#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CDK11A	728642	hgsc.bcm.edu	37	1	1634967	1634967	+	Missense_Mutation	SNP	G	G	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr1:1634967G>C	ENST00000378633.1	-	18	2096	c.2017C>G	c.(2017-2019)Cgc>Ggc	p.R673G	CDK11A_ENST00000358779.5_Missense_Mutation_p.R660G|CDK11A_ENST00000404249.3_Missense_Mutation_p.R670G|CDK11A_ENST00000357760.2_Missense_Mutation_p.R669G|CDK11A_ENST00000495016.1_5'Flank|CDK11A_ENST00000356200.3_Missense_Mutation_p.R636G|RP1-283E3.8_ENST00000598846.1_RNA|CDK11A_ENST00000378638.2_Missense_Mutation_p.R636G			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	673					apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						AAGCGCTTGCGGAGGTTGTTG	0.612																																					p.R670G	Pancreas(186;965 2119 30274 40311 50569)	Atlas-SNP	.											.	CDK11A	38	.	0			c.C2008G						PASS	.						17.0	31.0	27.0					1																	1634967		1542	4054	5596	SO:0001583	missense	728642	exon18			GCTTGCGGAGGTT	AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.2017C>G	chr1.hg19:g.1634967G>C	ENSP00000367900:p.Arg673Gly	61.0	0.0	.		81.0	13.0	.	NM_024011	O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Missense_Mutation	SNP	ENST00000378633.1	hg19		.	.	.	.	.	.	.	.	.	.	-	10.92	1.486914	0.26686	.	.	ENSG00000008128	ENST00000356200;ENST00000404249;ENST00000357760;ENST00000358779;ENST00000378633;ENST00000378638;ENST00000378630;ENST00000341028	T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;2.82	2.51	1.55	0.23275	.	0.000000	0.85682	D	0.000000	T	0.53012	0.1770	L	0.53617	1.68	0.80722	D	1	D;D;D	0.63880	0.979;0.979;0.993	P;P;D	0.66979	0.688;0.688;0.948	T	0.52290	-0.8595	10	0.87932	D	0	.	9.3145	0.37926	0.0:0.0:0.7833:0.2167	.	670;660;287	Q9UQ88-2;Q9UQ88-4;Q9UQ88-5	.;.;.	G	636;670;669;660;673;636;636;57	ENSP00000348529:R636G;ENSP00000384442:R670G;ENSP00000350403:R669G;ENSP00000351629:R660G;ENSP00000367900:R673G;ENSP00000367905:R636G;ENSP00000344418:R57G	ENSP00000344418:R57G	R	-	1	0	CDK11A	1624827	1.000000	0.71417	0.998000	0.56505	0.238000	0.25445	5.403000	0.66338	0.381000	0.24851	0.184000	0.17185	CGC	.	.	.	none		0.612	CDK11A-005	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000001735.1	NM_024011	
AJAP1	55966	hgsc.bcm.edu	37	1	4772481	4772481	+	Missense_Mutation	SNP	G	G	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr1:4772481G>T	ENST00000378191.4	+	2	932	c.551G>T	c.(550-552)gGg>gTg	p.G184V	AJAP1_ENST00000378190.3_Missense_Mutation_p.G184V	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	184	Thr-rich.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		ATCGCCTGGGGGCCCACGGGG	0.647																																					p.G184V		Atlas-SNP	.											.	AJAP1	68	.	0			c.G551T						PASS	.						18.0	18.0	18.0					1																	4772481		2200	4298	6498	SO:0001583	missense	55966	exon2			CCTGGGGGCCCAC	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.551G>T	chr1.hg19:g.4772481G>T	ENSP00000367433:p.Gly184Val	94.0	0.0	.		112.0	10.0	.	NM_018836	Q9Y229	Missense_Mutation	SNP	ENST00000378191.4	hg19	CCDS54.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305939	0.60305	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.74947	-0.89;-0.89	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.79811	0.4510	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81705	-0.0811	10	0.72032	D	0.01	-25.2912	14.3171	0.66460	0.0:0.0:1.0:0.0	.	184	Q9UKB5	AJAP1_HUMAN	V	184	ENSP00000367432:G184V;ENSP00000367433:G184V	ENSP00000367432:G184V	G	+	2	0	AJAP1	4672341	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.294000	0.78760	2.432000	0.82394	0.467000	0.42956	GGG	.	.	.	none		0.647	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	NM_018836	
PHC2	1912	hgsc.bcm.edu	37	1	33841054	33841054	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr1:33841054G>T	ENST00000257118.5	-	1	140	c.87C>A	c.(85-87)tgC>tgA	p.C29*	PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000419414.2_Nonsense_Mutation_p.C29*|PHC2_ENST00000431992.1_Nonsense_Mutation_p.C29*	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	29	Ser-rich.				multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				tgctgttgttgcagccactgc	0.592																																					p.C29X		Atlas-SNP	.											.	PHC2	78	.	0			c.C87A						PASS	.						46.0	43.0	44.0					1																	33841054		2203	4300	6503	SO:0001587	stop_gained	1912	exon1			GTTGTTGCAGCCA	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.87C>A	chr1.hg19:g.33841054G>T	ENSP00000257118:p.Cys29*	51.0	0.0	.		72.0	8.0	.	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Nonsense_Mutation	SNP	ENST00000257118.5	hg19	CCDS378.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241461	0.79912	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000419414	.	.	.	4.02	2.05	0.26809	.	0.643093	0.14507	N	0.315356	.	.	.	.	.	.	0.29812	N	0.831564	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-0.2524	6.676	0.23093	0.1055:0.1822:0.7123:0.0	.	.	.	.	X	29	.	ENSP00000257118:C29X	C	-	3	2	PHC2	33613641	0.993000	0.37304	0.115000	0.21578	0.963000	0.63663	2.257000	0.43240	0.295000	0.22570	0.407000	0.27541	TGC	.	.	.	none		0.592	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
IPO13	9670	hgsc.bcm.edu	37	1	44423158	44423158	+	Missense_Mutation	SNP	G	G	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr1:44423158G>T	ENST00000372343.3	+	7	2139	c.1477G>T	c.(1477-1479)Ggc>Tgc	p.G493C	IPO13_ENST00000492152.1_3'UTR	NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	493					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TGGGCTCATTGGCCTCATCCC	0.552																																					p.G493C		Atlas-SNP	.											.	IPO13	86	.	0			c.G1477T						PASS	.						168.0	136.0	147.0					1																	44423158		2203	4300	6503	SO:0001583	missense	9670	exon7			CTCATTGGCCTCA	AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.1477G>T	chr1.hg19:g.44423158G>T	ENSP00000361418:p.Gly493Cys	67.0	0.0	.		107.0	5.0	.	NM_014652	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	ENST00000372343.3	hg19	CCDS503.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354289	0.82243	.	.	ENSG00000117408	ENST00000372343	T	0.67698	-0.28	5.59	5.59	0.84812	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74068	0.3668	L	0.44542	1.39	0.80722	D	1	D	0.69078	0.997	P	0.56865	0.808	T	0.75747	-0.3209	10	0.66056	D	0.02	1.0371	19.5982	0.95549	0.0:0.0:1.0:0.0	.	493	O94829	IPO13_HUMAN	C	493	ENSP00000361418:G493C	ENSP00000361418:G493C	G	+	1	0	IPO13	44195745	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.735000	0.98825	2.644000	0.89710	0.561000	0.74099	GGC	.	.	.	none		0.552	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022846.1	NM_014652	
MOV10	4343	hgsc.bcm.edu	37	1	113232693	113232693	+	Missense_Mutation	SNP	G	G	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr1:113232693G>A	ENST00000413052.2	+	5	1199	c.809G>A	c.(808-810)cGg>cAg	p.R270Q	MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369644.1_Missense_Mutation_p.R214Q|MOV10_ENST00000357443.2_Missense_Mutation_p.R270Q|MOV10_ENST00000369645.1_Missense_Mutation_p.R270Q	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	270					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		GTGACCAATCGGATAGAGGAA	0.612																																					p.R270Q		Atlas-SNP	.											.	MOV10	74	.	0			c.G809A						PASS	.						56.0	58.0	58.0					1																	113232693		2203	4300	6503	SO:0001583	missense	4343	exon5			CCAATCGGATAGA	AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.809G>A	chr1.hg19:g.113232693G>A	ENSP00000399797:p.Arg270Gln	104.0	0.0	.		104.0	11.0	.	NM_020963	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Missense_Mutation	SNP	ENST00000413052.2	hg19	CCDS853.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.325084	0.60634	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000285733;ENST00000369644;ENST00000357443;ENST00000369648	D;D;D;D	0.91577	-2.87;-2.87;-2.86;-2.87	5.77	3.91	0.45181	.	0.509312	0.21069	N	0.080688	T	0.74359	0.3706	L	0.36672	1.1	0.80722	D	1	B;B;B	0.21905	0.012;0.062;0.002	B;B;B	0.13407	0.002;0.009;0.001	T	0.70753	-0.4786	10	0.25751	T	0.34	-17.3516	7.7467	0.28873	0.1826:0.0:0.8174:0.0	.	214;270;270	Q5JR04;Q9H8T8;Q9HCE1	.;.;MOV10_HUMAN	Q	270;270;270;214;270;208	ENSP00000399797:R270Q;ENSP00000358659:R270Q;ENSP00000358658:R214Q;ENSP00000350028:R270Q	ENSP00000285733:R270Q	R	+	2	0	MOV10	113034216	0.976000	0.34144	0.985000	0.45067	0.860000	0.49131	2.114000	0.41911	1.462000	0.47948	0.561000	0.74099	CGG	.	.	.	none		0.612	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963	
C1orf54	79630	hgsc.bcm.edu	37	1	150246488	150246488	+	Splice_Site	SNP	A	A	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr1:150246488A>G	ENST00000369102.1	+	4	816		c.e4-1		C1orf54_ENST00000369098.3_Splice_Site|C1orf54_ENST00000369099.3_Splice_Site			Q8WWF1	CA054_HUMAN	chromosome 1 open reading frame 54							extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTGTCCCCATAGGACAAGAAT	0.448																																					.		Atlas-SNP	.											.	C1orf54	20	.	0			c.47-2A>G						PASS	.						156.0	161.0	159.0					1																	150246488		2203	4300	6503	SO:0001630	splice_region_variant	79630	exon2			CCCCATAGGACAA	BC017761	CCDS948.1, CCDS72905.1	1q21.2	2012-06-25			ENSG00000118292	ENSG00000118292			26258	protein-coding gene	gene with protein product						12477932	Standard	NM_024579		Approved	FLJ23221	uc001eud.3	Q8WWF1	OTTHUMG00000012546	ENST00000369102.1:c.47-1A>G	chr1.hg19:g.150246488A>G		107.0	0.0	.		111.0	12.0	.	NM_024579	Q9H5P3	Splice_Site	SNP	ENST00000369102.1	hg19	CCDS948.1	.	.	.	.	.	.	.	.	.	.	A	16.54	3.151255	0.57151	.	.	ENSG00000118292	ENST00000369102;ENST00000369099;ENST00000369098	.	.	.	4.88	3.75	0.43078	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.3061	0.26449	0.901:0.0:0.099:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf54	148513112	0.973000	0.33851	0.962000	0.40283	0.976000	0.68499	2.557000	0.45871	0.991000	0.38814	0.523000	0.50628	.	.	.	.	none		0.448	C1orf54-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035055.1	NM_024579	Intron
DUSP27	92235	hgsc.bcm.edu	37	1	167097288	167097288	+	Missense_Mutation	SNP	A	A	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr1:167097288A>C	ENST00000361200.2	+	6	3086	c.2920A>C	c.(2920-2922)Aaa>Caa	p.K974Q	DUSP27_ENST00000443333.1_Missense_Mutation_p.K974Q|DUSP27_ENST00000271385.5_Missense_Mutation_p.K974Q|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	974	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GACAGAGTCTAAATCCTCCAG	0.507																																					p.K974Q		Atlas-SNP	.											.	DUSP27	235	.	0			c.A2920C						PASS	.						70.0	64.0	66.0					1																	167097288		2203	4300	6503	SO:0001583	missense	92235	exon5			GAGTCTAAATCCT	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2920A>C	chr1.hg19:g.167097288A>C	ENSP00000354483:p.Lys974Gln	128.0	0.0	.		146.0	10.0	.	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	hg19	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	A	10.28	1.307265	0.23821	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03386	3.95;3.95;3.95	4.9	3.75	0.43078	.	0.112170	0.40469	N	0.001100	T	0.01592	0.0051	L	0.57536	1.79	0.30368	N	0.783178	P	0.35077	0.483	B	0.33392	0.163	T	0.38845	-0.9642	10	0.66056	D	0.02	-29.7498	3.4315	0.07430	0.6859:0.0:0.3141:0.0	.	974	Q5VZP5	DUS27_HUMAN	Q	974	ENSP00000354483:K974Q;ENSP00000271385:K974Q;ENSP00000404874:K974Q	ENSP00000271385:K974Q	K	+	1	0	DUSP27	165363912	1.000000	0.71417	0.024000	0.17045	0.360000	0.29518	3.431000	0.52814	2.047000	0.60756	0.523000	0.50628	AAA	.	.	.	none		0.507	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
NRBP1	29959	hgsc.bcm.edu	37	2	27663700	27663700	+	Missense_Mutation	SNP	G	G	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr2:27663700G>C	ENST00000233557.3	+	15	2054	c.1222G>C	c.(1222-1224)Ggg>Cgg	p.G408R	KRTCAP3_ENST00000288873.3_5'Flank|KRTCAP3_ENST00000543753.1_5'Flank|NRBP1_ENST00000379863.3_Missense_Mutation_p.G416R|KRTCAP3_ENST00000407293.1_5'Flank|NRBP1_ENST00000379852.3_Missense_Mutation_p.G408R			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	408					ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					GACAGCCTTTGGGCTGCCTCG	0.602																																					p.G408R		Atlas-SNP	.											.	NRBP1	40	.	0			c.G1222C						PASS	.						61.0	66.0	64.0					2																	27663700		2203	4300	6503	SO:0001583	missense	29959	exon14			GCCTTTGGGCTGC	AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.1222G>C	chr2.hg19:g.27663700G>C	ENSP00000233557:p.Gly408Arg	60.0	0.0	.		56.0	9.0	.	NM_013392	B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	ENST00000233557.3	hg19	CCDS1753.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781434	0.90282	.	.	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863	T;T;T	0.28255	1.62;1.62;1.62	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	L	0.47716	1.5	0.80722	D	1	D;D;P	0.63046	0.992;0.964;0.901	P;P;P	0.61800	0.894;0.683;0.484	T	0.25984	-1.0116	10	0.51188	T	0.08	-20.4213	18.9284	0.92554	0.0:0.0:1.0:0.0	.	388;416;408	B4DW31;F8W6G1;Q9UHY1	.;.;NRBP_HUMAN	R	408;388;408;416	ENSP00000233557:G408R;ENSP00000369181:G408R;ENSP00000369192:G416R	ENSP00000233557:G408R	G	+	1	0	NRBP1	27517204	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.631000	0.98424	2.821000	0.97095	0.561000	0.74099	GGG	.	.	.	none		0.602	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1	NM_013392	
RANBP2	5903	hgsc.bcm.edu	37	2	109381490	109381490	+	Missense_Mutation	SNP	T	T	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr2:109381490T>C	ENST00000283195.6	+	20	4621	c.4495T>C	c.(4495-4497)Tgt>Cgt	p.C1499R		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1499					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTCTACAAAATGTGCTGCTTG	0.398																																					p.C1499R		Atlas-SNP	.											.	RANBP2	488	.	0			c.T4495C						PASS	.						76.0	75.0	76.0					2																	109381490		2203	4299	6502	SO:0001583	missense	5903	exon20			ACAAAATGTGCTG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.4495T>C	chr2.hg19:g.109381490T>C	ENSP00000283195:p.Cys1499Arg	84.0	0.0	.		84.0	12.0	.	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	hg19	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413745	0.42817	.	.	ENSG00000153201	ENST00000283195	D	0.99797	-6.79	5.24	5.24	0.73138	Zinc finger, RanBP2-type (4);	.	.	.	.	D	0.99843	0.9928	H	0.95780	3.72	0.52501	D	0.999951	D	0.76494	0.999	D	0.79108	0.992	D	0.96582	0.9431	9	0.87932	D	0	-15.2685	15.1468	0.72662	0.0:0.0:0.0:1.0	.	1499	P49792	RBP2_HUMAN	R	1499	ENSP00000283195:C1499R	ENSP00000283195:C1499R	C	+	1	0	RANBP2	108747922	1.000000	0.71417	0.980000	0.43619	0.686000	0.39977	5.855000	0.69510	1.975000	0.57531	0.533000	0.62120	TGT	.	.	.	none		0.398	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
WDR33	55339	hgsc.bcm.edu	37	2	128528415	128528415	+	Silent	SNP	T	T	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr2:128528415T>A	ENST00000322313.4	-	2	299	c.141A>T	c.(139-141)cgA>cgT	p.R47R	WDR33_ENST00000393006.1_Silent_p.R47R|WDR33_ENST00000409658.3_Silent_p.R47R	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	47					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CTTTTCTCATTCGTTTTCCAT	0.413																																					p.R47R		Atlas-SNP	.											.	WDR33	136	.	0			c.A141T						PASS	.						129.0	119.0	122.0					2																	128528415		2203	4300	6503	SO:0001819	synonymous_variant	55339	exon2			TCTCATTCGTTTT		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.141A>T	chr2.hg19:g.128528415T>A		141.0	0.0	.		135.0	14.0	.	NM_001006623	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Silent	SNP	ENST00000322313.4	hg19	CCDS2150.1																																																																																			.	.	.	none		0.413	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
TRAK2	66008	hgsc.bcm.edu	37	2	202265791	202265791	+	Missense_Mutation	SNP	T	T	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr2:202265791T>C	ENST00000332624.3	-	4	741	c.313A>G	c.(313-315)Atg>Gtg	p.M105V	TRAK2_ENST00000430254.1_Missense_Mutation_p.M105V	NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	105	HAP1 N-terminal.				protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						GTTTTGGTCATCTGCTCCACC	0.333																																					p.M105V		Atlas-SNP	.											.	TRAK2	62	.	0			c.A313G						PASS	.						163.0	145.0	151.0					2																	202265791		2203	4300	6503	SO:0001583	missense	66008	exon4			TGGTCATCTGCTC	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.313A>G	chr2.hg19:g.202265791T>C	ENSP00000328875:p.Met105Val	95.0	0.0	.		95.0	7.0	.	NM_015049	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Missense_Mutation	SNP	ENST00000332624.3	hg19	CCDS2347.1	.	.	.	.	.	.	.	.	.	.	T	13.26	2.184998	0.38609	.	.	ENSG00000115993	ENST00000332624;ENST00000542292;ENST00000430254	T;T	0.18338	2.22;2.22	5.86	5.86	0.93980	.	0.045004	0.85682	D	0.000000	T	0.12860	0.0312	L	0.38838	1.175	0.80722	D	1	B;B	0.17465	0.01;0.022	B;B	0.12837	0.008;0.008	T	0.12041	-1.0563	10	0.45353	T	0.12	.	5.759	0.18188	0.1499:0.0778:0.0:0.7723	.	105;105	E7EV21;O60296	.;TRAK2_HUMAN	V	105;11;105	ENSP00000328875:M105V;ENSP00000409333:M105V	ENSP00000328875:M105V	M	-	1	0	TRAK2	201974036	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.566000	0.53805	2.367000	0.80283	0.528000	0.53228	ATG	.	.	.	none		0.333	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049	
DUSP7	1849	hgsc.bcm.edu	37	3	52088120	52088120	+	Missense_Mutation	SNP	A	A	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr3:52088120A>G	ENST00000495880.1	-	2	971	c.788T>C	c.(787-789)cTg>cCg	p.L263P	DUSP7_ENST00000296483.6_Missense_Mutation_p.L212P			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	263					inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GAGCACGTCCAGGTTGGTGGA	0.592																																					p.L263P		Atlas-SNP	.											.	DUSP7	34	.	0			c.T788C						PASS	.						281.0	251.0	261.0					3																	52088120		2203	4300	6503	SO:0001583	missense	1849	exon2			ACGTCCAGGTTGG	X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.788T>C	chr3.hg19:g.52088120A>G	ENSP00000417183:p.Leu263Pro	122.0	0.0	.		163.0	18.0	.	NM_001947	Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	ENST00000495880.1	hg19	CCDS33766.2	.	.	.	.	.	.	.	.	.	.	A	25.8	4.671947	0.88348	.	.	ENSG00000164086	ENST00000495880;ENST00000296483;ENST00000469623	T;T;T	0.61742	0.08;0.08;0.08	5.42	5.42	0.78866	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.64402	D	0.000001	T	0.70762	0.3261	L	0.49126	1.545	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.79784	0.978;0.993	T	0.72887	-0.4156	10	0.59425	D	0.04	.	15.1265	0.72486	1.0:0.0:0.0:0.0	.	212;263	Q16829-2;Q16829	.;DUS7_HUMAN	P	263;212;196	ENSP00000417183:L263P;ENSP00000296483:L212P;ENSP00000418566:L196P	ENSP00000296483:L212P	L	-	2	0	DUSP7	52063160	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.260000	0.95568	2.044000	0.60594	0.448000	0.29417	CTG	.	.	.	none		0.592	DUSP7-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349697.1	NM_001947	
TMEM14E	645843	hgsc.bcm.edu	37	3	152058400	152058400	+	Silent	SNP	C	C	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr3:152058400C>T	ENST00000408960.3	-	1	379	c.294G>A	c.(292-294)ctG>ctA	p.L98L	MBNL1_ENST00000282486.6_Intron|MBNL1_ENST00000498502.1_Intron|MBNL1_ENST00000485910.1_Intron|MBNL1_ENST00000485509.1_Intron|MBNL1_ENST00000324196.5_Intron|MBNL1_ENST00000492948.1_Intron|MBNL1_ENST00000355460.2_Intron|MBNL1_ENST00000463374.1_Intron|MBNL1_ENST00000357472.3_Intron|MBNL1_ENST00000324210.5_Intron|MBNL1_ENST00000545754.1_Intron|MBNL1_ENST00000282488.7_Intron|MBNL1_ENST00000493459.1_Intron	NM_001123228.1	NP_001116700.1	Q6UXP3	TM14E_HUMAN	transmembrane protein 14E	98						integral component of membrane (GO:0016021)				lung(1)	1						TGGAAACTATCAGCAGGCACC	0.418																																					p.L98L		Atlas-SNP	.											.	TMEM14E	6	.	0			c.G294A						PASS	.						91.0	85.0	87.0					3																	152058400		1568	3582	5150	SO:0001819	synonymous_variant	645843	exon1			AACTATCAGCAGG		CCDS43161.1	3q25.1	2011-09-15			ENSG00000221962	ENSG00000221962			34386	protein-coding gene	gene with protein product							Standard	NM_001123228		Approved		uc010hvo.3	Q6UXP3	OTTHUMG00000159652	ENST00000408960.3:c.294G>A	chr3.hg19:g.152058400C>T		286.0	0.0	.		302.0	25.0	.	NM_001123228		Silent	SNP	ENST00000408960.3	hg19	CCDS43161.1																																																																																			.	.	.	none		0.418	TMEM14E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356703.1	NM_001123228	
DNAH5	1767	hgsc.bcm.edu	37	5	13917315	13917315	+	Missense_Mutation	SNP	C	C	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr5:13917315C>A	ENST00000265104.4	-	8	1130	c.1026G>T	c.(1024-1026)aaG>aaT	p.K342N		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	342	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCACATTGTCCTTTGCTTCAT	0.358									Kartagener syndrome																												p.K342N		Atlas-SNP	.											.	DNAH5	868	.	0			c.G1026T						PASS	.						161.0	136.0	144.0					5																	13917315		2203	4300	6503	SO:0001583	missense	1767	exon8	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	ATTGTCCTTTGCT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.1026G>T	chr5.hg19:g.13917315C>A	ENSP00000265104:p.Lys342Asn	68.0	0.0	.		66.0	5.0	.	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671367	0.67814	.	.	ENSG00000039139	ENST00000265104	T	0.56444	0.46	5.63	2.86	0.33363	Dynein heavy chain, domain-1 (1);	0.049678	0.85682	D	0.000000	T	0.73048	0.3537	M	0.91406	3.205	0.54753	D	0.999983	D	0.76494	0.999	D	0.83275	0.996	T	0.72673	-0.4222	10	0.62326	D	0.03	.	6.2795	0.20999	0.0:0.5504:0.0:0.4495	.	342	Q8TE73	DYH5_HUMAN	N	342	ENSP00000265104:K342N	ENSP00000265104:K342N	K	-	3	2	DNAH5	13970315	1.000000	0.71417	0.991000	0.47740	0.744000	0.42396	2.092000	0.41700	0.716000	0.32124	0.561000	0.74099	AAG	.	.	.	none		0.358	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
EGFLAM	133584	hgsc.bcm.edu	37	5	38370553	38370553	+	Missense_Mutation	SNP	T	T	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr5:38370553T>A	ENST00000354891.3	+	6	1047	c.701T>A	c.(700-702)aTc>aAc	p.I234N	EGFLAM_ENST00000322350.5_Missense_Mutation_p.I234N	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	234	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGTGACATCATCCGGACCCTC	0.572																																					p.I234N	Colon(62;485 1295 3347 17454)	Atlas-SNP	.											.	EGFLAM	302	.	0			c.T701A						PASS	.						37.0	37.0	37.0					5																	38370553		2203	4300	6503	SO:0001583	missense	133584	exon6			ACATCATCCGGAC	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.701T>A	chr5.hg19:g.38370553T>A	ENSP00000346964:p.Ile234Asn	36.0	0.0	.		39.0	7.0	.	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	hg19	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.167665	0.57476	.	.	ENSG00000164318	ENST00000354891;ENST00000322350	T;T	0.57273	0.57;0.41	5.82	3.44	0.39384	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.647983	0.16664	N	0.204679	T	0.67040	0.2851	M	0.85197	2.74	0.80722	D	1	P;P	0.48640	0.859;0.913	P;P	0.53722	0.545;0.733	T	0.67914	-0.5547	10	0.87932	D	0	-27.5021	9.7299	0.40355	0.0:0.1404:0.0:0.8596	.	234;234	Q63HQ2;Q63HQ2-2	EGFLA_HUMAN;.	N	234	ENSP00000346964:I234N;ENSP00000313084:I234N	ENSP00000313084:I234N	I	+	2	0	EGFLAM	38406310	0.999000	0.42202	0.002000	0.10522	0.634000	0.38068	7.066000	0.76734	0.481000	0.27557	0.459000	0.35465	ATC	.	.	.	none		0.572	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
MCUR1	63933	hgsc.bcm.edu	37	6	13814461	13814461	+	Silent	SNP	T	T	C	rs371767736	byFrequency	TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr6:13814461T>C	ENST00000379170.4	-	1	339	c.201A>G	c.(199-201)tcA>tcG	p.S67S	MCUR1_ENST00000359495.2_Silent_p.S67S	NM_001031713.3	NP_001026883.1	Q96AQ8	MCUR1_HUMAN	mitochondrial calcium uniporter regulator 1	67					calcium ion import (GO:0070509)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	integral component of mitochondrial inner membrane (GO:0031305)											GGAGCAGCGGTGAGGCACGTG	0.776													T|||	104	0.0207668	0.0	0.062	5008	,	,		7906	0.001		0.0308	False		,,,				2504	0.0297				p.S67S		Atlas-SNP	.											.	CCDC90A	15	.	0			c.A201G						PASS	.	T		3,2137		0,3,1067	2.0	3.0	2.0		201	-4.7	0.0	6		2	86,4212		0,86,2063	no	coding-synonymous	CCDC90A	NM_001031713.3		0,89,3130	CC,CT,TT		2.0009,0.1402,1.3824		67/360	13814461	89,6349	1070	2149	3219	SO:0001819	synonymous_variant	63933	exon1			CAGCGGTGAGGCA	BC016850	CCDS35495.1	6p23	2013-03-13	2013-03-13	2013-03-13	ENSG00000050393	ENSG00000050393			21097	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 79"", ""coiled-coil domain containing 90A"""	C6orf79, CCDC90A		23178883	Standard	NM_001031713		Approved	FLJ20958	uc003nbc.2	Q96AQ8	OTTHUMG00000014279	ENST00000379170.4:c.201A>G	chr6.hg19:g.13814461T>C		3.0	0.0	.		9.0	5.0	.	NM_001031713	Q96JS7|Q9H7F8	Silent	SNP	ENST00000379170.4	hg19	CCDS35495.1																																																																																			.	.	.	weak		0.776	MCUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039909.3	NM_022102	
SLC39A7	7922	hgsc.bcm.edu	37	6	33170059	33170059	+	Silent	SNP	T	T	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr6:33170059T>A	ENST00000374677.3	+	4	1027	c.654T>A	c.(652-654)tcT>tcA	p.S218S	SLC39A7_ENST00000463972.1_3'UTR|HSD17B8_ENST00000374662.3_5'Flank|RNY4P10_ENST00000365571.1_RNA|SLC39A7_ENST00000374675.3_Silent_p.S218S|RXRB_ENST00000374685.4_5'Flank|RXRB_ENST00000544186.1_5'Flank|RXRB_ENST00000413614.2_5'Flank|RXRB_ENST00000374680.3_5'Flank	NM_006979.2	NP_008910.2	Q92504	S39A7_HUMAN	solute carrier family 39 (zinc transporter), member 7	218					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						CCATTCTGTCTGTGGGACTGT	0.517																																					p.S218S		Atlas-SNP	.											.	SLC39A7	32	.	0			c.T654A						PASS	.						114.0	120.0	118.0					6																	33170059		1270	2569	3839	SO:0001819	synonymous_variant	7922	exon4			TCTGTCTGTGGGA	AF117221	CCDS43453.1	6p21.3	2014-01-28		2003-10-27	ENSG00000112473	ENSG00000112473		"""Solute carriers"""	4927	protein-coding gene	gene with protein product		601416	"""HLA class II region expressed gene KE4"""	HKE4		8812499, 1855816, 19246244, 15705588	Standard	NM_006979		Approved	H2-KE4, D6S2244E, KE4, RING5, ZIP7	uc003odf.3	Q92504	OTTHUMG00000031238	ENST00000374677.3:c.654T>A	chr6.hg19:g.33170059T>A		132.0	0.0	.		143.0	8.0	.	NM_006979	B0UXF6|Q5STP8|Q9UIQ0	Silent	SNP	ENST00000374677.3	hg19	CCDS43453.1																																																																																			.	.	.	none		0.517	SLC39A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076499.2	NM_006979	
GTPBP2	54676	hgsc.bcm.edu	37	6	43593600	43593600	+	Splice_Site	SNP	C	C	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr6:43593600C>A	ENST00000307126.5	-	4	399	c.400G>T	c.(400-402)Gtt>Ttt	p.V134F	GTPBP2_ENST00000307114.7_Splice_Site_p.V46F|GTPBP2_ENST00000476510.1_5'UTR	NM_019096.3	NP_061969.3			GTP binding protein 2											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			TCTGCCCCAACCCTGTCACAG	0.552																																					p.V134F	GBM(116;405 1620 28302 32150 44768)	Atlas-SNP	.											.	GTPBP2	39	.	0			c.G400T						PASS	.						136.0	113.0	121.0					6																	43593600		2203	4300	6503	SO:0001630	splice_region_variant	54676	exon4			CCCCAACCCTGTC	AB024574	CCDS4903.1, CCDS69124.1	6p21	2008-07-28			ENSG00000172432	ENSG00000172432			4670	protein-coding gene	gene with protein product		607434				10833435, 11054535	Standard	NM_019096		Approved		uc003ovs.3	Q9BX10	OTTHUMG00000014744	ENST00000307126.5:c.399-1G>T	chr6.hg19:g.43593600C>A		53.0	0.0	.		69.0	8.0	.	NM_019096		Missense_Mutation	SNP	ENST00000307126.5	hg19	CCDS4903.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.2|21.2	4.109076|4.109076	0.77096|0.77096	.|.	.|.	ENSG00000172432|ENSG00000172432	ENST00000442748|ENST00000307126;ENST00000307114;ENST00000452781	.|T;T;T	.|0.48836	.|1.39;1.42;0.8	4.78|4.78	4.78|4.78	0.61160|0.61160	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.43875|0.43875	0.1267|0.1267	M|M	0.73217|0.73217	2.22|2.22	0.58432|0.58432	D|D	0.999997|0.999997	.|P;P	.|0.49090	.|0.919;0.675	.|B;B	.|0.43623	.|0.425;0.176	T|T	0.55952|0.55952	-0.8059|-0.8059	5|10	.|0.72032	.|D	.|0.01	-12.0424|-12.0424	17.9977|17.9977	0.89189|0.89189	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|126;134	.|Q9BX10-4;Q9BX10	.|.;GTPB2_HUMAN	S|F	99|134;46;126	.|ENSP00000303997:V134F;ENSP00000304893:V46F;ENSP00000410676:V126F	.|ENSP00000304893:V46F	R|V	-|-	3|1	2|0	GTPBP2|GTPBP2	43701578|43701578	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.893000|0.893000	0.52053|0.52053	4.463000|4.463000	0.60128|0.60128	2.480000|2.480000	0.83734|0.83734	0.561000|0.561000	0.74099|0.74099	AGG|GTT	.	.	.	none		0.552	GTPBP2-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040679.1		Missense_Mutation
MEP1A	4224	hgsc.bcm.edu	37	6	46766863	46766863	+	Missense_Mutation	SNP	A	A	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr6:46766863A>T	ENST00000230588.4	+	5	216	c.207A>T	c.(205-207)agA>agT	p.R69S		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	69	Metalloprotease.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			ATGGCCTGAGAGACCCAAACA	0.423																																					p.R69S		Atlas-SNP	.											.	MEP1A	93	.	0			c.A207T						PASS	.						156.0	147.0	150.0					6																	46766863		2203	4300	6503	SO:0001583	missense	4224	exon5			CCTGAGAGACCCA		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.207A>T	chr6.hg19:g.46766863A>T	ENSP00000230588:p.Arg69Ser	136.0	0.0	.		159.0	20.0	.	NM_005588	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	ENST00000230588.4	hg19	CCDS4918.1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.443835	0.63067	.	.	ENSG00000112818	ENST00000230588	T	0.25579	1.79	5.77	4.62	0.57501	Metallopeptidase, catalytic domain (1);	0.103697	0.64402	D	0.000003	T	0.24353	0.0590	L	0.61218	1.895	0.38384	D	0.945216	D;D	0.69078	0.995;0.997	P;P	0.58721	0.844;0.824	T	0.06899	-1.0801	10	0.27082	T	0.32	-20.7669	8.3767	0.32447	0.9122:0.0:0.0878:0.0	.	97;69	B7ZL91;Q16819	.;MEP1A_HUMAN	S	69	ENSP00000230588:R69S	ENSP00000230588:R69S	R	+	3	2	MEP1A	46874822	1.000000	0.71417	1.000000	0.80357	0.337000	0.28794	1.001000	0.29783	1.039000	0.40074	0.528000	0.53228	AGA	.	.	.	none		0.423	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588	
HEATR2	54919	hgsc.bcm.edu	37	7	780577	780577	+	Missense_Mutation	SNP	T	T	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr7:780577T>A	ENST00000297440.6	+	3	922	c.902T>A	c.(901-903)gTc>gAc	p.V301D	HEATR2_ENST00000438961.1_3'UTR|HEATR2_ENST00000313147.5_Missense_Mutation_p.V301D	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	301						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		GTGCCTGAGGTCAGGTACGTG	0.592																																					p.V301D		Atlas-SNP	.											.	HEATR2	62	.	0			c.T902A						PASS	.						117.0	99.0	105.0					7																	780577		2203	4300	6503	SO:0001583	missense	54919	exon3			CTGAGGTCAGGTA	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.902T>A	chr7.hg19:g.780577T>A	ENSP00000297440:p.Val301Asp	29.0	0.0	.		47.0	8.0	.	NM_017802	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	ENST00000297440.6	hg19	CCDS34580.1	.	.	.	.	.	.	.	.	.	.	T	13.42	2.230973	0.39399	.	.	ENSG00000164818	ENST00000297440;ENST00000313147;ENST00000537862	T;T	0.68025	-0.3;-0.3	4.66	2.28	0.28536	Armadillo-like helical (1);Armadillo-type fold (1);	0.866751	0.09639	N	0.775197	T	0.62073	0.2398	M	0.61703	1.905	0.19945	N	0.999944	P;P	0.39920	0.695;0.478	B;B	0.40199	0.322;0.154	T	0.55186	-0.8180	10	0.87932	D	0	-13.8309	4.2822	0.10838	0.1838:0.1694:0.0:0.6468	.	301;47	Q86Y56;F5H8D4	HEAT2_HUMAN;.	D	301;301;47	ENSP00000297440:V301D;ENSP00000321451:V301D	ENSP00000297440:V301D	V	+	2	0	HEATR2	747103	0.981000	0.34729	0.003000	0.11579	0.034000	0.12701	4.207000	0.58480	0.261000	0.21753	0.528000	0.53228	GTC	.	.	.	none		0.592	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802	
PDE1C	5137	hgsc.bcm.edu	37	7	31862810	31862810	+	Missense_Mutation	SNP	C	C	A	rs372917246		TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr7:31862810C>A	ENST00000396191.1	-	14	1914	c.1459G>T	c.(1459-1461)Ggt>Tgt	p.G487C	PDE1C_ENST00000396182.2_Missense_Mutation_p.G487C|PDE1C_ENST00000321453.7_Missense_Mutation_p.G487C|PDE1C_ENST00000396193.1_Missense_Mutation_p.G547C|PDE1C_ENST00000396184.3_Missense_Mutation_p.G487C|PDE1C_ENST00000479980.1_5'Flank	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	487	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	CCCTCTGAACCAGAGGTCTTG	0.443																																					p.G547C		Atlas-SNP	.											.	PDE1C	465	.	0			c.G1639T						PASS	.						106.0	96.0	99.0					7																	31862810		2203	4300	6503	SO:0001583	missense	5137	exon15			CTGAACCAGAGGT	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1459G>T	chr7.hg19:g.31862810C>A	ENSP00000379494:p.Gly487Cys	108.0	0.0	.		121.0	28.0	.	NM_001191058	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	hg19	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.809335	0.90707	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.68;-0.68	5.91	5.91	0.95273	.	0.634852	0.16753	N	0.200964	T	0.78910	0.4358	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.73380	0.927;0.912;0.98	T	0.79507	-0.1775	10	0.72032	D	0.01	.	19.9003	0.96983	0.0:1.0:0.0:0.0	.	487;547;487	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	C	547;487;487;487;487	ENSP00000379496:G547C;ENSP00000379494:G487C;ENSP00000318105:G487C;ENSP00000379487:G487C;ENSP00000379485:G487C	ENSP00000318105:G487C	G	-	1	0	PDE1C	31829335	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.060000	0.76692	2.808000	0.96608	0.655000	0.94253	GGT	.	.	.	alt		0.443	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
PTPRZ1	5803	hgsc.bcm.edu	37	7	121682687	121682687	+	Missense_Mutation	SNP	T	T	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr7:121682687T>G	ENST00000393386.2	+	22	6238	c.5827T>G	c.(5827-5829)Tat>Gat	p.Y1943D	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.Y1076D	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1943	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AACAGGCACATATATTGTGCT	0.338																																					p.Y1943D		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.T5827G						PASS	.						121.0	99.0	107.0					7																	121682687		2203	4300	6503	SO:0001583	missense	5803	exon22			GGCACATATATTG	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5827T>G	chr7.hg19:g.121682687T>G	ENSP00000377047:p.Tyr1943Asp	166.0	0.0	.		183.0	26.0	.	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	hg19	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.068493	0.76301	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.14516	2.5;2.5	5.86	5.86	0.93980	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	D	0.000006	T	0.50599	0.1625	H	0.95004	3.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.65240	-0.6216	10	0.87932	D	0	.	16.2644	0.82568	0.0:0.0:0.0:1.0	.	1082;1076;1943	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	D	1943;1076	ENSP00000377047:Y1943D;ENSP00000410000:Y1076D	ENSP00000377047:Y1943D	Y	+	1	0	PTPRZ1	121469923	1.000000	0.71417	0.179000	0.23059	0.735000	0.41995	8.040000	0.89188	2.244000	0.73946	0.528000	0.53228	TAT	.	.	.	none		0.338	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
KAT6A	7994	hgsc.bcm.edu	37	8	41790172	41790172	+	Missense_Mutation	SNP	A	A	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr8:41790172A>G	ENST00000396930.3	-	18	6109	c.5566T>C	c.(5566-5568)Tcc>Ccc	p.S1856P	KAT6A_ENST00000406337.1_Missense_Mutation_p.S1856P|KAT6A_ENST00000265713.2_Missense_Mutation_p.S1856P	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1856					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GAGCGGATGGAAATGTGCCCC	0.592																																					p.S1856P		Atlas-SNP	.											.	.	.	.	0			c.T5566C						PASS	.						118.0	80.0	93.0					8																	41790172		2203	4300	6503	SO:0001583	missense	7994	exon18			GGATGGAAATGTG	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.5566T>C	chr8.hg19:g.41790172A>G	ENSP00000380136:p.Ser1856Pro	75.0	0.0	.		85.0	10.0	.	NM_001099412	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	hg19	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	A	8.585	0.883157	0.17467	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.67865	-0.29;-0.29;-0.29	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000001	T	0.69459	0.3113	L	0.27053	0.805	0.43994	D	0.996696	D	0.69078	0.997	P	0.60789	0.879	T	0.69731	-0.5066	10	0.38643	T	0.18	-11.9288	15.9132	0.79488	1.0:0.0:0.0:0.0	.	1856	Q92794	KAT6A_HUMAN	P	1856	ENSP00000265713:S1856P;ENSP00000385888:S1856P;ENSP00000380136:S1856P	ENSP00000265713:S1856P	S	-	1	0	KAT6A	41909329	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.712000	0.54875	2.148000	0.66965	0.533000	0.62120	TCC	.	.	.	none		0.592	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
SLC30A8	169026	hgsc.bcm.edu	37	8	118169968	118169968	+	Missense_Mutation	SNP	G	G	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr8:118169968G>A	ENST00000456015.2	+	4	457	c.457G>A	c.(457-459)Gtg>Atg	p.V153M	SLC30A8_ENST00000519688.1_Missense_Mutation_p.V104M|SLC30A8_ENST00000521243.1_Missense_Mutation_p.V104M|SLC30A8_ENST00000427715.2_Missense_Mutation_p.V104M	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	153					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			GTGCATCTGGGTGGTGACTGG	0.527																																					p.V153M	Ovarian(162;1202 1922 6011 16223 52092)	Atlas-SNP	.											.	SLC30A8	102	.	0			c.G457A						PASS	.						321.0	285.0	298.0					8																	118169968		2203	4300	6503	SO:0001583	missense	169026	exon4			ATCTGGGTGGTGA		CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.457G>A	chr8.hg19:g.118169968G>A	ENSP00000415011:p.Val153Met	144.0	0.0	.		112.0	14.0	.	NM_173851	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	ENST00000456015.2	hg19	CCDS6322.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059889	0.36373	.	.	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.77	1.77	0.24775	.	0.454505	0.23945	N	0.043018	T	0.61248	0.2332	M	0.66439	2.03	0.43756	D	0.996263	B	0.26845	0.161	B	0.37731	0.257	T	0.52939	-0.8508	10	0.35671	T	0.21	-0.9189	8.5281	0.33317	0.1502:0.5085:0.3413:0.0	.	153	Q8IWU4	ZNT8_HUMAN	M	104;104;104;153	ENSP00000428545:V104M;ENSP00000407505:V104M;ENSP00000431069:V104M;ENSP00000415011:V153M	ENSP00000407505:V104M	V	+	1	0	SLC30A8	118239149	0.999000	0.42202	0.988000	0.46212	0.836000	0.47400	0.543000	0.23237	0.034000	0.15491	0.655000	0.94253	GTG	.	.	.	none		0.527	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	NM_173851	
ALDOB	229	hgsc.bcm.edu	37	9	104187287	104187287	+	Silent	SNP	A	A	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr9:104187287A>G	ENST00000374855.4	-	8	961	c.837T>C	c.(835-837)gaT>gaC	p.D279D	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	279					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				TGAGAGTGGCATCCTCTTCAC	0.498																																					p.D279D		Atlas-SNP	.											.	ALDOB	69	.	0			c.T837C						PASS	.						88.0	82.0	84.0					9																	104187287		2203	4300	6503	SO:0001819	synonymous_variant	229	exon8			AGTGGCATCCTCT	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.837T>C	chr9.hg19:g.104187287A>G		130.0	0.0	.		136.0	10.0	.	NM_000035	Q13741|Q13742|Q5T7D6	Silent	SNP	ENST00000374855.4	hg19	CCDS6756.1																																																																																			.	.	.	none		0.498	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2		
NUP188	23511	hgsc.bcm.edu	37	9	131761490	131761490	+	Silent	SNP	G	G	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr9:131761490G>T	ENST00000372577.2	+	33	3576	c.3555G>T	c.(3553-3555)acG>acT	p.T1185T		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1185					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GACCCTTGACGGAGATCCTGG	0.522											OREG0003925	type=REGULATORY REGION|Gene=AK025292|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T1185T		Atlas-SNP	.											.	NUP188	140	.	0			c.G3555T						PASS	.						90.0	81.0	84.0					9																	131761490		2203	4300	6503	SO:0001819	synonymous_variant	23511	exon33			CTTGACGGAGATC	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.3555G>T	chr9.hg19:g.131761490G>T		75.0	0.0	.	1590	82.0	4.0	.	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Silent	SNP	ENST00000372577.2	hg19	CCDS35156.1																																																																																			.	.	.	none		0.522	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
RXRA	6256	hgsc.bcm.edu	37	9	137313579	137313579	+	Missense_Mutation	SNP	G	G	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr9:137313579G>A	ENST00000481739.1	+	6	890	c.838G>A	c.(838-840)Gtg>Atg	p.V280M	RXRA_ENST00000540193.1_Missense_Mutation_p.V183M|RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	280	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	TTTCACCCTGGTGGAGTGGGC	0.607																																					p.V280M		Atlas-SNP	.											.	RXRA	52	.	0			c.G838A						PASS	.						168.0	141.0	150.0					9																	137313579		2203	4300	6503	SO:0001583	missense	6256	exon6			ACCCTGGTGGAGT	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.838G>A	chr9.hg19:g.137313579G>A	ENSP00000419692:p.Val280Met	80.0	0.0	.		70.0	7.0	.	NM_002957	B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	ENST00000481739.1	hg19	CCDS35172.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.543798	0.86022	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.97455	-4.39;-4.39	4.51	4.51	0.55191	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.060613	0.64402	D	0.000004	D	0.98324	0.9444	M	0.91510	3.215	0.80722	D	1	P;D	0.54964	0.872;0.969	P;P	0.54965	0.541;0.765	D	0.99744	1.1016	10	0.87932	D	0	.	17.2581	0.87063	0.0:0.0:1.0:0.0	.	183;280	B3KY83;P19793	.;RXRA_HUMAN	M	280;183	ENSP00000419692:V280M;ENSP00000442123:V183M	ENSP00000419692:V280M	V	+	1	0	RXRA	136453400	1.000000	0.71417	0.973000	0.42090	0.868000	0.49771	9.335000	0.96500	2.055000	0.61198	0.485000	0.47835	GTG	.	.	.	none		0.607	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	NM_002957	
ZFAND4	93550	hgsc.bcm.edu	37	10	46113699	46113699	+	Missense_Mutation	SNP	G	G	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr10:46113699G>C	ENST00000344646.5	-	9	2152	c.1937C>G	c.(1936-1938)aCt>aGt	p.T646S	ZFAND4_ENST00000374371.2_Nonsense_Mutation_p.Y193*|ZFAND4_ENST00000374366.3_Missense_Mutation_p.T572S|ZFAND4_ENST00000374370.1_5'UTR	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	646							zinc ion binding (GO:0008270)										GTGATGAGTAGTACATTCTCC	0.368																																					p.T646S		Atlas-SNP	.											.	.	.	.	0			c.C1937G						PASS	.						89.0	89.0	89.0					10																	46113699		2203	4300	6503	SO:0001583	missense	93550	exon9			TGAGTAGTACATT	AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.1937C>G	chr10.hg19:g.46113699G>C	ENSP00000339484:p.Thr646Ser	81.0	0.0	.		78.0	12.0	.	NM_001128324	A8K8V4|B2RAX2|Q5VVY5	Missense_Mutation	SNP	ENST00000344646.5	hg19	CCDS7214.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.673531|6.673531	0.97751|0.97751	.|.	.|.	ENSG00000172671|ENSG00000172671	ENST00000344646;ENST00000374366;ENST00000374370|ENST00000374371;ENST00000374376	T;T|.	0.23950|.	1.88;1.88|.	5.99|5.99	1.9|1.9	0.25705|0.25705	Zinc finger, AN1-type (1);|.	0.810801|.	0.10951|.	N|.	0.616052|.	T|.	0.20700|.	0.0498|.	N|N	0.16656|0.16656	0.425|0.425	0.09310|0.09310	N|N	1|1	B|.	0.15473|.	0.013|.	B|.	0.10450|.	0.005|.	T|.	0.24977|.	-1.0145|.	10|.	0.21014|0.25751	T|T	0.42|0.34	.|.	5.5692|5.5692	0.17187|0.17187	0.0692:0.1228:0.5544:0.2537|0.0692:0.1228:0.5544:0.2537	.|.	646|.	Q86XD8|.	ANUB1_HUMAN|.	S|X	646;572;528|193	ENSP00000339484:T646S;ENSP00000363486:T572S|.	ENSP00000339484:T646S|ENSP00000363491:Y193X	T|Y	-|-	2|3	0|2	ANUBL1|ANUBL1	45433705|45433705	0.848000|0.848000	0.29623|0.29623	0.018000|0.018000	0.16275|0.16275	0.998000|0.998000	0.95712|0.95712	0.364000|0.364000	0.20325|0.20325	0.091000|0.091000	0.17302|0.17302	0.655000|0.655000	0.94253|0.94253	ACT|TAC	.	.	.	none		0.368	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047790.1	NM_174890	
ARHGAP22	58504	hgsc.bcm.edu	37	10	49663122	49663122	+	Missense_Mutation	SNP	G	G	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr10:49663122G>A	ENST00000249601.4	-	6	1011	c.715C>T	c.(715-717)Ccc>Tcc	p.P239S	ARHGAP22_ENST00000374172.1_Missense_Mutation_p.P130S|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.P245S|ARHGAP22_ENST00000374170.1_Intron|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.P255S|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.P149S	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	239	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						ACGGGCTCGGGGAGCTCCCGC	0.662																																					p.P255S		Atlas-SNP	.											ARHGAP22_ENST00000417912,NS,malignant_melanoma,0,2	ARHGAP22	94	.	0			c.C763T						PASS	.						40.0	34.0	36.0					10																	49663122		2202	4300	6502	SO:0001583	missense	58504	exon6			GCTCGGGGAGCTC	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.715C>T	chr10.hg19:g.49663122G>A	ENSP00000249601:p.Pro239Ser	47.0	0.0	.		70.0	8.0	.	NM_001256024	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	hg19	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.938685	0.92526	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T	0.58358	2.26;0.34;2.26;2.26;0.34	4.85	4.85	0.62838	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.75838	0.3904	M	0.85099	2.735	0.80722	D	1	D;D;D;D;D	0.89917	0.995;0.988;1.0;0.988;0.994	D;D;D;D;D	0.87578	0.98;0.954;0.998;0.954;0.966	T	0.80837	-0.1204	10	0.72032	D	0.01	.	16.9763	0.86314	0.0:0.0:1.0:0.0	.	245;239;255;239;149	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3	.;.;.;RHG22_HUMAN;.	S	239;130;149;245;255	ENSP00000249601:P239S;ENSP00000363287:P130S;ENSP00000410054:P149S;ENSP00000416701:P245S;ENSP00000412461:P255S	ENSP00000249601:P239S	P	-	1	0	ARHGAP22	49333128	1.000000	0.71417	0.827000	0.32855	0.943000	0.58893	9.747000	0.98863	2.246000	0.74042	0.561000	0.74099	CCC	.	.	.	none		0.662	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
PIDD1	55367	hgsc.bcm.edu	37	11	801990	801990	+	Missense_Mutation	SNP	G	G	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr11:801990G>C	ENST00000347755.5	-	7	1418	c.1277C>G	c.(1276-1278)aCc>aGc	p.T426S	PIDD_ENST00000534649.1_5'Flank|PIDD_ENST00000411829.2_Missense_Mutation_p.T426S	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					CTCCAGGTAGGTCTCCAGGTC	0.682																																					p.T426S		Atlas-SNP	.											PIDD_ENST00000347755,NS,carcinoma,0,1	PIDD	76	.	0			c.C1277G						PASS	.						30.0	28.0	28.0					11																	801990		2197	4293	6490	SO:0001583	missense	55367	exon7			AGGTAGGTCTCCA																												ENST00000347755.5:c.1277C>G	chr11.hg19:g.801990G>C	ENSP00000337797:p.Thr426Ser	63.0	0.0	.		79.0	6.0	.	NM_145887		Missense_Mutation	SNP	ENST00000347755.5	hg19	CCDS7716.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622155	0.46840	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.47869	0.94;0.83	4.03	3.06	0.35304	.	0.079208	0.49305	U	0.000151	T	0.50854	0.1640	L	0.29908	0.895	0.31516	N	0.662958	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.994;0.997	T	0.47086	-0.9144	10	0.12766	T	0.61	.	12.7861	0.57507	0.0:0.1651:0.8349:0.0	.	426;280;426	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	S	426	ENSP00000416801:T426S;ENSP00000337797:T426S	ENSP00000337797:T426S	T	-	2	0	PIDD	791990	0.997000	0.39634	0.994000	0.49952	0.123000	0.20343	3.663000	0.54518	2.084000	0.62774	0.462000	0.41574	ACC	.	.	.	none		0.682	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257103.1		
OR56A4	120793	hgsc.bcm.edu	37	11	6023641	6023641	+	Silent	SNP	G	G	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr11:6023641G>A	ENST00000330728.4	-	1	783	c.738C>T	c.(736-738)gaC>gaT	p.D246D		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGAAAGTGATGTCATCACAAG	0.428																																					p.D246D		Atlas-SNP	.											.	OR56A4	66	.	0			c.C738T						PASS	.						51.0	50.0	51.0					11																	6023641		2201	4296	6497	SO:0001819	synonymous_variant	120793	exon1			AGTGATGTCATCA	BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.738C>T	chr11.hg19:g.6023641G>A		136.0	0.0	.		114.0	11.0	.	NM_001005179	B9EH17	Silent	SNP	ENST00000330728.4	hg19	CCDS31404.1																																																																																			.	.	.	none		0.428	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383756.2	NM_001005179	
TTC17	55761	hgsc.bcm.edu	37	11	43465612	43465612	+	Missense_Mutation	SNP	T	T	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr11:43465612T>C	ENST00000039989.4	+	18	2532	c.2518T>C	c.(2518-2520)Ttc>Ctc	p.F840L	TTC17_ENST00000526774.1_3'UTR|TTC17_ENST00000299240.6_Missense_Mutation_p.F897L	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	840					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CCAGATTACATTCCAGGTCAA	0.373																																					p.F840L		Atlas-SNP	.											.	TTC17	112	.	0			c.T2518C						PASS	.						79.0	78.0	78.0					11																	43465612		2203	4300	6503	SO:0001583	missense	55761	exon18			ATTACATTCCAGG	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2518T>C	chr11.hg19:g.43465612T>C	ENSP00000039989:p.Phe840Leu	234.0	0.0	.		262.0	31.0	.	NM_018259	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	hg19	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.032954	0.93575	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.46819	0.86;1.13	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.55401	0.1918	L	0.32530	0.975	0.58432	D	0.999996	D;D;D	0.71674	0.996;0.997;0.998	P;D;D	0.70716	0.817;0.97;0.911	T	0.48692	-0.9013	10	0.19147	T	0.46	-17.1985	14.9183	0.70815	0.0:0.0:0.0:1.0	.	897;840;897	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	L	897;840	ENSP00000299240:F897L;ENSP00000039989:F840L	ENSP00000039989:F840L	F	+	1	0	TTC17	43422188	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.394000	0.73223	2.266000	0.75297	0.454000	0.30748	TTC	.	.	.	none		0.373	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
PRCP	5547	hgsc.bcm.edu	37	11	82535970	82535970	+	Missense_Mutation	SNP	T	T	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr11:82535970T>A	ENST00000313010.3	-	9	1663	c.1469A>T	c.(1468-1470)gAc>gTc	p.D490V	PRCP_ENST00000535099.1_Missense_Mutation_p.D385V|PRCP_ENST00000393399.2_Missense_Mutation_p.D511V|PRCP_ENST00000525772.1_5'Flank	NM_005040.2	NP_005031.1	P42785	PCP_HUMAN	prolylcarboxypeptidase (angiotensinase C)	490					angiogenesis involved in wound healing (GO:0060055)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|energy homeostasis (GO:0097009)|glucose homeostasis (GO:0042593)|negative regulation of systemic arterial blood pressure (GO:0003085)|plasma kallikrein-kinin cascade (GO:0002353)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						TCCCGCACTGTCATAGAAATC	0.403																																					p.D511V		Atlas-SNP	.											.	PRCP	69	.	0			c.A1532T						PASS	.						65.0	63.0	64.0					11																	82535970		2203	4300	6503	SO:0001583	missense	5547	exon10			GCACTGTCATAGA	BC001500, BI827978, L13977	CCDS8262.1, CCDS41695.1	11q14	2005-10-04				ENSG00000137509			9344	protein-coding gene	gene with protein product		176785				8344943	Standard	NM_199418		Approved	PCP, HUMPCP	uc001ozr.3	P42785		ENST00000313010.3:c.1469A>T	chr11.hg19:g.82535970T>A	ENSP00000317362:p.Asp490Val	94.0	0.0	.		88.0	6.0	.	NM_199418	A8MU24|B2R7B7|B3KRK5|B5BU34	Missense_Mutation	SNP	ENST00000313010.3	hg19	CCDS8262.1	.	.	.	.	.	.	.	.	.	.	T	8.923	0.961442	0.18583	.	.	ENSG00000137509	ENST00000313010;ENST00000393399;ENST00000535099	T;T;T	0.23552	2.48;2.47;1.9	5.25	-5.04	0.02964	.	2.033150	0.01986	N	0.045194	T	0.08088	0.0202	N	0.02539	-0.55	0.09310	N	1	B;B	0.23249	0.082;0.045	B;B	0.19148	0.017;0.024	T	0.14559	-1.0468	9	.	.	.	5.135	2.3732	0.04336	0.1764:0.4213:0.1508:0.2516	.	490;511	P42785;A8MU24	PCP_HUMAN;.	V	490;511;385	ENSP00000317362:D490V;ENSP00000377055:D511V;ENSP00000442077:D385V	.	D	-	2	0	PRCP	82213618	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-1.032000	0.03574	-0.462000	0.06984	0.383000	0.25322	GAC	.	.	.	none		0.403	PRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391792.1	NM_005040	
FAT3	120114	hgsc.bcm.edu	37	11	92615968	92615968	+	Missense_Mutation	SNP	G	G	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr11:92615968G>T	ENST00000298047.6	+	23	12363	c.12346G>T	c.(12346-12348)Gtg>Ttg	p.V4116L	FAT3_ENST00000409404.2_Missense_Mutation_p.V4116L|FAT3_ENST00000533797.1_Missense_Mutation_p.V451L|FAT3_ENST00000525166.1_Missense_Mutation_p.V3966L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4116	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTGCGTGAACGTGTTCGGCTC	0.632										TCGA Ovarian(4;0.039)																											p.V4116L		Atlas-SNP	.											.	FAT3	1822	.	0			c.G12346T						PASS	.						68.0	91.0	83.0					11																	92615968		2153	4240	6393	SO:0001583	missense	120114	exon23			GTGAACGTGTTCG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12346G>T	chr11.hg19:g.92615968G>T	ENSP00000298047:p.Val4116Leu	89.0	0.0	.		96.0	4.0	.	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	G	15.96	2.986927	0.53934	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;D	0.91631	-1.36;-1.36;-1.36;-2.88	5.37	-3.0	0.05480	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.78400	0.4277	N	0.05608	-0.01	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.003;0.004	T	0.56631	-0.7947	9	0.26408	T	0.33	.	6.8066	0.23780	0.3084:0.3052:0.3864:0.0	.	4116;4116	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	L	4116;4116;3966;451	ENSP00000298047:V4116L;ENSP00000387040:V4116L;ENSP00000432586:V3966L;ENSP00000436399:V451L	ENSP00000298047:V4116L	V	+	1	0	FAT3	92255616	0.989000	0.36119	0.862000	0.33874	0.992000	0.81027	0.389000	0.20751	-0.491000	0.06697	0.655000	0.94253	GTG	.	.	.	none		0.632	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
KIAA1731	85459	hgsc.bcm.edu	37	11	93432956	93432956	+	Silent	SNP	A	A	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr11:93432956A>G	ENST00000325212.6	+	15	5040	c.4878A>G	c.(4876-4878)ttA>ttG	p.L1626L	KIAA1731_ENST00000411936.1_Silent_p.L1626L|KIAA1731_ENST00000531700.1_Intron|KIAA1731_ENST00000344196.4_5'UTR			Q9C0D2	K1731_HUMAN	KIAA1731	1626						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AACTGTCTTTAAACAAACAAA	0.393																																					p.L1626L		Atlas-SNP	.											.	KIAA1731	173	.	0			c.A4878G						PASS	.						56.0	47.0	50.0					11																	93432956		692	1591	2283	SO:0001819	synonymous_variant	85459	exon15			GTCTTTAAACAAA	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.4878A>G	chr11.hg19:g.93432956A>G		133.0	0.0	.		121.0	12.0	.	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Silent	SNP	ENST00000325212.6	hg19	CCDS44708.1																																																																																			.	.	.	none		0.393	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
AMOTL1	154810	hgsc.bcm.edu	37	11	94583286	94583286	+	Missense_Mutation	SNP	A	A	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr11:94583286A>C	ENST00000433060.2	+	7	1797	c.1656A>C	c.(1654-1656)gaA>gaC	p.E552D	AMOTL1_ENST00000317829.8_Missense_Mutation_p.E502D|AMOTL1_ENST00000317837.9_Intron	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	552					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				TAGACAAAGAATTCTTGAAGG	0.458																																					p.E552D		Atlas-SNP	.											.	AMOTL1	95	.	0			c.A1656C						PASS	.						26.0	29.0	28.0					11																	94583286		1946	4149	6095	SO:0001583	missense	154810	exon7			CAAAGAATTCTTG	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.1656A>C	chr11.hg19:g.94583286A>C	ENSP00000387739:p.Glu552Asp	99.0	0.0	.		105.0	5.0	.	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	hg19	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.044077	0.75732	.	.	ENSG00000166025	ENST00000317829;ENST00000542840;ENST00000433060	T;T	0.24723	1.84;1.84	5.82	0.784	0.18578	.	0.000000	0.85682	D	0.000000	T	0.42585	0.1209	M	0.67625	2.065	0.80722	D	1	P;P	0.50710	0.938;0.887	D;P	0.66716	0.946;0.748	T	0.17961	-1.0352	10	0.52906	T	0.07	-23.6644	9.5207	0.39133	0.4586:0.0:0.5414:0.0	.	502;552	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	D	502;558;552	ENSP00000320968:E502D;ENSP00000387739:E552D	ENSP00000320968:E502D	E	+	3	2	AMOTL1	94222934	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	1.082000	0.30803	0.127000	0.18452	0.533000	0.62120	GAA	.	.	.	none		0.458	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
VSIG2	23584	hgsc.bcm.edu	37	11	124620639	124620639	+	Missense_Mutation	SNP	C	C	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr11:124620639C>T	ENST00000326621.5	-	3	498	c.398G>A	c.(397-399)gGg>gAg	p.G133E	VSIG2_ENST00000403470.1_Missense_Mutation_p.G133E	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	133	Ig-like V-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		TAGCCCCAACCCATTGGTGTA	0.527																																					p.G133E		Atlas-SNP	.											.	VSIG2	38	.	0			c.G398A						PASS	.						118.0	101.0	107.0					11																	124620639		2201	4299	6500	SO:0001583	missense	23584	exon3			CCCAACCCATTGG	AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.398G>A	chr11.hg19:g.124620639C>T	ENSP00000318684:p.Gly133Glu	81.0	0.0	.		97.0	10.0	.	NM_014312	O95791|Q9NX42	Missense_Mutation	SNP	ENST00000326621.5	hg19	CCDS8452.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270140	0.80469	.	.	ENSG00000019102	ENST00000326621;ENST00000403470	T;T	0.69435	-0.4;-0.4	5.08	5.08	0.68730	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000006	T	0.72763	0.3501	L	0.31578	0.945	0.42787	D	0.993885	D	0.89917	1.0	D	0.97110	1.0	T	0.73487	-0.3967	10	0.46703	T	0.11	.	15.5135	0.75802	0.0:1.0:0.0:0.0	.	133	Q96IQ7	VSIG2_HUMAN	E	133	ENSP00000318684:G133E;ENSP00000385013:G133E	ENSP00000318684:G133E	G	-	2	0	VSIG2	124125849	0.993000	0.37304	0.991000	0.47740	0.996000	0.88848	4.302000	0.59092	2.640000	0.89533	0.655000	0.94253	GGG	.	.	.	none		0.527	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317785.1	NM_014312	
GPR162	27239	hgsc.bcm.edu	37	12	6933876	6933876	+	Missense_Mutation	SNP	A	A	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr12:6933876A>C	ENST00000311268.3	+	2	1599	c.812A>C	c.(811-813)aAc>aCc	p.N271T	GPR162_ENST00000382315.3_Intron|GPR162_ENST00000428545.2_Intron	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						CAGGTCACCAACTTGGTCAGC	0.597																																					p.N271T		Atlas-SNP	.											.	GPR162	55	.	0			c.A812C						PASS	.						66.0	65.0	65.0					12																	6933876		2203	4300	6503	SO:0001583	missense	27239	exon2			TCACCAACTTGGT	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.812A>C	chr12.hg19:g.6933876A>C	ENSP00000311528:p.Asn271Thr	49.0	0.0	.		64.0	8.0	.	NM_019858	Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	ENST00000311268.3	hg19	CCDS8563.1	.	.	.	.	.	.	.	.	.	.	A	17.64	3.439584	0.63067	.	.	ENSG00000250510	ENST00000311268	T	0.36340	1.26	4.63	4.63	0.57726	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.34658	0.0905	N	0.19112	0.55	0.80722	D	1	D;D	0.63880	0.993;0.982	P;P	0.57846	0.828;0.762	T	0.05852	-1.0860	9	0.29301	T	0.29	.	8.8275	0.35063	0.9156:0.0:0.0844:0.0	.	271;271	B7Z3U3;Q16538	.;GP162_HUMAN	T	271	ENSP00000311528:N271T	ENSP00000311528:N271T	N	+	2	0	GPR162	6804137	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.379000	0.79691	1.946000	0.56461	0.402000	0.26972	AAC	.	.	.	none		0.597	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	NM_019858	
TOX4	9878	hgsc.bcm.edu	37	14	21961062	21961062	+	Silent	SNP	T	T	A	rs571846793		TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr14:21961062T>A	ENST00000405508.1	+	8	1563	c.1287T>A	c.(1285-1287)gcT>gcA	p.A429A	TOX4_ENST00000262709.3_Silent_p.A429A|TOX4_ENST00000448790.2_Silent_p.A406A			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	429	Gln/Pro-rich.|Poly-Ala.					chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)	p.A429A(1)		large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		CAGCAGCAGCTGCTGCTGCTG	0.582													T|||	1	0.000199681	0.0	0.0014	5008	,	,		14814	0.0		0.0	False		,,,				2504	0.0				p.A429A		Atlas-SNP	.											TOX4,NS,carcinoma,0,2	TOX4	50	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1287A						PASS	.						63.0	73.0	70.0					14																	21961062		2201	4298	6499	SO:0001819	synonymous_variant	9878	exon7			AGCAGCTGCTGCT	AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.1287T>A	chr14.hg19:g.21961062T>A		64.0	0.0	.		78.0	5.0	.	NM_014828	B4DPY8|B4DSM0|E7EV69	Silent	SNP	ENST00000405508.1	hg19	CCDS32043.1																																																																																			.	.	.	none		0.582	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317287.2	NM_014828	
PCNX	22990	hgsc.bcm.edu	37	14	71493571	71493571	+	Silent	SNP	A	A	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr14:71493571A>G	ENST00000304743.2	+	15	3884	c.3438A>G	c.(3436-3438)caA>caG	p.Q1146Q	PCNX_ENST00000238570.5_Silent_p.Q1146Q|PCNX_ENST00000439984.3_Silent_p.Q1035Q	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1146						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TTTGTGAACAATTGGATATTC	0.299																																					p.Q1146Q		Atlas-SNP	.											.	PCNX	198	.	0			c.A3438G						PASS	.						123.0	119.0	121.0					14																	71493571		2203	4298	6501	SO:0001819	synonymous_variant	22990	exon15			TGAACAATTGGAT	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.3438A>G	chr14.hg19:g.71493571A>G		72.0	0.0	.		77.0	6.0	.	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Silent	SNP	ENST00000304743.2	hg19	CCDS9806.1	.	.	.	.	.	.	.	.	.	.	A	7.910	0.736201	0.15574	.	.	ENSG00000100731	ENST00000554691	.	.	.	5.36	1.6	0.23607	.	.	.	.	.	T	0.57504	0.2058	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48736	-0.9009	4	.	.	.	.	9.0245	0.36220	0.6395:0.0:0.3605:0.0	.	.	.	.	S	205	.	.	N	+	2	0	PCNX	70563324	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	2.208000	0.42797	0.024000	0.15214	-1.054000	0.02325	AAT	.	.	.	none		0.299	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
CA12	771	hgsc.bcm.edu	37	15	63673897	63673897	+	Missense_Mutation	SNP	G	G	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr15:63673897G>C	ENST00000178638.3	-	1	463	c.23C>G	c.(22-24)gCg>gGg	p.A8G	CA12_ENST00000344366.3_Missense_Mutation_p.A8G|CA12_ENST00000422263.2_Missense_Mutation_p.A8G	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	8					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	CACGGCCGCCGCGTGCAGGCT	0.692																																					p.A8G		Atlas-SNP	.											.	CA12	33	.	0			c.C23G						PASS	.																																			SO:0001583	missense	771	exon1			GCCGCCGCGTGCA	AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.23C>G	chr15.hg19:g.63673897G>C	ENSP00000178638:p.Ala8Gly	110.0	0.0	.		99.0	13.0	.	NM_206925	B2RE24|Q53YE5|Q9BWG2	Missense_Mutation	SNP	ENST00000178638.3	hg19	CCDS10185.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289415	0.80914	.	.	ENSG00000074410	ENST00000178638;ENST00000344366;ENST00000422263	T;T;D	0.82344	-0.5;-0.54;-1.6	4.49	3.56	0.40772	.	0.347063	0.26187	N	0.025829	T	0.73249	0.3563	L	0.29908	0.895	0.09310	N	1	B;B;B	0.19583	0.022;0.037;0.022	B;B;B	0.17979	0.009;0.02;0.009	T	0.67035	-0.5772	10	0.87932	D	0	.	10.5982	0.45352	0.0:0.1953:0.8047:0.0	.	8;8;8	B3KUB4;O43570-2;O43570	.;.;CAH12_HUMAN	G	8	ENSP00000178638:A8G;ENSP00000343088:A8G;ENSP00000403028:A8G	ENSP00000178638:A8G	A	-	2	0	CA12	61460950	0.004000	0.15560	0.030000	0.17652	0.720000	0.41350	0.577000	0.23758	1.207000	0.43291	-0.315000	0.08773	GCG	.	.	.	none		0.692	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256370.1	NM_001218	
HS3ST6	64711	hgsc.bcm.edu	37	16	1961626	1961626	+	Missense_Mutation	SNP	A	A	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr16:1961626A>G	ENST00000293937.3	-	2	993	c.994T>C	c.(994-996)Tac>Cac	p.Y332H	HS3ST6_ENST00000454677.2_Missense_Mutation_p.Y349H|HS3ST6_ENST00000443547.1_Missense_Mutation_p.Y301H			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	332					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						GTCATCTGGTAGAACCTGCGG	0.697																																					p.Y301H		Atlas-SNP	.											.	HS3ST6	26	.	0			c.T901C						PASS	.						11.0	13.0	12.0					16																	1961626		2029	4191	6220	SO:0001583	missense	64711	exon2			TCTGGTAGAACCT			16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.994T>C	chr16.hg19:g.1961626A>G	ENSP00000293937:p.Tyr332His	62.0	0.0	.		76.0	15.0	.	NM_001009606	Q96RX7	Missense_Mutation	SNP	ENST00000293937.3	hg19		.	.	.	.	.	.	.	.	.	.	A	23.7	4.450374	0.84101	.	.	ENSG00000162040	ENST00000293937;ENST00000443547;ENST00000454677	T;T	0.55760	0.5;0.5	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.76126	0.3944	M	0.88842	2.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81562	-0.0876	10	0.87932	D	0	.	13.9056	0.63834	1.0:0.0:0.0:0.0	.	332	Q96QI5	HS3S6_HUMAN	H	332;301;371	ENSP00000293937:Y332H;ENSP00000390354:Y301H	ENSP00000293937:Y332H	Y	-	1	0	HS3ST6	1901627	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.233000	0.78125	1.890000	0.54733	0.414000	0.27820	TAC	.	.	.	none		0.697	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001009606	
CHD9	80205	hgsc.bcm.edu	37	16	53326887	53326887	+	Silent	SNP	T	T	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr16:53326887T>C	ENST00000398510.3	+	28	5520	c.5433T>C	c.(5431-5433)ccT>ccC	p.P1811P	CHD9_ENST00000566029.1_Silent_p.P1811P|CHD9_ENST00000564845.1_Silent_p.P1811P|CHD9_ENST00000447540.1_Silent_p.P1811P			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1811					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TCTCGGTGCCTACCAGTGTAA	0.403																																					p.P1811P		Atlas-SNP	.											.	CHD9	203	.	0			c.T5433C						PASS	.						69.0	66.0	67.0					16																	53326887		1883	4114	5997	SO:0001819	synonymous_variant	80205	exon29			GGTGCCTACCAGT	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.5433T>C	chr16.hg19:g.53326887T>C		189.0	0.0	.		212.0	18.0	.	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	ENST00000398510.3	hg19																																																																																				.	.	.	none		0.403	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
USP10	9100	hgsc.bcm.edu	37	16	84796615	84796615	+	Silent	SNP	G	G	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr16:84796615G>A	ENST00000219473.7	+	9	1688	c.1575G>A	c.(1573-1575)gaG>gaA	p.E525E	USP10_ENST00000570191.1_Silent_p.E529E	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	525	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						AAGATGCTGAGGAATACTTAG	0.418																																					p.E529E		Atlas-SNP	.											.	USP10	51	.	0			c.G1587A						PASS	.						161.0	147.0	151.0					16																	84796615		1903	4126	6029	SO:0001819	synonymous_variant	9100	exon10			TGCTGAGGAATAC	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.1575G>A	chr16.hg19:g.84796615G>A		47.0	0.0	.		49.0	7.0	.	NM_001272075	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Silent	SNP	ENST00000219473.7	hg19	CCDS45537.1																																																																																			.	.	.	none		0.418	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1		
CTNS	1497	hgsc.bcm.edu	37	17	3563995	3563995	+	3'UTR	SNP	T	T	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr17:3563995T>C	ENST00000046640.3	+	0	2029				CTNS_ENST00000441220.2_Silent_p.T282T|CTNS_ENST00000381870.3_Silent_p.T390T|RP11-235E17.6_ENST00000575741.1_RNA	NM_004937.2	NP_004928.2	O60931	CTNS_HUMAN	cystinosin, lysosomal cystine transporter						adult walking behavior (GO:0007628)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|cellular amino acid metabolic process (GO:0006520)|cognition (GO:0050890)|glutathione metabolic process (GO:0006749)|grooming behavior (GO:0007625)|L-cystine transport (GO:0015811)|lens development in camera-type eye (GO:0002088)|long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	L-cystine transmembrane transporter activity (GO:0015184)			NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)	10				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)	TGCCCCAAACTACCAGCGTTT	0.602																																					p.T390T		Atlas-SNP	.											.	CTNS	42	.	0			c.T1170C						PASS	.						64.0	58.0	60.0					17																	3563995		2203	4300	6503	SO:0001624	3_prime_UTR_variant	1497	exon13			CCAAACTACCAGC	AJ222967	CCDS11031.1, CCDS32530.1	17p13	2011-06-07	2011-06-07		ENSG00000040531	ENSG00000040531			2518	protein-coding gene	gene with protein product		606272	"""cystinosis, nephropathic"""			9537412, 15128704	Standard	NM_004937		Approved	CTNS-LSB, PQLC4	uc002fwa.3	O60931	OTTHUMG00000090693	ENST00000046640.3:c.*332T>C	chr17.hg19:g.3563995T>C		169.0	0.0	.		175.0	18.0	.	NM_001031681	D3DTJ5|Q8IZ01|Q9UNK6	Silent	SNP	ENST00000046640.3	hg19	CCDS11031.1																																																																																			.	.	.	none		0.602	CTNS-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317696.1	NM_004937	
NCOR1	9611	hgsc.bcm.edu	37	17	15961807	15961807	+	Silent	SNP	A	A	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr17:15961807A>C	ENST00000268712.3	-	38	6245	c.5988T>G	c.(5986-5988)gtT>gtG	p.V1996V	NCOR1_ENST00000395857.3_Silent_p.V580V|NCOR1_ENST00000395851.1_Silent_p.V1893V	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1996	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TTGCCTTAACAACCTCTGGCT	0.428																																					p.V1996V		Atlas-SNP	.											.	NCOR1	240	.	0			c.T5988G						PASS	.						180.0	179.0	179.0					17																	15961807		2203	4300	6503	SO:0001819	synonymous_variant	9611	exon38			CTTAACAACCTCT	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.5988T>G	chr17.hg19:g.15961807A>C		78.0	0.0	.		92.0	8.0	.	NM_006311	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	hg19	CCDS11175.1																																																																																			.	.	.	none		0.428	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
IKZF3	22806	hgsc.bcm.edu	37	17	37985676	37985676	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr17:37985676C>A	ENST00000346872.3	-	3	188	c.127G>T	c.(127-129)Gga>Tga	p.G43*	IKZF3_ENST00000377958.2_Nonsense_Mutation_p.G43*|IKZF3_ENST00000439167.2_Intron|IKZF3_ENST00000377952.2_Nonsense_Mutation_p.G43*|IKZF3_ENST00000394189.2_Nonsense_Mutation_p.G43*|IKZF3_ENST00000535189.1_Intron|IKZF3_ENST00000351680.3_Nonsense_Mutation_p.G43*|IKZF3_ENST00000350532.3_Nonsense_Mutation_p.G43*|IKZF3_ENST00000346243.3_Nonsense_Mutation_p.G43*|IKZF3_ENST00000467757.1_Nonsense_Mutation_p.G43*|IKZF3_ENST00000439016.2_Nonsense_Mutation_p.G43*|IKZF3_ENST00000377945.3_Nonsense_Mutation_p.G43*|IKZF3_ENST00000377944.3_Nonsense_Mutation_p.G43*	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	43					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GGGCCTTCTCCACTGTCCACA	0.403																																					p.G43X		Atlas-SNP	.											.	IKZF3	79	.	0			c.G127T						PASS	.						182.0	147.0	159.0					17																	37985676		2203	4300	6503	SO:0001587	stop_gained	22806	exon3			CTTCTCCACTGTC	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.127G>T	chr17.hg19:g.37985676C>A	ENSP00000344544:p.Gly43*	72.0	0.0	.		90.0	9.0	.	NM_012481	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Nonsense_Mutation	SNP	ENST00000346872.3	hg19	CCDS11346.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850524	0.71719	.	.	ENSG00000161405	ENST00000488188;ENST00000346872;ENST00000377945;ENST00000394189;ENST00000377944;ENST00000377958;ENST00000377952;ENST00000351680;ENST00000346243;ENST00000350532;ENST00000467757	.	.	.	5.41	1.04	0.20106	.	1.232630	0.05900	N	0.629846	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	1.0311	7.3734	0.26815	0.0:0.611:0.0:0.389	.	.	.	.	X	43	.	ENSP00000341977:G43X	G	-	1	0	IKZF3	35239202	0.884000	0.30299	0.951000	0.38953	0.945000	0.59286	0.300000	0.19156	-0.019000	0.14055	-0.252000	0.11476	GGA	.	.	.	none		0.403	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481	
NGFR	4804	hgsc.bcm.edu	37	17	47590364	47590364	+	Missense_Mutation	SNP	C	C	T	rs574245308	byFrequency	TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr17:47590364C>T	ENST00000172229.3	+	6	1402	c.1277C>T	c.(1276-1278)cCg>cTg	p.P426L	NGFR_ENST00000504201.1_Missense_Mutation_p.P332L|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	426					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GCCACATCCCCGGTGTGAGCC	0.711													C|||	2	0.000399361	0.0	0.0	5008	,	,		11944	0.001		0.0	False		,,,				2504	0.001				p.P426L		Atlas-SNP	.											.	NGFR	46	.	0			c.C1277T						PASS	.						8.0	9.0	8.0					17																	47590364		2175	4262	6437	SO:0001583	missense	4804	exon6			CATCCCCGGTGTG	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1277C>T	chr17.hg19:g.47590364C>T	ENSP00000172229:p.Pro426Leu	45.0	0.0	.		64.0	6.0	.	NM_002507	B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	hg19	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417274	0.62622	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.90844	-2.67;-2.74	4.32	4.32	0.51571	.	0.567072	0.17745	N	0.163402	D	0.92384	0.7583	L	0.51422	1.61	0.53688	D	0.999973	D	0.76494	0.999	P	0.58970	0.849	D	0.91837	0.5480	10	0.42905	T	0.14	-22.1632	15.7498	0.77976	0.0:1.0:0.0:0.0	.	426	P08138	TNR16_HUMAN	L	426;332	ENSP00000172229:P426L;ENSP00000421731:P332L	ENSP00000172229:P426L	P	+	2	0	NGFR	44945363	1.000000	0.71417	0.911000	0.35937	0.910000	0.53928	4.158000	0.58150	2.233000	0.73108	0.561000	0.74099	CCG	.	.	.	none		0.711	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
CLTC	1213	hgsc.bcm.edu	37	17	57754324	57754324	+	Silent	SNP	G	G	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr17:57754324G>C	ENST00000269122.3	+	17	2845	c.2571G>C	c.(2569-2571)ctG>ctC	p.L857L	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Silent_p.L857L|CLTC_ENST00000579815.1_3'UTR	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	857	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GATTGAAACTGCTTCTGCCTT	0.403			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.L857L		Atlas-SNP	.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	124	.	0			c.G2571C						PASS	.						42.0	45.0	44.0					17																	57754324		2203	4300	6503	SO:0001819	synonymous_variant	1213	exon17			GAAACTGCTTCTG	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2571G>C	chr17.hg19:g.57754324G>C		108.0	0.0	.		107.0	24.0	.	NM_004859	D3DU00|Q6N0A0|Q86TF2	Silent	SNP	ENST00000269122.3	hg19	CCDS32696.1																																																																																			.	.	.	none		0.403	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
HELZ	9931	hgsc.bcm.edu	37	17	65147177	65147177	+	Silent	SNP	A	A	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr17:65147177A>G	ENST00000358691.5	-	18	2507	c.2341T>C	c.(2341-2343)Ttg>Ctg	p.L781L	HELZ_ENST00000580168.1_Silent_p.L782L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	781						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TCAAGGTCCAACTGACAGAGG	0.453																																					p.L781L		Atlas-SNP	.											.	HELZ	160	.	0			c.T2341C						PASS	.						152.0	153.0	152.0					17																	65147177		1998	4160	6158	SO:0001819	synonymous_variant	9931	exon18			GGTCCAACTGACA	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.2341T>C	chr17.hg19:g.65147177A>G		191.0	0.0	.		186.0	30.0	.	NM_014877	I6L9H4	Silent	SNP	ENST00000358691.5	hg19	CCDS42374.1																																																																																			.	.	.	none		0.453	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
CEP192	55125	hgsc.bcm.edu	37	18	13068196	13068196	+	Missense_Mutation	SNP	C	C	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr18:13068196C>T	ENST00000325971.8	+	21	4523	c.2930C>T	c.(2929-2931)tCt>tTt	p.S977F	CEP192_ENST00000506447.1_Missense_Mutation_p.S1573F|CEP192_ENST00000430049.2_Missense_Mutation_p.S1098F			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	977					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GCAGGCCCTTCTGTGGTCAAC	0.498																																					p.S1573F		Atlas-SNP	.											.	CEP192	340	.	0			c.C4718T						PASS	.						71.0	72.0	72.0					18																	13068196		2203	4300	6503	SO:0001583	missense	55125	exon23			GCCCTTCTGTGGT	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.2930C>T	chr18.hg19:g.13068196C>T	ENSP00000317156:p.Ser977Phe	86.0	0.0	.		90.0	8.0	.	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	hg19		.	.	.	.	.	.	.	.	.	.	C	19.48	3.834805	0.71373	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.35421	1.31;1.31;1.31	5.37	5.37	0.77165	.	0.077917	0.53938	D	0.000059	T	0.62986	0.2473	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	T	0.64170	-0.6470	10	0.56958	D	0.05	-22.4154	19.4881	0.95039	0.0:1.0:0.0:0.0	.	1098;1573	C9JT09;E9PF99	.;.	F	1573;977;977;1098	ENSP00000427550:S1573F;ENSP00000317156:S977F;ENSP00000389190:S1098F	ENSP00000317156:S977F	S	+	2	0	CEP192	13058196	1.000000	0.71417	0.739000	0.30968	0.125000	0.20455	7.163000	0.77524	2.673000	0.90976	0.655000	0.94253	TCT	.	.	.	none		0.498	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
PLPPR3	79948	hgsc.bcm.edu	37	19	815758	815758	+	Missense_Mutation	SNP	G	G	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr19:815758G>T	ENST00000520876.3	-	3	247	c.169C>A	c.(169-171)Cgc>Agc	p.R57S	MIR3187_ENST00000583431.1_RNA|LPPR3_ENST00000359894.2_Missense_Mutation_p.R57S	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		57						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										GAGAGAGTGCGGTCATAGCAC	0.617																																					p.R57S		Atlas-SNP	.											.	.	.	.	0			c.C169A						PASS	.						76.0	53.0	61.0					19																	815758		2201	4299	6500	SO:0001583	missense	0	exon3			GAGTGCGGTCATA																												ENST00000520876.3:c.169C>A	chr19.hg19:g.815758G>T	ENSP00000430297:p.Arg57Ser	94.0	0.0	.		119.0	5.0	.	NM_001270366	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	hg19	CCDS58636.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229444	0.58777	.	.	ENSG00000129951	ENST00000300947;ENST00000359894;ENST00000520876;ENST00000521445	T;T	0.49432	0.78;0.78	3.96	3.96	0.45880	.	0.000000	0.85682	U	0.000000	T	0.56702	0.2003	L	0.38692	1.165	0.44309	D	0.997188	D;D	0.89917	1.0;1.0	D;D	0.91635	0.984;0.999	T	0.55003	-0.8208	10	0.36615	T	0.2	-37.6464	13.5102	0.61508	0.0:0.0:1.0:0.0	.	57;57	Q6T4P5;Q6T4P5-3	LPPR3_HUMAN;.	S	57	ENSP00000352962:R57S;ENSP00000430297:R57S	ENSP00000300947:R57S	R	-	1	0	AC006273.1	766758	1.000000	0.71417	0.996000	0.52242	0.647000	0.38526	3.510000	0.53393	1.765000	0.52091	0.313000	0.20887	CGC	.	.	.	none		0.617	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
FCGBP	8857	hgsc.bcm.edu	37	19	40366139	40366139	+	Missense_Mutation	SNP	A	A	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr19:40366139A>T	ENST00000221347.6	-	30	14102	c.14095T>A	c.(14095-14097)Tgc>Agc	p.C4699S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4699						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGAACTTGGCAGGCGTCCAGC	0.716																																					p.C4699S		Atlas-SNP	.											.	FCGBP	416	.	0			c.T14095A						PASS	.						18.0	25.0	23.0					19																	40366139		2184	4262	6446	SO:0001583	missense	8857	exon30			CTTGGCAGGCGTC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14095T>A	chr19.hg19:g.40366139A>T	ENSP00000221347:p.Cys4699Ser	195.0	0.0	.		195.0	15.0	.	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	hg19	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	A	17.80	3.478498	0.63849	.	.	ENSG00000090920	ENST00000221347	D	0.83837	-1.77	4.32	4.32	0.51571	Uncharacterised domain, cysteine-rich (2);	0.000000	0.85682	U	0.000000	D	0.93848	0.8032	H	0.97540	4.025	0.45239	D	0.998249	D	0.89917	1.0	D	0.91635	0.999	D	0.95437	0.8522	10	0.87932	D	0	.	12.8687	0.57953	1.0:0.0:0.0:0.0	.	4699	Q9Y6R7	FCGBP_HUMAN	S	4699	ENSP00000221347:C4699S	ENSP00000221347:C4699S	C	-	1	0	FCGBP	45057979	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	6.590000	0.74085	1.940000	0.56252	0.254000	0.18369	TGC	.	.	.	none		0.716	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
MEGF8	1954	hgsc.bcm.edu	37	19	42848184	42848184	+	Missense_Mutation	SNP	G	G	C			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr19:42848184G>C	ENST00000251268.6	+	10	1747	c.1747G>C	c.(1747-1749)Gcc>Ccc	p.A583P	MEGF8_ENST00000334370.4_Missense_Mutation_p.A583P	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	583	PSI 1.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GTGCCAAGGAGCCTGCCAAGC	0.622																																					p.A583P		Atlas-SNP	.											.	MEGF8	358	.	0			c.G1747C						PASS	.						57.0	55.0	56.0					19																	42848184		2203	4300	6503	SO:0001583	missense	1954	exon10			CAAGGAGCCTGCC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.1747G>C	chr19.hg19:g.42848184G>C	ENSP00000251268:p.Ala583Pro	51.0	0.0	.		57.0	7.0	.	NM_001271938	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	hg19		.	.	.	.	.	.	.	.	.	.	G	18.31	3.595569	0.66219	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.22134	1.97;1.97	4.84	2.57	0.30868	.	0.720289	0.12870	N	0.432362	T	0.15696	0.0378	N	0.14661	0.345	0.80722	D	1	P;D	0.56968	0.828;0.978	B;P	0.50049	0.374;0.629	T	0.07635	-1.0762	10	0.39692	T	0.17	-12.3962	5.5022	0.16834	0.0943:0.0:0.5465:0.3592	.	583;583	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	P	583	ENSP00000334219:A583P;ENSP00000251268:A583P	ENSP00000251268:A583P	A	+	1	0	MEGF8	47540024	0.993000	0.37304	0.949000	0.38748	0.988000	0.76386	2.498000	0.45363	0.388000	0.25054	0.486000	0.48141	GCC	.	.	.	none		0.622	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
LMTK3	114783	hgsc.bcm.edu	37	19	49002400	49002400	+	Silent	SNP	C	C	T			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr19:49002400C>T	ENST00000600059.1	-	11	2153	c.1926G>A	c.(1924-1926)gaG>gaA	p.E642E	LMTK3_ENST00000270238.3_Silent_p.E671E			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	642	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		CCTCCTCCTCCTCTTCTTCTT	0.741																																					p.E671E		Atlas-SNP	.											.	LMTK3	125	.	0			c.G2013A						PASS	.						4.0	4.0	4.0					19																	49002400		1578	3534	5112	SO:0001819	synonymous_variant	114783	exon12			CTCCTCCTCTTCT	AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.1926G>A	chr19.hg19:g.49002400C>T		82.0	0.0	.		75.0	5.0	.	NM_001080434	Q4G0U1	Silent	SNP	ENST00000600059.1	hg19																																																																																				.	.	.	none		0.741	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895	
ZNF606	80095	hgsc.bcm.edu	37	19	58490071	58490071	+	Missense_Mutation	SNP	T	T	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr19:58490071T>G	ENST00000341164.4	-	7	2597	c.1977A>C	c.(1975-1977)aaA>aaC	p.K659N	ZNF606_ENST00000536132.1_Missense_Mutation_p.K569N	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	659					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		GACTGAAGGATTTTCCACATT	0.393																																					p.K659N		Atlas-SNP	.											.	ZNF606	155	.	0			c.A1977C						PASS	.						96.0	89.0	91.0					19																	58490071		2203	4300	6503	SO:0001583	missense	80095	exon7			GAAGGATTTTCCA	AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.1977A>C	chr19.hg19:g.58490071T>G	ENSP00000343617:p.Lys659Asn	98.0	0.0	.		103.0	7.0	.	NM_025027	A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	ENST00000341164.4	hg19	CCDS12968.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.654627	0.47467	.	.	ENSG00000166704	ENST00000341164;ENST00000536132	T;T	0.27890	1.64;1.64	4.69	0.374	0.16183	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.128450	0.35903	N	0.002912	T	0.50360	0.1611	M	0.78456	2.415	0.39034	D	0.959998	D	0.89917	1.0	D	0.91635	0.999	T	0.52586	-0.8556	10	0.87932	D	0	.	8.7437	0.34573	0.0:0.4376:0.0:0.5624	.	659	Q8WXB4	ZN606_HUMAN	N	659;569	ENSP00000343617:K659N;ENSP00000445624:K569N	ENSP00000343617:K659N	K	-	3	2	ZNF606	63181883	0.000000	0.05858	0.996000	0.52242	0.995000	0.86356	-0.162000	0.10012	0.089000	0.17243	0.459000	0.35465	AAA	.	.	.	none		0.393	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405961.1	NM_025027	
ZNF831	128611	hgsc.bcm.edu	37	20	57767752	57767752	+	Missense_Mutation	SNP	G	G	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr20:57767752G>A	ENST00000371030.2	+	1	1678	c.1678G>A	c.(1678-1680)Gcc>Acc	p.A560T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	560							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GCATCCCCGGGCCCTGGTCAG	0.701																																					p.A560T		Atlas-SNP	.											.	ZNF831	287	.	0			c.G1678A						PASS	.						6.0	8.0	7.0					20																	57767752		1848	3995	5843	SO:0001583	missense	128611	exon1			CCCCGGGCCCTGG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1678G>A	chr20.hg19:g.57767752G>A	ENSP00000360069:p.Ala560Thr	84.0	0.0	.		125.0	9.0	.	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	hg19	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.411578	0.62399	.	.	ENSG00000124203	ENST00000371030	T	0.10005	2.92	5.21	4.25	0.50352	.	.	.	.	.	T	0.10508	0.0257	N	0.20401	0.57	0.28290	N	0.923571	P	0.52463	0.953	P	0.46543	0.52	T	0.06935	-1.0799	9	0.54805	T	0.06	-18.7895	12.2646	0.54670	0.0817:0.0:0.9183:0.0	.	560	Q5JPB2	ZN831_HUMAN	T	560	ENSP00000360069:A560T	ENSP00000360069:A560T	A	+	1	0	ZNF831	57201147	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	2.682000	0.46934	2.423000	0.82170	0.655000	0.94253	GCC	.	.	.	none		0.701	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
TUBGCP6	85378	hgsc.bcm.edu	37	22	50659180	50659180	+	Missense_Mutation	SNP	G	G	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr22:50659180G>A	ENST00000248846.5	-	16	3712	c.3608C>T	c.(3607-3609)tCa>tTa	p.S1203L	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.S1203L|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1203	9 X 27 AA tandem repeats.				G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGCCATGTCTGACACAGACTC	0.627																																					p.S1203L		Atlas-SNP	.											.	TUBGCP6	132	.	0			c.C3608T						PASS	.						70.0	64.0	66.0					22																	50659180		2203	4300	6503	SO:0001583	missense	85378	exon16			ATGTCTGACACAG	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.3608C>T	chr22.hg19:g.50659180G>A	ENSP00000248846:p.Ser1203Leu	50.0	0.0	.		58.0	6.0	.	NM_020461	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	hg19	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	N	8.442	0.850991	0.17034	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.21361	2.58;2.01	4.54	-0.414	0.12359	.	0.636742	0.12976	N	0.423723	T	0.16385	0.0394	L	0.43923	1.385	0.32013	N	0.601856	B;B;B	0.32382	0.0;0.368;0.005	B;B;B	0.39339	0.003;0.297;0.004	T	0.36890	-0.9729	10	0.10111	T	0.7	.	6.3147	0.21184	0.2362:0.2907:0.4731:0.0	.	1195;1203;1203	B2RWN4;Q96RT7;Q96RT7-3	.;GCP6_HUMAN;.	L	1203	ENSP00000248846:S1203L;ENSP00000397387:S1203L	ENSP00000248846:S1203L	S	-	2	0	TUBGCP6	49001307	0.389000	0.25205	0.055000	0.19348	0.002000	0.02628	1.791000	0.38744	0.048000	0.15891	-0.290000	0.09829	TCA	.	.	.	none		0.627	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461	
MT-CO1	4512	hgsc.bcm.edu	37	M	6285	6285	+	Missense_Mutation	SNP	G	G	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chrM:6285G>A	ENST00000361624.2	+	1	382	c.382G>A	c.(382-384)Gtc>Atc	p.V128I	MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	128					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CAGGTTGAACAGTCTACCCTC	0.532																																					p.V128I		Atlas-SNP	.											.	.	.	.	0			c.G382A						PASS	.																																			SO:0001583	missense	5742	exon1			TGAACAGTCTACC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.382G>A	chrM.hg19:g.6285G>A	ENSP00000354499:p.Val128Ile	36.0	0.0	.		32.0	18.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	none		0.532	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
ADAM7	8756	hgsc.bcm.edu	37	8	24350057	24350058	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr8:24350057_24350058insA	ENST00000175238.6	+	15	1685_1686	c.1602_1603insA	c.(1603-1605)aaafs	p.K535fs	RP11-561E1.1_ENST00000519364.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000520720.1_Frame_Shift_Ins_p.K307fs|ADAM7_ENST00000380789.1_Frame_Shift_Ins_p.K535fs	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	535	Cys-rich.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		CAAAAGGAAATAAATTTGGATA	0.347																																					p.N534fs		Atlas-Indel,Pindel	.											.	ADAM7	165	.	0			c.1602_1603insA						PASS	.																																			SO:0001589	frameshift_variant	8756	exon15			.	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.1605dupA	chr8.hg19:g.24350060_24350060dupA	ENSP00000175238:p.Lys535fs	386.0	0.0	0		472.0	40.0	0.0847458	NM_003817	A8K8X7|O75959|Q6PEJ6	Frame_Shift_Ins	INS	ENST00000175238.6	hg19	CCDS6045.1																																																																																			.	.	.	none		0.347	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
HTR2B	3357	hgsc.bcm.edu	37	2	231973805	231973805	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr2:231973805delT	ENST00000258400.3	-	4	1384	c.872delA	c.(871-873)aagfs	p.K291fs	PSMD1_ENST00000488354.1_3'UTR|PSMD1_ENST00000409643.1_Intron|PSMD1_ENST00000373635.4_Intron|PSMD1_ENST00000308696.6_Intron	NM_000867.4	NP_000858.3	P41595	5HT2B_HUMAN	5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled	291					activation of phospholipase C activity (GO:0007202)|behavior (GO:0007610)|calcium-mediated signaling (GO:0019722)|cardiac muscle hypertrophy (GO:0003300)|cellular calcium ion homeostasis (GO:0006874)|cellular response to temperature stimulus (GO:0071502)|cGMP biosynthetic process (GO:0006182)|embryonic morphogenesis (GO:0048598)|ERK1 and ERK2 cascade (GO:0070371)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|heart morphogenesis (GO:0003007)|intestine smooth muscle contraction (GO:0014827)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell death (GO:0060548)|neural crest cell differentiation (GO:0014033)|neural crest cell migration (GO:0001755)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphorylation (GO:0016310)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	drug binding (GO:0008144)|G-protein alpha-subunit binding (GO:0001965)|Ras GTPase activator activity (GO:0005099)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	11		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;4.48e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0141)	Amoxapine(DB00543)|Apomorphine(DB00714)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Dihydroergotamine(DB00320)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Lisuride(DB00589)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Ropinirole(DB00268)|Triflupromazine(DB00508)|Yohimbine(DB01392)	GGGCAGAGCCTTGTCCTTTCG	0.478																																					p.K291fs	Ovarian(155;1331 1891 12853 14038 34991)	Atlas-Indel,Pindel	.											.	HTR2B	33	.	0			c.873delG						PASS	.						195.0	182.0	186.0					2																	231973805		2203	4300	6503	SO:0001589	frameshift_variant	3357	exon4			.		CCDS2483.1	2q36.3-q37.1	2012-08-08	2012-02-03		ENSG00000135914	ENSG00000135914		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5294	protein-coding gene	gene with protein product		601122	"""5-hydroxytryptamine (serotonin) receptor 2B"""			8143856	Standard	NM_000867		Approved	5-HT(2B), 5-HT2B	uc002vro.3	P41595	OTTHUMG00000133222	ENST00000258400.3:c.872delA	chr2.hg19:g.231973805delT	ENSP00000258400:p.Lys291fs	156.0	0.0	0		172.0	12.0	0.0697674	NM_000867	B2R9D5|Q53TI1|Q62221|Q6P523	Frame_Shift_Del	DEL	ENST00000258400.3	hg19	CCDS2483.1																																																																																			.	.	.	none		0.478	HTR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256957.2	NM_000867	
PRSS21	10942	hgsc.bcm.edu	37	16	2868817	2868817	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr16:2868817delA	ENST00000005995.3	+	4	439	c.397delA	c.(397-399)aatfs	p.N133fs	PRSS21_ENST00000450020.3_Frame_Shift_Del_p.N133fs|PRSS21_ENST00000455114.1_Frame_Shift_Del_p.N131fs			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)	133	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						CTACCTGGGGAATTCACCCTA	0.517																																					p.G132fs		Atlas-INDEL	.											PRSS21,rectum,carcinoma,0,1	PRSS21	32	.	0			c.396delG						PASS	.						211.0	171.0	185.0					16																	2868817		2198	4300	6498	SO:0001589	frameshift_variant	10942	exon4			.	AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.397delA	chr16.hg19:g.2868817delA	ENSP00000005995:p.Asn133fs	67.0	0.0	0		86.0	10.0	0.116279	NM_144957	Q9NS34|Q9P2V6	Frame_Shift_Del	DEL	ENST00000005995.3	hg19	CCDS10478.1																																																																																			.	.	.	none		0.517	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250910.1	NM_006799	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305776	39305777	+	In_Frame_Ins	INS	-	-	GCAGCAGCTGGGGCG	rs146438235		TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr17:39305776_39305777insGCAGCAGCTGGGGCG	ENST00000343246.4	-	1	277_278	c.243_244insCGCCCCAGCTGCTGC	c.(241-246)tgccag>tgcCGCCCCAGCTGCTGCcag	p.80_81insCRPSC		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	80	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].		C -> CCCRPS.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			caggtggtctggcagcagcagg	0.653																																					p.Q82delinsRPSCCQ		Atlas-INDEL	.											.	KRTAP4-5	34	.	0			c.244_245insCGCCCCAGCTGCTGC						PASS	.																																			SO:0001652	inframe_insertion	85289	exon1			.	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.243_244insCGCCCCAGCTGCTGC	chr17.hg19:g.39305776_39305777insGCAGCAGCTGGGGCG	ENSP00000340546:p.Cys80_Cys81insCysArgProSerCys	45.0	0.0	0		52.0	31.0	0.596154	NM_033188		In_Frame_Ins	INS	ENST00000343246.4	hg19	CCDS32650.1																																																																																			.	.	.	alt		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
ZNF235	9310	hgsc.bcm.edu	37	19	44792736	44792737	+	Frame_Shift_Ins	INS	-	-	G			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr19:44792736_44792737insG	ENST00000291182.4	-	5	953_954	c.851_852insC	c.(850-852)gtafs	p.V284fs	ZNF235_ENST00000589799.1_Intron|ZNF235_ENST00000589248.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	284					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				TTCCCAAGTGTACCTGTTTATG	0.431																																					p.V284fs		Atlas-Indel,Pindel	.											.	ZNF235	60	.	0			c.852_853insC						PASS	.																																			SO:0001589	frameshift_variant	9310	exon5			.	X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.851_852insC	chr19.hg19:g.44792736_44792737insG	ENSP00000291182:p.Val284fs	176.0	0.0	0		178.0	20.0	0.11236	NM_004234	B4DTQ7|O14898|O14899|Q17RR8	Frame_Shift_Ins	INS	ENST00000291182.4	hg19	CCDS33048.1																																																																																			.	.	.	none		0.431	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1		
NBEA	26960	hgsc.bcm.edu	37	13	36051205	36051205	+	Intron	DEL	A	A	-			TCGA-2K-A9WE-01A-11D-A382-10	TCGA-2K-A9WE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	85477ef3-5aed-4159-ab85-169a86151ec5	1b9c4eb6-95e2-490d-9d51-2d9ffc29a8ad	g.chr13:36051205delA	ENST00000400445.3	+	41	7119				NBEA_ENST00000310336.4_Intron|NBEA_ENST00000537702.1_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron|MAB21L1_ENST00000379919.4_5'Flank	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin						protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTTCTAAAACAAAATCACTAA	0.373																																					.		Atlas-INDEL	.											.	.	.	.	0			.						PASS	.																																			SO:0001627	intron_variant	100302239	.			.	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6585+4532A>-	chr13.hg19:g.36051205delA		102.0	0.0	0		110.0	12.0	0.109091	.	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	RNA	DEL	ENST00000400445.3	hg19	CCDS45026.1																																																																																			.	.	.	none		0.373	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
