#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RAB42	115273	hgsc.bcm.edu	37	1	28920237	28920237	+	5'UTR	SNP	G	G	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr1:28920237G>T	ENST00000373826.3	+	0	232				TAF12_ENST00000471683.1_Intron|RAB42_ENST00000465518.1_3'UTR	NM_152304.1	NP_689517.1	Q8N4Z0	RAB42_HUMAN	RAB42, member RAS oncogene family						small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00618)|all_lung(284;0.00909)|Breast(348;0.0249)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0577)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00298)|KIRC - Kidney renal clear cell carcinoma(1967;0.00948)|BRCA - Breast invasive adenocarcinoma(304;0.0213)|READ - Rectum adenocarcinoma(331;0.0649)		CCGGAATGTGGTGGGTGTCCT	0.577																																					p.V89L		Atlas-SNP	.											.	RAB42	10	.	0			c.G265T						PASS	.																																			SO:0001623	5_prime_UTR_variant	115273	exon2			AATGTGGTGGGTG	BC033175	CCDS325.1	1p35.3	2014-02-12	2006-04-28		ENSG00000188060	ENSG00000188060		"""RAB, member RAS oncogene"""	28702	protein-coding gene	gene with protein product			"""RAB42, member RAS homolog family"""				Standard	NM_152304		Approved	MGC45806	uc001bqv.3	Q8N4Z0	OTTHUMG00000003656	ENST00000373826.3:c.-75G>T	chr1.hg19:g.28920237G>T		44.0	0.0	.		27.0	19.0	.	NM_001193532	B2R5G2	Missense_Mutation	SNP	ENST00000373826.3	hg19	CCDS325.1																																																																																			.	.	.	none		0.577	RAB42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010371.1	NM_152304	
C1orf101	257044	hgsc.bcm.edu	37	1	244662360	244662360	+	Silent	SNP	G	G	A			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr1:244662360G>A	ENST00000366534.4	+	7	462	c.408G>A	c.(406-408)ggG>ggA	p.G136G	C1orf101_ENST00000366533.4_Silent_p.G136G|C1orf101_ENST00000366531.3_Intron|C1orf101_ENST00000473875.1_Intron	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	136						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			AGTTGCTGGGGAATGCAGAAG	0.353																																					p.G136G		Atlas-SNP	.											.	C1orf101	158	.	0			c.G408A						PASS	.						107.0	104.0	105.0					1																	244662360		2203	4300	6503	SO:0001819	synonymous_variant	257044	exon7			GCTGGGGAATGCA	BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.408G>A	chr1.hg19:g.244662360G>A		372.0	0.0	.		316.0	133.0	.	NM_173807	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Silent	SNP	ENST00000366534.4	hg19	CCDS44340.1																																																																																			.	.	.	none		0.353	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096701.1	NM_173807	
ERBB4	2066	hgsc.bcm.edu	37	2	212578365	212578365	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr2:212578365C>T	ENST00000342788.4	-	8	1202	c.892G>A	c.(892-894)Gtg>Atg	p.V298M	ERBB4_ENST00000436443.1_Missense_Mutation_p.V298M|ERBB4_ENST00000402597.1_Missense_Mutation_p.V298M	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	298	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GAATCTACCACAAAGTTATCT	0.333										TSP Lung(8;0.080)																											p.V298M		Atlas-SNP	.											.	ERBB4	480	.	0			c.G892A						PASS	.						74.0	72.0	73.0					2																	212578365		2203	4300	6503	SO:0001583	missense	2066	exon8			CTACCACAAAGTT	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.892G>A	chr2.hg19:g.212578365C>T	ENSP00000342235:p.Val298Met	73.0	0.0	.		56.0	20.0	.	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	hg19	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742600	0.89573	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.32023	1.47;1.47;1.47	5.61	5.61	0.85477	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.63105	0.2483	M	0.85630	2.765	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.997;0.999;1.0;1.0	T	0.68104	-0.5497	10	0.87932	D	0	.	19.6299	0.95698	0.0:1.0:0.0:0.0	.	298;298;157;298;298	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.;.;.;.;ERBB4_HUMAN	M	298	ENSP00000342235:V298M;ENSP00000403204:V298M;ENSP00000385565:V298M	ENSP00000342235:V298M	V	-	1	0	ERBB4	212286610	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.639000	0.89480	0.655000	0.94253	GTG	.	.	.	none		0.333	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
CUL3	8452	hgsc.bcm.edu	37	2	225378264	225378264	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr2:225378264C>A	ENST00000264414.4	-	5	969	c.631G>T	c.(631-633)Gaa>Taa	p.E211*	CUL3_ENST00000432260.2_5'Flank|CUL3_ENST00000409777.1_Nonsense_Mutation_p.E187*|CUL3_ENST00000344951.4_Nonsense_Mutation_p.E145*|CUL3_ENST00000409096.1_Nonsense_Mutation_p.E187*	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	211					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GCAGACATTTCCAAAAAAGGA	0.303																																					p.E217X		Atlas-SNP	.											.	CUL3	96	.	0			c.G649T						PASS	.						57.0	60.0	59.0					2																	225378264		2202	4300	6502	SO:0001587	stop_gained	8452	exon5			ACATTTCCAAAAA	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.631G>T	chr2.hg19:g.225378264C>A	ENSP00000264414:p.Glu211*	240.0	0.0	.		251.0	107.0	.	NM_001257198	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Nonsense_Mutation	SNP	ENST00000264414.4	hg19	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	C	38	6.790642	0.97841	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	.	.	.	5.77	5.77	0.91146	.	0.095159	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	20.0562	0.97651	0.0:1.0:0.0:0.0	.	.	.	.	X	211;145;187;187	.	ENSP00000264414:E211X	E	-	1	0	CUL3	225086508	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.738000	0.68613	2.758000	0.94735	0.644000	0.83932	GAA	.	.	.	none		0.303	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
NCBP2	22916	hgsc.bcm.edu	37	3	196666228	196666228	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr3:196666228T>C	ENST00000321256.5	-	2	247	c.154A>G	c.(154-156)Act>Gct	p.T52A	NCBP2-AS1_ENST00000447775.1_RNA|NCBP2_ENST00000447325.1_5'UTR|NCBP2_ENST00000422610.1_5'UTR|NCBP2_ENST00000467803.1_5'Flank|NCBP2_ENST00000427641.2_Intron|NCBP2_ENST00000452404.2_Missense_Mutation_p.T34A	NM_007362.3	NP_031388.2	P52298	NCBP2_HUMAN	nuclear cap binding protein subunit 2, 20kDa	52	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of RNA export from nucleus (GO:0046833)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|RNA cap binding (GO:0000339)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.42e-24)|all cancers(36;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(49;4.13e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00551)		TGTTCTTCAGTTGTGTAAAAA	0.318																																					p.T52A		Atlas-SNP	.											.	NCBP2	12	.	0			c.A154G						PASS	.						100.0	98.0	99.0					3																	196666228		2203	4300	6503	SO:0001583	missense	22916	exon2			CTTCAGTTGTGTA	D59253	CCDS3323.1, CCDS46986.1	3q29	2013-02-12	2002-08-29		ENSG00000114503	ENSG00000114503		"""RNA binding motif (RRM) containing"""	7659	protein-coding gene	gene with protein product		605133	"""nuclear cap binding protein subunit 2, 20kD"""			7478990, 7651522, 8682299	Standard	NM_001042540		Approved	NIP1, CBP20, Cbc2	uc003fxd.1	P52298	OTTHUMG00000155520	ENST00000321256.5:c.154A>G	chr3.hg19:g.196666228T>C	ENSP00000326806:p.Thr52Ala	100.0	0.0	.		81.0	28.0	.	NM_007362	B2RE91|B4DMK7|E9PAR5|Q14924|Q2TS50	Missense_Mutation	SNP	ENST00000321256.5	hg19	CCDS3323.1	.	.	.	.	.	.	.	.	.	.	T	16.80	3.223483	0.58668	.	.	ENSG00000114503	ENST00000321256;ENST00000452404	T;T	0.80123	-1.34;-1.34	5.6	5.6	0.85130	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.88592	0.6478	M	0.83483	2.645	0.80722	D	1	B;D;B	0.60575	0.032;0.988;0.063	B;P;B	0.58391	0.052;0.838;0.141	D	0.90237	0.4283	10	0.72032	D	0.01	.	15.2696	0.73689	0.0:0.0:0.0:1.0	.	34;71;52	P52298-2;Q7Z3W9;P52298	.;.;NCBP2_HUMAN	A	52;34	ENSP00000326806:T52A;ENSP00000412785:T34A	ENSP00000326806:T52A	T	-	1	0	NCBP2	198150625	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.808000	0.62583	2.270000	0.75569	0.459000	0.35465	ACT	.	.	.	none		0.318	NCBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340470.2	NM_007362	
STAP1	26228	hgsc.bcm.edu	37	4	68424597	68424597	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr4:68424597C>A	ENST00000265404.2	+	1	152	c.70C>A	c.(70-72)Cta>Ata	p.L24I	STAP1_ENST00000396225.1_Missense_Mutation_p.L24I	NM_012108.2	NP_036240.1	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1	24					intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	12						GATTACTGCTCTACCTTTGTA	0.408																																					p.L24I		Atlas-SNP	.											.	STAP1	46	.	0			c.C70A						PASS	.						110.0	116.0	114.0					4																	68424597		2203	4300	6503	SO:0001583	missense	26228	exon1			ACTGCTCTACCTT	AB023483	CCDS3515.1	4q13.2	2013-02-14	2007-08-09		ENSG00000035720	ENSG00000035720		"""SH2 domain containing"""	24133	protein-coding gene	gene with protein product	"""BCR downstream signaling 1"""	604298				10518561, 10679268	Standard	NM_012108		Approved	STAP-1, BRDG1	uc003hde.4	Q9ULZ2	OTTHUMG00000129304	ENST00000265404.2:c.70C>A	chr4.hg19:g.68424597C>A	ENSP00000265404:p.Leu24Ile	127.0	0.0	.		93.0	31.0	.	NM_012108	B2R980	Missense_Mutation	SNP	ENST00000265404.2	hg19	CCDS3515.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102975	0.76983	.	.	ENSG00000035720	ENST00000265404;ENST00000396225	T;T	0.29917	1.55;1.55	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000015	T	0.53706	0.1813	M	0.71581	2.175	0.38906	D	0.957426	P	0.46457	0.878	D	0.74674	0.984	T	0.49679	-0.8914	10	0.26408	T	0.33	-11.5578	14.6071	0.68486	0.0:1.0:0.0:0.0	.	24	Q9ULZ2	STAP1_HUMAN	I	24	ENSP00000265404:L24I;ENSP00000379527:L24I	ENSP00000265404:L24I	L	+	1	2	STAP1	68107192	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.623000	0.46435	2.507000	0.84556	0.655000	0.94253	CTA	.	.	.	none		0.408	STAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251434.1	NM_012108	
NAAA	27163	hgsc.bcm.edu	37	4	76841890	76841890	+	Splice_Site	SNP	C	C	G			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr4:76841890C>G	ENST00000286733.4	-	7	1004		c.e7+1		NAAA_ENST00000399497.3_Splice_Site|NAAA_ENST00000507956.1_Splice_Site|NAAA_ENST00000511606.1_Splice_Site|NAAA_ENST00000505594.1_Splice_Site	NM_014435.3	NP_055250.2	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase						lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	11						TAGCAGCCTACCTCCGGTCAT	0.493																																					.		Atlas-SNP	.											.	NAAA	26	.	0			c.902+1G>C						PASS	.						137.0	143.0	141.0					4																	76841890		2005	4193	6198	SO:0001630	splice_region_variant	27163	exon8			AGCCTACCTCCGG	M92449	CCDS43239.1	4q21.1	2011-09-23	2008-04-24	2008-04-24	ENSG00000138744	ENSG00000138744	3.5.1.-		736	protein-coding gene	gene with protein product		607469	"""N-acylsphingosine amidohydrolase (acid ceramidase)-like"""	ASAHL		10610717, 1446826	Standard	NM_001042402		Approved		uc003hjb.3	Q02083	OTTHUMG00000160855	ENST00000286733.4:c.902+1G>C	chr4.hg19:g.76841890C>G		220.0	0.0	.		150.0	67.0	.	NM_001042402	Q5KTF2|Q96EY2|Q9BRA8	Splice_Site	SNP	ENST00000286733.4	hg19	CCDS43239.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.902094	0.33628	.	.	ENSG00000138744	ENST00000399497;ENST00000286733;ENST00000513045;ENST00000507956;ENST00000505594	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6924	0.88272	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NAAA	77060914	1.000000	0.71417	1.000000	0.80357	0.081000	0.17604	6.194000	0.72082	2.781000	0.95711	0.650000	0.86243	.	.	.	.	none		0.493	NAAA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362843.4		Intron
CLK4	57396	hgsc.bcm.edu	37	5	178043950	178043950	+	Splice_Site	SNP	C	C	G			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr5:178043950C>G	ENST00000316308.4	-	5	644		c.e5-1		CLK4_ENST00000522749.1_Splice_Site|RN7SKP70_ENST00000516655.1_RNA	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4						protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		ACGATTTCATCTAGAGTGAGG	0.378																																					.		Atlas-SNP	.											.	CLK4	103	.	0			c.476-1G>C						PASS	.						99.0	91.0	94.0					5																	178043950		2203	4300	6503	SO:0001630	splice_region_variant	57396	exon6			TTTCATCTAGAGT	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.476-1G>C	chr5.hg19:g.178043950C>G		276.0	0.0	.		232.0	73.0	.	NM_020666		Splice_Site	SNP	ENST00000316308.4	hg19	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972257	0.53614	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6461	0.85177	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLK4	177976556	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.669000	0.83911	2.529000	0.85273	0.650000	0.86243	.	.	.	.	none		0.378	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		Intron
RXRB	6257	hgsc.bcm.edu	37	6	33168099	33168099	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr6:33168099G>A	ENST00000374680.3	-	1	366	c.155C>T	c.(154-156)gCg>gTg	p.A52V	SLC39A7_ENST00000374677.3_5'Flank|RNY4P10_ENST00000365571.1_RNA|RXRB_ENST00000544186.1_Intron|RXRB_ENST00000374685.4_Missense_Mutation_p.A52V|SLC39A7_ENST00000374675.3_5'Flank|RXRB_ENST00000413614.2_Missense_Mutation_p.R39W	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	52	Modulating. {ECO:0000250}.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	gcctgccaccgccgccgccgc	0.736																																					p.A52V		Atlas-SNP	.											.	RXRB	34	.	0			c.C155T						PASS	.						4.0	5.0	5.0					6																	33168099		1328	2374	3702	SO:0001583	missense	6257	exon1			GCCACCGCCGCCG	M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.155C>T	chr6.hg19:g.33168099G>A	ENSP00000363812:p.Ala52Val	120.0	0.0	.		83.0	4.0	.	NM_021976	P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	hg19	CCDS4768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.61|17.61	3.433234|3.433234	0.62844|0.62844	.|.	.|.	ENSG00000204231|ENSG00000204231	ENST00000374685;ENST00000374680|ENST00000413614	D;D|D	0.92805|0.94092	-3.11;-3.11|-3.35	4.89|4.89	3.94|3.94	0.45596|0.45596	.|.	1.429120|.	0.04277|.	N|.	0.343109|.	T|T	0.75517|0.75517	0.3860|0.3860	N|N	0.08118|0.08118	0|0	0.25642|0.25642	N|N	0.9862|0.9862	B;B;B;B|B	0.18310|0.06786	0.027;0.001;0.001;0.001|0.001	B;B;B;B|B	0.08055|0.01281	0.003;0.0;0.0;0.0|0.0	T|T	0.67856|0.67856	-0.5562|-0.5562	10|9	0.31617|0.87932	T|D	0.26|0	.|.	7.295|7.295	0.26387|0.26387	0.1227:0.0:0.8773:0.0|0.1227:0.0:0.8773:0.0	.|.	52;52;92;52|39	B7Z6J2;B7Z6X3;Q59G65;P28702|B7Z3E4	.;.;.;RXRB_HUMAN|.	V|W	52|39	ENSP00000363817:A52V;ENSP00000363812:A52V|ENSP00000415561:R39W	ENSP00000363812:A52V|ENSP00000415561:R39W	A|R	-|-	2|1	0|2	RXRB|RXRB	33276077|33276077	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.847000|0.847000	0.48162|0.48162	1.319000|1.319000	0.33655|0.33655	2.535000|2.535000	0.85469|0.85469	0.549000|0.549000	0.68633|0.68633	GCG|CGG	.	.	.	none		0.736	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976	
AP1S1	1174	hgsc.bcm.edu	37	7	100802478	100802478	+	Splice_Site	SNP	G	G	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr7:100802478G>T	ENST00000337619.5	+	4	547		c.e4+1		MIR4653_ENST00000585107.1_RNA	NM_001283.3	NP_001274.1	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1 subunit						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor-mediated endocytosis (GO:0006898)|regulation of defense response to virus by virus (GO:0050690)|response to virus (GO:0009615)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|coated pit (GO:0005905)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)	protein transporter activity (GO:0008565)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)	8	Lung NSC(181;0.168)|all_lung(186;0.215)					ACTGCAAGAGGTACGGGCCAG	0.622																																					.		Atlas-SNP	.											.	AP1S1	22	.	0			c.429+1G>T						PASS	.						32.0	34.0	33.0					7																	100802478		2157	4257	6414	SO:0001630	splice_region_variant	1174	exon4			CAAGAGGTACGGG	AB015319	CCDS47669.1	7q22.1	2014-02-04			ENSG00000106367	ENSG00000106367			559	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, small 1 (19kD)"", ""clathrin coat assembly protein AP19"", ""sigma1A subunit of AP-1 clathrin adaptor complex"", ""AP-1 complex subunit sigma-1A"", ""sigma1A-adaptin"", ""golgi adaptor HA1/AP1 adaptin sigma-1A subunit"", ""clathrin assembly protein complex 1 sigma-1A small chain"", ""HA1 19 kDa subunit"""	603531	"""erythrokeratodermia variabilis 3 (Kamouraska type)"""	CLAPS1, EKV3		9653655, 9733768, 19057675	Standard	NM_001283		Approved	AP19, SIGMA1A, WUGSC:H_DJ0747G18.2	uc003uxv.4	P61966	OTTHUMG00000157103	ENST00000337619.5:c.429+1G>T	chr7.hg19:g.100802478G>T		51.0	0.0	.		27.0	7.0	.	NM_001283	B2R5D8|P82267|Q00382|Q53YA7|Q9BTN4|Q9UDW9	Splice_Site	SNP	ENST00000337619.5	hg19	CCDS47669.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977593	0.74360	.	.	ENSG00000106367	ENST00000337619;ENST00000429457	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9897	0.71377	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AP1S1	100589198	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.269000	0.95684	2.474000	0.83562	0.555000	0.69702	.	.	.	.	none		0.622	AP1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347439.1	NM_001283	Intron
MAPK15	225689	hgsc.bcm.edu	37	8	144803996	144803996	+	Silent	SNP	G	G	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr8:144803996G>T	ENST00000338033.4	+	13	1523	c.1404G>T	c.(1402-1404)ctG>ctT	p.L468L	RP11-429J17.5_ENST00000527908.1_RNA	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	468					MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACCAGGCCCTGATCCGGGGTG	0.692																																					p.L468L		Atlas-SNP	.											.	MAPK15	32	.	0			c.G1404T						PASS	.						31.0	40.0	37.0					8																	144803996		1969	4120	6089	SO:0001819	synonymous_variant	225689	exon13			GGCCCTGATCCGG	AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.1404G>T	chr8.hg19:g.144803996G>T		93.0	0.0	.		56.0	33.0	.	NM_139021	Q2TCF9|Q8N362	Silent	SNP	ENST00000338033.4	hg19	CCDS6409.2																																																																																			.	.	.	none		0.692	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000300348.1	NM_139021	
RRAGA	10670	hgsc.bcm.edu	37	9	19049688	19049688	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr9:19049688C>A	ENST00000380527.1	+	1	317	c.31C>A	c.(31-33)Ctg>Atg	p.L11M		NM_006570.4	NP_006561.1			Ras-related GTP binding A											endometrium(1)|large_intestine(1)|lung(1)	3						GAAAAAGGTGCTGCTGATGGG	0.647																																					p.L11M		Atlas-SNP	.											.	RRAGA	17	.	0			c.C31A						PASS	.						43.0	43.0	43.0					9																	19049688		2203	4300	6503	SO:0001583	missense	10670	exon1			AAGGTGCTGCTGA	BC006433	CCDS6488.1	9p21.3	2008-02-05			ENSG00000155876	ENSG00000155876			16963	protein-coding gene	gene with protein product		612194				7499430, 8995684	Standard	NM_006570		Approved	RAGA, FIP-1	uc003znj.3	Q7L523	OTTHUMG00000019621	ENST00000380527.1:c.31C>A	chr9.hg19:g.19049688C>A	ENSP00000369899:p.Leu11Met	164.0	0.0	.		127.0	50.0	.	NM_006570		Missense_Mutation	SNP	ENST00000380527.1	hg19	CCDS6488.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513952	0.64522	.	.	ENSG00000155876	ENST00000380527	T	0.74737	-0.87	4.81	4.81	0.61882	.	0.000000	0.64402	D	0.000019	D	0.90027	0.6886	H	0.95504	3.68	0.50813	D	0.999899	D	0.89917	1.0	D	0.97110	1.0	D	0.92530	0.6032	10	0.72032	D	0.01	-0.4855	15.8	0.78447	0.0:1.0:0.0:0.0	.	11	Q7L523	RRAGA_HUMAN	M	11	ENSP00000369899:L11M	ENSP00000369899:L11M	L	+	1	2	RRAGA	19039688	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.590000	0.46154	2.677000	0.91161	0.655000	0.94253	CTG	.	.	.	none		0.647	RRAGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051824.1	NM_006570	
ZNF195	7748	hgsc.bcm.edu	37	11	3380633	3380633	+	Silent	SNP	G	G	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr11:3380633G>T	ENST00000399602.4	-	6	1731	c.1605C>A	c.(1603-1605)tcC>tcA	p.S535S	ZNF195_ENST00000354599.6_Silent_p.S463S|ZNF195_ENST00000005082.9_Silent_p.S512S|ZNF195_ENST00000343338.7_Silent_p.S467S|ZNF195_ENST00000526601.1_Silent_p.S516S|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000429541.2_Silent_p.S467S	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	535					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		CAATAAGGTTGGAGGACTGGG	0.398																																					p.S535S		Atlas-SNP	.											ZNF195,NS,carcinoma,0,1	ZNF195	77	.	0			c.C1605A						PASS	.						138.0	140.0	139.0					11																	3380633		2042	4219	6261	SO:0001819	synonymous_variant	7748	exon6			AAGGTTGGAGGAC		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1605C>A	chr11.hg19:g.3380633G>T		99.0	0.0	.		90.0	4.0	.	NM_001130520	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Silent	SNP	ENST00000399602.4	hg19	CCDS44522.1																																																																																			.	.	.	none		0.398	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2		
MS4A7	58475	hgsc.bcm.edu	37	11	60156941	60156941	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr11:60156941G>T	ENST00000300184.3	+	5	614	c.418G>T	c.(418-420)Gta>Tta	p.V140L	MS4A7_ENST00000358246.1_Missense_Mutation_p.V95L|MS4A7_ENST00000534016.1_Missense_Mutation_p.V95L|MS4A7_ENST00000530234.2_Intron|MS4A14_ENST00000531787.1_Intron	NM_021201.4|NM_206939.1	NP_067024.1|NP_996822.1	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member 7	140						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(8)|ovary(1)|skin(1)	20						TGACAGCATGGTAGCCCTGAG	0.458																																					p.V140L		Atlas-SNP	.											.	MS4A7	38	.	0			c.G418T						PASS	.						123.0	106.0	111.0					11																	60156941		2203	4300	6503	SO:0001583	missense	58475	exon5			AGCATGGTAGCCC	AB026043	CCDS7985.1, CCDS7986.1	11q12	2008-03-25				ENSG00000166927			13378	protein-coding gene	gene with protein product		606502				11245982, 11401424	Standard	NM_021201		Approved	CD20L4, CFFM4, MS4A8	uc001npf.3	Q9GZW8		ENST00000300184.3:c.418G>T	chr11.hg19:g.60156941G>T	ENSP00000300184:p.Val140Leu	104.0	0.0	.		87.0	36.0	.	NM_021201	A6NP53|Q6IAG8	Missense_Mutation	SNP	ENST00000300184.3	hg19	CCDS7985.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047263	0.36085	.	.	ENSG00000166927	ENST00000300184;ENST00000358246;ENST00000534016;ENST00000530614;ENST00000530027	T;T;T;T;T	0.02121	4.44;4.44;4.44;4.44;4.44	3.69	0.755	0.18415	.	1.192500	0.06080	N	0.661653	T	0.05227	0.0139	M	0.66939	2.045	0.09310	N	0.999995	P;P;P	0.48503	0.911;0.891;0.835	P;P;B	0.51516	0.672;0.487;0.394	T	0.41052	-0.9530	10	0.10902	T	0.67	-14.9503	5.1754	0.15131	0.4047:0.0:0.5953:0.0	.	95;95;140	E9PIV6;Q9GZW8-2;Q9GZW8	.;.;MS4A7_HUMAN	L	140;95;95;95;76	ENSP00000300184:V140L;ENSP00000350983:V95L;ENSP00000434637:V95L;ENSP00000433861:V95L;ENSP00000434819:V76L	ENSP00000300184:V140L	V	+	1	0	MS4A7	59913517	0.030000	0.19436	0.014000	0.15608	0.010000	0.07245	0.052000	0.14163	0.173000	0.19788	0.563000	0.77884	GTA	.	.	.	none		0.458	MS4A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394299.1		
DPF2	5977	hgsc.bcm.edu	37	11	65108472	65108472	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr11:65108472C>T	ENST00000528416.1	+	3	362	c.229C>T	c.(229-231)Cgg>Tgg	p.R77W	DPF2_ENST00000415073.2_Missense_Mutation_p.R77W|DPF2_ENST00000252268.4_Missense_Mutation_p.R77W|DPF2_ENST00000532264.1_3'UTR	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	77					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						CTACCCTGCCCGGCGCTGGCG	0.537																																					p.R77W		Atlas-SNP	.											.	DPF2	54	.	0			c.C229T						PASS	.						61.0	56.0	58.0					11																	65108472		2201	4297	6498	SO:0001583	missense	5977	exon3			CCTGCCCGGCGCT	U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.229C>T	chr11.hg19:g.65108472C>T	ENSP00000436901:p.Arg77Trp	76.0	0.0	.		69.0	32.0	.	NM_006268	A8K7C9|B4DT58	Missense_Mutation	SNP	ENST00000528416.1	hg19	CCDS8100.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376421	0.82682	.	.	ENSG00000133884	ENST00000528416;ENST00000415073;ENST00000252268	D;D;D	0.91407	-2.75;-2.84;-2.76	5.4	3.49	0.39957	.	0.000000	0.34025	N	0.004326	D	0.94604	0.8261	M	0.77103	2.36	0.52501	D	0.999951	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.998	D	0.94286	0.7524	10	0.87932	D	0	-16.7802	12.6765	0.56897	0.2988:0.7012:0.0:0.0	.	77;77;77	B4DT58;E9PN04;Q92785	.;.;REQU_HUMAN	W	77	ENSP00000436901:R77W;ENSP00000399714:R77W;ENSP00000252268:R77W	ENSP00000252268:R77W	R	+	1	2	DPF2	64865048	0.929000	0.31497	1.000000	0.80357	0.994000	0.84299	1.997000	0.40786	0.631000	0.30412	0.460000	0.39030	CGG	.	.	.	none		0.537	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
ANKRD33	341405	hgsc.bcm.edu	37	12	52282036	52282036	+	5'UTR	SNP	C	C	A			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr12:52282036C>A	ENST00000340970.4	+	0	36				ANKRD33_ENST00000538991.1_5'UTR|ANKRD33_ENST00000301190.6_Missense_Mutation_p.F22L			Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.0969)		TGGAGGCATTCGGAGACCCAG	0.577																																					p.F22L		Atlas-SNP	.											ANKRD33,colon,carcinoma,0,1	ANKRD33	33	.	0			c.C66A						PASS	.						113.0	104.0	107.0					12																	52282036		2203	4300	6503	SO:0001623	5_prime_UTR_variant	341405	exon1			GGCATTCGGAGAC		CCDS8815.1, CCDS44892.1	12q13.13	2013-01-10	2005-01-07	2005-01-07		ENSG00000167612		"""Ankyrin repeat domain containing"""	13788	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 7"""	C12orf7		20026326	Standard	NM_182608		Approved	DKFZp686O1689, PANKY	uc001rzd.3	Q7Z3H0	OTTHUMG00000169506	ENST00000340970.4:c.-336C>A	chr12.hg19:g.52282036C>A		124.0	0.0	.		100.0	47.0	.	NM_182608	Q0VAA7|Q5K619|Q5K621|Q5K622|Q5K623|Q5K624|Q6ZUN0	Missense_Mutation	SNP	ENST00000340970.4	hg19	CCDS44892.1	.	.	.	.	.	.	.	.	.	.	C	3.679	-0.065896	0.07273	.	.	ENSG00000167612	ENST00000301190	T	0.18338	2.22	3.17	1.2	0.21068	.	.	.	.	.	T	0.06554	0.0168	N	0.03608	-0.345	0.19775	N	0.999956	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42799	-0.9430	9	0.11485	T	0.65	.	9.0053	0.36109	0.0:0.5521:0.4479:0.0	.	22;22	F8VTQ6;Q7Z3H0-2	.;.	L	22	ENSP00000301190:F22L	ENSP00000301190:F22L	F	+	3	2	ANKRD33	50568303	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.466000	0.22019	0.317000	0.23160	-0.467000	0.05162	TTC	.	.	.	none		0.577	ANKRD33-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404515.1	NM_182608	
PSMB5	5693	hgsc.bcm.edu	37	14	23502654	23502654	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr14:23502654G>C	ENST00000361611.6	-	2	691	c.428C>G	c.(427-429)gCc>gGc	p.A143G	PSMB5_ENST00000460922.2_Intron|AL132780.1_ENST00000385031.1_RNA|PSMB5_ENST00000425762.2_Missense_Mutation_p.A40G|PSMB5_ENST00000493471.2_Missense_Mutation_p.A143G	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	143					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	CACCATGTTGGCAAGCAGTTT	0.522																																					p.A143G		Atlas-SNP	.											.	PSMB5	31	.	0			c.C428G						PASS	.						141.0	122.0	128.0					14																	23502654		2203	4300	6503	SO:0001583	missense	5693	exon2			ATGTTGGCAAGCA	D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.428C>G	chr14.hg19:g.23502654G>C	ENSP00000355325:p.Ala143Gly	69.0	0.0	.		57.0	31.0	.	NM_001144932	B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Missense_Mutation	SNP	ENST00000361611.6	hg19	CCDS9584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.26|17.26	3.344679|3.344679	0.61073|0.61073	.|.	.|.	ENSG00000100804|ENSG00000100804	ENST00000361611;ENST00000493471;ENST00000425762|ENST00000555895	T;T;T|.	0.37752|.	1.18;1.18;1.18|.	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77370|0.77370	0.4120|0.4120	M|M	0.80028|0.80028	2.48|2.48	0.80722|0.80722	D|D	1|1	D;P|.	0.58620|.	0.983;0.906|.	P;P|.	0.54026|.	0.682;0.74|.	T|T	0.79310|0.79310	-0.1856|-0.1856	10|5	0.66056|.	D|.	0.02|.	-10.7057|-10.7057	16.8115|16.8115	0.85722|0.85722	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	143;143|.	P28074-2;P28074|.	.;PSB5_HUMAN|.	G|A	143;143;40|92	ENSP00000355325:A143G;ENSP00000452424:A143G;ENSP00000395206:A40G|.	ENSP00000334973:A143G|.	A|P	-|-	2|1	0|0	PSMB5|PSMB5	22572494|22572494	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.993000|0.993000	0.82548|0.82548	7.146000|7.146000	0.77373|0.77373	2.237000|2.237000	0.73441|0.73441	0.561000|0.561000	0.74099|0.74099	GCC|CCA	.	.	.	none		0.522	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071695.4	NM_002797	
WDR90	197335	hgsc.bcm.edu	37	16	703789	703789	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr16:703789C>G	ENST00000293879.4	+	13	1423	c.1423C>G	c.(1423-1425)Cac>Gac	p.H475D	WDR90_ENST00000549091.1_Missense_Mutation_p.H475D|LA16c-349E10.1_ENST00000573609.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	475										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				TGGCAAGGACCACCACGGGAG	0.637																																					p.H475D		Atlas-SNP	.											.	WDR90	107	.	0			c.C1423G						PASS	.						37.0	44.0	42.0					16																	703789		1983	4152	6135	SO:0001583	missense	197335	exon13			AAGGACCACCACG	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.1423C>G	chr16.hg19:g.703789C>G	ENSP00000293879:p.His475Asp	237.0	1.0	.		189.0	81.0	.	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	hg19	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	C	0.096	-1.158985	0.01686	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.25749	1.81;1.78	4.74	-1.93	0.07594	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.781704	0.10327	U	0.687997	T	0.09642	0.0237	N	0.11560	0.145	0.09310	N	0.999998	B;B;B	0.20052	0.008;0.005;0.041	B;B;B	0.20384	0.025;0.012;0.029	T	0.38845	-0.9642	10	0.10902	T	0.67	.	4.0027	0.09587	0.2474:0.1843:0.4737:0.0946	.	475;476;475	Q96KV7;C9JMK1;Q96KV7-3	WDR90_HUMAN;.;.	D	475	ENSP00000448122:H475D;ENSP00000293879:H475D	ENSP00000293879:H475D	H	+	1	0	WDR90	643790	0.000000	0.05858	0.343000	0.25615	0.626000	0.37791	-0.720000	0.04969	0.041000	0.15688	0.561000	0.74099	CAC	.	.	.	none		0.637	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
SLX4	84464	hgsc.bcm.edu	37	16	3656681	3656681	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr16:3656681T>G	ENST00000294008.3	-	3	1194	c.554A>C	c.(553-555)gAc>gCc	p.D185A		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	185	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						AGGCTGGGAGTCGCTGTTGGG	0.488								Direct reversal of damage																													p.D185A		Atlas-SNP	.											.	SLX4	173	.	0			c.A554C						PASS	.						132.0	127.0	129.0					16																	3656681		2197	4300	6497	SO:0001583	missense	84464	exon3			TGGGAGTCGCTGT	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.554A>C	chr16.hg19:g.3656681T>G	ENSP00000294008:p.Asp185Ala	129.0	0.0	.		83.0	35.0	.	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	hg19	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	T	11.65	1.700644	0.30142	.	.	ENSG00000188827	ENST00000294008	T	0.01228	5.14	5.03	-0.379	0.12493	.	1.301390	0.05020	N	0.472509	T	0.01029	0.0034	L	0.29908	0.895	0.09310	N	1	B	0.30068	0.267	B	0.22386	0.039	T	0.45175	-0.9279	10	0.07325	T	0.83	.	2.0194	0.03505	0.2658:0.0792:0.1375:0.5175	.	185	Q8IY92	SLX4_HUMAN	A	185	ENSP00000294008:D185A	ENSP00000294008:D185A	D	-	2	0	SLX4	3596682	0.000000	0.05858	0.000000	0.03702	0.110000	0.19582	-1.151000	0.03175	0.022000	0.15160	0.459000	0.35465	GAC	.	.	.	none		0.488	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
SLC14A2	8170	hgsc.bcm.edu	37	18	43252937	43252937	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr18:43252937C>T	ENST00000255226.6	+	17	3118	c.2302C>T	c.(2302-2304)Ctc>Ttc	p.L768F	RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000589658.1_Missense_Mutation_p.L245F|SLC14A2_ENST00000586448.1_Missense_Mutation_p.L768F	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	768					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AGGCATCTTCCTCATAGCTCT	0.512																																					p.L768F		Atlas-SNP	.											.	SLC14A2	121	.	0			c.C2302T						PASS	.						270.0	210.0	230.0					18																	43252937		2203	4300	6503	SO:0001583	missense	8170	exon18			ATCTTCCTCATAG	X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.2302C>T	chr18.hg19:g.43252937C>T	ENSP00000255226:p.Leu768Phe	73.0	0.0	.		74.0	22.0	.	NM_001242692	A8K8Q7|Q2TBD6|Q96PH5	Missense_Mutation	SNP	ENST00000255226.6	hg19	CCDS11924.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981375	0.53827	.	.	ENSG00000132874	ENST00000255226	T	0.58506	0.33	5.79	5.79	0.91817	.	0.000000	0.53938	D	0.000059	T	0.68504	0.3008	M	0.75447	2.3	0.80722	D	1	P	0.46706	0.883	P	0.51101	0.659	T	0.68965	-0.5270	10	0.45353	T	0.12	-34.2809	15.6071	0.76682	0.1381:0.8619:0.0:0.0	.	768	Q15849	UT2_HUMAN	F	768	ENSP00000255226:L768F	ENSP00000255226:L768F	L	+	1	0	SLC14A2	41506935	1.000000	0.71417	0.997000	0.53966	0.216000	0.24613	3.665000	0.54532	2.735000	0.93741	0.561000	0.74099	CTC	.	.	.	none		0.512	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1		
ZNF236	7776	hgsc.bcm.edu	37	18	74637348	74637348	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr18:74637348C>G	ENST00000253159.8	+	22	4057	c.3859C>G	c.(3859-3861)Cga>Gga	p.R1287G	ZNF236_ENST00000320610.9_Missense_Mutation_p.R1289G	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1287					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GCCTATGACTCGAAGCTCATC	0.483																																					p.R1287G		Atlas-SNP	.											.	ZNF236	325	.	0			c.C3859G						PASS	.						72.0	73.0	73.0					18																	74637348		2014	4162	6176	SO:0001583	missense	7776	exon22			ATGACTCGAAGCT	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.3859C>G	chr18.hg19:g.74637348C>G	ENSP00000253159:p.Arg1287Gly	104.0	0.0	.		93.0	42.0	.	NM_007345	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	hg19	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.614965	0.28712	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.11495	2.77;2.95	4.85	3.98	0.46160	.	0.483231	0.20519	N	0.090734	T	0.09512	0.0234	L	0.27053	0.805	0.09310	N	0.99999	B	0.11235	0.004	B	0.08055	0.003	T	0.20009	-1.0288	10	0.44086	T	0.13	.	14.8772	0.70504	0.1444:0.8556:0.0:0.0	.	1287	Q9UL36	ZN236_HUMAN	G	1287	ENSP00000253159:R1287G;ENSP00000444524:R1287G	ENSP00000253159:R1287G	R	+	1	2	ZNF236	72766336	0.998000	0.40836	0.002000	0.10522	0.144000	0.21451	4.056000	0.57448	1.154000	0.42482	0.650000	0.86243	CGA	.	.	.	none		0.483	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
DOT1L	84444	hgsc.bcm.edu	37	19	2223434	2223434	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr19:2223434C>T	ENST00000398665.3	+	25	3581	c.3545C>T	c.(3544-3546)cCa>cTa	p.P1182L		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1182					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACTACTCCCCACTCACCTCA	0.692																																					p.P1182L		Atlas-SNP	.											.	DOT1L	205	.	0			c.C3545T						PASS	.						41.0	47.0	45.0					19																	2223434		1953	4141	6094	SO:0001583	missense	84444	exon25			ACTCCCCACTCAC	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.3545C>T	chr19.hg19:g.2223434C>T	ENSP00000381657:p.Pro1182Leu	76.0	0.0	.		42.0	20.0	.	NM_032482	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	hg19	CCDS42460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.6|23.6	4.435602|4.435602	0.83885|0.83885	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000440640|ENST00000398665;ENST00000221482;ENST00000457590	.|T;T	.|0.42513	.|1.28;0.97	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63977|0.63977	0.2557|0.2557	M|M	0.66939|0.66939	2.045|2.045	0.54753|0.54753	D|D	0.999988|0.999988	.|D;D	.|0.89917	.|0.998;1.0	.|D;D	.|0.91635	.|0.914;0.999	T|T	0.68250|0.68250	-0.5458|-0.5458	5|10	.|0.87932	.|D	.|0	-14.6797|-14.6797	17.0688|17.0688	0.86567|0.86567	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1182;1182	.|Q8TEK3;Q8TEK3-2	.|DOT1L_HUMAN;.	Y|L	969|1182;1182;62	.|ENSP00000381657:P1182L;ENSP00000407411:P62L	.|ENSP00000221482:P1182L	H|P	+|+	1|2	0|0	DOT1L|DOT1L	2174434|2174434	0.999000|0.999000	0.42202|0.42202	0.892000|0.892000	0.35008|0.35008	0.462000|0.462000	0.32619|0.32619	7.226000|7.226000	0.78060|0.78060	2.284000|2.284000	0.76573|0.76573	0.561000|0.561000	0.74099|0.74099	CAC|CCA	.	.	.	none		0.692	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
RASGRP4	115727	hgsc.bcm.edu	37	19	38905689	38905689	+	Silent	SNP	G	G	A			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr19:38905689G>A	ENST00000587738.1	-	9	1099	c.1029C>T	c.(1027-1029)tgC>tgT	p.C343C	RASGRP4_ENST00000586305.1_Silent_p.C329C|RASGRP4_ENST00000587753.1_Intron|RASGRP4_ENST00000293062.9_Silent_p.C246C|RASGRP4_ENST00000454404.2_Silent_p.C309C|RASGRP4_ENST00000426920.2_Intron|RASGRP4_ENST00000433821.2_Intron			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	343	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGAAACCCGCGCAGCCAGCCC	0.672																																					p.C343C		Atlas-SNP	.											.	RASGRP4	54	.	0			c.C1029T						PASS	.						10.0	16.0	14.0					19																	38905689		1966	4151	6117	SO:0001819	synonymous_variant	115727	exon9			ACCCGCGCAGCCA	AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1029C>T	chr19.hg19:g.38905689G>A		170.0	0.0	.		149.0	70.0	.	NM_170604	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Silent	SNP	ENST00000587738.1	hg19	CCDS46068.1																																																																																			.	.	.	none		0.672	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460540.1	NM_170604	
DIAPH2	1730	hgsc.bcm.edu	37	X	96171470	96171470	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chrX:96171470A>C	ENST00000324765.8	+	8	1113	c.766A>C	c.(766-768)Agt>Cgt	p.S256R	DIAPH2_ENST00000373054.4_Missense_Mutation_p.S252R|DIAPH2_ENST00000355827.4_Missense_Mutation_p.S256R|DIAPH2_ENST00000373049.4_Missense_Mutation_p.S256R|DIAPH2_ENST00000373061.3_Missense_Mutation_p.S256R			O60879	DIAP2_HUMAN	diaphanous-related formin 2	256	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						AGATGAAAGAAGTCTTTTACT	0.299																																					p.S256R		Atlas-SNP	.											.	DIAPH2	148	.	0			c.A766C						PASS	.						62.0	57.0	58.0					X																	96171470		2203	4297	6500	SO:0001583	missense	1730	exon8			GAAAGAAGTCTTT	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.766A>C	chrX.hg19:g.96171470A>C	ENSP00000321348:p.Ser256Arg	310.0	1.0	.		310.0	241.0	.	NM_007309	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	hg19	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	A	17.92	3.506176	0.64410	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	D;D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22;-2.22	5.52	5.52	0.82312	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.000000	0.85682	D	0.000000	D	0.92645	0.7663	M	0.69823	2.125	0.58432	D	0.999997	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.992;0.995	D	0.93186	0.6579	10	0.62326	D	0.03	.	14.6448	0.68754	1.0:0.0:0.0:0.0	.	256;256;263	O60879;O60879-2;B7ZLJ0	DIAP2_HUMAN;.;.	R	256;252;256;256;256;263	ENSP00000362152:S256R;ENSP00000362145:S252R;ENSP00000348082:S256R;ENSP00000362140:S256R;ENSP00000321348:S256R	ENSP00000321348:S256R	S	+	1	0	DIAPH2	96058126	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.073000	0.76784	1.840000	0.53500	0.441000	0.28932	AGT	.	.	.	none		0.299	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309	
GPRASP1	9737	hgsc.bcm.edu	37	X	101910027	101910027	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chrX:101910027G>C	ENST00000361600.5	+	5	1987	c.1186G>C	c.(1186-1188)Gaa>Caa	p.E396Q	GPRASP1_ENST00000444152.1_Missense_Mutation_p.E396Q|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Missense_Mutation_p.E396Q|GPRASP1_ENST00000415986.1_Missense_Mutation_p.E396Q	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	396					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GGCCAAGCAAGAAGCCAGGTC	0.542																																					p.E396Q		Atlas-SNP	.											.	GPRASP1	140	.	0			c.G1186C						PASS	.						51.0	59.0	56.0					X																	101910027		2203	4300	6503	SO:0001583	missense	9737	exon3			AAGCAAGAAGCCA	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.1186G>C	chrX.hg19:g.101910027G>C	ENSP00000355146:p.Glu396Gln	64.0	0.0	.		66.0	57.0	.	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	hg19	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.517068	0.27123	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	2.32	1.44	0.22558	.	.	.	.	.	T	0.43678	0.1258	M	0.71036	2.16	0.22127	N	0.999348	D	0.89917	1.0	D	0.91635	0.999	T	0.16276	-1.0408	9	0.35671	T	0.21	-5.7701	6.5511	0.22433	0.1669:0.0:0.8331:0.0	.	396	Q5JY77	GASP1_HUMAN	Q	396	ENSP00000393691:E396Q;ENSP00000409420:E396Q;ENSP00000355146:E396Q;ENSP00000445683:E396Q	ENSP00000355146:E396Q	E	+	1	0	GPRASP1	101796683	0.458000	0.25760	0.007000	0.13788	0.025000	0.11179	2.670000	0.46833	0.414000	0.25790	-0.393000	0.06486	GAA	.	.	.	none		0.542	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
CUL3	8452	hgsc.bcm.edu	37	2	225449664	225449664	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr2:225449664delA	ENST00000264414.4	-	1	401	c.63delT	c.(61-63)tttfs	p.F21fs	CUL3_ENST00000344951.4_Frame_Shift_Del_p.F21fs	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	21					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GACTCACCGGAAAGGCCCGGA	0.731																																					p.P22fs		Atlas-Indel,Pindel	.											.	CUL3	96	.	0			c.64delC						PASS	.						31.0	30.0	30.0					2																	225449664		2195	4298	6493	SO:0001589	frameshift_variant	8452	exon1			.	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.63delT	chr2.hg19:g.225449664delA	ENSP00000264414:p.Phe21fs	138.0	0.0	0		107.0	37.0	0.345794	NM_001257197	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Frame_Shift_Del	DEL	ENST00000264414.4	hg19	CCDS2462.1																																																																																			.	.	.	none		0.731	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
CAMSAP2	23271	hgsc.bcm.edu	37	1	200818453	200818453	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr1:200818453delA	ENST00000236925.4	+	12	2638	c.2589delA	c.(2587-2589)ccafs	p.P863fs	CAMSAP2_ENST00000358823.2_Frame_Shift_Del_p.P852fs|CAMSAP2_ENST00000413307.2_Frame_Shift_Del_p.P836fs			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	863					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										TAAAGTCTCCAACTACACCTA	0.398																																					p.P852fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.2555delC						PASS	.						103.0	110.0	108.0					1																	200818453		2199	4300	6499	SO:0001589	frameshift_variant	23271	exon11			.	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.2589delA	chr1.hg19:g.200818453delA	ENSP00000236925:p.Pro863fs	361.0	0.0	0		294.0	124.0	0.421769	NM_203459	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Frame_Shift_Del	DEL	ENST00000236925.4	hg19																																																																																				.	.	.	none		0.398	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459	
NIPBL	25836	hgsc.bcm.edu	37	5	36995727	36995743	+	Frame_Shift_Del	DEL	GTATAGATCAATCAGTG	GTATAGATCAATCAGTG	-	rs368762999		TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	GTATAGATCAATCAGTG	GTATAGATCAATCAGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr5:36995727_36995743delGTATAGATCAATCAGTG	ENST00000282516.8	+	11	3624_3640	c.3125_3141delGTATAGATCAATCAGTG	c.(3124-3141)agtatagatcaatcagtgfs	p.SIDQSV1042fs	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Frame_Shift_Del_p.SIDQSV1042fs	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1042					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.Q1045E(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TTAATAGGTAGTATAGATCAATCAGTGTTAAAAGAAT	0.304																																					p.1042_1047del		Atlas-Indel,Pindel	.											.	NIPBL	513	.	2	Substitution - Missense(2)	lung(2)	c.3124_3140del						PASS	.																																			SO:0001589	frameshift_variant	25836	exon11			.	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.3125_3141delGTATAGATCAATCAGTG	chr5.hg19:g.36995727_36995743delGTATAGATCAATCAGTG	ENSP00000282516:p.Ser1042fs	160.0	0.0	0		128.0	54.0	0.421875	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Frame_Shift_Del	DEL	ENST00000282516.8	hg19	CCDS3920.1																																																																																			.	.	.	none		0.304	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
ZFYVE9	9372	hgsc.bcm.edu	37	1	52769546	52769547	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr1:52769546_52769547insA	ENST00000371591.1	+	12	3518_3519	c.3387_3388insA	c.(3388-3390)atgfs	p.M1130fs	ZFYVE9_ENST00000357206.2_Frame_Shift_Ins_p.M1071fs|ZFYVE9_ENST00000469134.1_3'UTR|ZFYVE9_ENST00000287727.3_Frame_Shift_Ins_p.M1130fs	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1130					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						TGGTGGTTGATATGGAAGTTCG	0.371																																					p.D1129fs		Atlas-Indel,Pindel	.											.	ZFYVE9	131	.	0			c.3387_3388insA						PASS	.																																			SO:0001589	frameshift_variant	9372	exon13			.	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3388dupA	chr1.hg19:g.52769547_52769547dupA	ENSP00000360647:p.Met1130fs	173.0	0.0	0		109.0	48.0	0.440367	NM_004799	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Frame_Shift_Ins	INS	ENST00000371591.1	hg19	CCDS563.1																																																																																			.	.	.	none		0.371	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	
TTYH3	80727	hgsc.bcm.edu	37	7	2696131	2696132	+	Frame_Shift_Ins	INS	-	-	TCGT			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr7:2696131_2696132insTCGT	ENST00000258796.7	+	11	1418_1419	c.1213_1214insTCGT	c.(1213-1215)atcfs	p.-406fs	TTYH3_ENST00000407643.1_Frame_Shift_Ins_p.-374fs|TTYH3_ENST00000403167.1_Frame_Shift_Ins_p.-235fs	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		GTTCAGCTCCATCGTCTGCAGC	0.639																																					p.I405fs		Atlas-Indel,Pindel	.											.	TTYH3	36	.	0			c.1213_1214insTCGT						PASS	.																																			SO:0001589	frameshift_variant	80727	exon11			.		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.1214_1217dupTCGT	chr7.hg19:g.2696132_2696135dupTCGT	ENSP00000258796:p.Val406fs	38.0	0.0	0		30.0	11.0	0.366667	NM_025250	A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Frame_Shift_Ins	INS	ENST00000258796.7	hg19	CCDS34588.1																																																																																			.	.	.	none		0.639	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325082.2	XM_166523	
OC90	729330	hgsc.bcm.edu	37	8	133044287	133044287	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr8:133044287delA	ENST00000443356.2	-	13	1006	c.920delT	c.(919-921)ttcfs	p.F307fs	OC90_ENST00000254627.3_Frame_Shift_Del_p.F291fs|OC90_ENST00000603859.1_Frame_Shift_Del_p.F291fs|OC90_ENST00000262283.5_Frame_Shift_Del_p.F503fs			Q02509	OC90_HUMAN	otoconin 90	307					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			CAGGAAGGTGAATCTGTCACA	0.547																																					p.F291fs		Atlas-Indel,Pindel	.											OC90_ENST00000262283,NS,carcinoma,0,2	OC90	163	.	0			c.873delC						PASS	.						114.0	111.0	112.0					8																	133044287		2066	4223	6289	SO:0001589	frameshift_variant	729330	exon12			.	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.920delT	chr8.hg19:g.133044287delA	ENSP00000390050:p.Phe307fs	96.0	0.0	0		85.0	45.0	0.529412	NM_001080399	B4DNG8	Frame_Shift_Del	DEL	ENST00000443356.2	hg19																																																																																				.	.	.	none		0.547	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399	
FAM110C	642273	hgsc.bcm.edu	37	2	46002	46003	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Z-A9J8-01A-11D-A42J-10	TCGA-2Z-A9J8-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cb146a7-7274-4738-9b83-05c82018a495	a106d5a1-9938-4c4f-aec9-6163033a57bd	g.chr2:46002_46003insT	ENST00000327669.4	-	1	382_383	c.383_384insA	c.(382-384)cagfs	p.Q128fs		NM_001077710.2	NP_001071178.2	Q1W6H9	F110C_HUMAN	family with sequence similarity 110, member C	128					positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell projection assembly (GO:0060491)	cell cortex (GO:0005938)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|kidney(1)|lung(2)	4	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00221)		all cancers(51;0.000815)|Epithelial(75;0.00379)|OV - Ovarian serous cystadenocarcinoma(76;0.0127)|GBM - Glioblastoma multiforme(21;0.232)		TACCCGGCCCCTGGAAGAGCTT	0.688																																					p.Q128fs		Atlas-Indel,Pindel	.											.	FAM110C	11	.	0			c.384_385insA						PASS	.																																			SO:0001589	frameshift_variant	642273	exon1			.	DQ431183	CCDS42645.1	2p25.3	2011-12-01			ENSG00000184731	ENSG00000184731			33340	protein-coding gene	gene with protein product		611395				17499476, 19698782	Standard	NM_001077710		Approved		uc010yim.2	Q1W6H9	OTTHUMG00000151321	ENST00000327669.4:c.384dupA	chr2.hg19:g.46003_46003dupT	ENSP00000328347:p.Gln128fs	66.0	0.0	0		47.0	19.0	0.404255	NM_001077710		Frame_Shift_Ins	INS	ENST00000327669.4	hg19	CCDS42645.1																																																																																			.	.	.	none		0.688	FAM110C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322220.1	NM_001077710	
