354	0.544000	0.35116	2.640000	0.46579	2.304000	0.77564	0.528000	0.53228	CAT	.		0.323	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241	
ANK3	288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	61829169	61829169	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr10:61829169C>T	ENST00000280772.2	-	37	11661	c.11470G>A	c.(11470-11472)Gtg>Atg	p.V3824M	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3824					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GAGACTTTCACTGGGTTATCT	0.378																																					p.V3824M		.											.	ANK3-107	0			c.G11470A						.						241.0	236.0	238.0					10																	61829169		2203	4300	6503	SO:0001583	missense	288	exon37			CTTTCACTGGGTT	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.11470G>A	10.37:g.61829169C>T	ENSP00000280772:p.Val3824Met	76	0		57	23	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048577	0.36181	.	.	ENSG00000151150	ENST00000280772	T	0.43688	0.94	4.99	3.09	0.35607	.	0.226364	0.22221	N	0.062959	T	0.22666	0.0547	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.04537	-1.0944	10	0.45353	T	0.12	.	5.5172	0.16914	0.0:0.6224:0.1464:0.2312	.	3824	Q12955	ANK3_HUMAN	M	3824	ENSP00000280772:V3824M	ENSP00000280772:V3824M	V	-	1	0	ANK3	61499175	0.975000	0.34042	1.000000	0.80357	0.979000	0.70002	0.968000	0.29357	0.581000	0.29539	0.650000	0.86243	GTG	.		0.378	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
MMRN2	79812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	88703695	88703695	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr10:88703695G>A	ENST00000372027.5	-	6	1167	c.846C>T	c.(844-846)gcC>gcT	p.A282A	MMRN2_ENST00000488950.1_5'UTR	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	282					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						AGTCAGCCCTGGCCACGGCAC	0.602																																					p.A282A		.											.	MMRN2-153	0			c.C846T						.						62.0	58.0	59.0					10																	88703695		2203	4300	6503	SO:0001819	synonymous_variant	79812	exon6			AGCCCTGGCCACG	AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.846C>T	10.37:g.88703695G>A		109	0		89	41	NM_024756	0	0	0	0	0	Q504V7|Q6P2N2	Silent	SNP	ENST00000372027.5	37	CCDS7379.1																																																																																			.		0.602	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049179.2	NM_024756	
RRP12	23223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	99160073	99160073	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr10:99160073C>T	ENST00000370992.4	-	2	469	c.358G>A	c.(358-360)Gcc>Acc	p.A120T	RRP12_ENST00000414986.1_Missense_Mutation_p.A120T|RRP12_ENST00000315563.6_Missense_Mutation_p.A120T|RP11-452K12.7_ENST00000422848.1_RNA	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	120						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TCCTTGTGGGCAGCCGAGTTG	0.582																																					p.A120T		.											.	RRP12-92	0			c.G358A						.						119.0	119.0	119.0					10																	99160073		2203	4300	6503	SO:0001583	missense	23223	exon2			TGTGGGCAGCCGA		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.358G>A	10.37:g.99160073C>T	ENSP00000360031:p.Ala120Thr	112	0		75	22	NM_001145114	0	0	0	0	0	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	ENST00000370992.4	37	CCDS7457.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.406058	0.42715	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986	T;T;T	0.64260	-0.09;1.52;1.51	5.7	4.8	0.61643	Armadillo-type fold (1);	0.208574	0.49916	D	0.000127	T	0.51295	0.1666	L	0.40543	1.245	0.80722	D	1	P;P;B	0.45715	0.787;0.865;0.001	B;B;B	0.39503	0.158;0.301;0.005	T	0.48246	-0.9052	10	0.13108	T	0.6	-11.1652	15.9236	0.79592	0.1366:0.8634:0.0:0.0	.	120;120;120	E9PCK7;Q5JTH9-2;Q5JTH9	.;.;RRP12_HUMAN	T	120	ENSP00000360031:A120T;ENSP00000324315:A120T;ENSP00000414863:A120T	ENSP00000324315:A120T	A	-	1	0	RRP12	99150063	0.992000	0.36948	0.983000	0.44433	0.965000	0.64279	3.045000	0.49838	1.429000	0.47314	-0.361000	0.07541	GCC	.		0.582	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	NM_015179	
STK32C	282974	hgsc.bcm.edu	37	10	134036392	134036392	+	Silent	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr10:134036392C>T	ENST00000368622.1	-	9	1122	c.741G>A	c.(739-741)aaG>aaA	p.K247K	STK32C_ENST00000368625.4_Silent_p.K377K					serine/threonine kinase 32C											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GCTCCACCCTCTTCTCGCTCA	0.711																																					p.K364K		.											.	STK32C-1083	0			c.G1092A						.						20.0	22.0	21.0					10																	134036392		2183	4281	6464	SO:0001819	synonymous_variant	282974	exon9			CACCCTCTTCTCG	AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368622.1:c.741G>A	10.37:g.134036392C>T		2	0		51	19	NM_173575	0	0	3	3	0		Silent	SNP	ENST00000368622.1	37																																																																																				.		0.711	STK32C-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051068.2	NM_173575	
SLC22A18	5002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	2937874	2937874	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr11:2937874G>T	ENST00000380574.1	+	6	990	c.559G>T	c.(559-561)Gct>Tct	p.A187S	SLC22A18_ENST00000312221.5_Missense_Mutation_p.A187S|SLC22A18_ENST00000449793.2_Missense_Mutation_p.A89S|SLC22A18_ENST00000347936.2_Missense_Mutation_p.A187S			Q96BI1	S22AI_HUMAN	solute carrier family 22, member 18	187					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|excretion (GO:0007588)|organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|symporter activity (GO:0015293)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		GGCCATCCTGGCTGCCCTGGC	0.687																																					p.A187S		.											.	SLC22A18-92	0			c.G559T						.						41.0	44.0	43.0					11																	2937874		2202	4299	6501	SO:0001583	missense	5002	exon6			ATCCTGGCTGCCC	AF028738	CCDS7740.1	11p15.5	2013-05-22	2008-01-11	2004-01-21	ENSG00000110628	ENSG00000110628		"""Solute carriers"""	10964	protein-coding gene	gene with protein product		602631	"""solute carrier family 22 (organic cation transporter), member 1-like"""	ORCTL2, BWSCR1A, IMPT1, SLC22A1L		9499412, 9520460	Standard	NM_183233		Approved	BWR1A, TSSC5, ITM	uc001lwx.3	Q96BI1	OTTHUMG00000010037	ENST00000380574.1:c.559G>T	11.37:g.2937874G>T	ENSP00000369948:p.Ala187Ser	57	0		124	50	NM_002555	0	0	36	67	31	O14906|O43562|O60485|O60680|Q7LDS5|Q7LGF7	Missense_Mutation	SNP	ENST00000380574.1	37	CCDS7740.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451570	0.43531	.	.	ENSG00000110628	ENST00000347936;ENST00000312221;ENST00000449793;ENST00000380574	T;T;T;T	0.81163	0.34;0.34;-1.46;0.34	3.77	2.8	0.32819	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.460037	0.20295	N	0.095157	D	0.84316	0.5445	M	0.62723	1.935	0.09310	N	1	D;D	0.59357	0.97;0.985	P;P	0.61070	0.681;0.883	T	0.74343	-0.3696	10	0.59425	D	0.04	-12.6812	8.7536	0.34633	0.0:0.0:0.7726:0.2273	.	89;187	E9PRM7;Q96BI1	.;S22AI_HUMAN	S	187;187;89;187	ENSP00000307859:A187S;ENSP00000311139:A187S;ENSP00000392072:A89S;ENSP00000369948:A187S	ENSP00000311139:A187S	A	+	1	0	SLC22A18	2894450	0.031000	0.19500	0.002000	0.10522	0.012000	0.07955	1.338000	0.33873	0.814000	0.34374	0.491000	0.48974	GCT	.		0.687	SLC22A18-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027770.1	NM_183233	
PAMR1	25891	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	35454107	35454107	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr11:35454107G>A	ENST00000378880.2	-	11	2405	c.1960C>T	c.(1960-1962)Ccc>Tcc	p.P654S	PAMR1_ENST00000378878.3_Missense_Mutation_p.P543S|PAMR1_ENST00000278360.3_Missense_Mutation_p.P671S|PAMR1_ENST00000532848.1_Missense_Mutation_p.P614S	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	654	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						GGGGCAGTGGGTTCCCAGCTG	0.592																																					p.P671S													.	PAMR1-70	0			c.C2011T						.						83.0	71.0	75.0					11																	35454107		2202	4298	6500	SO:0001583	missense	25891	exon12			CAGTGGGTTCCCA		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1960C>T	11.37:g.35454107G>A	ENSP00000368158:p.Pro654Ser	137	1		91	46	NM_015430	0	0	0	0	0	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	ENST00000378880.2	37	CCDS31460.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.779438	0.49891	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	D;D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07;-3.07	5.34	3.31	0.37934	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.101061	0.64402	D	0.000002	D	0.89458	0.6721	L	0.46157	1.445	0.45930	D	0.998768	P;P;P	0.45126	0.851;0.811;0.465	B;B;B	0.43838	0.253;0.433;0.124	D	0.89858	0.4014	10	0.87932	D	0	.	12.0084	0.53272	0.0:0.1315:0.732:0.1366	.	543;654;671	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	S	671;654;543;614;631	ENSP00000278360:P671S;ENSP00000368158:P654S;ENSP00000368156:P543S;ENSP00000433868:P614S;ENSP00000432591:P631S	ENSP00000278360:P671S	P	-	1	0	PAMR1	35410683	1.000000	0.71417	0.982000	0.44146	0.289000	0.27227	3.841000	0.55850	1.361000	0.45981	0.561000	0.74099	CCC	.		0.592	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430	
CLSTN3	9746	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7295575	7295575	+	Missense_Mutation	SNP	G	G	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr12:7295575G>C	ENST00000266546.6	+	11	2101	c.1651G>C	c.(1651-1653)Gag>Cag	p.E551Q	CLSTN3_ENST00000537408.1_Missense_Mutation_p.E563Q	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	551					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						TGCATGTCGGGAGGGGCTGGA	0.602																																					p.E551Q													.	CLSTN3-153	0			c.G1651C						.						78.0	64.0	69.0					12																	7295575		2203	4300	6503	SO:0001583	missense	9746	exon11			TGTCGGGAGGGGC	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1651G>C	12.37:g.7295575G>C	ENSP00000266546:p.Glu551Gln	210	2		174	101	NM_014718	0	0	16	35	19	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	37	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941192	0.92526	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.37058	1.22;1.22	5.08	5.08	0.68730	.	0.105878	0.64402	D	0.000007	T	0.63522	0.2518	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.97110	0.979;1.0	T	0.68804	-0.5312	10	0.87932	D	0	-30.0082	18.4777	0.90799	0.0:0.0:1.0:0.0	.	563;551	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	Q	551;563	ENSP00000266546:E551Q;ENSP00000440679:E563Q	ENSP00000266546:E551Q	E	+	1	0	CLSTN3	7186842	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.455000	0.97625	2.353000	0.79882	0.442000	0.29010	GAG	.		0.602	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
MARS	4141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57894254	57894254	+	Silent	SNP	G	G	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr12:57894254G>C	ENST00000262027.5	+	10	1376	c.1242G>C	c.(1240-1242)cgG>cgC	p.R414R	MARS_ENST00000315473.5_Silent_p.R180R|MARS_ENST00000447721.2_3'UTR	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	414					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	AGGAGGCTCGGGGTGACCAGT	0.562																																					p.R414R		.											.	MARS-654	0			c.G1242C						.						147.0	115.0	126.0					12																	57894254		2203	4300	6503	SO:0001819	synonymous_variant	4141	exon10			GGCTCGGGGTGAC	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.1242G>C	12.37:g.57894254G>C		213	0		187	44	NM_004990	0	0	28	40	12	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Silent	SNP	ENST00000262027.5	37	CCDS8942.1																																																																																			.		0.562	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	35770159	35770159	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr13:35770159G>T	ENST00000400445.3	+	31	5620	c.5086G>T	c.(5086-5088)Ggc>Tgc	p.G1696C	NBEA_ENST00000379939.2_Missense_Mutation_p.G1693C|NBEA_ENST00000540320.1_Missense_Mutation_p.G1696C|NBEA_ENST00000310336.4_Missense_Mutation_p.G1696C	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1696					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AACAAGTACAGGCCCTGATGC	0.433																																					p.G1696C		.											.	NBEA-144	0			c.G5086T						.						79.0	78.0	78.0					13																	35770159		1906	4130	6036	SO:0001583	missense	26960	exon31			AGTACAGGCCCTG	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.5086G>T	13.37:g.35770159G>T	ENSP00000383295:p.Gly1696Cys	100	0		111	57	NM_015678	0	0	0	0	0	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376162	0.82682	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.76688	0.4022	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.80764	0.846;0.994	T	0.77742	-0.2474	10	0.72032	D	0.01	.	13.6145	0.62099	0.0706:0.0:0.9294:0.0	.	1696;1693	Q8NFP9;Q5T321	NBEA_HUMAN;.	C	1696;1696;1693;1696;323	ENSP00000440951:G1696C;ENSP00000383295:G1696C;ENSP00000369271:G1693C;ENSP00000308534:G1696C	ENSP00000308534:G1696C	G	+	1	0	NBEA	34668159	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.455000	0.80726	2.843000	0.97960	0.585000	0.79938	GGC	.		0.433	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
EBPL	84650	broad.mit.edu	37	13	50235160	50235160	+	Missense_Mutation	SNP	G	G	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr13:50235160G>C	ENST00000242827.6	-	4	615	c.565C>G	c.(565-567)Cta>Gta	p.L189V	EBPL_ENST00000378270.5_3'UTR|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000378284.2_3'UTR|EBPL_ENST00000495963.2_5'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	189					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.L189V(9)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		TTGAGTTCTAGCCATGACTGC	0.418																																					p.L189V	NSCLC(39;857 1083 36109 42364 51411)												.	EBPL-90	9	Substitution - Missense(9)	endometrium(6)|kidney(3)	c.C565G						.						67.0	67.0	67.0					13																	50235160		2203	4300	6503	SO:0001583	missense	84650	exon4			GTTCTAGCCATGA	AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.565C>G	13.37:g.50235160G>C	ENSP00000242827:p.Leu189Val	107	0		97	3	NM_032565	0	0	31	31	0	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	ENST00000242827.6	37	CCDS9420.1	.	.	.	.	.	.	.	.	.	.	C	3.076	-0.189988	0.06299	.	.	ENSG00000123179	ENST00000242827	D	0.97850	-4.57	5.61	2.84	0.33178	.	0.689671	0.14945	N	0.289287	D	0.88179	0.6367	N	0.00621	-1.32	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.79482	-0.1785	10	0.25751	T	0.34	-0.2032	8.3049	0.32036	0.0:0.4998:0.3595:0.1406	.	189	Q9BY08	EBPL_HUMAN	V	189	ENSP00000242827:L189V	ENSP00000242827:L189V	L	-	1	2	EBPL	49133161	0.000000	0.05858	0.303000	0.25071	0.899000	0.52679	-1.071000	0.03437	0.397000	0.25310	-0.127000	0.14921	CTA	.		0.418	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044932.2	NM_032565	
FSIP1	161835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	40056080	40056080	+	Silent	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr15:40056080C>T	ENST00000350221.3	-	5	710	c.501G>A	c.(499-501)gaG>gaA	p.E167E		NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	167										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		TTTCCATCTCCTCTTTACTTT	0.299																																					p.E167E		.											.	FSIP1-517	0			c.G501A						.						51.0	57.0	55.0					15																	40056080		2201	4293	6494	SO:0001819	synonymous_variant	161835	exon5			CATCTCCTCTTTA	BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.501G>A	15.37:g.40056080C>T		155	0		121	49	NM_152597	0	0	0	0	0	Q6X2C8|Q86Y89	Silent	SNP	ENST00000350221.3	37	CCDS10050.1																																																																																			.		0.299	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252118.2	NM_152597	
NDUFAF1	51103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41689069	41689069	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr15:41689069G>A	ENST00000260361.4	-	2	570	c.189C>T	c.(187-189)caC>caT	p.H63H		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	63					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		CTTCTTTCTGGTGATCTCCTT	0.423																																					p.H63H		.											.	NDUFAF1-91	0			c.C189T						.						118.0	121.0	120.0					15																	41689069		2203	4300	6503	SO:0001819	synonymous_variant	51103	exon2			TTTCTGGTGATCT	AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.189C>T	15.37:g.41689069G>A		77	0		60	24	NM_016013	0	0	12	18	6	Q9BVZ5	Silent	SNP	ENST00000260361.4	37	CCDS10075.1																																																																																			.		0.423	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252692.2	NM_016013	
SPG11	80208	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	44855441	44855441	+	Missense_Mutation	SNP	A	A	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr15:44855441A>T	ENST00000261866.7	-	40	7226	c.7210T>A	c.(7210-7212)Tat>Aat	p.Y2404N	SPG11_ENST00000427534.2_3'UTR|SPG11_ENST00000535302.2_Missense_Mutation_p.Y2291N	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	2404					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TCTTCACAATATGTGAGTAAT	0.348																																					p.Y2404N													.	SPG11-95	0			c.T7210A						.						132.0	122.0	126.0					15																	44855441		2198	4298	6496	SO:0001583	missense	80208	exon40			CACAATATGTGAG		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.7210T>A	15.37:g.44855441A>T	ENSP00000261866:p.Tyr2404Asn	151	1		104	43	NM_025137	0	0	14	38	24	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	37	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	A	15.36	2.809037	0.50421	.	.	ENSG00000104133	ENST00000261866;ENST00000535302	T;T	0.77098	-1.07;-0.75	5.95	5.95	0.96441	.	0.182785	0.48767	D	0.000161	D	0.86280	0.5895	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.989;0.989;0.989	D	0.85452	0.1161	10	0.35671	T	0.21	.	12.2098	0.54373	0.9321:0.0:0.0679:0.0	.	2291;2404;2404	F5H3N6;C4B7M4;Q96JI7	.;.;SPTCS_HUMAN	N	2404;2291	ENSP00000261866:Y2404N;ENSP00000445278:Y2291N	ENSP00000261866:Y2404N	Y	-	1	0	SPG11	42642733	0.998000	0.40836	0.961000	0.40146	0.958000	0.62258	3.705000	0.54823	2.276000	0.75962	0.528000	0.53228	TAT	.		0.348	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
TICRR	90381	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	90167321	90167321	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr15:90167321G>A	ENST00000268138.7	+	20	3885	c.3780G>A	c.(3778-3780)acG>acA	p.T1260T	KIF7_ENST00000558928.1_Intron|TICRR_ENST00000560985.1_Silent_p.T1259T			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1260	Pro-rich.				cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										TCATGGGCACGCCTCAGAATC	0.542																																					p.T1260T		.											.	.	0			c.G3780A						.						66.0	70.0	69.0					15																	90167321		2200	4299	6499	SO:0001819	synonymous_variant	90381	exon20			GGGCACGCCTCAG	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.3780G>A	15.37:g.90167321G>A		49	0		39	17	NM_152259	0	0	0	0	0	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	ENST00000268138.7	37	CCDS10352.2																																																																																			.		0.542	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
ANKS3	124401	hgsc.bcm.edu	37	16	4748510	4748510	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr16:4748510G>T	ENST00000304283.4	-	14	1936	c.1642C>A	c.(1642-1644)Cgc>Agc	p.R548S	ANKS3_ENST00000585773.1_Missense_Mutation_p.R475S|ANKS3_ENST00000446014.2_Missense_Mutation_p.R419S	NM_133450.3	NP_597707.1	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain containing 3	548										endometrium(5)|kidney(4)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	19						TCGCGGGCGCGGTCCTGCTCC	0.736																																					p.R548S		.											.	ANKS3-90	0			c.C1642A						.						6.0	7.0	6.0					16																	4748510		2086	4135	6221	SO:0001583	missense	124401	exon14			GGGCGCGGTCCTG	AK057329	CCDS10520.1, CCDS73820.1	16p13.3	2013-01-10			ENSG00000168096	ENSG00000168096		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	29422	protein-coding gene	gene with protein product						11853319	Standard	NM_133450		Approved	KIAA1977, FLJ32345, FLJ32767	uc002cxj.2	Q6ZW76	OTTHUMG00000129478	ENST00000304283.4:c.1642C>A	16.37:g.4748510G>T	ENSP00000304586:p.Arg548Ser	1	0		25	17	NM_133450	0	0	14	44	30	B4DWU4|D3DUE2|Q8TF25	Missense_Mutation	SNP	ENST00000304283.4	37	CCDS10520.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318757	0.41096	.	.	ENSG00000168096	ENST00000304283;ENST00000446014	T;T	0.31510	1.49;3.24	5.46	-6.97	0.01616	.	1.035280	0.07528	N	0.911661	T	0.04815	0.0130	N	0.00289	-1.7	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.30001	-0.9993	10	0.08837	T	0.75	0.351	3.7451	0.08545	0.0874:0.2626:0.181:0.469	.	548	Q6ZW76	ANKS3_HUMAN	S	548;419	ENSP00000304586:R548S;ENSP00000406796:R419S	ENSP00000304586:R548S	R	-	1	0	ANKS3	4688511	0.000000	0.05858	0.001000	0.08648	0.091000	0.18340	-0.450000	0.06803	-1.265000	0.02449	-0.371000	0.07208	CGC	.		0.736	ANKS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251642.3	NM_133450	
GRIN2A	2903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	10273887	10273887	+	Missense_Mutation	SNP	G	G	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr16:10273887G>C	ENST00000396573.2	-	3	691	c.382C>G	c.(382-384)Cat>Gat	p.H128D	GRIN2A_ENST00000404927.2_Missense_Mutation_p.H128D|GRIN2A_ENST00000562109.1_Missense_Mutation_p.H128D|GRIN2A_ENST00000330684.3_Missense_Mutation_p.H128D|GRIN2A_ENST00000396575.2_Missense_Mutation_p.H128D	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	128					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCGCCCCCATGAATGCCCAAG	0.597																																					p.H128D		.											.	GRIN2A-349	0			c.C382G						.						56.0	52.0	53.0					16																	10273887		2197	4300	6497	SO:0001583	missense	2903	exon3			CCCCATGAATGCC		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.382C>G	16.37:g.10273887G>C	ENSP00000379818:p.His128Asp	145	0		158	42	NM_000833	0	0	0	0	0	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862300	0.71949	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	4.54	4.54	0.55810	Extracellular ligand-binding receptor (1);	0.062818	0.64402	D	0.000007	D	0.91068	0.7189	M	0.75447	2.3	0.80722	D	1	D;P;P	0.67145	0.996;0.879;0.803	D;P;P	0.64776	0.929;0.677;0.479	D	0.91402	0.5144	9	.	.	.	.	16.2901	0.82747	0.0:0.0:1.0:0.0	.	128;128;128	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	D	128	ENSP00000379818:H128D;ENSP00000385872:H128D;ENSP00000332549:H128D;ENSP00000379820:H128D	.	H	-	1	0	GRIN2A	10181388	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.938000	0.87678	2.088000	0.63022	0.561000	0.74099	CAT	.		0.597	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
DBNDD1	79007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	90072805	90072805	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr16:90072805G>T	ENST00000002501.6	-	4	546	c.415C>A	c.(415-417)Ccc>Acc	p.P139T	DBNDD1_ENST00000392973.3_Missense_Mutation_p.P145T|DBNDD1_ENST00000304733.3_Missense_Mutation_p.P159T|DBNDD1_ENST00000568838.1_Missense_Mutation_p.P259T	NM_001042610.1	NP_001036075.1	Q9H9R9	DBND1_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 1	139						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0275)		TGCCGCTCGGGGTCGCCTAGG	0.677																																					p.P159T		.											.	DBNDD1-90	0			c.C475A						.						35.0	45.0	42.0					16																	90072805		2023	4188	6211	SO:0001583	missense	79007	exon4			GCTCGGGGTCGCC	AK090696	CCDS10991.2, CCDS42223.1, CCDS73931.1	16q24.3	2008-02-05			ENSG00000003249	ENSG00000003249			28455	protein-coding gene	gene with protein product						12477932	Standard	NM_001288708		Approved	MGC3101, FLJ12582	uc002fqe.1	Q9H9R9	OTTHUMG00000138984	ENST00000002501.6:c.415C>A	16.37:g.90072805G>T	ENSP00000002501:p.Pro139Thr	38	0		62	16	NM_024043	0	0	11	15	4	B4DQS3|Q69YT2|Q9BW25	Missense_Mutation	SNP	ENST00000002501.6	37	CCDS42223.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990417	0.35131	.	.	ENSG00000003249	ENST00000304733;ENST00000002501;ENST00000392973	T;T	0.30448	1.53;1.53	5.64	0.925	0.19424	.	0.270724	0.37577	N	0.002024	T	0.18002	0.0432	L	0.46157	1.445	0.25250	N	0.989681	B;B	0.20052	0.023;0.041	B;B	0.15052	0.012;0.011	T	0.13098	-1.0522	10	0.16420	T	0.52	-4.1737	1.4458	0.02364	0.2704:0.1553:0.4171:0.1571	.	139;159	Q9H9R9;Q9H9R9-2	DBND1_HUMAN;.	T	159;139;259	ENSP00000306407:P159T;ENSP00000002501:P139T	ENSP00000002501:P139T	P	-	1	0	DBNDD1	88600306	1.000000	0.71417	0.003000	0.11579	0.131000	0.20780	1.604000	0.36804	0.321000	0.23259	0.491000	0.48974	CCC	.		0.677	DBNDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272872.1	NM_024043	
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7727530	7727530	+	Missense_Mutation	SNP	A	A	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr17:7727530A>T	ENST00000572933.1	+	76	13030	c.11570A>T	c.(11569-11571)cAc>cTc	p.H3857L	DNAH2_ENST00000389173.2_Missense_Mutation_p.H3857L			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3857	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGGCAGAGCACATGGGCATG	0.662																																					p.H3857L		.											.	DNAH2-102	0			c.A11570T						.						63.0	56.0	59.0					17																	7727530		2203	4300	6503	SO:0001583	missense	146754	exon75			CAGAGCACATGGG	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11570A>T	17.37:g.7727530A>T	ENSP00000458355:p.His3857Leu	27	0		100	56	NM_020877	0	0	0	2	2	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.321206	0.41096	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.08193	3.12	4.9	4.9	0.64082	Dynein heavy chain (1);	0.564059	0.19257	N	0.118766	T	0.05731	0.0150	N	0.11201	0.11	0.80722	D	1	B;B	0.14012	0.007;0.009	B;B	0.12156	0.004;0.007	T	0.38802	-0.9644	10	0.40728	T	0.16	.	13.4924	0.61405	1.0:0.0:0.0:0.0	.	3818;3857	Q9P225-2;Q9P225	.;DYH2_HUMAN	L	3818;3857	ENSP00000373825:H3857L	ENSP00000353818:H3818L	H	+	2	0	DNAH2	7668255	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.869000	0.63028	1.848000	0.53677	0.334000	0.21626	CAC	.		0.662	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
MAPK7	5598	broad.mit.edu	37	17	19285118	19285118	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr17:19285118C>A	ENST00000308406.5	+	5	1888	c.1502C>A	c.(1501-1503)gCt>gAt	p.A501D	MAPK7_ENST00000395604.3_Missense_Mutation_p.A501D|MAPK7_ENST00000395602.4_Missense_Mutation_p.A501D|MAPK7_ENST00000299612.7_Missense_Mutation_p.A362D|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000571657.1_Intron	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	501	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)	p.A501D(1)		autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					CCCCTGGAGGCTCCTGAGCCT	0.672																																					p.A501D													.	MAPK7-1402	1	Substitution - Missense(1)	endometrium(1)	c.C1502A						.						10.0	17.0	15.0					17																	19285118		2162	4232	6394	SO:0001583	missense	5598	exon5			TGGAGGCTCCTGA	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1502C>A	17.37:g.19285118C>A	ENSP00000311005:p.Ala501Asp	17	0		91	12	NM_002749	0	0	7	8	1	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248312	0.59103	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.74209	-0.57;-0.82;-0.57;-0.57	4.36	3.39	0.38822	.	0.278335	0.34291	N	0.004097	T	0.62792	0.2457	N	0.22421	0.69	0.33339	D	0.569546	P	0.50943	0.94	P	0.47299	0.543	T	0.71846	-0.4469	10	0.87932	D	0	-7.5638	6.6062	0.22726	0.0:0.7883:0.0:0.2117	.	501	Q13164	MK07_HUMAN	D	501;362;501;501	ENSP00000311005:A501D;ENSP00000299612:A362D;ENSP00000378968:A501D;ENSP00000378966:A501D	ENSP00000299612:A362D	A	+	2	0	MAPK7	19225711	0.988000	0.35896	0.980000	0.43619	0.970000	0.65996	1.704000	0.37857	1.055000	0.40461	0.561000	0.74099	GCT	.		0.672	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
SPAG5	10615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	26912886	26912886	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr17:26912886T>C	ENST00000321765.5	-	7	2068	c.1736A>G	c.(1735-1737)gAt>gGt	p.D579G		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	579	Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CCTTACCGCATCCTTGCCTCT	0.498																																					p.D579G		.											.	SPAG5-90	0			c.A1736G						.						225.0	197.0	206.0					17																	26912886		2203	4300	6503	SO:0001583	missense	10615	exon7			ACCGCATCCTTGC	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.1736A>G	17.37:g.26912886T>C	ENSP00000323300:p.Asp579Gly	74	0		79	48	NM_006461	0	0	0	0	0	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.907625	0.52333	.	.	ENSG00000076382	ENST00000321765;ENST00000536674	.	.	.	5.82	3.52	0.40303	.	0.549745	0.17799	N	0.161643	T	0.25827	0.0629	L	0.29908	0.895	0.22096	N	0.999364	P	0.48294	0.908	B	0.39660	0.306	T	0.05099	-1.0906	9	0.56958	D	0.05	-1.7343	10.252	0.43375	0.0:0.0:0.3183:0.6817	.	579	Q96R06	SPAG5_HUMAN	G	579;76	.	ENSP00000323300:D579G	D	-	2	0	SPAG5	23937013	0.989000	0.36119	0.994000	0.49952	0.917000	0.54804	1.208000	0.32345	0.414000	0.25790	0.533000	0.62120	GAT	.		0.498	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
KRT13	3860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39658844	39658844	+	Silent	SNP	T	T	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr17:39658844T>C	ENST00000246635.3	-	6	1072	c.1026A>G	c.(1024-1026)aaA>aaG	p.K342K	AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Silent_p.K342K|KRT13_ENST00000336861.3_Silent_p.K342K|KRT13_ENST00000587118.1_5'Flank	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	342	Coil 2.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				CCAGCCCCGCTTTCTGGTGGA	0.627																																					p.K342K		.											.	KRT13-95	0			c.A1026G						.						70.0	66.0	67.0					17																	39658844		2203	4300	6503	SO:0001819	synonymous_variant	3860	exon6			CCCCGCTTTCTGG		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.1026A>G	17.37:g.39658844T>C		67	0		63	19	NM_002274	0	0	0	0	0	Q53G54|Q6AZK5|Q8N240	Silent	SNP	ENST00000246635.3	37	CCDS11396.1																																																																																			.		0.627	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
ZNF516	9658	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	74091620	74091620	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr18:74091620C>G	ENST00000443185.2	-	4	2767	c.2450G>C	c.(2449-2451)gGc>gCc	p.G817A	ZNF516_ENST00000524431.2_5'UTR|RP11-504I13.3_ENST00000583287.1_RNA	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	817					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		AGGCGGGGGGCCCGTGCGTCC	0.622																																					p.G817A													.	ZNF516-69	0			c.G2450C						.						38.0	46.0	43.0					18																	74091620		1946	4125	6071	SO:0001583	missense	9658	exon4			GGGGGGCCCGTGC	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.2450G>C	18.37:g.74091620C>G	ENSP00000394757:p.Gly817Ala	111	1		99	37	NM_014643	0	0	0	0	0		Missense_Mutation	SNP	ENST00000443185.2	37		.	.	.	.	.	.	.	.	.	.	C	17.81	3.481490	0.63849	.	.	ENSG00000101493	ENST00000443185	T	0.63580	-0.05	4.31	4.31	0.51392	.	0.000000	0.51477	D	0.000095	T	0.79015	0.4375	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82412	-0.0470	9	0.87932	D	0	-15.9958	15.5252	0.75898	0.0:1.0:0.0:0.0	.	817	Q92618	ZN516_HUMAN	A	817	ENSP00000394757:G817A	ENSP00000394757:G817A	G	-	2	0	ZNF516	72220608	1.000000	0.71417	0.844000	0.33320	0.431000	0.31685	6.499000	0.73683	2.387000	0.81309	0.561000	0.74099	GGC	.		0.622	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
ELAVL1	1994	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	8038748	8038748	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr19:8038748G>A	ENST00000407627.2	-	4	420	c.291C>T	c.(289-291)cgC>cgT	p.R97R	ELAVL1_ENST00000593807.1_Silent_p.R97R|ELAVL1_ENST00000351593.5_Silent_p.R124R|ELAVL1_ENST00000596459.1_Silent_p.R97R	NM_001419.2	NP_001410.2	Q15717	ELAV1_HUMAN	ELAV like RNA binding protein 1	97	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|multicellular organismal development (GO:0007275)|positive regulation of translation (GO:0045727)|regulation of stem cell maintenance (GO:2000036)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|double-stranded RNA binding (GO:0003725)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						CTGAGCTCGGGCGAGCATACG	0.542																																					p.R97R													.	ELAVL1-90	0			c.C291T						.						138.0	105.0	116.0					19																	8038748		2203	4300	6503	SO:0001819	synonymous_variant	1994	exon4			GCTCGGGCGAGCA	U38175	CCDS12193.1	19p13.2	2013-10-03	2013-10-03			ENSG00000066044		"""RNA binding motif (RRM) containing"""	3312	protein-coding gene	gene with protein product	"""embryonic lethal, abnormal vision, drosophila, homolog-like 1"", ""Hu antigen R"""	603466	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)"""	HUR		8626503, 9003489	Standard	NM_001419		Approved	HuR, Hua, MelG	uc002mjb.3	Q15717		ENST00000407627.2:c.291C>T	19.37:g.8038748G>A		257	1		190	34	NM_001419	0	0	8	12	4	B4DVB8|Q53XN6|Q9BTT1	Silent	SNP	ENST00000407627.2	37	CCDS12193.1																																																																																			.		0.542	ELAVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461494.3	NM_001419	
MUC16	94025	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9077779	9077779	+	Missense_Mutation	SNP	T	T	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr19:9077779T>G	ENST00000397910.4	-	3	9870	c.9667A>C	c.(9667-9669)Act>Cct	p.T3223P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3224	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTCTCACAGTGGACCTGATC	0.512																																					p.T3223P													.	MUC16-566	0			c.A9667C						.						144.0	141.0	142.0					19																	9077779		1972	4160	6132	SO:0001583	missense	94025	exon3			TCACAGTGGACCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.9667A>C	19.37:g.9077779T>G	ENSP00000381008:p.Thr3223Pro	186	1		115	34	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	4.351	0.064560	0.08388	.	.	ENSG00000181143	ENST00000397910	T	0.02579	4.24	2.1	2.1	0.27182	.	.	.	.	.	T	0.04407	0.0121	N	0.08118	0	.	.	.	D	0.71674	0.998	D	0.80764	0.994	T	0.40646	-0.9552	8	0.87932	D	0	.	6.1843	0.20488	0.0:0.0:0.0:1.0	.	3223	B5ME49	.	P	3223	ENSP00000381008:T3223P	ENSP00000381008:T3223P	T	-	1	0	MUC16	8938779	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-1.277000	0.02812	1.204000	0.43247	0.260000	0.18958	ACT	.		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ILVBL	10994	broad.mit.edu	37	19	15227275	15227275	+	Silent	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr19:15227275G>T	ENST00000263383.3	-	11	1384	c.1245C>A	c.(1243-1245)gcC>gcA	p.A415A	ILVBL_ENST00000534378.1_Silent_p.A308A|ILVBL_ENST00000531635.1_5'Flank	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	415						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)			NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						CCCAGTCTGGGGCCCAGGTCT	0.647																																					p.A415A													.	ILVBL-92	0			c.C1245A						.						53.0	55.0	54.0					19																	15227275		2203	4300	6503	SO:0001819	synonymous_variant	10994	exon11			GTCTGGGGCCCAG	U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.1245C>A	19.37:g.15227275G>T		81	0		84	3	NM_006844	0	1	78	79	0	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Silent	SNP	ENST00000263383.3	37	CCDS12325.1																																																																																			.		0.647	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385439.1	NM_006844	
LRP1B	53353	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	141771172	141771172	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr2:141771172C>A	ENST00000389484.3	-	14	3304	c.2333G>T	c.(2332-2334)aGa>aTa	p.R778I		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	778					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TAGGGGTGGTCTTTCATGCCT	0.343										TSP Lung(27;0.18)																											p.R778I	Colon(99;50 2074 2507 20106)												.	LRP1B-311	0			c.G2333T						.						143.0	136.0	138.0					2																	141771172		2203	4300	6503	SO:0001583	missense	53353	exon14			GGTGGTCTTTCAT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2333G>T	2.37:g.141771172C>A	ENSP00000374135:p.Arg778Ile	217	0		187	40	NM_018557	0	0	0	0	0	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.167516	0.78339	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.90732	-2.72	5.64	5.64	0.86602	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	U	0.000000	D	0.93103	0.7804	L	0.41961	1.31	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.90084	0.4172	10	0.18710	T	0.47	.	19.7014	0.96054	0.0:1.0:0.0:0.0	.	778	Q9NZR2	LRP1B_HUMAN	I	778;716	ENSP00000374135:R778I	ENSP00000374135:R778I	R	-	2	0	LRP1B	141487642	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.938000	0.70170	2.660000	0.90430	0.563000	0.77884	AGA	.		0.343	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
GRB14	2888	hgsc.bcm.edu	37	2	165477654	165477654	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr2:165477654C>G	ENST00000263915.3	-	1	704	c.166G>C	c.(166-168)Ggg>Cgg	p.G56R		NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	56					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						CCGCGGGTCCCGTCCGGAAGG	0.771																																					p.G56R		.											.	GRB14-420	0			c.G166C						.						2.0	3.0	3.0					2																	165477654		1387	3094	4481	SO:0001583	missense	2888	exon1			GGGTCCCGTCCGG		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.166G>C	2.37:g.165477654C>G	ENSP00000263915:p.Gly56Arg	2	0		53	30	NM_004490	0	0	0	0	0	B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	ENST00000263915.3	37	CCDS2222.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638721	0.47153	.	.	ENSG00000115290	ENST00000263915	T	0.23552	1.9	3.52	3.52	0.40303	.	0.650759	0.12693	N	0.447067	T	0.14570	0.0352	N	0.08118	0	0.80722	D	1	B	0.28055	0.199	B	0.28139	0.086	T	0.10660	-1.0620	10	0.66056	D	0.02	-0.5305	10.4807	0.44691	0.0:1.0:0.0:0.0	.	56	Q14449	GRB14_HUMAN	R	56	ENSP00000263915:G56R	ENSP00000263915:G56R	G	-	1	0	GRB14	165185900	0.128000	0.22383	0.967000	0.41034	0.993000	0.82548	1.792000	0.38754	1.822000	0.53115	0.585000	0.79938	GGG	.		0.771	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2		
RNF25	64320	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219536685	219536685	+	Silent	SNP	C	C	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr2:219536685C>G	ENST00000295704.2	-	1	449	c.9G>C	c.(7-9)gcG>gcC	p.A3A	STK36_ENST00000440309.1_5'Flank|STK36_ENST00000295709.3_5'Flank|STK36_ENST00000392106.2_5'Flank|STK36_ENST00000392105.3_5'Flank	NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	3					positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGACGCAGACGCCGCCATAT	0.612																																					p.A3A													.	RNF25-227	0			c.G9C						.						33.0	35.0	34.0					2																	219536685		2203	4300	6503	SO:0001819	synonymous_variant	64320	exon1			CGCAGACGCCGCC		CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.9G>C	2.37:g.219536685C>G		192	2		247	155	NM_022453	0	0	6	12	6	A8K0D6|Q53HQ5|Q9H874	Silent	SNP	ENST00000295704.2	37	CCDS2420.1																																																																																			.		0.612	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	NM_022453	
ATG9A	79065	hgsc.bcm.edu	37	2	220085516	220085516	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr2:220085516C>T	ENST00000409618.1	-	15	2906	c.2467G>A	c.(2467-2469)Gtg>Atg	p.V823M	ABCB6_ENST00000439002.2_5'Flank|ABCB6_ENST00000265316.3_5'Flank|ATG9A_ENST00000361242.4_Missense_Mutation_p.V823M|ATG9A_ENST00000409422.1_Missense_Mutation_p.V762M|ATG9A_ENST00000396761.2_Missense_Mutation_p.V823M			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	823					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTTCGGGCACGGGCTCAGGG	0.607																																					p.V823M		.											.	ATG9A-91	0			c.G2467A						.						46.0	47.0	47.0					2																	220085516		1899	4124	6023	SO:0001583	missense	79065	exon15			CGGGCACGGGCTC	AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.2467G>A	2.37:g.220085516C>T	ENSP00000386710:p.Val823Met	42	0		73	4	NM_001077198	1	0	53	54	0	Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Missense_Mutation	SNP	ENST00000409618.1	37	CCDS42820.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.071397	0.55646	.	.	ENSG00000198925	ENST00000396761;ENST00000409618;ENST00000361242;ENST00000409422	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.06	5.06	0.68205	.	0.064569	0.64402	D	0.000010	T	0.65984	0.2744	L	0.34521	1.04	0.46874	D	0.999238	D	0.58268	0.982	P	0.44732	0.459	T	0.70722	-0.4794	10	0.56958	D	0.05	-11.0302	18.6114	0.91286	0.0:1.0:0.0:0.0	.	823	Q7Z3C6	ATG9A_HUMAN	M	823;823;823;762	ENSP00000379983:V823M;ENSP00000386710:V823M;ENSP00000355173:V823M;ENSP00000386535:V762M	ENSP00000355173:V823M	V	-	1	0	ATG9A	219793760	0.997000	0.39634	0.956000	0.39512	0.708000	0.40852	3.656000	0.54467	2.627000	0.88993	0.655000	0.94253	GTG	.		0.607	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335930.1	NM_024085	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		.											.	KIF1A-91	0			c.G2751T						.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	2.37:g.241696843C>A		97	0		189	11	NM_001244008	0	0	0	0	0	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
TMC2	117532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	2592879	2592879	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr20:2592879C>G	ENST00000358864.1	+	13	1651	c.1636C>G	c.(1636-1638)Ctg>Gtg	p.L546V	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	546					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TCACTGGACTCTGTTTAACTA	0.512																																					p.L546V		.											.	TMC2-93	0			c.C1636G						.						155.0	134.0	141.0					20																	2592879		2203	4300	6503	SO:0001583	missense	117532	exon13			TGGACTCTGTTTA	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1636C>G	20.37:g.2592879C>G	ENSP00000351732:p.Leu546Val	63	0		78	10	NM_080751	0	0	0	0	0	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	ENST00000358864.1	37	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	C	14.67	2.603805	0.46423	.	.	ENSG00000149488	ENST00000358864	T	0.66099	-0.19	5.85	5.85	0.93711	.	0.076272	0.53938	D	0.000052	T	0.69540	0.3122	M	0.73962	2.25	0.49051	D	0.999745	B;P;P;P	0.41524	0.382;0.563;0.753;0.638	B;B;P;B	0.46299	0.091;0.139;0.511;0.313	T	0.64609	-0.6367	10	0.22706	T	0.39	-10.7732	18.0364	0.89305	0.0:1.0:0.0:0.0	.	377;378;546;546	B4DFB3;B7ZAE6;Q8TDI7-3;Q8TDI7	.;.;.;TMC2_HUMAN	V	546	ENSP00000351732:L546V	ENSP00000351732:L546V	L	+	1	2	TMC2	2540879	0.933000	0.31639	1.000000	0.80357	0.997000	0.91878	1.970000	0.40520	2.941000	0.99782	0.655000	0.94253	CTG	.		0.512	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
PANK2	80025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	3869791	3869791	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr20:3869791C>T	ENST00000316562.4	+	1	50	c.44C>T	c.(43-45)gCg>gTg	p.A15V	PANK2_ENST00000497424.1_Intron|RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_5'Flank	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	15					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CATTGGGCGGCGCCGCCATCA	0.701																																					p.A15V		.											.	PANK2-115	0			c.C44T						.						19.0	14.0	16.0					20																	3869791		2183	4282	6465	SO:0001583	missense	80025	exon1			GGGCGGCGCCGCC	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.44C>T	20.37:g.3869791C>T	ENSP00000313377:p.Ala15Val	85	0		113	34	NM_153638	0	0	0	0	0	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	.	.	.	.	.	.	.	.	.	.	C	6.152	0.396211	0.11638	.	.	ENSG00000125779	ENST00000316562	D	0.97455	-4.39	4.57	-1.13	0.09775	.	0.546626	0.15407	N	0.263980	D	0.88691	0.6505	N	0.08118	0	0.21933	N	0.99946	B	0.06786	0.001	B	0.04013	0.001	T	0.80320	-0.1432	10	0.30854	T	0.27	-4.0E-4	4.3121	0.10976	0.0:0.4:0.1682:0.4318	.	15	Q9BZ23	PANK2_HUMAN	V	15	ENSP00000313377:A15V	ENSP00000313377:A15V	A	+	2	0	PANK2	3817791	0.959000	0.32827	0.677000	0.29947	0.004000	0.04260	-0.096000	0.11059	-0.135000	0.11495	-0.175000	0.13238	GCG	.		0.701	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V|FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.													.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	879	11		747	30	.	0	0	62	62	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29632680	29632680	+	Silent	SNP	G	G	A	rs4892355		TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr20:29632680G>A	ENST00000278882.3	+	8	875	c.495G>A	c.(493-495)aaG>aaA	p.K165K	FRG1B_ENST00000358464.4_Silent_p.K165K			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	165										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTCTTAAAAAGGCTCAGAAAG	0.313																																					.													.	FRG1B-22	0			.						.																																			SO:0001819	synonymous_variant	284802	.			TAAAAAGGCTCAG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.495G>A	20.37:g.29632680G>A		441	10		514	52	.	0	0	52	52	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				G|0.500;A|0.500		0.313	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
KRTAP19-5	337972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	31874285	31874285	+	Missense_Mutation	SNP	C	C	T	rs370535457		TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr21:31874285C>T	ENST00000334151.2	-	1	150	c.124G>A	c.(124-126)Gga>Aga	p.G42R		NM_181611.1	NP_853642.1	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	42						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(5)|lung(4)|pancreas(1)|prostate(1)	12						CCGTAGCCTCCGTAGCCACCG	0.572													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17165	0.0		0.0	False		,,,				2504	0.0				p.G42R		.											.	KRTAP19-5-68	0			c.G124A						.	C	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	128.0	122.0	124.0		124	-0.3	0.0	21		124	0,8600		0,0,4300	no	missense	KRTAP19-5	NM_181611.1	125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	42/73	31874285	1,13005	2203	4300	6503	SO:0001583	missense	337972	exon1			AGCCTCCGTAGCC	AP001708	CCDS13597.1	21q22.1	2006-03-13			ENSG00000186977	ENSG00000186977		"""Keratin associated proteins"""	18940	protein-coding gene	gene with protein product						12359730	Standard	NM_181611		Approved	KAP19.5	uc011ada.2	Q3LI72	OTTHUMG00000057774	ENST00000334151.2:c.124G>A	21.37:g.31874285C>T	ENSP00000334985:p.Gly42Arg	172	0		48	34	NM_181611	0	0	0	0	0	A4IF22	Missense_Mutation	SNP	ENST00000334151.2	37	CCDS13597.1	.	.	.	.	.	.	.	.	.	.	C	12.38	1.920297	0.33908	2.27E-4	0.0	ENSG00000186977	ENST00000334151	T	0.11495	2.77	5.06	-0.26	0.12967	.	0.758211	0.10161	U	0.708309	T	0.07279	0.0184	.	.	.	0.09310	N	0.999999	P	0.48089	0.905	B	0.37480	0.251	T	0.30001	-0.9993	9	0.87932	D	0	-0.8878	4.9837	0.14180	0.0:0.5363:0.1489:0.3148	.	42	Q3LI72	KR195_HUMAN	R	42	ENSP00000334985:G42R	ENSP00000334985:G42R	G	-	1	0	KRTAP19-5	30796156	0.001000	0.12720	0.021000	0.16686	0.458000	0.32498	0.145000	0.16157	0.018000	0.15052	0.591000	0.81541	GGA	.		0.572	KRTAP19-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128226.2		
MYH9	4627	broad.mit.edu	37	22	36702092	36702092	+	Silent	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr22:36702092G>T	ENST00000216181.5	-	17	2273	c.2043C>A	c.(2041-2043)ggC>ggA	p.G681G		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	681	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.G681G(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GGTCCAGCTTGCCGGCCTGGA	0.597			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.G681G				Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9-292	1	Substitution - coding silent(1)	kidney(1)	c.C2043A						.						61.0	58.0	59.0					22																	36702092		2203	4300	6503	SO:0001819	synonymous_variant	4627	exon17	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	CAGCTTGCCGGCC		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2043C>A	22.37:g.36702092G>T		72	1		76	7	NM_002473	0	0	0	0	0	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	37	CCDS13927.1																																																																																			.		0.597	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
TOP2B	7155	hgsc.bcm.edu	37	3	25705758	25705758	+	Missense_Mutation	SNP	C	C	T	rs145455403	byFrequency	TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr3:25705758C>T	ENST00000264331.4	-	1	30	c.31G>A	c.(31-33)Gcc>Acc	p.A11T	MIR4442_ENST00000583412.1_RNA|TOP2B_ENST00000435706.2_Missense_Mutation_p.A11T	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	11					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	CCCACGCCGGCTCCCGCGCCG	0.771													C|||	45	0.00898562	0.0008	0.0231	5008	,	,		6677	0.0		0.0199	False		,,,				2504	0.0082				p.A11T		.											.	TOP2B-273	0			c.G31A						.	C	THR/ALA	8,3016		0,8,1504	4.0	8.0	7.0		31	-1.1	0.3	3	dbSNP_134	7	129,6473		1,127,3173	no	missense	TOP2B	NM_001068.2	58	1,135,4677	TT,TC,CC		1.954,0.2646,1.4232	possibly-damaging	11/1622	25705758	137,9489	1512	3301	4813	SO:0001583	missense	7155	exon1			CGCCGGCTCCCGC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.31G>A	3.37:g.25705758C>T	ENSP00000264331:p.Ala11Thr	0	0		14	8	NM_001068	0	0	1	2	1	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	37		36	0.016483516483516484	6	0.012195121951219513	11	0.03038674033149171	6	0.01048951048951049	13	0.017150395778364115	c	16.12	3.034111	0.54896	0.002646	0.01954	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.44083	0.93;0.93	2.62	-1.06	0.10002	.	0.994270	0.08145	U	0.990988	T	0.09949	0.0244	N	0.08118	0	0.30757	N	0.744492	P	0.46395	0.877	P	0.51866	0.682	T	0.13899	-1.0492	10	0.29301	T	0.29	.	1.1455	0.01774	0.2237:0.407:0.22:0.1492	.	11	Q02880-2	.	T	11	ENSP00000396704:A11T;ENSP00000264331:A11T	ENSP00000264331:A11T	A	-	1	0	TOP2B	25680762	0.194000	0.23325	0.294000	0.24946	0.849000	0.48306	0.298000	0.19120	-0.467000	0.06932	0.457000	0.33378	GCC	C|0.983;T|0.016		0.771	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
SETD2	29072	hgsc.bcm.edu	37	3	47164505	47164505	+	Silent	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr3:47164505G>T	ENST00000409792.3	-	3	1663	c.1621C>A	c.(1621-1623)Cga>Aga	p.R541R		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	541					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GATGACCCTCGTCGGAATCCC	0.358			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.R541R		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.C1621A						.						100.0	100.0	100.0					3																	47164505		2200	4292	6492	SO:0001819	synonymous_variant	29072	exon3			ACCCTCGTCGGAA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.1621C>A	3.37:g.47164505G>T		42	0		77	4	NM_014159	0	0	0	0	0	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Silent	SNP	ENST00000409792.3	37	CCDS2749.2																																																																																			.		0.358	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
GMPPB	29925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49759370	49759370	+	Intron	SNP	C	C	T	rs71324991		TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr3:49759370C>T	ENST00000480687.1	-	9	1068				AMIGO3_ENST00000535833.1_Intron|GMPPB_ENST00000308375.6_Missense_Mutation_p.E327K|AMIGO3_ENST00000320431.7_5'Flank|GMPPB_ENST00000308388.6_Intron			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCGCCCCTCTCCCCACCCAGC	0.632																																					p.E327K		.											.	GMPPB-90	0			c.G979A						.						52.0	52.0	52.0					3																	49759370		2203	4300	6503	SO:0001627	intron_variant	29925	exon8			CCCTCTCCCCACC	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.951+27G>A	3.37:g.49759370C>T		81	0		113	67	NM_013334	0	0	0	0	0	A8K6N5|Q9H7U3	Missense_Mutation	SNP	ENST00000480687.1	37	CCDS2803.1	.	.	.	.	.	.	.	.	.	.	C	4.938	0.174300	0.09391	.	.	ENSG00000173540	ENST00000308375	T	0.72942	-0.7	4.7	1.73	0.24493	.	1.157320	0.06701	N	0.771475	T	0.53722	0.1814	.	.	.	0.32702	N	0.512756	B	0.02656	0.0	B	0.01281	0.0	T	0.51988	-0.8635	9	0.24483	T	0.36	-2.0563	5.6606	0.17667	0.0:0.442:0.3934:0.1645	.	327	Q9Y5P6-2	.	K	327	ENSP00000309092:E327K	ENSP00000309092:E327K	E	-	1	0	GMPPB	49734374	0.000000	0.05858	0.023000	0.16930	0.167000	0.22549	-0.551000	0.06027	0.524000	0.28502	0.655000	0.94253	GAG	C|0.500;T|0.500		0.632	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334	
UBA7	7318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49847782	49847782	+	Missense_Mutation	SNP	A	A	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr3:49847782A>T	ENST00000333486.3	-	13	1705	c.1547T>A	c.(1546-1548)cTg>cAg	p.L516Q	UBA7_ENST00000494212.1_5'Flank	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	516	2 approximate repeats.				cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGTGGGATCCAGTGGGTAGGT	0.587																																					p.L516Q		.											.	UBA7-228	0			c.T1547A						.						102.0	104.0	103.0					3																	49847782		2203	4300	6503	SO:0001583	missense	7318	exon13			GGATCCAGTGGGT	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.1547T>A	3.37:g.49847782A>T	ENSP00000333266:p.Leu516Gln	270	0		254	148	NM_003335	0	0	0	1	1	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	37	CCDS2805.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.249400	0.80024	.	.	ENSG00000182179	ENST00000333486	T	0.67345	-0.26	5.67	5.67	0.87782	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.331674	0.29631	N	0.011601	D	0.86180	0.5871	M	0.93854	3.465	0.52501	D	0.999951	D	0.76494	0.999	D	0.74674	0.984	D	0.89830	0.3995	10	0.87932	D	0	-8.7204	15.9043	0.79412	1.0:0.0:0.0:0.0	.	516	P41226	UBA7_HUMAN	Q	516	ENSP00000333266:L516Q	ENSP00000333266:L516Q	L	-	2	0	UBA7	49822786	1.000000	0.71417	0.352000	0.25734	0.711000	0.40976	8.947000	0.93000	2.169000	0.68431	0.459000	0.35465	CTG	.		0.587	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335	
ACTR8	93973	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	53913972	53913972	+	Silent	SNP	T	T	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr3:53913972T>C	ENST00000335754.3	-	2	388	c.288A>G	c.(286-288)ggA>ggG	p.G96G	ACTR8_ENST00000482349.1_5'UTR|AC012467.1_ENST00000410956.1_RNA|ACTR8_ENST00000231909.7_5'Flank	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	96					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		TTACATTTAGTCCCTCCCTTA	0.478																																					p.G96G													.	ACTR8-91	0			c.A288G						.						164.0	157.0	159.0					3																	53913972		2203	4300	6503	SO:0001819	synonymous_variant	93973	exon2			ATTTAGTCCCTCC		CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.288A>G	3.37:g.53913972T>C		147	2		121	72	NM_022899	0	0	0	0	0	B3KSW7|Q8N566|Q9H663	Silent	SNP	ENST00000335754.3	37	CCDS2875.1																																																																																			.		0.478	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2	NM_022899	
ERC2	26059	broad.mit.edu	37	3	56114913	56114913	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr3:56114913C>T	ENST00000288221.6	-	7	1828	c.1573G>A	c.(1573-1575)Ggt>Agt	p.G525S		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	525						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		CGAATTTCACCGGCCAGTGTC	0.408																																					p.G525S													.	ERC2-24	0			c.G1573A						.						146.0	130.0	135.0					3																	56114913		1865	4101	5966	SO:0001583	missense	26059	exon7			TTTCACCGGCCAG	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1573G>A	3.37:g.56114913C>T	ENSP00000288221:p.Gly525Ser	81	0		66	4	NM_015576	0	0	0	0	0	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	37	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.147764	0.78001	.	.	ENSG00000187672	ENST00000288221	T	0.77358	-1.09	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.85017	0.5601	L	0.43646	1.37	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82969	-0.0193	10	0.39692	T	0.17	-17.3627	20.0714	0.97726	0.0:1.0:0.0:0.0	.	525	O15083	ERC2_HUMAN	S	525	ENSP00000288221:G525S	ENSP00000288221:G525S	G	-	1	0	ERC2	56089953	1.000000	0.71417	0.991000	0.47740	0.877000	0.50540	7.818000	0.86416	2.750000	0.94351	0.585000	0.79938	GGT	.		0.408	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
IGF2BP2	10644	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	185542743	185542743	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr3:185542743C>G	ENST00000382199.2	-	1	101	c.6G>C	c.(4-6)atG>atC	p.M2I	IGF2BP2_ENST00000457616.2_Missense_Mutation_p.M2I|IGF2BP2_ENST00000346192.3_Missense_Mutation_p.M2I	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	2					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			AAAGCTTGTTCATCATCCGTC	0.706																																					p.M2I		.											.	IGF2BP2-226	0			c.G6C						.						22.0	24.0	24.0					3																	185542743		2202	4300	6502	SO:0001583	missense	10644	exon1			CTTGTTCATCATC	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.6G>C	3.37:g.185542743C>G	ENSP00000371634:p.Met2Ile	88	0		169	34	NM_001007225	0	0	2	2	0	A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Missense_Mutation	SNP	ENST00000382199.2	37	CCDS3273.2	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612112	0.87258	.	.	ENSG00000073792	ENST00000382199;ENST00000457616;ENST00000346192	T;T;T	0.20332	2.11;2.31;2.08	2.43	2.43	0.29744	.	0.000000	0.64402	U	0.000001	T	0.47358	0.1441	M	0.85197	2.74	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.77557	0.978;0.99;0.965	T	0.56914	-0.7900	10	0.87932	D	0	-7.2297	11.9545	0.52974	0.0:1.0:0.0:0.0	.	2;2;2	F8W930;Q9Y6M1-1;Q9Y6M1	.;.;IF2B2_HUMAN	I	2	ENSP00000371634:M2I;ENSP00000410242:M2I;ENSP00000320204:M2I	ENSP00000320204:M2I	M	-	3	0	IGF2BP2	187025437	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.717000	0.74707	1.354000	0.45846	0.393000	0.25936	ATG	.		0.706	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157087.2	NM_006548	
NKX3-2	579	hgsc.bcm.edu	37	4	13545664	13545664	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr4:13545664G>A	ENST00000382438.5	-	1	1010	c.375C>T	c.(373-375)ctC>ctT	p.L125L	AC006445.8_ENST00000501050.1_lincRNA	NM_001189.3	NP_001180.1	P78367	NKX32_HUMAN	NK3 homeobox 2	125					determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|intestinal epithelial cell development (GO:0060576)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|organ formation (GO:0048645)|pancreas development (GO:0031016)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|spleen development (GO:0048536)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(1)|lung(4)|prostate(1)	7						CCGGCTGGCCGAGGCTCAAGG	0.721																																					p.L125L		.											.	NKX3-2-68	0			c.C375T						.						3.0	4.0	4.0					4																	13545664		1713	3631	5344	SO:0001819	synonymous_variant	579	exon1			CTGGCCGAGGCTC	AF009801	CCDS3410.1	4p16.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000109705	ENSG00000109705		"""Homeoboxes / ANTP class : NKL subclass"""	951	protein-coding gene	gene with protein product		602183	"""bagpipe homeobox homolog 1 (Drosophila)"""	BAPX1		9344671	Standard	NM_001189		Approved	NKX3B, NKX3.2	uc003gmx.2	P78367	OTTHUMG00000090657	ENST00000382438.5:c.375C>T	4.37:g.13545664G>A		3	0		29	18	NM_001189	0	0	0	0	0	Q2M2I7	Silent	SNP	ENST00000382438.5	37	CCDS3410.1																																																																																			.		0.721	NKX3-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207317.3		
NIPAL1	152519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	48037862	48037862	+	Silent	SNP	T	T	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr4:48037862T>C	ENST00000295461.5	+	6	972	c.906T>C	c.(904-906)aaT>aaC	p.N302N		NM_207330.1	NP_997213.1	Q6NVV3	NIPA3_HUMAN	NIPA-like domain containing 1	302						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|large_intestine(1)|lung(3)|skin(2)	8						ACACCTTTAATACCTCTCTTG	0.423																																					p.N302N		.											.	NIPAL1-68	0			c.T906C						.						138.0	122.0	127.0					4																	48037862		2203	4300	6503	SO:0001819	synonymous_variant	152519	exon6			CTTTAATACCTCT	BC067881	CCDS3479.1	4p12	2009-03-24		2009-03-24	ENSG00000163293	ENSG00000163293			27194	protein-coding gene	gene with protein product				NPAL1			Standard	NM_207330		Approved	DKFZp686A06115	uc003gxw.3	Q6NVV3	OTTHUMG00000128622	ENST00000295461.5:c.906T>C	4.37:g.48037862T>C		201	0		145	58	NM_207330	0	0	0	0	0	B3KTB0|Q68DA9	Silent	SNP	ENST00000295461.5	37	CCDS3479.1																																																																																			.		0.423	NIPAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250491.4	NM_207330	
DSPP	1834	bcgsc.ca	37	4	88537018	88537018	+	Silent	SNP	T	T	C	rs370264407		TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr4:88537018T>C	ENST00000282478.7	+	4	3237	c.3204T>C	c.(3202-3204)gaT>gaC	p.D1068D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1068D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1068	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgatagcagtgaca	0.532																																					p.D1068D													.	DSPP-90	0			c.T3204C						.	T		27,3131		0,27,1552	54.0	66.0	62.0		3204	0.6	0.3	4	dbSNP_134	62	95,5593		2,91,2751	no	coding-synonymous	DSPP	NM_014208.3		2,118,4303	CC,CT,TT		1.6702,0.855,1.3792		1068/1302	88537018	122,8724	1579	2844	4423	SO:0001819	synonymous_variant	1834	exon5			CAGTGATAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3204T>C	4.37:g.88537018T>C		515	13		328	16	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.532	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
IRX2	153572	broad.mit.edu;bcgsc.ca	37	5	2748624	2748624	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr5:2748624C>T	ENST00000382611.6	-	3	1446	c.1198G>A	c.(1198-1200)Gcg>Acg	p.A400T	IRX2_ENST00000302057.5_Missense_Mutation_p.A400T|IRX2_ENST00000502957.1_5'Flank	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	400					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		TGCAGCGCCGCGTTCAAGTTC	0.706																																					p.A400T													.	IRX2-226	0			c.G1198A						.						37.0	38.0	38.0					5																	2748624		2189	4286	6475	SO:0001583	missense	153572	exon3			GCGCCGCGTTCAA	AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.1198G>A	5.37:g.2748624C>T	ENSP00000372056:p.Ala400Thr	56	0		68	9	NM_001134222	0	0	0	0	0	Q68A19|Q7Z2I7	Missense_Mutation	SNP	ENST00000382611.6	37	CCDS3868.1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780307	0.49891	.	.	ENSG00000170561	ENST00000382611;ENST00000302057	T;T	0.65178	-0.14;-0.14	4.43	4.43	0.53597	.	0.067153	0.64402	D	0.000011	T	0.53077	0.1774	L	0.39898	1.24	0.37331	D	0.909994	D	0.57899	0.981	B	0.40134	0.32	T	0.61950	-0.6957	10	0.33940	T	0.23	-19.73	17.4343	0.87547	0.0:1.0:0.0:0.0	.	400	Q9BZI1	IRX2_HUMAN	T	400	ENSP00000372056:A400T;ENSP00000307006:A400T	ENSP00000307006:A400T	A	-	1	0	IRX2	2801624	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.982000	0.70532	2.184000	0.69523	0.561000	0.74099	GCG	.		0.706	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206749.2		
PRDM9	56979	bcgsc.ca	37	5	23527640	23527640	+	Missense_Mutation	SNP	A	A	T	rs202203985	byFrequency	TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr5:23527640A>T	ENST00000296682.3	+	11	2625	c.2443A>T	c.(2443-2445)Aat>Tat	p.N815Y		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	815					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGGCTTTAGCAATAAGTCACA	0.567										HNSCC(3;0.000094)			a|||	116	0.0231629	0.0643	0.0043	5008	,	,		22804	0.0099		0.005	False		,,,				2504	0.0133				p.N815Y													.	PRDM9-139	0			c.A2443T						.																																			SO:0001583	missense	56979	exon11			TTTAGCAATAAGT	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2443A>T	5.37:g.23527640A>T	ENSP00000296682:p.Asn815Tyr	233	1		182	62	NM_020227	0	0	0	0	0	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	a	0.525	-0.860379	0.02610	.	.	ENSG00000164256	ENST00000296682	T	0.19532	2.14	3.02	-6.05	0.02172	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13713	0.0332	N	0.25245	0.725	0.09310	N	1	B	0.26400	0.148	B	0.35770	0.21	T	0.32613	-0.9900	9	0.37606	T	0.19	16.5357	7.1248	0.25465	0.093:0.115:0.5628:0.2292	.	815	Q9NQV7	PRDM9_HUMAN	Y	815	ENSP00000296682:N815Y	ENSP00000296682:N815Y	N	+	1	0	PRDM9	23563397	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-11.912000	0.00002	-4.540000	0.00043	-3.331000	0.00043	AAT	.		0.567	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
FYB	2533	bcgsc.ca	37	5	39202408	39202408	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr5:39202408C>G	ENST00000351578.6	-	2	845	c.655G>C	c.(655-657)Gtg>Ctg	p.V219L	FYB_ENST00000512982.1_Missense_Mutation_p.V219L|FYB_ENST00000505428.1_Missense_Mutation_p.V219L|FYB_ENST00000540520.1_Missense_Mutation_p.V229L|FYB_ENST00000515010.1_Missense_Mutation_p.V219L	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	219					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			GATGAAGACACATTCTTCATG	0.532																																					p.V229L													.	FYB-24	0			c.G685C						.						66.0	66.0	66.0					5																	39202408		1841	4077	5918	SO:0001583	missense	2533	exon2			AAGACACATTCTT	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.655G>C	5.37:g.39202408C>G	ENSP00000316460:p.Val219Leu	83	0		66	4	NM_001243093	0	0	0	0	0	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	ENST00000351578.6	37	CCDS47200.1	.	.	.	.	.	.	.	.	.	.	C	6.014	0.370969	0.11409	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.24908	1.83;1.83;1.84;1.84;1.87	6.07	-3.59	0.04583	.	2.202910	0.01678	N	0.025958	T	0.16769	0.0403	L	0.34521	1.04	0.09310	N	1	B;B	0.24483	0.104;0.001	B;B	0.18871	0.023;0.001	T	0.10405	-1.0631	10	0.28530	T	0.3	3.1834	3.5355	0.07793	0.089:0.4575:0.1745:0.2791	.	229;219	B4DLN2;O15117	.;FYB_HUMAN	L	219;219;219;219;229;219	ENSP00000316460:V219L;ENSP00000426346:V219L;ENSP00000425845:V219L;ENSP00000427114:V219L;ENSP00000442840:V229L	ENSP00000316460:V219L	V	-	1	0	FYB	39238165	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.158000	0.16422	-0.608000	0.05731	-1.261000	0.01458	GTG	.		0.532	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465	
MAP3K1	4214	hgsc.bcm.edu	37	5	56170960	56170960	+	Silent	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr5:56170960G>T	ENST00000399503.3	+	10	1788	c.1788G>T	c.(1786-1788)ctG>ctT	p.L596L		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	596					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GGGCCCTGCTGTTGGCAAATG	0.552																																					p.L596L		.											.	MAP3K1-956	0			c.G1788T						.						88.0	87.0	87.0					5																	56170960		1908	4114	6022	SO:0001819	synonymous_variant	4214	exon10			CCTGCTGTTGGCA	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1788G>T	5.37:g.56170960G>T		96	0		72	4	NM_005921	0	0	2	2	0		Silent	SNP	ENST00000399503.3	37	CCDS43318.1																																																																																			.		0.552	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
TRIM23	373	broad.mit.edu;bcgsc.ca	37	5	64892965	64892965	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr5:64892965C>T	ENST00000231524.9	-	8	1593	c.1222G>A	c.(1222-1224)Gtt>Att	p.V408I	TRIM23_ENST00000274327.7_Missense_Mutation_p.V408I|TRIM23_ENST00000381018.3_Missense_Mutation_p.V408I	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	408	ARF-like.				GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V408I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		CCTAACGTAACGACCCGAATT	0.323																																					p.V408I													.	TRIM23-230	1	Substitution - Missense(1)	kidney(1)	c.G1222A						.						119.0	113.0	115.0					5																	64892965		2203	4300	6503	SO:0001583	missense	373	exon8			ACGTAACGACCCG	L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.1222G>A	5.37:g.64892965C>T	ENSP00000231524:p.Val408Ile	110	0		84	5	NM_033228	0	0	3	3	0	Q9BZY4|Q9BZY5	Missense_Mutation	SNP	ENST00000231524.9	37	CCDS3987.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.483114	0.84747	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	T;T;T	0.63744	-0.06;-0.06;-0.06	5.97	5.97	0.96955	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.66257	0.2771	L	0.28608	0.87	0.80722	D	1	D;D;D	0.61697	0.975;0.99;0.989	P;P;P	0.54100	0.742;0.525;0.674	T	0.67469	-0.5663	10	0.62326	D	0.03	.	20.4324	0.99085	0.0:1.0:0.0:0.0	.	408;408;408	P36406;P36406-2;P36406-3	TRI23_HUMAN;.;.	I	408	ENSP00000231524:V408I;ENSP00000370406:V408I;ENSP00000274327:V408I	ENSP00000231524:V408I	V	-	1	0	TRIM23	64928721	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	5.920000	0.70017	2.833000	0.97629	0.585000	0.79938	GTT	.		0.323	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215058.2	NM_001656	
MSH3	4437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	79970928	79970928	+	Missense_Mutation	SNP	A	A	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr5:79970928A>T	ENST00000265081.6	+	7	1234	c.1154A>T	c.(1153-1155)aAc>aTc	p.N385I		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	385					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		AAAAAGGGCAACATTTTTATT	0.333								Mismatch excision repair (MMR)																													p.N385I	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.A1154T						.						148.0	152.0	151.0					5																	79970928		2203	4300	6503	SO:0001583	missense	4437	exon7			AGGGCAACATTTT	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.1154A>T	5.37:g.79970928A>T	ENSP00000265081:p.Asn385Ile	148	0		98	41	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	.	.	.	.	.	.	.	.	.	.	A	8.987	0.976749	0.18812	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.88664	-2.41	5.6	-5.6	0.02497	DNA mismatch repair protein MutS, connector (2);	0.642828	0.16451	N	0.213870	T	0.79405	0.4440	L	0.53249	1.67	0.09310	N	1	B	0.33318	0.408	B	0.34138	0.176	T	0.67783	-0.5581	9	.	.	.	-1.1852	2.0942	0.03664	0.3478:0.3369:0.2064:0.1089	.	385	P20585	MSH3_HUMAN	I	385;376	ENSP00000265081:N385I	.	N	+	2	0	MSH3	80006684	0.010000	0.17322	0.000000	0.03702	0.294000	0.27393	0.093000	0.15086	-0.822000	0.04306	-0.367000	0.07326	AAC	.		0.333	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
KDM3B	51780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	137717257	137717257	+	Missense_Mutation	SNP	A	A	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr5:137717257A>C	ENST00000314358.5	+	6	958	c.758A>C	c.(757-759)gAt>gCt	p.D253A		NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	253					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						ATGCTGATGGATAATTCAGCG	0.433																																					p.D253A		.											.	KDM3B-542	0			c.A758C						.						134.0	117.0	123.0					5																	137717257		2203	4300	6503	SO:0001583	missense	51780	exon6			TGATGGATAATTC	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.758A>C	5.37:g.137717257A>C	ENSP00000326563:p.Asp253Ala	87	0		72	25	NM_016604	0	0	0	0	0	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.253034	0.80135	.	.	ENSG00000120733	ENST00000314358;ENST00000545151	T	0.68025	-0.3	4.79	4.79	0.61399	.	0.104922	0.64402	D	0.000006	T	0.70876	0.3274	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.75357	-0.3346	10	0.72032	D	0.01	-8.6271	14.278	0.66194	1.0:0.0:0.0:0.0	.	253	Q7LBC6	KDM3B_HUMAN	A	253;43	ENSP00000326563:D253A	ENSP00000326563:D253A	D	+	2	0	KDM3B	137745156	1.000000	0.71417	0.996000	0.52242	0.876000	0.50452	6.004000	0.70709	1.905000	0.55150	0.460000	0.39030	GAT	.		0.433	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
ZNF354B	117608	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	178310106	178310106	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr5:178310106C>T	ENST00000322434.3	+	5	879	c.653C>T	c.(652-654)aCa>aTa	p.T218I	RNU1-39P_ENST00000383897.1_RNA	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAATGCAGTACATGTGAAAAA	0.299																																					p.T218I													.	ZNF354B-92	0			c.C653T						.						72.0	80.0	77.0					5																	178310106		2201	4295	6496	SO:0001583	missense	117608	exon5			GCAGTACATGTGA	AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.653C>T	5.37:g.178310106C>T	ENSP00000327143:p.Thr218Ile	99	1		80	33	NM_058230	0	0	2	3	1	A8K0V2|Q5U5Z4	Missense_Mutation	SNP	ENST00000322434.3	37	CCDS4439.1	.	.	.	.	.	.	.	.	.	.	C	4.307	0.056302	0.08291	.	.	ENSG00000178338	ENST00000322434	T	0.26810	1.71	3.53	-2.54	0.06307	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09905	0.0243	N	0.04959	-0.14	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25950	-1.0117	9	0.52906	T	0.07	-33.0293	3.159	0.06514	0.3538:0.1876:0.0:0.4585	.	218	Q96LW1	Z354B_HUMAN	I	218	ENSP00000327143:T218I	ENSP00000327143:T218I	T	+	2	0	ZNF354B	178242712	0.000000	0.05858	0.447000	0.26932	0.752000	0.42762	-0.127000	0.10547	-0.216000	0.10048	-0.291000	0.09656	ACA	.		0.299	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253482.1	NM_058230	
ZNF184	7738	ucsc.edu;bcgsc.ca	37	6	27420593	27420593	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr6:27420593G>T	ENST00000211936.6	-	6	1029	c.745C>A	c.(745-747)Ccc>Acc	p.P249T	ZNF184_ENST00000377419.1_Missense_Mutation_p.P249T	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	249					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						CATTTGTAGGGTTTTTCTCCA	0.348																																					p.P249T													.	ZNF184-91	0			c.C745A						.						121.0	127.0	125.0					6																	27420593		2203	4300	6503	SO:0001583	missense	7738	exon6			TGTAGGGTTTTTC	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.745C>A	6.37:g.27420593G>T	ENSP00000211936:p.Pro249Thr	32	0		33	4	NM_007149	0	0	2	2	0	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	37	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.660854	0.47572	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087	T;T	0.28895	1.59;1.59	5.12	5.12	0.69794	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47093	D	0.000247	T	0.50257	0.1605	M	0.86573	2.825	0.40341	D	0.979033	D	0.64830	0.994	D	0.65323	0.934	T	0.51060	-0.8753	10	0.33940	T	0.23	.	16.0902	0.81086	0.0:0.0:1.0:0.0	.	249	Q99676	ZN184_HUMAN	T	249	ENSP00000211936:P249T;ENSP00000366636:P249T	ENSP00000211936:P249T	P	-	1	0	ZNF184	27528572	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	6.225000	0.72271	2.660000	0.90430	0.555000	0.69702	CCC	.		0.348	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149	
C4A	720	broad.mit.edu;bcgsc.ca	37	6	31962347	31962347	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr6:31962347G>A	ENST00000428956.2	+	21	2749	c.2665G>A	c.(2665-2667)Gtg>Atg	p.V889M	C4A_ENST00000498271.1_Missense_Mutation_p.V889M	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	889					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	GCAGGTGCTGGTGCCTGCGGG	0.687																																					p.V889M													.	C4A-44	0			c.G2665A						.						9.0	12.0	11.0					6																	31962347		1943	3861	5804	SO:0001583	missense	720	exon21			GTGCTGGTGCCTG	L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.2665G>A	6.37:g.31962347G>A	ENSP00000396688:p.Val889Met	20	0		181	45	NM_007293	0	0	80	110	30	A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Missense_Mutation	SNP	ENST00000428956.2	37	CCDS47404.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.561139	0.45590	.	.	ENSG00000244731	ENST00000428956;ENST00000498271	T;T	0.46063	0.88;0.88	3.22	2.22	0.28083	.	0.583336	0.16838	N	0.197448	T	0.47154	0.1430	M	0.74258	2.255	0.58432	D	0.999994	D;D	0.71674	0.998;0.998	D;D	0.65684	0.916;0.937	T	0.49021	-0.8982	10	0.51188	T	0.08	.	7.0474	0.25052	0.0:0.0:0.7297:0.2703	.	889;889	A6H8M8;P0C0L4	.;CO4A_HUMAN	M	889	ENSP00000396688:V889M;ENSP00000420212:V889M	ENSP00000396688:V889M	V	+	1	0	C4A	32070326	0.999000	0.42202	0.872000	0.34217	0.722000	0.41435	2.548000	0.45794	1.846000	0.53633	0.121000	0.15741	GTG	.		0.687	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076364.3	NM_007293	
SYNGAP1	8831	broad.mit.edu;bcgsc.ca	37	6	33393615	33393615	+	Missense_Mutation	SNP	G	G	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr6:33393615G>C	ENST00000418600.2	+	3	331	c.230G>C	c.(229-231)aGt>aCt	p.S77T	SYNGAP1_ENST00000293748.5_Missense_Mutation_p.S77T|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	77					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						AGCGAGTCCAGTCGCAACAAA	0.682																																					p.S77T													.	SYNGAP1-48	0			c.G230C						.						54.0	46.0	48.0					6																	33393615		2203	4300	6503	SO:0001583	missense	8831	exon3			AGTCCAGTCGCAA	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.230G>C	6.37:g.33393615G>C	ENSP00000403636:p.Ser77Thr	143	1		160	48	NM_006772	0	0	0	0	0	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	g	2.923	-0.222722	0.06061	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372	T;T	0.16324	2.35;2.44	2.75	2.75	0.32379	Pleckstrin homology domain (1);	0.269330	0.27787	U	0.017849	T	0.01695	0.0054	N	0.12182	0.205	0.25547	N	0.987124	B;B;B	0.26445	0.092;0.149;0.0	B;B;B	0.17098	0.007;0.017;0.0	T	0.45527	-0.9255	10	0.02654	T	1	.	5.7389	0.18081	0.1499:0.0:0.8501:0.0	.	77;77;77	Q96PV0;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.	T	77	ENSP00000293748:S77T;ENSP00000403636:S77T	ENSP00000293748:S77T	S	+	2	0	SYNGAP1	33501593	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.565000	0.45939	1.874000	0.54306	0.281000	0.19383	AGT	.		0.682	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
CASP8AP2	9994	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	90573643	90573643	+	RNA	SNP	T	T	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr6:90573643T>C	ENST00000551025.1	+	0	3652									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TAATTCAGATTATTGTGGTAT	0.403																																					p.Y739H	Colon(187;1656 2025 17045 31481 39901)	.											.	CASP8AP2-24	0			c.T2215C						.						69.0	67.0	67.0					6																	90573643		1866	4106	5972			9994	exon7			TCAGATTATTGTG	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90573643T>C		113	0		68	5	NM_001137667	0	0	0	0	0		Missense_Mutation	SNP	ENST00000551025.1	37																																																																																				.		0.403	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
LAMA2	3908	bcgsc.ca	37	6	129573388	129573388	+	Missense_Mutation	SNP	A	A	G	rs202247790		TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr6:129573388A>G	ENST00000421865.2	+	14	2093	c.2044A>G	c.(2044-2046)Aag>Gag	p.K682E		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	682	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGCGAATTTGAAGAGAGTCCT	0.393																																					p.K682E													.	LAMA2-162	0			c.A2044G						.						96.0	91.0	93.0					6																	129573388		2203	4300	6503	SO:0001583	missense	3908	exon14			AATTTGAAGAGAG	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2044A>G	6.37:g.129573388A>G	ENSP00000400365:p.Lys682Glu	80	0		56	4	NM_000426	0	0	0	0	0	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	A	5.993	0.367107	0.11352	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.32988	1.43	5.53	-3.2	0.05156	Laminin B type IV (2);Laminin B, subgroup (1);	0.195277	0.44483	N	0.000442	T	0.03053	0.0090	N	0.16266	0.395	0.09310	N	0.999995	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.40098	-0.9581	10	0.02654	T	1	.	7.0643	0.25143	0.5637:0.1131:0.3232:0.0	.	682;682	A6NF00;P24043	.;LAMA2_HUMAN	E	682	ENSP00000400365:K682E	ENSP00000346769:K682E	K	+	1	0	LAMA2	129615081	0.996000	0.38824	0.003000	0.11579	0.784000	0.44337	1.676000	0.37565	-0.713000	0.04981	-0.334000	0.08254	AAG	.		0.393	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
REPS1	85021	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	139262487	139262487	+	Missense_Mutation	SNP	A	A	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr6:139262487A>T	ENST00000450536.2	-	8	1694	c.1120T>A	c.(1120-1122)Ttg>Atg	p.L374M	REPS1_ENST00000367663.4_Missense_Mutation_p.L374M|REPS1_ENST00000258062.5_Missense_Mutation_p.L374M|REPS1_ENST00000409812.2_Missense_Mutation_p.L374M|REPS1_ENST00000415951.2_Missense_Mutation_p.L374M			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	374	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		GAATCTTCCAAATCAATCAGT	0.388																																					p.L374M		.											.	REPS1-522	0			c.T1120A						.						167.0	170.0	169.0					6																	139262487		2203	4300	6503	SO:0001583	missense	85021	exon8			CTTCCAAATCAAT		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1120T>A	6.37:g.139262487A>T	ENSP00000392065:p.Leu374Met	76	0		64	12	NM_001128617	0	0	4	5	1	B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Missense_Mutation	SNP	ENST00000450536.2	37		.	.	.	.	.	.	.	.	.	.	A	18.47	3.630297	0.67015	.	.	ENSG00000135597	ENST00000450536;ENST00000367663;ENST00000529597;ENST00000409812;ENST00000258062;ENST00000415951;ENST00000367668	T;T;T;T;T;T	0.35789	1.31;1.35;1.33;1.34;1.29;1.36	5.91	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.23014	0.0556	N	0.08118	0	0.80722	D	1	D;D;D;P;P	0.89917	1.0;1.0;1.0;0.82;0.872	D;D;D;P;B	0.80764	0.992;0.981;0.994;0.451;0.393	T	0.23904	-1.0175	10	0.45353	T	0.12	-6.2792	8.9289	0.35657	0.8584:0.0:0.1416:0.0	.	374;322;374;374;374	Q96D71-3;B2R7D3;Q96D71-2;Q96D71;E9PMG1	.;.;.;REPS1_HUMAN;.	M	374;374;360;374;374;374;322	ENSP00000392065:L374M;ENSP00000356635:L374M;ENSP00000434251:L360M;ENSP00000386699:L374M;ENSP00000258062:L374M;ENSP00000397941:L374M	ENSP00000258062:L374M	L	-	1	2	REPS1	139304180	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.783000	0.47766	1.074000	0.40909	0.533000	0.62120	TTG	.		0.388	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3		
PDE1C	5137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	31862809	31862809	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr7:31862809C>A	ENST00000396191.1	-	14	1915	c.1460G>T	c.(1459-1461)gGt>gTt	p.G487V	PDE1C_ENST00000321453.7_Missense_Mutation_p.G487V|PDE1C_ENST00000396182.2_Missense_Mutation_p.G487V|PDE1C_ENST00000396193.1_Missense_Mutation_p.G547V|PDE1C_ENST00000396184.3_Missense_Mutation_p.G487V|PDE1C_ENST00000479980.1_5'Flank	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	487	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	TCCCTCTGAACCAGAGGTCTT	0.443																																					p.G547V		.											.	PDE1C-94	0			c.G1640T						.						107.0	96.0	100.0					7																	31862809		2203	4300	6503	SO:0001583	missense	5137	exon15			TCTGAACCAGAGG	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1460G>T	7.37:g.31862809C>A	ENSP00000379494:p.Gly487Val	100	0		117	38	NM_001191058	0	0	0	0	0	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415990	0.62511	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.63;-0.63	5.91	5.91	0.95273	.	0.634852	0.16753	N	0.200964	T	0.76730	0.4028	L	0.29908	0.895	0.80722	D	1	B;B;D	0.65815	0.081;0.23;0.995	B;B;P	0.60949	0.056;0.082;0.881	T	0.76537	-0.2923	10	0.54805	T	0.06	.	19.9003	0.96983	0.0:1.0:0.0:0.0	.	487;547;487	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	V	547;487;487;487;487	ENSP00000379496:G547V;ENSP00000379494:G487V;ENSP00000318105:G487V;ENSP00000379487:G487V;ENSP00000379485:G487V	ENSP00000318105:G487V	G	-	2	0	PDE1C	31829334	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.060000	0.76692	2.808000	0.96608	0.655000	0.94253	GGT	.		0.443	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	2824167	2824167	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr8:2824167A>G	ENST00000520002.1	-	59	9583	c.9028T>C	c.(9028-9030)Tac>Cac	p.Y3010H	CSMD1_ENST00000537824.1_Missense_Mutation_p.Y3009H|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Missense_Mutation_p.Y3010H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3010	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAGGTCTTGTAGCCTTCCCAG	0.547																																					p.Y3009H		.											.	CSMD1-86	0			c.T9025C						.						72.0	76.0	75.0					8																	2824167		2071	4221	6292	SO:0001583	missense	64478	exon58			TCTTGTAGCCTTC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9028T>C	8.37:g.2824167A>G	ENSP00000430733:p.Tyr3010His	211	0		122	50	NM_033225	0	0	0	0	0	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.86|18.86	3.714217|3.714217	0.68730|0.68730	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000520002;ENST00000318252;ENST00000537824	.|T;T	.|0.40756	.|1.02;1.02	5.46|5.46	5.46|5.46	0.80206|0.80206	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.079141	.|0.53938	.|D	.|0.000060	T|T	0.69495|0.69495	0.3117|0.3117	M|M	0.87827|0.87827	2.91|2.91	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.83275	.|0.996;0.992	T|T	0.76113|0.76113	-0.3078|-0.3078	5|10	.|0.87932	.|D	.|0	.|.	15.5456|15.5456	0.76097|0.76097	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|3010;3010	.|E5RIG2;Q96PZ7	.|.;CSMD1_HUMAN	P|H	2426|3010;2871;3009	.|ENSP00000430733:Y3010H;ENSP00000441462:Y3009H	.|ENSP00000320445:Y2871H	L|Y	-|-	2|1	0|0	CSMD1|CSMD1	2811574|2811574	1.000000|1.000000	0.71417|0.71417	0.807000|0.807000	0.32361|0.32361	0.329000|0.329000	0.28539|0.28539	9.116000|9.116000	0.94341|0.94341	2.068000|2.068000	0.61886|0.61886	0.533000|0.533000	0.62120|0.62120	CTA|TAC	.		0.547	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
NEFL	4747	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	24813800	24813800	+	RNA	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr8:24813800G>A	ENST00000221169.5	-	0	824				CTD-2168K21.2_ENST00000607735.1_RNA			P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GCTGATGGCGGCTACCTGGCT	0.637																																					p.A77V		.											.	NEFL-24	0			c.C230T						.						30.0	33.0	32.0					8																	24813800		2172	4272	6444			4747	exon1			ATGGCGGCTACCT		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24813800G>A		174	0		173	13	NM_006158	0	0	62	66	4	B9ZVN2|Q16154|Q8IU72	Missense_Mutation	SNP	ENST00000221169.5	37																																																																																				.		0.637	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158	
MATN2	4147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	99039960	99039960	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr8:99039960G>T	ENST00000520016.1	+	13	2383	c.2259G>T	c.(2257-2259)agG>agT	p.R753S	RPL30_ENST00000518164.1_Intron|MATN2_ENST00000524308.1_Missense_Mutation_p.R712S|MATN2_ENST00000522025.2_Missense_Mutation_p.R469S|MATN2_ENST00000521689.1_Missense_Mutation_p.R753S|MATN2_ENST00000254898.5_Missense_Mutation_p.R753S			O00339	MATN2_HUMAN	matrilin 2	753	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			AAGGGGCCAGGCCCCTTTCCA	0.562																																					p.R753S		.											.	MATN2-24	0			c.G2259T						.						41.0	42.0	42.0					8																	99039960		1887	4109	5996	SO:0001583	missense	4147	exon14			GGCCAGGCCCCTT	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.2259G>T	8.37:g.99039960G>T	ENSP00000430487:p.Arg753Ser	124	0		137	52	NM_002380	0	0	6	13	7	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	ENST00000520016.1	37	CCDS55264.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	18.65|18.65|18.65	3.670245|3.670245|3.670245	0.67814|0.67814|0.67814	.|.|.	.|.|.	ENSG00000132561|ENSG00000132561|ENSG00000132561	ENST00000518154|ENST00000519582|ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000522025;ENST00000520016	.|.|D;D;D;D;D	.|.|0.87571	.|.|-2.27;-2.27;-2.27;-2.27;-2.27	5.24|5.24|5.24	4.34|4.34|4.34	0.51931|0.51931|0.51931	.|.|von Willebrand factor, type A (3);	.|.|0.000000	.|.|0.64402	.|.|D	.|.|0.000002	D|D|D	0.94548|0.94548|0.94548	0.8244|0.8244|0.8244	H|H|H	0.95187|0.95187|0.95187	3.635|3.635|3.635	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D	.|.|0.89917	.|.|1.0;1.0;1.0	.|.|D;D;D	.|.|0.91635	.|.|0.999;0.999;0.999	D|D|D	0.94271|0.94271|0.94271	0.7511|0.7511|0.7511	5|5|10	.|.|0.87932	.|.|D	.|.|0	-23.5915|-23.5915|-23.5915	8.2515|8.2515|8.2515	0.31724|0.31724|0.31724	0.2672:0.0:0.7328:0.0|0.2672:0.0:0.7328:0.0|0.2672:0.0:0.7328:0.0	.|.|.	.|.|753;753;753	.|.|E9PF03;O00339-2;O00339	.|.|.;.;MATN2_HUMAN	S|V|S	536|9|753;753;712;712;469;753	.|.|ENSP00000429977:R753S;ENSP00000254898:R753S;ENSP00000430221:R712S;ENSP00000429010:R469S;ENSP00000430487:R753S	.|.|ENSP00000254898:R753S	A|G|R	+|+|+	1|2|3	0|0|2	MATN2|MATN2|MATN2	99109136|99109136|99109136	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.934000|0.934000|0.934000	0.57294|0.57294|0.57294	3.500000|3.500000|3.500000	0.53318|0.53318|0.53318	1.272000|1.272000|1.272000	0.44329|0.44329|0.44329	0.555000|0.555000|0.555000	0.69702|0.69702|0.69702	GCC|GGC|AGG	.		0.562	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
GPR20	2843	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	142367789	142367789	+	Missense_Mutation	SNP	A	A	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr8:142367789A>T	ENST00000377741.3	-	2	325	c.235T>A	c.(235-237)Tgc>Agc	p.C79S	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	79					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			GTGCGGCAGCAGAAGACGTAC	0.647																																					p.C79S													.	GPR20-91	0			c.T235A						.						86.0	86.0	86.0					8																	142367789		2203	4300	6503	SO:0001583	missense	2843	exon2			GGCAGCAGAAGAC	U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.235T>A	8.37:g.142367789A>T	ENSP00000366970:p.Cys79Ser	103	1		158	49	NM_005293	0	0	0	0	0	Q17R96	Missense_Mutation	SNP	ENST00000377741.3	37	CCDS34949.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.493963	0.64186	.	.	ENSG00000204882	ENST00000377741	T	0.36520	1.25	4.62	2.09	0.27110	GPCR, rhodopsin-like superfamily (1);	0.180691	0.48767	D	0.000162	T	0.38268	0.1034	M	0.61703	1.905	0.45995	D	0.998809	P	0.42010	0.768	P	0.46026	0.501	T	0.12451	-1.0547	10	0.66056	D	0.02	-18.3354	6.7304	0.23381	0.6853:0.1674:0.0:0.1472	.	79	Q99678	GPR20_HUMAN	S	79	ENSP00000366970:C79S	ENSP00000366970:C79S	C	-	1	0	GPR20	142436971	1.000000	0.71417	0.999000	0.59377	0.714000	0.41099	1.841000	0.39240	0.131000	0.18576	0.459000	0.35465	TGC	.		0.647	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378968.1	NM_005293	
FOCAD	54914	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	20988333	20988333	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr9:20988333G>A	ENST00000380249.1	+	43	5273	c.4909G>A	c.(4909-4911)Gtt>Att	p.V1637I	FOCAD_ENST00000338382.6_Missense_Mutation_p.V1637I|FOCAD_ENST00000605086.1_Missense_Mutation_p.V1073I	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1637						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											CATTTCAGGCGTTTTGAAGAG	0.378																																					p.V1637I		.											.	.	0			c.G4909A						.						144.0	133.0	137.0					9																	20988333		2203	4300	6503	SO:0001583	missense	54914	exon43			TCAGGCGTTTTGA	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.4909G>A	9.37:g.20988333G>A	ENSP00000369599:p.Val1637Ile	103	0		91	8	NM_017794	0	0	0	0	0	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415680	0.62511	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.22945	1.93;1.93	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.52597	0.1744	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	D	0.67382	0.951	T	0.36383	-0.9750	10	0.45353	T	0.12	-28.3855	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1637	Q5VW36	K1797_HUMAN	I	1637	ENSP00000369599:V1637I;ENSP00000344307:V1637I	ENSP00000344307:V1637I	V	+	1	0	KIAA1797	20978333	1.000000	0.71417	0.317000	0.25265	0.044000	0.14063	5.911000	0.69939	2.941000	0.99782	0.655000	0.94253	GTT	.		0.378	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
TOPORS	10210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	32541932	32541932	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr9:32541932C>T	ENST00000360538.2	-	3	2707	c.2591G>A	c.(2590-2592)aGc>aAc	p.S864N	TOPORS_ENST00000379858.1_Missense_Mutation_p.S799N	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	864	Interaction with TOP1.|Interaction with UBE2I.|Lys-rich.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TACACTTAGGCTCCGGGTCTT	0.358																																					p.S864N		.											.	TOPORS-230	0			c.G2591A						.						203.0	207.0	205.0					9																	32541932		2203	4300	6503	SO:0001583	missense	10210	exon3			CTTAGGCTCCGGG	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.2591G>A	9.37:g.32541932C>T	ENSP00000353735:p.Ser864Asn	72	0		38	11	NM_005802	0	0	7	8	1	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	37	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202662	0.58234	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.34072	1.38;1.44	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000011	T	0.52468	0.1736	L	0.32530	0.975	0.39310	D	0.965069	D	0.89917	1.0	D	0.83275	0.996	T	0.53982	-0.8361	10	0.87932	D	0	-9.414	19.0572	0.93070	0.0:1.0:0.0:0.0	.	864	Q9NS56	TOPRS_HUMAN	N	864;799	ENSP00000353735:S864N;ENSP00000369187:S799N	ENSP00000353735:S864N	S	-	2	0	TOPORS	32531932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.479000	0.60236	2.803000	0.96430	0.650000	0.86243	AGC	.		0.358	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
FCN2	2220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	137777085	137777085	+	Splice_Site	SNP	G	G	T	rs529779645	byFrequency	TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr9:137777085G>T	ENST00000291744.6	+	5	312	c.302G>T	c.(301-303)gGc>gTc	p.G101V	FCN2_ENST00000350339.2_Splice_Site_p.G63V	NM_004108.2	NP_004099.2	Q15485	FCN2_HUMAN	ficolin (collagen/fibrinogen domain containing lectin) 2	101	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|opsonization (GO:0008228)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	20		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		CCCTTCCCAGGCCCGCGTACC	0.667																																					p.G101V		.											.	FCN2-153	0			c.G302T						.						53.0	52.0	52.0					9																	137777085		2203	4300	6503	SO:0001630	splice_region_variant	2220	exon5			TCCCAGGCCCGCG	D49353	CCDS6983.1	9q34	2013-09-12	2013-09-12		ENSG00000160339	ENSG00000160339		"""Fibrinogen C domain containing"""	3624	protein-coding gene	gene with protein product	"""hucolin"", ""collagen/fibrinogen domain-containing protein 2"", ""ficolin B"", ""serum lectin p35"", ""L-ficolin"""	601624	"""ficolin (collagen/fibrinogen domain-containing lectin) 2 (hucolin)"""			8884275	Standard	XM_006717015		Approved	P35, FCNL, EBP-37, ficolin-2	uc004cfg.1	Q15485	OTTHUMG00000020892	ENST00000291744.6:c.302-1G>T	9.37:g.137777085G>T		54	0		45	16	NM_004108	0	0	0	0	0	A6NFG7|A8K478|Q6IS69|Q7M4P4|Q9UC57	Missense_Mutation	SNP	ENST00000291744.6	37	CCDS6983.1	.	.	.	.	.	.	.	.	.	.	G	6.759	0.508916	0.12883	.	.	ENSG00000160339	ENST00000350339;ENST00000291744	T;T	0.19394	2.15;2.15	3.59	2.66	0.31614	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (3);	.	.	.	.	T	0.40815	0.1132	M	0.89353	3.025	0.30440	N	0.776243	P;P	0.49696	0.927;0.763	P;P	0.51701	0.462;0.677	T	0.48258	-0.9051	8	.	.	.	.	9.7179	0.40284	0.0:0.4147:0.5853:0.0	.	63;101	Q15485-2;Q15485	.;FCN2_HUMAN	V	63;101	ENSP00000291741:G63V;ENSP00000291744:G101V	.	G	+	2	0	FCN2	136916906	0.229000	0.23729	0.063000	0.19743	0.018000	0.09664	0.409000	0.21082	0.444000	0.26612	0.462000	0.41574	GGC	.		0.667	FCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054960.1	NM_004108	Missense_Mutation
SOHLH1	402381	hgsc.bcm.edu	37	9	138594140	138594140	+	5'Flank	SNP	C	C	G			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr9:138594140C>G	ENST00000298466.5	-	0	0				SOHLH1_ENST00000425225.1_5'Flank|KCNT1_ENST00000487664.1_Silent_p.G12G|KCNT1_ENST00000298480.5_Silent_p.G12G|KCNT1_ENST00000371757.2_Silent_p.G12G	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1						oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		ccccggggggcgtctgccggg	0.731																																					p.G12G		.											.	KCNT1-137	0			c.C36G						.						12.0	16.0	15.0					9																	138594140		2168	4247	6415	SO:0001631	upstream_gene_variant	57582	exon1			GGGGGGCGTCTGC	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915		9.37:g.138594140C>G	Exception_encountered	1	0		23	14	NM_001272003	0	0	0	0	0	C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Silent	SNP	ENST00000298466.5	37	CCDS35174.1																																																																																			.		0.731	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415	
TBL1X	6907	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	9683003	9683003	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chrX:9683003C>T	ENST00000217964.7	+	17	2307	c.1667C>T	c.(1666-1668)gCc>gTc	p.A556V	TBL1X_ENST00000407597.2_Missense_Mutation_p.A556V|TBL1X_ENST00000380961.1_Missense_Mutation_p.A505V|TBL1X_ENST00000424279.1_Missense_Mutation_p.A505V|TBL1X_ENST00000536365.1_Missense_Mutation_p.A505V	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	556					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				TGCTGGAACGCCCGAGGAGAC	0.592																																					p.A556V		.											.	TBL1X-131	0			c.C1667T						.						86.0	62.0	70.0					X																	9683003		2203	4300	6503	SO:0001583	missense	6907	exon17			GGAACGCCCGAGG	Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1667C>T	X.37:g.9683003C>T	ENSP00000217964:p.Ala556Val	272	0		178	81	NM_001139466	0	0	1	13	12	A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297142	0.60086	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47	3.8	3.8	0.43715	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.116908	0.56097	D	0.000024	T	0.77994	0.4214	L	0.58101	1.795	0.44852	D	0.997864	B;B	0.29955	0.263;0.263	B;B	0.29598	0.104;0.104	T	0.80054	-0.1543	10	0.72032	D	0.01	.	15.6252	0.76851	0.0:1.0:0.0:0.0	.	519;556	Q59F53;O60907	.;TBL1X_HUMAN	V	556;505;505;505;556	ENSP00000385988:A556V;ENSP00000394097:A505V;ENSP00000445317:A505V;ENSP00000370348:A505V;ENSP00000217964:A556V	ENSP00000217964:A556V	A	+	2	0	TBL1X	9643003	1.000000	0.71417	0.958000	0.39756	0.937000	0.57800	4.399000	0.59703	1.667000	0.50832	0.429000	0.28392	GCC	.		0.592	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
PHKA1	5255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	71802352	71802352	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chrX:71802352G>A	ENST00000373542.4	-	31	3553	c.3394C>T	c.(3394-3396)Ctt>Ttt	p.L1132F	PHKA1_ENST00000541944.1_Missense_Mutation_p.L1060F|PHKA1_ENST00000373539.3_Missense_Mutation_p.L1149F|PHKA1_ENST00000373545.3_Missense_Mutation_p.L1090F|PHKA1_ENST00000339490.3_Missense_Mutation_p.L1119F	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	1132					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GTGAGGACAAGGATGGCTTCA	0.448																																					p.L1132F		.											.	PHKA1-134	0			c.C3394T						.						114.0	86.0	96.0					X																	71802352		2203	4300	6503	SO:0001583	missense	5255	exon31			GGACAAGGATGGC		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.3394C>T	X.37:g.71802352G>A	ENSP00000362643:p.Leu1132Phe	417	1		293	86	NM_002637	0	0	0	0	0	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819920	0.50633	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.91464	-2.84;-2.85;-2.83;-2.82;-2.83	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000001	D	0.93216	0.7839	M	0.63428	1.95	0.48901	D	0.999723	D;P;P;D	0.76494	0.999;0.913;0.794;0.975	D;P;P;P	0.87578	0.998;0.459;0.66;0.835	D	0.92493	0.6002	10	0.46703	T	0.11	-11.3305	8.8082	0.34952	0.1046:0.0:0.8954:0.0	.	1060;1090;1119;1132	B7ZL07;A6NIT2;P46020-2;P46020	.;.;.;KPB1_HUMAN	F	1090;1132;1060;1119;1149	ENSP00000362646:L1090F;ENSP00000362643:L1132F;ENSP00000441251:L1060F;ENSP00000342469:L1119F;ENSP00000362640:L1149F	ENSP00000342469:L1119F	L	-	1	0	PHKA1	71719077	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.085000	0.30840	2.132000	0.65825	0.594000	0.82650	CTT	.		0.448	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
PCDH11X	27328	broad.mit.edu;bcgsc.ca	37	X	91873700	91873700	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chrX:91873700C>T	ENST00000373094.1	+	7	4650	c.3805C>T	c.(3805-3807)Cgt>Tgt	p.R1269C	PCDH11X_ENST00000298274.8_Missense_Mutation_p.R1232C|PCDH11X_ENST00000373097.1_Missense_Mutation_p.R1259C|PCDH11X_ENST00000361655.2_Missense_Mutation_p.R1251C|PCDH11X_ENST00000406881.1_Missense_Mutation_p.R1261C|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000373088.1_Missense_Mutation_p.R1232C	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1269					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TGCCCTCCATCGTAGTCAGGC	0.552																																					p.R1269C	NSCLC(38;925 1092 2571 38200 45895)												.	PCDH11X-193	0			c.C3805T						.						227.0	202.0	211.0					X																	91873700		2203	4300	6503	SO:0001583	missense	27328	exon7			CTCCATCGTAGTC	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3805C>T	X.37:g.91873700C>T	ENSP00000362186:p.Arg1269Cys	1032	1		749	25	NM_032968	0	0	0	0	0	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	4.743	0.138075	0.09083	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.56444	0.49;0.5;0.47;0.48;0.5;0.46	3.85	1.88	0.25563	.	.	.	.	.	T	0.34716	0.0907	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.10296	0.003;0.003;0.003;0.003;0.002	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.21895	-1.0232	9	0.46703	T	0.11	.	7.3756	0.26827	0.0:0.7432:0.0:0.2568	.	1232;1251;1261;1259;1269	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	C	1269;1259;1232;1251;1261;1269;1232	ENSP00000362186:R1269C;ENSP00000362189:R1259C;ENSP00000362180:R1232C;ENSP00000355105:R1251C;ENSP00000384758:R1261C;ENSP00000298274:R1232C	ENSP00000298274:R1232C	R	+	1	0	PCDH11X	91760356	0.000000	0.05858	0.019000	0.16419	0.198000	0.23893	0.113000	0.15499	0.171000	0.19730	0.466000	0.42574	CGT	.		0.552	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
GPR50	9248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	150348665	150348665	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chrX:150348665G>A	ENST00000218316.3	+	2	679	c.610G>A	c.(610-612)Gtg>Atg	p.V204M	GPR50-AS1_ENST00000454196.1_RNA|AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	204					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					TCTCCTCATCGTGGGTTTCTG	0.532																																					p.V204M		.											.	GPR50-176	0			c.G610A						.						230.0	203.0	212.0					X																	150348665		2123	4223	6346	SO:0001583	missense	9248	exon2			CTCATCGTGGGTT	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.610G>A	X.37:g.150348665G>A	ENSP00000218316:p.Val204Met	80	0		43	12	NM_004224	0	0	0	0	0	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.456799	0.63401	.	.	ENSG00000102195	ENST00000535473;ENST00000218316	T	0.35048	1.33	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.50684	0.1630	L	0.53729	1.69	0.47547	D	0.999454	D;P	0.69078	0.997;0.819	D;P	0.64321	0.924;0.668	T	0.47018	-0.9149	10	0.36615	T	0.2	-12.9108	13.7644	0.62986	0.0:0.0:1.0:0.0	.	157;204	F5H1S3;Q13585	.;MTR1L_HUMAN	M	157;204	ENSP00000218316:V204M	ENSP00000218316:V204M	V	+	1	0	GPR50	150099323	1.000000	0.71417	0.981000	0.43875	0.745000	0.42441	9.754000	0.98908	1.903000	0.55091	0.529000	0.55759	GTG	.		0.532	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224	
RENBP	5973	hgsc.bcm.edu	37	X	153200791	153200791	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chrX:153200791G>T	ENST00000393700.3	-	11	1312	c.1232C>A	c.(1231-1233)cCc>cAc	p.P411H	NAA10_ENST00000464845.1_5'Flank|RENBP_ENST00000369997.3_Missense_Mutation_p.P397H|NAA10_ENST00000370009.1_5'Flank|NAA10_ENST00000393712.3_5'Flank|RENBP_ENST00000412763.1_3'UTR|NAA10_ENST00000393710.3_5'Flank|NAA10_ENST00000370015.4_5'Flank	NM_002910.5	NP_002901.2	P51606	RENBP_HUMAN	renin binding protein	411					N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)|regulation of blood pressure (GO:0008217)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|endopeptidase inhibitor activity (GO:0004866)|N-acylglucosamine 2-epimerase activity (GO:0050121)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	ggcgggggcggggCGGCTCAG	0.751																																					p.P411H		.											.	RENBP-132	0			c.C1232A						.						2.0	3.0	2.0					X																	153200791		1563	2987	4550	SO:0001583	missense	5973	exon11			GGGGCGGGGCGGC		CCDS14738.2	Xq28	2013-09-23	2001-11-28		ENSG00000102032	ENSG00000102032			9959	protein-coding gene	gene with protein product	"""N-acylglucosamine 2-epimerase"", ""GlcNAc 2-epimerase"", ""N-acetyl-D-glucosamine 2-epimerase"""	312420	"""renin-binding protein"""			1618798	Standard	NM_002910		Approved	RNBP, RBP	uc004fjo.2	P51606	OTTHUMG00000024224	ENST00000393700.3:c.1232C>A	X.37:g.153200791G>T	ENSP00000377303:p.Pro411His	0	0		8	4	NM_002910	0	0	8	8	0	B4DNZ3|Q96BI6	Missense_Mutation	SNP	ENST00000393700.3	37	CCDS14738.2	.	.	.	.	.	.	.	.	.	.	g	13.98	2.398865	0.42512	.	.	ENSG00000102032	ENST00000393700;ENST00000369997;ENST00000451114	T;T	0.32988	1.43;1.43	3.76	-6.35	0.01975	Six-hairpin glycosidase-like (1);	2.963070	0.01364	U	0.012354	T	0.24890	0.0604	L	0.44542	1.39	0.09310	N	0.99999	B	0.02656	0.0	B	0.01281	0.0	T	0.19353	-1.0308	10	0.45353	T	0.12	1.1156	7.9104	0.29787	0.1647:0.1371:0.6982:0.0	.	411	P51606	RENBP_HUMAN	H	411;397;124	ENSP00000377303:P411H;ENSP00000359014:P397H	ENSP00000359014:P397H	P	-	2	0	RENBP	152853985	0.000000	0.05858	0.000000	0.03702	0.698000	0.40448	-1.269000	0.02834	-1.762000	0.01308	0.445000	0.29226	CCC	.		0.751	RENBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061103.3	NM_002910	
MIA3	375056	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	222803477	222803477	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr1:222803477delA	ENST00000344922.5	+	4	2940	c.2915delA	c.(2914-2916)gaafs	p.E972fs	MIA3_ENST00000344507.1_Intron|MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344441.6_Frame_Shift_Del_p.E972fs	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	972					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.V974fs*4(1)		breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		TATAATATGGAAAAAGTCCTA	0.428																																					p.E972fs		.											.	MIA3-98	1	Insertion - Frameshift(1)	large_intestine(1)	c.2915delA						.						74.0	72.0	73.0					1																	222803477		1967	4169	6136	SO:0001589	frameshift_variant	375056	exon4			.		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.2915delA	1.37:g.222803477delA	ENSP00000340900:p.Glu972fs	76	0		73	32	NM_198551	0	0	0	0	0	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Frame_Shift_Del	DEL	ENST00000344922.5	37	CCDS41470.1																																																																																			.		0.428	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
IGFLR1	79713	hgsc.bcm.edu	37	19	36230984	36230986	+	In_Frame_Del	DEL	CGG	CGG	-	rs200340760		TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	CGG	CGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr19:36230984_36230986delCGG	ENST00000592537.1	-	4	446_448	c.346_348delCCG	c.(346-348)ccgdel	p.P116del	KMT2B_ENST00000607650.1_RNA|IGFLR1_ENST00000246532.1_In_Frame_Del_p.P116del|IGFLR1_ENST00000592889.1_Intron|IGFLR1_ENST00000587101.1_5'UTR|IGFLR1_ENST00000344990.3_Intron|AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000588992.1_Intron			Q9H665	IGFR1_HUMAN	IGF-like family receptor 1	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(3)|large_intestine(1)|lung(8)|prostate(1)	15						TGGCAGGGACCGGCCTCTGGGGA	0.621																																					p.116_116del		.											.	IGFLR1-90	0			c.346_348del						.																																			SO:0001651	inframe_deletion	79713	exon4			.	AK026226	CCDS12472.1	19q13.12	2012-10-02	2011-04-04	2011-04-04	ENSG00000126246	ENSG00000126246			23620	protein-coding gene	gene with protein product		614143	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 4"", ""transmembrane protein 149"""	U2AF1L4, TMEM149		21454693	Standard	NM_024660		Approved	FLJ22573	uc002obd.4	Q9H665		ENST00000592537.1:c.346_348delCCG	19.37:g.36230984_36230986delCGG	ENSP00000466181:p.Pro116del	44	0		34	11	NM_024660	0	0	0	0	0	Q8N5X0	In_Frame_Del	DEL	ENST00000592537.1	37	CCDS12472.1																																																																																			.		0.621	IGFLR1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459077.1	NM_024660	
SREBF2	6721	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	42289217	42289217	+	Frame_Shift_Del	DEL	T	T	-			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr22:42289217delT	ENST00000361204.4	+	12	2471	c.2305delT	c.(2305-2307)tttfs	p.F770fs	SREBF2_ENST00000491541.1_3'UTR	NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	770					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GGGCCAGAAGTTTTTCATGGA	0.582																																					p.F769fs		.											.	SREBF2-154	0			c.2305delT						.						55.0	58.0	57.0					22																	42289217		2203	4300	6503	SO:0001589	frameshift_variant	6721	exon12			.	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.2305delT	22.37:g.42289217delT	ENSP00000354476:p.Phe770fs	97	0		70	24	NM_004599	0	0	0	0	0	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Frame_Shift_Del	DEL	ENST00000361204.4	37	CCDS14023.1																																																																																			.		0.582	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
PLEC	5339	hgsc.bcm.edu	37	8	145024821	145024825	+	Frame_Shift_Del	DEL	CACCT	CACCT	-			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	CACCT	CACCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr8:145024821_145024825delCACCT	ENST00000322810.4	-	1	219_223	c.50_54delAGGTG	c.(49-54)gaggtgfs	p.EV17fs	PLEC_ENST00000356346.3_Intron|PLEC_ENST00000436759.2_Intron|PLEC_ENST00000527096.1_Intron|PLEC_ENST00000354958.2_Intron	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	17	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCGGAAGAGCACCTCATAGATGGC	0.683																																					p.17_18del		.											.	PLEC-141	0			c.50_54del						.																																			SO:0001589	frameshift_variant	5339	exon1			.	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.50_54delAGGTG	8.37:g.145024821_145024825delCACCT	ENSP00000323856:p.Glu17fs	3	0		46	17	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Frame_Shift_Del	DEL	ENST00000322810.4	37	CCDS43772.1																																																																																			.		0.683	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
SLC14A1	6563	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	43316457	43316458	+	Frame_Shift_Ins	INS	-	-	A			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr18:43316457_43316458insA	ENST00000321925.4	+	6	739_740	c.507_508insA	c.(508-510)aaafs	p.K170fs	SLC14A1_ENST00000586142.1_Frame_Shift_Ins_p.K170fs|SLC14A1_ENST00000535474.1_Frame_Shift_Ins_p.K38fs|SLC14A1_ENST00000402943.2_Frame_Shift_Ins_p.K65fs|SLC14A1_ENST00000502059.2_Frame_Shift_Ins_p.K62fs|SLC14A1_ENST00000589700.1_Frame_Shift_Ins_p.K170fs|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A1_ENST00000436407.3_Frame_Shift_Ins_p.K226fs|RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000591943.1_Intron|SLC14A1_ENST00000415427.3_Frame_Shift_Ins_p.K226fs	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	170					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						CCATGCTCAGCAAATGGGACCT	0.455																																					p.S225fs		.											.	SLC14A1-515	0			c.675_676insA						.																																			SO:0001589	frameshift_variant	6563	exon7			.	BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.510dupA	18.37:g.43316460_43316460dupA	ENSP00000318546:p.Lys170fs	156	0		128	51	NM_001128588	0	0	0	0	0	A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Frame_Shift_Ins	INS	ENST00000321925.4	37	CCDS11925.1																																																																																			.		0.455	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865	
VAPB	9217	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	57009683	57009684	+	Frame_Shift_Ins	INS	-	-	C			TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr20:57009683_57009684insC	ENST00000475243.1	+	3	575_576	c.237_238insC	c.(238-240)cccfs	p.P80fs	VAPB_ENST00000395802.3_Intron|VAPB_ENST00000265619.2_Intron	NM_004738.4	NP_004729.1	O95292	VAPB_HUMAN	VAMP (vesicle-associated membrane protein)-associated protein B and C	80	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|endoplasmic reticulum unfolded protein response (GO:0030968)|modulation by virus of host morphology or physiology (GO:0019048)|positive regulation of viral genome replication (GO:0045070)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-tubulin binding (GO:0048487)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|structural molecule activity (GO:0005198)			kidney(2)|lung(3)|prostate(1)	6	Lung NSC(12;0.000615)|all_lung(29;0.00186)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)			TCGATTATGATCCCAATGAGAA	0.361																																					p.D79fs		.											.	VAPB-226	0			c.237_238insC						.																																			SO:0001589	frameshift_variant	9217	exon3			.	AF086628	CCDS33498.1, CCDS56198.1	20q13	2014-09-17			ENSG00000124164	ENSG00000124164			12649	protein-coding gene	gene with protein product		605704				9920726	Standard	NM_004738		Approved	VAP-B, VAP-C, ALS8	uc002xza.3	O95292	OTTHUMG00000032840	ENST00000475243.1:c.240dupC	20.37:g.57009686_57009686dupC	ENSP00000417175:p.Pro80fs	89	0		79	21	NM_004738	0	0	0	0	0	A2A2F2|O95293|Q9P0H0	Frame_Shift_Ins	INS	ENST00000475243.1	37	CCDS33498.1																																																																																			.		0.361	VAPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079875.2		
PRRC2B	84726	broad.mit.edu	37	9	134351684	134351685	+	Frame_Shift_Ins	INS	-	-	G	rs376130854		TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr9:134351684_134351685insG	ENST00000357304.4	+	15	4223_4224	c.4168_4169insG	c.(4168-4170)cggfs	p.R1390fs	PRRC2B_ENST00000458550.1_Intron|PRRC2B_ENST00000405995.1_Intron|PRRC2B_ENST00000372249.1_5'UTR	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1390							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GCGGGAGCGGCGGGAAGGCCCT	0.649											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1390fs													.	PRRC2B-24	0			c.4168_4169insG						.			25,3565		0,25,1770						5.9	1.0			12	73,7729		0,73,3828	no	frameshift	PRRC2B	NM_013318.3		0,98,5598	A1A1,A1R,RR		0.9357,0.6964,0.8603				98,11294				SO:0001589	frameshift_variant	84726	exon15			GAGCGGCGGGAAG	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.4171dupG	9.37:g.134351687_134351687dupG	ENSP00000349856:p.Arg1390fs	45	0	1610	88	13	NM_013318	0	0	0	0	0	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Frame_Shift_Ins	INS	ENST00000357304.4	37	CCDS48044.1																																																																																			.		0.649	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
DES	1674	hgsc.bcm.edu	37	2	220283244	220283245	+	Missense_Mutation	DNP	GG	GG	AT	rs1058253		TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chr2:220283244_220283245GG>AT	ENST00000373960.3	+	1	146_147	c.60_61GG>AT	c.(58-63)ggGGcc>ggATcc	p.A21S		NM_001927.3	NP_001918.3	P17661	DESM_HUMAN	desmin	21	Head.				cytoskeleton organization (GO:0007010)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart contraction (GO:0008016)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)	18		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		CCTTCGGCGGGGCCCCGGGCTT	0.733																																					p.A21S		.											.	DES-514	0			c.G61T						.																																			SO:0001583	missense	1674	exon1			GGCGGGGCCCCGG	AF521879	CCDS33383.1	2q35	2014-09-17			ENSG00000175084	ENSG00000175084		"""Intermediate filaments type III"""	2770	protein-coding gene	gene with protein product	"""intermediate filament protein"""	125660				2673923, 9736733	Standard	NM_001927		Approved	CMD1I, CSM1, CSM2	uc002vll.3	P17661	OTTHUMG00000058924	Exception_encountered	2.37:g.220283244_220283245delinsAT	ENSP00000363071:p.Ala21Ser	3.0	0.0		31.0	24.0	NM_001927	0	0	0	0	0	Q15787|Q549R7|Q549R8|Q549R9|Q8IZR1|Q8IZR6|Q8NES2|Q8NEU6|Q8TAC4|Q8TCX2|Q8TD99|Q9UHN5|Q9UJ80	Missense_Mutation	DNP	ENST00000373960.3	37	CCDS33383.1																																																																																			.		0.733	DES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130240.1	NM_001927	
SSX5	6758	broad.mit.edu;bcgsc.ca	37	X	48053577	48053578	+	Missense_Mutation	DNP	GG	GG	TT	rs146748651	byFrequency	TCGA-PJ-A5Z9-01A-11D-A28G-10	TCGA-PJ-A5Z9-10A-01D-A28G-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	0040144d-5bfe-4476-b511-2fa1fed81583	32635493-96c3-4fed-a9f7-85537363c7f0	g.chrX:48053577_48053578GG>TT	ENST00000376923.1	-	3	266_267	c.267_268CC>AA	c.(265-270)aaCCgt>aaAAgt	p.89_90NR>KS	SSX5_ENST00000311798.1_Missense_Mutation_p.130_131NR>KS|SSX5_ENST00000347757.1_Missense_Mutation_p.89_90NR>KS			O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5	89					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|skin(1)	18						TGATTCCCACGGTTAGGGTCAT	0.5																																					p.NR130KS													.	SSX5-90	0			c.C390A						.																																			SO:0001583	missense	6758	exon5			CCCACGGTTAGGG	BC016640	CCDS14288.1, CCDS14289.1	Xp11.23	2008-02-05			ENSG00000165583	ENSG00000165583			11339	protein-coding gene	gene with protein product		300327					Standard	NM_021015		Approved		uc004diz.1	O60225	OTTHUMG00000021471	ENST00000376923.1:c.267_268delinsTT	X.37:g.48053577_48053578delinsTT	ENSP00000366122:p.N89_R90delinsKS	1114	1		867	26	NM_021015	0	0	0	0	0	Q5JQ59|Q5JQ60|Q96AW3	Missense_Mutation	DNP	ENST00000376923.1	37	CCDS14289.1																																																																																			.		0.500	SSX5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056466.1	NM_021015	
