#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF1	65121	hgsc.bcm.edu	37	1	12854459	12854459	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:12854459T>G	ENST00000332296.7	+	3	786	c.683T>G	c.(682-684)cTg>cGg	p.L228R	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	228					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CGTTGTTACCTGAAGGAGATG	0.413																																					p.L228R		Atlas-SNP	.											.	PRAMEF1	78	.	0			c.T683G						PASS	.						199.0	196.0	197.0					1																	12854459		2202	4293	6495	SO:0001583	missense	65121	exon3			GTTACCTGAAGGA	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.683T>G	chr1.hg19:g.12854459T>G	ENSP00000332134:p.Leu228Arg	211.0	0.0	.		209.0	51.0	.	NM_023013	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	hg19	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	11.91	1.778239	0.31502	.	.	ENSG00000116721	ENST00000332296	T	0.01279	5.06	1.61	1.61	0.23674	.	0.000000	0.64402	D	0.000019	T	0.07098	0.0180	M	0.86953	2.85	0.18873	N	0.999984	D	0.89917	1.0	D	0.97110	1.0	T	0.04811	-1.0925	10	0.87932	D	0	.	5.2932	0.15739	0.0:0.0:0.0:1.0	.	228	O95521	PRAM1_HUMAN	R	228	ENSP00000332134:L228R	ENSP00000332134:L228R	L	+	2	0	PRAMEF1	12777046	0.002000	0.14202	0.009000	0.14445	0.014000	0.08584	1.259000	0.32956	0.987000	0.38709	0.358000	0.22013	CTG	.	.	.	none		0.413	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
RHCE	6006	hgsc.bcm.edu	37	1	25718532	25718532	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:25718532T>C	ENST00000294413.7	-	4	645	c.587A>G	c.(586-588)gAg>gGg	p.E196G	RHCE_ENST00000346452.4_Intron|RHCE_ENST00000455194.1_Intron|RHCE_ENST00000374352.2_Missense_Mutation_p.E180G|RHCE_ENST00000413854.1_Missense_Mutation_p.E196G|RHCE_ENST00000243186.6_Missense_Mutation_p.E196G|RHCE_ENST00000349438.4_Missense_Mutation_p.E196G|RHCE_ENST00000425135.1_Missense_Mutation_p.E196G|RHCE_ENST00000349320.3_Missense_Mutation_p.E180G|RHCE_ENST00000340849.4_Intron	NM_020485.4	NP_065231	P18577	RHCE_HUMAN	Rh blood group, CcEe antigens	196						integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			endometrium(8)|large_intestine(6)|lung(3)	17		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		ATCATTATCCTCCGTTCCCTT	0.537																																					p.E196G		Atlas-SNP	.											.	RHCE	36	.	0			c.A587G						PASS	.						285.0	226.0	246.0					1																	25718532		2203	4300	6503	SO:0001583	missense	6006	exon4			TTATCCTCCGTTC	BC075081	CCDS30634.1, CCDS30635.1, CCDS30636.1, CCDS30637.1	1p36.11	2014-09-17	2006-02-23		ENSG00000188672	ENSG00000188672		"""CD molecules"", ""Blood group antigens"""	10008	protein-coding gene	gene with protein product		111700	"""Rhesus blood group, CcEe antigens"""	RH		8220426	Standard	NM_138618		Approved	CD240CE	uc001bkf.3	P18577	OTTHUMG00000007650	ENST00000294413.7:c.587A>G	chr1.hg19:g.25718532T>C	ENSP00000294413:p.Glu196Gly	160.0	0.0	.		196.0	68.0	.	NM_138618	A7DW68|B7UDF3|B7UDF4|B7UDF5|B7UDF6|B7UDF7|B7UDF8|B7UDF9|B7UDG0|B7UDG1|B7UDG2|B7UDG3|Q02163|Q02164|Q02165|Q16160|Q2MJW0|Q2VC86|Q3LTM6|Q6AZX5|Q6J2U3|Q7RU06|Q8IZT2|Q8IZT3|Q8IZT4|Q8IZT5|Q9UD13|Q9UD14|Q9UD15|Q9UD16|Q9UD73|Q9UD74|Q9UEC2|Q9UEC3|Q9UPN0	Missense_Mutation	SNP	ENST00000294413.7	hg19	CCDS30635.1	.	.	.	.	.	.	.	.	.	.	t	10.89	1.478742	0.26511	.	.	ENSG00000188672	ENST00000413854;ENST00000374352;ENST00000243186;ENST00000425135;ENST00000349320;ENST00000294413;ENST00000447203;ENST00000349438	T;T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97;1.97	3.99	1.46	0.22682	Ammonium transporter AmtB-like (3);	1.495710	0.03510	N	0.219354	T	0.31670	0.0804	L	0.49699	1.58	0.09310	N	1	B;B;P	0.39809	0.004;0.004;0.689	B;B;P	0.51657	0.033;0.02;0.676	T	0.13019	-1.0525	10	0.40728	T	0.16	-0.1541	3.4811	0.07602	0.2098:0.1119:0.0:0.6784	.	180;196;196	Q5VSJ9;Q5VSJ8;P18577	.;.;RHCE_HUMAN	G	196;180;196;196;180;196;196;196	ENSP00000415417:E196G;ENSP00000363472:E180G;ENSP00000243186:E196G;ENSP00000392809:E196G;ENSP00000311185:E180G;ENSP00000294413:E196G;ENSP00000334570:E196G	ENSP00000243186:E196G	E	-	2	0	RHCE	25591119	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.027000	0.12371	0.150000	0.19136	0.459000	0.35465	GAG	.	.	.	none		0.537	RHCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020312.2	NM_020485	
AIM1L	55057	hgsc.bcm.edu	37	1	26665868	26665868	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:26665868T>C	ENST00000308182.5	-	5	551	c.122A>G	c.(121-123)gAg>gGg	p.E41G	AIM1L_ENST00000522993.1_5'Flank|AIM1L_ENST00000527815.1_Missense_Mutation_p.E212G			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	41	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.						carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		CTTCACTTGCTCCCCCTTGAG	0.552																																					p.E1086G		Atlas-SNP	.											.	AIM1L	98	.	0			c.A3257G						PASS	.						68.0	74.0	72.0					1																	26665868		2203	4300	6503	SO:0001583	missense	55057	exon6			ACTTGCTCCCCCT			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.122A>G	chr1.hg19:g.26665868T>C	ENSP00000310435:p.Glu41Gly	80.0	0.0	.		93.0	4.0	.	NM_001039775	B2RNG3|Q5T137|Q5T150	Missense_Mutation	SNP	ENST00000308182.5	hg19		.	.	.	.	.	.	.	.	.	.	T	6.765	0.510112	0.12883	.	.	ENSG00000176092	ENST00000527815;ENST00000308182	T;T	0.76839	-1.05;-1.05	5.26	1.53	0.23141	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.358794	0.28940	N	0.013650	T	0.69780	0.3149	M	0.64997	1.995	0.54753	D	0.999987	B	0.34103	0.437	B	0.33846	0.171	T	0.61811	-0.6986	10	0.31617	T	0.26	.	7.8916	0.29682	0.1101:0.0:0.3649:0.525	.	41	Q8N1P7	AIM1L_HUMAN	G	212;41	ENSP00000433931:E212G;ENSP00000310435:E41G	ENSP00000310435:E41G	E	-	2	0	AIM1L	26538455	1.000000	0.71417	0.883000	0.34634	0.302000	0.27658	2.050000	0.41297	0.390000	0.25115	-2.293000	0.00265	GAG	.	.	.	none		0.552	AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2	
ARID1A	8289	hgsc.bcm.edu	37	1	27056349	27056349	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:27056349C>T	ENST00000324856.7	+	2	1716	c.1345C>T	c.(1345-1347)Cag>Tag	p.Q449*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q66*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q449*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	449					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTCTTATACACAGCAGGTAGA	0.557			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q449X		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.C1345T						PASS	.						33.0	36.0	35.0					1																	27056349		2203	4300	6503	SO:0001587	stop_gained	8289	exon2			TATACACAGCAGG	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1345C>T	chr1.hg19:g.27056349C>T	ENSP00000320485:p.Gln449*	216.0	0.0	.		241.0	66.0	.	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	37	6.225161	0.97390	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000524572;ENST00000374152	.	.	.	5.94	5.94	0.96194	.	0.056021	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-6.9651	20.3771	0.98923	0.0:1.0:0.0:0.0	.	.	.	.	X	449;449;66;66	.	ENSP00000320485:Q449X	Q	+	1	0	ARID1A	26928936	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.217000	0.77982	2.824000	0.97209	0.650000	0.86243	CAG	.	.	.	none		0.557	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
AGL	178	hgsc.bcm.edu	37	1	100340327	100340327	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:100340327T>A	ENST00000294724.4	+	8	1521	c.1043T>A	c.(1042-1044)gTa>gAa	p.V348E	AGL_ENST00000361522.4_Missense_Mutation_p.V331E|AGL_ENST00000370161.2_Missense_Mutation_p.V332E|AGL_ENST00000477753.1_3'UTR|AGL_ENST00000361302.3_Missense_Mutation_p.V332E|AGL_ENST00000370165.3_Missense_Mutation_p.V348E|AGL_ENST00000370163.3_Missense_Mutation_p.V348E|AGL_ENST00000361915.3_Missense_Mutation_p.V348E	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	348					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GGCTGTACTGTAGATATGAAC	0.338																																					p.V348E		Atlas-SNP	.											.	AGL	137	.	0			c.T1043A						PASS	.						141.0	124.0	130.0					1																	100340327		2203	4300	6503	SO:0001583	missense	178	exon8			GTACTGTAGATAT	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.1043T>A	chr1.hg19:g.100340327T>A	ENSP00000294724:p.Val348Glu	100.0	0.0	.		106.0	19.0	.	NM_000644	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	hg19	CCDS759.1	.	.	.	.	.	.	.	.	.	.	T	18.30	3.594592	0.66219	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	D;D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04	4.84	4.84	0.62591	Glycoside hydrolase, superfamily (1);	0.137739	0.48767	D	0.000175	D	0.90280	0.6960	M	0.83012	2.62	0.80722	D	1	D;D;P	0.53619	0.961;0.961;0.796	P;P;P	0.61940	0.896;0.896;0.701	D	0.92046	0.5644	10	0.87932	D	0	.	14.6928	0.69098	0.0:0.0:0.0:1.0	.	331;332;348	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	E	348;348;348;348;332;332;331	ENSP00000355106:V348E;ENSP00000359184:V348E;ENSP00000359182:V348E;ENSP00000294724:V348E;ENSP00000354971:V332E;ENSP00000359180:V332E;ENSP00000354635:V331E	ENSP00000294724:V348E	V	+	2	0	AGL	100112915	1.000000	0.71417	0.612000	0.29024	0.342000	0.28953	6.856000	0.75450	1.933000	0.56026	0.477000	0.44152	GTA	.	.	.	none		0.338	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
RPTN	126638	hgsc.bcm.edu	37	1	152128604	152128604	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:152128604C>T	ENST00000316073.3	-	3	1035	c.971G>A	c.(970-972)aGa>aAa	p.R324K		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	324	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						CTGGCCTTGTCTGTCCGTCTG	0.493																																					p.R324K		Atlas-SNP	.											.	RPTN	123	.	0			c.G971A						PASS	.						742.0	647.0	676.0					1																	152128604		1568	3582	5150	SO:0001583	missense	126638	exon3			CCTTGTCTGTCCG	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.971G>A	chr1.hg19:g.152128604C>T	ENSP00000317895:p.Arg324Lys	109.0	0.0	.		152.0	41.0	.	NM_001122965	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	hg19	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	c	10.67	1.414408	0.25465	.	.	ENSG00000215853	ENST00000316073	T	0.12879	2.64	4.56	-1.55	0.08558	.	.	.	.	.	T	0.07683	0.0193	L	0.58428	1.81	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.17228	-1.0376	9	0.06099	T	0.92	.	1.7411	0.02952	0.1409:0.4549:0.1381:0.2662	.	324	Q6XPR3	RPTN_HUMAN	K	324	ENSP00000317895:R324K	ENSP00000317895:R324K	R	-	2	0	RPTN	150395228	0.176000	0.23096	0.007000	0.13788	0.295000	0.27426	0.448000	0.21726	-0.262000	0.09392	0.393000	0.25936	AGA	.	.	.	none		0.493	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
DHX9	1660	hgsc.bcm.edu	37	1	182828229	182828229	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:182828229G>A	ENST00000367549.3	+	11	1227	c.1117G>A	c.(1117-1119)Gaa>Aaa	p.E373K		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	373	MTAD.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GTACCAGTTGGAACAGGATCA	0.378																																					p.E373K	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.G1117A						PASS	.						116.0	104.0	108.0					1																	182828229		1867	4116	5983	SO:0001583	missense	1660	exon11			CAGTTGGAACAGG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.1117G>A	chr1.hg19:g.182828229G>A	ENSP00000356520:p.Glu373Lys	94.0	0.0	.		93.0	33.0	.	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125740	0.56721	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.03580	3.88	5.9	5.9	0.94986	.	0.066463	0.64402	D	0.000009	T	0.03871	0.0109	N	0.19112	0.55	0.58432	D	0.999999	B	0.15719	0.014	B	0.09377	0.004	T	0.55147	-0.8186	10	0.29301	T	0.29	.	18.0703	0.89404	0.0:0.0:1.0:0.0	.	373	Q08211	DHX9_HUMAN	K	373	ENSP00000356520:E373K	ENSP00000356520:E373K	E	+	1	0	DHX9	181094852	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.439000	0.73430	2.786000	0.95864	0.563000	0.77884	GAA	.	.	.	none		0.378	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
CR1	1378	hgsc.bcm.edu	37	1	207782641	207782641	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:207782641C>T	ENST00000367049.4	+	37	5903	c.5903C>T	c.(5902-5904)tCt>tTt	p.S1968F	CR1_ENST00000367051.1_Missense_Mutation_p.S1518F|CR1_ENST00000400960.2_Missense_Mutation_p.S1518F|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000367052.1_Missense_Mutation_p.S1518F|CR1_ENST00000367053.1_Missense_Mutation_p.S1518F|RP11-78B10.2_ENST00000597497.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1518					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TCAGTCATATCTTGTGAGCCA	0.348																																					p.S1968F		Atlas-SNP	.											.	CR1	354	.	0			c.C5903T						PASS	.						87.0	84.0	85.0					1																	207782641		1871	4106	5977	SO:0001583	missense	1378	exon37			TCATATCTTGTGA	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5903C>T	chr1.hg19:g.207782641C>T	ENSP00000356016:p.Ser1968Phe	65.0	0.0	.		71.0	20.0	.	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	hg19	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	C	9.427	1.084621	0.20309	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9	2.66	0.685	0.18009	Complement control module (2);Sushi/SCR/CCP (1);	.	.	.	.	T	0.33847	0.0877	L	0.41492	1.28	0.09310	N	1	P;D;D	0.71674	0.848;0.998;0.995	B;D;P	0.77004	0.247;0.989;0.844	T	0.12863	-1.0531	9	0.59425	D	0.04	.	3.1826	0.06589	0.2595:0.5917:0.0:0.1488	.	1518;1518;1968	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	F	1518;1518;1518;1518;1068;1968	ENSP00000356019:S1518F;ENSP00000356018:S1518F;ENSP00000356020:S1518F;ENSP00000383744:S1518F;ENSP00000436139:S1068F;ENSP00000356016:S1968F	ENSP00000356016:S1968F	S	+	2	0	CR1	205849264	0.075000	0.21258	0.002000	0.10522	0.048000	0.14542	0.375000	0.20518	0.176000	0.19873	0.555000	0.69702	TCT	.	.	.	none		0.348	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
HSD11B1	3290	hgsc.bcm.edu	37	1	209907854	209907854	+	Silent	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:209907854C>T	ENST00000367028.2	+	7	1036	c.867C>T	c.(865-867)ttC>ttT	p.F289F	HSD11B1_ENST00000367027.3_Silent_p.F289F|HSD11B1_ENST00000261465.1_Silent_p.F289F	NM_001206741.1	NP_001193670.1	P28845	DHI1_HUMAN	hydroxysteroid (11-beta) dehydrogenase 1	289					glucocorticoid biosynthetic process (GO:0006704)|lung development (GO:0030324)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	11-beta-hydroxysteroid dehydrogenase (NADP+) activity (GO:0070524)|11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(9)	16				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	Prednisone(DB00635)	TGGACAGATTCATAAACAAGT	0.433																																					p.F289F		Atlas-SNP	.											.	HSD11B1	35	.	0			c.C867T						PASS	.						88.0	86.0	87.0					1																	209907854		2203	4300	6503	SO:0001819	synonymous_variant	3290	exon7			CAGATTCATAAAC	BC012593	CCDS1489.1	1q32-q41	2011-09-20			ENSG00000117594	ENSG00000117594	1.1.1.146	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5208	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 26C, member 1"""	600713		HSD11B, HSD11		1885595, 19027726	Standard	NM_005525		Approved	SDR26C1	uc001hhk.3	P28845	OTTHUMG00000036481	ENST00000367028.2:c.867C>T	chr1.hg19:g.209907854C>T		52.0	0.0	.		49.0	19.0	.	NM_001206741	B2R9Z1|D3DT89	Silent	SNP	ENST00000367028.2	hg19	CCDS1489.1																																																																																			.	.	.	none		0.433	HSD11B1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088743.2	NM_005525	
OBSCN	84033	hgsc.bcm.edu	37	1	228506775	228506775	+	Silent	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:228506775G>A	ENST00000422127.1	+	54	14366	c.14322G>A	c.(14320-14322)gaG>gaA	p.E4774E	OBSCN_ENST00000284548.11_Silent_p.E4774E|OBSCN_ENST00000570156.2_Silent_p.E5731E|OBSCN_ENST00000366709.4_Silent_p.E1893E|OBSCN_ENST00000366707.4_Silent_p.E2408E	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4774					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGCCACAGGAGGCAGAGGAGG	0.642																																					p.E5731E		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G17193A						PASS	.						26.0	31.0	29.0					1																	228506775		2199	4289	6488	SO:0001819	synonymous_variant	84033	exon65			ACAGGAGGCAGAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14322G>A	chr1.hg19:g.228506775G>A		135.0	0.0	.		139.0	47.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	.	.	none		0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
PLD5	200150	hgsc.bcm.edu	37	1	242383316	242383316	+	Missense_Mutation	SNP	C	C	A	rs552058954	byFrequency	TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:242383316C>A	ENST00000536534.2	-	5	950	c.709G>T	c.(709-711)Ggt>Tgt	p.G237C	PLD5_ENST00000427495.1_Missense_Mutation_p.G175C|PLD5_ENST00000442594.2_Missense_Mutation_p.G145C			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	237	PLD phosphodiesterase 1.					integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CAGTCCAAACCGGCACTGCCG	0.517																																					p.G237C		Atlas-SNP	.											PLD5_ENST00000536534,bladder,carcinoma,0,2	PLD5	216	.	0			c.G709T						PASS	.						114.0	98.0	103.0					1																	242383316		2203	4300	6503	SO:0001583	missense	200150	exon6			CCAAACCGGCACT	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.709G>T	chr1.hg19:g.242383316C>A	ENSP00000440896:p.Gly237Cys	103.0	0.0	.		138.0	24.0	.	NM_152666	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	hg19	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	C	16.30	3.084149	0.55861	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.13778	2.56;2.56;2.56	5.58	-1.11	0.09840	Phospholipase D/Transphosphatidylase (1);	0.233267	0.48286	D	0.000186	T	0.15739	0.0379	N	0.22421	0.69	0.26533	N	0.974214	D;D;D	0.65815	0.995;0.975;0.995	P;P;P	0.60949	0.881;0.571;0.667	T	0.08827	-1.0703	10	0.87932	D	0	-2.9252	8.6192	0.33851	0.0:0.348:0.0:0.652	.	145;237;175	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	C	175;145;237	ENSP00000401285:G175C;ENSP00000414188:G145C;ENSP00000440896:G237C	ENSP00000401285:G175C	G	-	1	0	PLD5	240449939	0.119000	0.22226	0.141000	0.22245	0.912000	0.54170	0.959000	0.29240	-0.136000	0.11475	-0.136000	0.14681	GGT	.	.	.	none		0.517	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
BIRC6	57448	hgsc.bcm.edu	37	2	32631577	32631577	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr2:32631577C>A	ENST00000421745.2	+	9	1563	c.1429C>A	c.(1429-1431)Ctg>Atg	p.L477M		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	477					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TGATGATTTACTGGAGGATTC	0.284																																					p.L477M	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.C1429A						PASS	.						69.0	76.0	74.0					2																	32631577		2203	4299	6502	SO:0001583	missense	57448	exon9			GATTTACTGGAGG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1429C>A	chr2.hg19:g.32631577C>A	ENSP00000393596:p.Leu477Met	185.0	0.0	.		278.0	121.0	.	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	11.51	1.659685	0.29515	.	.	ENSG00000115760	ENST00000421745	T	0.79653	-1.29	5.54	4.66	0.58398	.	0.000000	0.64402	D	0.000014	T	0.73071	0.3540	N	0.22421	0.69	0.38105	D	0.937395	P	0.48162	0.906	P	0.46758	0.526	T	0.75847	-0.3173	10	0.40728	T	0.16	.	12.9011	0.58125	0.0:0.867:0.0:0.133	.	477	Q9NR09	BIRC6_HUMAN	M	477	ENSP00000393596:L477M	ENSP00000393596:L477M	L	+	1	2	BIRC6	32485081	0.991000	0.36638	1.000000	0.80357	0.994000	0.84299	0.299000	0.19138	2.607000	0.88179	0.585000	0.79938	CTG	.	.	.	none		0.284	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
ELMOD3	84173	hgsc.bcm.edu	37	2	85617285	85617285	+	Silent	SNP	C	C	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr2:85617285C>A	ENST00000409890.2	+	13	1507	c.840C>A	c.(838-840)gtC>gtA	p.V280V	ELMOD3_ENST00000490508.1_3'UTR|ELMOD3_ENST00000409344.3_Silent_p.V280V|ELMOD3_ENST00000393852.4_Silent_p.V280V|ELMOD3_ENST00000409013.3_Silent_p.V280V|ELMOD3_ENST00000315658.7_Silent_p.V280V			Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3	280	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	12						AGCAGAAGGTCATCCCCGTGG	0.572																																					p.V280V		Atlas-SNP	.											.	ELMOD3	53	.	0			c.C840A						PASS	.						103.0	84.0	90.0					2																	85617285		2203	4300	6503	SO:0001819	synonymous_variant	84173	exon13			GAAGGTCATCCCC	AF258573	CCDS1973.1, CCDS46352.1	2p11.2	2014-01-28	2008-08-14	2008-08-14	ENSG00000115459	ENSG00000115459		"""RNA binding motif (RRM) containing"""	26158	protein-coding gene	gene with protein product		615427	"""RNA binding motif protein 29"", ""RNA binding motif and ELMO/CED-12 domain 1"", ""deafness, autosomal recessive 88"""	RBM29, RBED1, DFNB88		24039609	Standard	NM_032213		Approved	FLJ21977	uc010ysn.2	Q96FG2	OTTHUMG00000130170	ENST00000409890.2:c.840C>A	chr2.hg19:g.85617285C>A		90.0	0.0	.		175.0	28.0	.	NM_001135022	B8ZZD6|D6W5K4|Q2M1K3|Q2XSU3|Q2XSU4|Q8NAC1|Q8TCK4|Q8WV70|Q8WY75|Q9H6Q8	Silent	SNP	ENST00000409890.2	hg19	CCDS46352.1																																																																																			.	.	.	none		0.572	ELMOD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329124.1	NM_032213	
FOXD4L1	200350	hgsc.bcm.edu	37	2	114257882	114257882	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr2:114257882G>A	ENST00000306507.5	+	1	1222	c.1049G>A	c.(1048-1050)aGc>aAc	p.S350N		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	350					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						ACCGCGTGGAGCTACTGCCCC	0.627																																					p.S350N		Atlas-SNP	.											.	FOXD4L1	48	.	0			c.G1049A						PASS	.						18.0	24.0	22.0					2																	114257882		2081	4032	6113	SO:0001583	missense	200350	exon1			CGTGGAGCTACTG	AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.1049G>A	chr2.hg19:g.114257882G>A	ENSP00000302756:p.Ser350Asn	165.0	0.0	.		197.0	75.0	.	NM_012184	B3KWN1|B9EGF3	Missense_Mutation	SNP	ENST00000306507.5	hg19	CCDS2117.1	.	.	.	.	.	.	.	.	.	.	.	8.149	0.786951	0.16189	.	.	ENSG00000184492	ENST00000306507	D	0.94650	-3.48	2.37	2.37	0.29283	.	0.222365	0.21869	U	0.067914	D	0.86648	0.5983	N	0.24115	0.695	0.23841	N	0.996697	B	0.29432	0.244	B	0.26864	0.074	T	0.75013	-0.3467	10	0.19590	T	0.45	.	8.2663	0.31815	0.0:0.0:1.0:0.0	.	350	Q9NU39	FX4L1_HUMAN	N	350	ENSP00000302756:S350N	ENSP00000302756:S350N	S	+	2	0	FOXD4L1	113974352	0.973000	0.33851	0.872000	0.34217	0.242000	0.25591	3.399000	0.52586	1.337000	0.45525	0.184000	0.17185	AGC	.	.	.	none		0.627	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254148.1	NM_012184	
TUBA3D	113457	hgsc.bcm.edu	37	2	132240242	132240242	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr2:132240242G>A	ENST00000321253.6	+	5	1281	c.1174G>A	c.(1174-1176)Gac>Aac	p.D392N	MZT2A_ENST00000410036.2_5'Flank	NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	392			D -> V (in dbSNP:rs17076703).		'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		GGCCCGCCTGGACCATAAGTT	0.652																																					p.D392N	Ovarian(137;2059 2432 35543 39401)	Atlas-SNP	.											.	TUBA3D	60	.	0			c.G1174A						PASS	.						106.0	105.0	106.0					2																	132240242		2203	4300	6503	SO:0001583	missense	113457	exon5			CGCCTGGACCATA	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.1174G>A	chr2.hg19:g.132240242G>A	ENSP00000326042:p.Asp392Asn	127.0	0.0	.		161.0	58.0	.	NM_080386	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000321253.6	hg19	CCDS33290.1	.	.	.	.	.	.	.	.	.	.	g	12.98	2.099992	0.37048	.	.	ENSG00000075886	ENST00000321253;ENST00000341158	D	0.84070	-1.8	2.41	2.41	0.29592	Tubulin/FtsZ, 2-layer sandwich domain (2);Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.47852	U	0.000215	T	0.75591	0.3870	N	0.21097	0.63	0.46874	D	0.999238	B	0.09022	0.002	B	0.35931	0.214	T	0.73883	-0.3842	10	0.66056	D	0.02	.	10.5186	0.44905	0.0:0.0:1.0:0.0	.	392	Q13748	TBA3C_HUMAN	N	392	ENSP00000326042:D392N	ENSP00000326042:D392N	D	+	1	0	TUBA3D	131956712	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	7.072000	0.76777	1.334000	0.45468	0.194000	0.17425	GAC	.	.	.	none		0.652	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331800.2	NM_080386	
CDK15	65061	hgsc.bcm.edu	37	2	202698681	202698681	+	Silent	SNP	A	A	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr2:202698681A>G	ENST00000374598.4	+	7	717	c.717A>G	c.(715-717)aaA>aaG	p.K239K	CDK15_ENST00000410091.3_Silent_p.K188K|CDK15_ENST00000450471.2_Silent_p.K239K|CDK15_ENST00000488419.1_3'UTR|CDK15_ENST00000434439.1_Silent_p.K239K|CDK15_ENST00000260967.2_Silent_p.K188K			Q96Q40	CDK15_HUMAN	cyclin-dependent kinase 15	239	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)			breast(3)|endometrium(2)|kidney(5)|large_intestine(1)|lung(14)|ovary(1)	26					Adenosine triphosphate(DB00171)	GAGAGCTCAAACTGGCTGATT	0.512																																					p.K239K		Atlas-SNP	.											.	CDK15	66	.	0			c.A717G						PASS	.						116.0	102.0	107.0					2																	202698681		2203	4300	6503	SO:0001819	synonymous_variant	65061	exon7			GCTCAAACTGGCT	AB053308	CCDS2350.1, CCDS58746.1, CCDS58747.1	2q33.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000138395	ENSG00000138395		"""Cyclin-dependent kinases"""	14434	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7"", ""PFTAIRE protein kinase 2"""	ALS2CR7, PFTK2		11586298, 16236519, 19884882	Standard	NM_139158		Approved	PFTAIRE2	uc002uyt.3	Q96Q40	OTTHUMG00000132838	ENST00000374598.4:c.717A>G	chr2.hg19:g.202698681A>G		76.0	0.0	.		111.0	19.0	.	NM_001261435	A8K8R9|B8ZZX0|C9J1N8|C9K003|F8W6H8|Q4ZG86|Q53TV1|Q6ZMR9|Q8IUP1	Silent	SNP	ENST00000374598.4	hg19																																																																																				.	.	.	none		0.512	CDK15-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000336053.2		
PLXNB1	5364	hgsc.bcm.edu	37	3	48464321	48464321	+	Silent	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr3:48464321G>A	ENST00000358536.4	-	4	1412	c.1143C>T	c.(1141-1143)caC>caT	p.H381H	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000358459.4_Silent_p.H381H|PLXNB1_ENST00000456774.1_Silent_p.H381H|PLXNB1_ENST00000296440.6_Silent_p.H381H	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	381	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGCTGGGCGTGTGGTCTGAGC	0.607																																					p.H381H		Atlas-SNP	.											.	PLXNB1	150	.	0			c.C1143T						PASS	.						52.0	51.0	51.0					3																	48464321		2203	4300	6503	SO:0001819	synonymous_variant	5364	exon4			GGGCGTGTGGTCT	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.1143C>T	chr3.hg19:g.48464321G>A		124.0	0.0	.		188.0	54.0	.	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	ENST00000358536.4	hg19	CCDS2765.1																																																																																			.	.	.	none		0.607	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
ROBO2	6092	hgsc.bcm.edu	37	3	77617480	77617480	+	Silent	SNP	A	A	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr3:77617480A>T	ENST00000461745.1	+	13	2766	c.1866A>T	c.(1864-1866)gcA>gcT	p.A622A	ROBO2_ENST00000332191.8_Silent_p.A622A|ROBO2_ENST00000487694.3_Silent_p.A638A	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	622					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GCCCACCAGCACAAGGAGTGG	0.418																																					p.A622A		Atlas-SNP	.											.	ROBO2	527	.	0			c.A1866T						PASS	.						108.0	106.0	106.0					3																	77617480		2035	4193	6228	SO:0001819	synonymous_variant	6092	exon13			ACCAGCACAAGGA	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1866A>T	chr3.hg19:g.77617480A>T		79.0	0.0	.		106.0	19.0	.	NM_002942	O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	hg19	CCDS43109.1																																																																																			.	.	.	none		0.418	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
CHMP2B	25978	hgsc.bcm.edu	37	3	87299049	87299049	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr3:87299049A>G	ENST00000263780.4	+	4	584	c.346A>G	c.(346-348)Atg>Gtg	p.M116V	CHMP2B_ENST00000471660.1_Missense_Mutation_p.M75V|CHMP2B_ENST00000472024.1_3'UTR|CHMP2B_ENST00000494980.1_Missense_Mutation_p.M86V	NM_014043.3	NP_054762.2	Q9UQN3	CHM2B_HUMAN	charged multivesicular body protein 2B	116					cell death (GO:0008219)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	12	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		TAACAAGAAGATGGATCCACA	0.284																																					p.M116V		Atlas-SNP	.											.	CHMP2B	28	.	0			c.A346G						PASS	.						71.0	71.0	71.0					3																	87299049		2203	4295	6498	SO:0001583	missense	25978	exon4			AAGAAGATGGATC	BC001553	CCDS2918.1, CCDS58840.1	3p12.1	2011-09-21	2011-09-21		ENSG00000083937	ENSG00000083937		"""Charged multivesicular body proteins"""	24537	protein-coding gene	gene with protein product	"""VPS2 homolog B (S. cerevisiae)"""	609512	"""chromatin modifying protein 2B"""			11559748	Standard	NM_014043		Approved	DKFZP564O123, CHMP2.5, VPS2B	uc003dqp.4	Q9UQN3	OTTHUMG00000158982	ENST00000263780.4:c.346A>G	chr3.hg19:g.87299049A>G	ENSP00000263780:p.Met116Val	445.0	0.0	.		679.0	141.0	.	NM_014043	B4DJG8|Q53HC7|Q9Y4U6	Missense_Mutation	SNP	ENST00000263780.4	hg19	CCDS2918.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813168	0.50527	.	.	ENSG00000083937	ENST00000471660;ENST00000263780;ENST00000494980	T;T;T	0.72282	-0.64;-0.64;-0.64	5.95	3.58	0.41010	.	0.068172	0.85682	N	0.000000	T	0.63943	0.2554	M	0.64170	1.965	0.80722	D	1	P;B	0.37573	0.6;0.0	B;B	0.35931	0.214;0.001	T	0.57230	-0.7847	10	0.26408	T	0.33	-13.8833	10.4077	0.44274	0.8709:0.0:0.1291:0.0	.	75;116	B4DJG8;Q9UQN3	.;CHM2B_HUMAN	V	75;116;86	ENSP00000419998:M75V;ENSP00000263780:M116V;ENSP00000418920:M86V	ENSP00000263780:M116V	M	+	1	0	CHMP2B	87381739	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.727000	0.68523	0.505000	0.28104	0.460000	0.39030	ATG	.	.	.	none		0.284	CHMP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352779.2	NM_014043	
SEMA5B	54437	hgsc.bcm.edu	37	3	122647427	122647427	+	Silent	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr3:122647427G>A	ENST00000357599.3	-	7	959	c.573C>T	c.(571-573)gtC>gtT	p.V191V	AC078794.1_ENST00000408284.1_RNA|SEMA5B_ENST00000451055.2_Silent_p.V245V|SEMA5B_ENST00000195173.4_Silent_p.V191V	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	191	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TCCGGCCGGCGACGATCAGGA	0.592																																					p.V245V		Atlas-SNP	.											.	SEMA5B	303	.	0			c.C735T						PASS	.						65.0	49.0	54.0					3																	122647427		2199	4288	6487	SO:0001819	synonymous_variant	54437	exon7			GCCGGCGACGATC	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.573C>T	chr3.hg19:g.122647427G>A		149.0	0.0	.		208.0	92.0	.	NM_001256347	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Silent	SNP	ENST00000357599.3	hg19	CCDS35491.1																																																																																			.	.	.	none		0.592	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
SLC7A14	57709	hgsc.bcm.edu	37	3	170244552	170244552	+	Silent	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr3:170244552G>A	ENST00000231706.5	-	2	489	c.174C>T	c.(172-174)ctC>ctT	p.L58L	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	58					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CAAGAGAGATGAGGTCCACTG	0.567																																					p.L58L		Atlas-SNP	.											.	SLC7A14	110	.	0			c.C174T						PASS	.						260.0	195.0	217.0					3																	170244552		2203	4300	6503	SO:0001819	synonymous_variant	57709	exon2			AGAGATGAGGTCC	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.174C>T	chr3.hg19:g.170244552G>A		84.0	0.0	.		147.0	57.0	.	NM_020949	B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	hg19	CCDS33892.1																																																																																			.	.	.	none		0.567	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	
CC2D2A	57545	hgsc.bcm.edu	37	4	15482437	15482437	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr4:15482437G>A	ENST00000503292.1	+	5	413	c.233G>A	c.(232-234)cGg>cAg	p.R78Q	CC2D2A_ENST00000515124.1_Missense_Mutation_p.R78Q|CC2D2A_ENST00000438599.2_Silent_p.P113P|CC2D2A_ENST00000413206.1_Missense_Mutation_p.R78Q|CC2D2A_ENST00000424120.1_Missense_Mutation_p.R78Q|CC2D2A_ENST00000389652.5_Missense_Mutation_p.R29Q|CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000511544.1_Silent_p.P113P|CC2D2A_ENST00000507954.1_Missense_Mutation_p.R78Q|CC2D2A_ENST00000503658.1_Silent_p.P113P	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	78					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						ATGACAGTCCGGAGAGGCCCA	0.552																																					p.R78Q		Atlas-SNP	.											.	CC2D2A	158	.	0			c.G233A						PASS	.						31.0	32.0	32.0					4																	15482437		1898	4119	6017	SO:0001583	missense	57545	exon5			CAGTCCGGAGAGG	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.233G>A	chr4.hg19:g.15482437G>A	ENSP00000421809:p.Arg78Gln	247.0	0.0	.		285.0	78.0	.	NM_001080522	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	hg19	CCDS47026.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.934877	0.34189	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000512702;ENST00000507954;ENST00000515124;ENST00000503292;ENST00000389652	T;T;T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71;1.71;1.71	4.96	2.33	0.28932	.	0.862507	0.09564	N	0.785128	T	0.21962	0.0529	L	0.54323	1.7	0.09310	N	1	B;B;B;B	0.31125	0.048;0.048;0.09;0.309	B;B;B;B	0.23852	0.008;0.008;0.021;0.049	T	0.18524	-1.0334	10	0.36615	T	0.2	.	6.9029	0.24293	0.2849:0.0:0.7151:0.0	.	78;29;78;78	Q9P2K1;Q9P2K1-2;C9JKY6;D6RB72	C2D2A_HUMAN;.;.;.	Q	78;78;29;29;78;78;78;78;29	ENSP00000403465:R78Q;ENSP00000398391:R78Q;ENSP00000422875:R78Q;ENSP00000427221:R78Q;ENSP00000424368:R78Q;ENSP00000421809:R78Q;ENSP00000374303:R29Q	ENSP00000374303:R29Q	R	+	2	0	CC2D2A	15091535	0.123000	0.22298	0.014000	0.15608	0.115000	0.19883	1.888000	0.39708	0.291000	0.22468	-0.241000	0.12123	CGG	.	.	.	none		0.552	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
OTULIN	90268	hgsc.bcm.edu	37	5	14687708	14687708	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr5:14687708G>A	ENST00000284274.4	+	5	625	c.547G>A	c.(547-549)Gac>Aac	p.D183N		NM_138348.4	NP_612357.4	Q96BN8	OTUL_HUMAN		183	OTU.				canonical Wnt signaling pathway (GO:0060070)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|protein linear deubiquitination (GO:1990108)|sprouting angiogenesis (GO:0002040)	cytoplasm (GO:0005737)|LUBAC complex (GO:0071797)	cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	14	Lung NSC(4;0.00696)					GAAGAATGAGGACCTGGTTGA	0.403																																					p.D183N		Atlas-SNP	.											.	FAM105B	36	.	0			c.G547A						PASS	.						142.0	146.0	144.0					5																	14687708		1838	4091	5929	SO:0001583	missense	90268	exon5			AATGAGGACCTGG																												ENST00000284274.4:c.547G>A	chr5.hg19:g.14687708G>A	ENSP00000284274:p.Asp183Asn	82.0	0.0	.		95.0	28.0	.	NM_138348	D3DTD3|Q8NAS0|Q96IA3	Missense_Mutation	SNP	ENST00000284274.4	hg19	CCDS43302.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638791	0.47153	.	.	ENSG00000154124	ENST00000284274	T	0.18657	2.2	6.17	4.42	0.53409	.	0.137100	0.64402	N	0.000005	T	0.11879	0.0289	N	0.14661	0.345	0.33190	D	0.550715	B	0.06786	0.001	B	0.10450	0.005	T	0.17501	-1.0367	10	0.18276	T	0.48	-18.6943	10.8094	0.46538	0.1439:0.0:0.8561:0.0	.	183	Q96BN8	F105B_HUMAN	N	183	ENSP00000284274:D183N	ENSP00000284274:D183N	D	+	1	0	FAM105B	14740708	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.288000	0.43514	0.960000	0.38005	0.655000	0.94253	GAC	.	.	.	none		0.403	FAM105B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366012.1		
C5orf42	65250	hgsc.bcm.edu	37	5	37184927	37184927	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr5:37184927A>G	ENST00000508244.1	-	24	4537	c.4444T>C	c.(4444-4446)Tcg>Ccg	p.S1482P	C5orf42_ENST00000274258.7_Missense_Mutation_p.S363P|C5orf42_ENST00000425232.2_Missense_Mutation_p.S1482P			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1482						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TCTTCAACCGACAAAGCTTCA	0.393																																					p.S1482P		Atlas-SNP	.											.	C5orf42	422	.	0			c.T4444C						PASS	.						128.0	120.0	123.0					5																	37184927		2203	4300	6503	SO:0001583	missense	65250	exon25			CAACCGACAAAGC		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.4444T>C	chr5.hg19:g.37184927A>G	ENSP00000421690:p.Ser1482Pro	63.0	0.0	.		93.0	20.0	.	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	A	17.26	3.343649	0.61073	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.86	0.619	0.17630	.	0.554792	0.15252	N	0.272275	T	0.44519	0.1297	N	0.19112	0.55	0.18873	N	0.999988	B;B	0.14438	0.005;0.01	B;B	0.11329	0.004;0.006	T	0.26224	-1.0109	10	0.41790	T	0.15	.	4.2899	0.10872	0.517:0.0:0.2653:0.2177	.	1482;363	E9PH94;Q9H799	.;CE042_HUMAN	P	1482;1482;363;530;363	ENSP00000421690:S1482P;ENSP00000389014:S1482P;ENSP00000274258:S363P;ENSP00000424223:S530P	ENSP00000274258:S363P	S	-	1	0	C5orf42	37220684	0.001000	0.12720	0.113000	0.21522	0.112000	0.19704	0.064000	0.14437	0.509000	0.28195	0.482000	0.46254	TCG	.	.	.	none		0.393	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
AGGF1	55109	hgsc.bcm.edu	37	5	76332530	76332530	+	Silent	SNP	T	T	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr5:76332530T>G	ENST00000312916.7	+	4	1048	c.666T>G	c.(664-666)ggT>ggG	p.G222G		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	222					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		ACAGCACTGGTTTCTATTATG	0.423																																					p.G222G		Atlas-SNP	.											.	AGGF1	71	.	0			c.T666G						PASS	.						48.0	49.0	49.0					5																	76332530		2203	4300	6503	SO:0001819	synonymous_variant	55109	exon4			CACTGGTTTCTAT	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.666T>G	chr5.hg19:g.76332530T>G		72.0	0.0	.		82.0	4.0	.	NM_018046	O00581|Q53YS3|Q9BU84|Q9NW66	Silent	SNP	ENST00000312916.7	hg19	CCDS4035.1																																																																																			.	.	.	none		0.423	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046	
APC	324	hgsc.bcm.edu	37	5	112174167	112174167	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr5:112174167C>A	ENST00000457016.1	+	16	3256	c.2876C>A	c.(2875-2877)tCt>tAt	p.S959Y	APC_ENST00000508376.2_Missense_Mutation_p.S959Y|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.S959Y			P25054	APC_HUMAN	adenomatous polyposis coli	959	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TACAAGAGATCTTCAAATGAT	0.343		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S959Y	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	Atlas-SNP	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	4158	.	1	Unknown(1)	skin(1)	c.C2876A						PASS	.						69.0	69.0	69.0					5																	112174167		2202	4300	6502	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	AGAGATCTTCAAA	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2876C>A	chr5.hg19:g.112174167C>A	ENSP00000413133:p.Ser959Tyr	127.0	0.0	.		147.0	43.0	.	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	hg19	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.808071	0.50421	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.93763	-2.55;-3.28;-2.55;-2.55;-2.73	5.9	5.9	0.94986	.	0.049171	0.85682	D	0.000000	D	0.85762	0.5772	N	0.08118	0	0.52099	D	0.999941	P;P	0.44877	0.845;0.845	B;B	0.34536	0.185;0.185	D	0.87864	0.2666	10	0.59425	D	0.04	-14.3819	20.2787	0.98501	0.0:1.0:0.0:0.0	.	961;959	Q4LE70;P25054	.;APC_HUMAN	Y	959;941;959;959;959	ENSP00000413133:S959Y;ENSP00000423224:S941Y;ENSP00000257430:S959Y;ENSP00000427089:S959Y;ENSP00000423828:S959Y	ENSP00000257430:S959Y	S	+	2	0	APC	112202066	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.668000	0.61568	2.798000	0.96311	0.650000	0.86243	TCT	.	.	.	none		0.343	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHAC1	56135	hgsc.bcm.edu	37	5	140306623	140306623	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr5:140306623C>A	ENST00000253807.2	+	1	146	c.146C>A	c.(145-147)gCt>gAt	p.A49D	PCDHA1_ENST00000394633.3_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.A49D|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	49	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGCGGCCGCTATGTCCTCG	0.652																																					p.A49D		Atlas-SNP	.											.	PCDHAC1	141	.	0			c.C146A						PASS	.						52.0	62.0	58.0					5																	140306623		2203	4300	6503	SO:0001583	missense	56135	exon1			CGGCCGCTATGTC	AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.146C>A	chr5.hg19:g.140306623C>A	ENSP00000253807:p.Ala49Asp	41.0	0.0	.		45.0	18.0	.	NM_031882	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	ENST00000253807.2	hg19	CCDS4241.1	.	.	.	.	.	.	.	.	.	.	C	6.060	0.379337	0.11466	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.26810	1.71;1.71	5.29	1.17	0.20885	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.11196	0.0273	N	0.05124	-0.11	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.16289	0.006;0.015	T	0.28964	-1.0027	9	0.36615	T	0.2	.	5.5223	0.16939	0.0:0.4802:0.231:0.2888	.	49;49	Q9H158;Q9H158-2	PCDC1_HUMAN;.	D	49	ENSP00000386356:A49D;ENSP00000253807:A49D	ENSP00000253807:A49D	A	+	2	0	PCDHAC1	140286807	0.000000	0.05858	0.008000	0.14137	0.148000	0.21650	-0.208000	0.09371	0.196000	0.20367	0.561000	0.74099	GCT	.	.	.	none		0.652	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
BAI3	577	hgsc.bcm.edu	37	6	69646517	69646517	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr6:69646517C>G	ENST00000370598.1	+	5	1796	c.975C>G	c.(973-975)caC>caG	p.H325Q		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	325	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ACGGGACACACTGCAGCGGCC	0.498																																					p.H325Q		Atlas-SNP	.											.	BAI3	451	.	0			c.C975G						PASS	.						123.0	95.0	105.0					6																	69646517		2203	4300	6503	SO:0001583	missense	577	exon5			GACACACTGCAGC	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.975C>G	chr6.hg19:g.69646517C>G	ENSP00000359630:p.His325Gln	91.0	0.0	.		130.0	27.0	.	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	hg19	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.841299	0.51057	.	.	ENSG00000135298	ENST00000370598	T	0.49720	0.77	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.18551	0.0445	N	0.04018	-0.295	0.80722	D	1	P	0.51933	0.949	P	0.46208	0.507	T	0.08638	-1.0712	10	0.10377	T	0.69	.	19.2236	0.93808	0.0:1.0:0.0:0.0	.	325	O60242	BAI3_HUMAN	Q	325	ENSP00000359630:H325Q	ENSP00000359630:H325Q	H	+	3	2	BAI3	69703238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.807000	0.86032	2.545000	0.85829	0.585000	0.79938	CAC	.	.	.	none		0.498	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
CEP57L1	285753	hgsc.bcm.edu	37	6	109480588	109480588	+	Silent	SNP	A	A	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr6:109480588A>T	ENST00000517392.1	+	9	1365	c.939A>T	c.(937-939)tcA>tcT	p.S313S	CEP57L1_ENST00000520883.1_Silent_p.S213S|CEP57L1_ENST00000336977.4_Silent_p.S213S|CEP57L1_ENST00000407272.1_Silent_p.S313S|CEP57L1_ENST00000359793.3_Silent_p.S313S|CEP57L1_ENST00000523787.1_Silent_p.S316S|CEP57L1_ENST00000368968.2_Silent_p.S313S|CEP57L1_ENST00000521522.1_Silent_p.S260S|CEP57L1_ENST00000368970.2_Silent_p.S330S	NM_001271852.1|NM_001271853.1	NP_001258781.1|NP_001258782.1	Q8IYX8	CE57L_HUMAN	centrosomal protein 57kDa-like 1	313					microtubule anchoring (GO:0034453)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)	11						CTCCTGACTCAGAAAAGTCCA	0.383																																					p.S313S		Atlas-SNP	.											.	CEP57L1	24	.	0			c.A939T						PASS	.						82.0	84.0	83.0					6																	109480588		2203	4300	6503	SO:0001819	synonymous_variant	285753	exon9			TGACTCAGAAAAG	AK092723	CCDS5071.1, CCDS64491.1	6q21	2014-01-28	2010-09-30	2010-09-30	ENSG00000183137	ENSG00000183137			21561	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 182"""	C6orf182			Standard	NM_001083535		Approved	bA487F23.2, MGC21731	uc003psy.4	Q8IYX8	OTTHUMG00000015336	ENST00000517392.1:c.939A>T	chr6.hg19:g.109480588A>T		197.0	0.0	.		243.0	58.0	.	NM_001271853	G5E992	Silent	SNP	ENST00000517392.1	hg19	CCDS5071.1																																																																																			.	.	.	none		0.383	CEP57L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041734.4	NM_173830	
CARD11	84433	hgsc.bcm.edu	37	7	2976750	2976750	+	Missense_Mutation	SNP	A	A	T	rs372864426	byFrequency	TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr7:2976750A>T	ENST00000396946.4	-	9	1665	c.1262T>A	c.(1261-1263)aTg>aAg	p.M421K		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	421					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCGCCGCACCATCTCGATCCT	0.597			Mis		DLBCL																																p.M421K		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	339	.	0			c.T1262A						PASS	.						159.0	128.0	139.0					7																	2976750		2203	4300	6503	SO:0001583	missense	84433	exon9			CGCACCATCTCGA	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1262T>A	chr7.hg19:g.2976750A>T	ENSP00000380150:p.Met421Lys	70.0	0.0	.		80.0	46.0	.	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	hg19	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	A	16.17	3.047193	0.55110	.	.	ENSG00000198286	ENST00000396946	T	0.35236	1.32	5.22	5.22	0.72569	.	0.182330	0.56097	D	0.000021	T	0.27594	0.0678	N	0.22421	0.69	0.45390	D	0.998376	B	0.26363	0.147	B	0.25759	0.063	T	0.08126	-1.0737	10	0.59425	D	0.04	-37.5613	14.2746	0.66173	1.0:0.0:0.0:0.0	.	421	Q9BXL7	CAR11_HUMAN	K	421	ENSP00000380150:M421K	ENSP00000380150:M421K	M	-	2	0	CARD11	2943276	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.387000	0.52501	1.981000	0.57761	0.459000	0.35465	ATG	.	.	.	alt		0.597	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
ADAM22	53616	hgsc.bcm.edu	37	7	87785232	87785232	+	Silent	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr7:87785232C>T	ENST00000265727.7	+	22	1897	c.1818C>T	c.(1816-1818)acC>acT	p.T606T	ADAM22_ENST00000398209.3_Silent_p.T606T|ADAM22_ENST00000398204.4_Silent_p.T606T|ADAM22_ENST00000398201.4_Silent_p.T606T|ADAM22_ENST00000315984.7_Silent_p.T606T			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	606	Cys-rich.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TTTTGTGTACCAATATTGGCA	0.358																																					p.T606T		Atlas-SNP	.											.	ADAM22	280	.	0			c.C1818T						PASS	.						227.0	211.0	216.0					7																	87785232		1870	4106	5976	SO:0001819	synonymous_variant	53616	exon22			GTGTACCAATATT	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1818C>T	chr7.hg19:g.87785232C>T		152.0	0.0	.		232.0	53.0	.	NM_021722	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Silent	SNP	ENST00000265727.7	hg19	CCDS47637.1																																																																																			.	.	.	none		0.358	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	
PSMC2	5701	hgsc.bcm.edu	37	7	103008257	103008257	+	Splice_Site	SNP	G	G	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr7:103008257G>T	ENST00000435765.1	+	12	1555		c.e12+1		SLC26A5_ENST00000339444.6_Intron|PSMC2_ENST00000544811.1_Splice_Site|SLC26A5_ENST00000393735.2_Intron|SLC26A5_ENST00000356767.4_Intron|PSMC2_ENST00000292644.3_Splice_Site	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						AATAGCACTGGTAAGTAGAAA	0.393																																					.		Atlas-SNP	.											.	PSMC2	38	.	0			c.1144+1G>T						PASS	.						108.0	111.0	110.0					7																	103008257		2203	4300	6503	SO:0001630	splice_region_variant	5701	exon11			GCACTGGTAAGTA	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.1144+1G>T	chr7.hg19:g.103008257G>T		45.0	0.0	.		95.0	41.0	.	NM_002803	A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Splice_Site	SNP	ENST00000435765.1	hg19	CCDS5731.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553104	0.86127	.	.	ENSG00000161057	ENST00000435765;ENST00000292644;ENST00000544811	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5674	0.91121	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PSMC2	102795493	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.483000	0.97937	2.367000	0.80283	0.644000	0.83932	.	.	.	.	none		0.393	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347922.1	NM_002803	Intron
TNPO3	23534	hgsc.bcm.edu	37	7	128632137	128632137	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr7:128632137G>C	ENST00000265388.5	-	10	1417	c.1274C>G	c.(1273-1275)tCt>tGt	p.S425C	TNPO3_ENST00000393245.1_Missense_Mutation_p.S425C|TNPO3_ENST00000482320.1_Missense_Mutation_p.S359C|TNPO3_ENST00000471234.1_Missense_Mutation_p.S425C|TNPO3_ENST00000471166.1_Missense_Mutation_p.S425C			Q9Y5L0	TNPO3_HUMAN	transportin 3	425					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						TTTCAGAGTAGAATATAACTA	0.398																																					p.S425C	Pancreas(147;583 2585 39696 52331)	Atlas-SNP	.											.	TNPO3	148	.	0			c.C1274G						PASS	.						97.0	101.0	100.0					7																	128632137		2203	4300	6503	SO:0001583	missense	23534	exon10			AGAGTAGAATATA	AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.1274C>G	chr7.hg19:g.128632137G>C	ENSP00000265388:p.Ser425Cys	42.0	0.0	.		63.0	22.0	.	NM_012470	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	ENST00000265388.5	hg19	CCDS5809.1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854304	0.71719	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3	5.49	5.49	0.81192	Armadillo-like helical (1);Armadillo-type fold (1);	0.159224	0.56097	D	0.000021	T	0.59609	0.2206	N	0.19112	0.55	0.58432	D	0.999998	P;P;P	0.51933	0.949;0.943;0.911	B;B;P	0.46685	0.405;0.405;0.524	T	0.64499	-0.6393	10	0.56958	D	0.05	.	17.2251	0.86967	0.0:0.0:1.0:0.0	.	425;425;425	C9IZM0;C9J7E5;Q9Y5L0	.;.;TNPO3_HUMAN	C	425;425;359;425;425	ENSP00000376936:S425C;ENSP00000265388:S425C;ENSP00000420089:S359C;ENSP00000418646:S425C;ENSP00000418267:S425C	ENSP00000265388:S425C	S	-	2	0	TNPO3	128419373	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.358000	0.97109	2.732000	0.93576	0.557000	0.71058	TCT	.	.	.	none		0.398	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350929.1	NM_012470	
PLXNA4	91584	hgsc.bcm.edu	37	7	131815331	131815331	+	Silent	SNP	G	G	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr7:131815331G>T	ENST00000359827.3	-	32	6554	c.5592C>A	c.(5590-5592)atC>atA	p.I1864I	PLXNA4_ENST00000321063.4_Silent_p.I1864I			Q9HCM2	PLXA4_HUMAN	plexin A4	1864					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GAGGTCCAAGGATCTGCGGAA	0.512																																					p.I1864I		Atlas-SNP	.											.	PLXNA4	873	.	0			c.C5592A						PASS	.						143.0	142.0	142.0					7																	131815331		2021	4169	6190	SO:0001819	synonymous_variant	91584	exon32			TCCAAGGATCTGC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.5592C>A	chr7.hg19:g.131815331G>T		93.0	0.0	.		111.0	36.0	.	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	hg19	CCDS43646.1																																																																																			.	.	.	none		0.512	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
CNOT4	4850	hgsc.bcm.edu	37	7	135078775	135078775	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr7:135078775T>C	ENST00000315544.5	-	10	1801	c.1522A>G	c.(1522-1524)Atc>Gtc	p.I508V	CNOT4_ENST00000428680.2_Missense_Mutation_p.I505V|CNOT4_ENST00000451834.1_Missense_Mutation_p.I505V|CNOT4_ENST00000541284.1_Missense_Mutation_p.I508V|CNOT4_ENST00000423368.2_Missense_Mutation_p.I508V|CNOT4_ENST00000414802.1_Intron|CNOT4_ENST00000356162.4_Intron|CNOT4_ENST00000361528.4_Missense_Mutation_p.I505V	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	508					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						AAGTGCATGATGCTATTGCGT	0.507																																					p.I508V	Ovarian(51;766 1130 5502 35047 50875)	Atlas-SNP	.											.	CNOT4	146	.	0			c.A1522G						PASS	.						64.0	70.0	68.0					7																	135078775		1977	4179	6156	SO:0001583	missense	4850	exon10			GCATGATGCTATT	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.1522A>G	chr7.hg19:g.135078775T>C	ENSP00000326731:p.Ile508Val	141.0	0.0	.		213.0	103.0	.	NM_001190850	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Missense_Mutation	SNP	ENST00000315544.5	hg19	CCDS55166.1	.	.	.	.	.	.	.	.	.	.	T	13.29	2.192948	0.38707	.	.	ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000423368;ENST00000262563;ENST00000361528;ENST00000428680;ENST00000315544	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	5.96	3.49	0.39957	.	0.196794	0.53938	N	0.000045	T	0.25044	0.0608	N	0.19112	0.55	0.42892	D	0.994204	B;B;B;B;B;B	0.20671	0.028;0.047;0.003;0.006;0.047;0.047	B;B;B;B;B;B	0.21917	0.016;0.025;0.005;0.01;0.037;0.037	T	0.05852	-1.0860	10	0.26408	T	0.33	-7.2682	7.7871	0.29097	0.0:0.0716:0.1392:0.7891	.	505;508;508;505;508;505	E7ET38;F8VQP3;O95628;O95628-2;O95628-4;O95628-8	.;.;CNOT4_HUMAN;.;.;.	V	508;505;508;508;505;505;508	ENSP00000445508:I508V;ENSP00000388491:I505V;ENSP00000406777:I508V;ENSP00000354673:I505V;ENSP00000399108:I505V;ENSP00000326731:I508V	ENSP00000262563:I508V	I	-	1	0	CNOT4	134729315	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.181000	0.42547	1.092000	0.41356	0.533000	0.62120	ATC	.	.	.	none		0.507	CNOT4-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_013316	
ABCF2	10061	hgsc.bcm.edu	37	7	150915213	150915213	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr7:150915213G>C	ENST00000287844.2	-	11	1401	c.1292C>G	c.(1291-1293)cCc>cGc	p.P431R	ABCF2_ENST00000473874.1_5'Flank|ABCF2_ENST00000222388.2_Missense_Mutation_p.P431R	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	431	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCTCCATTGGGCCCTACCAG	0.507																																					p.P431R		Atlas-SNP	.											.	ABCF2	54	.	0			c.C1292G						PASS	.						143.0	121.0	128.0					7																	150915213		2203	4300	6503	SO:0001583	missense	10061	exon11			CCATTGGGCCCTA	AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1292C>G	chr7.hg19:g.150915213G>C	ENSP00000287844:p.Pro431Arg	75.0	0.0	.		112.0	55.0	.	NM_005692	O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	ENST00000287844.2	hg19	CCDS5923.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113188	0.94339	.	.	ENSG00000033050	ENST00000222388;ENST00000287844	D;D	0.94537	-3.45;-3.45	5.49	5.49	0.81192	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96153	0.8746	L	0.45581	1.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.983	D	0.96634	0.9469	10	0.87932	D	0	-34.616	18.3531	0.90345	0.0:0.0:1.0:0.0	.	431;431	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	R	431	ENSP00000222388:P431R;ENSP00000287844:P431R	ENSP00000222388:P431R	P	-	2	0	ABCF2	150546146	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.139000	0.94554	2.571000	0.86741	0.591000	0.81541	CCC	.	.	.	none		0.507	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336086.1	NM_005692	
TTI2	80185	hgsc.bcm.edu	37	8	33361326	33361326	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr8:33361326G>C	ENST00000431156.2	-	5	1673	c.1055C>G	c.(1054-1056)cCa>cGa	p.P352R	TTI2_ENST00000520636.1_Missense_Mutation_p.P321R|TTI2_ENST00000519356.1_5'UTR|TTI2_ENST00000360742.5_Missense_Mutation_p.P352R	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	352																	GCGGTGCTCTGGCTCCATGTG	0.522																																					p.P352R		Atlas-SNP	.											.	.	.	.	0			c.C1055G						PASS	.						62.0	53.0	56.0					8																	33361326		2203	4300	6503	SO:0001583	missense	80185	exon5			TGCTCTGGCTCCA	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1055C>G	chr8.hg19:g.33361326G>C	ENSP00000411169:p.Pro352Arg	74.0	0.0	.		80.0	28.0	.	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	ENST00000431156.2	hg19	CCDS6090.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006383	0.54361	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636	T;T;T	0.77229	-1.08;-1.08;-1.08	5.5	5.5	0.81552	.	0.137293	0.49916	D	0.000134	T	0.79452	0.4448	M	0.63428	1.95	0.80722	D	1	P;P	0.45634	0.863;0.863	P;P	0.49637	0.617;0.617	T	0.75277	-0.3374	10	0.25106	T	0.35	-6.1452	12.4975	0.55937	0.0763:0.0:0.9237:0.0	.	352;321	Q6NXR4;E5RIH5	TTI2_HUMAN;.	R	352;352;352;321	ENSP00000353971:P352R;ENSP00000411169:P352R;ENSP00000428401:P321R	ENSP00000353971:P352R	P	-	2	0	C8orf41	33480868	0.981000	0.34729	1.000000	0.80357	0.990000	0.78478	4.372000	0.59530	2.850000	0.98022	0.650000	0.86243	CCA	.	.	.	none		0.522	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
RNF19A	25897	hgsc.bcm.edu	37	8	101273971	101273971	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr8:101273971A>G	ENST00000519449.1	-	9	1797	c.1481T>C	c.(1480-1482)gTa>gCa	p.V494A	RNF19A_ENST00000523255.1_5'UTR|RNF19A_ENST00000341084.2_Missense_Mutation_p.V494A	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	494					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			TGCTTCTGCTACTGATGTTGT	0.423																																					p.V494A		Atlas-SNP	.											.	RNF19A	67	.	0			c.T1481C						PASS	.						174.0	143.0	153.0					8																	101273971		2203	4300	6503	SO:0001583	missense	25897	exon9			TCTGCTACTGATG	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1481T>C	chr8.hg19:g.101273971A>G	ENSP00000428968:p.Val494Ala	135.0	0.0	.		144.0	24.0	.	NM_015435	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	hg19	CCDS6286.1	.	.	.	.	.	.	.	.	.	.	A	18.32	3.598075	0.66332	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.85955	-2.05;-2.05	5.34	5.34	0.76211	.	0.116360	0.64402	D	0.000017	T	0.78761	0.4334	L	0.51422	1.61	0.80722	D	1	P	0.40083	0.702	B	0.36092	0.217	T	0.76971	-0.2761	10	0.07175	T	0.84	.	14.9917	0.71393	1.0:0.0:0.0:0.0	.	494	Q9NV58	RN19A_HUMAN	A	494	ENSP00000428968:V494A;ENSP00000342667:V494A	ENSP00000342667:V494A	V	-	2	0	RNF19A	101343147	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.033000	0.60031	0.482000	0.46254	GTA	.	.	.	none		0.423	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435	
COL22A1	169044	hgsc.bcm.edu	37	8	139809070	139809071	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr8:139809070_139809071CC>TA	ENST00000303045.6	-	12	2033_2034	c.1587_1588GG>TA	c.(1585-1590)aaGGgt>aaTAgt	p.529_530KG>NS	COL22A1_ENST00000435777.1_Missense_Mutation_p.529_530KG>NS	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	529	Collagen-like 2.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			ACCTTTTCACCCTTTTCCCCTT	0.46										HNSCC(7;0.00092)																											p.G530S|p.K529N		Atlas-SNP	.											.	COL22A1	390	.	0			c.G1588A|c.G1587T						PASS	.																																			SO:0001583	missense	169044	exon12			TTTCACCCTTTTC|TTCACCCTTTTCC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1587_1588delinsTA	chr8.hg19:g.139809070_139809071delinsTA	ENSP00000303153:p.K529_G530delinsNS	91.0	0.0	.		90.0	24.0	.	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	hg19	CCDS6376.1																																																																																			.	.	.	none		0.460	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
CCDC180	100499483	hgsc.bcm.edu	37	9	100124603	100124603	+	Intron	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr9:100124603C>T	ENST00000357054.1	+	40	4692				CCDC180_ENST00000529487.1_Missense_Mutation_p.P1305L|MIR1302-8_ENST00000408342.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.P1305L|CCDC180_ENST00000395220.1_Intron|RP11-23J9.4_ENST00000534123.1_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GTGTGCTCACCTCCTGTCCTC	0.617																																					p.P1305L		Atlas-SNP	.											.	.	.	.	0			c.C3914T						PASS	.						134.0	128.0	130.0					9																	100124603		2203	4300	6503	SO:0001627	intron_variant	0	exon28			GCTCACCTCCTGT	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3758-42C>T	chr9.hg19:g.100124603C>T		88.0	0.0	.		101.0	55.0	.	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	hg19		.	.	.	.	.	.	.	.	.	.	C	10.03	1.237976	0.22711	.	.	ENSG00000197816	ENST00000375202;ENST00000529487	T;T	0.06933	3.24;3.24	4.46	0.619	0.17630	.	1.418180	0.04404	N	0.364733	T	0.09069	0.0224	L	0.40543	1.245	0.09310	N	0.999993	B	0.11235	0.004	B	0.11329	0.006	T	0.39961	-0.9588	10	0.56958	D	0.05	4.3628	6.6401	0.22904	0.0:0.6055:0.0:0.3945	.	1444	B7ZMG3	.	L	1305	ENSP00000364348:P1305L;ENSP00000434727:P1305L	ENSP00000364348:P1305L	P	+	2	0	C9orf174	99164424	0.000000	0.05858	0.001000	0.08648	0.035000	0.12851	-0.155000	0.10115	0.116000	0.18110	-0.140000	0.14226	CCT	.	.	.	none		0.617	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
ASTN2	23245	hgsc.bcm.edu	37	9	119976776	119976776	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr9:119976776G>T	ENST00000313400.4	-	3	976	c.876C>A	c.(874-876)gaC>gaA	p.D292E	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.D292E|ASTN2_ENST00000361209.2_Missense_Mutation_p.D292E			O75129	ASTN2_HUMAN	astrotactin 2	292					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CACAGTCATAGTCATCCAGGA	0.622																																					p.D292E		Atlas-SNP	.											.	ASTN2	307	.	0			c.C876A						PASS	.						79.0	76.0	77.0					9																	119976776		2203	4300	6503	SO:0001583	missense	23245	exon3			GTCATAGTCATCC	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.876C>A	chr9.hg19:g.119976776G>T	ENSP00000314038:p.Asp292Glu	85.0	0.0	.		90.0	4.0	.	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	hg19		.	.	.	.	.	.	.	.	.	.	G	14.86	2.662602	0.47572	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.13538	2.69;2.68;2.63;2.58	5.16	4.26	0.50523	.	0.073163	0.52532	D	0.000066	T	0.16854	0.0405	N	0.08118	0	0.40900	D	0.984144	D;D;D	0.67145	0.99;0.994;0.996	P;D;D	0.72625	0.789;0.978;0.94	T	0.22417	-1.0217	9	.	.	.	-25.8287	13.3233	0.60444	0.0775:0.0:0.9225:0.0	.	292;292;292	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	E	292;292;19;292	ENSP00000314038:D292E;ENSP00000363108:D292E;ENSP00000363098:D19E;ENSP00000354504:D292E	.	D	-	3	2	ASTN2	119016597	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	4.188000	0.58351	1.159000	0.42565	0.655000	0.94253	GAC	.	.	.	none		0.622	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
TOR1B	27348	hgsc.bcm.edu	37	9	132565494	132565494	+	Start_Codon_SNP	SNP	G	G	T	rs375663995		TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr9:132565494G>T	ENST00000259339.2	+	1	63	c.3G>T	c.(1-3)atG>atT	p.M1I	TOR1B_ENST00000486372.1_3'UTR	NM_014506.1	NP_055321.1	O14657	TOR1B_HUMAN	torsin family 1, member B (torsin B)	1					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum organization (GO:0007029)|nuclear membrane organization (GO:0071763)|protein homooligomerization (GO:0051260)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)	12		Ovarian(14;0.0586)				GGAGCGGGATGTTGCGGGCTG	0.741																																					p.M1I		Atlas-SNP	.											.	TOR1B	20	.	0			c.G3T						PASS	.						6.0	8.0	7.0					9																	132565494		2024	4032	6056	SO:0001582	initiator_codon_variant	27348	exon1			CGGGATGTTGCGG	AF007872	CCDS6929.1	9q34	2008-07-21			ENSG00000136816	ENSG00000136816			11995	protein-coding gene	gene with protein product		608050				9288096, 10644435	Standard	NM_014506		Approved	DQ1, MGC4386	uc004byk.1	O14657	OTTHUMG00000020795	ENST00000259339.2:c.3G>T	chr9.hg19:g.132565494G>T	ENSP00000259339:p.Met1Ile	39.0	0.0	.		50.0	30.0	.	NM_014506		Missense_Mutation	SNP	ENST00000259339.2	hg19	CCDS6929.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542757	0.65198	.	.	ENSG00000136816	ENST00000259339;ENST00000437263	T	0.48836	0.8	5.22	5.22	0.72569	.	4.487620	0.01845	U	0.035573	T	0.48943	0.1528	.	.	.	0.80722	D	1	B	0.13145	0.007	B	0.14578	0.011	T	0.08432	-1.0722	9	0.62326	D	0.03	.	15.9196	0.79552	0.0:0.0:1.0:0.0	.	1	O14657	TOR1B_HUMAN	I	1	ENSP00000259339:M1I	ENSP00000259339:M1I	M	+	3	0	TOR1B	131605315	0.000000	0.05858	0.014000	0.15608	0.005000	0.04900	0.522000	0.22909	2.438000	0.82558	0.491000	0.48974	ATG	.	.	.	alt		0.741	TOR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054615.1	NM_014506	Missense_Mutation
SETX	23064	hgsc.bcm.edu	37	9	135204944	135204944	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr9:135204944C>T	ENST00000224140.5	-	10	2223	c.2041G>A	c.(2041-2043)Gac>Aac	p.D681N	SETX_ENST00000372169.2_Missense_Mutation_p.D681N|SETX_ENST00000393220.1_Missense_Mutation_p.D681N	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	681					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AAGAGATGGTCCTCTAGTTTC	0.343																																					p.D681N		Atlas-SNP	.											.	SETX	234	.	0			c.G2041A						PASS	.						82.0	82.0	82.0					9																	135204944		2203	4300	6503	SO:0001583	missense	23064	exon10			GATGGTCCTCTAG	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.2041G>A	chr9.hg19:g.135204944C>T	ENSP00000224140:p.Asp681Asn	34.0	0.0	.		37.0	19.0	.	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	hg19	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868576	0.51588	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87966	-2.24;-2.32;-1.94	5.37	5.37	0.77165	.	5.735300	0.00357	N	0.000020	D	0.89157	0.6635	L	0.32530	0.975	0.09310	N	1	P;P;P	0.51351	0.944;0.906;0.944	P;P;P	0.52957	0.714;0.521;0.714	T	0.78214	-0.2291	10	0.24483	T	0.36	.	15.85	0.78924	0.0:1.0:0.0:0.0	.	681;681;681	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	N	681	ENSP00000224140:D681N;ENSP00000361242:D681N;ENSP00000376913:D681N	ENSP00000224140:D681N	D	-	1	0	SETX	134194765	0.003000	0.15002	0.023000	0.16930	0.177000	0.22998	1.467000	0.35321	2.523000	0.85059	0.555000	0.69702	GAC	.	.	.	none		0.343	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
CEL	1056	hgsc.bcm.edu	37	9	135946849	135946849	+	Missense_Mutation	SNP	T	T	G	rs587780308		TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr9:135946849T>G	ENST00000372080.4	+	11	1985	c.1969T>G	c.(1969-1971)Tcc>Gcc	p.S657A	CEL_ENST00000351304.7_Missense_Mutation_p.S588A	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	654	17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CACGGGTGACTCCGGGGCCCC	0.851																																					p.S657A		Atlas-SNP	.											.	CEL	71	.	0			c.T1969G						PASS	.						1.0	1.0	1.0					9																	135946849		65	235	300	SO:0001583	missense	1056	exon11			GGTGACTCCGGGG	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1969T>G	chr9.hg19:g.135946849T>G	ENSP00000361151:p.Ser657Ala	10.0	0.0	.		42.0	11.0	.	NM_001807	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	ENST00000372080.4	hg19	CCDS43896.1	.	.	.	.	.	.	.	.	.	.	t	9.616	1.132507	0.21041	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.70749	-0.33;-0.51	1.65	-3.25	0.05079	.	.	.	.	.	T	0.49150	0.1540	L	0.28115	0.83	0.09310	N	1	B	0.25007	0.116	B	0.19148	0.024	T	0.27971	-1.0058	9	0.48119	T	0.1	.	3.5479	0.07835	0.2212:0.4916:0.0:0.2872	.	654	P19835	CEL_HUMAN	A	657;588;623	ENSP00000361151:S657A;ENSP00000342217:S588A	ENSP00000304021:S623A	S	+	1	0	CEL	134936670	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	-0.474000	0.06607	-0.858000	0.04110	0.352000	0.21897	TCC	.	.	.	none		0.851	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1		
CCDC183	84960	hgsc.bcm.edu	37	9	139700623	139700623	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr9:139700623G>A	ENST00000338005.6	+	10	1077	c.1042G>A	c.(1042-1044)Gcc>Acc	p.A348T	KIAA1984_ENST00000371682.3_3'UTR|RP11-216L13.19_ENST00000415992.1_RNA|RP11-216L13.18_ENST00000471502.1_RNA|RABL6_ENST00000311502.7_5'Flank|RABL6_ENST00000371671.4_5'Flank|KIAA1984-AS1_ENST00000414656.1_RNA|RABL6_ENST00000371663.4_5'Flank|RABL6_ENST00000357466.2_5'Flank	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		348										biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GCAGCTGAAGGCCCTGGTGAA	0.657																																					p.A348T		Atlas-SNP	.											.	KIAA1984	39	.	0			c.G1042A						PASS	.						27.0	38.0	34.0					9																	139700623		2068	4195	6263	SO:0001583	missense	84960	exon10			CTGAAGGCCCTGG																												ENST00000338005.6:c.1042G>A	chr9.hg19:g.139700623G>A	ENSP00000338013:p.Ala348Thr	55.0	0.0	.		78.0	40.0	.	NM_001039374	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	ENST00000338005.6	hg19	CCDS43906.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598637	0.46318	.	.	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.14144	2.53	5.07	2.03	0.26663	.	0.168502	0.27366	U	0.019683	T	0.25044	0.0608	M	0.63843	1.955	0.21473	N	0.999672	D	0.76494	0.999	D	0.72075	0.976	T	0.09314	-1.0680	10	0.30078	T	0.28	-14.64	4.0722	0.09887	0.1981:0.0:0.6209:0.181	.	348	Q5T5S1	K1984_HUMAN	T	348	ENSP00000338013:A348T	ENSP00000338013:A348T	A	+	1	0	KIAA1984	138820444	0.407000	0.25352	0.029000	0.17559	0.440000	0.31957	0.595000	0.24029	0.107000	0.17824	0.561000	0.74099	GCC	.	.	.	none		0.657	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354899.1		
ATP5C1	509	hgsc.bcm.edu	37	10	7841871	7841871	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr10:7841871A>T	ENST00000356708.7	+	5	644	c.565A>T	c.(565-567)Aaa>Taa	p.K189*	ATP5C1_ENST00000493053.1_3'UTR|ATP5C1_ENST00000541227.1_Nonsense_Mutation_p.K142*|ATP5C1_ENST00000335698.4_Nonsense_Mutation_p.K189*	NM_001001973.1	NP_001001973.1	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1	189					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	16						CATCTTTAATAAATTCAGGCA	0.318																																					p.K189X	Melanoma(143;1012 1820 16249 30920 33158)	Atlas-SNP	.											.	ATP5C1	32	.	0			c.A565T						PASS	.						45.0	48.0	47.0					10																	7841871		2200	4300	6500	SO:0001587	stop_gained	509	exon5			TTTAATAAATTCA	D16561	CCDS7081.1, CCDS31142.1	10p14	2012-10-12			ENSG00000165629	ENSG00000165629		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	833	protein-coding gene	gene with protein product		108729		ATP5CL1, ATP5C		8168843, 8227057	Standard	NM_005174		Approved		uc001iju.3	P36542	OTTHUMG00000017639	ENST00000356708.7:c.565A>T	chr10.hg19:g.7841871A>T	ENSP00000349142:p.Lys189*	38.0	0.0	.		39.0	12.0	.	NM_001001973	A8KA31|Q5VYP3|Q6I9V2|Q96AS8	Nonsense_Mutation	SNP	ENST00000356708.7	hg19	CCDS31142.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.058482	0.76074	.	.	ENSG00000165629	ENST00000356708;ENST00000335698;ENST00000541227	.	.	.	5.6	3.74	0.42951	.	0.116219	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0	13.9922	0.64374	0.4013:0.5987:0.0:0.0	.	.	.	.	X	189;189;142	.	ENSP00000338568:K189X	K	+	1	0	ATP5C1	7881877	1.000000	0.71417	0.883000	0.34634	0.442000	0.32017	1.528000	0.35985	0.827000	0.34685	-0.148000	0.13756	AAA	.	.	.	none		0.318	ATP5C1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046708.1	NM_005174	
CCDC7	79741	hgsc.bcm.edu	37	10	32760011	32760011	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr10:32760011T>A	ENST00000362006.5	+	7	1073	c.530T>A	c.(529-531)cTt>cAt	p.L177H	CCDC7_ENST00000537047.1_Intron|CCDC7_ENST00000277657.6_Missense_Mutation_p.L177H|CCDC7_ENST00000535327.1_Intron|CCDC7_ENST00000539197.1_Intron|CCDC7_ENST00000545067.1_Intron	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	177										NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				GATCAAACTCTTTTACAAGCA	0.294																																					p.L177H		Atlas-SNP	.											.	CCDC7	47	.	0			c.T530A						PASS	.						33.0	35.0	34.0					10																	32760011		2200	4294	6494	SO:0001583	missense	221016	exon7			AAACTCTTTTACA	BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.530T>A	chr10.hg19:g.32760011T>A	ENSP00000355078:p.Leu177His	147.0	0.0	.		202.0	59.0	.	NM_145023	Q5VW55|Q8IVQ0|Q8NEQ0	Missense_Mutation	SNP	ENST00000362006.5	hg19	CCDS7173.1	.	.	.	.	.	.	.	.	.	.	T	8.249	0.808496	0.16467	.	.	ENSG00000216937	ENST00000324147;ENST00000277657;ENST00000362006	T;T	0.34072	1.38;1.38	5.06	-2.02	0.07388	.	.	.	.	.	T	0.20414	0.0491	N	0.14661	0.345	0.09310	N	0.999999	P	0.39157	0.662	B	0.42386	0.386	T	0.16748	-1.0392	9	0.49607	T	0.09	-20.8565	3.2857	0.06931	0.3191:0.2688:0.0:0.412	.	177	Q96M83	CCDC7_HUMAN	H	182;177;177	ENSP00000277657:L177H;ENSP00000355078:L177H	ENSP00000277657:L177H	L	+	2	0	CCDC7	32800017	0.021000	0.18746	0.000000	0.03702	0.073000	0.16967	0.379000	0.20585	-0.261000	0.09405	0.482000	0.46254	CTT	.	.	.	none		0.294	CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047490.1	NM_145023	
ANKRD30A	91074	hgsc.bcm.edu	37	10	37508184	37508184	+	Silent	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr10:37508184T>C	ENST00000602533.1	+	34	3475	c.3376T>C	c.(3376-3378)Ttg>Ctg	p.L1126L	ANKRD30A_ENST00000361713.1_Silent_p.L1126L|ANKRD30A_ENST00000374660.1_Silent_p.L1245L			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1182					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CACTTCTAAATTGAAGGAAAA	0.383																																					p.L1126L		Atlas-SNP	.											.	ANKRD30A	448	.	0			c.T3376C						PASS	.						91.0	91.0	91.0					10																	37508184		1852	4084	5936	SO:0001819	synonymous_variant	91074	exon34			TCTAAATTGAAGG	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3376T>C	chr10.hg19:g.37508184T>C		165.0	0.0	.		260.0	82.0	.	NM_052997	Q5W025	Silent	SNP	ENST00000602533.1	hg19																																																																																				.	.	.	none		0.383	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
RHOBTB1	9886	hgsc.bcm.edu	37	10	62670721	62670721	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr10:62670721C>T	ENST00000337910.5	-	4	557	c.220G>A	c.(220-222)Gat>Aat	p.D74N	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.D74N|RNU2-72P_ENST00000411175.1_RNA	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	74	Rho-like.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					CTCACTTCATCAACAACATCC	0.493																																					p.D74N		Atlas-SNP	.											.	RHOBTB1	61	.	0			c.G220A						PASS	.						151.0	117.0	128.0					10																	62670721		2203	4300	6503	SO:0001583	missense	9886	exon4			CTTCATCAACAAC	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.220G>A	chr10.hg19:g.62670721C>T	ENSP00000338671:p.Asp74Asn	80.0	0.0	.		84.0	21.0	.	NM_014836		Missense_Mutation	SNP	ENST00000337910.5	hg19	CCDS7261.1	.	.	.	.	.	.	.	.	.	.	C	36	5.770273	0.96914	.	.	ENSG00000072422	ENST00000357917;ENST00000337910;ENST00000536302	T;T	0.24151	1.87;1.87	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.51109	0.1655	M	0.63428	1.95	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.49234	-0.8961	10	0.62326	D	0.03	.	19.4554	0.94886	0.0:1.0:0.0:0.0	.	74	O94844	RHBT1_HUMAN	N	74	ENSP00000350595:D74N;ENSP00000338671:D74N	ENSP00000338671:D74N	D	-	1	0	RHOBTB1	62340727	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.724000	0.84798	2.591000	0.87537	0.555000	0.69702	GAT	.	.	.	none		0.493	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1		
JMJD1C	221037	hgsc.bcm.edu	37	10	64968945	64968945	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr10:64968945A>T	ENST00000399262.2	-	9	2963	c.2745T>A	c.(2743-2745)gaT>gaA	p.D915E	JMJD1C_ENST00000399251.1_Missense_Mutation_p.D696E|JMJD1C_ENST00000542921.1_Missense_Mutation_p.D733E|JMJD1C_ENST00000402544.1_Missense_Mutation_p.D696E	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	915					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					ATCCAATACCATCTGCTGAGG	0.423																																					p.D915E		Atlas-SNP	.											.	JMJD1C	347	.	0			c.T2745A						PASS	.						90.0	83.0	85.0					10																	64968945		1898	4113	6011	SO:0001583	missense	221037	exon9			AATACCATCTGCT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.2745T>A	chr10.hg19:g.64968945A>T	ENSP00000382204:p.Asp915Glu	99.0	0.0	.		114.0	36.0	.	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	hg19	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.016377	0.75161	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	6.03	4.88	0.63580	.	0.096988	0.64402	N	0.000002	T	0.37999	0.1024	L	0.35723	1.085	0.39613	D	0.969902	B;B	0.27625	0.183;0.183	B;B	0.29942	0.109;0.109	T	0.40136	-0.9579	10	0.49607	T	0.09	-16.6076	1.8984	0.03262	0.5723:0.1677:0.0997:0.1604	.	915;733	Q15652;A0T124	JHD2C_HUMAN;.	E	915;696;696;733	ENSP00000382204:D915E;ENSP00000384990:D696E;ENSP00000382195:D696E;ENSP00000444682:D733E	ENSP00000382195:D696E	D	-	3	2	JMJD1C	64638951	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.732000	0.38146	1.062000	0.40625	0.533000	0.62120	GAT	.	.	.	none		0.423	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
ZFYVE27	118813	hgsc.bcm.edu	37	10	99498260	99498260	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr10:99498260G>A	ENST00000393677.4	+	2	230	c.26G>A	c.(25-27)aGt>aAt	p.S9N	ZFYVE27_ENST00000337540.7_Missense_Mutation_p.S9N|ZFYVE27_ENST00000370613.3_Missense_Mutation_p.S9N|ZFYVE27_ENST00000370610.3_Intron|ZFYVE27_ENST00000453958.2_Missense_Mutation_p.S9N|ZFYVE27_ENST00000359980.3_Missense_Mutation_p.S9N|ZFYVE27_ENST00000357540.4_Missense_Mutation_p.S9N|ZFYVE27_ENST00000356257.4_Missense_Mutation_p.S9N	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	9					cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		CGTGAGGGGAGTGGGCCGGAG	0.517																																					p.S9N		Atlas-SNP	.											.	ZFYVE27	31	.	0			c.G26A						PASS	.						138.0	134.0	135.0					10																	99498260		2203	4300	6503	SO:0001583	missense	118813	exon1			AGGGGAGTGGGCC	BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.26G>A	chr10.hg19:g.99498260G>A	ENSP00000377282:p.Ser9Asn	78.0	0.0	.		62.0	15.0	.	NM_001002261	B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Missense_Mutation	SNP	ENST00000393677.4	hg19	CCDS31263.1	.	.	.	.	.	.	.	.	.	.	G	8.596	0.885766	0.17540	.	.	ENSG00000155256	ENST00000337540;ENST00000357540;ENST00000370613;ENST00000393677;ENST00000453958;ENST00000359980;ENST00000356257	T;T;T;T;T	0.45668	0.89;1.46;1.45;1.46;1.46	5.04	2.0	0.26442	.	0.853122	0.10772	N	0.635877	T	0.25975	0.0633	N	0.19112	0.55	0.26977	N	0.965458	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.06405	0.0;0.0;0.001;0.001;0.002;0.0	T	0.19778	-1.0295	10	0.48119	T	0.1	0.0993	5.8759	0.18828	0.2398:0.2259:0.5343:0.0	.	9;9;9;9;9;9	B7Z404;B7Z626;Q5T4F4-5;Q5T4F4-3;Q5T4F4-2;Q5T4F4	.;.;.;.;.;ZFY27_HUMAN	N	9	ENSP00000337993:S9N;ENSP00000377282:S9N;ENSP00000401580:S9N;ENSP00000353069:S9N;ENSP00000348593:S9N	ENSP00000337993:S9N	S	+	2	0	ZFYVE27	99488250	0.979000	0.34478	0.883000	0.34634	0.179000	0.23085	0.667000	0.25112	0.535000	0.28714	-0.258000	0.10820	AGT	.	.	.	none		0.517	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049745.2	NM_144588	
SEC23IP	11196	hgsc.bcm.edu	37	10	121663721	121663721	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr10:121663721T>A	ENST00000369075.3	+	4	1105	c.1033T>A	c.(1033-1035)Tgg>Agg	p.W345R	SEC23IP_ENST00000543134.1_Missense_Mutation_p.W134R	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	345	Interaction with SEC23A.				acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		ACGCTGTACTTGGTTTTACAA	0.468																																					p.W345R		Atlas-SNP	.											.	SEC23IP	100	.	0			c.T1033A						PASS	.						87.0	90.0	89.0					10																	121663721		2203	4300	6503	SO:0001583	missense	11196	exon4			TGTACTTGGTTTT	AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.1033T>A	chr10.hg19:g.121663721T>A	ENSP00000358071:p.Trp345Arg	125.0	0.0	.		164.0	38.0	.	NM_007190	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	hg19	CCDS7618.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.9|25.9	4.683414|4.683414	0.88542|0.88542	.|.	.|.	ENSG00000107651|ENSG00000107651	ENST00000442952|ENST00000369075;ENST00000543134;ENST00000446561	.|D;D;T	.|0.91237	.|-2.81;-2.81;1.33	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.96231	.|0.8771	M|M	0.91768|0.91768	3.24|3.24	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.996	.|D	.|0.97154	.|0.9833	.|10	.|0.87932	.|D	.|0	-7.97|-7.97	15.6047|15.6047	0.76658|0.76658	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|134;345	.|F5H0L8;Q9Y6Y8	.|.;S23IP_HUMAN	X|R	110|345;134;79	.|ENSP00000358071:W345R;ENSP00000438773:W134R;ENSP00000396906:W79R	.|ENSP00000358071:W345R	L|W	+|+	2|1	0|0	SEC23IP|SEC23IP	121653711|121653711	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.991000|0.991000	0.79684|0.79684	7.544000|7.544000	0.82117|0.82117	2.137000|2.137000	0.66172|0.66172	0.460000|0.460000	0.39030|0.39030	TTG|TGG	.	.	.	none		0.468	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1		
ANO3	63982	hgsc.bcm.edu	37	11	26663544	26663544	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr11:26663544T>C	ENST00000256737.3	+	22	3095	c.2243T>C	c.(2242-2244)cTt>cCt	p.L748P	ANO3_ENST00000537978.1_Missense_Mutation_p.L732P|ANO3_ENST00000531568.1_Missense_Mutation_p.L602P|ANO3_ENST00000525139.1_Missense_Mutation_p.L732P	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	748					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						CCCATGAACCTTCATGGACTG	0.408																																					p.L748P		Atlas-SNP	.											.	ANO3	145	.	0			c.T2243C						PASS	.						119.0	110.0	113.0					11																	26663544		2203	4299	6502	SO:0001583	missense	63982	exon22			TGAACCTTCATGG	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.2243T>C	chr11.hg19:g.26663544T>C	ENSP00000256737:p.Leu748Pro	82.0	0.0	.		79.0	17.0	.	NM_031418	B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	hg19	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.995368	0.35226	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000538001;ENST00000531568	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	6.07	6.07	0.98685	.	0.232790	0.43747	D	0.000531	T	0.37404	0.1002	N	0.03608	-0.345	0.58432	D	0.999996	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.30592	-0.9973	10	0.28530	T	0.3	.	10.8996	0.47043	0.0:0.0695:0.0:0.9305	.	650;748	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	P	732;732;748;650;602	ENSP00000440737:L732P;ENSP00000432576:L732P;ENSP00000256737:L748P;ENSP00000432394:L602P	ENSP00000256737:L748P	L	+	2	0	ANO3	26620120	1.000000	0.71417	0.963000	0.40424	0.930000	0.56654	5.868000	0.69605	2.326000	0.78906	0.533000	0.62120	CTT	.	.	.	none		0.408	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418	
PAMR1	25891	hgsc.bcm.edu	37	11	35457562	35457562	+	Missense_Mutation	SNP	T	T	C	rs147274037		TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr11:35457562T>C	ENST00000378880.2	-	9	1667	c.1222A>G	c.(1222-1224)Acc>Gcc	p.T408A	PAMR1_ENST00000278360.3_Missense_Mutation_p.T425A|PAMR1_ENST00000378878.3_Missense_Mutation_p.T297A|PAMR1_ENST00000532848.1_Missense_Mutation_p.T368A	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	408	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TGGAGCTGGGTATGCAGATGT	0.582																																					p.T425A		Atlas-SNP	.											.	PAMR1	85	.	0			c.A1273G						PASS	.	T	ALA/THR,ALA/THR	2,4402	4.2+/-10.8	0,2,2200	195.0	176.0	183.0		1222,1273	5.5	1.0	11	dbSNP_134	183	0,8596		0,0,4298	no	missense,missense	PAMR1	NM_001001991.1,NM_015430.2	58,58	0,2,6498	CC,CT,TT		0.0,0.0454,0.0154	probably-damaging,probably-damaging	408/721,425/738	35457562	2,12998	2202	4298	6500	SO:0001583	missense	25891	exon10			GCTGGGTATGCAG		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1222A>G	chr11.hg19:g.35457562T>C	ENSP00000368158:p.Thr408Ala	153.0	0.0	.		206.0	57.0	.	NM_015430	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	ENST00000378880.2	hg19	CCDS31460.1	.	.	.	.	.	.	.	.	.	.	T	19.93	3.918376	0.73098	4.54E-4	0.0	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01	5.54	5.54	0.83059	Complement control module (2);Sushi/SCR/CCP (3);	0.095778	0.64402	D	0.000001	T	0.70290	0.3207	L	0.29908	0.895	0.58432	D	0.999999	D;D;B	0.76494	0.996;0.999;0.433	D;D;B	0.83275	0.973;0.996;0.134	T	0.74250	-0.3726	10	0.87932	D	0	.	15.6714	0.77279	0.0:0.0:0.0:1.0	.	297;408;425	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	A	425;408;297;368;385	ENSP00000278360:T425A;ENSP00000368158:T408A;ENSP00000368156:T297A;ENSP00000433868:T368A;ENSP00000432591:T385A	ENSP00000278360:T425A	T	-	1	0	PAMR1	35414138	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	2.230000	0.42999	2.107000	0.64212	0.459000	0.35465	ACC	.	T|1.000;C|0.000	0.000	weak		0.582	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430	
GANAB	23193	hgsc.bcm.edu	37	11	62394377	62394377	+	Silent	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr11:62394377C>T	ENST00000356638.3	-	20	2368	c.2352G>A	c.(2350-2352)aaG>aaA	p.K784K	GANAB_ENST00000540933.1_Silent_p.K687K|GANAB_ENST00000534779.1_Silent_p.K692K|GANAB_ENST00000346178.4_Silent_p.K806K	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	784					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	GACCATGATGCTTCTGGTAGC	0.517																																					p.K806K	Melanoma(23;1005 1074 15747 18937)	Atlas-SNP	.											.	GANAB	110	.	0			c.G2418A						PASS	.						84.0	79.0	80.0					11																	62394377		2202	4299	6501	SO:0001819	synonymous_variant	23193	exon21			ATGATGCTTCTGG	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.2352G>A	chr11.hg19:g.62394377C>T		104.0	0.0	.		100.0	29.0	.	NM_198335	A6NC20|Q8WTS9|Q9P0X0	Silent	SNP	ENST00000356638.3	hg19	CCDS8026.1																																																																																			.	.	.	none		0.517	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334	
MUS81	80198	hgsc.bcm.edu	37	11	65628851	65628851	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr11:65628851A>T	ENST00000308110.4	+	3	645	c.296A>T	c.(295-297)gAg>gTg	p.E99V	MUS81_ENST00000533035.1_Missense_Mutation_p.E24V|CFL1_ENST00000525451.2_5'Flank|CFL1_ENST00000534769.1_5'UTR|CFL1_ENST00000531413.1_5'Flank	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	99					DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		CCATCTGGAGAGAACAGTCCA	0.607								Homologous recombination																													p.E99V		Atlas-SNP	.											.	MUS81	68	.	0			c.A296T						PASS	.						33.0	32.0	32.0					11																	65628851		2191	4295	6486	SO:0001583	missense	80198	exon3			CTGGAGAGAACAG		CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.296A>T	chr11.hg19:g.65628851A>T	ENSP00000307853:p.Glu99Val	44.0	0.0	.		48.0	17.0	.	NM_025128	Q9H7D9	Missense_Mutation	SNP	ENST00000308110.4	hg19	CCDS8115.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.77|10.77	1.444355|1.444355	0.25987|0.25987	.|.	.|.	ENSG00000172732|ENSG00000172732	ENST00000529857;ENST00000533035;ENST00000308110;ENST00000437855;ENST00000525768|ENST00000529374	T;T;T;T|.	0.49139|.	0.79;2.41;0.79;1.77|.	3.66|3.66	-0.0927|-0.0927	0.13655|0.13655	.|.	2.043970|.	0.01586|.	N|.	0.021309|.	T|T	0.20536|0.20536	0.0494|0.0494	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|.	0.15473|.	0.013|.	B|.	0.10450|.	0.005|.	T|T	0.26950|0.26950	-1.0088|-1.0088	10|5	0.28530|.	T|.	0.3|.	0.0131|0.0131	5.0512|5.0512	0.14508|0.14508	0.4401:0.4472:0.1127:0.0|0.4401:0.4472:0.1127:0.0	.|.	99|.	Q96NY9|.	MUS81_HUMAN|.	V|S	164;24;99;99;24|23	ENSP00000431979:E164V;ENSP00000432287:E24V;ENSP00000307853:E99V;ENSP00000431478:E24V|.	ENSP00000307853:E99V|.	E|R	+|+	2|3	0|2	MUS81|MUS81	65385427|65385427	0.009000|0.009000	0.17119|0.17119	0.004000|0.004000	0.12327|0.12327	0.013000|0.013000	0.08279|0.08279	0.123000|0.123000	0.15708|0.15708	-0.026000|-0.026000	0.13895|0.13895	0.448000|0.448000	0.29417|0.29417	GAG|AGA	.	.	.	none		0.607	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390941.3	NM_025128	
DDIAS	220042	hgsc.bcm.edu	37	11	82643420	82643420	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr11:82643420C>T	ENST00000533655.1	+	6	1252	c.1040C>T	c.(1039-1041)cCc>cTc	p.P347L	C11orf82_ENST00000329143.3_Missense_Mutation_p.P46L|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000430323.2_Missense_Mutation_p.P347L	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		347					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						ATGCGAGAGCCCCTTGAGTCA	0.408																																					p.P347L		Atlas-SNP	.											.	C11orf82	71	.	0			c.C1040T						PASS	.						98.0	108.0	105.0					11																	82643420		2203	4300	6503	SO:0001583	missense	220042	exon6			GAGAGCCCCTTGA																												ENST00000533655.1:c.1040C>T	chr11.hg19:g.82643420C>T	ENSP00000435421:p.Pro347Leu	94.0	0.0	.		71.0	19.0	.	NM_145018	Q96LK6|Q9H856	Missense_Mutation	SNP	ENST00000533655.1	hg19	CCDS8263.1	.	.	.	.	.	.	.	.	.	.	C	6.484	0.457558	0.12342	.	.	ENSG00000165490	ENST00000430323;ENST00000533655;ENST00000329143	T;T;T	0.21932	2.22;2.22;1.98	5.58	-2.57	0.06248	.	1.219580	0.05461	N	0.551274	T	0.18383	0.0441	L	0.55481	1.735	0.09310	N	1	B	0.12630	0.006	B	0.11329	0.006	T	0.30238	-0.9985	9	.	.	.	7.3012	5.3775	0.16174	0.0:0.4007:0.2401:0.3592	.	347	Q8IXT1	NOXIN_HUMAN	L	347;347;46	ENSP00000414687:P347L;ENSP00000435421:P347L;ENSP00000329930:P46L	.	P	+	2	0	C11orf82	82321068	0.000000	0.05858	0.000000	0.03702	0.100000	0.18952	0.291000	0.18994	-0.836000	0.04229	-0.259000	0.10710	CCC	.	.	.	none		0.408	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391936.1		
ARHGAP20	57569	hgsc.bcm.edu	37	11	110451689	110451689	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr11:110451689T>C	ENST00000260283.4	-	16	2265	c.1981A>G	c.(1981-1983)Aac>Gac	p.N661D	ARHGAP20_ENST00000529591.1_Missense_Mutation_p.N204D|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.N625D|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.N635D|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.N635D|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.N638D|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.N625D	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	661					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		ACTAAAATGTTCACCGGCTTG	0.517																																					p.N661D		Atlas-SNP	.											.	ARHGAP20	150	.	0			c.A1981G						PASS	.						83.0	82.0	82.0					11																	110451689		2201	4298	6499	SO:0001583	missense	57569	exon16			AAATGTTCACCGG	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.1981A>G	chr11.hg19:g.110451689T>C	ENSP00000260283:p.Asn661Asp	93.0	0.0	.		86.0	17.0	.	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	hg19	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	T	3.414	-0.119605	0.06838	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.09073	3.02;3.02;3.06;3.02;3.02;3.02;3.02	5.37	1.55	0.23275	.	1.230650	0.05450	N	0.549242	T	0.05593	0.0147	N	0.16478	0.41	0.09310	N	0.999999	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.001;0.002	T	0.40813	-0.9543	10	0.41790	T	0.15	.	3.1674	0.06540	0.243:0.2555:0.0:0.5016	.	635;661;638	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	D	661;635;204;638;625;635;625	ENSP00000260283:N661D;ENSP00000349660:N635D;ENSP00000437905:N204D;ENSP00000432076:N638D;ENSP00000436319:N625D;ENSP00000436522:N635D;ENSP00000431399:N625D	ENSP00000260283:N661D	N	-	1	0	ARHGAP20	109956899	0.000000	0.05858	0.099000	0.21106	0.006000	0.05464	-0.012000	0.12699	0.357000	0.24183	0.383000	0.25322	AAC	.	.	.	none		0.517	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
FRS2	10818	hgsc.bcm.edu	37	12	69962872	69962872	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr12:69962872T>G	ENST00000550389.1	+	3	308	c.62T>G	c.(61-63)tTt>tGt	p.F21C	FRS2_ENST00000397997.2_Missense_Mutation_p.F21C|FRS2_ENST00000299293.2_Missense_Mutation_p.F21C|FRS2_ENST00000549921.1_Missense_Mutation_p.F21C	NM_001278353.1|NM_001278357.1	NP_001265282.1|NP_001265286.1	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	21	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification, embryo (GO:0008595)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation with mouth forming second (GO:0001702)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lens fiber cell development (GO:0070307)|neuroblast proliferation (GO:0007405)|neurotrophin TRK receptor signaling pathway (GO:0048011)|optic placode formation involved in camera-type eye formation (GO:0046619)|organ induction (GO:0001759)|phosphatidylinositol-mediated signaling (GO:0048015)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of apoptotic process (GO:0042981)|regulation of epithelial cell proliferation (GO:0050678)|regulation of ERK1 and ERK2 cascade (GO:0070372)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatase activator activity (GO:0019211)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			CGGAACAAGTTTAAGGTCAGT	0.378																																					p.F21C		Atlas-SNP	.											.	FRS2	88	.	0			c.T62G						PASS	.						88.0	86.0	86.0					12																	69962872		1849	4090	5939	SO:0001583	missense	10818	exon6			ACAAGTTTAAGGT	AF036717	CCDS41809.1	12q15	2008-02-05				ENSG00000166225			16971	protein-coding gene	gene with protein product		607743				8761293, 9660748	Standard	NM_001278351		Approved	SNT-1, FRS2alpha, SNT1, FRS2A	uc001suz.3	Q8WU20		ENST00000550389.1:c.62T>G	chr12.hg19:g.69962872T>G	ENSP00000447241:p.Phe21Cys	85.0	0.0	.		125.0	59.0	.	NM_001042555	B0LPF2|B2R684|O43558|Q7LDQ6	Missense_Mutation	SNP	ENST00000550389.1	hg19	CCDS41809.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.633974	0.87660	.	.	ENSG00000166225	ENST00000547219;ENST00000299293;ENST00000549921;ENST00000548154;ENST00000550389;ENST00000550937;ENST00000549092;ENST00000397997;ENST00000551325	D;D;D;D;D;D	0.91011	-2.77;-2.77;-2.77;-2.77;-2.77;-2.77	5.22	5.22	0.72569	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.85682	D	0.000000	D	0.95367	0.8496	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95594	0.8657	9	.	.	.	-20.3769	15.4105	0.74914	0.0:0.0:0.0:1.0	.	21	Q8WU20	FRS2_HUMAN	C	21	ENSP00000299293:F21C;ENSP00000450048:F21C;ENSP00000447241:F21C;ENSP00000447804:F21C;ENSP00000381083:F21C;ENSP00000449432:F21C	.	F	+	2	0	FRS2	68249139	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.100000	0.63781	0.533000	0.62120	TTT	.	.	.	none		0.378	FRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403760.1	NM_006654	
MYO1H	283446	hgsc.bcm.edu	37	12	109858829	109858829	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr12:109858829A>T	ENST00000431443.2	+	15	1623	c.1623A>T	c.(1621-1623)aaA>aaT	p.K541N	MYO1H_ENST00000310903.5_Missense_Mutation_p.K531N	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	541	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						GACATCTGAAAGAAGTAAGTC	0.284																																					p.K531N		Atlas-SNP	.											.	MYO1H	98	.	0			c.A1593T						PASS	.						69.0	66.0	67.0					12																	109858829		1795	4064	5859	SO:0001583	missense	283446	exon15			TCTGAAAGAAGTA		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1623A>T	chr12.hg19:g.109858829A>T	ENSP00000444076:p.Lys541Asn	86.0	0.0	.		118.0	7.0	.	NM_001101421	F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	hg19		.	.	.	.	.	.	.	.	.	.	A	20.4	3.990003	0.74589	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	D;D	0.87179	-2.22;-2.22	5.0	2.64	0.31445	.	.	.	.	.	D	0.90584	0.7048	M	0.87038	2.855	0.40543	D	0.981045	D	0.59357	0.985	P	0.53722	0.733	D	0.89020	0.3434	9	0.54805	T	0.06	.	8.3992	0.32574	0.8368:0.0:0.1632:0.0	.	531	F5H3C6	.	N	531;541	ENSP00000439182:K531N;ENSP00000444076:K541N	ENSP00000439182:K531N	K	+	3	2	MYO1H	108343212	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.758000	0.47565	0.379000	0.24794	0.533000	0.62120	AAA	.	.	.	none		0.284	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
TSC22D1	8848	hgsc.bcm.edu	37	13	45008845	45008845	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr13:45008845A>G	ENST00000458659.2	-	3	3629	c.3139T>C	c.(3139-3141)Tcc>Ccc	p.S1047P	TSC22D1_ENST00000501704.2_Intron|RP11-71C5.2_ENST00000426579.2_RNA|TSC22D1_ENST00000261489.2_Missense_Mutation_p.S118P	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	1047					negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		GCAGGGGGGGAGCCAGTCTGC	0.627																																					p.S1047P		Atlas-SNP	.											.	TSC22D1	88	.	0			c.T3139C						PASS	.						26.0	31.0	29.0					13																	45008845		2201	4298	6499	SO:0001583	missense	8848	exon3			GGGGGGAGCCAGT	AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.3139T>C	chr13.hg19:g.45008845A>G	ENSP00000397435:p.Ser1047Pro	33.0	0.0	.		51.0	23.0	.	NM_183422	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Missense_Mutation	SNP	ENST00000458659.2	hg19	CCDS31966.1	.	.	.	.	.	.	.	.	.	.	A	11.59	1.682552	0.29872	.	.	ENSG00000102804	ENST00000458659;ENST00000261489	T	0.36878	1.23	5.91	5.91	0.95273	.	0.267097	0.27088	N	0.020995	T	0.51210	0.1661	L	0.40543	1.245	0.80722	D	1	D;D	0.76494	0.999;0.965	D;P	0.77557	0.99;0.469	T	0.46020	-0.9221	10	0.42905	T	0.14	.	15.1833	0.72978	1.0:0.0:0.0:0.0	.	1047;118	Q15714;Q15714-2	T22D1_HUMAN;.	P	1047;118	ENSP00000397435:S1047P	ENSP00000261489:S118P	S	-	1	0	TSC22D1	43906845	1.000000	0.71417	1.000000	0.80357	0.109000	0.19521	1.907000	0.39897	2.254000	0.74563	0.533000	0.62120	TCC	.	.	.	none		0.627	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044743.2	NM_006022	
GPR183	1880	hgsc.bcm.edu	37	13	99947502	99947502	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr13:99947502T>G	ENST00000376414.4	-	2	981	c.898A>C	c.(898-900)Aat>Cat	p.N300H	UBAC2_ENST00000376440.2_Intron|UBAC2_ENST00000403766.3_Intron	NM_004951.4	NP_004942.1	P32249	GP183_HUMAN	G protein-coupled receptor 183	300					G-protein coupled receptor signaling pathway (GO:0007186)|humoral immune response (GO:0006959)|immune response (GO:0006955)|mature B cell differentiation involved in immune response (GO:0002313)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|oxysterol binding (GO:0008142)			cervix(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	23						ATGCAGCAATTGAAGTTCATC	0.388																																					p.N300H		Atlas-SNP	.											.	GPR183	38	.	0			c.A898C						PASS	.						101.0	93.0	96.0					13																	99947502		2203	4300	6503	SO:0001583	missense	1880	exon2			AGCAATTGAAGTT	L08177	CCDS9492.1	13q32.3	2012-08-21	2008-07-21	2008-07-21	ENSG00000169508	ENSG00000169508		"""GPCR / Class A : Orphans"""	3128	protein-coding gene	gene with protein product	"""EBV-induced G-protein coupled receptor 2"""	605741	"""Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor)"""	EBI2		8383238	Standard	NM_004951		Approved		uc001vog.3	P32249	OTTHUMG00000017263	ENST00000376414.4:c.898A>C	chr13.hg19:g.99947502T>G	ENSP00000365596:p.Asn300His	129.0	0.0	.		139.0	42.0	.	NM_004951	B2R8N5|Q53F99|Q5JUH7	Missense_Mutation	SNP	ENST00000376414.4	hg19	CCDS9492.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.177974	0.78564	.	.	ENSG00000169508	ENST00000376414	T	0.52526	0.66	5.91	5.91	0.95273	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.69205	0.3085	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70364	-0.4892	9	.	.	.	.	16.3483	0.83171	0.0:0.0:0.0:1.0	.	300	P32249	GP183_HUMAN	H	300	ENSP00000365596:N300H	.	N	-	1	0	GPR183	98745503	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.254000	0.74563	0.533000	0.62120	AAT	.	.	.	none		0.388	GPR183-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045582.2	NM_004951	
SYNE2	23224	hgsc.bcm.edu	37	14	64593109	64593109	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr14:64593109T>A	ENST00000344113.4	+	72	13831	c.13619T>A	c.(13618-13620)cTc>cAc	p.L4540H	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000358025.3_Missense_Mutation_p.L4540H|SYNE2_ENST00000357395.3_Missense_Mutation_p.L925H|SYNE2_ENST00000394768.2_Missense_Mutation_p.L925H|SYNE2_ENST00000554584.1_Missense_Mutation_p.L4491H|SYNE2_ENST00000555002.1_Missense_Mutation_p.L1174H	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4540					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTCCTGACCCTCAGTCAGTGC	0.428																																					p.L4540H		Atlas-SNP	.											.	SYNE2	577	.	0			c.T13619A						PASS	.						82.0	81.0	81.0					14																	64593109		2203	4300	6503	SO:0001583	missense	23224	exon72			TGACCCTCAGTCA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13619T>A	chr14.hg19:g.64593109T>A	ENSP00000341781:p.Leu4540His	223.0	0.0	.		273.0	78.0	.	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.234296	0.39498	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.62105	0.69;3.99;0.68;0.05;4.04;3.99	5.81	5.81	0.92471	.	0.145716	0.31542	N	0.007462	T	0.69424	0.3109	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.72338	0.917;0.95;0.977	T	0.72868	-0.4162	10	0.72032	D	0.01	.	14.7401	0.69448	0.0:0.0:0.0:1.0	.	925;4540;4540	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	H	4540;925;4540;4491;4491;1174;925	ENSP00000350719:L4540H;ENSP00000349969:L925H;ENSP00000341781:L4540H;ENSP00000452570:L4491H;ENSP00000450831:L1174H;ENSP00000378249:L925H	ENSP00000261678:L4491H	L	+	2	0	SYNE2	63662862	0.997000	0.39634	0.973000	0.42090	0.936000	0.57629	4.859000	0.62954	2.213000	0.71641	0.533000	0.62120	CTC	.	.	.	none		0.428	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
YLPM1	56252	hgsc.bcm.edu	37	14	75276225	75276225	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr14:75276225T>G	ENST00000552421.1	+	6	2670	c.2546T>G	c.(2545-2547)cTa>cGa	p.L849R	YLPM1_ENST00000325680.7_Missense_Mutation_p.L1555R|YLPM1_ENST00000238571.3_Missense_Mutation_p.L1360R			P49750	YLPM1_HUMAN	YLP motif containing 1	1360	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		cctccacctctacctcctcct	0.502																																					p.L1555R		Atlas-SNP	.											.	YLPM1	298	.	0			c.T4664G						PASS	.						82.0	80.0	81.0					14																	75276225		2002	4190	6192	SO:0001583	missense	56252	exon7			CACCTCTACCTCC	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.2546T>G	chr14.hg19:g.75276225T>G	ENSP00000447921:p.Leu849Arg	82.0	0.0	.		77.0	17.0	.	NM_019589	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000552421.1	hg19		.	.	.	.	.	.	.	.	.	.	T	6.984	0.551642	0.13374	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.09	4.19	0.49359	.	0.475155	0.19470	N	0.113468	T	0.27663	0.0680	N	0.14661	0.345	0.25321	N	0.989116	B;B	0.16603	0.018;0.018	B;B	0.20955	0.026;0.032	T	0.23762	-1.0179	9	0.62326	D	0.03	-0.0056	11.0988	0.48161	0.0:0.9121:0.0:0.0879	.	1360;1555	P49750-3;P49750-4	.;.	R	849;1555;1360;1268	.	ENSP00000238571:L1360R	L	+	2	0	YLPM1	74345978	0.171000	0.23029	0.575000	0.28536	0.367000	0.29736	2.720000	0.47252	1.109000	0.41680	-0.462000	0.05337	CTA	.	.	.	none		0.502	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589	
SPPL2A	84888	hgsc.bcm.edu	37	15	51028376	51028376	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr15:51028376A>T	ENST00000261854.5	-	8	1128	c.854T>A	c.(853-855)aTg>aAg	p.M285K		NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	285					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		TCTCACTTCCATGTTTTTGCC	0.348																																					p.M285K	Melanoma(50;790 1209 4069 22965 33125)	Atlas-SNP	.											.	SPPL2A	26	.	0			c.T854A						PASS	.						133.0	112.0	119.0					15																	51028376		2196	4294	6490	SO:0001583	missense	84888	exon8			ACTTCCATGTTTT		CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.854T>A	chr15.hg19:g.51028376A>T	ENSP00000261854:p.Met285Lys	65.0	0.0	.		56.0	13.0	.	NM_032802	B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	ENST00000261854.5	hg19	CCDS10138.1	.	.	.	.	.	.	.	.	.	.	A	12.31	1.898643	0.33535	.	.	ENSG00000138600	ENST00000261854	T	0.17054	2.3	5.07	2.72	0.32119	.	0.534882	0.21346	N	0.076048	T	0.09512	0.0234	N	0.19112	0.55	0.22378	N	0.999157	B	0.22414	0.069	B	0.11329	0.006	T	0.31024	-0.9958	10	0.27785	T	0.31	-4.6682	7.4553	0.27264	0.7429:0.0:0.2571:0.0	.	285	Q8TCT8	PSL2_HUMAN	K	285	ENSP00000261854:M285K	ENSP00000261854:M285K	M	-	2	0	AC012100.1	48815668	0.996000	0.38824	1.000000	0.80357	0.815000	0.46073	4.339000	0.59322	0.350000	0.24002	-0.371000	0.07208	ATG	.	.	.	none		0.348	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254543.3	NM_032802	
FAM214A	56204	hgsc.bcm.edu	37	15	52901851	52901851	+	Silent	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr15:52901851T>C	ENST00000261844.7	-	6	1412	c.1260A>G	c.(1258-1260)aaA>aaG	p.K420K	FAM214A_ENST00000546305.2_Silent_p.K427K	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	420																	CTTCTTTACCTTTTCCCACGT	0.413																																					p.K420K		Atlas-SNP	.											.	.	.	.	0			c.A1260G						PASS	.						67.0	60.0	62.0					15																	52901851		1821	4073	5894	SO:0001819	synonymous_variant	56204	exon6			TTTACCTTTTCCC	AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.1260A>G	chr15.hg19:g.52901851T>C		61.0	0.0	.		57.0	14.0	.	NM_019600	A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Silent	SNP	ENST00000261844.7	hg19	CCDS45263.1																																																																																			.	.	.	none		0.413	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419914.1	NM_019600	
POLG	5428	hgsc.bcm.edu	37	15	89870191	89870191	+	Silent	SNP	A	A	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr15:89870191A>G	ENST00000268124.5	-	8	1870	c.1537T>C	c.(1537-1539)Ttg>Ctg	p.L513L	POLG_ENST00000442287.2_Silent_p.L513L	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	513					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			TCGATGGGCAACTTGCTGGCT	0.582								DNA polymerases (catalytic subunits)																													p.L513L	Colon(73;648 1203 11348 18386 27782)	Atlas-SNP	.											.	POLG	75	.	0			c.T1537C						PASS	.						139.0	129.0	132.0					15																	89870191		2200	4299	6499	SO:0001819	synonymous_variant	5428	exon8			TGGGCAACTTGCT	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.1537T>C	chr15.hg19:g.89870191A>G		67.0	0.0	.		70.0	23.0	.	NM_002693	Q8NFM2|Q92515	Silent	SNP	ENST00000268124.5	hg19	CCDS10350.1																																																																																			.	.	.	none		0.582	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
TFAP4	7023	hgsc.bcm.edu	37	16	4311843	4311843	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr16:4311843C>G	ENST00000204517.6	-	4	790	c.462G>C	c.(460-462)gaG>gaC	p.E154D		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	154	Leucine-zipper 2.				cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						GCTCAATCATCTCCCGCCGCA	0.692											OREG0023575	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E154D		Atlas-SNP	.											.	TFAP4	31	.	0			c.G462C						PASS	.						38.0	36.0	37.0					16																	4311843		2196	4300	6496	SO:0001583	missense	7023	exon4			AATCATCTCCCGC	X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.462G>C	chr16.hg19:g.4311843C>G	ENSP00000204517:p.Glu154Asp	57.0	0.0	.	617	78.0	43.0	.	NM_003223	O60409	Missense_Mutation	SNP	ENST00000204517.6	hg19	CCDS10510.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972243	0.34754	.	.	ENSG00000090447	ENST00000204517	D	0.99023	-5.34	5.03	5.03	0.67393	.	0.060936	0.64402	D	0.000005	D	0.97077	0.9045	L	0.46157	1.445	0.46078	D	0.998852	B	0.09022	0.002	B	0.08055	0.003	D	0.95121	0.8246	10	0.35671	T	0.21	.	11.4972	0.50415	0.0:0.9161:0.0:0.0839	.	154	Q01664	TFAP4_HUMAN	D	154	ENSP00000204517:E154D	ENSP00000204517:E154D	E	-	3	2	TFAP4	4251844	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.767000	0.26575	2.330000	0.79161	0.462000	0.41574	GAG	.	.	.	none		0.692	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251595.2	NM_003223	
SOCS1	8651	hgsc.bcm.edu	37	16	11348785	11348785	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr16:11348785G>A	ENST00000332029.2	-	2	701	c.551C>T	c.(550-552)gCc>gTc	p.A184V	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	184	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.R127_*212del(1)|p.0?(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						GCCCACGGTGGCCACGATGCG	0.741			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.A184V	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	.	SOCS1	84	.	2	Whole gene deletion(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(2)	c.C551T						PASS	.						9.0	9.0	9.0					16																	11348785		2159	4260	6419	SO:0001583	missense	8651	exon2			ACGGTGGCCACGA	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.551C>T	chr16.hg19:g.11348785G>A	ENSP00000329418:p.Ala184Val	99.0	0.0	.		188.0	47.0	.	NM_003745	O15097|Q9NSA7	Missense_Mutation	SNP	ENST00000332029.2	hg19	CCDS10546.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948453	0.53186	.	.	ENSG00000185338	ENST00000332029	T	0.44083	0.93	4.25	4.25	0.50352	SOCS protein, C-terminal (4);	0.656455	0.15111	N	0.279946	T	0.45776	0.1359	L	0.54323	1.7	0.29000	N	0.887502	P	0.43662	0.814	P	0.47346	0.544	T	0.39683	-0.9602	10	0.41790	T	0.15	-20.1611	11.6312	0.51175	0.0:0.0:0.8094:0.1906	.	184	O15524	SOCS1_HUMAN	V	184	ENSP00000329418:A184V	ENSP00000329418:A184V	A	-	2	0	SOCS1	11256286	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.340000	0.43974	2.211000	0.71520	0.561000	0.74099	GCC	.	.	.	none		0.741	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
SNX29	92017	hgsc.bcm.edu	37	16	12371799	12371799	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr16:12371799T>C	ENST00000566228.1	+	15	1757	c.1688T>C	c.(1687-1689)cTt>cCt	p.L563P	SNX29_ENST00000323433.4_Missense_Mutation_p.L178P|SNX29_ENST00000306030.3_Missense_Mutation_p.L178P	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	563						extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						GTGCCAAATCTTTGGAGTGTT	0.378																																					p.L563P		Atlas-SNP	.											.	SNX29	60	.	0			c.T1688C						PASS	.						59.0	58.0	58.0					16																	12371799		1852	4102	5954	SO:0001583	missense	92017	exon15			CAAATCTTTGGAG	AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.1688T>C	chr16.hg19:g.12371799T>C	ENSP00000456480:p.Leu563Pro	95.0	0.0	.		134.0	31.0	.	NM_032167	B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	ENST00000566228.1	hg19	CCDS10553.2	.	.	.	.	.	.	.	.	.	.	T	15.89	2.965775	0.53507	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	.	.	.	5.46	4.37	0.52481	.	0.155686	0.42682	N	0.000679	T	0.60534	0.2276	L	0.54323	1.7	0.45733	D	0.998639	.	.	.	.	.	.	T	0.61382	-0.7074	7	0.72032	D	0.01	-5.764	7.971	0.30127	0.0:0.0924:0.0:0.9076	.	.	.	.	P	178	.	ENSP00000306940:L178P	L	+	2	0	SNX29	12279300	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	1.877000	0.39598	0.920000	0.36970	0.533000	0.62120	CTT	.	.	.	none		0.378	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422622.1		
CHRNE	1145	hgsc.bcm.edu	37	17	4802092	4802092	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr17:4802092A>G	ENST00000293780.4	-	12	1431	c.1421T>C	c.(1420-1422)tTc>tCc	p.F474S	C17orf107_ENST00000521575.1_5'Flank|CHRNE_ENST00000575637.1_5'Flank|C17orf107_ENST00000381365.3_5'Flank	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)	474					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	GGCCCCGAGGAAGATGAGGCT	0.602																																					p.F474S		Atlas-SNP	.											.	CHRNE	25	.	0			c.T1421C						PASS	.						57.0	41.0	46.0					17																	4802092		2202	4300	6502	SO:0001583	missense	1145	exon12			CCGAGGAAGATGA	X66403	CCDS11058.1	17p13.2	2012-02-11	2012-02-07		ENSG00000108556	ENSG00000108556		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1966	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	100725	"""cholinergic receptor, nicotinic, epsilon"""			7688301	Standard	NM_000080		Approved	ACHRE	uc002fzk.1	Q04844	OTTHUMG00000090778	ENST00000293780.4:c.1421T>C	chr17.hg19:g.4802092A>G	ENSP00000293780:p.Phe474Ser	82.0	0.0	.		83.0	7.0	.	NM_000080	D3DTK6	Missense_Mutation	SNP	ENST00000293780.4	hg19	CCDS11058.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.829048	0.90955	.	.	ENSG00000108556	ENST00000293780	D	0.88741	-2.42	4.76	4.76	0.60689	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95472	0.8529	M	0.93420	3.415	0.53688	D	0.999973	D	0.89917	1.0	D	0.91635	0.999	D	0.96218	0.9158	10	0.87932	D	0	.	12.2686	0.54693	1.0:0.0:0.0:0.0	.	474	Q04844	ACHE_HUMAN	S	474	ENSP00000293780:F474S	ENSP00000293780:F474S	F	-	2	0	CHRNE	4742871	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.047000	0.93823	2.001000	0.58596	0.533000	0.62120	TTC	.	.	.	none		0.602	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207560.3		
ALKBH5	54890	hgsc.bcm.edu	37	17	18088203	18088203	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr17:18088203G>C	ENST00000399138.4	+	1	651	c.646G>C	c.(646-648)Gtg>Ctg	p.V216L	ALKBH5_ENST00000541285.1_Intron|RP11-258F1.1_ENST00000583062.1_RNA|RP11-258F1.1_ENST00000577847.1_RNA	NM_017758.3	NP_060228.3	Q6P6C2	ALKB5_HUMAN	AlkB family member 5, RNA demethylase	216					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|oxidative single-stranded RNA demethylation (GO:0035553)|response to hypoxia (GO:0001666)|spermatogenesis (GO:0007283)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidative RNA demethylase activity (GO:0035515)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|skin(1)	10	all_neural(463;0.228)					GCGCCCCATCGTGTCCGTGTC	0.617																																					p.V216L	Ovarian(166;154 1953 40235 46283 46309)	Atlas-SNP	.											.	ALKBH5	24	.	0			c.G646C						PASS	.						63.0	70.0	68.0					17																	18088203		2164	4257	6421	SO:0001583	missense	54890	exon1			CCCATCGTGTCCG	AK000315	CCDS42272.1	17p11.2	2014-07-23	2014-07-23	2006-02-09	ENSG00000091542	ENSG00000091542	1.14.11.-	"""Alkylation repair homologs"""	25996	protein-coding gene	gene with protein product		613303	"""oxoglutarate and iron-dependent oxygenase domain containing"", ""alkB, alkylation repair homolog 5 (E. coli)"""	OFOXD1		11997338, 24778178	Standard	NM_017758		Approved	FLJ20308	uc010cpw.3	Q6P6C2	OTTHUMG00000059397	ENST00000399138.4:c.646G>C	chr17.hg19:g.18088203G>C	ENSP00000382091:p.Val216Leu	52.0	0.0	.		78.0	22.0	.	NM_017758	B4DVJ4|D3DXC6|Q9NXD6	Missense_Mutation	SNP	ENST00000399138.4	hg19	CCDS42272.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590056	0.86851	.	.	ENSG00000091542	ENST00000261650;ENST00000500385;ENST00000399138	T	0.13307	2.6	5.31	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.21145	0.0509	L	0.58669	1.825	0.80722	D	1	P	0.47106	0.89	P	0.47346	0.544	T	0.01146	-1.1437	10	0.40728	T	0.16	0.4929	15.4042	0.74866	0.0:0.1394:0.8606:0.0	.	216	Q6P6C2-2	.	L	216;205;216	ENSP00000382091:V216L	ENSP00000261650:V216L	V	+	1	0	ALKBH5	18028928	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.861000	0.87004	2.484000	0.83849	0.655000	0.94253	GTG	.	.	.	none		0.617	ALKBH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132069.3	NM_017758	
SLC47A1	55244	hgsc.bcm.edu	37	17	19459000	19459000	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr17:19459000G>T	ENST00000270570.4	+	8	822	c.736G>T	c.(736-738)Gga>Tga	p.G246*	SLC47A1_ENST00000542886.1_Missense_Mutation_p.G213V|SNORA59B_ENST00000458926.1_RNA|SLC47A1_ENST00000395585.1_Nonsense_Mutation_p.G246*|SLC47A1_ENST00000571335.1_Intron|SLC47A1_ENST00000436810.2_Nonsense_Mutation_p.G223*|SLC47A1_ENST00000575023.1_Intron|SLC47A1_ENST00000457293.1_Nonsense_Mutation_p.G246*	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	246					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	AGCTACATGGGGAGGTAATGA	0.507																																					p.G246X		Atlas-SNP	.											.	SLC47A1	55	.	0			c.G736T						PASS	.						122.0	112.0	116.0					17																	19459000		2203	4300	6503	SO:0001587	stop_gained	55244	exon8			ACATGGGGAGGTA		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.736G>T	chr17.hg19:g.19459000G>T	ENSP00000270570:p.Gly246*	50.0	0.0	.		74.0	15.0	.	NM_018242	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Nonsense_Mutation	SNP	ENST00000270570.4	hg19	CCDS11209.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	7.249755|7.249755	0.98164|0.98164	.|.	.|.	ENSG00000142494|ENSG00000142494	ENST00000542886|ENST00000436810;ENST00000270570;ENST00000457293;ENST00000395585	.|.	.|.	.|.	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	0.325890|0.325890	0.36338|0.36338	N|N	0.002649|0.002649	T|.	0.74030|.	0.3663|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.72714|.	-0.4210|.	6|.	0.87932|0.39692	D|T	0|0.17	-5.9107|-5.9107	18.0822|18.0822	0.89444|0.89444	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	V|X	213|223;246;246;246	.|.	ENSP00000440435:G213V|ENSP00000270570:G246X	G|G	+|+	2|1	0|0	SLC47A1|SLC47A1	19399592|19399592	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	7.096000|7.096000	0.76960|0.76960	2.517000|2.517000	0.84864|0.84864	0.650000|0.650000	0.86243|0.86243	GGG|GGA	.	.	.	none		0.507	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	NM_018242	
EZH1	2145	hgsc.bcm.edu	37	17	40870014	40870014	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr17:40870014T>C	ENST00000428826.2	-	10	1124	c.1003A>G	c.(1003-1005)Aca>Gca	p.T335A	EZH1_ENST00000590078.1_Missense_Mutation_p.T265A|EZH1_ENST00000592743.1_Missense_Mutation_p.T335A|EZH1_ENST00000415827.2_Missense_Mutation_p.T326A|EZH1_ENST00000435174.1_Missense_Mutation_p.T196A|EZH1_ENST00000585893.1_Missense_Mutation_p.T295A			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	335					anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)	p.T335A(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		AAGCAGTCTGTGCCACATGGT	0.428																																					p.T335A		Atlas-SNP	.											EZH1,bladder,carcinoma,0,1	EZH1	62	.	1	Substitution - Missense(1)	urinary_tract(1)	c.A1003G						PASS	.						161.0	146.0	151.0					17																	40870014		2203	4300	6503	SO:0001583	missense	2145	exon10			AGTCTGTGCCACA		CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.1003A>G	chr17.hg19:g.40870014T>C	ENSP00000404658:p.Thr335Ala	84.0	1.0	.		114.0	44.0	.	NM_001991	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	ENST00000428826.2	hg19	CCDS32659.1	.	.	.	.	.	.	.	.	.	.	T	9.108	1.005805	0.19199	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	T;T	0.77358	-1.09;-1.09	4.51	-2.48	0.06423	.	0.844588	0.11228	N	0.585983	T	0.46014	0.1371	N	0.04880	-0.145	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.0	T	0.31586	-0.9938	10	0.12430	T	0.62	.	1.1979	0.01878	0.2247:0.3103:0.1147:0.3503	.	196;295;341;335	Q92800-5;Q92800-3;Q92800-2;Q92800	.;.;.;EZH1_HUMAN	A	338;335;295;196	ENSP00000404658:T335A;ENSP00000404071:T196A	ENSP00000264646:T338A	T	-	1	0	EZH1	38123540	0.006000	0.16342	0.989000	0.46669	0.998000	0.95712	-0.035000	0.12205	-0.242000	0.09667	0.460000	0.39030	ACA	.	.	.	none		0.428	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452347.1	NM_001991	
IGF2BP1	10642	hgsc.bcm.edu	37	17	47075185	47075185	+	Silent	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr17:47075185G>A	ENST00000290341.3	+	1	412	c.78G>A	c.(76-78)aaG>aaA	p.K26K	RP11-501C14.5_ENST00000505903.1_RNA|IGF2BP1_ENST00000515586.1_3'UTR|IGF2BP1_ENST00000431824.2_Silent_p.K26K	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	26	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CGGAGCACAAGATCTCCTACA	0.587																																					p.K26K	Esophageal Squamous(198;1041 2123 8248 37119 38268)	Atlas-SNP	.											.	IGF2BP1	80	.	0			c.G78A						PASS	.						115.0	111.0	113.0					17																	47075185		2203	4300	6503	SO:0001819	synonymous_variant	10642	exon1			GCACAAGATCTCC	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.78G>A	chr17.hg19:g.47075185G>A		77.0	0.0	.		119.0	26.0	.	NM_001160423	C9JT33	Silent	SNP	ENST00000290341.3	hg19	CCDS11543.1																																																																																			.	.	.	none		0.587	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364046.1	NM_006546	
AFG3L2	10939	hgsc.bcm.edu	37	18	12340242	12340242	+	Silent	SNP	A	A	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr18:12340242A>C	ENST00000269143.3	-	15	2169	c.1938T>G	c.(1936-1938)gcT>gcG	p.A646A		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	646					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	AGTCATCTTGAGCACCAGTTG	0.393																																					p.A646A		Atlas-SNP	.											.	AFG3L2	60	.	0			c.T1938G						PASS	.						146.0	140.0	142.0					18																	12340242		2203	4300	6503	SO:0001819	synonymous_variant	10939	exon15			ATCTTGAGCACCA	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.1938T>G	chr18.hg19:g.12340242A>C		50.0	0.0	.		65.0	14.0	.	NM_006796	Q6P1L0	Silent	SNP	ENST00000269143.3	hg19	CCDS11859.1																																																																																			.	.	.	none		0.393	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796	
DAZAP1	26528	hgsc.bcm.edu	37	19	1434904	1434904	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr19:1434904G>C	ENST00000233078.4	+	12	1378	c.1217G>C	c.(1216-1218)cGa>cCa	p.R406P	DAZAP1_ENST00000336761.6_3'UTR	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	406					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCCCTACCGACGCTAGCCC	0.672																																					p.R406P		Atlas-SNP	.											.	DAZAP1	52	.	0			c.G1217C						PASS	.						9.0	10.0	10.0					19																	1434904		2136	4184	6320	SO:0001583	missense	26528	exon12			CCTACCGACGCTA		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.1217G>C	chr19.hg19:g.1434904G>C	ENSP00000233078:p.Arg406Pro	60.0	0.0	.		80.0	26.0	.	NM_018959	Q96MJ3|Q9NRR9	Missense_Mutation	SNP	ENST00000233078.4	hg19	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091413	0.76756	.	.	ENSG00000071626	ENST00000233078	T	0.34275	1.37	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.48169	0.1485	N	0.24115	0.695	0.80722	D	1	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.81914	0.989;0.989;0.995	T	0.53215	-0.8470	10	0.87932	D	0	.	17.8389	0.88709	0.0:0.0:1.0:0.0	.	473;406;172	Q5IRN4;Q96EP5;B3KS63	.;DAZP1_HUMAN;.	P	406	ENSP00000233078:R406P	ENSP00000233078:R406P	R	+	2	0	DAZAP1	1385904	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.449000	0.97603	2.454000	0.82982	0.561000	0.74099	CGA	.	.	.	none		0.672	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
NOTCH3	4854	hgsc.bcm.edu	37	19	15292387	15292387	+	Splice_Site	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr19:15292387C>T	ENST00000263388.2	-	17	2867	c.2792G>A	c.(2791-2793)aGc>aAc	p.S931N		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	931	EGF-like 24. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCCCGCCCACCTGGGGCTGCA	0.682																																					p.S931N		Atlas-SNP	.											.	NOTCH3	340	.	0			c.G2792A						PASS	.						7.0	6.0	7.0					19																	15292387		1946	3760	5706	SO:0001630	splice_region_variant	4854	exon17			GCCCACCTGGGGC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.2792+1G>A	chr19.hg19:g.15292387C>T		161.0	0.0	.		182.0	48.0	.	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	hg19	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	31	5.091511	0.94149	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.91686	-2.89	5.45	5.45	0.79879	EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.37857	N	0.001920	D	0.90745	0.7095	N	0.04820	-0.15	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.81914	0.995;0.968	D	0.90376	0.4384	9	.	.	.	.	18.0459	0.89332	0.0:1.0:0.0:0.0	.	882;931	Q59FL3;Q9UM47	.;NOTC3_HUMAN	N	931;881	ENSP00000263388:S931N	.	S	-	2	0	NOTCH3	15153387	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.739000	0.47409	2.569000	0.86673	0.561000	0.74099	AGC	.	.	.	none		0.682	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	Missense_Mutation
IFI30	10437	hgsc.bcm.edu	37	19	18286479	18286479	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr19:18286479T>C	ENST00000407280.3	+	4	630	c.455T>C	c.(454-456)tTt>tCt	p.F152S	PIK3R2_ENST00000593731.1_3'UTR	NM_006332.3	NP_006323.2	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	152					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of fibroblast proliferation (GO:0048147)|protein stabilization (GO:0050821)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)			endometrium(1)|kidney(2)|large_intestine(1)|stomach(1)	5						ATGGAAGAGTTTGAGGACATG	0.577																																					p.F152S		Atlas-SNP	.											.	IFI30	12	.	0			c.T455C						PASS	.						42.0	43.0	43.0					19																	18286479		2019	4194	6213	SO:0001583	missense	10437	exon4			AAGAGTTTGAGGA	J03909	CCDS46015.1	19p13.1	2008-07-16				ENSG00000216490			5398	protein-coding gene	gene with protein product	"""gamma-interferon-inducible lysosomal thiol reductase"", ""interferon gamma-inducible protein 30 preproprotein"""	604664				3136170, 10639150	Standard	NM_006332		Approved	IFI-30, GILT, IP30, MGC32056	uc002nic.1	P13284		ENST00000407280.3:c.455T>C	chr19.hg19:g.18286479T>C	ENSP00000384886:p.Phe152Ser	46.0	0.0	.		67.0	22.0	.	NM_006332	Q76MF9|Q8NEI4|Q8WU77|Q9UL08	Missense_Mutation	SNP	ENST00000407280.3	hg19	CCDS46015.1	.	.	.	.	.	.	.	.	.	.	T	1.463	-0.561981	0.03939	.	.	ENSG00000216490	ENST00000407280	.	.	.	4.4	3.38	0.38709	.	.	.	.	.	T	0.11367	0.0277	N	0.01284	-0.91	0.09310	N	1	B	0.16166	0.016	B	0.17433	0.018	T	0.27054	-1.0085	8	0.07175	T	0.84	-23.2549	7.7231	0.28744	0.0:0.1025:0.0:0.8975	.	152	P13284	GILT_HUMAN	S	152	.	ENSP00000384886:F152S	F	+	2	0	IFI30	18147479	0.047000	0.20315	0.668000	0.29813	0.003000	0.03518	1.938000	0.40203	1.983000	0.57843	0.459000	0.35465	TTT	.	.	.	none		0.577	IFI30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466396.3	NM_006332	
SIGLEC10	89790	hgsc.bcm.edu	37	19	51920173	51920173	+	Silent	SNP	G	G	A	rs139091162		TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr19:51920173G>A	ENST00000339313.5	-	3	569	c.453C>T	c.(451-453)ccC>ccT	p.P151P	SIGLEC10_ENST00000439889.2_Intron|SIGLEC10_ENST00000436984.2_Intron|SIGLEC10_ENST00000353836.5_Silent_p.P151P|SIGLEC10_ENST00000525998.1_Silent_p.P151P|CTD-2616J11.2_ENST00000532688.1_RNA|CTD-2616J11.3_ENST00000532473.1_RNA|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Silent_p.P151P|SIGLEC10_ENST00000442846.3_Intron|SIGLEC10_ENST00000441969.3_Intron|SIGLEC10_ENST00000432469.2_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	151	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		CCAGGGTCTCGGGGATGTAGA	0.622																																					p.P151P		Atlas-SNP	.											.	SIGLEC10	112	.	0			c.C453T						PASS	.	G	,,,,,,	2,4404		0,2,2201	67.0	78.0	75.0		,453,,,,,453	-9.4	0.0	19	dbSNP_134	75	0,8600		0,0,4300	no	intron,coding-synonymous,intron,intron,intron,intron,coding-synonymous	SIGLEC10	NM_001171156.1,NM_001171157.1,NM_001171158.1,NM_001171159.1,NM_001171160.1,NM_001171161.1,NM_033130.4	,,,,,,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,,,,,	,151/603,,,,,151/698	51920173	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	89790	exon3			GGTCTCGGGGATG	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.453C>T	chr19.hg19:g.51920173G>A		176.0	0.0	.		171.0	37.0	.	NM_001171157	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Silent	SNP	ENST00000339313.5	hg19	CCDS12832.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.622	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
ZNF350	59348	hgsc.bcm.edu	37	19	52468148	52468148	+	Missense_Mutation	SNP	C	C	T	rs148220969		TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr19:52468148C>T	ENST00000243644.4	-	5	1785	c.1558G>A	c.(1558-1560)Gtg>Atg	p.V520M	HCCAT3_ENST00000595010.1_RNA|HCCAT3_ENST00000600253.1_RNA|ZNF350_ENST00000600703.1_5'Flank	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	520					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V520M(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		TAATTGATCACGGAAGGCACA	0.413																																					p.V520M		Atlas-SNP	.											ZNF350,NS,carcinoma,0,1	ZNF350	48	.	1	Substitution - Missense(1)	endometrium(1)	c.G1558A						PASS	.	C	MET/VAL	0,4406		0,0,2203	103.0	90.0	95.0		1558	1.4	0.0	19	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF350	NM_021632.3	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	520/533	52468148	1,13005	2203	4300	6503	SO:0001583	missense	59348	exon5			TGATCACGGAAGG	AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.1558G>A	chr19.hg19:g.52468148C>T	ENSP00000243644:p.Val520Met	55.0	0.0	.		67.0	19.0	.	NM_021632	Q96G73|Q9HAQ4	Missense_Mutation	SNP	ENST00000243644.4	hg19	CCDS12845.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.367472	0.24771	0.0	1.16E-4	ENSG00000256683	ENST00000243644	T	0.05855	3.38	3.64	1.41	0.22369	.	0.275159	0.19550	N	0.111587	T	0.03915	0.0110	L	0.34521	1.04	0.09310	N	1	P	0.34587	0.458	B	0.19391	0.025	T	0.39761	-0.9598	10	0.48119	T	0.1	.	6.2576	0.20881	0.0:0.7534:0.0:0.2466	.	520	Q9GZX5	ZN350_HUMAN	M	520	ENSP00000243644:V520M	ENSP00000243644:V520M	V	-	1	0	ZNF350	57159960	0.000000	0.05858	0.031000	0.17742	0.243000	0.25628	-0.184000	0.09698	0.763000	0.33175	-0.186000	0.12905	GTG	.	C|1.000;T|0.000	0.000	weak		0.413	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462278.1	NM_021632	
ZNF580	51157	hgsc.bcm.edu	37	19	56153876	56153876	+	Start_Codon_SNP	SNP	T	T	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr19:56153876T>A	ENST00000543039.1	+	1	459	c.2T>A	c.(1-3)aTg>aAg	p.M1K	ZNF580_ENST00000545125.1_Start_Codon_SNP_p.M1K|ZNF581_ENST00000588537.1_5'Flank|ZNF580_ENST00000325333.5_Start_Codon_SNP_p.M1K|ZNF581_ENST00000587252.1_Intron|ZNF581_ENST00000270451.5_5'Flank	NM_016202.2	NP_057286.1	Q9UK33	ZN580_HUMAN	zinc finger protein 580	1					cellular response to hydrogen peroxide (GO:0070301)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte chemotaxis (GO:0002690)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(1)|upper_aerodigestive_tract(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		CCGCTCCAGATGCTGCTGCTG	0.612																																					p.M1K		Atlas-SNP	.											.	ZNF580	2	.	0			c.T2A						PASS	.						15.0	18.0	17.0					19																	56153876		1649	3510	5159	SO:0001582	initiator_codon_variant	51157	exon1			TCCAGATGCTGCT	AF184939	CCDS12931.1	19q13.42	2013-09-20			ENSG00000213015	ENSG00000213015		"""Zinc fingers, C2H2-type"""	29473	protein-coding gene	gene with protein product						12477932	Standard	NM_001163423		Approved		uc002qlo.3	Q9UK33	OTTHUMG00000180868	ENST00000543039.1:c.2T>A	chr19.hg19:g.56153876T>A	ENSP00000443957:p.Met1Lys	61.0	0.0	.		57.0	17.0	.	NM_016202	B2RC05|Q9NPP7	Missense_Mutation	SNP	ENST00000543039.1	hg19	CCDS12931.1	.	.	.	.	.	.	.	.	.	.	T	14.15	2.448547	0.43429	.	.	ENSG00000213015	ENST00000325333;ENST00000543039;ENST00000545125	T;T;T	0.05258	3.47;3.47;3.47	3.57	3.57	0.40892	.	.	.	.	.	T	0.06462	0.0166	.	.	.	0.80722	D	1	B	0.10296	0.003	B	0.04013	0.001	T	0.15464	-1.0436	8	0.87932	D	0	-7.8799	8.699	0.34314	0.0:0.0:0.0:1.0	.	1	Q9UK33	ZN580_HUMAN	K	1	ENSP00000320050:M1K;ENSP00000443957:M1K;ENSP00000446126:M1K	ENSP00000320050:M1K	M	+	2	0	ZNF580	60845688	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.632000	0.24583	1.620000	0.50308	0.374000	0.22700	ATG	.	.	.	none		0.612	ZNF580-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453428.1	NM_016202	Missense_Mutation
ZSCAN22	342945	hgsc.bcm.edu	37	19	58849868	58849868	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr19:58849868C>T	ENST00000329665.4	+	3	799	c.652C>T	c.(652-654)Cag>Tag	p.Q218*		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	218					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		CCCCACAGACCAGCGTGGCCG	0.517																																					p.Q218X		Atlas-SNP	.											.	ZSCAN22	47	.	0			c.C652T						PASS	.						149.0	152.0	151.0					19																	58849868		2203	4300	6503	SO:0001587	stop_gained	342945	exon3			ACAGACCAGCGTG	M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.652C>T	chr19.hg19:g.58849868C>T	ENSP00000332433:p.Gln218*	115.0	0.0	.		118.0	33.0	.	NM_181846	Q15922|Q7Z3L8	Nonsense_Mutation	SNP	ENST00000329665.4	hg19	CCDS12975.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930821	0.73327	.	.	ENSG00000182318	ENST00000329665	.	.	.	4.02	0.338	0.15974	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	7.3595	0.26737	0.0:0.5848:0.3188:0.0964	.	.	.	.	X	218	.	ENSP00000332433:Q218X	Q	+	1	0	ZSCAN22	63541680	0.000000	0.05858	0.001000	0.08648	0.120000	0.20174	-0.156000	0.10100	0.350000	0.24002	0.313000	0.20887	CAG	.	.	.	none		0.517	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466765.1	NM_181846	
SDCBP2	27111	hgsc.bcm.edu	37	20	1294040	1294040	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr20:1294040G>A	ENST00000360779.3	-	5	501	c.328C>T	c.(328-330)Cac>Tac	p.H110Y	SDCBP2_ENST00000381812.1_Missense_Mutation_p.H110Y|SDCBP2_ENST00000339987.3_Missense_Mutation_p.H110Y|SDCBP2_ENST00000467129.1_5'Flank|SDCBP2_ENST00000381808.3_Missense_Mutation_p.H25Y	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	110	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						TTGCACAGGTGGATCTCGCGC	0.716																																					p.H110Y		Atlas-SNP	.											.	SDCBP2	78	.	0			c.C328T						PASS	.						27.0	27.0	27.0					20																	1294040		2202	4298	6500	SO:0001583	missense	27111	exon5			ACAGGTGGATCTC	AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.328C>T	chr20.hg19:g.1294040G>A	ENSP00000354013:p.His110Tyr	124.0	0.0	.		123.0	24.0	.	NM_080489	O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	ENST00000360779.3	hg19	CCDS42848.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.859249	0.32884	.	.	ENSG00000125775	ENST00000381812;ENST00000381808;ENST00000360779;ENST00000339987	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	5.01	3.08	0.35506	PDZ/DHR/GLGF (3);	0.270706	0.36555	N	0.002529	T	0.19485	0.0468	L	0.46157	1.445	0.32669	N	0.517107	B;B	0.22003	0.063;0.003	B;B	0.17433	0.018;0.012	T	0.21690	-1.0238	10	0.08179	T	0.78	-6.8767	4.5438	0.12071	0.1812:0.0:0.6438:0.175	.	110;110	B4DKI5;Q9H190	.;SDCB2_HUMAN	Y	110;25;110;110	ENSP00000371233:H110Y;ENSP00000371229:H25Y;ENSP00000354013:H110Y;ENSP00000342935:H110Y	ENSP00000342935:H110Y	H	-	1	0	SDCBP2	1242040	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.052000	0.49893	0.708000	0.31955	0.462000	0.41574	CAC	.	.	.	none		0.716	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077513.2	NM_080489	
LRRN4	164312	hgsc.bcm.edu	37	20	6031523	6031523	+	Silent	SNP	G	G	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr20:6031523G>A	ENST00000378858.4	-	3	986	c.762C>T	c.(760-762)aaC>aaT	p.N254N		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	254					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						GCTGCTGCAGGTTGGGGGTCA	0.552																																					p.N254N		Atlas-SNP	.											.	LRRN4	54	.	0			c.C762T						PASS	.						133.0	123.0	127.0					20																	6031523		2203	4300	6503	SO:0001819	synonymous_variant	164312	exon3			CTGCAGGTTGGGG	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.762C>T	chr20.hg19:g.6031523G>A		116.0	0.0	.		138.0	36.0	.	NM_152611	A8K258|Q5JWV6|Q9H419	Silent	SNP	ENST00000378858.4	hg19	CCDS13097.1																																																																																			.	.	.	none		0.552	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
NOL4L	140688	hgsc.bcm.edu	37	20	31044026	31044026	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr20:31044026C>G	ENST00000359676.5	-	3	424	c.282G>C	c.(280-282)aaG>aaC	p.K94N	RP5-1184F4.5_ENST00000442179.1_RNA|C20orf112_ENST00000475781.1_5'UTR	NM_001256798.1|NM_080616.4	NP_001243727.1|NP_542183.2	Q96MY1	NOL4L_HUMAN		94						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(5)|lung(5)	15						CCGGCGGGAGCTTGTCACACA	0.682																																					p.K338N		Atlas-SNP	.											.	C20orf112	39	.	0			c.G1014C						PASS	.						51.0	49.0	50.0					20																	31044026		2202	4298	6500	SO:0001583	missense	140688	exon6			CGGGAGCTTGTCA																												ENST00000359676.5:c.282G>C	chr20.hg19:g.31044026C>G	ENSP00000352704:p.Lys94Asn	72.0	0.0	.		87.0	27.0	.	NM_001256798	Q5JYB7|Q6P0Y4|Q9BR34|Q9NQF6	Missense_Mutation	SNP	ENST00000359676.5	hg19	CCDS13202.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957547	0.73902	.	.	ENSG00000197183	ENST00000359676;ENST00000397984	.	.	.	5.1	5.1	0.69264	.	0.203164	0.43110	D	0.000607	T	0.55194	0.1905	L	0.50333	1.59	0.80722	D	1	P	0.44429	0.835	P	0.44477	0.451	T	0.60831	-0.7185	9	0.87932	D	0	-7.3123	11.0544	0.47909	0.0:0.9154:0.0:0.0846	.	94	Q96MY1	CT112_HUMAN	N	94	.	ENSP00000352704:K94N	K	-	3	2	C20orf112	30507687	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.181000	0.32017	2.378000	0.81104	0.561000	0.74099	AAG	.	.	.	none		0.682	C20orf112-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078628.2		
ZNF512B	57473	hgsc.bcm.edu	37	20	62595216	62595216	+	Missense_Mutation	SNP	C	C	T	rs370483162		TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr20:62595216C>T	ENST00000450537.1	-	9	1591	c.1531G>A	c.(1531-1533)Gtc>Atc	p.V511I	ZNF512B_ENST00000217130.3_Missense_Mutation_p.V511I|ZNF512B_ENST00000369888.1_Missense_Mutation_p.V511I			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GTGGGGCAGACGGCTTCCCCG	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		17133	0.0		0.0	False		,,,				2504	0.001				p.V511I		Atlas-SNP	.											.	ZNF512B	72	.	0			c.G1531A						PASS	.	C	ILE/VAL	0,4406		0,0,2203	68.0	68.0	68.0		1531	2.7	1.0	20		68	1,8597	1.2+/-3.3	0,1,4298	no	missense	ZNF512B	NM_020713.1	29	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	511/893	62595216	1,13003	2203	4299	6502	SO:0001583	missense	57473	exon9			GGCAGACGGCTTC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1531G>A	chr20.hg19:g.62595216C>T	ENSP00000393795:p.Val511Ile	34.0	0.0	.		42.0	10.0	.	NM_020713	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	hg19	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392201	0.25118	0.0	1.16E-4	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.26067	1.76;1.76;1.76	4.62	2.68	0.31781	.	0.224107	0.37261	N	0.002172	T	0.20659	0.0497	L	0.50333	1.59	0.29642	N	0.844651	B	0.12630	0.006	B	0.08055	0.003	T	0.16041	-1.0416	10	0.24483	T	0.36	-14.6217	8.8556	0.35225	0.0:0.8211:0.0:0.1789	.	511	Q96KM6	Z512B_HUMAN	I	511	ENSP00000358904:V511I;ENSP00000393795:V511I;ENSP00000217130:V511I	ENSP00000217130:V511I	V	-	1	0	ZNF512B	62065660	0.039000	0.19947	0.980000	0.43619	0.635000	0.38103	0.410000	0.21098	0.384000	0.24942	-0.444000	0.05651	GTC	.	.	.	weak		0.652	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
MN1	4330	hgsc.bcm.edu	37	22	28194900	28194900	+	Silent	SNP	T	T	C	rs202212250|rs530519178	byFrequency	TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr22:28194900T>C	ENST00000302326.4	-	1	2586	c.1632A>G	c.(1630-1632)caA>caG	p.Q544Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	544	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgttgct	0.647			T	ETV6	"""AML, meningioma"""								C|||	5	0.000998403	0.0023	0.0	5008	,	,		12597	0.0		0.0	False		,,,				2504	0.002				p.Q544Q		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1	122	.	0			c.A1632G						PASS	.																																			SO:0001819	synonymous_variant	4330	exon1			CTGCTGTTGCTGT	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1632A>G	chr22.hg19:g.28194900T>C		26.0	0.0	.		57.0	7.0	.	NM_002430	A9Z1V9	Silent	SNP	ENST00000302326.4	hg19	CCDS42998.1																																																																																			.	.	.	none		0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
CPT1B	1375	hgsc.bcm.edu	37	22	51009666	51009666	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr22:51009666T>C	ENST00000360719.2	-	15	1933	c.1796A>G	c.(1795-1797)gAg>gGg	p.E599G	CPT1B_ENST00000434492.2_Missense_Mutation_p.E394G|CPT1B_ENST00000440709.1_Missense_Mutation_p.E518G|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000312108.7_Missense_Mutation_p.E599G|CPT1B_ENST00000395650.2_Missense_Mutation_p.E599G|CPT1B_ENST00000457250.1_Missense_Mutation_p.E565G|CPT1B_ENST00000405237.3_Missense_Mutation_p.E599G	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	599					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		AGTCCGTCCCTCCCGGAACAT	0.572																																					p.E599G	Esophageal Squamous(170;988 1933 25577 30295 48163)	Atlas-SNP	.											.	CPT1B	61	.	0			c.A1796G						PASS	.						126.0	105.0	112.0					22																	51009666		2203	4300	6503	SO:0001583	missense	1375	exon15			CGTCCCTCCCGGA	U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.1796A>G	chr22.hg19:g.51009666T>C	ENSP00000353945:p.Glu599Gly	35.0	0.0	.		50.0	17.0	.	NM_001145135	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	ENST00000360719.2	hg19	CCDS14098.1	.	.	.	.	.	.	.	.	.	.	T	31	5.076517	0.94000	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000457250;ENST00000440709;ENST00000434492;ENST00000395650	D;D;D;D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59	5.82	5.82	0.92795	.	0.102840	0.64402	D	0.000004	D	0.94175	0.8131	M	0.83312	2.635	0.80722	D	1	P;D;D;D	0.63046	0.822;0.984;0.986;0.992	B;D;D;D	0.65874	0.341;0.939;0.911;0.911	D	0.94829	0.7994	10	0.87932	D	0	-34.8941	14.122	0.65195	0.0:0.0:0.0:1.0	.	518;565;394;599	E9PCP2;B7Z4U4;A2RRE8;Q92523	.;.;.;CPT1B_HUMAN	G	599;599;599;565;518;394;599	ENSP00000385486:E599G;ENSP00000312189:E599G;ENSP00000353945:E599G;ENSP00000409342:E565G;ENSP00000414713:E518G;ENSP00000410966:E394G;ENSP00000379011:E599G	ENSP00000312189:E599G	E	-	2	0	CPT1B	49356532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.611000	0.82962	2.224000	0.72417	0.459000	0.35465	GAG	.	.	.	none		0.572	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317264.5	NM_152246	
HUWE1	10075	hgsc.bcm.edu	37	X	53565805	53565805	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chrX:53565805G>T	ENST00000342160.3	-	75	12326	c.11869C>A	c.(11869-11871)Cgc>Agc	p.R3957S	HUWE1_ENST00000262854.6_Missense_Mutation_p.R3957S			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3957					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CCTGCAAAGCGAAGGAACTTC	0.498																																					p.R3957S		Atlas-SNP	.											.	HUWE1	724	.	0			c.C11869A						PASS	.						34.0	27.0	29.0					X																	53565805		2203	4300	6503	SO:0001583	missense	10075	exon76			CAAAGCGAAGGAA	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11869C>A	chrX.hg19:g.53565805G>T	ENSP00000340648:p.Arg3957Ser	25.0	0.0	.		37.0	21.0	.	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.00|14.00	2.406129|2.406129	0.42715|0.42715	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052;ENST00000426907	T;T|.	0.36520|.	1.25;1.25|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.061518|.	0.64402|.	D|.	0.000003|.	T|.	0.42291|.	0.1196|.	N|N	0.17379|0.17379	0.485|0.485	0.58432|0.58432	D|D	0.999999|0.999999	B;D;D|.	0.63046|.	0.245;0.987;0.992|.	B;D;D|.	0.70487|.	0.044;0.931;0.969|.	T|.	0.30297|.	-0.9983|.	10|.	0.26408|.	T|.	0.33|.	.|.	11.8503|11.8503	0.52407|0.52407	0.0:0.0:0.825:0.175|0.0:0.0:0.825:0.175	.|.	779;3957;3941|.	Q5H935;Q7Z6Z7;Q7Z6Z7-2|.	.;HUWE1_HUMAN;.|.	S|X	3957|2990;779	ENSP00000340648:R3957S;ENSP00000262854:R3957S|.	ENSP00000262854:R3957S|.	R|S	-|-	1|2	0|0	HUWE1|HUWE1	53582530|53582530	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.789000|6.789000	0.75110|0.75110	2.276000|2.276000	0.75962|0.75962	0.600000|0.600000	0.82982|0.82982	CGC|TCG	.	.	.	none		0.498	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
MT-ND1	4535	hgsc.bcm.edu	37	M	3760	3760	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chrM:3760T>G	ENST00000361390.2	+	1	454	c.454T>G	c.(454-456)Tca>Gca	p.S152A	MT-TM_ENST00000387377.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TQ_ENST00000387372.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	152					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCATTCTACTATCAACATTAC	0.458																																					p.S152A		Atlas-SNP	.											.	.	.	.	0			c.T454G						PASS	.																																			SO:0001583	missense	10625	exon1			CTACTATCAACAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.454T>G	chrM.hg19:g.3760T>G	ENSP00000354687:p.Ser152Ala	16.0	0.0	.		26.0	8.0	.	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.	.	none		0.458	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
ZNF549	256051	hgsc.bcm.edu	37	19	58049579	58049583	+	Frame_Shift_Del	DEL	TCACT	TCACT	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	TCACT	TCACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr19:58049579_58049583delTCACT	ENST00000376233.3	+	4	1388_1392	c.1207_1211delTCACT	c.(1207-1212)tcacttfs	p.SL403fs	ZNF549_ENST00000240719.3_Frame_Shift_Del_p.SL390fs|ZNF549_ENST00000594943.1_Intron|ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Intron	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	403					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATACAAACAGTCACTTCTTGATCAC	0.434																																					p.402_404del		Atlas-Indel,Pindel	.											.	ZNF549	118	.	0			c.1206_1210del						PASS	.																																			SO:0001589	frameshift_variant	256051	exon4			.	AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.1207_1211delTCACT	chr19.hg19:g.58049579_58049583delTCACT	ENSP00000365407:p.Ser403fs	92.0	0.0	0		98.0	19.0	0.193878	NM_001199295	B3KV91|O43336|Q8NAR4	Frame_Shift_Del	DEL	ENST00000376233.3	hg19	CCDS56106.1																																																																																			.	.	.	none		0.434	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	NM_153263	
CTAGE9	643854	hgsc.bcm.edu	37	6	132030533	132030533	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr6:132030533delA	ENST00000314099.8	-	1	1673	c.1625delT	c.(1624-1626)ttgfs	p.L543fs	ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000357639.3_Intron|ENPP3_ENST00000414305.1_Intron	NM_001145659.1|NM_001278507.1	NP_001139131.1|NP_001265436.1	A4FU28	CTGE9_HUMAN	CTAGE family, member 9	543						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						ATCCTCCAACAAAGTTTGAGG	0.522																																					p.L542fs		Atlas-Indel,Pindel	.											.	CTAGE9	56	.	0			c.1626delG						PASS	.						1.0	1.0	1.0					6																	132030533		17	57	74	SO:0001589	frameshift_variant	643854	exon1			.		CCDS47475.1	6q23.2	2010-06-23			ENSG00000236761	ENSG00000236761			37275	protein-coding gene	gene with protein product							Standard	NM_001145659		Approved		uc011ece.2	A4FU28	OTTHUMG00000047966	ENST00000314099.8:c.1625delT	chr6.hg19:g.132030533delA	ENSP00000395587:p.Leu543fs	268.0	0.0	0		393.0	36.0	0.0916031	NM_001145659		Frame_Shift_Del	DEL	ENST00000314099.8	hg19	CCDS47475.1																																																																																			.	.	.	none		0.522	CTAGE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109220.1	NM_001145659	
MYO18A	399687	hgsc.bcm.edu	37	17	27438845	27438845	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr17:27438845delG	ENST00000527372.1	-	16	2815	c.2635delC	c.(2635-2637)ctgfs	p.L880fs	MYO18A_ENST00000531253.1_Frame_Shift_Del_p.L880fs|MYO18A_ENST00000533112.1_Frame_Shift_Del_p.L880fs|MYO18A_ENST00000354329.4_Frame_Shift_Del_p.L880fs	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	880	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			AGCCAGAGCAGGCCCCTCGCC	0.612											OREG0024287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L879fs	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-Indel,Pindel	.											.	MYO18A	217	.	0			c.2636delT						PASS	.						43.0	49.0	47.0					17																	27438845		1884	4105	5989	SO:0001589	frameshift_variant	399687	exon16			.	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2635delC	chr17.hg19:g.27438845delG	ENSP00000437073:p.Leu880fs	64.0	0.0	0	794	95.0	46.0	0.484211	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Frame_Shift_Del	DEL	ENST00000527372.1	hg19	CCDS45642.1																																																																																			.	.	.	none		0.612	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
NAALADL1	10004	hgsc.bcm.edu	37	11	64815657	64815657	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr11:64815657delC	ENST00000358658.3	-	10	1342	c.1315delG	c.(1315-1317)gtgfs	p.V439fs	NAALADL1_ENST00000339885.2_Frame_Shift_Del_p.V439fs|NAALADL1_ENST00000355369.2_Frame_Shift_Del_p.V439fs|NAALADL1_ENST00000526799.1_5'UTR|NAALADL1_ENST00000528884.1_5'UTR|NAALADL1_ENST00000356632.3_Frame_Shift_Del_p.V404fs|RN7SL114P_ENST00000582042.1_RNA|NAALADL1_ENST00000340252.4_Frame_Shift_Del_p.V490fs|NAALADL1_ENST00000355721.3_Frame_Shift_Del_p.V398fs	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1	439	NAALADase.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						ATGTAGGCCACCGTGCGCTCC	0.632																																					p.V439fs		Atlas-Indel,Pindel	.											.	NAALADL1	58	.	0			c.1316delT						PASS	.						119.0	119.0	119.0					11																	64815657		2201	4297	6498	SO:0001589	frameshift_variant	10004	exon10			.	AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595	ENST00000358658.3:c.1315delG	chr11.hg19:g.64815657delC	ENSP00000351484:p.Val439fs	85.0	0.0	0		83.0	28.0	0.337349	NM_005468	C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Frame_Shift_Del	DEL	ENST00000358658.3	hg19	CCDS31604.1																																																																																			.	.	.	none		0.632	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385162.1	NM_005468	
CLIP2	7461	hgsc.bcm.edu	37	7	73790571	73790571	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr7:73790571delA	ENST00000395060.1	+	9	1840	c.1840delA	c.(1840-1842)aaafs	p.K614fs	CLIP2_ENST00000223398.6_Frame_Shift_Del_p.K614fs|CLIP2_ENST00000361545.5_Frame_Shift_Del_p.K579fs			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	614						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						GGACAACTGGAAATCCAAGCT	0.632																																					p.W613X		Atlas-Indel,Pindel	.											.	CLIP2	134	.	0			c.1839delG						PASS	.						63.0	56.0	58.0					7																	73790571		2203	4300	6503	SO:0001589	frameshift_variant	7461	exon10			.	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.1840delA	chr7.hg19:g.73790571delA	ENSP00000378500:p.Lys614fs	207.0	0.0	0		263.0	116.0	0.441065	NM_003388	O14527|O43611	Frame_Shift_Del	DEL	ENST00000395060.1	hg19	CCDS5569.1																																																																																			.	.	.	none		0.632	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
SCN10A	6336	hgsc.bcm.edu	37	3	38739055	38739055	+	Frame_Shift_Del	DEL	C	C	-	rs148979438	byFrequency	TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr3:38739055delC	ENST00000449082.2	-	27	5655	c.5656delG	c.(5656-5658)gctfs	p.A1887fs		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1887					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AGTGATGCAGCCTCCTCCTCA	0.498																																					p.A1886fs		Atlas-Indel,Pindel	.											.	SCN10A	359	.	0			c.5657delC						PASS	.						144.0	131.0	135.0					3																	38739055		2203	4300	6503	SO:0001589	frameshift_variant	6336	exon27			.	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5656delG	chr3.hg19:g.38739055delC	ENSP00000390600:p.Ala1887fs	97.0	0.0	0		148.0	72.0	0.486486	NM_006514	A6NDQ1	Frame_Shift_Del	DEL	ENST00000449082.2	hg19	CCDS33736.1																																																																																			.	.	.	none		0.498	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
WFIKKN1	117166	hgsc.bcm.edu	37	16	682600	682600	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr16:682600delA	ENST00000319070.2	+	2	512	c.190delA	c.(190-192)aagfs	p.K64fs		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	64	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				GGCTGCTGAGAAGTGCTGCAT	0.697																																					p.E63fs		Atlas-Indel,Pindel	.											WFIKKN1,larynx,carcinoma,0,1	WFIKKN1	30	.	0			c.189delG						PASS	.						22.0	24.0	24.0					16																	682600		2175	4293	6468	SO:0001589	frameshift_variant	117166	exon2			.	AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.190delA	chr16.hg19:g.682600delA	ENSP00000324763:p.Lys64fs	133.0	0.0	0		187.0	35.0	0.187166	NM_053284	Q7LDW0|Q8NBQ1|Q96S20	Frame_Shift_Del	DEL	ENST00000319070.2	hg19	CCDS10414.1																																																																																			.	.	.	none		0.697	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206731.2	NM_053284	
EPHA3	2042	hgsc.bcm.edu	37	3	89259542	89259542	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr3:89259542delC	ENST00000336596.2	+	3	911	c.686delC	c.(685-687)tctfs	p.S229fs	EPHA3_ENST00000452448.2_Frame_Shift_Del_p.S229fs|EPHA3_ENST00000494014.1_Frame_Shift_Del_p.S229fs	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	229	Cys-rich.		S -> Y (in a lung large cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.S229Y(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GTTAGAGGGTCTTGTGTCAAC	0.483										TSP Lung(6;0.00050)																											p.S229fs		Atlas-Indel,Pindel	.											EPHA3_ENST00000452448,colon,carcinoma,-2,6	EPHA3	501	.	1	Substitution - Missense(1)	lung(1)	c.685delT						PASS	.						156.0	150.0	152.0					3																	89259542		2203	4300	6503	SO:0001589	frameshift_variant	2042	exon3			.	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.686delC	chr3.hg19:g.89259542delC	ENSP00000337451:p.Ser229fs	86.0	0.0	0		123.0	55.0	0.447154	NM_005233	Q9H2V3|Q9H2V4	Frame_Shift_Del	DEL	ENST00000336596.2	hg19	CCDS2922.1																																																																																			.	.	.	none		0.483	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
DOCK3	1795	hgsc.bcm.edu	37	3	51350329	51350329	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr3:51350329delT	ENST00000266037.9	+	31	3272	c.3249delT	c.(3247-3249)aatfs	p.N1083fs		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1083					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TGTGGCAGAATTTGGGTAGGT	0.408																																					p.N1083fs		Atlas-Indel,Pindel	.											.	DOCK3	397	.	0			c.3248delA						PASS	.						296.0	274.0	281.0					3																	51350329		1904	4122	6026	SO:0001589	frameshift_variant	1795	exon31			.	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3249delT	chr3.hg19:g.51350329delT	ENSP00000266037:p.Asn1083fs	82.0	0.0	0		111.0	56.0	0.504505	NM_004947	O15017	Frame_Shift_Del	DEL	ENST00000266037.9	hg19	CCDS46835.1																																																																																			.	.	.	none		0.408	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
RYR2	6262	hgsc.bcm.edu	37	1	237791158	237791159	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr1:237791158_237791159insT	ENST00000366574.2	+	41	6535_6536	c.6218_6219insT	c.(6217-6222)tctgtcfs	p.V2074fs	RYR2_ENST00000360064.6_Frame_Shift_Ins_p.V2072fs|RYR2_ENST00000542537.1_Frame_Shift_Ins_p.V2058fs	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2074	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCTCAGGAGTCTGTCATTGAAG	0.49																																					p.S2073fs		Atlas-Indel,Pindel	.											.	RYR2	1273	.	0			c.6218_6219insT						PASS	.																																			SO:0001589	frameshift_variant	6262	exon41			.	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6219dupT	chr1.hg19:g.237791159_237791159dupT	ENSP00000355533:p.Val2074fs	60.0	0.0	0		87.0	28.0	0.321839	NM_001035	Q15411|Q546N8|Q5T3P2	Frame_Shift_Ins	INS	ENST00000366574.2	hg19	CCDS55691.1																																																																																			.	.	.	none		0.490	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
NFATC3	4775	hgsc.bcm.edu	37	16	68156669	68156669	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr16:68156669delC	ENST00000346183.3	+	2	907	c.883delC	c.(883-885)cctfs	p.P295fs	RP11-67A1.2_ENST00000548144.1_RNA|NFATC3_ENST00000329524.4_Frame_Shift_Del_p.P295fs|NFATC3_ENST00000349223.5_Frame_Shift_Del_p.P295fs|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Frame_Shift_Del_p.P295fs	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	295	3 X SP repeats.				cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CTCACCTGTTCCTTCACCTGG	0.557																																					p.V294fs		Atlas-Indel,Pindel	.											.	NFATC3	190	.	0			c.882delT						PASS	.						112.0	100.0	104.0					16																	68156669		2198	4300	6498	SO:0001589	frameshift_variant	4775	exon2			.	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.883delC	chr16.hg19:g.68156669delC	ENSP00000300659:p.Pro295fs	58.0	0.0	0		97.0	43.0	0.443299	NM_173163	O75211|Q14516|Q99840|Q99841|Q99842	Frame_Shift_Del	DEL	ENST00000346183.3	hg19	CCDS10860.1																																																																																			.	.	.	none		0.557	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555	
GPATCH2L	55668	hgsc.bcm.edu	37	14	76662242	76662242	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr14:76662242delA	ENST00000261530.7	+	9	1281	c.1215delA	c.(1213-1215)ggafs	p.G405fs	GPATCH2L_ENST00000553588.1_Frame_Shift_Del_p.D26fs|GPATCH2L_ENST00000312858.5_Frame_Shift_Del_p.G400fs|GPATCH2L_ENST00000556675.1_3'UTR	NM_017926.2	NP_060396.2	Q9NWQ4	GPT2L_HUMAN	G patch domain containing 2-like	405																	TACACTGGGGACCACCATGTT	0.408																																					p.G405fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.1214delG						PASS	.						197.0	187.0	190.0					14																	76662242		2203	4300	6503	SO:0001589	frameshift_variant	55668	exon9			.	AK000696	CCDS9848.1, CCDS9849.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000089916	ENSG00000089916			20210	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 118"""	C14orf118		10574461	Standard	NM_017926		Approved	FLJ20689, FLJ10033	uc001xsh.3	Q9NWQ4	OTTHUMG00000171490	ENST00000261530.7:c.1215delA	chr14.hg19:g.76662242delA	ENSP00000261530:p.Gly405fs	74.0	0.0	0		75.0	12.0	0.16	NM_017926	B3KN42|Q6PEJ7|Q9H3M3|Q9NWH0|Q9ULR8	Frame_Shift_Del	DEL	ENST00000261530.7	hg19	CCDS9848.1																																																																																			.	.	.	none		0.408	GPATCH2L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000413698.2	NM_017926	
CLEC7A	64581	hgsc.bcm.edu	37	12	10279210	10279211	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2Z-A9J5-01A-21D-A382-10	TCGA-2Z-A9J5-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	237ddfd6-6bf8-4d4b-aa08-0da80f631160	b35fa663-4ad4-4c0b-9d5a-c6490a0c9009	g.chr12:10279210_10279211insA	ENST00000304084.8	-	3	453_454	c.299_300insT	c.(298-300)ttafs	p.L100fs	CLEC7A_ENST00000533022.1_Frame_Shift_Ins_p.L100fs|CLEC7A_ENST00000353231.5_Intron|CLEC7A_ENST00000396484.2_Intron|CLEC7A_ENST00000298523.5_Intron	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A	100					carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						CACTGTCTTCTAAAGATGATTG	0.421																																					p.L100fs		Pindel	.											.	CLEC7A	55	.	0			c.300_301insT						PASS	.																																			SO:0001589	frameshift_variant	64581	exon3			.	AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.300dupT	chr12.hg19:g.10279213_10279213dupA	ENSP00000302569:p.Leu100fs	76.0	0.0	.		111.0	15.0	0.135	NM_197947	B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Frame_Shift_Ins	INS	ENST00000304084.8	hg19	CCDS41753.1																																																																																			.	.	.	none		0.421	CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390772.1	NM_197954	
