#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGRN	375790	hgsc.bcm.edu	37	1	984390	984390	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:984390G>T	ENST00000379370.2	+	24	4299	c.4249G>T	c.(4249-4251)Ggc>Tgc	p.G1417C		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1417	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CAACGCCCGGGGCAAGGACTT	0.711																																					p.G1417C		Atlas-SNP	.											.	AGRN	110	.	0			c.G4249T						PASS	.						7.0	8.0	8.0					1																	984390		2166	4270	6436	SO:0001583	missense	375790	exon24			GCCCGGGGCAAGG	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.4249G>T	chr1.hg19:g.984390G>T	ENSP00000368678:p.Gly1417Cys	194.0	0.0	.		100.0	27.0	.	NM_198576	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	ENST00000379370.2	hg19	CCDS30551.1	.	.	.	.	.	.	.	.	.	.	g	14.88	2.666084	0.47677	.	.	ENSG00000188157	ENST00000379370	T	0.76448	-1.02	4.62	4.62	0.57501	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.177734	0.37178	U	0.002213	D	0.90212	0.6940	M	0.91612	3.225	0.49130	D	0.999757	D	0.89917	1.0	D	0.79784	0.993	D	0.92456	0.5974	10	0.66056	D	0.02	-30.8549	16.6039	0.84823	0.0:0.0:1.0:0.0	.	1417	O00468	AGRIN_HUMAN	C	1417	ENSP00000368678:G1417C	ENSP00000368678:G1417C	G	+	1	0	AGRN	974253	1.000000	0.71417	0.932000	0.37286	0.031000	0.12232	5.858000	0.69532	2.284000	0.76573	0.555000	0.69702	GGC	.	.	.	none		0.711	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576	
KIF1B	23095	hgsc.bcm.edu	37	1	10394605	10394605	+	Silent	SNP	G	G	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:10394605G>A	ENST00000377086.1	+	28	3154	c.2952G>A	c.(2950-2952)ctG>ctA	p.L984L	KIF1B_ENST00000263934.6_Silent_p.L938L|KIF1B_ENST00000377081.1_Silent_p.L984L			O60333	KIF1B_HUMAN	kinesin family member 1B	984					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GCAATCTGCTGTATCCCGTGC	0.507																																					p.L938L		Atlas-SNP	.											.	KIF1B	242	.	0			c.G2814A						PASS	.						292.0	261.0	271.0					1																	10394605		2203	4300	6503	SO:0001819	synonymous_variant	23095	exon26			TCTGCTGTATCCC	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2952G>A	chr1.hg19:g.10394605G>A		90.0	0.0	.		81.0	33.0	.	NM_015074	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	ENST00000377086.1	hg19																																																																																				.	.	.	none		0.507	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
PEX14	5195	hgsc.bcm.edu	37	1	10596271	10596271	+	Splice_Site	SNP	T	T	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:10596271T>G	ENST00000356607.4	+	3	166	c.86T>G	c.(85-87)aTt>aGt	p.I29S	PEX14_ENST00000538836.1_Intron|PEX14_ENST00000492696.1_3'UTR	NM_004565.2	NP_004556.1	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	29					microtubule anchoring (GO:0034453)|negative regulation of protein binding (GO:0032091)|negative regulation of protein homotetramerization (GO:1901094)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peroxisome organization (GO:0007031)|peroxisome transport along microtubule (GO:0036250)|protein complex assembly (GO:0006461)|protein homooligomerization (GO:0051260)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, substrate release (GO:0044721)|protein import into peroxisome matrix, translocation (GO:0016561)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(3)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	13	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		TCTCACCAGATTGCCACGGCA	0.458																																					p.I29S		Atlas-SNP	.											.	PEX14	40	.	0			c.T86G						PASS	.						54.0	55.0	55.0					1																	10596271		2203	4300	6503	SO:0001630	splice_region_variant	5195	exon3			ACCAGATTGCCAC	AF045186	CCDS30582.1	1p36.22	2008-05-14			ENSG00000142655	ENSG00000142655			8856	protein-coding gene	gene with protein product		601791				9653144	Standard	NM_004565		Approved		uc001arn.3	O75381	OTTHUMG00000001908	ENST00000356607.4:c.85-1T>G	chr1.hg19:g.10596271T>G		336.0	1.0	.		226.0	87.0	.	NM_004565	B2R7N1|B3KML6|B7Z1N2|Q8WX51	Missense_Mutation	SNP	ENST00000356607.4	hg19	CCDS30582.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.524443	0.85600	.	.	ENSG00000142655	ENST00000356607	T	0.52526	0.66	5.82	5.82	0.92795	Peroxisome membrane anchor protein Pex14p, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73799	0.3633	M	0.89214	3.015	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.72338	0.943;0.977	T	0.79619	-0.1728	10	0.87932	D	0	.	16.1986	0.82053	0.0:0.0:0.0:1.0	.	29;29	O75381-2;O75381	.;PEX14_HUMAN	S	29	ENSP00000349016:I29S	ENSP00000349016:I29S	I	+	2	0	PEX14	10518858	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.082000	0.76851	2.227000	0.72691	0.455000	0.32223	ATT	.	.	.	none		0.458	PEX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005414.1		Missense_Mutation
GJA4	2701	hgsc.bcm.edu	37	1	35260710	35260710	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:35260710G>C	ENST00000342280.4	+	2	984	c.896G>C	c.(895-897)aGg>aCg	p.R299T		NM_002060.2	NP_002051.2	P35212	CXA4_HUMAN	gap junction protein, alpha 4, 37kDa	299					blood vessel development (GO:0001568)|calcium ion transport (GO:0006816)|cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|endothelium development (GO:0003158)|response to pain (GO:0048265)|transport (GO:0006810)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(4)|stomach(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				ACAGAGGAGAGGCTGGCGTCT	0.612																																					p.R299T		Atlas-SNP	.											.	GJA4	25	.	0			c.G896C						PASS	.						50.0	46.0	48.0					1																	35260710		2203	4300	6503	SO:0001583	missense	2701	exon2			AGGAGAGGCTGGC	M96789	CCDS30669.1	1p35.1	2008-02-05	2007-01-16		ENSG00000187513	ENSG00000187513		"""Ion channels / Gap junction proteins (connexins)"""	4278	protein-coding gene	gene with protein product	"""connexin 37"""	121012	"""gap junction protein, alpha 4, 37kD (connexin 37)"", ""gap junction protein, alpha 4, 37kDa (connexin 37)"""			9843209, 7680674	Standard	XM_005270750		Approved	CX37	uc001bya.3	P35212	OTTHUMG00000004050	ENST00000342280.4:c.896G>C	chr1.hg19:g.35260710G>C	ENSP00000343676:p.Arg299Thr	47.0	0.0	.		40.0	15.0	.	NM_002060	A8K698|D3DPR4|Q9P106|Q9UBL1|Q9UNA9|Q9UNB0|Q9UNB1|Q9Y5N7	Missense_Mutation	SNP	ENST00000342280.4	hg19	CCDS30669.1	.	.	.	.	.	.	.	.	.	.	G	6.072	0.381657	0.11524	.	.	ENSG00000187513	ENST00000342280	T	0.81247	-1.47	5.25	5.25	0.73442	.	0.525534	0.20845	N	0.084627	T	0.67961	0.2949	L	0.36672	1.1	0.28591	N	0.90966	B	0.02656	0.0	B	0.01281	0.0	T	0.53961	-0.8364	10	0.17832	T	0.49	.	7.1313	0.25502	0.1489:0.1466:0.7045:0.0	.	299	P35212	CXA4_HUMAN	T	299	ENSP00000343676:R299T	ENSP00000343676:R299T	R	+	2	0	GJA4	35033297	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	2.161000	0.42358	2.438000	0.82558	0.561000	0.74099	AGG	.	.	.	none		0.612	GJA4-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011556.1	NM_002060	
SLFNL1	200172	hgsc.bcm.edu	37	1	41486067	41486067	+	Missense_Mutation	SNP	G	G	T	rs189387361		TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:41486067G>T	ENST00000359345.1	-	1	2842	c.266C>A	c.(265-267)cCg>cAg	p.P89Q	SLFNL1_ENST00000439569.2_Missense_Mutation_p.P89Q|SLFNL1_ENST00000372611.1_Missense_Mutation_p.P89Q|SLFNL1_ENST00000302946.8_Missense_Mutation_p.P89Q|SLFNL1_ENST00000397197.2_Missense_Mutation_p.P89Q|SLFNL1_ENST00000372613.2_Missense_Mutation_p.P89Q	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	89							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				GGCCTTCCGCGGCCGCCTCAC	0.677																																					p.P89Q		Atlas-SNP	.											.	SLFNL1	37	.	0			c.C266A						PASS	.						50.0	55.0	53.0					1																	41486067		2203	4299	6502	SO:0001583	missense	200172	exon3			TTCCGCGGCCGCC	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.266C>A	chr1.hg19:g.41486067G>T	ENSP00000352299:p.Pro89Gln	50.0	0.0	.		33.0	9.0	.	NM_001168247	A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Missense_Mutation	SNP	ENST00000359345.1	hg19	CCDS460.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551154	0.65311	.	.	ENSG00000171790	ENST00000302946;ENST00000372613;ENST00000372611;ENST00000359345;ENST00000439569;ENST00000397197	T;T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24;0.24	5.8	4.81	0.61882	.	0.328529	0.26390	N	0.024655	T	0.69070	0.3070	L	0.55481	1.735	0.24286	N	0.995182	D;D;D	0.76494	0.998;0.997;0.999	D;D;D	0.70487	0.969;0.923;0.953	T	0.60480	-0.7255	10	0.49607	T	0.09	-30.5925	12.8379	0.57784	0.0:0.0:0.8264:0.1736	.	89;89;89	Q499Z3-3;Q499Z3-2;Q499Z3	.;.;SLNL1_HUMAN	Q	89	ENSP00000304401:P89Q;ENSP00000361696:P89Q;ENSP00000361694:P89Q;ENSP00000352299:P89Q;ENSP00000398938:P89Q;ENSP00000380381:P89Q	ENSP00000304401:P89Q	P	-	2	0	SLFNL1	41258654	0.916000	0.31088	0.960000	0.40013	0.865000	0.49528	2.555000	0.45854	2.739000	0.93911	0.561000	0.74099	CCG	.	G|0.999;A|0.001	.	alt		0.677	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015650.1	NM_144990	
SZT2	23334	hgsc.bcm.edu	37	1	43896443	43896443	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:43896443G>C	ENST00000562955.1	+	31	4586	c.4586G>C	c.(4585-4587)aGc>aCc	p.S1529T	SZT2_ENST00000372442.1_Missense_Mutation_p.S687T	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1586					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CCTGTGTGCAGCCTGCCTACC	0.617																																					p.S1529T		Atlas-SNP	.											.	SZT2	383	.	0			c.G4586C						PASS	.						80.0	84.0	83.0					1																	43896443		2203	4299	6502	SO:0001583	missense	23334	exon31			TGTGCAGCCTGCC	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.4586G>C	chr1.hg19:g.43896443G>C	ENSP00000457168:p.Ser1529Thr	29.0	0.0	.		39.0	14.0	.	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	hg19	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	G	8.339	0.828333	0.16749	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.79	4.86	0.63082	.	0.161368	0.56097	D	0.000037	T	0.19765	0.0475	N	0.04880	-0.145	0.25888	N	0.983513	B	0.15473	0.013	B	0.14023	0.01	T	0.08576	-1.0715	9	0.06365	T	0.9	.	13.1417	0.59438	0.0:0.3852:0.6148:0.0	.	1529	Q5T011-5	.	T	687	.	ENSP00000361519:S687T	S	+	2	0	SZT2	43669030	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.200000	0.65158	2.733000	0.93635	0.655000	0.94253	AGC	.	.	.	none		0.617	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
ZCCHC11	23318	hgsc.bcm.edu	37	1	52941009	52941009	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:52941009A>C	ENST00000371544.3	-	13	2484	c.2222T>G	c.(2221-2223)aTg>aGg	p.M741R	ZCCHC11_ENST00000371541.1_5'UTR|ZCCHC11_ENST00000257177.4_Missense_Mutation_p.M741R	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	741					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						ATTGGTTGCCATATTGTTCGA	0.408																																					p.M741R		Atlas-SNP	.											.	ZCCHC11	151	.	0			c.T2222G						PASS	.						171.0	170.0	170.0					1																	52941009		2203	4300	6503	SO:0001583	missense	23318	exon13			GTTGCCATATTGT	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.2222T>G	chr1.hg19:g.52941009A>C	ENSP00000360599:p.Met741Arg	90.0	0.0	.		63.0	10.0	.	NM_001009881	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	ENST00000371544.3	hg19	CCDS30716.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.888457	0.00527	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	T;T;T;T	0.39997	1.05;1.05;1.06;1.06	5.49	0.239	0.15484	.	1.086240	0.06799	N	0.788393	T	0.20414	0.0491	N	0.14661	0.345	0.09310	N	1	B;B	0.13145	0.007;0.007	B;B	0.12837	0.005;0.008	T	0.22034	-1.0228	10	0.15066	T	0.55	.	1.1744	0.01832	0.2833:0.2912:0.2819:0.1435	.	500;741	E9PKX1;Q5TAX3	.;TUT4_HUMAN	R	741;741;670;500	ENSP00000257177:M741R;ENSP00000360599:M741R;ENSP00000433486:M670R;ENSP00000435256:M500R	ENSP00000257177:M741R	M	-	2	0	ZCCHC11	52713597	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.599000	0.24089	0.061000	0.16311	0.455000	0.32223	ATG	.	.	.	none		0.408	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288	
ARHGAP29	9411	hgsc.bcm.edu	37	1	94650461	94650461	+	Silent	SNP	G	G	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:94650461G>T	ENST00000260526.6	-	18	2258	c.2076C>A	c.(2074-2076)gcC>gcA	p.A692A	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	692	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CAATCTCTGAGGCACATATTT	0.328																																					p.A692A		Atlas-SNP	.											.	ARHGAP29	132	.	0			c.C2076A						PASS	.						74.0	76.0	75.0					1																	94650461		2201	4299	6500	SO:0001819	synonymous_variant	9411	exon18			CTCTGAGGCACAT		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2076C>A	chr1.hg19:g.94650461G>T		69.0	0.0	.		90.0	11.0	.	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Silent	SNP	ENST00000260526.6	hg19	CCDS748.1																																																																																			.	.	.	none		0.328	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
SASS6	163786	hgsc.bcm.edu	37	1	100573433	100573433	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:100573433T>A	ENST00000287482.5	-	9	1129	c.989A>T	c.(988-990)gAa>gTa	p.E330V	SASS6_ENST00000535161.1_Missense_Mutation_p.E163V|SASS6_ENST00000462159.1_5'UTR	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	330					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		ATCCTTGATTTCCTGTTCTAA	0.353																																					p.E330V		Atlas-SNP	.											.	SASS6	61	.	0			c.A989T						PASS	.						109.0	108.0	108.0					1																	100573433		2203	4300	6503	SO:0001583	missense	163786	exon9			TTGATTTCCTGTT	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.989A>T	chr1.hg19:g.100573433T>A	ENSP00000287482:p.Glu330Val	84.0	0.0	.		64.0	23.0	.	NM_194292	D3DT55|Q8N3K0	Missense_Mutation	SNP	ENST00000287482.5	hg19	CCDS764.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.649344	0.87958	.	.	ENSG00000156876	ENST00000287482;ENST00000539329;ENST00000535161	T;T	0.81163	-1.46;-1.46	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.88085	0.6342	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89635	0.3858	10	0.72032	D	0.01	-25.3753	16.2466	0.82448	0.0:0.0:0.0:1.0	.	330	Q6UVJ0	SAS6_HUMAN	V	330;303;163	ENSP00000287482:E330V;ENSP00000440169:E163V	ENSP00000287482:E330V	E	-	2	0	SASS6	100346021	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.495000	0.81514	2.229000	0.72834	0.477000	0.44152	GAA	.	.	.	none		0.353	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	NM_194292	
IGSF9	57549	hgsc.bcm.edu	37	1	159912854	159912854	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:159912854C>T	ENST00000368094.1	-	3	343	c.146G>A	c.(145-147)cGg>cAg	p.R49Q	IGSF9_ENST00000361509.3_Missense_Mutation_p.R49Q	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	49	Ig-like 1.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CAgggggggccggccggccgg	0.637																																					p.R49Q		Atlas-SNP	.											.	IGSF9	123	.	0			c.G146A						PASS	.						23.0	29.0	27.0					1																	159912854		2203	4300	6503	SO:0001583	missense	57549	exon3			GGGGGCCGGCCGG	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.146G>A	chr1.hg19:g.159912854C>T	ENSP00000357073:p.Arg49Gln	200.0	0.0	.		188.0	12.0	.	NM_001135050		Missense_Mutation	SNP	ENST00000368094.1	hg19	CCDS44254.1	.	.	.	.	.	.	.	.	.	.	C	11.24	1.579962	0.28180	.	.	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.27557	1.66;1.66	4.84	1.88	0.25563	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.204861	0.23402	N	0.048567	T	0.03608	0.0103	N	0.04508	-0.205	0.24333	N	0.994993	B;B	0.27853	0.007;0.191	B;B	0.20955	0.001;0.032	T	0.44360	-0.9333	9	.	.	.	-6.5247	8.9188	0.35599	0.0:0.7473:0.0:0.2527	.	49;49	Q9P2J2;C9JI81	TUTLA_HUMAN;.	Q	49	ENSP00000355049:R49Q;ENSP00000357073:R49Q	.	R	-	2	0	IGSF9	158179478	0.003000	0.15002	0.965000	0.40720	0.867000	0.49689	0.098000	0.15189	0.179000	0.19938	0.557000	0.71058	CGG	.	.	.	none		0.637	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789	
SLC9C2	284525	hgsc.bcm.edu	37	1	173503688	173503688	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:173503688C>T	ENST00000367714.3	-	16	2331	c.1909G>A	c.(1909-1911)Gta>Ata	p.V637I	SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Intron	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	637					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										AGTGCTGATACATTTAAACCT	0.249																																					p.V637I		Atlas-SNP	.											.	.	.	.	0			c.G1909A						PASS	.						37.0	44.0	42.0					1																	173503688		2162	4205	6367	SO:0001583	missense	284525	exon16			CTGATACATTTAA	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1909G>A	chr1.hg19:g.173503688C>T	ENSP00000356687:p.Val637Ile	320.0	1.0	.		457.0	218.0	.	NM_178527	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	hg19	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	C	5.777	0.327746	0.10956	.	.	ENSG00000162753	ENST00000367714	D	0.97328	-4.34	5.76	5.76	0.90799	.	0.407412	0.20491	N	0.091286	D	0.95341	0.8488	L	0.57536	1.79	0.80722	D	1	D	0.56968	0.978	P	0.48738	0.588	D	0.93530	0.6869	10	0.22706	T	0.39	-2.8591	15.4679	0.75416	0.0:1.0:0.0:0.0	.	637	Q5TAH2	S9A11_HUMAN	I	637	ENSP00000356687:V637I	ENSP00000356687:V637I	V	-	1	0	SLC9A11	171770311	0.824000	0.29247	0.416000	0.26546	0.130000	0.20726	1.138000	0.31491	2.721000	0.93114	0.609000	0.83330	GTA	.	.	.	none		0.249	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
KIAA1614	57710	hgsc.bcm.edu	37	1	180882414	180882414	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:180882414C>T	ENST00000367588.4	+	1	90	c.35C>T	c.(34-36)gCg>gTg	p.A12V		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	12										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						GCCAAACCCGCGGGCGGCAGC	0.776																																					p.A12V		Atlas-SNP	.											.	KIAA1614	75	.	0			c.C35T						PASS	.						2.0	2.0	2.0					1																	180882414		932	2251	3183	SO:0001583	missense	57710	exon1			AACCCGCGGGCGG	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.35C>T	chr1.hg19:g.180882414C>T	ENSP00000356560:p.Ala12Val	236.0	0.0	.		181.0	50.0	.	NM_020950	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	hg19	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440830	0.83993	.	.	ENSG00000135835	ENST00000367588	T	0.18174	2.23	3.93	2.91	0.33838	.	.	.	.	.	T	0.23688	0.0573	L	0.27053	0.805	0.20638	N	0.999872	D	0.89917	1.0	D	0.71870	0.975	T	0.08953	-1.0697	9	0.30078	T	0.28	-12.4368	8.5894	0.33677	0.0:0.6809:0.3191:0.0	.	12	Q5VZ46	K1614_HUMAN	V	12	ENSP00000356560:A12V	ENSP00000356560:A12V	A	+	2	0	KIAA1614	179149037	0.003000	0.15002	0.646000	0.29493	0.784000	0.44337	0.640000	0.24705	1.924000	0.55735	0.555000	0.69702	GCG	.	.	.	none		0.776	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
NFASC	23114	hgsc.bcm.edu	37	1	204955212	204955212	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:204955212G>A	ENST00000404076.1	+	21	3120	c.2698G>A	c.(2698-2700)Gag>Aag	p.E900K	NFASC_ENST00000367171.4_Missense_Mutation_p.E906K|NFASC_ENST00000367169.4_Intron|NFASC_ENST00000338586.6_Missense_Mutation_p.E921K|NFASC_ENST00000539706.1_Missense_Mutation_p.E917K|NFASC_ENST00000404907.1_Missense_Mutation_p.E917K|NFASC_ENST00000339876.6_Intron|NFASC_ENST00000338515.6_Missense_Mutation_p.E921K|NFASC_ENST00000360049.4_Missense_Mutation_p.E917K|NFASC_ENST00000367172.4_Missense_Mutation_p.E921K|NFASC_ENST00000513543.1_Missense_Mutation_p.E917K|NFASC_ENST00000401399.1_Intron|NFASC_ENST00000367170.4_Missense_Mutation_p.E921K			O94856	NFASC_HUMAN	neurofascin	921	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCCTCGCAGTGAGACCAAGGA	0.612																																					p.E932K		Atlas-SNP	.											.	NFASC	396	.	0			c.G2794A						PASS	.						75.0	65.0	68.0					1																	204955212		2203	4300	6503	SO:0001583	missense	23114	exon21			CGCAGTGAGACCA	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000404076.1:c.2698G>A	chr1.hg19:g.204955212G>A	ENSP00000385676:p.Glu900Lys	136.0	0.0	.		108.0	15.0	.	NM_001160331	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000404076.1	hg19		.	.	.	.	.	.	.	.	.	.	G	13.96	2.393311	0.42410	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000404076;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5	5.66	5.66	0.87406	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000079	T	0.54175	0.1842	L	0.54965	1.715	0.80722	D	1	B;B;B;P;B	0.38078	0.146;0.106;0.248;0.617;0.125	B;B;B;B;B	0.41412	0.053;0.089;0.115;0.356;0.115	T	0.46317	-0.9200	10	0.19590	T	0.45	.	19.3505	0.94381	0.0:0.0:1.0:0.0	.	921;932;917;906;917	O94856;O94856-11;O94856-8;F8W791;O94856-3	NFASC_HUMAN;.;.;.;.	K	921;906;921;921;921;932;917;917;900;917;917;908	ENSP00000356140:E921K;ENSP00000356139:E906K;ENSP00000356138:E921K;ENSP00000342128:E921K;ENSP00000343509:E921K;ENSP00000438614:E917K;ENSP00000353154:E917K;ENSP00000385676:E900K;ENSP00000384061:E917K;ENSP00000425908:E917K;ENSP00000415031:E908K	ENSP00000295776:E932K	E	+	1	0	NFASC	203221835	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	7.613000	0.82986	2.665000	0.90641	0.563000	0.77884	GAG	.	.	.	none		0.612	NFASC-012	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000131243.1	NM_001005388	
LCLAT1	253558	hgsc.bcm.edu	37	2	30863435	30863435	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr2:30863435T>A	ENST00000309052.4	+	7	1404	c.1195T>A	c.(1195-1197)Tac>Aac	p.Y399N	LCLAT1_ENST00000379509.3_Missense_Mutation_p.Y361N|LCLAT1_ENST00000540623.1_Missense_Mutation_p.Y361N|LCLAT1_ENST00000491680.2_3'UTR	NM_182551.3	NP_872357.2	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1	399					cardiolipin acyl-chain remodeling (GO:0035965)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|multicellular organismal development (GO:0007275)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)	19						ACTTGCATGTTACCGACTTTT	0.333																																					p.Y399N		Atlas-SNP	.											.	LCLAT1	51	.	0			c.T1195A						PASS	.						94.0	94.0	94.0					2																	30863435		2203	4300	6503	SO:0001583	missense	253558	exon7			GCATGTTACCGAC	AK095284	CCDS1772.1, CCDS42670.1	2p23.1	2008-12-15	2008-12-15	2008-12-15	ENSG00000172954	ENSG00000172954			26756	protein-coding gene	gene with protein product		614241	"""lysocardiolipin acyltransferase"""	LYCAT		18931347, 15152008, 16620771, 17675553	Standard	NM_001002257		Approved	FLJ37965, ALCAT1, AGPAT8	uc002rnl.3	Q6UWP7	OTTHUMG00000099349	ENST00000309052.4:c.1195T>A	chr2.hg19:g.30863435T>A	ENSP00000310551:p.Tyr399Asn	92.0	0.0	.		97.0	10.0	.	NM_182551	A6H8Z7|Q8N1Q7	Missense_Mutation	SNP	ENST00000309052.4	hg19	CCDS1772.1	.	.	.	.	.	.	.	.	.	.	T	12.53	1.965768	0.34659	.	.	ENSG00000172954	ENST00000379509;ENST00000309052;ENST00000540623	T;T;T	0.34275	1.46;1.37;1.46	6.03	4.89	0.63831	.	0.047907	0.85682	D	0.000000	T	0.26666	0.0652	L	0.27053	0.805	0.44221	D	0.997051	P	0.50272	0.933	B	0.44108	0.441	T	0.06075	-1.0847	10	0.72032	D	0.01	-20.2528	6.5263	0.22303	0.0:0.2756:0.0:0.7244	.	399	Q6UWP7	LCLT1_HUMAN	N	361;399;361	ENSP00000368823:Y361N;ENSP00000310551:Y399N;ENSP00000442857:Y361N	ENSP00000310551:Y399N	Y	+	1	0	LCLAT1	30716939	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	4.148000	0.58085	1.114000	0.41781	-0.379000	0.06801	TAC	.	.	.	none		0.333	LCLAT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216780.1	NM_182551	
TMEM17	200728	hgsc.bcm.edu	37	2	62729639	62729639	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr2:62729639A>G	ENST00000335390.5	-	3	462	c.251T>C	c.(250-252)aTc>aCc	p.I84T		NM_198276.2	NP_938017.2	Q86X19	TMM17_HUMAN	transmembrane protein 17	84					cilium assembly (GO:0042384)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	Lung NSC(7;0.0274)|all_lung(7;0.0568)		LUSC - Lung squamous cell carcinoma(7;1.31e-05)|Epithelial(17;0.169)			TATTAGGATGATAACAGTGAT	0.353																																					p.I84T		Atlas-SNP	.											.	TMEM17	19	.	0			c.T251C						PASS	.						102.0	100.0	100.0					2																	62729639		2203	4300	6503	SO:0001583	missense	200728	exon3			AGGATGATAACAG		CCDS1871.1	2p15	2008-02-05			ENSG00000186889	ENSG00000186889			26623	protein-coding gene	gene with protein product		614950				12477932	Standard	NM_198276		Approved	FLJ34583	uc002sbt.2	Q86X19	OTTHUMG00000129455	ENST00000335390.5:c.251T>C	chr2.hg19:g.62729639A>G	ENSP00000335094:p.Ile84Thr	162.0	0.0	.		137.0	9.0	.	NM_198276	Q53QP7|Q53R98	Missense_Mutation	SNP	ENST00000335390.5	hg19	CCDS1871.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.822568	0.50739	.	.	ENSG00000186889	ENST00000335390	D	0.88431	-2.38	5.96	5.96	0.96718	.	0.341351	0.33631	N	0.004712	T	0.80358	0.4608	N	0.19112	0.55	0.31954	N	0.609326	P	0.35226	0.491	B	0.31946	0.138	D	0.83619	0.0138	10	0.51188	T	0.08	-14.8168	11.4636	0.50225	0.9304:0.0:0.0696:0.0	.	84	Q86X19	TMM17_HUMAN	T	84	ENSP00000335094:I84T	ENSP00000335094:I84T	I	-	2	0	TMEM17	62583143	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	5.869000	0.69613	2.279000	0.76181	0.533000	0.62120	ATC	.	.	.	none		0.353	TMEM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251618.3	NM_198276	
KDM3A	55818	hgsc.bcm.edu	37	2	86669203	86669203	+	Silent	SNP	A	A	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr2:86669203A>G	ENST00000409556.1	+	3	398	c.33A>G	c.(31-33)gtA>gtG	p.V11V	KDM3A_ENST00000542128.1_Silent_p.V11V|KDM3A_ENST00000409064.1_Silent_p.V11V|KDM3A_ENST00000312912.5_Silent_p.V11V			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	11					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						GTTGGCCGGTATTGGTGGGGA	0.627																																					p.V11V	NSCLC(96;1150 1523 6936 46253 49736)	Atlas-SNP	.											.	KDM3A	179	.	0			c.A33G						PASS	.						96.0	97.0	97.0					2																	86669203		2203	4300	6503	SO:0001819	synonymous_variant	55818	exon2			GCCGGTATTGGTG	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.33A>G	chr2.hg19:g.86669203A>G		71.0	0.0	.		51.0	10.0	.	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	ENST00000409556.1	hg19	CCDS1990.1																																																																																			.	.	.	none		0.627	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125405359	125405359	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr2:125405359A>T	ENST00000431078.1	+	13	2262	c.1898A>T	c.(1897-1899)cAg>cTg	p.Q633L		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	633	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		ACATCAGTGCAGCACAACAAT	0.542																																					p.Q633L		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.A1898T						PASS	.						41.0	42.0	42.0					2																	125405359		2106	4236	6342	SO:0001583	missense	129684	exon13			CAGTGCAGCACAA	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1898A>T	chr2.hg19:g.125405359A>T	ENSP00000399013:p.Gln633Leu	196.0	0.0	.		187.0	14.0	.	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	A	13.11	2.138971	0.37728	.	.	ENSG00000155052	ENST00000431078	T	0.28895	1.59	5.5	5.5	0.81552	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (2);	0.000000	0.48286	D	0.000181	T	0.28995	0.0720	L	0.56124	1.755	0.43183	D	0.995009	B	0.28713	0.22	B	0.26416	0.069	T	0.07139	-1.0788	10	0.42905	T	0.14	.	10.8862	0.46968	0.8426:0.1573:0.0:0.0	.	633	Q8WYK1	CNTP5_HUMAN	L	633	ENSP00000399013:Q633L	ENSP00000399013:Q633L	Q	+	2	0	CNTNAP5	125121829	1.000000	0.71417	1.000000	0.80357	0.466000	0.32739	2.831000	0.48144	2.093000	0.63338	0.459000	0.35465	CAG	.	.	.	none		0.542	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
MAP3K19	80122	hgsc.bcm.edu	37	2	135738784	135738784	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr2:135738784T>C	ENST00000375845.3	-	9	3557	c.3527A>G	c.(3526-3528)tAt>tGt	p.Y1176C	MAP3K19_ENST00000392917.3_Missense_Mutation_p.Y308C|MAP3K19_ENST00000358371.4_Missense_Mutation_p.Y1063C|MAP3K19_ENST00000375844.3_Missense_Mutation_p.Y358C|MAP3K19_ENST00000315513.3_Missense_Mutation_p.Y37C|MAP3K19_ENST00000392918.3_Missense_Mutation_p.Y310C|MAP3K19_ENST00000392915.1_3'UTR	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										CTCATGGAGATAAGCAACACC	0.408																																					p.Y1176C		Atlas-SNP	.											.	.	.	.	0			c.A3527G						PASS	.						146.0	143.0	144.0					2																	135738784		2203	4300	6503	SO:0001583	missense	80122	exon9			TGGAGATAAGCAA	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3527A>G	chr2.hg19:g.135738784T>C	ENSP00000365005:p.Tyr1176Cys	55.0	0.0	.		70.0	26.0	.	NM_025052	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	hg19	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	T	20.4	3.984760	0.74474	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000437365;ENST00000315513	T;T;T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	5.75	5.75	0.90469	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42053	D	0.000766	D	0.88592	0.6478	M	0.90595	3.13	0.58432	D	0.999994	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.968;1.0;1.0;1.0	D	0.90863	0.4740	10	0.87932	D	0	.	15.2483	0.73523	0.0:0.0:0.0:1.0	.	308;1063;310;358;1176	B7ZMH9;Q56UN5-3;Q56UN5-4;Q56UN5-5;Q56UN5	.;.;.;.;YSK4_HUMAN	C	1176;1063;358;310;308;566;37	ENSP00000365005:Y1176C;ENSP00000351140:Y1063C;ENSP00000365004:Y358C;ENSP00000376650:Y310C;ENSP00000376649:Y308C;ENSP00000392827:Y566C;ENSP00000321160:Y37C	ENSP00000321160:Y37C	Y	-	2	0	YSK4	135455254	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.921000	0.63397	2.192000	0.70111	0.460000	0.39030	TAT	.	.	.	none		0.408	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
TTN	7273	hgsc.bcm.edu	37	2	179396967	179396967	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr2:179396967A>C	ENST00000591111.1	-	308	99676	c.99452T>G	c.(99451-99453)tTc>tGc	p.F33151C	TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.F25919C|TTN_ENST00000342992.6_Missense_Mutation_p.F32224C|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.F25852C|TTN-AS1_ENST00000592182.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.F25727C|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.F34792C			Q8WZ42	TITIN_HUMAN	titin	33151					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTGACATGAAGTCAAGTTC	0.423																																					p.F34792C		Atlas-SNP	.											.	TTN	18412	.	0			c.T104375G						PASS	.						151.0	137.0	142.0					2																	179396967		1938	4141	6079	SO:0001583	missense	7273	exon358			GACATGAAGTCAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.99452T>G	chr2.hg19:g.179396967A>C	ENSP00000465570:p.Phe33151Cys	31.0	0.0	.		32.0	9.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	9.296	1.051828	0.19827	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64618	-0.11;0.12;0.1;0.09	5.55	4.39	0.52855	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.42944	0.1225	N	0.08118	0	0.25146	N	0.990465	B;B;B;B	0.20368	0.044;0.044;0.044;0.044	B;B;B;B	0.09377	0.002;0.002;0.004;0.004	T	0.39563	-0.9608	9	0.87932	D	0	.	11.6729	0.51413	0.1339:0.0:0.0:0.8661	.	25727;25852;25919;33151	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	32224;25727;25919;25852;25724	ENSP00000343764:F32224C;ENSP00000434586:F25727C;ENSP00000340554:F25919C;ENSP00000352154:F25852C	ENSP00000340554:F25919C	F	-	2	0	TTN	179105213	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	1.227000	0.32576	0.935000	0.37341	-0.282000	0.10007	TTC	.	.	.	none		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
XRCC5	7520	hgsc.bcm.edu	37	2	216982471	216982471	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr2:216982471C>A	ENST00000392133.3	+	6	783	c.322C>A	c.(322-324)Ctg>Atg	p.L108M	XRCC5_ENST00000392132.2_Missense_Mutation_p.L108M			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	108					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		TAGCTGAGTCCTGGATGCACT	0.418								Non-homologous end-joining																													p.L108M		Atlas-SNP	.											.	XRCC5	64	.	0			c.C322A						PASS	.						158.0	133.0	141.0					2																	216982471		2203	4300	6503	SO:0001583	missense	7520	exon4			TGAGTCCTGGATG	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.322C>A	chr2.hg19:g.216982471C>A	ENSP00000375978:p.Leu108Met	55.0	0.0	.		71.0	20.0	.	NM_021141	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	ENST00000392133.3	hg19	CCDS2402.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948208	0.73787	.	.	ENSG00000079246	ENST00000392133;ENST00000392132;ENST00000417391	T;T	0.35789	1.29;1.29	5.74	3.87	0.44632	Ku70/Ku80, N-terminal alpha/beta (1);von Willebrand factor, type A (1);	0.154656	0.44097	D	0.000500	T	0.44244	0.1284	M	0.65975	2.015	0.54753	D	0.999988	P	0.45396	0.857	P	0.50791	0.65	T	0.32428	-0.9907	10	0.38643	T	0.18	.	8.8825	0.35382	0.0:0.7152:0.1506:0.1342	.	108	P13010	XRCC5_HUMAN	M	108;108;95	ENSP00000375978:L108M;ENSP00000375977:L108M	ENSP00000375977:L108M	L	+	1	2	XRCC5	216690716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.453000	0.44970	1.319000	0.45190	0.650000	0.86243	CTG	.	.	.	none		0.418	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	
SH3BP4	23677	hgsc.bcm.edu	37	2	235950616	235950616	+	Silent	SNP	A	A	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr2:235950616A>T	ENST00000409212.1	+	4	1710	c.1203A>T	c.(1201-1203)atA>atT	p.I401I	SH3BP4_ENST00000392011.2_Silent_p.I401I|SH3BP4_ENST00000344528.4_Silent_p.I401I			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	401					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CAGCCGAGATAAAAAATGACC	0.532																																					p.I401I		Atlas-SNP	.											.	SH3BP4	109	.	0			c.A1203T						PASS	.						43.0	45.0	44.0					2																	235950616		2203	4300	6503	SO:0001819	synonymous_variant	23677	exon4			CGAGATAAAAAAT	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1203A>T	chr2.hg19:g.235950616A>T		78.0	0.0	.		68.0	19.0	.	NM_014521	O95082|Q309A3|Q53QD0|Q53TD1	Silent	SNP	ENST00000409212.1	hg19	CCDS2513.1																																																																																			.	.	.	none		0.532	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
DLEC1	9940	hgsc.bcm.edu	37	3	38158502	38158502	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr3:38158502T>C	ENST00000308059.6	+	30	4237	c.4216T>C	c.(4216-4218)Tcc>Ccc	p.S1406P	DLEC1_ENST00000452631.2_Missense_Mutation_p.S1409P|DLEC1_ENST00000346219.3_Missense_Mutation_p.S1406P					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CATCTACATCTCCTTCACCCC	0.587																																					p.S1406P		Atlas-SNP	.											.	DLEC1	278	.	0			c.T4216C						PASS	.						95.0	97.0	97.0					3																	38158502		2099	4231	6330	SO:0001583	missense	9940	exon30			TACATCTCCTTCA	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.4216T>C	chr3.hg19:g.38158502T>C	ENSP00000308597:p.Ser1406Pro	59.0	0.0	.		32.0	10.0	.	NM_007337		Missense_Mutation	SNP	ENST00000308059.6	hg19	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	T	14.83	2.652603	0.47362	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.08458	3.12;3.09;3.35	4.39	4.39	0.52855	.	0.000000	0.64402	U	0.000001	T	0.27697	0.0681	M	0.75264	2.295	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.98;0.998;0.98;0.98	T	0.02026	-1.1227	10	0.72032	D	0.01	-25.6014	12.5811	0.56391	0.0:0.0:0.0:1.0	.	1409;1406;1406;1406	F8W6T4;B7ZW06;Q9Y238-3;Q9Y238	.;.;.;DLEC1_HUMAN	P	1406;1406;1409	ENSP00000308597:S1406P;ENSP00000315914:S1406P;ENSP00000410427:S1409P	ENSP00000308597:S1406P	S	+	1	0	DLEC1	38133506	1.000000	0.71417	0.978000	0.43139	0.097000	0.18754	3.903000	0.56318	1.610000	0.50200	0.379000	0.24179	TCC	.	.	.	none		0.587	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
PHF7	51533	hgsc.bcm.edu	37	3	52443600	52443600	+	5'Flank	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr3:52443600T>C	ENST00000327906.3	+	0	0				PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000460680.1_Missense_Mutation_p.E31G|BAP1_ENST00000296288.5_Missense_Mutation_p.E31G	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.E31A(1)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		GTCGTAGATCTCCTCCACTTG	0.617																																					p.E31G		Atlas-SNP	.											BAP1,NS,carcinoma,0,2	BAP1	371	.	1	Substitution - Missense(1)	kidney(1)	c.A92G						PASS	.						218.0	227.0	224.0					3																	52443600		2203	4300	6503	SO:0001631	upstream_gene_variant	8314	exon3			TAGATCTCCTCCA	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		chr3.hg19:g.52443600T>C	Exception_encountered	142.0	0.0	.		53.0	21.0	.	NM_004656	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	hg19	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	T	33	5.244578	0.95272	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.61274	0.12;0.12	4.97	4.97	0.65823	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.85682	D	0.000000	T	0.82144	0.4973	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87513	0.2441	10	0.87932	D	0	-3.7767	14.6644	0.68896	0.0:0.0:0.0:1.0	.	31	Q92560	BAP1_HUMAN	G	31	ENSP00000417132:E31G;ENSP00000296288:E31G	ENSP00000296288:E31G	E	-	2	0	BAP1	52418640	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.825000	0.86693	1.875000	0.54330	0.533000	0.62120	GAG	.	.	.	none		0.617	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
ITIH1	3697	hgsc.bcm.edu	37	3	52813055	52813055	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr3:52813055C>A	ENST00000273283.2	+	4	427	c.403C>A	c.(403-405)Ctt>Att	p.L135I	ITIH1_ENST00000540715.1_De_novo_Start_OutOfFrame|ITIH1_ENST00000537050.1_5'Flank|ITIH1_ENST00000542827.1_Missense_Mutation_p.L135I	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	135	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		GAATGCCGGCCTTGTCAGGTG	0.547																																					p.L135I		Atlas-SNP	.											.	ITIH1	108	.	0			c.C403A						PASS	.						113.0	94.0	100.0					3																	52813055		2203	4300	6503	SO:0001583	missense	3697	exon4			GCCGGCCTTGTCA		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.403C>A	chr3.hg19:g.52813055C>A	ENSP00000273283:p.Leu135Ile	54.0	0.0	.		24.0	6.0	.	NM_002215	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	hg19	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512092	0.64522	.	.	ENSG00000055957	ENST00000542827;ENST00000273283	T;T	0.26373	1.74;1.74	5.05	3.2	0.36748	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.43211	0.1237	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.27571	-1.0070	10	0.48119	T	0.1	-15.2366	10.4182	0.44335	0.0:0.8434:0.0:0.1566	.	135	P19827	ITIH1_HUMAN	I	135	ENSP00000442584:L135I;ENSP00000273283:L135I	ENSP00000273283:L135I	L	+	1	0	ITIH1	52788095	0.901000	0.30685	0.994000	0.49952	0.897000	0.52465	0.730000	0.26043	1.345000	0.45676	0.561000	0.74099	CTT	.	.	.	none		0.547	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
ERC2	26059	hgsc.bcm.edu	37	3	55768866	55768866	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr3:55768866T>C	ENST00000288221.6	-	15	2900	c.2645A>G	c.(2644-2646)aAg>aGg	p.K882R		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	882	Poly-Lys.					cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TTCCTGCGTCTTTTTCTTTTT	0.443																																					p.K880R		Atlas-SNP	.											.	ERC2	221	.	0			c.A2639G						PASS	.						91.0	83.0	86.0					3																	55768866		1846	4120	5966	SO:0001583	missense	26059	exon14			TGCGTCTTTTTCT	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2645A>G	chr3.hg19:g.55768866T>C	ENSP00000288221:p.Lys882Arg	49.0	0.0	.		46.0	4.0	.	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	hg19	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	T	29.3	4.998014	0.93227	.	.	ENSG00000187672	ENST00000288221	T	0.47177	0.85	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.57475	0.2056	L	0.37750	1.13	0.46222	D	0.998937	D	0.57257	0.979	D	0.71414	0.973	T	0.52087	-0.8622	10	0.24483	T	0.36	-20.7165	15.6587	0.77165	0.0:0.0:0.0:1.0	.	882	O15083	ERC2_HUMAN	R	882	ENSP00000288221:K882R	ENSP00000288221:K882R	K	-	2	0	ERC2	55743906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.109000	0.64355	0.533000	0.62120	AAG	.	.	.	none		0.443	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
CFAP44	55779	hgsc.bcm.edu	37	3	113125861	113125861	+	Silent	SNP	G	G	A	rs543988684		TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr3:113125861G>A	ENST00000295868.2	-	8	1080	c.918C>T	c.(916-918)acC>acT	p.T306T	WDR52_ENST00000393845.2_Silent_p.T306T|WDR52-AS1_ENST00000473329.1_RNA|WDR52-AS1_ENST00000498480.1_RNA	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						GCTTGAGACCGGTGAACGTAA	0.398													T|||	1	0.000199681	0.0	0.0	5008	,	,		16680	0.0		0.0	False		,,,				2504	0.001				p.T306T		Atlas-SNP	.											.	WDR52	151	.	0			c.C918T						PASS	.						140.0	127.0	131.0					3																	113125861		2203	4300	6503	SO:0001819	synonymous_variant	55779	exon8			GAGACCGGTGAAC																												ENST00000295868.2:c.918C>T	chr3.hg19:g.113125861G>A		101.0	0.0	.		150.0	28.0	.	NM_001164496		Silent	SNP	ENST00000295868.2	hg19	CCDS2972.1																																																																																			.	.	.	none		0.398	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		
OTOL1	131149	hgsc.bcm.edu	37	3	161220933	161220933	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr3:161220933G>A	ENST00000327928.4	+	4	637	c.637G>A	c.(637-639)Gct>Act	p.A213T		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	213	Collagen-like 2.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						AGACCAAGGGGCTATGGGCTC	0.557																																					p.A213T		Atlas-SNP	.											.	OTOL1	63	.	0			c.G637A						PASS	.						5.0	6.0	6.0					3																	161220933		1825	3981	5806	SO:0001583	missense	131149	exon4			CAAGGGGCTATGG		CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.637G>A	chr3.hg19:g.161220933G>A	ENSP00000330808:p.Ala213Thr	135.0	0.0	.		280.0	68.0	.	NM_001080440		Missense_Mutation	SNP	ENST00000327928.4	hg19	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	G	6.893	0.534174	0.13188	.	.	ENSG00000182447	ENST00000327928	D	0.94232	-3.38	5.12	2.14	0.27477	.	0.710572	0.13922	N	0.353481	D	0.85911	0.5807	L	0.35542	1.07	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.69785	-0.5051	10	0.18276	T	0.48	.	4.7642	0.13123	0.0881:0.1479:0.611:0.153	.	213	A6NHN0	OTOL1_HUMAN	T	213	ENSP00000330808:A213T	ENSP00000330808:A213T	A	+	1	0	OTOL1	162703627	0.071000	0.21146	0.002000	0.10522	0.050000	0.14768	0.782000	0.26788	0.111000	0.17947	0.557000	0.71058	GCT	.	.	.	none		0.557	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440	
BCL6	604	hgsc.bcm.edu	37	3	187446278	187446278	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr3:187446278C>A	ENST00000406870.2	-	6	1776	c.1410G>T	c.(1408-1410)atG>atT	p.M470I	BCL6_ENST00000232014.4_Missense_Mutation_p.M470I|RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000450123.2_Missense_Mutation_p.M470I|RP11-211G3.3_ENST00000449623.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	470					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		TCGGGGGGTGCATGTAGAGTG	0.632			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.M470I		Atlas-SNP	.		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	BCL6	107	.	0			c.G1410T						PASS	.						65.0	58.0	60.0					3																	187446278		2203	4300	6503	SO:0001583	missense	604	exon5			GGGGTGCATGTAG		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1410G>T	chr3.hg19:g.187446278C>A	ENSP00000384371:p.Met470Ile	53.0	0.0	.		71.0	35.0	.	NM_001134738	A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	ENST00000406870.2	hg19	CCDS3289.1	.	.	.	.	.	.	.	.	.	.	C	11.24	1.581183	0.28180	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123	T;T;T	0.07567	3.19;3.19;3.18	5.09	3.14	0.36123	.	0.499500	0.22842	N	0.054964	T	0.05823	0.0152	N	0.25647	0.755	0.41396	D	0.987646	B;B	0.09022	0.0;0.002	B;B	0.04013	0.001;0.001	T	0.30357	-0.9981	10	0.33940	T	0.23	.	7.6733	0.28471	0.2589:0.6611:0.0:0.08	.	470;470	B8PSA7;P41182	.;BCL6_HUMAN	I	470	ENSP00000384371:M470I;ENSP00000232014:M470I;ENSP00000413122:M470I	ENSP00000232014:M470I	M	-	3	0	BCL6	188928972	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	1.641000	0.37197	1.468000	0.48064	0.561000	0.74099	ATG	.	.	.	none		0.632	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
MUC4	4585	hgsc.bcm.edu	37	3	195492266	195492266	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr3:195492266C>T	ENST00000346145.4	-	8	1004	c.965G>A	c.(964-966)cGt>cAt	p.R322H	MUC4_ENST00000475231.1_Missense_Mutation_p.R4506H|MUC4_ENST00000463781.3_Missense_Mutation_p.R4558H|MUC4_ENST00000349607.4_Missense_Mutation_p.R271H	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1315					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCACTCGAGACGGTAGTTGGG	0.652																																					p.R4558H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	.	0			c.G13673A						PASS	.						45.0	42.0	43.0					3																	195492266		2203	4300	6503	SO:0001583	missense	4585	exon9			TCGAGACGGTAGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.965G>A	chr3.hg19:g.195492266C>T	ENSP00000304207:p.Arg322His	110.0	0.0	.		77.0	4.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000346145.4	hg19	CCDS3310.1	.	.	.	.	.	.	.	.	.	.	.	12.67	2.008048	0.35415	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.41065	1.01;1.36;1.3;1.3	4.15	3.26	0.37387	AMOP (2);	0.208574	0.21556	U	0.072656	T	0.61476	0.2350	M	0.73598	2.24	0.30861	N	0.73352	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.75484	0.986;0.971;0.955;0.955;0.938;0.938;0.981	T	0.64947	-0.6287	10	0.59425	D	0.04	-0.2742	11.3015	0.49309	0.0:0.9096:0.0:0.0904	.	4430;1315;271;322;4558;4506;1263	E7ESK3;Q99102;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;MUC4_HUMAN;.;.;.;.;.	H	271;322;4558;4506;1284	ENSP00000338109:R271H;ENSP00000304207:R322H;ENSP00000417498:R4558H;ENSP00000420243:R4506H	ENSP00000304207:R322H	R	-	2	0	MUC4	196977937	0.955000	0.32602	0.992000	0.48379	0.138000	0.21146	2.284000	0.43478	0.942000	0.37525	0.461000	0.40582	CGT	.	.	.	none		0.652	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195511408	195511408	+	Missense_Mutation	SNP	C	C	T	rs555627961		TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr3:195511408C>T	ENST00000463781.3	-	2	7502	c.7043G>A	c.(7042-7044)gGt>gAt	p.G2348D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.G2348D|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGTGGCGTGACCTGTGGATGC	0.587													.|||	1	0.000199681	0.0	0.0	5008	,	,		23267	0.001		0.0	False		,,,				2504	0.0				p.G2348D		Atlas-SNP	.											.	MUC4	1505	.	0			c.G7043A						PASS	.						9.0	11.0	10.0					3																	195511408		616	1545	2161	SO:0001583	missense	4585	exon2			GCGTGACCTGTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7043G>A	chr3.hg19:g.195511408C>T	ENSP00000417498:p.Gly2348Asp	100.0	0.0	.		114.0	9.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	2.717	-0.267508	0.05754	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36340	1.26;1.32	.	.	.	.	.	.	.	.	T	0.16896	0.0406	N	0.19112	0.55	0.09310	N	1	B	0.15141	0.012	B	0.01281	0.0	T	0.23547	-1.0185	7	.	.	.	.	1.4135	0.02296	0.3442:0.3283:0.0:0.3275	.	2348	E7ESK3	.	D	2348	ENSP00000417498:G2348D;ENSP00000420243:G2348D	.	G	-	2	0	MUC4	196995803	0.000000	0.05858	0.017000	0.16124	0.063000	0.16089	-1.298000	0.02756	-0.417000	0.07461	0.064000	0.15345	GGT	.	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
GPR98	84059	hgsc.bcm.edu	37	5	90012405	90012405	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr5:90012405C>A	ENST00000405460.2	+	43	9402	c.9306C>A	c.(9304-9306)taC>taA	p.Y3102*		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3102	Calx-beta 22. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CAGTATTGTACATTGTTCGGG	0.428																																					p.Y3102X		Atlas-SNP	.											.	GPR98	605	.	0			c.C9306A						PASS	.						93.0	86.0	88.0					5																	90012405		1869	4102	5971	SO:0001587	stop_gained	84059	exon43			ATTGTACATTGTT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.9306C>A	chr5.hg19:g.90012405C>A	ENSP00000384582:p.Tyr3102*	136.0	0.0	.		138.0	16.0	.	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	49|49	15.942102|15.942102	0.99849|0.99849	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000509621|ENST00000405460;ENST00000296619	.|.	.|.	.|.	6.01|6.01	1.91|1.91	0.25777|0.25777	.|.	.|0.473406	.|0.26016	.|N	.|0.026847	T|.	0.13798|.	0.0334|.	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999999|0.999999	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34279|.	-0.9835|.	4|.	.|0.02654	.|T	.|1	.|.	9.5215|9.5215	0.39138|0.39138	0.0:0.513:0.0:0.487|0.0:0.513:0.0:0.487	.|.	.|.	.|.	.|.	K|X	668|3102	.|.	.|ENSP00000296619:Y3102X	T|Y	+|+	2|3	0|2	GPR98|GPR98	90048161|90048161	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.398000|0.398000	0.30690|0.30690	-0.367000|-0.367000	0.07553|0.07553	0.049000|0.049000	0.15920|0.15920	0.650000|0.650000	0.86243|0.86243	ACA|TAC	.	.	.	none		0.428	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
MCC	4163	hgsc.bcm.edu	37	5	112420999	112420999	+	Missense_Mutation	SNP	C	C	A	rs560764461		TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr5:112420999C>A	ENST00000302475.4	-	7	1400	c.837G>T	c.(835-837)gaG>gaT	p.E279D	MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Missense_Mutation_p.E216D|MCC_ENST00000408903.3_Missense_Mutation_p.E469D	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	279					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GAGTTTGAAGCTCTCTGACCT	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18161	0.0		0.0	False		,,,				2504	0.0				p.E469D		Atlas-SNP	.											.	MCC	234	.	0			c.G1407T						PASS	.						134.0	134.0	134.0					5																	112420999		2202	4300	6502	SO:0001583	missense	4163	exon9			TTGAAGCTCTCTG		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.837G>T	chr5.hg19:g.112420999C>A	ENSP00000305617:p.Glu279Asp	46.0	0.0	.		62.0	25.0	.	NM_001085377	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000302475.4	hg19	CCDS4111.1	.	.	.	.	.	.	.	.	.	.	C	19.80	3.894175	0.72639	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.55930	0.49;0.49;0.49	5.73	2.6	0.31112	Usher syndrome type-1C protein-binding protein 1, PDZ domain (1);	0.000000	0.85682	D	0.000000	T	0.53514	0.1801	L	0.27053	0.805	0.47407	D	0.99941	D;D;D;D	0.57257	0.979;0.979;0.974;0.979	D;D;D;D	0.71414	0.973;0.973;0.969;0.973	T	0.50039	-0.8874	10	0.44086	T	0.13	-27.2275	7.6576	0.28383	0.0:0.5691:0.0:0.4309	.	279;241;469;279	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	D	279;216;469	ENSP00000305617:E279D;ENSP00000421615:E216D;ENSP00000386227:E469D	ENSP00000305617:E279D	E	-	3	2	MCC	112448898	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	0.795000	0.26972	0.781000	0.33589	0.655000	0.94253	GAG	.	.	.	none		0.537	MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377	
PCDHGB7	56099	hgsc.bcm.edu	37	5	140797588	140797588	+	Silent	SNP	A	A	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr5:140797588A>C	ENST00000398594.2	+	1	162	c.162A>C	c.(160-162)ctA>ctC	p.L54L	PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	54	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTAAGGATCTAGGGCTTAGTG	0.612											OREG0016863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L54L		Atlas-SNP	.											.	PCDHGB7	117	.	0			c.A162C						PASS	.						62.0	68.0	66.0					5																	140797588		1962	4150	6112	SO:0001819	synonymous_variant	56099	exon1			GGATCTAGGGCTT	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.162A>C	chr5.hg19:g.140797588A>C		132.0	0.0	.	1659	59.0	21.0	.	NM_018927	Q9UN63	Silent	SNP	ENST00000398594.2	hg19	CCDS47293.1																																																																																			.	.	.	none		0.612	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
SH3TC2	79628	hgsc.bcm.edu	37	5	148386485	148386485	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr5:148386485C>G	ENST00000515425.1	-	16	3735	c.3634G>C	c.(3634-3636)Gtg>Ctg	p.V1212L	SH3TC2_ENST00000538184.1_3'UTR|SH3TC2_ENST00000502274.1_Missense_Mutation_p.V74L|SH3TC2_ENST00000512049.1_Missense_Mutation_p.V1205L	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	1212					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGATAATACACCTTGGCATAG	0.552																																					p.V1212L		Atlas-SNP	.											.	SH3TC2	178	.	0			c.G3634C						PASS	.						114.0	117.0	116.0					5																	148386485		2203	4300	6503	SO:0001583	missense	79628	exon16			AATACACCTTGGC	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.3634G>C	chr5.hg19:g.148386485C>G	ENSP00000423660:p.Val1212Leu	126.0	0.0	.		112.0	26.0	.	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	hg19	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885931	0.72410	.	.	ENSG00000169247	ENST00000502274;ENST00000515425;ENST00000512049	T;D;T	0.81499	0.55;-1.5;-0.91	6.17	6.17	0.99709	Tetratricopeptide-like helical (1);	0.133551	0.49916	D	0.000137	T	0.79003	0.4373	M	0.62723	1.935	0.80722	D	1	B;B;B	0.24043	0.096;0.096;0.096	B;B;B	0.24848	0.051;0.056;0.051	T	0.74583	-0.3617	10	0.51188	T	0.08	-10.8348	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	1205;1212;1212	Q14CC0;E9PDF1;Q8TF17	.;.;S3TC2_HUMAN	L	74;1212;1205	ENSP00000421092:V74L;ENSP00000423660:V1212L;ENSP00000421860:V1205L	ENSP00000421092:V74L	V	-	1	0	SH3TC2	148366678	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	3.051000	0.49885	2.941000	0.99782	0.655000	0.94253	GTG	.	.	.	none		0.552	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
C2	717	hgsc.bcm.edu	37	6	31905164	31905164	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr6:31905164C>A	ENST00000299367.5	+	8	1333	c.1057C>A	c.(1057-1059)Caa>Aaa	p.Q353K	C2_ENST00000469372.1_Missense_Mutation_p.Q107K|CFB_ENST00000477310.1_Missense_Mutation_p.Q171K|CFB_ENST00000456570.1_Missense_Mutation_p.Q200K|C2_ENST00000452323.2_Missense_Mutation_p.Q139K|C2_ENST00000442278.2_Missense_Mutation_p.Q221K|CFB_ENST00000556679.1_Missense_Mutation_p.Q200K	NM_000063.4	NP_000054.2	P06681	CO2_HUMAN	complement component 2	353	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	27		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		GATGAACAACCAAATGCGACT	0.473																																					p.Q353K		Atlas-SNP	.											.	C2	50	.	0			c.C1057A						PASS	.						212.0	207.0	209.0					6																	31905164		1511	2709	4220	SO:0001583	missense	717	exon8			AACAACCAAATGC		CCDS4728.1, CCDS54991.1, CCDS56416.1, CCDS75427.1, CCDS75428.1	6p21.3	2014-09-17			ENSG00000166278	ENSG00000166278		"""Complement system"""	1248	protein-coding gene	gene with protein product		613927					Standard	NM_001145903		Approved		uc011hbs.1	P06681	OTTHUMG00000031190	ENST00000299367.5:c.1057C>A	chr6.hg19:g.31905164C>A	ENSP00000299367:p.Gln353Lys	113.0	0.0	.		83.0	24.0	.	NM_000063	B4DPF3|B4DV20|E9PFN7|O19694|Q13904	Missense_Mutation	SNP	ENST00000299367.5	hg19	CCDS4728.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.131136	0.37630	.	.	ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000243649;ENSG00000244255;ENSG00000244255	ENST00000469372;ENST00000497706;ENST00000432397;ENST00000452323;ENST00000299367;ENST00000375493;ENST00000442278;ENST00000556679;ENST00000456570;ENST00000477310	D;D;D;D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66;-1.66;-1.66;-1.66	4.97	4.06	0.47325	von Willebrand factor, type A (3);	0.000000	0.36972	N	0.002318	T	0.74068	0.3668	L	0.49350	1.555	0.26005	N	0.98206	P;P;P;P;P;P;P;B;P	0.45672	0.791;0.84;0.49;0.84;0.673;0.807;0.814;0.048;0.864	P;P;B;B;B;P;P;P;B	0.48488	0.463;0.498;0.299;0.413;0.395;0.486;0.579;0.45;0.407	T	0.65689	-0.6107	10	0.25106	T	0.35	-13.0037	13.1289	0.59369	0.0:0.8253:0.1747:0.0	.	200;324;139;107;221;38;221;353;140	B4E1Z4;B4DV48;B4DPF3;B4DQI1;E9PFN7;F8VNY6;B4DV20;P06681;E9PDZ0	.;.;.;.;.;.;.;CO2_HUMAN;.	K	107;140;140;139;353;38;221;200;200;171	ENSP00000418923:Q107K;ENSP00000417482:Q140K;ENSP00000392322:Q139K;ENSP00000299367:Q353K;ENSP00000395683:Q221K;ENSP00000451848:Q200K;ENSP00000410815:Q200K;ENSP00000418996:Q171K	ENSP00000299367:Q353K	Q	+	1	0	CFB;C2;XXbac-BPG116M5.17	32013143	0.995000	0.38212	0.955000	0.39395	0.047000	0.14425	1.563000	0.36364	2.596000	0.87737	0.544000	0.68410	CAA	.	.	.	none		0.473	C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076379.9		
AZGP1	563	hgsc.bcm.edu	37	7	99565822	99565822	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr7:99565822A>T	ENST00000292401.4	-	3	705	c.569T>A	c.(568-570)cTg>cAg	p.L190Q	AZGP1_ENST00000411734.1_Missense_Mutation_p.L187Q|AZGP1_ENST00000483612.1_5'Flank	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	190					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GTATTTCCGCAGAGTCGCAGG	0.547																																					p.L190Q		Atlas-SNP	.											.	AZGP1	41	.	0			c.T569A						PASS	.						99.0	96.0	97.0					7																	99565822		2203	4300	6503	SO:0001583	missense	563	exon3			TTCCGCAGAGTCG	BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.569T>A	chr7.hg19:g.99565822A>T	ENSP00000292401:p.Leu190Gln	59.0	0.0	.		33.0	10.0	.	NM_001185	D6W5T8|O60386|Q5XKQ4|Q8N4N0	Missense_Mutation	SNP	ENST00000292401.4	hg19	CCDS5680.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.240853	0.79912	.	.	ENSG00000160862	ENST00000292401;ENST00000411734	D;D	0.96554	-4.05;-4.05	2.76	2.76	0.32466	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.000000	0.26522	U	0.023916	D	0.98560	0.9519	H	0.97918	4.105	0.45762	D	0.99865	D	0.76494	0.999	D	0.75020	0.985	D	0.98106	1.0417	10	0.87932	D	0	.	9.2502	0.37551	1.0:0.0:0.0:0.0	.	190	P25311	ZA2G_HUMAN	Q	190;187	ENSP00000292401:L190Q;ENSP00000396093:L187Q	ENSP00000292401:L190Q	L	-	2	0	AZGP1	99403758	1.000000	0.71417	0.063000	0.19743	0.661000	0.39034	7.145000	0.77365	1.200000	0.43188	0.260000	0.18958	CTG	.	.	.	none		0.547	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059387.4	NM_001185	
GPR37	2861	hgsc.bcm.edu	37	7	124387366	124387366	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr7:124387366A>G	ENST00000303921.2	-	2	1705	c.1055T>C	c.(1054-1056)tTa>tCa	p.L352S		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	352					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CAGAGCACATAAGGTGAAAGT	0.473																																					p.L352S		Atlas-SNP	.											.	GPR37	89	.	0			c.T1055C						PASS	.						60.0	62.0	61.0					7																	124387366		2203	4300	6503	SO:0001583	missense	2861	exon2			GCACATAAGGTGA		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1055T>C	chr7.hg19:g.124387366A>G	ENSP00000306449:p.Leu352Ser	43.0	0.0	.		58.0	6.0	.	NM_005302	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	hg19	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	A	16.35	3.098540	0.56183	.	.	ENSG00000170775	ENST00000303921	T	0.81415	-1.49	5.77	5.77	0.91146	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000298	D	0.89259	0.6664	M	0.76002	2.32	0.51233	D	0.999911	D	0.89917	1.0	D	0.97110	1.0	D	0.90432	0.4425	10	0.87932	D	0	-7.7845	15.2683	0.73681	1.0:0.0:0.0:0.0	.	352	O15354	GPR37_HUMAN	S	352	ENSP00000306449:L352S	ENSP00000306449:L352S	L	-	2	0	GPR37	124174602	0.998000	0.40836	0.949000	0.38748	0.352000	0.29268	9.339000	0.96797	2.202000	0.70862	0.533000	0.62120	TTA	.	.	.	none		0.473	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
TMEM139	135932	hgsc.bcm.edu	37	7	142983223	142983223	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr7:142983223T>C	ENST00000359333.3	+	2	686	c.173T>C	c.(172-174)tTt>tCt	p.F58S	TMEM139_ENST00000409541.1_Missense_Mutation_p.F58S|TMEM139_ENST00000409102.1_Missense_Mutation_p.F58S|TMEM139_ENST00000410004.1_Missense_Mutation_p.F58S|CASP2_ENST00000392925.2_5'Flank|CASP2_ENST00000310447.5_5'Flank|TMEM139_ENST00000409244.1_Missense_Mutation_p.F58S|TMEM139_ENST00000471161.1_Intron|AC073342.12_ENST00000427392.1_RNA|AC073342.12_ENST00000446192.1_RNA	NM_001242775.2|NM_001282876.1|NM_001282877.1	NP_001229704.1|NP_001269805.1|NP_001269806.1	Q8IV31	TM139_HUMAN	transmembrane protein 139	58						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(1)|prostate(1)	7	Melanoma(164;0.059)					CTGGTCCGGTTTCTGGAATGG	0.552																																					p.F58S		Atlas-SNP	.											.	TMEM139	18	.	0			c.T173C						PASS	.						156.0	150.0	152.0					7																	142983223		2203	4300	6503	SO:0001583	missense	135932	exon3			TCCGGTTTCTGGA	AK075067	CCDS5878.1	7q34	2006-03-17			ENSG00000178826	ENSG00000178826			22058	protein-coding gene	gene with protein product							Standard	NM_153345		Approved	FLJ90586	uc003wck.4	Q8IV31	OTTHUMG00000152652	ENST00000359333.3:c.173T>C	chr7.hg19:g.142983223T>C	ENSP00000352284:p.Phe58Ser	64.0	0.0	.		42.0	15.0	.	NM_001242773	B2RCL5|D3DXD4|Q6ZME2|Q8NC22|Q96AU8	Missense_Mutation	SNP	ENST00000359333.3	hg19	CCDS5878.1	.	.	.	.	.	.	.	.	.	.	T	9.451	1.090601	0.20471	.	.	ENSG00000178826	ENST00000409102;ENST00000359333;ENST00000409244;ENST00000409541;ENST00000410004	.	.	.	5.0	0.855	0.19013	.	0.643829	0.15236	N	0.273162	T	0.17023	0.0409	N	0.19112	0.55	0.09310	N	1	B	0.19583	0.037	B	0.17433	0.018	T	0.15407	-1.0438	9	0.22706	T	0.39	0.0033	1.6402	0.02750	0.1701:0.0953:0.1765:0.5581	.	58	Q8IV31	TM139_HUMAN	S	58	.	ENSP00000352284:F58S	F	+	2	0	TMEM139	142693345	0.000000	0.05858	0.374000	0.26016	0.030000	0.12068	0.273000	0.18662	0.315000	0.23110	0.456000	0.33151	TTT	.	.	.	none		0.552	TMEM139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327145.1	NM_153345	
PDIA4	9601	hgsc.bcm.edu	37	7	148712027	148712027	+	Missense_Mutation	SNP	C	C	A	rs565062386		TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr7:148712027C>A	ENST00000286091.4	-	4	815	c.583G>T	c.(583-585)Gat>Tat	p.D195Y		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	195	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			AGAATGATATCTGCATCATTC	0.537																																					p.D195Y		Atlas-SNP	.											.	PDIA4	57	.	0			c.G583T						PASS	.						138.0	103.0	115.0					7																	148712027		2203	4300	6503	SO:0001583	missense	9601	exon4			TGATATCTGCATC	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.583G>T	chr7.hg19:g.148712027C>A	ENSP00000286091:p.Asp195Tyr	93.0	0.0	.		80.0	16.0	.	NM_004911	A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	hg19	CCDS5893.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081506	0.76528	.	.	ENSG00000155660	ENST00000286091	T	0.43688	0.94	4.7	4.7	0.59300	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.000000	0.85682	D	0.000000	T	0.58424	0.2121	L	0.53780	1.695	0.80722	D	1	D	0.69078	0.997	P	0.62298	0.9	T	0.63633	-0.6593	10	0.87932	D	0	.	17.6525	0.88169	0.0:1.0:0.0:0.0	.	195	P13667	PDIA4_HUMAN	Y	195	ENSP00000286091:D195Y	ENSP00000286091:D195Y	D	-	1	0	PDIA4	148342960	1.000000	0.71417	0.824000	0.32777	0.694000	0.40290	7.561000	0.82288	2.153000	0.67306	0.404000	0.27445	GAT	.	.	.	none		0.537	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911	
TMEM176A	55365	hgsc.bcm.edu	37	7	150500886	150500886	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr7:150500886T>C	ENST00000484928.1	+	5	1102	c.521T>C	c.(520-522)cTa>cCa	p.L174P	TMEM176A_ENST00000461345.1_Missense_Mutation_p.L115P|TMEM176B_ENST00000447204.2_5'Flank|TMEM176A_ENST00000004103.3_Missense_Mutation_p.L174P			Q96HP8	T176A_HUMAN	transmembrane protein 176A	174					negative regulation of dendritic cell differentiation (GO:2001199)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|lung(7)|ovary(2)|stomach(1)	12			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTCAGAAGGCTACACCTATGT	0.582																																					p.L174P		Atlas-SNP	.											.	TMEM176A	35	.	0			c.T521C						PASS	.						53.0	51.0	52.0					7																	150500886		2203	4300	6503	SO:0001583	missense	55365	exon5			GAAGGCTACACCT	AF258340	CCDS5909.1	7q36.1	2006-09-04			ENSG00000002933	ENSG00000002933			24930	protein-coding gene	gene with protein product		610334				12097419, 8889548	Standard	NM_018487		Approved	HCA112	uc003whx.1	Q96HP8	OTTHUMG00000158114	ENST00000484928.1:c.521T>C	chr7.hg19:g.150500886T>C	ENSP00000417626:p.Leu174Pro	66.0	0.0	.		58.0	25.0	.	NM_018487	D3DX00|Q9NYC7	Missense_Mutation	SNP	ENST00000484928.1	hg19	CCDS5909.1	.	.	.	.	.	.	.	.	.	.	T	11.79	1.743811	0.30865	.	.	ENSG00000002933	ENST00000484928;ENST00000004103;ENST00000461345;ENST00000475536;ENST00000468689	T;T;T;T;T	0.24908	4.37;4.37;4.37;4.37;1.83	3.33	-6.65	0.01795	.	2.443990	0.01405	N	0.013769	T	0.38268	0.1034	L	0.47716	1.5	0.21020	N	0.999808	D	0.65815	0.995	P	0.61658	0.892	T	0.53732	-0.8397	10	0.37606	T	0.19	-16.8622	11.8227	0.52247	0.8007:0.0:0.0:0.1993	.	174	Q96HP8	T176A_HUMAN	P	174;174;115;126;115	ENSP00000417626:L174P;ENSP00000004103:L174P;ENSP00000420818:L115P;ENSP00000417834:L126P;ENSP00000420081:L115P	ENSP00000004103:L174P	L	+	2	0	TMEM176A	150131819	0.000000	0.05858	0.001000	0.08648	0.230000	0.25150	-0.970000	0.03810	-1.688000	0.01435	0.374000	0.22700	CTA	.	.	.	none		0.582	TMEM176A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350222.1	NM_018487	
KIF13B	23303	hgsc.bcm.edu	37	8	29024953	29024953	+	Silent	SNP	G	G	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr8:29024953G>T	ENST00000524189.1	-	11	1133	c.1095C>A	c.(1093-1095)gcC>gcA	p.A365A	KIF13B_ENST00000521515.1_Silent_p.A365A	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	365					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GGATAATTCGGGCATTAGGGT	0.547																																					p.A365A		Atlas-SNP	.											.	KIF13B	192	.	0			c.C1095A						PASS	.						62.0	60.0	61.0					8																	29024953		1950	4157	6107	SO:0001819	synonymous_variant	23303	exon11			AATTCGGGCATTA	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.1095C>A	chr8.hg19:g.29024953G>T		62.0	0.0	.		97.0	14.0	.	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	ENST00000524189.1	hg19	CCDS55217.1																																																																																			.	.	.	none		0.547	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
KAT6A	7994	hgsc.bcm.edu	37	8	41906305	41906305	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr8:41906305G>T	ENST00000396930.3	-	3	734	c.191C>A	c.(190-192)tCa>tAa	p.S64*	KAT6A_ENST00000265713.2_Nonsense_Mutation_p.S64*|KAT6A_ENST00000485568.1_Nonsense_Mutation_p.S64*|KAT6A_ENST00000406337.1_Nonsense_Mutation_p.S64*	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	64	Required for activation of RUNX1-1.|Required for nuclear localization.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TCCTTTATTTGAGACTTTTAA	0.368																																					p.S64X		Atlas-SNP	.											.	.	.	.	0			c.C191A						PASS	.						171.0	168.0	169.0					8																	41906305		2203	4300	6503	SO:0001587	stop_gained	7994	exon3			TTATTTGAGACTT	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.191C>A	chr8.hg19:g.41906305G>T	ENSP00000380136:p.Ser64*	105.0	0.0	.		116.0	27.0	.	NM_001099412	Q76L81	Nonsense_Mutation	SNP	ENST00000396930.3	hg19	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	G	40	8.032524	0.98619	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000485568	.	.	.	5.66	5.66	0.87406	.	0.106722	0.42172	D	0.000758	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-13.388	19.7395	0.96220	0.0:0.0:1.0:0.0	.	.	.	.	X	64	.	ENSP00000265713:S64X	S	-	2	0	KAT6A	42025462	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.335000	0.96500	2.669000	0.90835	0.655000	0.94253	TCA	.	.	.	none		0.368	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
ZFHX4	79776	hgsc.bcm.edu	37	8	77776082	77776082	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr8:77776082A>T	ENST00000521891.2	+	11	10580	c.10132A>T	c.(10132-10134)Aaa>Taa	p.K3378*	ZFHX4_ENST00000455469.2_Nonsense_Mutation_p.K3333*|ZFHX4_ENST00000050961.6_Nonsense_Mutation_p.K3329*|ZFHX4_ENST00000518282.1_Nonsense_Mutation_p.K3352*	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3329					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGAAAGCACAAAAGAAGAACC	0.408										HNSCC(33;0.089)																											p.K3378X		Atlas-SNP	.											.	ZFHX4	878	.	0			c.A10132T						PASS	.						31.0	29.0	30.0					8																	77776082		1849	4085	5934	SO:0001587	stop_gained	79776	exon11			AGCACAAAAGAAG		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10132A>T	chr8.hg19:g.77776082A>T	ENSP00000430497:p.Lys3378*	37.0	0.0	.		63.0	11.0	.	NM_024721	G3V138|Q18PS0|Q6ZN20	Nonsense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	52	18.637453	0.99908	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	.	.	.	4.5	4.5	0.54988	.	0.000000	0.47455	U	0.000231	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9762	0.64275	1.0:0.0:0.0:0.0	.	.	.	.	X	3378;3362;3333;3329;3352	.	ENSP00000050961:K3329X	K	+	1	0	ZFHX4	77938637	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.177000	0.77650	1.907000	0.55213	0.496000	0.49642	AAA	.	.	.	none		0.408	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
RIMS2	9699	hgsc.bcm.edu	37	8	105257207	105257207	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr8:105257207A>T	ENST00000436393.2	+	24	3693	c.3452A>T	c.(3451-3453)gAa>gTa	p.E1151V	RIMS2_ENST00000262231.10_Missense_Mutation_p.E972V|RIMS2_ENST00000507740.1_Missense_Mutation_p.E947V|RIMS2_ENST00000339750.2_Missense_Mutation_p.E69V|RIMS2_ENST00000406091.3_Missense_Mutation_p.E1133V			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1195					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CTGGCCGTGGAAATGAGGAAC	0.468										HNSCC(12;0.0054)																											p.E1133V		Atlas-SNP	.											.	RIMS2	1357	.	0			c.A3398T						PASS	.						130.0	136.0	134.0					8																	105257207		2024	4187	6211	SO:0001583	missense	9699	exon20			CCGTGGAAATGAG	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3452A>T	chr8.hg19:g.105257207A>T	ENSP00000390665:p.Glu1151Val	166.0	0.0	.		281.0	24.0	.	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	hg19		.	.	.	.	.	.	.	.	.	.	A	21.4	4.140378	0.77775	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T;T	0.25250	2.39;2.1;2.13;2.01;2.49;1.83;1.81	5.05	5.05	0.67936	.	.	.	.	.	T	0.47002	0.1422	L	0.58510	1.815	0.80722	D	1	D;D;D;P;P	0.63880	0.993;0.993;0.984;0.939;0.939	D;D;D;P;P	0.72338	0.977;0.977;0.946;0.58;0.58	T	0.44390	-0.9331	9	0.59425	D	0.04	.	14.9548	0.71104	1.0:0.0:0.0:0.0	.	1195;1151;972;947;1133	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	V	1170;1133;1195;972;947;1140;1151;69;69	ENSP00000384892:E1133V;ENSP00000262231:E972V;ENSP00000423559:E947V;ENSP00000386228:E1140V;ENSP00000390665:E1151V;ENSP00000428478:E69V;ENSP00000342051:E69V	ENSP00000262231:E972V	E	+	2	0	RIMS2	105326383	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.116000	0.77119	2.119000	0.64992	0.528000	0.53228	GAA	.	.	.	none		0.468	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
C9orf72	203228	hgsc.bcm.edu	37	9	27566893	27566893	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr9:27566893C>T	ENST00000380003.3	-	2	289	c.226G>A	c.(226-228)Gag>Aag	p.E76K	C9orf72_ENST00000379997.3_Missense_Mutation_p.E76K|C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	76					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		GCACCACTCTCTGCATTTCGA	0.403																																					p.E76K		Atlas-SNP	.											.	C9orf72	48	.	0			c.G226A						PASS	.						101.0	96.0	98.0					9																	27566893		2203	4300	6503	SO:0001583	missense	203228	exon2			CACTCTCTGCATT	AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.226G>A	chr9.hg19:g.27566893C>T	ENSP00000369339:p.Glu76Lys	97.0	0.0	.		114.0	37.0	.	NM_018325	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	hg19	CCDS6522.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026734	0.93518	.	.	ENSG00000147894	ENST00000380003;ENST00000379997;ENST00000379995	T;T;T	0.44083	0.93;0.93;0.93	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.52645	0.1747	N	0.24115	0.695	0.80722	D	1	D;P	0.67145	0.996;0.952	D;P	0.73708	0.981;0.641	T	0.42816	-0.9429	9	.	.	.	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	76;76	Q96LT7-2;Q96LT7	.;CI072_HUMAN	K	76	ENSP00000369339:E76K;ENSP00000369333:E76K;ENSP00000369331:E76K	.	E	-	1	0	C9orf72	27556893	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.840000	0.97914	0.655000	0.94253	GAG	.	.	.	none		0.403	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325	
TMEM2	23670	hgsc.bcm.edu	37	9	74345097	74345097	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr9:74345097T>C	ENST00000377044.4	-	9	2385	c.1846A>G	c.(1846-1848)Act>Gct	p.T616A	TMEM2_ENST00000377066.5_Missense_Mutation_p.T553A	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	616					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TGGAACAAAGTATTCCTCTGT	0.423																																					p.T616A		Atlas-SNP	.											.	TMEM2	112	.	0			c.A1846G						PASS	.						124.0	117.0	119.0					9																	74345097		2203	4300	6503	SO:0001583	missense	23670	exon9			ACAAAGTATTCCT		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.1846A>G	chr9.hg19:g.74345097T>C	ENSP00000366243:p.Thr616Ala	140.0	0.0	.		129.0	28.0	.	NM_013390	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	hg19	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.481878	0.63849	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.58652	0.32;0.32	5.63	5.63	0.86233	Pectin lyase fold/virulence factor (1);	0.295695	0.41294	D	0.000910	T	0.60287	0.2257	M	0.78456	2.415	0.80722	D	1	B;B	0.28178	0.061;0.202	B;B	0.28232	0.04;0.087	T	0.58763	-0.7579	10	0.29301	T	0.29	.	15.8301	0.78743	0.0:0.0:0.0:1.0	.	616;553	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	A	616;553	ENSP00000366243:T616A;ENSP00000366266:T553A	ENSP00000366243:T616A	T	-	1	0	TMEM2	73534917	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.579000	0.82511	2.140000	0.66376	0.477000	0.44152	ACT	.	.	.	none		0.423	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
PHF2	5253	hgsc.bcm.edu	37	9	96421819	96421819	+	Silent	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr9:96421819C>T	ENST00000359246.4	+	11	1633	c.1266C>T	c.(1264-1266)ctC>ctT	p.L422L	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	422					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		AGGACGAGCTCCCGGAGCACT	0.612																																					p.L422L		Atlas-SNP	.											.	PHF2	113	.	0			c.C1266T						PASS	.						61.0	56.0	58.0					9																	96421819		2203	4300	6503	SO:0001819	synonymous_variant	5253	exon11			CGAGCTCCCGGAG	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.1266C>T	chr9.hg19:g.96421819C>T		248.0	0.0	.		159.0	47.0	.	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	hg19	CCDS35069.1																																																																																			.	.	.	none		0.612	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
CUBN	8029	hgsc.bcm.edu	37	10	17110184	17110184	+	Silent	SNP	A	A	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr10:17110184A>G	ENST00000377833.4	-	21	2952	c.2887T>C	c.(2887-2889)Tta>Cta	p.L963L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	963	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGTTGGACTAATATATGCCAA	0.398																																					p.L963L		Atlas-SNP	.											.	CUBN	515	.	0			c.T2887C						PASS	.						165.0	157.0	160.0					10																	17110184		2203	4300	6503	SO:0001819	synonymous_variant	8029	exon21			GGACTAATATATG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2887T>C	chr10.hg19:g.17110184A>G		100.0	0.0	.		138.0	52.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	hg19	CCDS7113.1																																																																																			.	.	.	none		0.398	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
EDRF1	26098	hgsc.bcm.edu	37	10	127411636	127411636	+	Splice_Site	SNP	G	G	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr10:127411636G>T	ENST00000356792.4	+	3	549		c.e3-1		C10orf137_ENST00000337623.3_Splice_Site	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN							regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CTCTTTGGTAGCTTTGGCATG	0.373																																					.		Atlas-SNP	.											.	C10orf137	153	.	0			c.318-1G>T						PASS	.						359.0	325.0	337.0					10																	127411636		2203	4300	6503	SO:0001630	splice_region_variant	26098	exon3			TTGGTAGCTTTGG																												ENST00000356792.4:c.318-1G>T	chr10.hg19:g.127411636G>T		107.0	0.0	.		93.0	6.0	.	NM_001202438	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Splice_Site	SNP	ENST00000356792.4	hg19	CCDS55733.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652557	0.67472	.	.	ENSG00000107938	ENST00000356792;ENST00000392732;ENST00000337623	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8405	0.96681	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C10orf137	127401626	1.000000	0.71417	0.681000	0.30009	0.712000	0.41017	9.094000	0.94168	2.692000	0.91855	0.655000	0.94253	.	.	.	.	none		0.373	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		Intron
OR51Q1	390061	hgsc.bcm.edu	37	11	5443619	5443619	+	Silent	SNP	G	G	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr11:5443619G>T	ENST00000300778.4	+	1	279	c.189G>T	c.(187-189)ctG>ctT	p.L63L	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCATGTATCTGTTTCTCTCCA	0.552																																					p.L63L		Atlas-SNP	.											.	OR51Q1	79	.	0			c.G189T						PASS	.						268.0	231.0	243.0					11																	5443619		2201	4297	6498	SO:0001819	synonymous_variant	390061	exon1			GTATCTGTTTCTC	AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.189G>T	chr11.hg19:g.5443619G>T		60.0	0.0	.		77.0	8.0	.	NM_001004757	B2RNN1	Silent	SNP	ENST00000300778.4	hg19	CCDS31381.1																																																																																			.	.	.	none		0.552	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143373.1	NM_001004757	
NLRP10	338322	hgsc.bcm.edu	37	11	7982378	7982378	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr11:7982378T>G	ENST00000328600.2	-	2	942	c.781A>C	c.(781-783)Aag>Cag	p.K261Q		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	261	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TTCTTCAACTTTTCTTCAAAG	0.552																																					p.K261Q		Atlas-SNP	.											.	NLRP10	146	.	0			c.A781C						PASS	.						65.0	66.0	66.0					11																	7982378		2201	4296	6497	SO:0001583	missense	338322	exon2			TCAACTTTTCTTC	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.781A>C	chr11.hg19:g.7982378T>G	ENSP00000327763:p.Lys261Gln	73.0	0.0	.		66.0	23.0	.	NM_176821	Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	hg19	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	T	2.103	-0.405652	0.04832	.	.	ENSG00000182261	ENST00000328600	T	0.79247	-1.25	4.68	-9.36	0.00629	NACHT nucleoside triphosphatase (1);	1.973700	0.03508	N	0.219126	T	0.43366	0.1244	N	0.02315	-0.6	0.09310	N	1	B	0.11235	0.004	B	0.18263	0.021	T	0.42120	-0.9470	10	0.12430	T	0.62	.	2.4824	0.04590	0.0922:0.362:0.2663:0.2796	.	261	Q86W26	NAL10_HUMAN	Q	261	ENSP00000327763:K261Q	ENSP00000327763:K261Q	K	-	1	0	NLRP10	7938954	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.595000	0.05727	-1.919000	0.01071	-1.137000	0.01932	AAG	.	.	.	none		0.552	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821	
OR4C11	219429	hgsc.bcm.edu	37	11	55371658	55371658	+	Silent	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr11:55371658C>T	ENST00000302231.4	-	1	216	c.192G>A	c.(190-192)ttG>ttA	p.L64L		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						CTGCAAAGGACAAATAAAATA	0.403																																					p.L64L		Atlas-SNP	.											.	OR4C11	73	.	0			c.G192A						PASS	.						78.0	75.0	76.0					11																	55371658		2178	3997	6175	SO:0001819	synonymous_variant	219429	exon1			AAAGGACAAATAA	AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.192G>A	chr11.hg19:g.55371658C>T		30.0	0.0	.		43.0	28.0	.	NM_001004700	B9EIL4|Q8NGL8	Silent	SNP	ENST00000302231.4	hg19	CCDS31503.1																																																																																			.	.	.	none		0.403	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700	
CD5	921	hgsc.bcm.edu	37	11	60891376	60891376	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr11:60891376C>T	ENST00000347785.3	+	8	1412	c.1246C>T	c.(1246-1248)Cag>Tag	p.Q416*		NM_014207.3	NP_055022.2	P06127	CD5_HUMAN	CD5 molecule	416					apoptotic signaling pathway (GO:0097190)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		GAAGCAGCGCCAGTGGATTGG	0.632																																					p.Q416X		Atlas-SNP	.											.	CD5	52	.	0			c.C1246T						PASS	.						77.0	68.0	71.0					11																	60891376		2203	4299	6502	SO:0001587	stop_gained	921	exon8			CAGCGCCAGTGGA	X04391	CCDS8000.1	11q13	2008-07-18	2006-03-28		ENSG00000110448	ENSG00000110448		"""CD molecules"""	1685	protein-coding gene	gene with protein product		153340	"""CD5 antigen (p56-62)"""	LEU1		1711157	Standard	NM_014207		Approved	T1	uc009ynk.3	P06127	OTTHUMG00000167825	ENST00000347785.3:c.1246C>T	chr11.hg19:g.60891376C>T	ENSP00000342681:p.Gln416*	42.0	0.0	.		30.0	12.0	.	NM_014207	A0N0P4|A8K9I3	Nonsense_Mutation	SNP	ENST00000347785.3	hg19	CCDS8000.1	.	.	.	.	.	.	.	.	.	.	C	36	5.948840	0.97134	.	.	ENSG00000110448	ENST00000347785	.	.	.	4.32	4.32	0.51571	.	0.000000	0.44902	D	0.000408	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-22.0462	15.0108	0.71547	0.0:1.0:0.0:0.0	.	.	.	.	X	416	.	ENSP00000342681:Q416X	Q	+	1	0	CD5	60647952	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	4.549000	0.60726	1.951000	0.56629	0.313000	0.20887	CAG	.	.	.	none		0.632	CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396465.2	NM_014207	
MED17	9440	hgsc.bcm.edu	37	11	93535078	93535078	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr11:93535078A>G	ENST00000251871.3	+	9	1693	c.1406A>G	c.(1405-1407)gAt>gGt	p.D469G	RN7SL195P_ENST00000582088.1_RNA|MED17_ENST00000533367.1_3'UTR	NM_004268.4	NP_004259.3	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	469					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			large_intestine(2)|lung(11)|ovary(1)	14		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AATATCAATGATGTTTATGAA	0.328																																					p.D469G		Atlas-SNP	.											.	MED17	37	.	0			c.A1406G						PASS	.						77.0	69.0	71.0					11																	93535078		2201	4298	6499	SO:0001583	missense	9440	exon9			TCAATGATGTTTA	AF104254	CCDS8295.1	11q21	2007-07-30	2007-07-30	2007-07-30	ENSG00000042429	ENSG00000042429			2375	protein-coding gene	gene with protein product		603810	"""cofactor required for Sp1 transcriptional activation, subunit 6 (77kD)"", ""cofactor required for Sp1 transcriptional activation, subunit 6, 77kDa"""	CRSP6		9989412, 10198638	Standard	NM_004268		Approved	CRSP77, TRAP80, DRIP80	uc001pem.4	Q9NVC6	OTTHUMG00000167497	ENST00000251871.3:c.1406A>G	chr11.hg19:g.93535078A>G	ENSP00000251871:p.Asp469Gly	190.0	0.0	.		207.0	18.0	.	NM_004268	B3KN07|Q9HA81|Q9UNP7|Q9Y2W0|Q9Y660	Missense_Mutation	SNP	ENST00000251871.3	hg19	CCDS8295.1	.	.	.	.	.	.	.	.	.	.	A	18.21	3.573152	0.65765	.	.	ENSG00000042429	ENST00000251871;ENST00000427225	T	0.55588	0.51	5.68	5.68	0.88126	.	0.044636	0.85682	D	0.000000	T	0.46073	0.1374	L	0.44542	1.39	0.80722	D	1	P	0.47762	0.9	B	0.38500	0.275	T	0.50074	-0.8870	10	0.49607	T	0.09	-26.9024	16.2164	0.82224	1.0:0.0:0.0:0.0	.	469	Q9NVC6	MED17_HUMAN	G	469;439	ENSP00000251871:D469G	ENSP00000251871:D469G	D	+	2	0	MED17	93174726	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.916000	0.92745	2.289000	0.77006	0.533000	0.62120	GAT	.	.	.	none		0.328	MED17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394800.2	NM_004268	
KCNA5	3741	hgsc.bcm.edu	37	12	5154784	5154784	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr12:5154784G>T	ENST00000252321.3	+	1	1700	c.1471G>T	c.(1471-1473)Gtt>Ttt	p.V491F		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	491					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GCCCATCACTGTTGGGGGCAA	0.592																																					p.V491F		Atlas-SNP	.											.	KCNA5	138	.	0			c.G1471T						PASS	.						120.0	110.0	114.0					12																	5154784		2203	4300	6503	SO:0001583	missense	3741	exon1			ATCACTGTTGGGG	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1471G>T	chr12.hg19:g.5154784G>T	ENSP00000252321:p.Val491Phe	112.0	0.0	.		90.0	18.0	.	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	hg19	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.527624	0.27299	.	.	ENSG00000130037	ENST00000252321	D	0.97553	-4.43	4.87	3.99	0.46301	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.95749	0.8617	L	0.54323	1.7	0.38272	D	0.942173	B	0.27997	0.197	B	0.36464	0.225	D	0.95565	0.8633	10	0.62326	D	0.03	.	12.4131	0.55478	0.0804:0.0:0.9196:0.0	.	491	P22460	KCNA5_HUMAN	F	491	ENSP00000252321:V491F	ENSP00000252321:V491F	V	+	1	0	KCNA5	5025045	0.998000	0.40836	0.069000	0.20011	0.781000	0.44180	2.520000	0.45554	1.292000	0.44672	0.561000	0.74099	GTT	.	.	.	none		0.592	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
KCNH3	23416	hgsc.bcm.edu	37	12	49942732	49942732	+	Missense_Mutation	SNP	G	G	A	rs574111580	byFrequency	TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr12:49942732G>A	ENST00000257981.6	+	8	1504	c.1244G>A	c.(1243-1245)cGg>cAg	p.R415Q		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	415					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						CTGGTGGGCCGGAGGCCAGCT	0.701													G|||	2	0.000399361	0.0	0.0	5008	,	,		15321	0.002		0.0	False		,,,				2504	0.0				p.R415Q		Atlas-SNP	.											.	KCNH3	88	.	0			c.G1244A						PASS	.						12.0	15.0	14.0					12																	49942732		2194	4291	6485	SO:0001583	missense	23416	exon8			TGGGCCGGAGGCC	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1244G>A	chr12.hg19:g.49942732G>A	ENSP00000257981:p.Arg415Gln	99.0	0.0	.		87.0	22.0	.	NM_012284	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	hg19	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082658	0.36758	.	.	ENSG00000135519	ENST00000257981	D	0.98633	-5.04	4.53	0.652	0.17823	Ion transport (1);	0.609308	0.13925	N	0.353267	D	0.95014	0.8386	L	0.32530	0.975	0.21147	N	0.999771	B	0.02656	0.0	B	0.04013	0.001	D	0.87894	0.2686	10	0.18276	T	0.48	.	6.7337	0.23397	0.3979:0.0:0.6021:0.0	.	415	Q9ULD8	KCNH3_HUMAN	Q	415	ENSP00000257981:R415Q	ENSP00000257981:R415Q	R	+	2	0	KCNH3	48228999	0.005000	0.15991	0.164000	0.22755	0.642000	0.38348	-0.270000	0.08584	0.025000	0.15241	-0.140000	0.14226	CGG	.	.	.	none		0.701	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
KIAA1033	23325	hgsc.bcm.edu	37	12	105538550	105538550	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr12:105538550T>C	ENST00000332180.5	+	22	2321	c.2234T>C	c.(2233-2235)cTt>cCt	p.L745P		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						ACTGTAGCCCTTCATGACTGG	0.398																																					p.L745P		Atlas-SNP	.											.	KIAA1033	83	.	0			c.T2234C						PASS	.						113.0	106.0	108.0					12																	105538550		1901	4120	6021	SO:0001583	missense	23325	exon22			TAGCCCTTCATGA	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.2234T>C	chr12.hg19:g.105538550T>C	ENSP00000328062:p.Leu745Pro	75.0	0.0	.		91.0	48.0	.	NM_015275		Missense_Mutation	SNP	ENST00000332180.5	hg19	CCDS41826.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.549404	0.86127	.	.	ENSG00000136051	ENST00000332180	T	0.48201	0.82	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.62085	0.2399	L	0.54323	1.7	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.64042	0.921;0.921	T	0.60510	-0.7249	10	0.39692	T	0.17	.	15.9674	0.79985	0.0:0.0:0.0:1.0	.	746;745	B7ZKT9;Q2M389	.;WASH7_HUMAN	P	745	ENSP00000328062:L745P	ENSP00000328062:L745P	L	+	2	0	KIAA1033	104062680	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.994000	0.88315	2.170000	0.68504	0.477000	0.44152	CTT	.	.	.	none		0.398	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
SPATA13	221178	hgsc.bcm.edu	37	13	24797769	24797769	+	Intron	SNP	G	G	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr13:24797769G>A	ENST00000382095.4	+	2	185				SPATA13_ENST00000424834.2_Silent_p.V234V|SPATA13_ENST00000382108.3_Silent_p.V234V|RP11-307N16.6_ENST00000382141.4_Silent_p.V234V	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		TGCCCGCCGTGTGTGAGATTC	0.602																																					p.V234V		Atlas-SNP	.											.	SPATA13	92	.	0			c.G702A						PASS	.						52.0	52.0	52.0					13																	24797769		692	1591	2283	SO:0001627	intron_variant	221178	exon2			CGCCGTGTGTGAG	AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.-222-25846G>A	chr13.hg19:g.24797769G>A		70.0	0.0	.		42.0	13.0	.	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Silent	SNP	ENST00000382095.4	hg19	CCDS9305.1	.	.	.	.	.	.	.	.	.	.	G	5.253	0.232192	0.09969	.	.	ENSG00000182957	ENST00000424834	.	.	.	4.5	-1.53	0.08611	.	1.228160	0.06596	N	0.752934	T	0.26919	0.0659	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32079	-0.9920	6	0.54805	T	0.06	.	1.1339	0.01751	0.2807:0.3551:0.1824:0.1817	.	.	.	.	M	272	.	ENSP00000371576:V272M	V	+	1	0	SPATA13	23695769	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.066000	0.03454	-0.522000	0.06417	-0.702000	0.03669	GTG	.	.	.	none		0.602	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
RTL1	388015	hgsc.bcm.edu	37	14	101347376	101347376	+	Silent	SNP	G	G	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr14:101347376G>A	ENST00000534062.1	-	1	3808	c.3750C>T	c.(3748-3750)gaC>gaT	p.D1250D	MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1250					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						CTTGCAGGCCGTCATGCAGGC	0.637																																					p.D1250D		Atlas-SNP	.											.	RTL1	120	.	0			c.C3750T						PASS	.						18.0	18.0	18.0					14																	101347376		1567	3579	5146	SO:0001819	synonymous_variant	388015	exon1			CAGGCCGTCATGC		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3750C>T	chr14.hg19:g.101347376G>A		116.0	0.0	.		79.0	9.0	.	NM_001134888	E9PKS8	Silent	SNP	ENST00000534062.1	hg19	CCDS53910.1																																																																																			.	.	.	none		0.637	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
DMXL2	23312	hgsc.bcm.edu	37	15	51799330	51799330	+	Splice_Site	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr15:51799330C>T	ENST00000251076.5	-	16	3052		c.e16+1		DMXL2_ENST00000449909.3_Splice_Site|DMXL2_ENST00000543779.2_Splice_Site	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TAATTACTTACCTAAACATGC	0.279																																					.		Atlas-SNP	.											.	DMXL2	262	.	0			c.2764+1G>A						PASS	.						63.0	60.0	61.0					15																	51799330		2195	4290	6485	SO:0001630	splice_region_variant	23312	exon17			TACTTACCTAAAC	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.2764+1G>A	chr15.hg19:g.51799330C>T		55.0	0.0	.		37.0	11.0	.	NM_015263	B2RTR3|B7ZMH3|F5GWF1|O94938	Splice_Site	SNP	ENST00000251076.5	hg19	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497642	0.85069	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5259	0.87800	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DMXL2	49586622	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.440000	0.80464	2.210000	0.71456	0.484000	0.47621	.	.	.	.	none		0.279	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	Intron
CNOT1	23019	hgsc.bcm.edu	37	16	58583738	58583738	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr16:58583738A>T	ENST00000317147.5	-	25	3739	c.3407T>A	c.(3406-3408)aTg>aAg	p.M1136K	SNORA46_ENST00000384762.1_RNA|CNOT1_ENST00000569732.1_5'Flank|CNOT1_ENST00000441024.2_Missense_Mutation_p.M1136K|CNOT1_ENST00000569240.1_Missense_Mutation_p.M1131K|CNOT1_ENST00000245138.4_Missense_Mutation_p.M26K	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1136	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GACTCTCTTCATAACCAGATA	0.408																																					p.M1136K		Atlas-SNP	.											.	CNOT1	359	.	0			c.T3407A						PASS	.						166.0	155.0	159.0					16																	58583738		2198	4300	6498	SO:0001583	missense	23019	exon25			CTCTTCATAACCA	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3407T>A	chr16.hg19:g.58583738A>T	ENSP00000320949:p.Met1136Lys	66.0	0.0	.		106.0	27.0	.	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638031	0.87760	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000245138;ENST00000394200;ENST00000441024	T;T	0.18016	2.24;2.24	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.22898	0.0553	L	0.31845	0.965	0.80722	D	1	D;P;P;P	0.56746	0.977;0.814;0.666;0.95	P;P;B;P	0.58391	0.696;0.838;0.212;0.687	T	0.01914	-1.1248	10	0.06236	T	0.91	.	15.4197	0.75000	1.0:0.0:0.0:0.0	.	26;1136;1136;1131	B5MDN3;A5YKK6-4;A5YKK6;A5YKK6-2	.;.;CNOT1_HUMAN;.	K	1136;565;26;1131;1136	ENSP00000320949:M1136K;ENSP00000413113:M1136K	ENSP00000245138:M26K	M	-	2	0	CNOT1	57141239	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.050000	0.60909	0.402000	0.26972	ATG	.	.	.	none		0.408	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CNOT1	23019	hgsc.bcm.edu	37	16	58615281	58615281	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr16:58615281T>C	ENST00000317147.5	-	11	1515	c.1183A>G	c.(1183-1185)Ata>Gta	p.I395V	CNOT1_ENST00000441024.2_Missense_Mutation_p.I395V|CNOT1_ENST00000569240.1_Missense_Mutation_p.I395V	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	395					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GGTCTATATATGAGGTCTACT	0.413																																					p.I395V		Atlas-SNP	.											.	CNOT1	359	.	0			c.A1183G						PASS	.						116.0	106.0	109.0					16																	58615281		2198	4300	6498	SO:0001583	missense	23019	exon11			TATATATGAGGTC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.1183A>G	chr16.hg19:g.58615281T>C	ENSP00000320949:p.Ile395Val	115.0	0.0	.		123.0	46.0	.	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	13.10	2.136887	0.37728	.	.	ENSG00000125107	ENST00000317147;ENST00000394200;ENST00000441024	T;T	0.44482	0.94;0.92	5.67	5.67	0.87782	.	0.042158	0.85682	D	0.000000	T	0.23451	0.0567	N	0.12182	0.205	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.12604	-1.0541	9	.	.	.	0.0017	10.2862	0.43568	0.0:0.0733:0.0:0.9267	.	395;395;395	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	V	395	ENSP00000320949:I395V;ENSP00000413113:I395V	.	I	-	1	0	CNOT1	57172782	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.097000	0.64542	2.158000	0.67659	0.533000	0.62120	ATA	.	.	.	none		0.413	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
ABR	29	hgsc.bcm.edu	37	17	1082993	1082993	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr17:1082993G>C	ENST00000302538.5	-	1	175	c.29C>G	c.(28-30)cCg>cGg	p.P10R	AC016292.1_ENST00000438344.1_RNA|ABR_ENST00000544583.2_Intron	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	10					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GGACAGGCGCGGCAGGCCCCG	0.711																																					p.P10R	Esophageal Squamous(197;2016 2115 4129 29033 46447)	Atlas-SNP	.											.	ABR	119	.	0			c.C29G						PASS	.						9.0	12.0	11.0					17																	1082993		2175	4265	6440	SO:0001583	missense	29	exon1			AGGCGCGGCAGGC	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.29C>G	chr17.hg19:g.1082993G>C	ENSP00000303909:p.Pro10Arg	226.0	0.0	.		169.0	38.0	.	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	ENST00000302538.5	hg19	CCDS10999.1	.	.	.	.	.	.	.	.	.	.	g	16.44	3.124012	0.56613	.	.	ENSG00000159842	ENST00000302538	T	0.21734	1.99	3.83	3.83	0.44106	.	2.609730	0.02144	N	0.057429	T	0.15565	0.0375	N	0.19112	0.55	0.80722	D	1	P	0.36183	0.542	B	0.22601	0.04	T	0.20273	-1.0280	10	0.87932	D	0	.	11.091	0.48115	0.0:0.0:1.0:0.0	.	10	Q12979	ABR_HUMAN	R	10	ENSP00000303909:P10R	ENSP00000303909:P10R	P	-	2	0	ABR	1029743	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.945000	0.63568	1.972000	0.57404	0.511000	0.50034	CCG	.	.	.	none		0.711	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
DNAH2	146754	hgsc.bcm.edu	37	17	7689641	7689641	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr17:7689641C>G	ENST00000572933.1	+	40	7789	c.6329C>G	c.(6328-6330)cCt>cGt	p.P2110R	DNAH2_ENST00000389173.2_Missense_Mutation_p.P2110R			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2110	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCCGGAGACCCTAACTTCAAC	0.607																																					p.P2110R		Atlas-SNP	.											.	DNAH2	498	.	0			c.C6329G						PASS	.						39.0	39.0	39.0					17																	7689641		2203	4300	6503	SO:0001583	missense	146754	exon39			GAGACCCTAACTT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6329C>G	chr17.hg19:g.7689641C>G	ENSP00000458355:p.Pro2110Arg	47.0	0.0	.		36.0	23.0	.	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	hg19	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757144	0.69648	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.25912	1.77	5.43	5.43	0.79202	ATPase, dynein-related, AAA domain (1);	0.129591	0.52532	D	0.000068	T	0.37679	0.1012	M	0.62723	1.935	0.80722	D	1	D	0.54397	0.966	P	0.54431	0.752	T	0.02596	-1.1136	10	0.17369	T	0.5	.	13.8398	0.63432	0.0:0.8467:0.1533:0.0	.	2110	Q9P225	DYH2_HUMAN	R	2110	ENSP00000373825:P2110R	ENSP00000353818:P2110R	P	+	2	0	DNAH2	7630366	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.930000	0.63462	2.827000	0.97445	0.650000	0.86243	CCT	.	.	.	none		0.607	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
NCOR1	9611	hgsc.bcm.edu	37	17	15961343	15961343	+	Missense_Mutation	SNP	G	G	A	rs376750361		TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr17:15961343G>A	ENST00000268712.3	-	39	6303	c.6046C>T	c.(6046-6048)Cac>Tac	p.H2016Y	NCOR1_ENST00000395857.3_Missense_Mutation_p.H600Y|NCOR1_ENST00000395851.1_Missense_Mutation_p.H1913Y	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2016	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGTCGATAGTGATGTAATGGT	0.483																																					p.H2016Y		Atlas-SNP	.											.	NCOR1	240	.	0			c.C6046T						PASS	.						93.0	74.0	81.0					17																	15961343		2203	4300	6503	SO:0001583	missense	9611	exon39			GATAGTGATGTAA	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.6046C>T	chr17.hg19:g.15961343G>A	ENSP00000268712:p.His2016Tyr	84.0	0.0	.		78.0	11.0	.	NM_006311	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	hg19	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	G	0.872	-0.731627	0.03135	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.42513	0.97;1.52;0.98	5.87	5.87	0.94306	.	0.160125	0.56097	D	0.000034	T	0.48943	0.1528	L	0.46157	1.445	0.40181	D	0.977297	P;P;B;D;P;P	0.55172	0.572;0.893;0.378;0.97;0.71;0.773	B;B;B;P;B;B	0.48901	0.116;0.242;0.04;0.594;0.169;0.34	T	0.50600	-0.8809	10	0.72032	D	0.01	-10.6861	19.1839	0.93635	0.0:0.0:1.0:0.0	.	826;1920;2016;1913;536;30	B4DZ48;E7EVK1;O75376;O75376-2;Q86YY1;Q86YY2	.;.;NCOR1_HUMAN;.;.;.	Y	2016;1913;1920;600	ENSP00000268712:H2016Y;ENSP00000379192:H1913Y;ENSP00000379198:H600Y	ENSP00000268712:H2016Y	H	-	1	0	NCOR1	15902068	1.000000	0.71417	0.993000	0.49108	0.083000	0.17756	6.790000	0.75115	2.780000	0.95670	0.655000	0.94253	CAC	.	.	.	alt		0.483	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
CCDC103	388389	hgsc.bcm.edu	37	17	42979927	42979927	+	Silent	SNP	G	G	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr17:42979927G>A	ENST00000417826.2	+	4	566	c.471G>A	c.(469-471)ccG>ccA	p.P157P	AC015936.3_ENST00000441312.1_RNA|FAM187A_ENST00000412523.2_Intron|CCDC103_ENST00000410006.2_Silent_p.P157P|EFTUD2_ENST00000426333.2_5'Flank|FAM187A_ENST00000331733.4_5'UTR	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	157					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				ACGTGGGGCCGGCTGACCGGG	0.642																																					p.P157P		Atlas-SNP	.											.	CCDC103	15	.	0			c.G471A						PASS	.						56.0	63.0	61.0					17																	42979927		2203	4300	6503	SO:0001819	synonymous_variant	388389	exon4			GGGGCCGGCTGAC	AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.471G>A	chr17.hg19:g.42979927G>A		102.0	0.0	.		99.0	20.0	.	NM_001258395	A8K145|B8ZZU0	Silent	SNP	ENST00000417826.2	hg19	CCDS11490.1																																																																																			.	.	.	none		0.642	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334578.1	NM_213607	
TEN1	100134934	hgsc.bcm.edu	37	17	73996327	73996327	+	Missense_Mutation	SNP	G	G	A	rs377039339		TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr17:73996327G>A	ENST00000397640.1	+	4	654	c.356G>A	c.(355-357)cGg>cAg	p.R119Q	TEN1_ENST00000416485.1_Missense_Mutation_p.R118Q|CDK3_ENST00000425876.2_5'Flank|TEN1_ENST00000588202.1_3'UTR|TEN1-CDK3_ENST00000567351.1_RNA|CDK3_ENST00000448471.1_5'Flank	NM_001113324.2	NP_001106795.2	Q86WV5	TEN1L_HUMAN	TEN1 CST complex subunit	119						nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			breast(1)	1						AAGCAGGAGCGGGGCGGCAGC	0.637																																					p.R119Q		Atlas-SNP	.											.	TEN1	4	.	0			c.G356A						PASS	.	G	GLN/ARG	0,1384		0,0,692	29.0	39.0	36.0		356	3.7	0.0	17		36	1,3181		0,1,1590	no	missense	TEN1	NM_001113324.2	43	0,1,2282	AA,AG,GG		0.0314,0.0,0.0219	possibly-damaging	119/124	73996327	1,4565	692	1591	2283	SO:0001583	missense	100134934	exon4			AGGAGCGGGGCGG		CCDS45780.1, CCDS45780.2	17q25.1	2013-05-23	2013-05-23	2011-06-14	ENSG00000257949	ENSG00000257949			37242	protein-coding gene	gene with protein product		613130	"""chromosome 17 open reading frame 106"", ""TEN1 telomerase capping complex subunit homolog (S. cerevisiae)"""	C17orf106		19854130	Standard	NM_001113324		Approved	FLJ39785		Q86WV5	OTTHUMG00000132686	ENST00000397640.1:c.356G>A	chr17.hg19:g.73996327G>A	ENSP00000380762:p.Arg119Gln	110.0	0.0	.		92.0	45.0	.	NM_001113324	I3L0C7	Missense_Mutation	SNP	ENST00000397640.1	hg19	CCDS45780.2	.	.	.	.	.	.	.	.	.	.	G	16.22	3.061358	0.55432	0.0	3.14E-4	ENSG00000257949	ENST00000397640;ENST00000416485	.	.	.	4.68	3.71	0.42584	.	0.000000	0.56097	U	0.000024	T	0.35682	0.0940	L	0.59436	1.845	0.22571	N	0.998978	P	0.34462	0.454	B	0.26614	0.071	T	0.31586	-0.9938	9	0.62326	D	0.03	-10.2768	10.8578	0.46808	0.0884:0.0:0.9116:0.0	.	118	Q86WV5	TEN1L_HUMAN	Q	119;118	.	ENSP00000380762:R119Q	R	+	2	0	AC040980.1	71507922	1.000000	0.71417	0.003000	0.11579	0.173000	0.22820	5.619000	0.67729	0.933000	0.37291	0.557000	0.71058	CGG	.	.	.	weak		0.637	TEN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255983.1	NM_001113324	
MIDN	90007	hgsc.bcm.edu	37	19	1255611	1255611	+	Silent	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr19:1255611T>C	ENST00000591446.2	+	6	1456	c.1047T>C	c.(1045-1047)acT>acC	p.T349T	MIDN_ENST00000300952.2_Silent_p.T349T			Q504T8	MIDN_HUMAN	midnolin	349						cytosol (GO:0005829)|nucleolus (GO:0005730)				NS(1)|endometrium(3)|kidney(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCCAGAACTACCTCCTGCG	0.726																																					p.T349T		Atlas-SNP	.											.	MIDN	34	.	0			c.T1047C						PASS	.						19.0	26.0	24.0					19																	1255611		2194	4287	6481	SO:0001819	synonymous_variant	90007	exon7			CAGAACTACCTCC	AC004221	CCDS32864.1	19p13.3	2013-09-20			ENSG00000167470	ENSG00000167470			16298	protein-coding gene	gene with protein product		606700				10974535	Standard	XM_005259671		Approved		uc002lrp.3	Q504T8	OTTHUMG00000180144	ENST00000591446.2:c.1047T>C	chr19.hg19:g.1255611T>C		136.0	0.0	.		67.0	25.0	.	NM_177401	Q96BW8	Silent	SNP	ENST00000591446.2	hg19	CCDS32864.1																																																																																			.	.	.	none		0.726	MIDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449965.2		
SIRPA	140885	hgsc.bcm.edu	37	20	1903069	1903069	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr20:1903069G>C	ENST00000358771.4	+	4	1017	c.865G>C	c.(865-867)Gag>Cag	p.E289Q	SIRPA_ENST00000356025.3_Missense_Mutation_p.E289Q|SIRPA_ENST00000400068.3_Missense_Mutation_p.E289Q	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	289	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GACCTGGTTGGAGAATGGAAA	0.537																																					p.E289Q	GBM(155;1668 1920 5945 42733 48121)	Atlas-SNP	.											.	SIRPA	83	.	0			c.G865C						PASS	.						147.0	127.0	134.0					20																	1903069		2203	4300	6503	SO:0001583	missense	140885	exon5			TGGTTGGAGAATG	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.865G>C	chr20.hg19:g.1903069G>C	ENSP00000351621:p.Glu289Gln	394.0	0.0	.		278.0	18.0	.	NM_001040022	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	hg19	CCDS13022.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812345	0.70912	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.00608	6.25;6.25;6.25	5.35	5.35	0.76521	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000013	T	0.02119	0.0066	L	0.59967	1.855	0.46798	D	0.999207	P;D;P	0.76494	0.926;0.999;0.912	P;D;P	0.72982	0.596;0.979;0.691	T	0.62282	-0.6887	10	0.59425	D	0.04	.	14.7506	0.69522	0.0:0.0:1.0:0.0	.	269;289;289	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	Q	289	ENSP00000382941:E289Q;ENSP00000348307:E289Q;ENSP00000351621:E289Q	ENSP00000348307:E289Q	E	+	1	0	SIRPA	1851069	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	5.119000	0.64679	2.941000	0.99782	0.655000	0.94253	GAG	.	.	.	none		0.537	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
RBM12	10137	hgsc.bcm.edu	37	20	34240509	34240509	+	Silent	SNP	A	A	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr20:34240509A>G	ENST00000374114.3	-	3	2999	c.2736T>C	c.(2734-2736)gcT>gcC	p.A912A	CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000397446.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000317619.3_Intron|RBM12_ENST00000359646.1_Silent_p.A912A|RBM12_ENST00000374104.3_Silent_p.A912A|CPNE1_ENST00000397445.1_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	912	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			CAATGACAGCAGCTGTGGCTT	0.403																																					p.A912A		Atlas-SNP	.											.	RBM12	93	.	0			c.T2736C						PASS	.						87.0	85.0	86.0					20																	34240509		2203	4300	6503	SO:0001819	synonymous_variant	10137	exon2			GACAGCAGCTGTG	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2736T>C	chr20.hg19:g.34240509A>G		97.0	0.0	.		71.0	10.0	.	NM_001198840	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Silent	SNP	ENST00000374114.3	hg19	CCDS13261.1																																																																																			.	.	.	none		0.403	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
BCR	613	hgsc.bcm.edu	37	22	23524065	23524065	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr22:23524065G>T	ENST00000305877.8	+	1	1669	c.918G>T	c.(916-918)gaG>gaT	p.E306D	BCR_ENST00000359540.3_Missense_Mutation_p.E306D|BCR_ENST00000398512.5_Missense_Mutation_p.E306D	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	306	Binding to ABL SH2-domain.|Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CTGAGCAGGAGAAGCGCCTTA	0.642			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.E306D		Atlas-SNP	.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR	74	.	0			c.G918T						PASS	.						26.0	29.0	28.0					22																	23524065		2203	4300	6503	SO:0001583	missense	613	exon1			GCAGGAGAAGCGC		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.918G>T	chr22.hg19:g.23524065G>T	ENSP00000303507:p.Glu306Asp	25.0	0.0	.		19.0	11.0	.	NM_021574	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	hg19	CCDS13806.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878350	0.33162	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000398512;ENST00000290956;ENST00000292697;ENST00000420248	T;T;T	0.39787	1.88;1.89;1.06	4.67	3.59	0.41128	.	0.062995	0.64402	D	0.000007	T	0.26882	0.0658	N	0.25647	0.755	0.40319	D	0.978809	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.09164	-1.0687	10	0.33141	T	0.24	.	8.5781	0.33612	0.0903:0.1551:0.7547:0.0	.	306;306	P11274-2;P11274	.;BCR_HUMAN	D	306	ENSP00000303507:E306D;ENSP00000352535:E306D;ENSP00000381524:E306D	ENSP00000290956:E306D	E	+	3	2	BCR	21854065	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.473000	0.35387	2.315000	0.78130	0.557000	0.71058	GAG	.	.	.	none		0.642	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
UPB1	51733	hgsc.bcm.edu	37	22	24896185	24896185	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr22:24896185T>C	ENST00000326010.5	+	2	559	c.215T>C	c.(214-216)gTg>gCg	p.V72A	UPB1_ENST00000382760.2_Missense_Mutation_p.V72A|UPB1_ENST00000413389.2_Intron	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta	72	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					CCCCGCATTGTGCACGTGGGG	0.547																																					p.V72A		Atlas-SNP	.											.	UPB1	60	.	0			c.T215C						PASS	.						79.0	82.0	81.0					22																	24896185		2203	4300	6503	SO:0001583	missense	51733	exon2			GCATTGTGCACGT	AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.215T>C	chr22.hg19:g.24896185T>C	ENSP00000324343:p.Val72Ala	59.0	0.0	.		59.0	14.0	.	NM_016327	A3KMF8|Q9UIR3	Missense_Mutation	SNP	ENST00000326010.5	hg19	CCDS13827.1	.	.	.	.	.	.	.	.	.	.	T	13.18	2.159972	0.38119	.	.	ENSG00000100024	ENST00000326010;ENST00000382760;ENST00000426507	D;T	0.86769	-2.17;-0.97	4.66	3.62	0.41486	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (3);	0.509443	0.20750	N	0.086361	D	0.94450	0.8214	H	0.97587	4.035	0.80722	D	1	P	0.52316	0.952	P	0.59357	0.856	D	0.93657	0.6978	10	0.87932	D	0	-16.6106	8.6137	0.33817	0.0:0.0941:0.0:0.9059	.	72	Q9UBR1	BUP1_HUMAN	A	72	ENSP00000324343:V72A;ENSP00000372208:V72A	ENSP00000324343:V72A	V	+	2	0	UPB1	23226185	1.000000	0.71417	0.100000	0.21137	0.023000	0.10783	3.159000	0.50731	0.738000	0.32606	-0.473000	0.04963	GTG	.	.	.	none		0.547	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319869.1		
RRP7A	27341	hgsc.bcm.edu	37	22	42912116	42912116	+	Silent	SNP	G	G	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr22:42912116G>A	ENST00000323013.6	-	3	258	c.243C>T	c.(241-243)acC>acT	p.T81T		NM_015703.4	NP_056518.2	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A (S. cerevisiae)	81	RRM.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	10						CGAGGCCACAGGTGGACAGGA	0.617																																					p.T81T		Atlas-SNP	.											.	RRP7A	25	.	0			c.C243T						PASS	.						46.0	44.0	45.0					22																	42912116		2203	4300	6503	SO:0001819	synonymous_variant	27341	exon3			GCCACAGGTGGAC	BC035992	CCDS14036.1	22q13.2	2008-08-08			ENSG00000189306	ENSG00000189306			24286	protein-coding gene	gene with protein product						10810093, 12087473	Standard	NM_015703		Approved	CGI-96	uc003bcq.3	Q9Y3A4	OTTHUMG00000150891	ENST00000323013.6:c.243C>T	chr22.hg19:g.42912116G>A		126.0	0.0	.		68.0	14.0	.	NM_015703	A4FTX2|B2RBG4|Q0VAD0|Q5JZ94|Q6P4B5|Q8IVR9|Q8IVY0|Q8N5Q3|Q8NEY6|Q9Y3H5	Silent	SNP	ENST00000323013.6	hg19	CCDS14036.1																																																																																			.	.	.	none		0.617	RRP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320451.1	NM_015703	
PANX2	56666	hgsc.bcm.edu	37	22	50617455	50617455	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr22:50617455C>A	ENST00000395842.2	+	3	1783	c.1783C>A	c.(1783-1785)Ccc>Acc	p.P595T	PANX2_ENST00000159647.5_Missense_Mutation_p.P595T	NM_052839.3	NP_443071.2	Q96RD6	PANX2_HUMAN	pannexin 2	595					ion transport (GO:0006811)|protein hexamerization (GO:0034214)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)	7		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		CCGCTCACCTCCCGCCGCCCC	0.692																																					p.P595T		Atlas-SNP	.											.	PANX2	69	.	0			c.C1783A						PASS	.						24.0	23.0	23.0					22																	50617455		2186	4299	6485	SO:0001583	missense	56666	exon3			TCACCTCCCGCCG		CCDS14085.2, CCDS54544.1	22q13.33	2011-12-05			ENSG00000073150	ENSG00000073150		"""Ion channels / Pannexins"""	8600	protein-coding gene	gene with protein product		608421				14702039, 14597722	Standard	NM_052839		Approved	hPANX2, PX2	uc003bjn.4	Q96RD6	OTTHUMG00000044649	ENST00000395842.2:c.1783C>A	chr22.hg19:g.50617455C>A	ENSP00000379183:p.Pro595Thr	142.0	0.0	.		88.0	30.0	.	NM_052839	B7Z684|Q96RD5|Q9UGX8	Missense_Mutation	SNP	ENST00000395842.2	hg19	CCDS14085.2	.	.	.	.	.	.	.	.	.	.	C	7.891	0.732382	0.15507	.	.	ENSG00000073150	ENST00000159647;ENST00000395842;ENST00000401643	T;T	0.21932	1.98;2.0	3.71	1.26	0.21427	.	0.243973	0.25450	N	0.030597	T	0.08758	0.0217	N	0.14661	0.345	0.26828	N	0.968647	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.22103	-1.0226	10	0.21014	T	0.42	-2.0275	3.3091	0.07010	0.2806:0.4825:0.1443:0.0926	.	595;595	Q96RD6-1;Q96RD6	.;PANX2_HUMAN	T	595;595;272	ENSP00000159647:P595T;ENSP00000379183:P595T	ENSP00000159647:P595T	P	+	1	0	PANX2	48959582	0.000000	0.05858	0.968000	0.41197	0.590000	0.36582	0.686000	0.25392	0.860000	0.35481	0.305000	0.20034	CCC	.	.	.	none		0.692	PANX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075010.3	NM_052839	
FAAH2	158584	hgsc.bcm.edu	37	X	57475117	57475117	+	Silent	SNP	C	C	G			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chrX:57475117C>G	ENST00000374900.4	+	10	1509	c.1389C>G	c.(1387-1389)gtC>gtG	p.V463V	FAAH2_ENST00000491179.1_3'UTR	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	463						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						AGCATCATGTCCCTCTAACAC	0.423										HNSCC(52;0.14)																											p.V463V		Atlas-SNP	.											.	FAAH2	66	.	0			c.C1389G						PASS	.						228.0	164.0	185.0					X																	57475117		2203	4300	6503	SO:0001819	synonymous_variant	158584	exon10			TCATGTCCCTCTA	AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.1389C>G	chrX.hg19:g.57475117C>G		96.0	0.0	.		69.0	35.0	.	NM_174912	Q86VT2|Q96N98	Silent	SNP	ENST00000374900.4	hg19	CCDS14375.1																																																																																			.	.	.	none		0.423	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912	
ZCCHC5	203430	hgsc.bcm.edu	37	X	77913324	77913324	+	Silent	SNP	C	C	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chrX:77913324C>T	ENST00000321110.1	-	2	889	c.594G>A	c.(592-594)caG>caA	p.Q198Q		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	198							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						CTAGGAATTCCTGGGCATTTG	0.547																																					p.Q198Q		Atlas-SNP	.											.	ZCCHC5	101	.	0			c.G594A						PASS	.						38.0	38.0	38.0					X																	77913324		2203	4300	6503	SO:0001819	synonymous_variant	203430	exon2			GAATTCCTGGGCA	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.594G>A	chrX.hg19:g.77913324C>T		67.0	0.0	.		71.0	5.0	.	NM_152694	B2RMZ0|Q5JQE9	Silent	SNP	ENST00000321110.1	hg19	CCDS14440.1																																																																																			.	.	.	none		0.547	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694	
MT-ND1	4535	hgsc.bcm.edu	37	M	3659	3659	+	Silent	SNP	G	G	A			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chrM:3659G>A	ENST00000361390.2	+	1	353	c.353G>A	c.(352-354)tGa>tAa	p.*118*	MT-TY_ENST00000387409.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	118					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CTCAATCCTCTGATCAGGGTG	0.512																																					p.W118X		Atlas-SNP	.											.	.	.	.	0			c.G353A						PASS	.																																			SO:0001819	synonymous_variant	10625	exon1			TCCTCTGATCAGG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.353G>A	chrM.hg19:g.3659G>A		6.0	0.0	.		178.0	172.0	.	ENST00000361390	C0JKH6|Q37523	Nonsense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.	.	none		0.512	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MT-CO3	4514	hgsc.bcm.edu	37	M	9466	9466	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chrM:9466T>C	ENST00000362079.2	+	1	260	c.260T>C	c.(259-261)aTt>aCt	p.I87T	MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TD_ENST00000387419.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	87					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						AATCCTATTTATTACCTCAGA	0.502																																					p.I87T		Atlas-SNP	.											.	.	.	.	0			c.T260C						PASS	.																																			SO:0001583	missense	5742	exon1			TATTTATTACCTC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.260T>C	chrM.hg19:g.9466T>C	ENSP00000354982:p.Ile87Thr	17.0	0.0	.		203.0	198.0	.	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.	.	none		0.502	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
WDR27	253769	hgsc.bcm.edu	37	6	170038673	170038674	+	Frame_Shift_Del	DEL	TT	TT	-	rs115828649	byFrequency	TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr6:170038673_170038674delTT	ENST00000448612.1	-	18	1939_1940	c.1830_1831delAA	c.(1828-1833)cgaatgfs	p.M611fs	WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000423258.1_Frame_Shift_Del_p.M484fs|WDR27_ENST00000333572.6_Frame_Shift_Del_p.M611fs	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	581						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GCCGACCACATTCGCAGGGTCC	0.599																																					p.611_611del		Atlas-INDEL	.											.	WDR27	129	.	0			c.1831_1832del						PASS	.																																			SO:0001589	frameshift_variant	253769	exon18			.	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.1830_1831delAA	chr6.hg19:g.170038673_170038674delTT	ENSP00000416289:p.Met611fs	213.0	0.0	0		101.0	21.0	0.207921	NM_182552	A5PLM8|C9JGV0|Q5T066	Frame_Shift_Del	DEL	ENST00000448612.1	hg19	CCDS47520.2																																																																																			.	.	.	none		0.599	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	
NUP54	53371	hgsc.bcm.edu	37	4	77053755	77053755	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr4:77053755delT	ENST00000264883.3	-	6	968	c.828delA	c.(826-828)caafs	p.Q276fs	NUP54_ENST00000458189.2_Frame_Shift_Del_p.Q96fs|NUP54_ENST00000342467.6_Frame_Shift_Del_p.Q96fs|NUP54_ENST00000514987.1_Frame_Shift_Del_p.Q228fs|NUP54_ENST00000515460.1_5'Flank	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	276	9 X 2 AA repeats of F-G.			FEQANIKTQLQQL -> LNKPYKNTIAAT (in Ref. 1; AAF67488). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						TTACACCAAGTTGCTGCAATT	0.403																																					p.L277fs		Atlas-Indel,Pindel	.											.	NUP54	48	.	0			c.829delC						PASS	.						216.0	209.0	211.0					4																	77053755		2203	4300	6503	SO:0001589	frameshift_variant	53371	exon6			.	AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.828delA	chr4.hg19:g.77053755delT	ENSP00000264883:p.Gln276fs	199.0	0.0	0		140.0	33.0	0.235714	NM_017426	B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Frame_Shift_Del	DEL	ENST00000264883.3	hg19	CCDS3576.1																																																																																			.	.	.	none		0.403	NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252402.3		
HELZ	9931	hgsc.bcm.edu	37	17	65144699	65144700	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr17:65144699_65144700insT	ENST00000358691.5	-	20	2772_2773	c.2606_2607insA	c.(2605-2607)catfs	p.H869fs	HELZ_ENST00000580168.1_Frame_Shift_Ins_p.H870fs	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	869						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TGATAGCTTCATGGGAGCGGTA	0.49																																					p.H869fs		Atlas-Indel,Pindel	.											.	HELZ	160	.	0			c.2607_2608insA						PASS	.																																			SO:0001589	frameshift_variant	9931	exon20			.	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.2607dupA	chr17.hg19:g.65144700_65144700dupT	ENSP00000351524:p.His869fs	78.0	0.0	0		134.0	60.0	0.447761	NM_014877	I6L9H4	Frame_Shift_Ins	INS	ENST00000358691.5	hg19	CCDS42374.1																																																																																			.	.	.	none		0.490	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
MTA1	9112	hgsc.bcm.edu	37	14	105927224	105927224	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr14:105927224delG	ENST00000331320.7	+	10	1090	c.876delG	c.(874-876)gagfs	p.E292fs	MTA1_ENST00000435036.2_5'Flank|MTA1_ENST00000406191.1_Frame_Shift_Del_p.E292fs|MTA1_ENST00000405646.1_Frame_Shift_Del_p.E275fs	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	292	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		CTGCATCAGAGGCCAACCTTT	0.572																																					p.E292fs		Atlas-Indel,Pindel	.											.	MTA1	61	.	0			c.875delA						PASS	.						104.0	104.0	104.0					14																	105927224		2203	4298	6501	SO:0001589	frameshift_variant	9112	exon10			.	U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.876delG	chr14.hg19:g.105927224delG	ENSP00000333633:p.Glu292fs	166.0	0.0	0		96.0	38.0	0.395833	NM_004689	A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Frame_Shift_Del	DEL	ENST00000331320.7	hg19	CCDS32169.1																																																																																			.	.	.	none		0.572	MTA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317849.15		
PTPN13	5783	hgsc.bcm.edu	37	4	87724921	87724947	+	In_Frame_Del	DEL	TCTGGTAAATACACGGGTGCCAACTTA	TCTGGTAAATACACGGGTGCCAACTTA	-	rs114813002	byFrequency	TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	TCTGGTAAATACACGGGTGCCAACTTA	TCTGGTAAATACACGGGTGCCAACTTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr4:87724921_87724947delTCTGGTAAATACACGGGTGCCAACTTA	ENST00000411767.2	+	43	6628_6654	c.6565_6591delTCTGGTAAATACACGGGTGCCAACTTA	c.(6565-6591)tctggtaaatacacgggtgccaacttadel	p.SGKYTGANL2189del	PTPN13_ENST00000427191.2_In_Frame_Del_p.SGKYTGANL2170del|PTPN13_ENST00000316707.6_In_Frame_Del_p.SGKYTGANL1998del|PTPN13_ENST00000511467.1_In_Frame_Del_p.SGKYTGANL2194del|PTPN13_ENST00000436978.1_In_Frame_Del_p.SGKYTGANL2194del			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	2189					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.T2198T(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AGTGCTTCCCTCTGGTAAATACACGGGTGCCAACTTAAAATCAGTCA	0.454																																					p.2193_2202del		Atlas-Indel,Pindel	.											.	PTPN13	203	.	1	Substitution - coding silent(1)	lung(1)	c.6579_6605del						PASS	.																																			SO:0001651	inframe_deletion	5783	exon43			.		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.6565_6591delTCTGGTAAATACACGGGTGCCAACTTA	chr4.hg19:g.87724921_87724947delTCTGGTAAATACACGGGTGCCAACTTA	ENSP00000407249:p.Ser2189_Leu2197del	76.0	0.0	0		73.0	12.0	0.164384	NM_080685	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	In_Frame_Del	DEL	ENST00000411767.2	hg19	CCDS47094.1																																																																																			.	.	.	none		0.454	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
WDR27	253769	hgsc.bcm.edu	37	6	170038676	170038680	+	Frame_Shift_Del	DEL	GCAGG	GCAGG	-	rs201534381		TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	GCAGG	GCAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr6:170038676_170038680delGCAGG	ENST00000448612.1	-	18	1933_1937	c.1824_1828delCCTGC	c.(1822-1830)accctgcgafs	p.LR609fs	WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000423258.1_Frame_Shift_Del_p.LR482fs|WDR27_ENST00000333572.6_Frame_Shift_Del_p.LR609fs	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	579						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GACCACATTCGCAGGGTCCCGTCCC	0.605																																					p.609_610del		Atlas-INDEL	.											.	WDR27	129	.	0			c.1825_1829del						PASS	.																																			SO:0001589	frameshift_variant	253769	exon18			.	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.1824_1828delCCTGC	chr6.hg19:g.170038676_170038680delGCAGG	ENSP00000416289:p.Leu609fs	214.0	0.0	0		104.0	21.0	0.201923	NM_182552	A5PLM8|C9JGV0|Q5T066	Frame_Shift_Del	DEL	ENST00000448612.1	hg19	CCDS47520.2																																																																																			.	.	.	none		0.605	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	
ARID4B	51742	hgsc.bcm.edu	37	1	235416071	235416072	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:235416071_235416072insT	ENST00000264183.3	-	6	824_825	c.327_328insA	c.(325-330)aaaggafs	p.G110fs	ARID4B_ENST00000349213.3_Frame_Shift_Ins_p.G110fs|ARID4B_ENST00000366603.2_Frame_Shift_Ins_p.G110fs	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	110					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TGCCTCTCTCCTTTCAGGCACA	0.356																																					p.G110fs		Atlas-Indel,Pindel	.											.	ARID4B	142	.	0			c.328_329insA						PASS	.																																			SO:0001589	frameshift_variant	51742	exon6			.	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.328dupA	chr1.hg19:g.235416074_235416074dupT	ENSP00000264183:p.Gly110fs	210.0	0.0	0		177.0	51.0	0.288136	NM_016374	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Frame_Shift_Ins	INS	ENST00000264183.3	hg19	CCDS31061.1																																																																																			.	.	.	none		0.356	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374	
FOXM1	2305	hgsc.bcm.edu	37	12	2967807	2967812	+	In_Frame_Del	DEL	CTGTAG	CTGTAG	-			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	CTGTAG	CTGTAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr12:2967807_2967812delCTGTAG	ENST00000359843.3	-	9	2352_2357	c.2284_2289delCTACAG	c.(2284-2289)ctacagdel	p.LQ762del	Y_RNA_ENST00000410561.1_RNA|AC005841.1_ENST00000382678.3_5'Flank|ITFG2_ENST00000545509.1_Intron|FOXM1_ENST00000342628.2_In_Frame_Del_p.LQ800del|FOXM1_ENST00000361953.3_In_Frame_Del_p.LQ747del	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	762					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			CAGGGCTCTACTGTAGCTCAGGAATA	0.597																																					p.800_802del		Atlas-Indel,Pindel	.											.	FOXM1	62	.	0			c.2399_2404del						PASS	.																																			SO:0001651	inframe_deletion	2305	exon10			.	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.2284_2289delCTACAG	chr12.hg19:g.2967807_2967812delCTGTAG	ENSP00000352901:p.Leu762_Gln763del	39.0	0.0	0		44.0	17.0	0.386364	NM_202002	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	In_Frame_Del	DEL	ENST00000359843.3	hg19	CCDS8515.1																																																																																			.	.	.	none		0.597	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1	NM_021953	
ZSCAN5B	342933	hgsc.bcm.edu	37	19	56701355	56701355	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr19:56701355delG	ENST00000586855.2	-	5	1642	c.1329delC	c.(1327-1329)tacfs	p.Y443fs	ZSCAN5B_ENST00000358992.3_Frame_Shift_Del_p.Y443fs			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	443					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CTTTGCTGCAGTATTTACATT	0.547																																					p.C444fs		Atlas-Indel,Pindel	.											.	ZSCAN5B	160	.	0			c.1330delT						PASS	.						89.0	90.0	90.0					19																	56701355		2075	4230	6305	SO:0001589	frameshift_variant	342933	exon4			.		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.1329delC	chr19.hg19:g.56701355delG	ENSP00000466072:p.Tyr443fs	156.0	0.0	0		127.0	45.0	0.354331	NM_001080456		Frame_Shift_Del	DEL	ENST00000586855.2	hg19	CCDS46203.1																																																																																			.	.	.	none		0.547	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456	
ANKRD52	283373	hgsc.bcm.edu	37	12	56646601	56646601	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr12:56646601delG	ENST00000267116.7	-	12	1385	c.1264delC	c.(1264-1266)cttfs	p.L422fs		NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	422										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						GTACGGCCAAGGTTGTCAGGT	0.532																																					p.L422fs		Atlas-Indel,Pindel	.											.	ANKRD52	81	.	0			c.1265delT						PASS	.						60.0	62.0	62.0					12																	56646601		2092	4249	6341	SO:0001589	frameshift_variant	283373	exon12			.	AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.1264delC	chr12.hg19:g.56646601delG	ENSP00000267116:p.Leu422fs	80.0	0.0	0		74.0	20.0	0.27027	NM_173595	A6NE79|B1Q2K2	Frame_Shift_Del	DEL	ENST00000267116.7	hg19	CCDS44920.1																																																																																			.	.	.	none		0.532	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1	NM_173595	
WDR27	253769	hgsc.bcm.edu	37	6	170038673	170038680	+	Frame_Shift_Del	DEL	TTCGCAGG	TTCGCAGG	-	rs200836555|rs201534381|rs115828649	byFrequency	TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	TTCGCAGG	TTCGCAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr6:170038673_170038680delTTCGCAGG	ENST00000448612.1	-	18	1933_1940	c.1824_1831delCCTGCGAA	c.(1822-1833)accctgcgaatgfs	p.LRM609fs	WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000423258.1_Frame_Shift_Del_p.LRM482fs|WDR27_ENST00000333572.6_Frame_Shift_Del_p.LRM609fs	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	579						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GCCGACCACATTCGCAGGGTCCCGTCCC	0.596																																					p.609_611del		Pindel	.											.	WDR27	129	.	0			c.1825_1832del						PASS	.																																			SO:0001589	frameshift_variant	253769	exon18			.	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.1824_1831delCCTGCGAA	chr6.hg19:g.170038673_170038680delTTCGCAGG	ENSP00000416289:p.Leu609fs	216.0	0.0	.		108.0	22.0	0.204	NM_182552	A5PLM8|C9JGV0|Q5T066	Frame_Shift_Del	DEL	ENST00000448612.1	hg19	CCDS47520.2																																																																																			.	.	.	none		0.596	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	
ARHGEF19	128272	hgsc.bcm.edu	37	1	16529006	16529007	+	Frame_Shift_Ins	INS	-	-	CTCAGGTCCCGCACCTGCAGCTCAGCCAT			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr1:16529006_16529007insCTCAGGTCCCGCACCTGCAGCTCAGCCAT	ENST00000270747.3	-	13	2106_2107	c.1970_1971insATGGCTGAGCTGCAGGTGCGGGACCTGAG	c.(1969-1971)agcfs	p.S657fs	ARHGEF19_ENST00000478117.1_De_novo_Start_OutOfFrame	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	657	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGCTTCAGGCTCAGGTCCCG	0.663																																					p.S657_L658delinsRWLSCRCGTX		Pindel	.											.	ARHGEF19	49	.	0			c.1971_1972insATGGCTGAGCTGCAGGTGCGGGACCTGAG						PASS	.																																			SO:0001589	frameshift_variant	128272	exon13			.	BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.1942_1970dupATGGCTGAGCTGCAGGTGCGGGACCTGAG	chr1.hg19:g.16529006_16529007insCTCAGGTCCCGCACCTGCAGCTCAGCCAT	ENSP00000270747:p.Ser657fs	256.0	0.0	.		163.0	21.0	0.129	NM_153213	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Frame_Shift_Ins	INS	ENST00000270747.3	hg19	CCDS170.1																																																																																			.	.	.	none		0.663	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006289.1	NM_153213	
NUDT18	79873	hgsc.bcm.edu	37	8	21966703	21966708	+	Splice_Site	DEL	CGCACG	CGCACG	-	rs58343576		TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	CGCACG	CGCACG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr8:21966703_21966708delCGCACG	ENST00000309188.6	-	2	223_228	c.105_110delCGTGCG	c.(103-111)cccgtgcgg>ccg	p.VR36del	NUDT18_ENST00000522405.1_5'UTR|NUDT18_ENST00000521807.2_In_Frame_Del_p.RA36del	NM_024815.3	NP_079091.3	Q6ZVK8	NUD18_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 18	36					dADP catabolic process (GO:0046057)|dGDP catabolic process (GO:0046067)|GDP catabolic process (GO:0046712)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	8-hydroxy-dADP phosphatase activity (GO:0044717)|8-oxo-dGDP phosphatase activity (GO:0044715)|8-oxo-GDP phosphatase activity (GO:0044716)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|lung(2)	4				Colorectal(74;0.00185)|COAD - Colon adenocarcinoma(73;0.0608)|READ - Rectum adenocarcinoma(5;0.0986)		TTCCGCAGCCCGCAcggggcgccggc	0.782																																					p.36_37del		Pindel	.											.	NUDT18	13	.	0			c.106_110del						PASS	.																																			SO:0001630	splice_region_variant	79873	exon2			.		CCDS75706.1	8p21.3	2012-07-31				ENSG00000275074		"""Nudix motif containing"""	26194	protein-coding gene	gene with protein product	"""mutT human homolog 3"""	615791				22556419	Standard	NM_024815		Approved	FLJ22494, MTH3	uc003xaq.1	Q6ZVK8		ENST00000309188.6:c.102+3CGTGCG>-	chr8.hg19:g.21966703_21966708delCGCACG		5.0	0.0	.		13.0	10.0	0.769	NM_024815	Q8IZ75|Q9H687	Frame_Shift_Del	DEL	ENST00000309188.6	hg19																																																																																				.	.	.	none		0.782	NUDT18-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_024815	In_Frame_Del
PTPLA	9200	hgsc.bcm.edu	37	10	17659300	17659301	+	Frame_Shift_Ins	INS	-	-	CCGCTGC			TCGA-2Z-A9J2-01A-11D-A382-10	TCGA-2Z-A9J2-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b136f8d-949c-4f48-9ca6-f9bb90a10bb3	2d763603-a0f5-4dbe-a146-ef518556d752	g.chr10:17659300_17659301insCCGCTGC	ENST00000361271.3	-	1	75_76	c.38_39insGCAGCGG	c.(37-39)ggcfs	p.-13fs	PTPLA_ENST00000326961.6_Frame_Shift_Ins_p.-13fs	NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A						fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						CAGCCCGAGAGCCGCTGCCCGC	0.762																																					p.G13fs		Pindel	.											.	PTPLA	34	.	0			c.39_40insGCAGCGG						PASS	.																																			SO:0001589	frameshift_variant	9200	exon1			.	AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.32_38dupGCAGCGG	chr10.hg19:g.17659301_17659307dupCCGCTGC	ENSP00000355308:p.Gly13fs	50.0	0.0	.		38.0	10.0	0.263	NM_014241	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Frame_Shift_Ins	INS	ENST00000361271.3	hg19	CCDS7121.1																																																																																			.	.	.	none		0.762	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241	
