#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
S100PBP	64766	hgsc.bcm.edu	37	1	33292095	33292095	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr1:33292095C>T	ENST00000373475.5	+	3	649	c.395C>T	c.(394-396)cCa>cTa	p.P132L	S100PBP_ENST00000373476.1_Missense_Mutation_p.P132L|S100PBP_ENST00000356689.3_3'UTR|S100PBP_ENST00000398243.3_Missense_Mutation_p.P132L	NM_022753.3	NP_073590.2			S100P binding protein											endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|stomach(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CATACTAAACCATTAAACAGA	0.418																																					p.P132L		Atlas-SNP	.											.	S100PBP	31	.	0			c.C395T						PASS	.						57.0	57.0	57.0					1																	33292095		2203	4300	6503	SO:0001583	missense	64766	exon3			CTAAACCATTAAA	BX647916	CCDS30666.1	1p35.1	2008-02-05			ENSG00000116497	ENSG00000116497			25768	protein-coding gene	gene with protein product	"""S100P binding protein 1"""	611889				12477932	Standard	NM_022753		Approved	FLJ12903, S100PBPR	uc001bwc.4	Q96BU1	OTTHUMG00000003955	ENST00000373475.5:c.395C>T	chr1.hg19:g.33292095C>T	ENSP00000362574:p.Pro132Leu	169.0	0.0	.		191.0	32.0	.	NM_001256121		Missense_Mutation	SNP	ENST00000373475.5	hg19	CCDS30666.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768157	0.31320	.	.	ENSG00000116497	ENST00000373476;ENST00000373475;ENST00000531123;ENST00000398243;ENST00000356689;ENST00000531256;ENST00000482212	.	.	.	5.85	5.85	0.93711	.	0.276721	0.35040	N	0.003497	T	0.60753	0.2293	N	0.19112	0.55	0.39844	D	0.973141	D;D	0.63046	0.992;0.992	D;P	0.64410	0.925;0.856	T	0.58200	-0.7678	8	.	.	.	-1.5056	16.0378	0.80642	0.0:1.0:0.0:0.0	.	132;132	A8MTZ6;Q96BU1	.;S1PBP_HUMAN	L	132	.	.	P	+	2	0	S100PBP	33064682	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	3.345000	0.52182	2.941000	0.99782	0.655000	0.94253	CCA	.	.	.	none		0.418	S100PBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011266.1	NM_022753	
CDC20	991	hgsc.bcm.edu	37	1	43825898	43825898	+	Silent	SNP	A	A	G			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr1:43825898A>G	ENST00000372462.1	+	5	794	c.591A>G	c.(589-591)gtA>gtG	p.V197V	RP1-92O14.3_ENST00000424948.1_RNA|CDC20_ENST00000478882.1_3'UTR|CDC20_ENST00000310955.6_Silent_p.V197V			Q12834	CDC20_HUMAN	cell division cycle 20	197					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTGGGAATGTACTGGCCGTGG	0.517																																					p.V197V	Esophageal Squamous(137;1154 1759 10362 10401 46925)	Atlas-SNP	.											.	CDC20	34	.	0			c.A591G						PASS	.						155.0	146.0	149.0					1																	43825898		2203	4300	6503	SO:0001819	synonymous_variant	991	exon6			GAATGTACTGGCC	U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.591A>G	chr1.hg19:g.43825898A>G		80.0	0.0	.		100.0	50.0	.	NM_001255	B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Silent	SNP	ENST00000372462.1	hg19	CCDS484.1																																																																																			.	.	.	none		0.517	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019488.1	NM_001255	
PTGER3	5733	hgsc.bcm.edu	37	1	71512615	71512615	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr1:71512615C>T	ENST00000306666.5	-	1	856	c.646G>A	c.(646-648)Ggc>Agc	p.G216S	PTGER3_ENST00000370932.2_Missense_Mutation_p.G216S|PTGER3_ENST00000370931.3_Missense_Mutation_p.G216S|ZRANB2-AS1_ENST00000450461.1_RNA|PTGER3_ENST00000356595.4_Missense_Mutation_p.G216S|PTGER3_ENST00000354608.5_Missense_Mutation_p.G216S|PTGER3_ENST00000414819.1_Missense_Mutation_p.G216S|PTGER3_ENST00000351052.5_Missense_Mutation_p.G216S|PTGER3_ENST00000370924.4_Missense_Mutation_p.G216S|PTGER3_ENST00000460330.1_Missense_Mutation_p.G216S	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	216					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	GTCCCGTTGCCCCCTCGCCCG	0.647																																					p.G216S		Atlas-SNP	.											.	PTGER3	246	.	0			c.G646A						PASS	.						84.0	82.0	83.0					1																	71512615		2203	4300	6503	SO:0001583	missense	5733	exon1			CGTTGCCCCCTCG	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.646G>A	chr1.hg19:g.71512615C>T	ENSP00000302313:p.Gly216Ser	90.0	0.0	.		137.0	42.0	.	NM_001126044	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000306666.5	hg19	CCDS657.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.986926	0.53934	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51;-0.51;-0.51;-0.51;-0.51	5.1	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	0.214089	0.44902	D	0.000416	T	0.37210	0.0995	N	0.08118	0	0.30485	N	0.772003	P;B;P;P;P;B;B;B	0.52061	0.805;0.201;0.95;0.698;0.885;0.101;0.29;0.338	P;B;P;B;P;B;B;B	0.50440	0.492;0.26;0.641;0.393;0.492;0.12;0.185;0.282	T	0.28364	-1.0046	10	0.16420	T	0.52	-16.9936	9.9405	0.41578	0.0:0.7752:0.0:0.2248	.	216;216;216;216;216;216;216;216	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	S	216	ENSP00000359969:G216S;ENSP00000359970:G216S;ENSP00000280208:G216S;ENSP00000418073:G216S;ENSP00000346624:G216S;ENSP00000349003:G216S;ENSP00000401423:G216S;ENSP00000302313:G216S;ENSP00000359962:G216S	ENSP00000302313:G216S	G	-	1	0	PTGER3	71285203	0.866000	0.29940	0.964000	0.40570	0.935000	0.57460	2.370000	0.44240	1.372000	0.46190	0.462000	0.41574	GGC	.	.	.	none		0.647	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
FUBP1	8880	hgsc.bcm.edu	37	1	78432739	78432739	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr1:78432739C>A	ENST00000370768.2	-	5	418	c.337G>T	c.(337-339)Gga>Tga	p.G113*	FUBP1_ENST00000436586.2_Nonsense_Mutation_p.G134*|FUBP1_ENST00000370767.1_Nonsense_Mutation_p.G113*	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	113	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						TTACTGAATCCAACCATTCCA	0.274			"""F, N"""		oligodendroglioma																																p.G113X		Atlas-SNP	.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1	112	.	0			c.G337T						PASS	.						45.0	47.0	46.0					1																	78432739		2200	4293	6493	SO:0001587	stop_gained	8880	exon5			TGAATCCAACCAT	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.337G>T	chr1.hg19:g.78432739C>A	ENSP00000359804:p.Gly113*	179.0	0.0	.		175.0	81.0	.	NM_003902	Q12828	Nonsense_Mutation	SNP	ENST00000370768.2	hg19	CCDS683.1	.	.	.	.	.	.	.	.	.	.	C	35	5.472734	0.96274	.	.	ENSG00000162613	ENST00000370773;ENST00000370767;ENST00000370768;ENST00000394922;ENST00000436586;ENST00000421641	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.1391	19.4544	0.94882	0.0:1.0:0.0:0.0	.	.	.	.	X	112;113;113;112;134;133	.	ENSP00000294623:G112X	G	-	1	0	FUBP1	78205327	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.776000	0.85560	2.669000	0.90835	0.591000	0.81541	GGA	.	.	.	none		0.274	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227268711	227268711	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr1:227268711G>C	ENST00000366769.3	-	17	3654	c.2363C>G	c.(2362-2364)aCt>aGt	p.T788S	CDC42BPA_ENST00000535525.1_Missense_Mutation_p.T788S|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.T707S|CDC42BPA_ENST00000488131.1_5'UTR|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.T788S|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.T788S|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.T788S|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.T788S	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CTCATACAAAGTAGTAAGCTG	0.368																																					p.T788S		Atlas-SNP	.											.	CDC42BPA	528	.	0			c.C2363G						PASS	.						141.0	128.0	132.0					1																	227268711		2203	4300	6503	SO:0001583	missense	8476	exon17			TACAAAGTAGTAA	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2363C>G	chr1.hg19:g.227268711G>C	ENSP00000355731:p.Thr788Ser	78.0	0.0	.		82.0	40.0	.	NM_003607		Missense_Mutation	SNP	ENST00000366769.3	hg19	CCDS1558.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.006|0.006	-2.071546|-2.071546	0.00379|0.00379	.|.	.|.	ENSG00000143776|ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000535525;ENST00000366765|ENST00000442054	T;T;T;T;T;T;T|.	0.64085|.	0.0;-0.01;-0.01;0.01;-0.08;-0.04;0.01|.	5.49|5.49	2.62|2.62	0.31277|0.31277	.|.	0.580520|.	0.20021|.	N|.	0.100917|.	T|.	0.16428|.	0.0395|.	N|N	0.03154|0.03154	-0.405|-0.405	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.10296|.	0.003;0.001;0.0;0.0;0.0|.	B;B;B;B;B|.	0.09377|.	0.004;0.002;0.001;0.001;0.0|.	T|.	0.25813|.	-1.0121|.	10|.	0.02654|.	T|.	1|.	.|.	10.8933|10.8933	0.47008|0.47008	0.2036:0.0:0.7964:0.0|0.2036:0.0:0.7964:0.0	.|.	788;788;707;788;788|.	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5;Q5VT25-2|.	.;.;.;.;.|.	S|X	788;707;788;788;788;52;788;788|81	ENSP00000355731:T788S;ENSP00000355729:T707S;ENSP00000335341:T788S;ENSP00000355728:T788S;ENSP00000355726:T788S;ENSP00000443275:T788S;ENSP00000355727:T788S|.	ENSP00000335341:T788S|.	T|Y	-|-	2|3	0|2	CDC42BPA|CDC42BPA	225335334|225335334	0.950000|0.950000	0.32346|0.32346	0.001000|0.001000	0.08648|0.08648	0.197000|0.197000	0.23852|0.23852	2.806000|2.806000	0.47947|0.47947	0.288000|0.288000	0.22398|0.22398	-0.216000|-0.216000	0.12614|0.12614	ACT|TAC	.	.	.	none		0.368	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
TRAPPC12	51112	hgsc.bcm.edu	37	2	3392180	3392180	+	Silent	SNP	C	C	G			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr2:3392180C>G	ENST00000324266.5	+	2	981	c.786C>G	c.(784-786)ccC>ccG	p.P262P	TRAPPC12_ENST00000382110.2_Silent_p.P262P	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	262					vesicle-mediated transport (GO:0016192)												GCCCCGAACCCGTGGCCATGC	0.736																																					p.P262P		Atlas-SNP	.											.	.	.	.	0			c.C786G						PASS	.						8.0	10.0	9.0					2																	3392180		2160	4207	6367	SO:0001819	synonymous_variant	51112	exon2			CGAACCCGTGGCC	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.786C>G	chr2.hg19:g.3392180C>G		111.0	0.0	.		127.0	55.0	.	NM_016030	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Silent	SNP	ENST00000324266.5	hg19	CCDS1652.1																																																																																			.	.	.	none		0.736	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
EGR4	1961	hgsc.bcm.edu	37	2	73519561	73519561	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr2:73519561G>C	ENST00000545030.1	-	2	868	c.794C>G	c.(793-795)tCg>tGg	p.S265W	EGR4_ENST00000436467.2_Missense_Mutation_p.S162W	NM_001965.3	NP_001956.3	Q05215	EGR4_HUMAN	early growth response 4	265	Pro-rich.				cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CGCGCAAGGCGAGGCCTCCCA	0.721																																					p.S265W		Atlas-SNP	.											.	EGR4	52	.	0			c.C794G						PASS	.						8.0	11.0	10.0					2																	73519561		2169	4251	6420	SO:0001583	missense	1961	exon2			CAAGGCGAGGCCT		CCDS1925.2	2p13	2013-01-08			ENSG00000135625	ENSG00000135625		"""Zinc fingers, C2H2-type"""	3241	protein-coding gene	gene with protein product		128992				1584812	Standard	NM_001965		Approved	NGFI-C, PAT133	uc010yrj.2	Q05215	OTTHUMG00000129774	ENST00000545030.1:c.794C>G	chr2.hg19:g.73519561G>C	ENSP00000445626:p.Ser265Trp	105.0	0.0	.		106.0	50.0	.	NM_001965	B2RAE3|G3V1T5|Q2Z1P5	Missense_Mutation	SNP	ENST00000545030.1	hg19	CCDS1925.2	.	.	.	.	.	.	.	.	.	.	G	11.04	1.521481	0.27211	.	.	ENSG00000135625	ENST00000545030;ENST00000436467	T;T	0.15603	2.41;2.75	4.39	4.39	0.52855	.	0.663371	0.14050	N	0.344855	T	0.24236	0.0587	N	0.24115	0.695	0.43122	D	0.994847	D;D	0.63880	0.988;0.993	P;D	0.63703	0.828;0.917	T	0.02263	-1.1186	10	0.87932	D	0	-8.1456	9.4657	0.38811	0.0984:0.0:0.9016:0.0	.	162;265	Q05215;G3V1T5	EGR4_HUMAN;.	W	265;162	ENSP00000445626:S265W;ENSP00000419687:S162W	ENSP00000419687:S162W	S	-	2	0	EGR4	73373069	0.112000	0.22096	0.985000	0.45067	0.221000	0.24807	1.161000	0.31773	2.267000	0.75376	0.555000	0.69702	TCG	.	.	.	none		0.721	EGR4-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001965	
SPEG	10290	hgsc.bcm.edu	37	2	220299815	220299815	+	Missense_Mutation	SNP	T	T	C	rs565137573	byFrequency	TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr2:220299815T>C	ENST00000312358.7	+	1	248	c.116T>C	c.(115-117)gTg>gCg	p.V39A		NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	39					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCTGTGGCCGTGGCCGGGGCG	0.781													T|||	43	0.00858626	0.0287	0.0072	5008	,	,		10028	0.0		0.0	False		,,,				2504	0.0				p.V39A		Atlas-SNP	.											SPEG,brain,glioma,0,1	SPEG	272	.	0			c.T116C						PASS	.						1.0	2.0	2.0					2																	220299815		898	2387	3285	SO:0001583	missense	10290	exon1			TGGCCGTGGCCGG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.116T>C	chr2.hg19:g.220299815T>C	ENSP00000311684:p.Val39Ala	4.0	2.0	.		9.0	4.0	.	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	hg19	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	T	3.599	-0.081974	0.07141	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.63913	-0.07	3.19	-3.42	0.04825	Immunoglobulin-like fold (1);	0.959955	0.08421	N	0.948317	T	0.30070	0.0753	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25847	-1.0120	10	0.05436	T	0.98	.	4.6272	0.12484	0.0:0.2917:0.4213:0.2871	.	39	Q15772	SPEG_HUMAN	A	39	ENSP00000311684:V39A	ENSP00000265327:V39A	V	+	2	0	SPEG	220008059	0.000000	0.05858	0.071000	0.20095	0.324000	0.28378	-2.176000	0.01262	-1.212000	0.02620	0.460000	0.39030	GTG	.	.	.	none		0.781	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
GATB	5188	hgsc.bcm.edu	37	4	152622569	152622569	+	Missense_Mutation	SNP	C	C	A	rs199827552		TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr4:152622569C>A	ENST00000515812.1	-	8	1002	c.986G>T	c.(985-987)cGg>cTg	p.R329L	PET112_ENST00000263985.6_Missense_Mutation_p.R370L																breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	23						GAGTGTCTCCCGAATCTGGTC	0.557																																					p.R370L		Atlas-SNP	.											.	PET112	43	.	0			c.G1109T						PASS	.						72.0	68.0	69.0					4																	152622569		2203	4300	6503	SO:0001583	missense	5188	exon9			GTCTCCCGAATCT																												ENST00000515812.1:c.986G>T	chr4.hg19:g.152622569C>A	ENSP00000426859:p.Arg329Leu	86.0	0.0	.		122.0	58.0	.	NM_004564		Missense_Mutation	SNP	ENST00000515812.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.72	2.321005	0.41096	.	.	ENSG00000059691	ENST00000263985;ENST00000515812	T;T	0.50548	0.76;0.74	5.7	5.7	0.88788	.	0.226336	0.38720	N	0.001597	T	0.49712	0.1573	M	0.80982	2.52	0.80722	D	1	B	0.30914	0.3	B	0.22601	0.04	T	0.54774	-0.8243	10	0.66056	D	0.02	-18.6049	13.5076	0.61493	0.0:0.9194:0.0:0.0805	.	370	O75879	GATB_HUMAN	L	370;329	ENSP00000263985:R370L;ENSP00000426859:R329L	ENSP00000263985:R370L	R	-	2	0	PET112	152842019	0.876000	0.30132	0.835000	0.33067	0.365000	0.29674	1.675000	0.37555	2.679000	0.91253	0.650000	0.86243	CGG	.	C|0.999;T|0.001	.	alt		0.557	PET112-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365672.1		
ZNF622	90441	hgsc.bcm.edu	37	5	16465654	16465654	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr5:16465654G>A	ENST00000308683.2	-	1	247	c.121C>T	c.(121-123)Cca>Tca	p.P41S		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	41					intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						GCGGTCACTGGGGCCATGCTG	0.682																																					p.P41S		Atlas-SNP	.											.	ZNF622	49	.	0			c.C121T						PASS	.						33.0	34.0	34.0					5																	16465654		2203	4298	6501	SO:0001583	missense	90441	exon1			TCACTGGGGCCAT	AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.121C>T	chr5.hg19:g.16465654G>A	ENSP00000310042:p.Pro41Ser	137.0	0.0	.		128.0	54.0	.	NM_033414		Missense_Mutation	SNP	ENST00000308683.2	hg19	CCDS3886.1	.	.	.	.	.	.	.	.	.	.	G	33	5.267658	0.95399	.	.	ENSG00000173545	ENST00000308683	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.79992	0.4542	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80448	-0.1378	9	0.46703	T	0.11	-4.253	18.4546	0.90715	0.0:0.0:1.0:0.0	.	41	Q969S3	ZN622_HUMAN	S	41	.	ENSP00000310042:P41S	P	-	1	0	ZNF622	16518654	1.000000	0.71417	0.995000	0.50966	0.872000	0.50106	9.482000	0.97935	2.576000	0.86940	0.650000	0.86243	CCA	.	.	.	none		0.682	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207105.1	NM_033414	
PPAP2A	8611	hgsc.bcm.edu	37	5	54771139	54771139	+	Silent	SNP	G	G	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr5:54771139G>A	ENST00000307259.8	-	2	618	c.198C>T	c.(196-198)ttC>ttT	p.F66F	PPAP2A_ENST00000515132.1_Intron|PPAP2A_ENST00000264775.5_Intron	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A	66					androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				CGATAATACTGAATGGAATGA	0.348																																					p.F66F		Atlas-SNP	.											.	PPAP2A	42	.	0			c.C198T						PASS	.						119.0	111.0	114.0					5																	54771139		2203	4300	6503	SO:0001819	synonymous_variant	8611	exon2			AATACTGAATGGA	AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.198C>T	chr5.hg19:g.54771139G>A		134.0	0.0	.		113.0	50.0	.	NM_003711	B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	Silent	SNP	ENST00000307259.8	hg19	CCDS34159.1																																																																																			.	.	.	none		0.348	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368073.1		
CMYA5	202333	hgsc.bcm.edu	37	5	79033639	79033639	+	Silent	SNP	A	A	G			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr5:79033639A>G	ENST00000446378.2	+	2	9082	c.9051A>G	c.(9049-9051)aaA>aaG	p.K3017K		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3017					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CCCCATTGAAAGAAAATAAAC	0.348																																					p.K3017K		Atlas-SNP	.											.	CMYA5	643	.	0			c.A9051G						PASS	.						44.0	43.0	44.0					5																	79033639		1804	4068	5872	SO:0001819	synonymous_variant	202333	exon2			ATTGAAAGAAAAT	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.9051A>G	chr5.hg19:g.79033639A>G		318.0	0.0	.		396.0	189.0	.	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	hg19	CCDS47238.1																																																																																			.	.	.	none		0.348	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
PCDHGC4	56098	hgsc.bcm.edu	37	5	140865299	140865299	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr5:140865299G>A	ENST00000306593.1	+	1	559	c.559G>A	c.(559-561)Gac>Aac	p.D187N	PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	187	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGCGCAGCGACGGCAGCCT	0.557																																					p.D187N		Atlas-SNP	.											.	PCDHGC4	91	.	0			c.G559A						PASS	.						39.0	43.0	42.0					5																	140865299		2203	4300	6503	SO:0001583	missense	56098	exon1			CGCAGCGACGGCA	AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.559G>A	chr5.hg19:g.140865299G>A	ENSP00000306918:p.Asp187Asn	67.0	0.0	.		76.0	44.0	.	NM_018928	Q495T2|Q9Y5C3	Missense_Mutation	SNP	ENST00000306593.1	hg19	CCDS4262.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325972	0.60743	.	.	ENSG00000242419	ENST00000306593	T	0.19938	2.11	5.0	5.0	0.66597	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.44603	0.1301	M	0.70275	2.135	0.30765	N	0.7436	D;D	0.89917	1.0;0.985	D;P	0.81914	0.995;0.804	T	0.42783	-0.9431	9	0.48119	T	0.1	.	12.8602	0.57910	0.0779:0.0:0.9221:0.0	.	187;187	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	N	187	ENSP00000306918:D187N	ENSP00000306918:D187N	D	+	1	0	PCDHGC4	140845483	0.986000	0.35501	1.000000	0.80357	0.998000	0.95712	3.383000	0.52471	2.596000	0.87737	0.561000	0.74099	GAC	.	.	.	none		0.557	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928	
JAKMIP2	9832	hgsc.bcm.edu	37	5	147028036	147028036	+	Splice_Site	SNP	T	T	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr5:147028036T>A	ENST00000265272.5	-	5	1306	c.839A>T	c.(838-840)gAt>gTt	p.D280V	JAKMIP2_ENST00000333010.6_Splice_Site_p.D238V|JAKMIP2_ENST00000507386.1_Splice_Site_p.D280V	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	280						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTCGCAAATCCTACAAAGA	0.323																																					p.D280V		Atlas-SNP	.											.	JAKMIP2	154	.	0			c.A839T						PASS	.						127.0	122.0	124.0					5																	147028036		2202	4294	6496	SO:0001630	splice_region_variant	9832	exon5			CGCAAATCCTACA	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.838-1A>T	chr5.hg19:g.147028036T>A		89.0	0.0	.		71.0	30.0	.	NM_001270941	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	hg19	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.352623	0.82132	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.34072	1.38;1.38;1.38	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.60792	0.2296	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.994;0.994;0.994;0.994	T	0.65730	-0.6097	10	0.87932	D	0	.	15.5322	0.75974	0.0:0.0:0.0:1.0	.	238;280;280;280	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	V	280;280;238;280	ENSP00000421398:D280V;ENSP00000265272:D280V;ENSP00000328989:D238V	ENSP00000265272:D280V	D	-	2	0	JAKMIP2	147008229	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.481000	0.66826	2.127000	0.65507	0.482000	0.46254	GAT	.	.	.	none		0.323	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	Missense_Mutation
PEX6	5190	hgsc.bcm.edu	37	6	42946507	42946507	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr6:42946507C>T	ENST00000304611.8	-	1	451	c.382G>A	c.(382-384)Gga>Aga	p.G128R	PEX6_ENST00000244546.4_Missense_Mutation_p.G128R	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	128					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			AGGGTCTCTCCGCGCCTCACC	0.761																																					p.G128R		Atlas-SNP	.											.	PEX6	44	.	0			c.G382A						PASS	.						2.0	3.0	3.0					6																	42946507		1580	3280	4860	SO:0001583	missense	5190	exon1			TCTCTCCGCGCCT	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.382G>A	chr6.hg19:g.42946507C>T	ENSP00000303511:p.Gly128Arg	16.0	0.0	.		25.0	14.0	.	NM_000287	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	ENST00000304611.8	hg19	CCDS4877.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372469	0.61624	.	.	ENSG00000124587	ENST00000304611;ENST00000244546	D;D	0.98090	-4.15;-4.71	4.89	4.89	0.63831	.	0.000000	0.44902	D	0.000405	D	0.96012	0.8701	N	0.19112	0.55	0.42599	D	0.993279	D	0.71674	0.998	P	0.58077	0.832	D	0.96930	0.9680	10	0.87932	D	0	-9.8384	15.434	0.75129	0.0:1.0:0.0:0.0	.	128	Q13608	PEX6_HUMAN	R	128	ENSP00000303511:G128R;ENSP00000244546:G128R	ENSP00000244546:G128R	G	-	1	0	PEX6	43054485	1.000000	0.71417	0.998000	0.56505	0.027000	0.11550	2.230000	0.42999	2.709000	0.92574	0.650000	0.86243	GGA	.	.	.	none		0.761	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
MICAL1	64780	hgsc.bcm.edu	37	6	109771667	109771667	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr6:109771667G>T	ENST00000358807.3	-	8	1338	c.1027C>A	c.(1027-1029)Cat>Aat	p.H343N	MICAL1_ENST00000358577.3_Intron|MICAL1_ENST00000368952.4_Missense_Mutation_p.H362N|MICAL1_ENST00000483856.1_5'Flank	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	343	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		AGCTTGCCATGGGTGGCAAAG	0.597																																					p.H343N		Atlas-SNP	.											.	MICAL1	79	.	0			c.C1027A						PASS	.						41.0	41.0	41.0					6																	109771667		2203	4300	6503	SO:0001583	missense	64780	exon8			TGCCATGGGTGGC	AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.1027C>A	chr6.hg19:g.109771667G>T	ENSP00000351664:p.His343Asn	130.0	0.0	.		114.0	5.0	.	NM_022765	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	ENST00000358807.3	hg19	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	G	0.321	-0.961904	0.02249	.	.	ENSG00000135596	ENST00000358807;ENST00000368952	T;T	0.11495	2.77;2.77	4.5	1.46	0.22682	.	0.762737	0.12285	N	0.482545	T	0.00815	0.0027	N	0.00793	-1.18	0.50813	D	0.999894	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.50276	-0.8847	10	0.02654	T	1	.	11.6301	0.51168	0.0:0.0:0.3423:0.6577	.	362;343	B7Z3R5;Q8TDZ2	.;MICA1_HUMAN	N	343;362	ENSP00000351664:H343N;ENSP00000357948:H362N	ENSP00000351664:H343N	H	-	1	0	MICAL1	109878360	1.000000	0.71417	0.292000	0.24919	0.914000	0.54420	1.139000	0.31504	0.159000	0.19401	0.563000	0.77884	CAT	.	.	.	none		0.597	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
ITGB8	3696	hgsc.bcm.edu	37	7	20403321	20403321	+	Silent	SNP	A	A	G			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr7:20403321A>G	ENST00000222573.4	+	2	873	c.189A>G	c.(187-189)ccA>ccG	p.P63P	ITGB8_ENST00000537992.1_5'UTR	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	63					cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						CGCTGGGTCCAGAATGTGGAT	0.398																																					p.P63P		Atlas-SNP	.											.	ITGB8	159	.	0			c.A189G						PASS	.						70.0	62.0	65.0					7																	20403321		2203	4299	6502	SO:0001819	synonymous_variant	3696	exon2			GGGTCCAGAATGT		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.189A>G	chr7.hg19:g.20403321A>G		64.0	0.0	.		136.0	36.0	.	NM_002214	A4D133|B4DHD4	Silent	SNP	ENST00000222573.4	hg19	CCDS5370.1																																																																																			.	.	.	none		0.398	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214	
KLHL7	55975	hgsc.bcm.edu	37	7	23145688	23145688	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr7:23145688G>A	ENST00000339077.5	+	1	286	c.43G>A	c.(43-45)Gag>Aag	p.E15K	KLHL7_ENST00000322275.5_Missense_Mutation_p.E15K|KLHL7_ENST00000539124.1_5'UTR|KLHL7_ENST00000410047.1_5'Flank|KLHL7_ENST00000479288.1_3'UTR|KLHL7_ENST00000542558.1_5'UTR|KLHL7_ENST00000409689.1_5'Flank|KLHL7_ENST00000545771.1_5'Flank|KLHL7_ENST00000322231.7_5'UTR|KLHL7-AS1_ENST00000419813.1_lincRNA	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	15					protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GAAGAAGACCGAGAAGAAACT	0.602																																					p.E15K		Atlas-SNP	.											.	KLHL7	102	.	0			c.G43A						PASS	.						60.0	49.0	53.0					7																	23145688		2202	4300	6502	SO:0001583	missense	55975	exon1			AAGACCGAGAAGA		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.43G>A	chr7.hg19:g.23145688G>A	ENSP00000343273:p.Glu15Lys	82.0	0.0	.		160.0	41.0	.	NM_001172428	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	hg19	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858661	0.71834	.	.	ENSG00000122550	ENST00000538858;ENST00000536369;ENST00000339077;ENST00000322275	T;T	0.73363	-0.52;-0.74	4.87	3.99	0.46301	.	0.059372	0.64402	D	0.000003	T	0.62073	0.2398	N	0.08118	0	0.80722	D	1	D;D	0.56521	0.976;0.964	P;P	0.50825	0.651;0.458	T	0.61332	-0.7084	10	0.23302	T	0.38	.	13.4923	0.61402	0.0757:0.0:0.9243:0.0	.	15;15	Q8IXQ5;Q8IXQ5-3	KLHL7_HUMAN;.	K	15	ENSP00000343273:E15K;ENSP00000323270:E15K	ENSP00000323270:E15K	E	+	1	0	KLHL7	23112213	1.000000	0.71417	0.956000	0.39512	0.600000	0.36913	5.114000	0.64648	1.409000	0.46915	0.591000	0.81541	GAG	.	.	.	none		0.602	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
GRM3	2913	hgsc.bcm.edu	37	7	86469144	86469144	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr7:86469144G>A	ENST00000361669.2	+	4	3413	c.2314G>A	c.(2314-2316)Ggt>Agt	p.G772S	GRM3_ENST00000394720.2_Intron|GRM3_ENST00000546348.1_Missense_Mutation_p.G364S|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000536043.1_Missense_Mutation_p.G644S	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	772					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TAAGTTCATAGGTTTTACCAT	0.418																																					p.G772S	GBM(52;969 1098 3139 52280)	Atlas-SNP	.											.	GRM3	237	.	0			c.G2314A						PASS	.						124.0	113.0	117.0					7																	86469144		2203	4300	6503	SO:0001583	missense	2913	exon4			TTCATAGGTTTTA		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2314G>A	chr7.hg19:g.86469144G>A	ENSP00000355316:p.Gly772Ser	74.0	0.0	.		183.0	35.0	.	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	hg19	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573564	0.86542	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.89050	-2.46;-2.46;-2.46	5.54	5.54	0.83059	GPCR, family 3, conserved site (1);GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.94512	0.8233	M	0.78916	2.43	0.80722	D	1	D;D;D	0.76494	0.999;0.994;0.995	D;D;D	0.75484	0.986;0.965;0.979	D	0.94683	0.7867	10	0.66056	D	0.02	.	18.4662	0.90755	0.0:0.0:1.0:0.0	.	364;644;772	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	S	772;364;644	ENSP00000355316:G772S;ENSP00000444064:G364S;ENSP00000441407:G644S	ENSP00000355316:G772S	G	+	1	0	GRM3	86307080	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.603000	0.88011	0.563000	0.77884	GGT	.	.	.	none		0.418	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
MUC17	140453	hgsc.bcm.edu	37	7	100681533	100681533	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr7:100681533C>A	ENST00000306151.4	+	3	6900	c.6836C>A	c.(6835-6837)aCt>aAt	p.T2279N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2279	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGGAACGACTCCATTAACA	0.478																																					p.T2279N		Atlas-SNP	.											.	MUC17	804	.	0			c.C6836A						PASS	.																																			SO:0001583	missense	140453	exon3			GAACGACTCCATT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6836C>A	chr7.hg19:g.100681533C>A	ENSP00000302716:p.Thr2279Asn	94.0	0.0	.		217.0	10.0	.	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	2.491	-0.317530	0.05386	.	.	ENSG00000169876	ENST00000306151	T	0.02472	4.28	0.762	0.762	0.18454	.	.	.	.	.	T	0.03390	0.0098	N	0.19112	0.55	0.09310	N	1	P	0.51933	0.949	P	0.51297	0.665	T	0.49679	-0.8914	9	0.35671	T	0.21	.	6.9517	0.24548	0.0:0.9999:0.0:1.0E-4	.	2279	Q685J3	MUC17_HUMAN	N	2279	ENSP00000302716:T2279N	ENSP00000302716:T2279N	T	+	2	0	MUC17	100468253	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.068000	0.14531	0.132000	0.18615	0.134000	0.15878	ACT	.	.	.	none		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
CUL1	8454	hgsc.bcm.edu	37	7	148484199	148484199	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr7:148484199T>G	ENST00000325222.4	+	13	1745	c.1466T>G	c.(1465-1467)aTc>aGc	p.I489S	CUL1_ENST00000409469.1_Missense_Mutation_p.I489S|CUL1_ENST00000602748.1_Missense_Mutation_p.I489S	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	489					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GCCAGCATGATCTCCAAGTTA	0.468																																					p.I489S		Atlas-SNP	.											.	CUL1	80	.	0			c.T1466G						PASS	.						75.0	70.0	72.0					7																	148484199		2203	4300	6503	SO:0001583	missense	8454	exon13			GCATGATCTCCAA	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1466T>G	chr7.hg19:g.148484199T>G	ENSP00000326804:p.Ile489Ser	58.0	0.0	.		155.0	53.0	.	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	hg19	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.349001	0.82132	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	T;T	0.79749	-1.3;-1.3	5.5	5.5	0.81552	Cullin, N-terminal (1);Cullin homology (3);	0.046639	0.85682	D	0.000000	D	0.92883	0.7736	H	0.96430	3.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.988;0.99	D	0.95044	0.8181	10	0.87932	D	0	0.0152	15.6219	0.76813	0.0:0.0:0.0:1.0	.	416;489	E7EWR0;Q13616	.;CUL1_HUMAN	S	489;489;447;416	ENSP00000387160:I489S;ENSP00000326804:I489S	ENSP00000326804:I489S	I	+	2	0	CUL1	148115132	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	7.746000	0.85057	2.098000	0.63641	0.533000	0.62120	ATC	.	.	.	none		0.468	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
OPLAH	26873	hgsc.bcm.edu	37	8	145112996	145112996	+	Silent	SNP	G	G	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr8:145112996G>A	ENST00000426825.1	-	8	1086	c.1005C>T	c.(1003-1005)gcC>gcT	p.A335A	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	335					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGCTGTGCTGGCCTCGAAGA	0.657																																					p.A335A		Atlas-SNP	.											.	OPLAH	78	.	0			c.C1005T						PASS	.						43.0	51.0	48.0					8																	145112996		2054	4182	6236	SO:0001819	synonymous_variant	26873	exon8			TGTGCTGGCCTCG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.1005C>T	chr8.hg19:g.145112996G>A		156.0	0.0	.		169.0	80.0	.	NM_017570	A5PKY8|Q75W65|Q9Y4Q0	Silent	SNP	ENST00000426825.1	hg19																																																																																				.	.	.	none		0.657	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
PTPRD	5789	hgsc.bcm.edu	37	9	8486309	8486309	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr9:8486309C>T	ENST00000381196.4	-	25	3051	c.2508G>A	c.(2506-2508)atG>atA	p.M836I	PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000540109.1_Missense_Mutation_p.M836I|PTPRD_ENST00000356435.5_Missense_Mutation_p.M836I|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Missense_Mutation_p.M823I|PTPRD_ENST00000358503.5_Missense_Mutation_p.M814I|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000471274.1_5'UTR	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	836	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.M836I(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GAGCAGTATTCATCTGAGTGT	0.483										TSP Lung(15;0.13)																											p.M836I		Atlas-SNP	.											PTPRD,leg,malignant_melanoma,0,1	PTPRD	1348	.	1	Substitution - Missense(1)	skin(1)	c.G2508A						PASS	.						73.0	71.0	72.0					9																	8486309		2203	4300	6503	SO:0001583	missense	5789	exon28			AGTATTCATCTGA	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2508G>A	chr9.hg19:g.8486309C>T	ENSP00000370593:p.Met836Ile	98.0	1.0	.		75.0	36.0	.	NM_002839	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	hg19	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059631	0.55325	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	5.93	5.93	0.95920	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.49218	0.1544	L	0.36672	1.1	0.80722	D	1	B;P;B	0.37573	0.397;0.6;0.137	B;B;B	0.39299	0.138;0.296;0.216	T	0.32508	-0.9904	9	.	.	.	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	823;836;836	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	I	836;836;823;814;836	ENSP00000370593:M836I;ENSP00000348812:M836I;ENSP00000353187:M823I;ENSP00000351293:M814I;ENSP00000438164:M836I	.	M	-	3	0	PTPRD	8476309	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.826000	0.97356	0.655000	0.94253	ATG	.	.	.	none		0.483	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
CACNA1B	774	hgsc.bcm.edu	37	9	140904505	140904505	+	Silent	SNP	G	G	C			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr9:140904505G>C	ENST00000371372.1	+	17	2281	c.2136G>C	c.(2134-2136)ctG>ctC	p.L712L	CACNA1B_ENST00000277551.2_Silent_p.L712L|CACNA1B_ENST00000371363.1_Silent_p.L712L|CACNA1B_ENST00000277550.3_Silent_p.L3L|CACNA1B_ENST00000371355.4_Silent_p.L713L|CACNA1B_ENST00000371357.1_Silent_p.L713L|CACNA1B_ENST00000277549.5_5'UTR	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	712					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGACAACCTGGCCAACGCCC	0.607																																					p.L712L		Atlas-SNP	.											.	CACNA1B	266	.	0			c.G2136C						PASS	.						71.0	75.0	74.0					9																	140904505		2160	4269	6429	SO:0001819	synonymous_variant	774	exon17			CAACCTGGCCAAC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.2136G>C	chr9.hg19:g.140904505G>C		108.0	0.0	.		100.0	43.0	.	NM_001243812	B1AQK5	Silent	SNP	ENST00000371372.1	hg19	CCDS59522.1																																																																																			.	.	.	none		0.607	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CACNA1B	774	hgsc.bcm.edu	37	9	140918184	140918185	+	Missense_Mutation	DNP	AC	AC	GT	rs145816559|rs370787788	byFrequency	TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr9:140918184_140918185AC>GT	ENST00000371372.1	+	19	3134_3135	c.2989_2990AC>GT	c.(2989-2991)ACg>GTg	p.T997V	CACNA1B_ENST00000277551.2_Missense_Mutation_p.T997V|CACNA1B_ENST00000371367.5_5'UTR|CACNA1B_ENST00000545473.1_5'Flank|CACNA1B_ENST00000371363.1_Missense_Mutation_p.T997V|CACNA1B_ENST00000371355.4_Missense_Mutation_p.T998V|CACNA1B_ENST00000371357.1_Missense_Mutation_p.T998V|CACNA1B_ENST00000277549.5_Missense_Mutation_p.T189V	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	997					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.T996_E1000delTTEKE(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GAAGGAGACCACGGAGAAGGAG	0.718																																					p.T997A|p.T997M		Atlas-SNP	.											.	CACNA1B	266	.	1	Deletion - In frame(1)	breast(1)	c.A2989G|c.C2990T						PASS	.																																			SO:0001583	missense	774	exon19			GAGACCACGGAGA|AGACCACGGAGAA	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	Exception_encountered	chr9.hg19:g.140918184_140918185delinsGT	ENSP00000360423:p.Thr997Val	0.0	0.0	.		191.0|189.0	24.0|30.0	.	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1																																																																																			.	.	.	none		0.718	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CUBN	8029	hgsc.bcm.edu	37	10	16967343	16967343	+	Silent	SNP	T	T	C			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr10:16967343T>C	ENST00000377833.4	-	43	6608	c.6543A>G	c.(6541-6543)tcA>tcG	p.S2181S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2181	CUB 15. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACAGAGTTGATGAAGCATGAC	0.388																																					p.S2181S		Atlas-SNP	.											.	CUBN	515	.	0			c.A6543G						PASS	.						69.0	69.0	69.0					10																	16967343		2203	4300	6503	SO:0001819	synonymous_variant	8029	exon43			AGTTGATGAAGCA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6543A>G	chr10.hg19:g.16967343T>C		319.0	1.0	.		350.0	165.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	hg19	CCDS7113.1																																																																																			.	.	.	none		0.388	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
LZTS2	84445	hgsc.bcm.edu	37	10	102770293	102770293	+	IGR	SNP	T	T	G	rs200896335|rs71013480	byFrequency	TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr10:102770293T>G	ENST00000370220.1	+	0	5741									leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		TGACCCCGgctgctgcggctg	0.697																																					p.S785R	Esophageal Squamous(8;38 437 13604 19902 37640)	Atlas-SNP	.											.	PDZD7	101	.	0			c.A2353C						PASS	.																																			SO:0001628	intergenic_variant	79955	exon15			CCCGGCTGCTGCG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914		chr10.hg19:g.102770293T>G		365.0	0.0	.		386.0	21.0	.	NM_001195263		Missense_Mutation	SNP	ENST00000370220.1	hg19	CCDS7507.1	.	.	.	.	.	.	.	.	.	.	T	2.648	-0.282573	0.05642	.	.	ENSG00000186862	ENST00000393462	.	.	.	3.99	2.83	0.33086	.	.	.	.	.	T	0.29716	0.0742	N	0.24115	0.695	0.28374	N	0.919888	.	.	.	.	.	.	T	0.21793	-1.0235	6	0.20046	T	0.44	.	9.5348	0.39216	0.0:0.0:0.1777:0.8222	.	.	.	.	R	785	.	ENSP00000377106:S785R	S	-	1	0	PDZD7	102760283	0.123000	0.22298	0.736000	0.30914	0.083000	0.17756	0.220000	0.17660	0.649000	0.30751	-0.680000	0.03767	AGC	.	.	.	none		0.697	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
ADD3	120	hgsc.bcm.edu	37	10	111884029	111884029	+	Silent	SNP	C	C	T			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr10:111884029C>T	ENST00000356080.4	+	10	1765	c.1398C>T	c.(1396-1398)atC>atT	p.I466I	ADD3_ENST00000277900.8_Silent_p.I466I|ADD3_ENST00000360162.3_Silent_p.I466I	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	466						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GAACCAAAATCACGGTATGCC	0.363																																					p.I466I		Atlas-SNP	.											.	ADD3	89	.	0			c.C1398T						PASS	.						81.0	80.0	80.0					10																	111884029		2203	4300	6503	SO:0001819	synonymous_variant	120	exon10			CAAAATCACGGTA	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.1398C>T	chr10.hg19:g.111884029C>T		155.0	0.0	.		193.0	96.0	.	NM_001121	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Silent	SNP	ENST00000356080.4	hg19	CCDS7561.1																																																																																			.	.	.	none		0.363	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	
SAA4	6291	hgsc.bcm.edu	37	11	18254055	18254055	+	Silent	SNP	A	A	G			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr11:18254055A>G	ENST00000278222.4	-	3	297	c.117T>C	c.(115-117)taT>taC	p.Y39Y	SAA2-SAA4_ENST00000524555.1_RNA	NM_006512.3	NP_006503.2	P35542	SAA4_HUMAN	serum amyloid A4, constitutive	39					acute-phase response (GO:0006953)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(1)|stomach(1)	13						TTATGTCCCAATAGGCTCTGC	0.438																																					p.Y117Y		Atlas-SNP	.											.	.	.	.	0			c.T351C						PASS	.						143.0	142.0	142.0					11																	18254055		2199	4293	6492	SO:0001819	synonymous_variant	100528017	exon5			GTCCCAATAGGCT	M81349	CCDS7832.1	11p15.1-p14	2008-07-21			ENSG00000148965	ENSG00000148965			10516	protein-coding gene	gene with protein product		104752				8325654	Standard	NM_006512		Approved	C-SAA, CSAA		P35542	OTTHUMG00000166483	ENST00000278222.4:c.117T>C	chr11.hg19:g.18254055A>G		101.0	0.0	.		108.0	48.0	.	NM_001199744	Q6FHJ4	Silent	SNP	ENST00000278222.4	hg19	CCDS7832.1																																																																																			.	.	.	none		0.438	SAA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389988.1	NM_006512	
BRCA2	675	hgsc.bcm.edu	37	13	32910939	32910939	+	Missense_Mutation	SNP	A	A	G	rs80359331		TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr13:32910939A>G	ENST00000380152.3	+	11	2680	c.2447A>G	c.(2446-2448)gAa>gGa	p.E816G	BRCA2_ENST00000544455.1_Missense_Mutation_p.E816G			P51587	BRCA2_HUMAN	breast cancer 2, early onset	816	Interaction with NPM1.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ATTCCCATGGAAAAGAATCAA	0.328			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.E816G	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812	.	0			c.A2447G						PASS	.						52.0	56.0	55.0					13																	32910939		2203	4296	6499	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	CCATGGAAAAGAA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.2447A>G	chr13.hg19:g.32910939A>G	ENSP00000369497:p.Glu816Gly	271.0	0.0	.		306.0	146.0	.	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	hg19	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	A	5.922	0.354207	0.11182	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.72051	-0.62;-0.62	5.43	1.47	0.22746	.	1.104510	0.06758	N	0.781238	T	0.55689	0.1936	L	0.29908	0.895	0.09310	N	1	B	0.22276	0.067	B	0.17433	0.018	T	0.36114	-0.9761	10	0.27785	T	0.31	.	5.4273	0.16433	0.5898:0.1389:0.2713:0.0	.	816	P51587	BRCA2_HUMAN	G	816	ENSP00000369497:E816G;ENSP00000439902:E816G	ENSP00000369497:E816G	E	+	2	0	BRCA2	31808939	0.000000	0.05858	0.003000	0.11579	0.089000	0.18198	0.028000	0.13644	0.020000	0.15106	0.482000	0.46254	GAA	.	.	.	none		0.328	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
HOMEZ	57594	hgsc.bcm.edu	37	14	23744832	23744832	+	Silent	SNP	C	C	T			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr14:23744832C>T	ENST00000357460.5	-	2	1769	c.1605G>A	c.(1603-1605)gaG>gaA	p.E535E	HOMEZ_ENST00000431326.2_Silent_p.E537E|HOMEZ_ENST00000561013.1_Silent_p.E537E	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	535	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		catcttcctcctcctcctcct	0.483																																					p.E535E		Atlas-SNP	.											.	HOMEZ	80	.	0			c.G1605A						PASS	.						38.0	38.0	38.0					14																	23744832		2192	4269	6461	SO:0001819	synonymous_variant	57594	exon2			TTCCTCCTCCTCC	AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.1605G>A	chr14.hg19:g.23744832C>T		29.0	0.0	.		68.0	9.0	.	NM_020834	A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Silent	SNP	ENST00000357460.5	hg19	CCDS45085.1																																																																																			.	.	.	none		0.483	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000416939.2	NM_020834	
MFAP1	4236	hgsc.bcm.edu	37	15	44106734	44106734	+	Silent	SNP	C	C	T			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr15:44106734C>T	ENST00000267812.3	-	4	814	c.582G>A	c.(580-582)gaG>gaA	p.E194E		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	194					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		GAGGCTCCATCTCATCTTCAC	0.453																																					p.E194E		Atlas-SNP	.											.	MFAP1	36	.	0			c.G582A						PASS	.						229.0	214.0	219.0					15																	44106734		2198	4298	6496	SO:0001819	synonymous_variant	4236	exon4			CTCCATCTCATCT		CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.582G>A	chr15.hg19:g.44106734C>T		80.0	0.0	.		81.0	33.0	.	NM_005926	Q86TG6	Silent	SNP	ENST00000267812.3	hg19	CCDS10105.1																																																																																			.	.	.	none		0.453	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133491.2	NM_005926	
LCTL	197021	hgsc.bcm.edu	37	15	66856303	66856303	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr15:66856303T>A	ENST00000341509.5	-	3	447	c.316A>T	c.(316-318)Aac>Tac	p.N106Y	LCTL_ENST00000537670.1_5'UTR|LCTL_ENST00000563438.1_5'UTR	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	106					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CGGTAGTGGTTGACGTGCAGT	0.632																																					p.N106Y		Atlas-SNP	.											.	LCTL	73	.	0			c.A316T						PASS	.						146.0	126.0	133.0					15																	66856303		2201	4299	6500	SO:0001583	missense	197021	exon3			AGTGGTTGACGTG	AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.316A>T	chr15.hg19:g.66856303T>A	ENSP00000343490:p.Asn106Tyr	89.0	0.0	.		78.0	40.0	.	NM_207338	B3KQY0	Missense_Mutation	SNP	ENST00000341509.5	hg19	CCDS10220.1	.	.	.	.	.	.	.	.	.	.	T	15.20	2.762455	0.49574	.	.	ENSG00000188501	ENST00000341509	T	0.34472	1.36	5.21	4.06	0.47325	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.375249	0.35207	N	0.003378	T	0.40956	0.1138	M	0.83692	2.655	0.80722	D	1	B	0.33826	0.427	B	0.33799	0.17	T	0.40534	-0.9558	10	0.87932	D	0	-12.579	8.7922	0.34857	0.3018:0.0:0.0:0.6982	.	106	Q6UWM7	LCTL_HUMAN	Y	106	ENSP00000343490:N106Y	ENSP00000343490:N106Y	N	-	1	0	LCTL	64643357	0.884000	0.30299	0.353000	0.25747	0.919000	0.55068	3.436000	0.52856	0.900000	0.36469	0.379000	0.24179	AAC	.	.	.	none		0.632	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338	
CDH13	1012	hgsc.bcm.edu	37	16	83378492	83378492	+	Missense_Mutation	SNP	A	A	G	rs374048975		TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr16:83378492A>G	ENST00000566620.1	+	6	952	c.662A>G	c.(661-663)aAt>aGt	p.N221S	CDH13_ENST00000428848.3_Missense_Mutation_p.N182S|CDH13_ENST00000268613.10_Missense_Mutation_p.N268S|CDH13_ENST00000569454.1_3'UTR	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	221	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		ACTGATGTCAATGGCAAAACT	0.448																																					p.N268S		Atlas-SNP	.											.	CDH13	97	.	0			c.A803G						PASS	.						79.0	81.0	81.0					16																	83378492		1855	4088	5943	SO:0001583	missense	1012	exon7			ATGTCAATGGCAA	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.662A>G	chr16.hg19:g.83378492A>G	ENSP00000454435:p.Asn221Ser	71.0	0.0	.		81.0	33.0	.	NM_001220488	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	hg19	CCDS58486.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.115445	0.37339	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143	T	0.60548	0.18	5.76	0.716	0.18191	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35508	0.0934	N	0.05510	-0.035	0.58432	D	0.999997	B;B;B	0.23185	0.081;0.0;0.001	B;B;B	0.30251	0.113;0.008;0.004	T	0.08554	-1.0716	9	0.41790	T	0.15	.	8.7915	0.34854	0.483:0.0:0.517:0.0	.	182;268;221	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	S	268;221;182	ENSP00000268613:N268S	ENSP00000268613:N268S	N	+	2	0	CDH13	81935993	0.228000	0.23718	0.573000	0.28510	0.906000	0.53458	0.515000	0.22801	0.193000	0.20303	0.533000	0.62120	AAT	.	.	.	weak		0.448	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257	
ACSF3	197322	hgsc.bcm.edu	37	16	89167635	89167635	+	Silent	SNP	G	G	T			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr16:89167635G>T	ENST00000317447.4	+	3	923	c.546G>T	c.(544-546)ccG>ccT	p.P182P	ACSF3_ENST00000378345.4_Intron|ACSF3_ENST00000406948.3_Silent_p.P182P	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	182					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		TAGAGGAACCGGCAGAGGTCC	0.657																																					p.P182P		Atlas-SNP	.											.	ACSF3	40	.	0			c.G546T						PASS	.						16.0	13.0	14.0					16																	89167635		2196	4299	6495	SO:0001819	synonymous_variant	197322	exon3			GGAACCGGCAGAG	AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.546G>T	chr16.hg19:g.89167635G>T		102.0	0.0	.		76.0	40.0	.	NM_174917	A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Silent	SNP	ENST00000317447.4	hg19	CCDS10974.1																																																																																			.	.	.	none		0.657	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1	NM_174917	
MPRIP	23164	hgsc.bcm.edu	37	17	17039564	17039564	+	Missense_Mutation	SNP	G	G	C	rs3833098|rs113250356|rs35599326|rs202138172	byFrequency	TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr17:17039564G>C	ENST00000341712.4	+	6	536	c.536G>C	c.(535-537)aGc>aCc	p.S179T	MPRIP_ENST00000395804.3_Missense_Mutation_p.S179T|MPRIP_ENST00000395811.5_Missense_Mutation_p.S179T|MPRIP_ENST00000444976.1_Missense_Mutation_p.S179T			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	179	Interaction with F-actin. {ECO:0000250}.|Ser-rich.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.S189delS(1)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						GCTGTTACcagcagcagcagc	0.597																																					p.S179T		Atlas-SNP	.											.	MPRIP	87	.	1	Deletion - In frame(1)	kidney(1)	c.G536C						PASS	.						22.0	22.0	22.0					17																	17039564		2203	4295	6498	SO:0001583	missense	23164	exon6			TTACCAGCAGCAG	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.536G>C	chr17.hg19:g.17039564G>C	ENSP00000342379:p.Ser179Thr	64.0	0.0	.		102.0	9.0	.	NM_015134	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	ENST00000341712.4	hg19	CCDS32578.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519798	0.27211	.	.	ENSG00000133030	ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712	D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34	2.12	2.12	0.27331	.	.	.	.	.	D	0.90566	0.7043	L	0.34521	1.04	0.29751	N	0.836355	P;P	0.51933	0.949;0.61	P;B	0.50659	0.647;0.135	D	0.85374	0.1115	9	0.52906	T	0.07	.	7.7647	0.28972	0.0:0.0:1.0:0.0	.	179;179	Q6WCQ1-2;Q6WCQ1	.;MPRIP_HUMAN	T	179	ENSP00000400189:S179T;ENSP00000379156:S179T;ENSP00000379149:S179T;ENSP00000342379:S179T	ENSP00000342379:S179T	S	+	2	0	MPRIP	16980289	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.655000	0.46707	1.509000	0.48786	0.591000	0.81541	AGC	.	.	.	none		0.597	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
ATP5G1	516	hgsc.bcm.edu	37	17	46973049	46973049	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr17:46973049A>C	ENST00000393366.2	+	5	432	c.329A>C	c.(328-330)tAt>tCt	p.Y110S	RP11-463M16.4_ENST00000508743.1_RNA|ATP5G1_ENST00000355938.5_Missense_Mutation_p.Y110S|ATP5G1_ENST00000503641.1_Missense_Mutation_p.Y101S|ATP5G1_ENST00000506855.1_Missense_Mutation_p.Y84S|ATP5G1_ENST00000513781.1_3'UTR	NM_005175.2	NP_005166.1	P05496	AT5G1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)	110					ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|lipid binding (GO:0008289)|transporter activity (GO:0005215)			liver(1)|lung(1)	2						CTCTTCTCCTATGCCATTCTT	0.582																																					p.Y110S		Atlas-SNP	.											.	ATP5G1	7	.	0			c.A329C						PASS	.						205.0	184.0	191.0					17																	46973049		2203	4300	6503	SO:0001583	missense	516	exon5			TCTCCTATGCCAT	D13118	CCDS11539.1	17q21.32	2012-10-12	2010-06-11		ENSG00000159199	ENSG00000159199		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	841	protein-coding gene	gene with protein product		603192	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9)"""	ATP5G		8328972	Standard	NM_005175		Approved		uc002ioh.3	P05496	OTTHUMG00000160520	ENST00000393366.2:c.329A>C	chr17.hg19:g.46973049A>C	ENSP00000377033:p.Tyr110Ser	37.0	0.0	.		76.0	22.0	.	NM_005175		Missense_Mutation	SNP	ENST00000393366.2	hg19	CCDS11539.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.469812	0.84533	.	.	ENSG00000159199	ENST00000355938;ENST00000503641;ENST00000393366;ENST00000506855	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	4.64	4.64	0.57946	ATPase, F0/V0 complex, subunit C (3);	0.000000	0.85682	D	0.000000	T	0.47040	0.1424	L	0.61036	1.89	0.80722	D	1	B	0.29136	0.234	B	0.37047	0.24	T	0.53251	-0.8465	10	0.87932	D	0	-6.5187	13.8811	0.63682	1.0:0.0:0.0:0.0	.	110	P05496	AT5G1_HUMAN	S	110;101;110;84	ENSP00000348205:Y110S;ENSP00000426094:Y101S;ENSP00000377033:Y110S;ENSP00000422950:Y84S	ENSP00000348205:Y110S	Y	+	2	0	ATP5G1	44328048	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.139000	0.94554	1.951000	0.56629	0.454000	0.30748	TAT	.	.	.	none		0.582	ATP5G1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360948.2	NM_005175	
CLTC	1213	hgsc.bcm.edu	37	17	57742269	57742269	+	Splice_Site	SNP	A	A	G			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr17:57742269A>G	ENST00000269122.3	+	10	1917	c.1643A>G	c.(1642-1644)cAg>cGg	p.Q548R	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Splice_Site_p.Q548R	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	548	Distal segment.|Heavy chain arm.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GACATCACACAGGTAATGTGA	0.433			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.Q548R		Atlas-SNP	.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	124	.	0			c.A1643G						PASS	.						88.0	84.0	85.0					17																	57742269		2203	4300	6503	SO:0001630	splice_region_variant	1213	exon10			TCACACAGGTAAT	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.1644+1A>G	chr17.hg19:g.57742269A>G		66.0	0.0	.		98.0	26.0	.	NM_004859	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	hg19	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.265813	0.59540	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.17528	2.27;2.27	5.45	5.45	0.79879	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.31857	0.0810	L	0.42686	1.345	0.80722	D	1	P;B	0.49185	0.92;0.0	D;B	0.71870	0.975;0.01	T	0.02933	-1.1092	10	0.13108	T	0.6	.	15.8028	0.78468	1.0:0.0:0.0:0.0	.	548;548	Q00610;Q00610-2	CLH1_HUMAN;.	R	548	ENSP00000269122:Q548R;ENSP00000376763:Q548R	ENSP00000269122:Q548R	Q	+	2	0	CLTC	55097051	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.287000	0.95975	2.196000	0.70406	0.460000	0.39030	CAG	.	.	.	none		0.433	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	Missense_Mutation
USP36	57602	hgsc.bcm.edu	37	17	76803450	76803450	+	Missense_Mutation	SNP	G	G	A	rs532327037		TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr17:76803450G>A	ENST00000542802.3	-	14	2119	c.1676C>T	c.(1675-1677)tCg>tTg	p.S559L	USP36_ENST00000312010.6_Missense_Mutation_p.S559L|USP36_ENST00000449938.2_Missense_Mutation_p.S259L|USP36_ENST00000588467.1_5'Flank			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	559					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GCTGCTATTCGAGTTGCTGGT	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		17767	0.001		0.0	False		,,,				2504	0.0				p.S559L		Atlas-SNP	.											.	USP36	243	.	0			c.C1676T						PASS	.						51.0	52.0	52.0					17																	76803450		2203	4300	6503	SO:0001583	missense	57602	exon14			CTATTCGAGTTGC	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.1676C>T	chr17.hg19:g.76803450G>A	ENSP00000441214:p.Ser559Leu	99.0	0.0	.		186.0	54.0	.	NM_025090	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	ENST00000542802.3	hg19	CCDS32755.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466850	0.26335	.	.	ENSG00000055483	ENST00000312010;ENST00000449938;ENST00000542802	T;T;T	0.18810	3.24;2.19;3.24	4.16	-6.85	0.01681	.	2.812930	0.01095	N	0.005268	T	0.12433	0.0302	N	0.25647	0.755	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.04013	0.001;0.001	T	0.15983	-1.0418	10	0.22706	T	0.39	4.049	6.0048	0.19541	0.4716:0.2424:0.2859:0.0	.	559;559	Q9P275;Q9P275-2	UBP36_HUMAN;.	L	559;259;559	ENSP00000310590:S559L;ENSP00000401119:S259L;ENSP00000441214:S559L	ENSP00000310590:S559L	S	-	2	0	USP36	74315045	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.389000	0.02530	-1.303000	0.02332	-0.258000	0.10820	TCG	.	.	.	none		0.582	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090	
ZNF180	7733	hgsc.bcm.edu	37	19	44988631	44988631	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr19:44988631G>C	ENST00000221327.4	-	3	429	c.148C>G	c.(148-150)Caa>Gaa	p.Q50E	ZNF180_ENST00000586637.1_Nonsense_Mutation_p.S59*|ZNF180_ENST00000592529.1_Missense_Mutation_p.Q23E|ZNF180_ENST00000587047.1_Silent_p.L51L|ZNF180_ENST00000585514.1_5'UTR|ZNF180_ENST00000391956.4_Intron	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q50E(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				ATAATCTCTTGAGGAAGGAAA	0.463																																					p.Q50E	Esophageal Squamous(180;1353 2003 32862 46574 49854)	Atlas-SNP	.											ZNF180,NS,carcinoma,0,1	ZNF180	103	.	1	Substitution - Missense(1)	endometrium(1)	c.C148G						PASS	.						81.0	75.0	77.0					19																	44988631		2203	4300	6503	SO:0001583	missense	7733	exon3			TCTCTTGAGGAAG	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.148C>G	chr19.hg19:g.44988631G>C	ENSP00000221327:p.Gln50Glu	75.0	0.0	.		68.0	27.0	.	NM_013256	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	hg19	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.787995	0.31593	.	.	ENSG00000167384	ENST00000221327	T	0.07567	3.18	3.62	2.56	0.30785	.	0.229752	0.22273	N	0.062227	T	0.04998	0.0134	N	0.19112	0.55	0.80722	D	1	B;B	0.15930	0.015;0.015	B;B	0.11329	0.006;0.006	T	0.36890	-0.9729	10	0.15066	T	0.55	-9.8046	9.1823	0.37149	0.0:0.2219:0.7781:0.0	.	49;50	Q58F03;Q9UJW8	.;ZN180_HUMAN	E	50	ENSP00000221327:Q50E	ENSP00000221327:Q50E	Q	-	1	0	ZNF180	49680471	1.000000	0.71417	0.933000	0.37362	0.963000	0.63663	3.520000	0.53465	1.084000	0.41184	0.650000	0.86243	CAA	.	.	.	none		0.463	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
UQCR10	29796	hgsc.bcm.edu	37	22	30163499	30163499	+	Nonsense_Mutation	SNP	C	C	T	rs377432442		TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr22:30163499C>T	ENST00000330029.6	+	1	142	c.112C>T	c.(112-114)Caa>Taa	p.Q38*	UQCR10_ENST00000401406.3_Nonsense_Mutation_p.Q38*|ZMAT5_ENST00000344318.3_5'Flank|ZMAT5_ENST00000397781.3_5'Flank	NM_001003684.1|NM_013387.3	NP_001003684.1|NP_037519.2	Q9UDW1	QCR9_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit X	38					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)	ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)	5						CGCCTTCGATCAAGGCGCGGA	0.602																																					p.Q38X		Atlas-SNP	.											UQCR10,NS,carcinoma,0,1	UQCR10	10	.	0			c.C112T						PASS	.						41.0	47.0	45.0					22																	30163499		2010	4167	6177	SO:0001587	stop_gained	29796	exon1			TTCGATCAAGGCG	AB028598	CCDS46680.1, CCDS46681.1	22q12.2	2011-07-04			ENSG00000184076	ENSG00000184076		"""Mitochondrial respiratory chain complex / Complex III"""	30863	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit X, 7.2kDa"", ""complex III subunit 9"""	610843				11042152	Standard	NM_013387		Approved	HSPC051, UCRC, QCR9, UCCR7.2	uc003agq.1	Q9UDW1	OTTHUMG00000151283	ENST00000330029.6:c.112C>T	chr22.hg19:g.30163499C>T	ENSP00000332887:p.Gln38*	63.0	0.0	.		75.0	35.0	.	NM_001003684	B5MCM5|Q9T2V6	Nonsense_Mutation	SNP	ENST00000330029.6	hg19	CCDS46680.1	.	.	.	.	.	.	.	.	.	.	C	36	5.758193	0.96898	.	.	ENSG00000184076	ENST00000330029;ENST00000401406;ENST00000406782	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	1.1857	15.4576	0.75327	0.0:1.0:0.0:0.0	.	.	.	.	X	38	.	ENSP00000332887:Q38X	Q	+	1	0	UQCR10	28493499	1.000000	0.71417	0.991000	0.47740	0.874000	0.50279	6.063000	0.71162	2.720000	0.93068	0.558000	0.71614	CAA	.	.	.	alt		0.602	UQCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322081.1	NM_013387	
PLCXD1	55344	hgsc.bcm.edu	37	X	205414	205414	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chrX:205414A>C	ENST00000381657.2	+	3	656	c.142A>C	c.(142-144)Atg>Ctg	p.M48L	PLCXD1_ENST00000399012.1_Missense_Mutation_p.M48L|PLCXD1_ENST00000484611.2_3'UTR|PLCXD1_ENST00000381663.3_Missense_Mutation_p.M48L	NM_018390.3	NP_060860.1	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 1	48	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid metabolic process (GO:0006629)		phosphoric diester hydrolase activity (GO:0008081)			endometrium(3)|large_intestine(1)|lung(7)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCACGACACGATGACGTACTG	0.627																																					p.M48L		Atlas-SNP	.											.	PLCXD1	18	.	0			c.A142C						PASS	.						348.0	270.0	296.0					X																	205414		2203	4296	6499	SO:0001583	missense	55344	exon3			GACACGATGACGT	AK002185	CCDS14103.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000182378	ENSG00000182378		"""Pseudoautosomal regions / PAR1"""	23148	protein-coding gene	gene with protein product							Standard	NM_018390		Approved	FLJ11323	uc004cpc.3	Q9NUJ7	OTTHUMG00000022693	ENST00000381657.2:c.142A>C	chrX.hg19:g.205414A>C	ENSP00000371073:p.Met48Leu	281.0	0.0	.		176.0	163.0	.	NM_018390	A2BH51|A2BH52	Missense_Mutation	SNP	ENST00000381657.2	hg19	CCDS14103.1	.	.	.	.	.	.	.	.	.	.	.	11.38	1.622626	0.28889	.	.	ENSG00000182378	ENST00000399012;ENST00000430923;ENST00000445062;ENST00000381657;ENST00000429181;ENST00000381663;ENST00000443019;ENST00000415337;ENST00000447472;ENST00000448477	.	.	.	1.79	1.79	0.24919	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (1);	0.132030	0.64402	D	0.000002	T	0.36331	0.0963	.	.	.	0.09310	N	1	D	0.59357	0.985	P	0.61070	0.883	T	0.20240	-1.0281	8	0.11182	T	0.66	-50.3823	5.6988	0.17871	1.0:0.0:0.0:0.0	.	48	Q9NUJ7	PLCX1_HUMAN	L	48	.	ENSP00000371073:M48L	M	+	1	0	PLCXD1	145414	0.996000	0.38824	0.416000	0.26546	0.619000	0.37552	3.400000	0.52594	0.552000	0.29026	0.320000	0.21374	ATG	.	.	.	none		0.627	PLCXD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058879.2	NM_018390	
NRK	203447	hgsc.bcm.edu	37	X	105179166	105179166	+	Nonsense_Mutation	SNP	C	C	A	rs56273831		TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chrX:105179166C>A	ENST00000243300.9	+	21	3807	c.3504C>A	c.(3502-3504)taC>taA	p.Y1168*	NRK_ENST00000428173.2_Nonsense_Mutation_p.Y1169*	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1168					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TTGCAGTATACGCTGGATTCG	0.383										HNSCC(51;0.14)																											p.Y1168X		Atlas-SNP	.											.	NRK	321	.	0			c.C3504A						PASS	.						165.0	146.0	152.0					X																	105179166		1880	4096	5976	SO:0001587	stop_gained	203447	exon21			AGTATACGCTGGA	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.3504C>A	chrX.hg19:g.105179166C>A	ENSP00000434830:p.Tyr1168*	64.0	0.0	.		58.0	56.0	.	NM_198465	Q32ND6|Q5H9K2|Q6ZMP2	Nonsense_Mutation	SNP	ENST00000243300.9	hg19		.	.	.	.	.	.	.	.	.	.	C	39	7.642014	0.98406	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	.	.	.	4.78	2.21	0.28008	.	0.336622	0.21892	N	0.067570	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.9928	0.05988	0.2156:0.1161:0.0:0.6683	.	.	.	.	X	1168;1169	.	ENSP00000434830:Y1168X	Y	+	3	2	NRK	105065822	0.992000	0.36948	0.557000	0.28306	0.083000	0.17756	1.051000	0.30417	0.764000	0.33197	-0.296000	0.09543	TAC	.	.	.	alt		0.383	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
PLK3	1263	hgsc.bcm.edu	37	1	45266511	45266511	+	Splice_Site	DEL	G	G	-			TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr1:45266511delG	ENST00000372201.4	+	2	449		c.e2-1		PLK3_ENST00000465443.1_Splice_Site	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3						apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					CCTCTTCACAGGGGGGCTTCG	0.701																																					.		Atlas-Indel,Pindel	.											.	PLK3	41	.	0			c.211-2G>-						PASS	.						10.0	13.0	12.0					1																	45266511		2175	4262	6437	SO:0001630	splice_region_variant	1263	exon2			.	AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.211-1G>-	chr1.hg19:g.45266511delG		90.0	0.0	0		69.0	34.0	0.492754	NM_004073	Q15767|Q5JR99|Q96CV1	Splice_Site	DEL	ENST00000372201.4	hg19	CCDS515.1																																																																																			.	.	.	none		0.701	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023429.1	NM_004073	Intron
CFDP1	10428	hgsc.bcm.edu	37	16	75327931	75327951	+	Splice_Site	DEL	TTCAATGTACCTAGAAGATGA	TTCAATGTACCTAGAAGATGA	-	rs375111551		TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	TTCAATGTACCTAGAAGATGA	TTCAATGTACCTAGAAGATGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr16:75327931_75327951delTTCAATGTACCTAGAAGATGA	ENST00000283882.3	-	7	942_951	c.810_819delTCATCTTCTAGGTACATTGAA	c.(808-819)ggtcatcttcta>gg	p.GHLL270del		NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1	270	BCNT-C. {ECO:0000255|PROSITE- ProRule:PRU00610}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						AGGCTTTCCGTTCAATGTACCTAGAAGATGAAAACAGTGTT	0.457																																					p.270_274del		Atlas-Indel,Pindel	.											.	CFDP1	17	.	0			c.810_820del						PASS	.																																			SO:0001630	splice_region_variant	10428	exon7			.	AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.810-1TCATCTTCTAGGTACATTGAA>-	chr16.hg19:g.75327931_75327951delTTCAATGTACCTAGAAGATGA		66.0	0.0	0		52.0	11.0	0.211538	NM_006324	O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	Frame_Shift_Del	DEL	ENST00000283882.3	hg19	CCDS10916.1																																																																																			.	.	.	none		0.457	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269031.2	NM_006324	In_Frame_Del
KRTAP5-9	3846	hgsc.bcm.edu	37	11	71259971	71260114	+	In_Frame_Del	DEL	TCAGGCTGTGGGTCATCCTGCTGCCAGTGCAGCTGCTGCAAGCCCTACTGCTCCCAGTGCAGCTGCTGTAAGCCCTGTTGCTCCTCCTCGGGTCGTGGGTCATCCTGCTGCCAATCCAGCTGCTGCAAGCCCTGCTGCTCATCC	TCAGGCTGTGGGTCATCCTGCTGCCAGTGCAGCTGCTGCAAGCCCTACTGCTCCCAGTGCAGCTGCTGTAAGCCCTGTTGCTCCTCCTCGGGTCGTGGGTCATCCTGCTGCCAATCCAGCTGCTGCAAGCCCTGCTGCTCATCC	-	rs200171268|rs202087444|rs569788113|rs543172155|rs371997244|rs535053140|rs200091258|rs114705722|rs201275630|rs35547146|rs202236982|rs372250247|rs564532132|rs369827874|rs546472579|rs117137984|rs531897567|rs200956303|rs267603173|rs572772724|rs61746411|rs367545102|rs557667941	byFrequency	TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	TCAGGCTGTGGGTCATCCTGCTGCCAGTGCAGCTGCTGCAAGCCCTACTGCTCCCAGTGCAGCTGCTGTAAGCCCTGTTGCTCCTCCTCGGGTCGTGGGTCATCCTGCTGCCAATCCAGCTGCTGCAAGCCCTGCTGCTCATCC	TCAGGCTGTGGGTCATCCTGCTGCCAGTGCAGCTGCTGCAAGCCCTACTGCTCCCAGTGCAGCTGCTGTAAGCCCTGTTGCTCCTCCTCGGGTCGTGGGTCATCCTGCTGCCAATCCAGCTGCTGCAAGCCCTGCTGCTCATCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr11:71259971_71260114delTCAGGCTGTGGGTCATCCTGCTGCCAGTGCAGCTGCTGCAAGCCCTACTGCTCCCAGTGCAGCTGCTGTAAGCCCTGTTGCTCCTCCTCGGGTCGTGGGTCATCCTGCTGCCAATCCAGCTGCTGCAAGCCCTGCTGCTCATCC	ENST00000528743.2	+	1	506_649	c.268_411delTCAGGCTGTGGGTCATCCTGCTGCCAGTGCAGCTGCTGCAAGCCCTACTGCTCCCAGTGCAGCTGCTGTAAGCCCTGTTGCTCCTCCTCGGGTCGTGGGTCATCCTGCTGCCAATCCAGCTGCTGCAAGCCCTGCTGCTCATCC	c.(268-411)tcaggctgtgggtcatcctgctgccagtgcagctgctgcaagccctactgctcccagtgcagctgctgtaagccctgttgctcctcctcgggtcgtgggtcatcctgctgccaatccagctgctgcaagccctgctgctcatccdel	p.SGCGSSCCQCSCCKPYCSQCSCCKPCCSSSGRGSSCCQSSCCKPCCSS90del		NM_005553.3	NP_005544.4	P26371	KRA59_HUMAN	keratin associated protein 5-9	90	8 X 4 AA repeats of C-C-X-P.				epidermis development (GO:0008544)	keratin filament (GO:0045095)		p.S119S(1)|p.K103M(1)|p.C97F(1)|p.C130Y(1)		kidney(1)|large_intestine(1)|lung(6)|prostate(3)	11						CTGTTGCTCTTCAGGCTGTGGGTCATCCTGCTGCCAGTGCAGCTGCTGCAAGCCCTACTGCTCCCAGTGCAGCTGCTGTAAGCCCTGTTGCTCCTCCTCGGGTCGTGGGTCATCCTGCTGCCAATCCAGCTGCTGCAAGCCCTGCTGCTCATCCTCAGGCTGTG	0.622																																					p.89_137del		Pindel	.											.	KRTAP5-9	19	.	4	Substitution - Missense(3)|Substitution - coding silent(1)	lung(3)|prostate(1)	c.267_410del						PASS	.																																			SO:0001651	inframe_deletion	3846	exon1			.	AB126078	CCDS53677.1	11q13.4	2008-02-05				ENSG00000254997		"""Keratin associated proteins"""	23604	protein-coding gene	gene with protein product		148021		KRN1		15144888	Standard	NM_005553		Approved	KRTAP5.9, KRTAP5-1	uc001oqs.1	P26371		ENST00000528743.2:c.268_411delTCAGGCTGTGGGTCATCCTGCTGCCAGTGCAGCTGCTGCAAGCCCTACTGCTCCCAGTGCAGCTGCTGTAAGCCCTGTTGCTCCTCCTCGGGTCGTGGGTCATCCTGCTGCCAATCCAGCTGCTGCAAGCCCTGCTGCTCATCC	chr11.hg19:g.71259971_71260114delTCAGGCTGTGGGTCATCCTGCTGCCAGTGCAGCTGCTGCAAGCCCTACTGCTCCCAGTGCAGCTGCTGTAAGCCCTGTTGCTCCTCCTCGGGTCGTGGGTCATCCTGCTGCCAATCCAGCTGCTGCAAGCCCTGCTGCTCATCC	ENSP00000431443:p.Ser90_Ser137del	91.0	0.0	.		85.0	16.0	0.188	NM_005553	Q14564|Q3MIP8	In_Frame_Del	DEL	ENST00000528743.2	hg19	CCDS53677.1																																																																																			.	.	.	none		0.622	KRTAP5-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393901.2		
LILRB1	10859	hgsc.bcm.edu	37	19	55148104	55148105	+	Splice_Site	DEL	GT	GT	-	rs201250339	byFrequency	TCGA-2Z-A9J7-01A-11D-A382-10	TCGA-2Z-A9J7-10A-01D-A385-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f706942e-5a4c-4299-bbb2-7da02d8f774d	29721c4c-1077-4ae3-9583-4d7cd96257fe	g.chr19:55148104_55148105delGT	ENST00000396331.1	+	15	2163		c.e15+1		LILRB1_ENST00000462628.1_Splice_Site|LILRB1_ENST00000396332.4_Splice_Site|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000324602.7_Splice_Site|LILRB1_ENST00000396327.3_Splice_Site|LILRB1_ENST00000434867.2_Splice_Site|LILRB1_ENST00000396315.1_Splice_Site|LILRB1_ENST00000418536.2_Splice_Site|LILRB1_ENST00000396321.2_Splice_Site|LILRB1_ENST00000396317.1_Splice_Site|LILRB1_ENST00000448689.1_Splice_Site|LILRB1_ENST00000427581.2_Splice_Site	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1						cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GGACACTGAGGTGAGTCCTTTC	0.619										HNSCC(37;0.09)																											p.604_604del		Pindel	.											.	LILRB1	140	.	0			c.1812_1812del						PASS	.																																			SO:0001630	splice_region_variant	10859	exon14			.	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1806+1GT>-	chr19.hg19:g.55148104_55148105delGT		104.0	0.0	.		103.0	12.0	0.117	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Frame_Shift_Del	DEL	ENST00000396331.1	hg19	CCDS42617.1																																																																																			.	.	.	none		0.619	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		Intron
