#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZMYM6	9204	hgsc.bcm.edu	37	1	35453206	35453206	+	Silent	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:35453206T>C	ENST00000357182.4	-	16	3704	c.3477A>G	c.(3475-3477)caA>caG	p.Q1159Q	ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000373340.2_Intron|ZMYM6NB_ENST00000373337.3_5'Flank|RP11-244H3.1_ENST00000417456.1_RNA|ZMYM6_ENST00000487874.1_Intron	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	1159					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				aatcattctcttgtgtgcgct	0.318																																					p.Q1159Q		Atlas-SNP	.											.	ZMYM6	110	.	0			c.A3477G						PASS	.						39.0	38.0	39.0					1																	35453206		1856	4087	5943	SO:0001819	synonymous_variant	9204	exon16			ATTCTCTTGTGTG	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.3477A>G	chr1.hg19:g.35453206T>C		325.0	0.0	.		266.0	91.0	.	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Silent	SNP	ENST00000357182.4	hg19	CCDS387.2																																																																																			.	.	.	none		0.318	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
SZT2	23334	hgsc.bcm.edu	37	1	43907699	43907699	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:43907699T>C	ENST00000562955.1	+	55	7600	c.7600T>C	c.(7600-7602)Tgt>Cgt	p.C2534R	SZT2_ENST00000372442.1_Missense_Mutation_p.C1692R	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2591					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CTTCGGCCCTTGTTCCCCTGG	0.602																																					p.C2534R		Atlas-SNP	.											.	SZT2	383	.	0			c.T7600C						PASS	.						50.0	48.0	49.0					1																	43907699		2203	4300	6503	SO:0001583	missense	23334	exon55			GGCCCTTGTTCCC	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.7600T>C	chr1.hg19:g.43907699T>C	ENSP00000457168:p.Cys2534Arg	96.0	0.0	.		100.0	39.0	.	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	hg19	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	T	8.595	0.885587	0.17540	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.21	4.07	0.47477	.	0.294570	0.39759	N	0.001273	T	0.42177	0.1191	L	0.29908	0.895	0.39585	D	0.969494	B	0.02656	0.0	B	0.04013	0.001	T	0.23190	-1.0195	9	0.25751	T	0.34	.	9.7297	0.40352	0.0:0.0868:0.0:0.9132	.	2534	Q5T011-5	.	R	1692	.	ENSP00000361519:C1692R	C	+	1	0	SZT2	43680286	0.999000	0.42202	0.901000	0.35422	0.818000	0.46254	3.426000	0.52778	0.805000	0.34159	0.533000	0.62120	TGT	.	.	.	none		0.602	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
AGBL4	84871	hgsc.bcm.edu	37	1	49100226	49100226	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:49100226G>A	ENST00000371839.1	-	9	1006	c.890C>T	c.(889-891)cCa>cTa	p.P297L	AGBL4_ENST00000334103.7_Missense_Mutation_p.P30L|AGBL4_ENST00000371838.1_Missense_Mutation_p.P297L	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	297					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		ATGGACCCATGGAGAGGGATC	0.483																																					p.P297L		Atlas-SNP	.											.	AGBL4	54	.	0			c.C890T						PASS	.						86.0	89.0	88.0					1																	49100226		1970	4152	6122	SO:0001583	missense	84871	exon9			ACCCATGGAGAGG	AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.890C>T	chr1.hg19:g.49100226G>A	ENSP00000360905:p.Pro297Leu	34.0	0.0	.		103.0	5.0	.	NM_032785	B3KT26|B4DG37	Missense_Mutation	SNP	ENST00000371839.1	hg19	CCDS44137.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.056437|4.056437	0.76074|0.76074	.|.	.|.	ENSG00000186094|ENSG00000186094	ENST00000416121|ENST00000371839;ENST00000411952;ENST00000334103;ENST00000371838	.|T;T;T	.|0.17691	.|2.64;2.64;2.26	5.6|5.6	5.6|5.6	0.85130|0.85130	.|Peptidase M14, carboxypeptidase A (1);	.|0.046068	.|0.85682	.|D	.|0.000000	T|T	0.34019|0.34019	0.0883|0.0883	L|L	0.43598|0.43598	1.365|1.365	0.80722|0.80722	D|D	1|1	.|P;D;P;B;B	.|0.76494	.|0.677;0.999;0.948;0.256;0.182	.|B;D;P;B;B	.|0.71414	.|0.299;0.973;0.754;0.173;0.102	T|T	0.00655|0.00655	-1.1624|-1.1624	5|9	.|.	.|.	.|.	-17.6024|-17.6024	17.0797|17.0797	0.86595|0.86595	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|112;309;30;142;297	.|A0AVJ2;Q5VU57-2;B4DGK1;B1AMW2;Q5VU57	.|.;.;.;.;CBPC6_HUMAN	Y|L	143|297;291;30;297	.|ENSP00000360905:P297L;ENSP00000335516:P30L;ENSP00000360904:P297L	.|.	H|P	-|-	1|2	0|0	AGBL4|AGBL4	48872813|48872813	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	8.608000|8.608000	0.90895|0.90895	2.636000|2.636000	0.89361|0.89361	0.462000|0.462000	0.41574|0.41574	CAT|CCA	.	.	.	none		0.483	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021346.4	NM_032785	
ALG14	199857	hgsc.bcm.edu	37	1	95448663	95448663	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:95448663G>T	ENST00000370205.5	-	4	666	c.620C>A	c.(619-621)cCc>cAc	p.P207H		NM_144988.3	NP_659425.1	Q96F25	ALG14_HUMAN	ALG14, UDP-N-acetylglucosaminyltransferase subunit	207					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	6		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.0615)|Epithelial(280;0.139)		CACCGATTTGGGATACTTTTC	0.408																																					p.P207H		Atlas-SNP	.											.	ALG14	13	.	0			c.C620A						PASS	.						92.0	87.0	89.0					1																	95448663		2203	4300	6503	SO:0001583	missense	199857	exon4			GATTTGGGATACT		CCDS752.1	1p21.3	2013-02-21	2013-02-21		ENSG00000172339	ENSG00000172339			28287	protein-coding gene	gene with protein product		612866	"""asparagine-linked glycosylation 14 homolog (yeast)"", ""asparagine-linked glycosylation 14 homolog (S. cerevisiae)"""			15615718	Standard	NM_144988		Approved	MGC19780	uc001dra.2	Q96F25	OTTHUMG00000010781	ENST00000370205.5:c.620C>A	chr1.hg19:g.95448663G>T	ENSP00000359224:p.Pro207His	62.0	0.0	.		97.0	36.0	.	NM_144988	A8K030	Missense_Mutation	SNP	ENST00000370205.5	hg19	CCDS752.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958451	0.92726	.	.	ENSG00000172339	ENST00000370205	T	0.50548	0.74	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.72036	0.3411	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.76468	-0.2948	10	0.87932	D	0	-29.758	20.1766	0.98178	0.0:0.0:1.0:0.0	.	207	Q96F25	ALG14_HUMAN	H	207	ENSP00000359224:P207H	ENSP00000359224:P207H	P	-	2	0	ALG14	95221251	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.232000	0.95325	2.772000	0.95346	0.655000	0.94253	CCC	.	.	.	none		0.408	ALG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029699.2	NM_144988	
COL11A1	1301	hgsc.bcm.edu	37	1	103461460	103461460	+	Missense_Mutation	SNP	G	G	C	rs372933541		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:103461460G>C	ENST00000370096.3	-	28	2612	c.2300C>G	c.(2299-2301)gCa>gGa	p.A767G	COL11A1_ENST00000512756.1_Missense_Mutation_p.A651G|COL11A1_ENST00000353414.4_Missense_Mutation_p.A728G|COL11A1_ENST00000358392.2_Missense_Mutation_p.A779G	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	767	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.A779E(1)|p.A767E(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GACACCATCTGCTCCCTGTGG	0.308																																					p.A779G		Atlas-SNP	.											COL11A1_ENST00000370096,NS,carcinoma,0,2	COL11A1	972	.	2	Substitution - Missense(2)	endometrium(2)	c.C2336G						PASS	.						79.0	88.0	85.0					1																	103461460		2203	4297	6500	SO:0001583	missense	1301	exon28			CCATCTGCTCCCT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2300C>G	chr1.hg19:g.103461460G>C	ENSP00000359114:p.Ala767Gly	115.0	0.0	.		184.0	10.0	.	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868258	0.72065	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22	5.62	5.62	0.85841	.	0.055500	0.64402	D	0.000001	D	0.89026	0.6598	N	0.25789	0.76	0.80722	D	1	B;P;P;P	0.49961	0.347;0.93;0.93;0.886	P;P;P;B	0.49085	0.479;0.6;0.6;0.396	D	0.90656	0.4586	10	0.59425	D	0.04	.	14.8656	0.70412	0.0706:0.0:0.9294:0.0	.	651;728;779;767	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	G	767;779;728;651	ENSP00000359114:A767G;ENSP00000351163:A779G;ENSP00000302551:A728G;ENSP00000426533:A651G	ENSP00000302551:A728G	A	-	2	0	COL11A1	103234048	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.158000	0.94723	2.640000	0.89533	0.591000	0.81541	GCA	.	.	.	none		0.308	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
LRIG2	9860	hgsc.bcm.edu	37	1	113661942	113661942	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:113661942A>G	ENST00000361127.5	+	17	2966	c.2768A>G	c.(2767-2769)tAt>tGt	p.Y923C	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	923					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CCATACACCTATATTGCTGAG	0.463																																					p.Y923C		Atlas-SNP	.											.	LRIG2	67	.	0			c.A2768G						PASS	.						151.0	140.0	143.0					1																	113661942		2203	4300	6503	SO:0001583	missense	9860	exon17			ACACCTATATTGC	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.2768A>G	chr1.hg19:g.113661942A>G	ENSP00000355396:p.Tyr923Cys	103.0	0.0	.		118.0	8.0	.	NM_014813	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	hg19	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	A	15.39	2.820350	0.50633	.	.	ENSG00000198799	ENST00000361127	T	0.70045	-0.45	5.12	2.63	0.31362	.	0.209042	0.42682	D	0.000676	T	0.65439	0.2691	M	0.62723	1.935	0.44500	D	0.997441	D	0.61080	0.989	D	0.63192	0.912	T	0.64896	-0.6299	10	0.41790	T	0.15	.	10.232	0.43260	0.6218:0.0:0.0:0.3782	.	923	O94898	LRIG2_HUMAN	C	923	ENSP00000355396:Y923C	ENSP00000355396:Y923C	Y	+	2	0	LRIG2	113463465	1.000000	0.71417	0.126000	0.21872	0.817000	0.46193	5.801000	0.69115	0.291000	0.22468	0.482000	0.46254	TAT	.	.	.	none		0.463	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
FLG2	388698	hgsc.bcm.edu	37	1	152324407	152324407	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:152324407C>T	ENST00000388718.5	-	3	5927	c.5855G>A	c.(5854-5856)gGa>gAa	p.G1952E	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1952					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGGCCAGATCCCCTTCTTCC	0.527																																					p.G1952E		Atlas-SNP	.											.	FLG2	431	.	0			c.G5855A						PASS	.						326.0	307.0	313.0					1																	152324407		2203	4300	6503	SO:0001583	missense	388698	exon3			CCAGATCCCCTTC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5855G>A	chr1.hg19:g.152324407C>T	ENSP00000373370:p.Gly1952Glu	31.0	0.0	.		69.0	31.0	.	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	hg19	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	c	0.563	-0.844454	0.02671	.	.	ENSG00000143520	ENST00000388718	T	0.04119	3.7	3.91	-3.47	0.04753	.	.	.	.	.	T	0.00784	0.0026	L	0.38531	1.155	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.48969	-0.8987	9	0.02654	T	1	0.2959	6.2752	0.20977	0.0:0.2193:0.4883:0.2924	.	1952	Q5D862	FILA2_HUMAN	E	1952	ENSP00000373370:G1952E	ENSP00000373370:G1952E	G	-	2	0	FLG2	150591031	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-1.819000	0.01716	-0.486000	0.06744	-0.371000	0.07208	GGA	.	.	.	none		0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
ADAM15	8751	hgsc.bcm.edu	37	1	155028274	155028274	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:155028274T>G	ENST00000356955.2	+	7	722	c.621T>G	c.(619-621)gaT>gaG	p.D207E	ADAM15_ENST00000368413.1_Intron|ADAM15_ENST00000449910.2_Missense_Mutation_p.D207E|ADAM15_ENST00000271836.6_Missense_Mutation_p.D207E|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000368410.2_Intron|ADAM15_ENST00000360674.4_Missense_Mutation_p.D207E|ADAM15_ENST00000355956.2_Missense_Mutation_p.D207E|ADAM15_ENST00000531455.1_Missense_Mutation_p.D217E|ADAM15_ENST00000447332.3_Missense_Mutation_p.D191E|ADAM15_ENST00000359280.4_Missense_Mutation_p.D207E|ADAM15_ENST00000368412.3_Missense_Mutation_p.D207E	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	207					angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			AGAGGCGGGATGTGGTAACAG	0.587																																					p.D217E		Atlas-SNP	.											.	ADAM15	92	.	0			c.T651G						PASS	.						163.0	148.0	153.0					1																	155028274		2203	4300	6503	SO:0001583	missense	8751	exon7			GCGGGATGTGGTA	U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.621T>G	chr1.hg19:g.155028274T>G	ENSP00000349436:p.Asp207Glu	96.0	0.0	.		86.0	32.0	.	NM_001261464	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	ENST00000356955.2	hg19	CCDS1087.1	.	.	.	.	.	.	.	.	.	.	T	17.22	3.333297	0.60853	.	.	ENSG00000143537	ENST00000356955;ENST00000449910;ENST00000359280;ENST00000360674;ENST00000368412;ENST00000355956;ENST00000271836;ENST00000531455	T;T;T;T;T;T;T;T	0.00832	5.81;5.81;5.81;5.73;5.64;5.8;5.78;5.81	5.06	-8.02	0.01118	.	0.000000	0.43579	D	0.000558	T	0.00695	0.0023	N	0.24115	0.695	0.58432	D	0.999998	D;D;D;D;P;D;D;D;P;D	0.89917	0.999;0.999;1.0;1.0;0.867;0.999;0.999;0.999;0.933;0.999	D;D;D;D;P;D;D;D;P;D	0.91635	0.978;0.978;0.986;0.999;0.832;0.99;0.99;0.99;0.886;0.997	T	0.28839	-1.0031	10	0.18710	T	0.47	.	15.9225	0.79586	0.0:0.2266:0.0:0.7734	.	217;224;191;207;207;207;207;207;207;207	E9PN65;B7Z390;B4DMH8;Q13444-10;Q13444-2;Q13444-4;Q13444-5;Q13444-3;Q13444-9;Q13444	.;.;.;.;.;.;.;.;.;ADA15_HUMAN	E	207;207;207;207;207;207;207;217	ENSP00000349436:D207E;ENSP00000403843:D207E;ENSP00000352226:D207E;ENSP00000353892:D207E;ENSP00000357397:D207E;ENSP00000348227:D207E;ENSP00000271836:D207E;ENSP00000432927:D217E	ENSP00000271836:D207E	D	+	3	2	ADAM15	153294898	0.001000	0.12720	0.505000	0.27651	0.980000	0.70556	-2.038000	0.01419	-1.727000	0.01368	0.379000	0.24179	GAT	.	.	.	none		0.587	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815	
EFNA1	1942	hgsc.bcm.edu	37	1	155106478	155106478	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:155106478C>A	ENST00000368407.3	+	5	1071	c.553C>A	c.(553-555)Cca>Aca	p.P185T	EFNA1_ENST00000368406.2_Missense_Mutation_p.P163T|SLC50A1_ENST00000368401.5_5'Flank|EFNA1_ENST00000469878.1_3'UTR|SLC50A1_ENST00000303343.8_5'Flank|SLC50A1_ENST00000484157.1_5'Flank|SLC50A1_ENST00000368404.4_5'Flank	NM_004428.2	NP_004419.2	P20827	EFNA1_HUMAN	ephrin-A1	185					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|ephrin receptor signaling pathway (GO:0048013)|mitral valve morphogenesis (GO:0003183)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|notochord formation (GO:0014028)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of angiogenesis (GO:0045765)|regulation of axonogenesis (GO:0050770)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|substrate adhesion-dependent cell spreading (GO:0034446)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ephrin receptor binding (GO:0046875)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|kidney(1)|lung(1)|skin(1)	5	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)			CAGTGCTGCCCCACGCCTCTT	0.572																																					p.P185T		Atlas-SNP	.											.	EFNA1	10	.	0			c.C553A						PASS	.						122.0	97.0	105.0					1																	155106478		2203	4300	6503	SO:0001583	missense	1942	exon5			GCTGCCCCACGCC		CCDS1091.1, CCDS1092.1	1q21-q22	2011-03-09			ENSG00000169242	ENSG00000169242		"""Ephrins"""	3221	protein-coding gene	gene with protein product		191164		TNFAIP4, EPLG1		2233719, 8660976	Standard	NM_182685		Approved	LERK1, ECKLG	uc001fhh.3	P20827	OTTHUMG00000035312	ENST00000368407.3:c.553C>A	chr1.hg19:g.155106478C>A	ENSP00000357392:p.Pro185Thr	64.0	0.0	.		47.0	14.0	.	NM_004428	D3DV86|Q5SR60|Q5SR61|Q6I9T9|Q8N578	Missense_Mutation	SNP	ENST00000368407.3	hg19	CCDS1091.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965044	0.74131	.	.	ENSG00000169242	ENST00000368407;ENST00000368406	D;D	0.97256	-3.16;-4.31	5.64	5.64	0.86602	.	0.168948	0.53938	D	0.000052	D	0.95535	0.8549	L	0.27053	0.805	0.37000	D	0.8952	D;P	0.60575	0.988;0.915	P;B	0.58721	0.844;0.313	D	0.95458	0.8540	10	0.44086	T	0.13	3.0189	15.557	0.76203	0.0:1.0:0.0:0.0	.	163;185	P20827-2;P20827	.;EFNA1_HUMAN	T	185;163	ENSP00000357392:P185T;ENSP00000357391:P163T	ENSP00000357391:P163T	P	+	1	0	EFNA1	153373102	0.598000	0.26882	1.000000	0.80357	0.983000	0.72400	2.090000	0.41682	2.826000	0.97356	0.561000	0.74099	CCA	.	.	.	none		0.572	EFNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085428.1	NM_004428	
FDPS	2224	hgsc.bcm.edu	37	1	155279709	155279709	+	Silent	SNP	C	C	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:155279709C>T	ENST00000356657.6	+	2	291	c.129C>T	c.(127-129)gcC>gcT	p.A43A	FDPS_ENST00000368356.4_Silent_p.A43A|FDPS_ENST00000447866.1_Intron|FDPS_ENST00000487002.1_3'UTR	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	43					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	CAGTCCTGGCCTGGCACAGTG	0.682																																					p.A43A		Atlas-SNP	.											.	FDPS	41	.	0			c.C129T						PASS	.						16.0	18.0	17.0					1																	155279709		2202	4300	6502	SO:0001819	synonymous_variant	2224	exon2			CCTGGCCTGGCAC	J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.129C>T	chr1.hg19:g.155279709C>T		87.0	0.0	.		75.0	33.0	.	NM_001135821	D3DV91|E9PCI9|Q96G29	Silent	SNP	ENST00000356657.6	hg19	CCDS1110.1																																																																																			.	.	.	none		0.682	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039053.1	NM_002004	
OR10K2	391107	hgsc.bcm.edu	37	1	158390085	158390085	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:158390085T>C	ENST00000314902.2	-	1	571	c.572A>G	c.(571-573)cAt>cGt	p.H191R		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					AAAGTGGTTATGGTGAGATGC	0.438																																					p.H191R		Atlas-SNP	.											.	OR10K2	69	.	0			c.A572G						PASS	.						155.0	136.0	142.0					1																	158390085		2203	4300	6503	SO:0001583	missense	391107	exon1			TGGTTATGGTGAG	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.572A>G	chr1.hg19:g.158390085T>C	ENSP00000324251:p.His191Arg	57.0	0.0	.		127.0	8.0	.	NM_001004476		Missense_Mutation	SNP	ENST00000314902.2	hg19	CCDS30896.1	.	.	.	.	.	.	.	.	.	.	t	3.646	-0.072430	0.07228	.	.	ENSG00000180708	ENST00000314902	T	0.00044	8.83	4.13	2.97	0.34412	GPCR, rhodopsin-like superfamily (1);	0.136917	0.33477	N	0.004876	T	0.00039	0.0001	N	0.14661	0.345	0.09310	N	1	B	0.33883	0.43	B	0.37833	0.259	T	0.00346	-1.1800	10	0.87932	D	0	.	10.0033	0.41942	0.0:0.0:0.1708:0.8292	.	191	Q6IF99	O10K2_HUMAN	R	191	ENSP00000324251:H191R	ENSP00000324251:H191R	H	-	2	0	OR10K2	156656709	0.001000	0.12720	0.006000	0.13384	0.007000	0.05969	1.152000	0.31663	0.710000	0.31997	-0.658000	0.03865	CAT	.	.	.	none		0.438	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476	
SPTA1	6708	hgsc.bcm.edu	37	1	158592846	158592846	+	Missense_Mutation	SNP	C	C	T	rs199993378		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:158592846C>T	ENST00000368147.4	-	43	6227	c.6047G>A	c.(6046-6048)cGc>cAc	p.R2016H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2016					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R2016H(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTGTTCCCAGCGCTTCAGCAG	0.478																																					p.R2016H		Atlas-SNP	.											SPTA1,colon,carcinoma,0,2	SPTA1	720	.	1	Substitution - Missense(1)	lung(1)	c.G6047A						PASS	.	C	HIS/ARG	3,3867		0,3,1932	231.0	230.0	231.0		6047	-1.5	0.6	1		231	1,8273		0,1,4136	yes	missense	SPTA1	NM_003126.2	29	0,4,6068	TT,TC,CC		0.0121,0.0775,0.0329	benign	2016/2420	158592846	4,12140	1935	4137	6072	SO:0001583	missense	6708	exon43			TCCCAGCGCTTCA	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6047G>A	chr1.hg19:g.158592846C>T	ENSP00000357129:p.Arg2016His	74.0	0.0	.		124.0	40.0	.	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.288856	0.23478	7.75E-4	1.21E-4	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.40476	1.03;1.03	4.78	-1.49	0.08718	.	.	.	.	.	T	0.17619	0.0423	L	0.56340	1.77	0.38903	D	0.957367	P	0.47106	0.89	B	0.41723	0.365	T	0.10132	-1.0643	9	0.40728	T	0.16	.	5.6431	0.17575	0.1234:0.5367:0.0:0.3399	.	2016	P02549	SPTA1_HUMAN	H	2016;2013	ENSP00000357130:R2016H;ENSP00000357129:R2013H	ENSP00000357129:R2013H	R	-	2	0	SPTA1	156859470	0.999000	0.42202	0.633000	0.29310	0.020000	0.10135	0.741000	0.26202	-0.360000	0.08138	-0.136000	0.14681	CGC	.	.	.	weak		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
MAPKAPK2	9261	hgsc.bcm.edu	37	1	206905963	206905963	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:206905963A>G	ENST00000367103.3	+	10	1296	c.1103A>G	c.(1102-1104)gAg>gGg	p.E368G	MAPKAPK2_ENST00000294981.4_3'UTR	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	368	p38 MAPK-binding site.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GTTGACTACGAGCAGATCAAG	0.572																																					p.E368G		Atlas-SNP	.											.	MAPKAPK2	45	.	0			c.A1103G						PASS	.						93.0	92.0	93.0					1																	206905963		2203	4300	6503	SO:0001583	missense	9261	exon10			ACTACGAGCAGAT	U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.1103A>G	chr1.hg19:g.206905963A>G	ENSP00000356070:p.Glu368Gly	232.0	0.0	.		199.0	64.0	.	NM_032960	Q5SY30|Q5SY41|Q8IYD6	Missense_Mutation	SNP	ENST00000367103.3	hg19	CCDS31001.1	.	.	.	.	.	.	.	.	.	.	A	18.95	3.732623	0.69189	.	.	ENSG00000162889	ENST00000367103	T	0.49139	0.79	5.33	5.33	0.75918	Protein kinase-like domain (1);	.	.	.	.	T	0.46852	0.1414	M	0.65498	2.005	0.80722	D	1	B	0.32010	0.351	B	0.27887	0.084	T	0.50668	-0.8801	9	0.56958	D	0.05	-27.7491	14.4797	0.67573	1.0:0.0:0.0:0.0	.	368	P49137	MAPK2_HUMAN	G	368	ENSP00000356070:E368G	ENSP00000356070:E368G	E	+	2	0	MAPKAPK2	204972586	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	9.231000	0.95317	2.024000	0.59613	0.533000	0.62120	GAG	.	.	.	none		0.572	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088465.1	NM_004759	
DNAH14	127602	hgsc.bcm.edu	37	1	225445671	225445671	+	Intron	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:225445671T>C	ENST00000445597.2	+	31	5584				DNAH14_ENST00000439375.2_Missense_Mutation_p.L2286S|DNAH14_ENST00000430092.1_Missense_Mutation_p.L2286S			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GGAACTTCATTACTAACTAAT	0.303																																					p.L2286S		Atlas-SNP	.											.	DNAH14	300	.	0			c.T6857C						PASS	.						98.0	88.0	91.0					1																	225445671		692	1591	2283	SO:0001627	intron_variant	127602	exon45			CTTCATTACTAAC	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.5584+5552T>C	chr1.hg19:g.225445671T>C		64.0	0.0	.		64.0	31.0	.	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.244|4.244	0.044341|0.044341	0.08196|0.08196	.|.	.|.	ENSG00000185842|ENSG00000185842	ENST00000430092;ENST00000439375|ENST00000450490	T;T|.	0.30714|.	1.52;1.52|.	3.66|3.66	3.66|3.66	0.41972|0.41972	.|.	.|.	.|.	.|.	.|.	T|T	0.19644|0.19644	0.0472|0.0472	N|N	0.08118|0.08118	0|0	0.26284|0.26284	N|N	0.978228|0.978228	P|.	0.52061|.	0.95|.	P|.	0.49276|.	0.605|.	T|T	0.15263|0.15263	-1.0443|-1.0443	9|5	0.59425|.	D|.	0.04|.	.|.	8.9826|8.9826	0.35974|0.35974	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2286|.	Q0VDD8-4|.	.|.	S|H	2286|58	ENSP00000414402:L2286S;ENSP00000392061:L2286S|.	ENSP00000414402:L2286S|.	L|Y	+|+	2|1	0|0	DNAH14|DNAH14	223512294|223512294	0.003000|0.003000	0.15002|0.15002	0.007000|0.007000	0.13788|0.13788	0.051000|0.051000	0.14879|0.14879	1.426000|1.426000	0.34870|0.34870	1.886000|1.886000	0.54624|0.54624	0.491000|0.491000	0.48974|0.48974	TTA|TAC	.	.	.	none		0.303	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
OR2T34	127068	hgsc.bcm.edu	37	1	248737994	248737995	+	Missense_Mutation	DNP	AG	AG	GT			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:248737994_248737995AG>GT	ENST00000328782.2	-	1	85_86	c.64_65CT>AC	c.(64-66)CTc>ACc	p.L22T		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTCAGCAAAGAGTCCCGTGAGG	0.515																																					p.L22P|p.L22I		Atlas-SNP	.											.	OR2T34	72	.	0			c.T65C|c.C64A						PASS	.																																			SO:0001583	missense	127068	exon1			GCAAAGAGTCCCG|CAAAGAGTCCCGT	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.64_65delinsGT	chr1.hg19:g.248737994_248737995delinsGT	ENSP00000330904:p.Leu22Thr	223.0|219.0	0.0	.		429.0	111.0|110.0	.	NM_001001821	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	hg19	CCDS31120.1																																																																																			.	.	.	none		0.515	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821	
OR2T34	127068	hgsc.bcm.edu	37	1	248738035	248738035	+	Silent	SNP	A	A	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:248738035A>C	ENST00000328782.2	-	1	45	c.24T>G	c.(22-24)tcT>tcG	p.S8S		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTTGATTCTGAGAAGTCTGAT	0.448																																					p.S8S		Atlas-SNP	.											.	OR2T34	72	.	0			c.T24G						PASS	.						46.0	64.0	58.0					1																	248738035		2069	4274	6343	SO:0001819	synonymous_variant	127068	exon1			ATTCTGAGAAGTC	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.24T>G	chr1.hg19:g.248738035A>C		204.0	0.0	.		391.0	118.0	.	NM_001001821	B2RNJ8|Q6IEY5|Q96R31	Silent	SNP	ENST00000328782.2	hg19	CCDS31120.1																																																																																			.	.	.	none		0.448	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821	
GREB1	9687	hgsc.bcm.edu	37	2	11758487	11758487	+	Silent	SNP	G	G	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr2:11758487G>A	ENST00000381486.2	+	22	3786	c.3486G>A	c.(3484-3486)caG>caA	p.Q1162Q	GREB1_ENST00000396123.1_Silent_p.Q160Q|GREB1_ENST00000234142.5_Silent_p.Q1162Q	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1162	Ser-rich.					integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGTCGCCCCAGCCCCGTGGCC	0.697																																					p.Q1162Q	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.G3486A						PASS	.						17.0	20.0	19.0					2																	11758487		1961	4056	6017	SO:0001819	synonymous_variant	9687	exon22			GCCCCAGCCCCGT		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3486G>A	chr2.hg19:g.11758487G>A		224.0	0.0	.		113.0	38.0	.	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Silent	SNP	ENST00000381486.2	hg19	CCDS42655.1																																																																																			.	.	.	none		0.697	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
DNAJC5G	285126	hgsc.bcm.edu	37	2	27500849	27500849	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr2:27500849G>C	ENST00000296097.3	+	4	759	c.341G>C	c.(340-342)aGa>aCa	p.R114T	SLC30A3_ENST00000447008.2_5'Flank|DNAJC5G_ENST00000404433.1_Missense_Mutation_p.R98T|DNAJC5G_ENST00000406962.1_Intron|DNAJC5G_ENST00000402462.1_Missense_Mutation_p.R114T	NM_173650.1	NP_775921.1	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 gamma	114						membrane (GO:0016020)				cervix(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGGCGTCAGATACTATTTT	0.403																																					p.R114T		Atlas-SNP	.											.	DNAJC5G	19	.	0			c.G341C						PASS	.						77.0	76.0	77.0					2																	27500849		2203	4300	6503	SO:0001583	missense	285126	exon4			GCGTCAGATACTA	AF368277	CCDS1744.1	2p23	2011-09-02			ENSG00000163793	ENSG00000163793		"""Heat shock proteins / DNAJ (HSP40)"""	24844	protein-coding gene	gene with protein product		613946					Standard	NM_173650		Approved	FLJ40417, CSP-gamma	uc002rjl.1	Q8N7S2	OTTHUMG00000097079	ENST00000296097.3:c.341G>C	chr2.hg19:g.27500849G>C	ENSP00000296097:p.Arg114Thr	120.0	0.0	.		149.0	53.0	.	NM_173650	B4DY29|Q53SY5|Q8IYQ4|Q96RJ8	Missense_Mutation	SNP	ENST00000296097.3	hg19	CCDS1744.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504325	0.26949	.	.	ENSG00000163793	ENST00000296097;ENST00000402462;ENST00000404433	T;T;T	0.72282	-0.64;-0.64;-0.64	4.96	0.26	0.15588	.	0.389286	0.21364	N	0.075745	T	0.48187	0.1486	N	0.19112	0.55	0.80722	D	1	B	0.12013	0.005	B	0.10450	0.005	T	0.13415	-1.0510	10	0.25106	T	0.35	.	6.3686	0.21469	0.1661:0.6106:0.2233:0.0	.	114	Q8N7S2	DNJ5G_HUMAN	T	114;114;98	ENSP00000296097:R114T;ENSP00000384305:R114T;ENSP00000385829:R98T	ENSP00000296097:R114T	R	+	2	0	DNAJC5G	27354353	0.612000	0.27000	0.938000	0.37757	0.835000	0.47333	1.289000	0.33307	0.116000	0.18110	0.563000	0.77884	AGA	.	.	.	none		0.403	DNAJC5G-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214200.1	NM_173650	
AQP12B	653437	hgsc.bcm.edu	37	2	241622206	241622206	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr2:241622206G>T	ENST00000407834.3	-	1	111	c.49C>A	c.(49-51)Ctc>Atc	p.L17I		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	17						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GCCTCACAGAGGGTGAAGGTG	0.677																																					p.L17I		Atlas-SNP	.											.	AQP12B	33	.	0			c.C49A						PASS	.						49.0	55.0	53.0					2																	241622206		2168	4270	6438	SO:0001583	missense	653437	exon1			CACAGAGGGTGAA	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.49C>A	chr2.hg19:g.241622206G>T	ENSP00000384894:p.Leu17Ile	109.0	0.0	.		64.0	44.0	.	NM_001102467	A4QPB9	Missense_Mutation	SNP	ENST00000407834.3	hg19	CCDS46560.1	.	.	.	.	.	.	.	.	.	.	.	9.399	1.077458	0.20227	.	.	ENSG00000185176	ENST00000407834	T	0.10477	2.87	3.19	2.24	0.28232	.	0.462193	0.22773	N	0.055816	T	0.08313	0.0207	L	0.38175	1.15	0.30214	N	0.797416	B	0.27351	0.176	B	0.26202	0.067	T	0.17806	-1.0357	9	.	.	.	-14.734	9.3887	0.38359	0.0:0.0:0.7749:0.2251	.	17	A6NM10-2	.	I	17	ENSP00000384894:L17I	.	L	-	1	0	AQP12B	241270879	0.017000	0.18338	0.381000	0.26106	0.247000	0.25773	0.485000	0.22324	0.549000	0.28973	0.479000	0.44913	CTC	.	.	.	none		0.677	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325625.1		
BAP1	8314	hgsc.bcm.edu	37	3	52437657	52437657	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr3:52437657C>G	ENST00000460680.1	-	13	1975	c.1504G>C	c.(1504-1506)Gct>Cct	p.A502P	BAP1_ENST00000296288.5_Missense_Mutation_p.A484P	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GAGTTGAAAGCACTGCCGATC	0.642			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.A502P	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.G1504C						PASS	.						48.0	51.0	50.0					3																	52437657		2203	4300	6503	SO:0001583	missense	8314	exon13			TGAAAGCACTGCC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1504G>C	chr3.hg19:g.52437657C>G	ENSP00000417132:p.Ala502Pro	108.0	0.0	.		50.0	41.0	.	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	30	5.055937	0.93793	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000478368	T;T;T	0.64438	-0.07;-0.1;-0.03	6.05	6.05	0.98169	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.000000	0.85682	D	0.000000	T	0.73552	0.3601	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.74375	-0.3686	10	0.87932	D	0	.	20.6086	0.99469	0.0:1.0:0.0:0.0	.	502	Q92560	BAP1_HUMAN	P	502;484;3	ENSP00000417132:A502P;ENSP00000296288:A484P;ENSP00000420647:A3P	ENSP00000296288:A484P	A	-	1	0	BAP1	52412697	1.000000	0.71417	0.994000	0.49952	0.964000	0.63967	7.313000	0.78978	2.880000	0.98712	0.655000	0.94253	GCT	.	.	.	none		0.642	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
CACNA1D	776	hgsc.bcm.edu	37	3	53684852	53684852	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr3:53684852T>G	ENST00000350061.5	+	4	1041	c.530T>G	c.(529-531)tTt>tGt	p.F177C	CACNA1D_ENST00000288139.4_Missense_Mutation_p.F177C|CACNA1D_ENST00000422281.2_Missense_Mutation_p.F177C	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	177					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTCGAGACATTTTTGAAGATT	0.353																																					p.F177C		Atlas-SNP	.											.	CACNA1D	324	.	0			c.T530G						PASS	.						151.0	151.0	151.0					3																	53684852		2203	4300	6503	SO:0001583	missense	776	exon4			AGACATTTTTGAA	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.530T>G	chr3.hg19:g.53684852T>G	ENSP00000288133:p.Phe177Cys	44.0	0.0	.		66.0	57.0	.	NM_001128840	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	hg19	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	t	20.2	3.958340	0.73902	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281	D;D;D	0.98419	-4.92;-4.92;-4.92	5.06	5.06	0.68205	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.97723	0.9253	L	0.60012	1.86	0.80722	D	1	B;P;B	0.47962	0.118;0.903;0.096	B;P;B	0.50136	0.22;0.632;0.072	D	0.98463	1.0597	10	0.87932	D	0	.	15.0208	0.71630	0.0:0.0:0.0:1.0	.	177;177;177	B0FYA3;Q01668;Q01668-2	.;CAC1D_HUMAN;.	C	177	ENSP00000288133:F177C;ENSP00000288139:F177C;ENSP00000409174:F177C	ENSP00000288139:F177C	F	+	2	0	CACNA1D	53659892	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.860000	0.86993	2.139000	0.66308	0.358000	0.22013	TTT	.	.	.	none		0.353	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
CCDC39	339829	hgsc.bcm.edu	37	3	180334122	180334122	+	Silent	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr3:180334122T>C	ENST00000442201.2	-	19	2735	c.2616A>G	c.(2614-2616)acA>acG	p.T872T	TTC14_ENST00000382584.4_Intron|CCDC39_ENST00000273654.4_3'UTR	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	872	Ser-rich.				axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GACTGCCTTTTGTGCTAGCTG	0.378																																					p.T872T		Atlas-SNP	.											.	CCDC39	242	.	0			c.A2616G						PASS	.						112.0	106.0	108.0					3																	180334122		1869	4110	5979	SO:0001819	synonymous_variant	339829	exon19			GCCTTTTGTGCTA	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2616A>G	chr3.hg19:g.180334122T>C		45.0	0.0	.		102.0	70.0	.	NM_181426	B4E2H1	Silent	SNP	ENST00000442201.2	hg19	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	T	4.423	0.078286	0.08485	.	.	ENSG00000145075	ENST00000473854	.	.	.	4.62	-6.0	0.02206	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24799	-1.0150	4	.	.	.	.	1.1368	0.01757	0.2271:0.1119:0.2181:0.4429	.	.	.	.	R	56	.	.	Q	-	2	0	CCDC39	181816816	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.781000	0.04648	-1.154000	0.02825	-0.585000	0.04130	CAA	.	.	.	none		0.378	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
ZNF141	7700	hgsc.bcm.edu	37	4	366865	366865	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr4:366865A>G	ENST00000240499.7	+	4	788	c.639A>G	c.(637-639)atA>atG	p.I213M	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	213					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						GGTCTTTAATATTTAATGAAC	0.358																																					p.I213M		Atlas-SNP	.											.	ZNF141	48	.	0			c.A639G						PASS	.						53.0	60.0	57.0					4																	366865		2178	4293	6471	SO:0001583	missense	7700	exon4			TTTAATATTTAAT	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.639A>G	chr4.hg19:g.366865A>G	ENSP00000240499:p.Ile213Met	59.0	0.0	.		77.0	33.0	.	NM_003441	Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	hg19	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	A	10.31	1.315890	0.23908	.	.	ENSG00000131127	ENST00000240499	T	0.15256	2.44	1.23	-1.64	0.08318	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08179	0.0204	N	0.20986	0.625	0.09310	N	1	P	0.40681	0.727	B	0.35688	0.208	T	0.25606	-1.0127	8	.	.	.	.	4.0674	0.09866	0.6895:0.0:0.0:0.3105	.	213	Q15928	ZN141_HUMAN	M	213	ENSP00000240499:I213M	.	I	+	3	3	ZNF141	356865	0.000000	0.05858	0.006000	0.13384	0.958000	0.62258	-2.175000	0.01263	-0.521000	0.06426	0.254000	0.18369	ATA	.	.	.	none		0.358	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
Unknown	0	hgsc.bcm.edu	37	4	8951827	8951827	+	IGR	SNP	C	C	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr4:8951827C>G								HMX1 (78284 upstream) : AC073648.1 (73231 downstream)																							TGTCCTTTTTCCTTAGCCTGT	0.438																																					p.F117L		Atlas-SNP	.											.	.	.	.	0			c.C351G						PASS	.						32.0	30.0	30.0					4																	8951827		692	1590	2282	SO:0001628	intergenic_variant	0	exon1			CTTTTTCCTTAGC																													chr4.hg19:g.8951827C>G		5.0	0.0	.		8.0	4.0	.	NM_001040071		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.438								
NWD2	57495	hgsc.bcm.edu	37	4	37445619	37445619	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr4:37445619T>C	ENST00000309447.5	+	7	2857	c.2009T>C	c.(2008-2010)aTg>aCg	p.M670T		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		670	NACHT.									breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						ATGGCCAAAATGGGTCTGAGT	0.463																																					p.M670T		Atlas-SNP	.											.	KIAA1239	79	.	0			c.T2009C						PASS	.						65.0	60.0	61.0					4																	37445619		692	1591	2283	SO:0001583	missense	57495	exon7			CCAAAATGGGTCT																												ENST00000309447.5:c.2009T>C	chr4.hg19:g.37445619T>C	ENSP00000309501:p.Met670Thr	81.0	0.0	.		143.0	54.0	.	NM_001144990	A8MRU1	Missense_Mutation	SNP	ENST00000309447.5	hg19	CCDS47040.1	.	.	.	.	.	.	.	.	.	.	T	0.911	-0.719121	0.03182	.	.	ENSG00000174145	ENST00000309447	T	0.79352	-1.26	6.05	4.88	0.63580	.	0.187210	0.52532	D	0.000070	T	0.47040	0.1424	N	0.02011	-0.69	0.34460	D	0.701612	B	0.02656	0.0	B	0.01281	0.0	T	0.52283	-0.8596	10	0.21014	T	0.42	.	4.9096	0.13814	0.0:0.248:0.0:0.752	.	670	Q9ULI1	K1239_HUMAN	T	670	ENSP00000309501:M670T	ENSP00000309501:M670T	M	+	2	0	KIAA1239	37122014	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.630000	0.67805	2.320000	0.78422	0.528000	0.53228	ATG	.	.	.	none		0.463	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347551.2		
N4BP2	55728	hgsc.bcm.edu	37	4	40121601	40121601	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr4:40121601T>C	ENST00000261435.6	+	9	2286	c.1870T>C	c.(1870-1872)Tct>Cct	p.S624P		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	624					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AAATATTTTATCTTTATCTTT	0.323																																					p.S624P		Atlas-SNP	.											.	N4BP2	166	.	0			c.T1870C						PASS	.						42.0	49.0	47.0					4																	40121601		2181	4262	6443	SO:0001583	missense	55728	exon9			ATTTTATCTTTAT	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.1870T>C	chr4.hg19:g.40121601T>C	ENSP00000261435:p.Ser624Pro	182.0	0.0	.		257.0	92.0	.	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	hg19	CCDS3457.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.926|6.926	0.540553|0.540553	0.13250|0.13250	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000513269|ENST00000261435;ENST00000381804	.|T	.|0.19669	.|2.13	4.54|4.54	4.54|4.54	0.55810|0.55810	.|.	.|0.364797	.|0.28815	.|N	.|0.014051	T|T	0.19644|0.19644	0.0472|0.0472	L|L	0.56769|0.56769	1.78|1.78	0.25803|0.25803	N|N	0.984481|0.984481	.|B;B	.|0.14438	.|0.01;0.003	.|B;B	.|0.16722	.|0.016;0.003	T|T	0.11891|0.11891	-1.0569|-1.0569	5|10	.|0.52906	.|T	.|0.07	-9.1621|-9.1621	5.7056|5.7056	0.17907|0.17907	0.1577:0.0:0.1896:0.6527|0.1577:0.0:0.1896:0.6527	.|.	.|624;624	.|Q86UW6-2;Q86UW6	.|.;N4BP2_HUMAN	T|P	270|624;544	.|ENSP00000261435:S624P	.|ENSP00000261435:S624P	I|S	+|+	2|1	0|0	N4BP2|N4BP2	39797996|39797996	0.317000|0.317000	0.24589|0.24589	0.949000|0.949000	0.38748|0.38748	0.075000|0.075000	0.17131|0.17131	2.005000|2.005000	0.40864|0.40864	2.269000|2.269000	0.75478|0.75478	0.454000|0.454000	0.30748|0.30748	ATC|TCT	.	.	.	none		0.323	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
SHROOM3	57619	hgsc.bcm.edu	37	4	77660481	77660481	+	Silent	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr4:77660481T>C	ENST00000296043.6	+	5	2108	c.1155T>C	c.(1153-1155)ccT>ccC	p.P385P		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	385					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CACCCCTGCCTCCAGCTCGGA	0.632																																					p.P385P		Atlas-SNP	.											.	SHROOM3	134	.	0			c.T1155C						PASS	.						43.0	42.0	42.0					4																	77660481		2203	4300	6503	SO:0001819	synonymous_variant	57619	exon5			CCTGCCTCCAGCT	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.1155T>C	chr4.hg19:g.77660481T>C		113.0	0.0	.		91.0	33.0	.	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	hg19	CCDS3579.2																																																																																			.	.	.	none		0.632	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
IL6ST	3572	hgsc.bcm.edu	37	5	55247359	55247359	+	Silent	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr5:55247359T>C	ENST00000381298.2	-	14	2085	c.1773A>G	c.(1771-1773)cgA>cgG	p.R591R	IL6ST_ENST00000522633.2_3'UTR|IL6ST_ENST00000381294.3_Silent_p.R530R|IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000336909.5_Silent_p.R591R|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000502326.3_Silent_p.R591R	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	591	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				ATGCTGCCATTCGTACCATGT	0.383			O		hepatocellular ca																																p.R591R		Atlas-SNP	.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	75	.	0			c.A1773G						PASS	.						142.0	129.0	133.0					5																	55247359		2203	4300	6503	SO:0001819	synonymous_variant	3572	exon14			TGCCATTCGTACC	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.1773A>G	chr5.hg19:g.55247359T>C		36.0	0.0	.		51.0	17.0	.	NM_002184	A0N0L4|Q5FC04|Q9UQ41	Silent	SNP	ENST00000381298.2	hg19	CCDS3971.1																																																																																			.	.	.	none		0.383	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
GFM2	84340	hgsc.bcm.edu	37	5	74017604	74017604	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr5:74017604T>C	ENST00000296805.3	-	21	2673	c.2216A>G	c.(2215-2217)tAt>tGt	p.Y739C	GFM2_ENST00000515125.1_5'UTR|GFM2_ENST00000345239.2_Missense_Mutation_p.Y692C|GFM2_ENST00000509430.1_Missense_Mutation_p.Y739C	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		CACAGTTGAATAACCCTAATC	0.343																																					p.Y739C		Atlas-SNP	.											.	GFM2	38	.	0			c.A2216G						PASS	.						61.0	58.0	59.0					5																	74017604		2203	4300	6503	SO:0001583	missense	84340	exon21			GTTGAATAACCCT	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.2216A>G	chr5.hg19:g.74017604T>C	ENSP00000296805:p.Tyr739Cys	36.0	0.0	.		65.0	32.0	.	NM_032380		Missense_Mutation	SNP	ENST00000296805.3	hg19	CCDS4023.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.965843	0.74131	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000546082;ENST00000509430	T;T;T	0.62105	0.05;0.05;0.05	5.85	5.85	0.93711	Elongation factor G/III/V (1);Translation elongation factor EFG/EF2, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.87581	0.6213	H	0.98577	4.27	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.92382	0.5914	10	0.87932	D	0	-16.682	16.2444	0.82434	0.0:0.0:0.0:1.0	.	737;692;739	Q969S9-3;Q969S9-2;Q969S9	.;.;RRF2M_HUMAN	C	739;692;561;739	ENSP00000296805:Y739C;ENSP00000296804:Y692C;ENSP00000427004:Y739C	ENSP00000296805:Y739C	Y	-	2	0	GFM2	74053360	1.000000	0.71417	1.000000	0.80357	0.675000	0.39556	7.524000	0.81866	2.233000	0.73108	0.455000	0.32223	TAT	.	.	.	none		0.343	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
PCDHGB2	56103	hgsc.bcm.edu	37	5	140741837	140741837	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr5:140741837C>T	ENST00000522605.1	+	1	2135	c.2135C>T	c.(2134-2136)tCc>tTc	p.S712F	PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	712					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGCAATCTCCCTGCGCCTG	0.572																																					p.S712F		Atlas-SNP	.											.	PCDHGB2	196	.	0			c.C2135T						PASS	.						94.0	98.0	97.0					5																	140741837		2036	4193	6229	SO:0001583	missense	56103	exon1			CAATCTCCCTGCG	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2135C>T	chr5.hg19:g.140741837C>T	ENSP00000429018:p.Ser712Phe	163.0	0.0	.		92.0	10.0	.	NM_018923	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	hg19	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	9.528	1.110098	0.20714	.	.	ENSG00000253910	ENST00000522605	T	0.13778	2.56	4.96	3.01	0.34805	.	.	.	.	.	T	0.09291	0.0229	L	0.38175	1.15	0.09310	N	1	B;P	0.48016	0.288;0.904	B;B	0.37198	0.162;0.243	T	0.25916	-1.0118	9	0.87932	D	0	.	4.844	0.13505	0.0:0.4413:0.3815:0.1772	.	712;712	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	F	712	ENSP00000429018:S712F	ENSP00000429018:S712F	S	+	2	0	PCDHGB2	140722021	0.577000	0.26708	0.243000	0.24186	0.540000	0.34992	1.496000	0.35638	1.193000	0.43086	0.461000	0.40582	TCC	.	.	.	none		0.572	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
PCDHGB6	56100	hgsc.bcm.edu	37	5	140788766	140788766	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr5:140788766G>T	ENST00000520790.1	+	1	997	c.997G>T	c.(997-999)Gta>Tta	p.V333L	PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	333	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGTGTAAAGTAATCATAGA	0.398																																					p.V333L		Atlas-SNP	.											.	PCDHGB6	120	.	0			c.G997T						PASS	.						100.0	101.0	101.0					5																	140788766		1895	4117	6012	SO:0001583	missense	56100	exon1			TGTAAAGTAATCA	AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.997G>T	chr5.hg19:g.140788766G>T	ENSP00000428603:p.Val333Leu	263.0	0.0	.		131.0	54.0	.	NM_032100	Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	hg19	CCDS54929.1	.	.	.	.	.	.	.	.	.	.	-	14.96	2.692194	0.48202	.	.	ENSG00000253305	ENST00000520790	T	0.57107	0.42	5.33	3.52	0.40303	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.58438	0.2122	M	0.67700	2.07	0.24431	N	0.994579	P;D	0.54047	0.863;0.964	P;P	0.52554	0.702;0.499	T	0.49615	-0.8921	9	0.49607	T	0.09	.	7.0434	0.25033	0.1481:0.0:0.7137:0.1381	.	333;333	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	L	333	ENSP00000428603:V333L	ENSP00000428603:V333L	V	+	1	0	PCDHGB6	140768950	0.819000	0.29175	0.770000	0.31555	0.968000	0.65278	0.600000	0.24104	0.604000	0.29930	0.460000	0.39030	GTA	.	.	.	none		0.398	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926	
ARHGAP26	23092	hgsc.bcm.edu	37	5	142281604	142281604	+	Splice_Site	SNP	C	C	A	rs142837036		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr5:142281604C>A	ENST00000274498.4	+	7	1080	c.702C>A	c.(700-702)aaC>aaA	p.N234K	ARHGAP26_ENST00000378004.3_Splice_Site_p.N234K	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	234					actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.N234N(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCATACAGAACGTGAGTGGGC	0.463																																					p.N234K		Atlas-SNP	.											ARHGAP26,colon,carcinoma,+1,1	ARHGAP26	57	.	1	Substitution - coding silent(1)	ovary(1)	c.C702A						PASS	.						126.0	111.0	116.0					5																	142281604		2203	4300	6503	SO:0001630	splice_region_variant	23092	exon7			ACAGAACGTGAGT	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.702+1C>A	chr5.hg19:g.142281604C>A		47.0	0.0	.		119.0	40.0	.	NM_015071	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	hg19	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206681	0.58343	.	.	ENSG00000145819	ENST00000274498;ENST00000378004	T;T	0.04015	3.73;3.73	5.49	-7.51	0.01346	.	0.000000	0.85682	D	0.000000	T	0.04543	0.0124	L	0.48218	1.51	0.58432	D	0.999991	P;B	0.42620	0.785;0.18	B;B	0.42827	0.399;0.188	T	0.13845	-1.0494	10	0.19590	T	0.45	.	13.6099	0.62071	0.0:0.2143:0.0:0.7857	.	234;234	Q9UNA1;Q9UNA1-2	RHG26_HUMAN;.	K	234	ENSP00000274498:N234K;ENSP00000367243:N234K	ENSP00000274498:N234K	N	+	3	2	ARHGAP26	142261788	0.998000	0.40836	0.887000	0.34795	0.680000	0.39746	0.442000	0.21628	-1.491000	0.01840	-2.010000	0.00438	AAC	.	C|1.000;T|0.000	.	alt		0.463	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	Missense_Mutation
FAXDC2	10826	hgsc.bcm.edu	37	5	154200926	154200926	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr5:154200926T>C	ENST00000326080.5	-	8	1162	c.739A>G	c.(739-741)Atc>Gtc	p.I247V	FAXDC2_ENST00000517938.1_Missense_Mutation_p.I224V|FAXDC2_ENST00000523997.1_5'Flank	NM_032385.3	NP_115761.2	Q96IV6	FXDC2_HUMAN	fatty acid hydroxylase domain containing 2	247					fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)										CACATGGTGATGGAGGACAAG	0.552																																					p.I247V		Atlas-SNP	.											.	.	.	.	0			c.A739G						PASS	.						187.0	195.0	192.0					5																	154200926		2118	4218	6336	SO:0001583	missense	10826	exon8			TGGTGATGGAGGA	AF159165	CCDS43390.1	5q31-q32	2013-03-04	2013-03-04	2013-03-04	ENSG00000170271	ENSG00000170271		"""Fatty acid hydroxylase domain containing"""	1334	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 4"""	C5orf4		10843801	Standard	NM_032385		Approved	FLJ13758	uc003lvs.4	Q96IV6	OTTHUMG00000164141	ENST00000326080.5:c.739A>G	chr5.hg19:g.154200926T>C	ENSP00000320604:p.Ile247Val	61.0	0.0	.		139.0	52.0	.	NM_032385	B4DIE1|Q9BSX6|Q9H8C7	Missense_Mutation	SNP	ENST00000326080.5	hg19	CCDS43390.1	.	.	.	.	.	.	.	.	.	.	T	2.017	-0.425684	0.04701	.	.	ENSG00000170271	ENST00000326080;ENST00000517938	D;D	0.84660	-1.88;-1.88	5.24	5.24	0.73138	Fatty acid hydroxylase (1);	0.050639	0.85682	D	0.000000	T	0.69223	0.3087	N	0.05487	-0.04	0.80722	D	1	B	0.12013	0.005	B	0.14023	0.01	T	0.64334	-0.6432	10	0.17832	T	0.49	.	11.1394	0.48394	0.0:0.0739:0.0:0.9261	.	247	Q96IV6	CE004_HUMAN	V	247;224	ENSP00000320604:I247V;ENSP00000430286:I224V	ENSP00000320604:I247V	I	-	1	0	C5orf4	154181119	1.000000	0.71417	0.995000	0.50966	0.569000	0.35902	4.848000	0.62874	1.977000	0.57605	0.533000	0.62120	ATC	.	.	.	none		0.552	FAXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377429.1	NM_032385	
DOCK2	1794	hgsc.bcm.edu	37	5	169127100	169127100	+	Silent	SNP	C	C	A	rs141406325	byFrequency	TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr5:169127100C>A	ENST00000256935.8	+	13	1295	c.1215C>A	c.(1213-1215)acC>acA	p.T405T		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	405					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACAGGACCACCGTGGTGGCCA	0.562																																					p.T405T		Atlas-SNP	.											.	DOCK2	389	.	0			c.C1215A						PASS	.						156.0	143.0	148.0					5																	169127100		2203	4300	6503	SO:0001819	synonymous_variant	1794	exon13			GACCACCGTGGTG	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1215C>A	chr5.hg19:g.169127100C>A		20.0	0.0	.		74.0	25.0	.	NM_004946	Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	hg19	CCDS4371.1																																																																																			.	C|0.999;T|0.001	.	alt		0.562	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
PGC	5225	hgsc.bcm.edu	37	6	41712458	41712458	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr6:41712458G>C	ENST00000373025.3	-	2	210	c.148C>G	c.(148-150)Cct>Gct	p.P50A	PGC_ENST00000425343.2_Missense_Mutation_p.P50A	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	50					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			TTCCAAGCAGGATCATACTTG	0.532																																					p.P50A		Atlas-SNP	.											.	PGC	56	.	0			c.C148G						PASS	.						90.0	76.0	81.0					6																	41712458		2203	4300	6503	SO:0001583	missense	5225	exon2			AAGCAGGATCATA		CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.148C>G	chr6.hg19:g.41712458G>C	ENSP00000362116:p.Pro50Ala	62.0	0.0	.		79.0	33.0	.	NM_002630	B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation	SNP	ENST00000373025.3	hg19	CCDS4859.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878022	0.33162	.	.	ENSG00000096088	ENST00000373025;ENST00000424183;ENST00000394278;ENST00000356667;ENST00000425343;ENST00000415707	T;T;T;T	0.65364	1.59;-0.15;0.44;0.44	5.15	4.22	0.49857	Peptidase aspartic (1);	0.459575	0.22142	N	0.064040	T	0.62744	0.2453	M	0.66939	2.045	0.18873	N	0.999988	D	0.71674	0.998	D	0.64687	0.928	T	0.53315	-0.8456	10	0.23302	T	0.38	.	12.4904	0.55897	0.0:0.0:0.8332:0.1668	.	50	P20142	PEPC_HUMAN	A	50;50;50;50;50;54	ENSP00000362116:P50A;ENSP00000349094:P50A;ENSP00000405094:P50A;ENSP00000399429:P54A	ENSP00000349094:P50A	P	-	1	0	PGC	41820436	1.000000	0.71417	0.086000	0.20670	0.005000	0.04900	3.402000	0.52608	2.426000	0.82243	0.555000	0.69702	CCT	.	.	.	none		0.532	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040521.2		
CUL7	9820	hgsc.bcm.edu	37	6	43020188	43020188	+	Missense_Mutation	SNP	G	G	C	rs4711738	byFrequency	TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr6:43020188G>C	ENST00000265348.3	-	2	424	c.339C>G	c.(337-339)gaC>gaG	p.D113E	CUL7_ENST00000535468.1_Missense_Mutation_p.D165E			Q14999	CUL7_HUMAN	cullin 7	113					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGGACTTCACGTCGGTTTCCA	0.612																																					p.D165E		Atlas-SNP	.											.	CUL7	133	.	0			c.C495G						PASS	.						91.0	78.0	83.0					6																	43020188		2203	4300	6503	SO:0001583	missense	9820	exon2			CTTCACGTCGGTT	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.339C>G	chr6.hg19:g.43020188G>C	ENSP00000265348:p.Asp113Glu	74.0	0.0	.		51.0	19.0	.	NM_001168370	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	hg19	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	A	15.26	2.780558	0.49891	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	D;T	0.91180	-2.8;-0.03	5.51	-9.29	0.00653	.	0.176300	0.49916	D	0.000124	D	0.89791	0.6817	L	0.36672	1.1	0.09310	P	0.9999999999999996	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.88870	0.3332	9	0.87932	D	0	-20.9624	25.0489	0.99993	0.2693:0.0:0.7307:0.0	.	165;113	F5H0L1;Q14999	.;CUL7_HUMAN	E	113;165	ENSP00000265348:D113E;ENSP00000438788:D165E	ENSP00000265348:D113E	D	-	3	2	CUL7	43128166	0.000000	0.05858	0.045000	0.18777	0.499000	0.33736	-2.094000	0.01351	-2.277000	0.00677	-1.214000	0.01621	GAC	.	G|0.755;A|0.245	.	alt		0.612	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
PKHD1	5314	hgsc.bcm.edu	37	6	51523921	51523921	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr6:51523921T>A	ENST00000371117.3	-	61	11278	c.11003A>T	c.(11002-11004)gAt>gTt	p.D3668V		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3668					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGTTGGCGAATCACCAATTTC	0.428																																					p.D3668V		Atlas-SNP	.											.	PKHD1	927	.	0			c.A11003T						PASS	.						175.0	161.0	166.0					6																	51523921		2203	4300	6503	SO:0001583	missense	5314	exon61			GGCGAATCACCAA	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.11003A>T	chr6.hg19:g.51523921T>A	ENSP00000360158:p.Asp3668Val	21.0	0.0	.		69.0	25.0	.	NM_138694	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	19.58	3.854844	0.71719	.	.	ENSG00000170927	ENST00000371117	D	0.88896	-2.44	6.03	6.03	0.97812	.	0.148294	0.46758	D	0.000263	D	0.92541	0.7631	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.93498	0.6842	10	0.87932	D	0	.	15.7393	0.77876	0.0:0.0:0.0:1.0	.	3668	P08F94	PKHD1_HUMAN	V	3668	ENSP00000360158:D3668V	ENSP00000360158:D3668V	D	-	2	0	PKHD1	51631880	1.000000	0.71417	0.989000	0.46669	0.860000	0.49131	5.307000	0.65762	2.308000	0.77769	0.533000	0.62120	GAT	.	.	.	none		0.428	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
COL19A1	1310	hgsc.bcm.edu	37	6	70850849	70850849	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr6:70850849G>C	ENST00000322773.4	+	20	1552	c.1450G>C	c.(1450-1452)Gag>Cag	p.E484Q	COL19A1_ENST00000393344.1_Missense_Mutation_p.E106Q	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	484	Collagen-like 4.|Triple-helical region 3 (COL3).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TCCTTAGGGAGAGCCTTTTAC	0.383																																					p.E484Q		Atlas-SNP	.											.	COL19A1	232	.	0			c.G1450C						PASS	.						174.0	188.0	183.0					6																	70850849		2203	4300	6503	SO:0001583	missense	1310	exon20			TAGGGAGAGCCTT		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.1450G>C	chr6.hg19:g.70850849G>C	ENSP00000316030:p.Glu484Gln	32.0	0.0	.		91.0	28.0	.	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	hg19	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.925830	0.34002	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.93906	-3.31;-3.31	4.27	4.27	0.50696	.	0.657664	0.14822	N	0.296417	D	0.92136	0.7507	L	0.52206	1.635	0.80722	D	1	D	0.56746	0.977	P	0.57057	0.812	D	0.88677	0.3199	10	0.16420	T	0.52	.	15.7248	0.77747	0.0:0.0:1.0:0.0	.	484	Q14993	COJA1_HUMAN	Q	484;106	ENSP00000316030:E484Q;ENSP00000377013:E106Q	ENSP00000316030:E484Q	E	+	1	0	COL19A1	70907570	1.000000	0.71417	0.987000	0.45799	0.383000	0.30230	3.488000	0.53229	2.649000	0.89929	0.650000	0.86243	GAG	.	.	.	none		0.383	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
EEF1A1	1915	hgsc.bcm.edu	37	6	74227637	74227637	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr6:74227637T>C	ENST00000316292.9	-	7	2276	c.1285A>G	c.(1285-1287)Atg>Gtg	p.M429V	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Missense_Mutation_p.M429V|EEF1A1_ENST00000309268.6_Missense_Mutation_p.M429V	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	429					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GTCTGTCTCATATCACGAACA	0.403											OREG0003893	type=REGULATORY REGION|Gene=BC038897|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.M429V		Atlas-SNP	.											.	EEF1A1	56	.	0			c.A1285G						PASS	.						46.0	49.0	48.0					6																	74227637		2203	4300	6503	SO:0001583	missense	1915	exon8			GTCTCATATCACG	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1285A>G	chr6.hg19:g.74227637T>C	ENSP00000339063:p.Met429Val	335.0	0.0	.	1151	339.0	134.0	.	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	T	12.31	1.898780	0.33535	.	.	ENSG00000156508	ENST00000316292;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.44482	0.92;0.92;0.92	4.81	4.81	0.61882	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (2);Translation elongation factor EFTu/EF1A, C-terminal (2);	0.000000	0.85682	U	0.000000	T	0.55321	0.1913	H	0.99919	4.95	0.80722	D	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.70208	-0.4935	10	0.87932	D	0	.	10.7978	0.46470	0.0:0.0775:0.0:0.9225	.	429;429;429	P68104;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;EF1A3_HUMAN	V	429;429;429;408	ENSP00000339063:M429V;ENSP00000339053:M429V;ENSP00000330054:M429V	ENSP00000339053:M429V	M	-	1	0	EEF1A1	74284358	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	5.900000	0.69853	1.929000	0.55896	0.454000	0.30748	ATG	.	.	.	weak		0.403	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
LATS1	9113	hgsc.bcm.edu	37	6	150004253	150004253	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr6:150004253G>C	ENST00000543571.1	-	4	2519	c.1972C>G	c.(1972-1974)Cta>Gta	p.L658V	LATS1_ENST00000392273.3_Missense_Mutation_p.L658V|LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Missense_Mutation_p.L658V	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TTACGATGTAGACGCTGCTGA	0.323																																					p.L658V		Atlas-SNP	.											.	LATS1	241	.	0			c.C1972G						PASS	.						71.0	64.0	66.0					6																	150004253		2203	4300	6503	SO:0001583	missense	9113	exon4			GATGTAGACGCTG	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.1972C>G	chr6.hg19:g.150004253G>C	ENSP00000437550:p.Leu658Val	58.0	0.0	.		80.0	24.0	.	NM_001270519		Missense_Mutation	SNP	ENST00000543571.1	hg19	CCDS34551.1	.	.	.	.	.	.	.	.	.	.	G	3.874	-0.027265	0.07589	.	.	ENSG00000131023	ENST00000543571;ENST00000253339;ENST00000392273	T;T;T	0.41758	0.99;0.99;0.99	5.63	5.63	0.86233	.	0.000000	0.45606	D	0.000360	T	0.21718	0.0523	N	0.16790	0.44	0.37536	D	0.91811	B;P;B	0.47191	0.059;0.891;0.012	B;P;B	0.47299	0.008;0.543;0.008	T	0.02220	-1.1193	9	.	.	.	.	13.7301	0.62783	0.08:0.0:0.92:0.0	.	510;658;658	Q59FN4;O95835-2;O95835	.;.;LATS1_HUMAN	V	658	ENSP00000437550:L658V;ENSP00000253339:L658V;ENSP00000444678:L658V	.	L	-	1	2	LATS1	150045946	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.749000	0.55150	2.814000	0.96858	0.655000	0.94253	CTA	.	.	.	none		0.323	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
KIAA1324L	222223	hgsc.bcm.edu	37	7	86568242	86568242	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr7:86568242C>A	ENST00000450689.2	-	7	1067	c.882G>T	c.(880-882)aaG>aaT	p.K294N	KIAA1324L_ENST00000416314.1_Missense_Mutation_p.K127N|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.K54N|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.K294N	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	294						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					ATGTGCCTGGCTTGCAAGGAA	0.463																																					p.K294N		Atlas-SNP	.											.	KIAA1324L	225	.	0			c.G882T						PASS	.						131.0	122.0	125.0					7																	86568242		2203	4300	6503	SO:0001583	missense	222223	exon7			GCCTGGCTTGCAA	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.882G>T	chr7.hg19:g.86568242C>A	ENSP00000413445:p.Lys294Asn	28.0	0.0	.		78.0	40.0	.	NM_001142749	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	hg19	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.96|17.96	3.515588|3.515588	0.64634|0.64634	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	.|T;T;T;T	.|0.49432	.|0.99;0.78;0.99;0.78	5.47|5.47	1.68|1.68	0.24146|0.24146	.|Growth factor, receptor (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.60521|0.60521	0.2275|0.2275	M|M	0.66939|0.66939	2.045|2.045	0.54753|0.54753	D|D	0.999985|0.999985	.|D;D;D	.|0.69078	.|0.997;0.958;0.958	.|D;P;P	.|0.69654	.|0.965;0.663;0.663	T|T	0.59257|0.59257	-0.7488|-0.7488	5|10	.|0.62326	.|D	.|0.03	.|.	9.0638|9.0638	0.36451|0.36451	0.0:0.7011:0.0:0.2989|0.0:0.7011:0.0:0.2989	.|.	.|294;54;127	.|A8MWY0;A8MWY0-2;B4DJV3	.|K132L_HUMAN;.;.	S|N	255|294;54;294;127	.|ENSP00000413445:K294N;ENSP00000297222:K54N;ENSP00000397377:K294N;ENSP00000402390:K127N	.|ENSP00000297222:K54N	A|K	-|-	1|3	0|2	KIAA1324L|KIAA1324L	86406178|86406178	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.898000|0.898000	0.52572|0.52572	0.565000|0.565000	0.23578|0.23578	0.287000|0.287000	0.22375|0.22375	-0.251000|-0.251000	0.11542|0.11542	GCC|AAG	.	.	.	none		0.463	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
PON1	5444	hgsc.bcm.edu	37	7	94931604	94931604	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr7:94931604A>T	ENST00000222381.3	-	8	1053	c.822T>A	c.(820-822)gaT>gaA	p.D274E	PON1_ENST00000542556.1_Missense_Mutation_p.D274E	NM_000446.5	NP_000437.3	P27169	PON1_HUMAN	paraoxonase 1	274					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|dephosphorylation (GO:0016311)|organophosphate catabolic process (GO:0046434)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of binding (GO:0051099)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of transporter activity (GO:0032411)|response to external stimulus (GO:0009605)|response to toxic substance (GO:0009636)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|intracellular membrane-bounded organelle (GO:0043231)|spherical high-density lipoprotein particle (GO:0034366)	aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(11)|pancreas(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	27	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Cefazolin(DB01327)	CTGTCTCAGGATCCACAGATA	0.378																																					p.D274E	GBM(119;715 1622 17358 22490 33240)	Atlas-SNP	.											.	PON1	55	.	0			c.T822A						PASS	.						80.0	79.0	80.0					7																	94931604		2203	4300	6503	SO:0001583	missense	5444	exon8			CTCAGGATCCACA	AF539592	CCDS5638.1	7q21.3	2014-03-14			ENSG00000005421	ENSG00000005421	3.1.1.2	"""Paraoxonases"""	9204	protein-coding gene	gene with protein product	"""esterase A"", ""arylesterase 1"""	168820		PON		8661009, 15450851	Standard	NM_000446		Approved	ESA	uc003uns.3	P27169	OTTHUMG00000153894	ENST00000222381.3:c.822T>A	chr7.hg19:g.94931604A>T	ENSP00000222381:p.Asp274Glu	45.0	0.0	.		86.0	15.0	.	NM_000446	B2RA40|Q16052|Q6B0J6|Q9UCB1	Missense_Mutation	SNP	ENST00000222381.3	hg19	CCDS5638.1	.	.	.	.	.	.	.	.	.	.	A	16.48	3.135537	0.56828	.	.	ENSG00000005421	ENST00000222381;ENST00000542556	T;T	0.58797	0.31;0.31	4.67	-0.246	0.13022	Six-bladed beta-propeller, TolB-like (1);	0.044644	0.85682	D	0.000000	T	0.67767	0.2928	M	0.92367	3.3	0.53005	D	0.999967	D;D	0.57899	0.981;0.968	P;B	0.47941	0.562;0.359	T	0.74937	-0.3494	10	0.87932	D	0	-32.2036	11.0367	0.47804	0.5075:0.0:0.4925:0.0	.	274;274	F5H4W9;P27169	.;PON1_HUMAN	E	274	ENSP00000222381:D274E;ENSP00000444854:D274E	ENSP00000222381:D274E	D	-	3	2	PON1	94769540	0.658000	0.27402	0.985000	0.45067	0.630000	0.37929	-0.167000	0.09940	-0.036000	0.13669	-0.256000	0.11100	GAT	.	.	.	none		0.378	PON1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000332865.2	NM_000446	
TMEM139	135932	hgsc.bcm.edu	37	7	142983809	142983809	+	Silent	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr7:142983809T>C	ENST00000359333.3	+	3	1051	c.538T>C	c.(538-540)Ttg>Ctg	p.L180L	TMEM139_ENST00000409541.1_Silent_p.L180L|AC073342.12_ENST00000446192.1_RNA|TMEM139_ENST00000409102.1_Silent_p.L180L|TMEM139_ENST00000471161.1_3'UTR|AC073342.12_ENST00000427392.1_RNA|TMEM139_ENST00000410004.1_Silent_p.L180L|CASP2_ENST00000392925.2_5'Flank|CASP2_ENST00000310447.5_5'Flank|TMEM139_ENST00000409244.1_Silent_p.L180L	NM_001242775.2|NM_001282876.1|NM_001282877.1	NP_001229704.1|NP_001269805.1|NP_001269806.1	Q8IV31	TM139_HUMAN	transmembrane protein 139	180						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(1)|prostate(1)	7	Melanoma(164;0.059)					TCTGCAGAGCTTGGCGGCAGT	0.562																																					p.L180L		Atlas-SNP	.											.	TMEM139	18	.	0			c.T538C						PASS	.						110.0	99.0	103.0					7																	142983809		2203	4300	6503	SO:0001819	synonymous_variant	135932	exon4			CAGAGCTTGGCGG	AK075067	CCDS5878.1	7q34	2006-03-17			ENSG00000178826	ENSG00000178826			22058	protein-coding gene	gene with protein product							Standard	NM_153345		Approved	FLJ90586	uc003wck.4	Q8IV31	OTTHUMG00000152652	ENST00000359333.3:c.538T>C	chr7.hg19:g.142983809T>C		102.0	0.0	.		128.0	39.0	.	NM_001242773	B2RCL5|D3DXD4|Q6ZME2|Q8NC22|Q96AU8	Silent	SNP	ENST00000359333.3	hg19	CCDS5878.1																																																																																			.	.	.	none		0.562	TMEM139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327145.1	NM_153345	
CLCN1	1180	hgsc.bcm.edu	37	7	143047464	143047464	+	Splice_Site	SNP	G	G	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr7:143047464G>T	ENST00000343257.2	+	21	2490		c.e21-1			NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1						chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					CTGGCTGACAGATTGAGGCCT	0.557																																					.		Atlas-SNP	.											.	CLCN1	141	.	0			c.2404-1G>T						PASS	.						66.0	58.0	61.0					7																	143047464		2203	4300	6503	SO:0001630	splice_region_variant	1180	exon21			CTGACAGATTGAG	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2404-1G>T	chr7.hg19:g.143047464G>T		59.0	0.0	.		77.0	46.0	.	NM_000083	A4D2H5|Q2M202	Splice_Site	SNP	ENST00000343257.2	hg19	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469487	0.63625	.	.	ENSG00000188037	ENST00000343257	.	.	.	4.4	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1768	0.86844	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CLCN1	142757586	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	8.823000	0.92018	2.302000	0.77476	0.462000	0.41574	.	.	.	.	none		0.557	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	Intron
MTUS1	57509	hgsc.bcm.edu	37	8	17613134	17613134	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:17613134G>C	ENST00000262102.6	-	2	407	c.183C>G	c.(181-183)gaC>gaG	p.D61E	MTUS1_ENST00000381862.3_Missense_Mutation_p.D61E|MTUS1_ENST00000519263.1_Missense_Mutation_p.D61E|MTUS1_ENST00000381869.3_Missense_Mutation_p.D61E	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	61					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		CTACAGCAGGGTCAGTTTCAT	0.413																																					p.D61E		Atlas-SNP	.											.	MTUS1	144	.	0			c.C183G						PASS	.						159.0	148.0	152.0					8																	17613134		1882	4117	5999	SO:0001583	missense	57509	exon2			AGCAGGGTCAGTT	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.183C>G	chr8.hg19:g.17613134G>C	ENSP00000262102:p.Asp61Glu	100.0	0.0	.		105.0	13.0	.	NM_001001924	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	hg19	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	g	13.81	2.347152	0.41599	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.21361	2.99;2.99;2.99;2.01	3.82	2.92	0.33932	.	1.076460	0.07367	N	0.885099	T	0.13200	0.0320	N	0.24115	0.695	0.09310	N	1	P;B;B	0.36535	0.557;0.341;0.341	B;B;B	0.30495	0.116;0.059;0.059	T	0.21724	-1.0237	10	0.72032	D	0.01	0.0574	5.5626	0.17152	0.2502:0.0:0.7498:0.0	.	61;61;61	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	E	61	ENSP00000371293:D61E;ENSP00000262102:D61E;ENSP00000430167:D61E;ENSP00000371286:D61E	ENSP00000262102:D61E	D	-	3	2	MTUS1	17657414	0.000000	0.05858	0.131000	0.22000	0.459000	0.32528	0.483000	0.22292	1.149000	0.42402	0.558000	0.71614	GAC	.	.	.	none		0.413	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
SNAI2	6591	hgsc.bcm.edu	37	8	49831524	49831524	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:49831524G>T	ENST00000396822.1	-	4	1006	c.649C>A	c.(649-651)Cac>Aac	p.H217N	SNAI2_ENST00000020945.1_Missense_Mutation_p.H217N			O43623	SNAI2_HUMAN	snail family zinc finger 2	217					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CTGTTGCAGTGAGGGCAAGAA	0.423																																					p.H217N		Atlas-SNP	.											.	SNAI2	53	.	0			c.C649A						PASS	.						80.0	80.0	80.0					8																	49831524		2203	4300	6503	SO:0001583	missense	6591	exon3			TGCAGTGAGGGCA	U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.649C>A	chr8.hg19:g.49831524G>T	ENSP00000380034:p.His217Asn	33.0	0.0	.		38.0	10.0	.	NM_003068	B2R6P6|Q53FC1	Missense_Mutation	SNP	ENST00000396822.1	hg19	CCDS6146.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443898	0.83993	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.07327	3.2;3.2	5.22	5.22	0.72569	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.13200	0.0320	L	0.45051	1.395	0.80722	D	1	P	0.37370	0.592	B	0.41135	0.348	T	0.01814	-1.1268	10	0.72032	D	0.01	-12.9153	18.7761	0.91912	0.0:0.0:1.0:0.0	.	217	O43623	SNAI2_HUMAN	N	217	ENSP00000020945:H217N;ENSP00000380034:H217N	ENSP00000020945:H217N	H	-	1	0	SNAI2	49994077	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.430000	0.82344	0.650000	0.86243	CAC	.	.	.	none		0.423	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313873.2	NM_003068	
CRH	1392	hgsc.bcm.edu	37	8	67089639	67089639	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:67089639A>G	ENST00000276571.3	-	2	520	c.74T>C	c.(73-75)cTc>cCc	p.L25P		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	25					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	GCGGCTCAGGAGCGCCCTGCA	0.726											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L25P		Atlas-SNP	.											.	CRH	8	.	0			c.T74C						PASS	.						2.0	2.0	2.0					8																	67089639		1380	3141	4521	SO:0001583	missense	1392	exon2			CTCAGGAGCGCCC		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.74T>C	chr8.hg19:g.67089639A>G	ENSP00000276571:p.Leu25Pro	100.0	0.0	.	1096	50.0	19.0	.	NM_000756	B3KQS4	Missense_Mutation	SNP	ENST00000276571.3	hg19	CCDS6188.1	.	.	.	.	.	.	.	.	.	.	A	10.74	1.434760	0.25813	.	.	ENSG00000147571	ENST00000276571	.	.	.	5.59	4.43	0.53597	.	0.209947	0.40908	D	0.000995	T	0.65668	0.2713	M	0.67953	2.075	0.58432	D	0.999999	D	0.53885	0.963	P	0.54401	0.751	T	0.67722	-0.5597	9	0.87932	D	0	.	9.8159	0.40851	0.8272:0.1728:0.0:0.0	.	25	P06850	CRF_HUMAN	P	25	.	ENSP00000276571:L25P	L	-	2	0	CRH	67252193	1.000000	0.71417	0.880000	0.34516	0.177000	0.22998	3.898000	0.56281	0.937000	0.37394	-0.418000	0.06021	CTC	.	.	.	none		0.726	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
ESRP1	54845	hgsc.bcm.edu	37	8	95653652	95653652	+	Nonsense_Mutation	SNP	A	A	T	rs548563810		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:95653652A>T	ENST00000433389.2	+	1	296	c.106A>T	c.(106-108)Aaa>Taa	p.K36*	ESRP1_ENST00000423620.2_Nonsense_Mutation_p.K36*|RP11-22C11.2_ENST00000562760.1_RNA|ESRP1_ENST00000454170.2_Nonsense_Mutation_p.K36*|ESRP1_ENST00000358397.5_Nonsense_Mutation_p.K36*	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	36					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						GCTGTTCTGGAAAGTCGTGGA	0.537																																					p.K36X		Atlas-SNP	.											.	ESRP1	148	.	0			c.A106T						PASS	.						92.0	93.0	93.0					8																	95653652		1921	4129	6050	SO:0001587	stop_gained	54845	exon1			TTCTGGAAAGTCG	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.106A>T	chr8.hg19:g.95653652A>T	ENSP00000405738:p.Lys36*	88.0	0.0	.		57.0	28.0	.	NM_001122827	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Nonsense_Mutation	SNP	ENST00000433389.2	hg19	CCDS47897.1	.	.	.	.	.	.	.	.	.	.	A	38	7.048454	0.98029	.	.	ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170	.	.	.	4.95	2.37	0.29283	.	0.269234	0.36444	N	0.002599	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5406	7.2173	0.25967	0.7766:0.145:0.0784:0.0	.	.	.	.	X	36	.	ENSP00000351168:K36X	K	+	1	0	ESRP1	95722828	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.272000	0.43373	0.710000	0.31997	0.533000	0.62120	AAA	.	.	.	none		0.537	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
OXR1	55074	hgsc.bcm.edu	37	8	107670240	107670240	+	Intron	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:107670240A>G	ENST00000442977.2	+	3	322				OXR1_ENST00000531443.1_Intron|OXR1_ENST00000312046.6_Missense_Mutation_p.E9G|OXR1_ENST00000452423.2_Intron|OXR1_ENST00000445937.1_Intron|OXR1_ENST00000497705.1_Intron|OXR1_ENST00000517566.2_Intron|RP11-649G15.2_ENST00000518591.1_RNA	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1						adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			ACGTTCACCGAGAAGAGTGGG	0.701																																					p.E9G		Atlas-SNP	.											.	OXR1	190	.	0			c.A26G						PASS	.						6.0	10.0	9.0					8																	107670240		662	1568	2230	SO:0001627	intron_variant	55074	exon1			TCACCGAGAAGAG	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.224-21198A>G	chr8.hg19:g.107670240A>G		413.0	0.0	.		217.0	89.0	.	NM_181354	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	ENST00000442977.2	hg19	CCDS56548.1	.	.	.	.	.	.	.	.	.	.	A	0.018	-1.470777	0.01044	.	.	ENSG00000164830	ENST00000312046	T	0.10005	2.92	4.0	1.95	0.26073	.	.	.	.	.	T	0.03695	0.0105	.	.	.	0.24866	N	0.992312	B	0.02656	0.0	B	0.01281	0.0	T	0.43442	-0.9391	8	0.02654	T	1	.	6.6439	0.22925	0.1057:0.1789:0.7154:0.0	.	9	Q8N573-2	.	G	9	ENSP00000311026:E9G	ENSP00000311026:E9G	E	+	2	0	OXR1	107739416	0.992000	0.36948	0.738000	0.30950	0.020000	0.10135	2.097000	0.41748	0.877000	0.35895	-0.313000	0.08912	GAG	.	.	.	none		0.701	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
EBAG9	9166	hgsc.bcm.edu	37	8	110567083	110567083	+	Missense_Mutation	SNP	G	G	T	rs370306388		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:110567083G>T	ENST00000337573.5	+	4	588	c.288G>T	c.(286-288)aaG>aaT	p.K96N	EBAG9_ENST00000529502.1_3'UTR|EBAG9_ENST00000531677.1_Missense_Mutation_p.K96N|EBAG9_ENST00000395785.2_Missense_Mutation_p.K96N	NM_001278938.1|NM_004215.3	NP_001265867.1|NP_004206.1	O00559	RCAS1_HUMAN	estrogen receptor binding site associated, antigen, 9	96					regulation of cell growth (GO:0001558)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	peptidase activator activity involved in apoptotic process (GO:0016505)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)	10			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			ACTATTTTAAGGACATGACAC	0.363																																					p.K96N		Atlas-SNP	.											.	EBAG9	23	.	0			c.G288T						PASS	.						126.0	116.0	119.0					8																	110567083		2203	4300	6503	SO:0001583	missense	9166	exon4			TTTTAAGGACATG	AB007619	CCDS6313.1	8q23	2013-03-07			ENSG00000147654	ENSG00000147654			3123	protein-coding gene	gene with protein product		605772					Standard	NM_004215		Approved	EB9, RCAS1	uc003ynf.3	O00559	OTTHUMG00000165346	ENST00000337573.5:c.288G>T	chr8.hg19:g.110567083G>T	ENSP00000337675:p.Lys96Asn	36.0	0.0	.		114.0	5.0	.	NM_004215	A8K3N6|Q5Y8C7|Q6IB20|Q9BS76	Missense_Mutation	SNP	ENST00000337573.5	hg19	CCDS6313.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480071	0.63849	.	.	ENSG00000147654	ENST00000395785;ENST00000337573;ENST00000530629;ENST00000531677	.	.	.	5.53	2.09	0.27110	.	0.000000	0.85682	D	0.000000	T	0.64538	0.2607	L	0.52266	1.64	0.58432	D	0.999994	D	0.89917	1.0	D	0.83275	0.996	T	0.62932	-0.6749	9	0.62326	D	0.03	9.6559	5.8258	0.18552	0.261:0.0:0.5919:0.1471	.	96	O00559	RCAS1_HUMAN	N	96	.	ENSP00000337675:K96N	K	+	3	2	EBAG9	110636259	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.315000	0.33608	0.739000	0.32628	-0.181000	0.13052	AAG	.	.	.	alt		0.363	EBAG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383536.1	NM_004215	
ZFAT	57623	hgsc.bcm.edu	37	8	135521962	135521962	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:135521962A>G	ENST00000377838.3	-	15	3566	c.3392T>C	c.(3391-3393)aTc>aCc	p.I1131T	ZFAT_ENST00000429442.2_Missense_Mutation_p.I1119T|ZFAT_ENST00000520214.1_Missense_Mutation_p.I1119T|ZFAT_ENST00000517307.1_5'Flank|ZFAT_ENST00000523399.1_Missense_Mutation_p.I1069T|ZFAT_ENST00000520727.1_Missense_Mutation_p.I1119T|ZFAT_ENST00000520356.1_Intron	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	1131					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CTGCTGCAGGATGTTCACGGC	0.587																																					p.I1131T		Atlas-SNP	.											.	ZFAT	265	.	0			c.T3392C						PASS	.						118.0	122.0	121.0					8																	135521962		2085	4214	6299	SO:0001583	missense	57623	exon15			TGCAGGATGTTCA	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.3392T>C	chr8.hg19:g.135521962A>G	ENSP00000367069:p.Ile1131Thr	53.0	0.0	.		40.0	15.0	.	NM_020863	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	hg19	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.471547	0.84533	.	.	ENSG00000066827	ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000521673;ENST00000318135;ENST00000523399	T;T;T;T;T	0.16457	2.84;2.34;2.75;2.84;2.78	5.81	5.81	0.92471	.	0.112528	0.64402	D	0.000017	T	0.29126	0.0724	L	0.29908	0.895	0.51767	D	0.999935	D;D;D	0.76494	0.993;0.999;0.999	D;D;D	0.78314	0.977;0.991;0.991	T	0.02821	-1.1106	10	0.24483	T	0.36	-26.8601	15.3472	0.74346	1.0:0.0:0.0:0.0	.	250;1069;1131	B7Z741;E9PER3;Q9P243	.;.;ZFAT_HUMAN	T	1119;1119;1131;1119;51;1018;1069	ENSP00000427831:I1119T;ENSP00000394501:I1119T;ENSP00000367069:I1131T;ENSP00000428483:I1119T;ENSP00000429091:I1069T	ENSP00000326997:I1018T	I	-	2	0	ZFAT	135591144	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	6.820000	0.75267	2.221000	0.72209	0.455000	0.32223	ATC	.	.	.	none		0.587	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
PTK2	5747	hgsc.bcm.edu	37	8	141685559	141685559	+	Splice_Site	SNP	C	C	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:141685559C>T	ENST00000522684.1	-	28	2831	c.2602G>A	c.(2602-2604)Gat>Aat	p.D868N	PTK2_ENST00000395218.2_Missense_Mutation_p.G868S|PTK2_ENST00000430260.2_Splice_Site_p.D178N|PTK2_ENST00000538769.1_Splice_Site_p.D536N|PTK2_ENST00000521059.1_Splice_Site_p.D868N|PTK2_ENST00000340930.3_Missense_Mutation_p.G868S|PTK2_ENST00000519465.1_Splice_Site_p.D496N|PTK2_ENST00000519419.1_Splice_Site_p.D912N|PTK2_ENST00000517887.1_Splice_Site_p.D912N|PTK2_ENST00000535192.1_Splice_Site_p.D822N	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	868	Interaction with TGFB1I1.|Pro-rich.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TCTTCTTTACCTGGTTTACCC	0.383																																					p.D890N		Atlas-SNP	.											.	PTK2	311	.	0			c.G2668A						PASS	.						169.0	146.0	153.0					8																	141685559		2203	4300	6503	SO:0001630	splice_region_variant	5747	exon28			CTTTACCTGGTTT	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.2602+1G>A	chr8.hg19:g.141685559C>T		85.0	0.0	.		86.0	32.0	.	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	hg19	CCDS6381.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	33|33|33	5.217585|5.217585|5.217585	0.95104|0.95104|0.95104	.|.|.	.|.|.	ENSG00000169398|ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000538769;ENST00000519419;ENST00000430260;ENST00000521986|ENST00000395218;ENST00000340930|ENST00000519654	T;T;T;T;T;T;T;T;T;T|T;T|.	0.75821|0.74209|.	-0.93;-0.97;-0.93;-0.93;-0.93;-0.91;-0.91;-0.93;1.48;-0.92|-0.82;-0.81|.	5.73|5.73|5.73	5.73|5.73|5.73	0.89815|0.89815|0.89815	.|.|.	0.045906|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.66416|0.66416|0.66416	0.2787|0.2787|0.2787	L|L|L	0.36672|0.36672|0.36672	1.1|1.1|1.1	0.80722|0.80722|0.80722	D|D|D	1|1|1	B;P;P;P;B;B;B;B;B|D|.	0.38788|0.89917|.	0.0;0.647;0.561;0.611;0.418;0.0;0.0;0.112;0.177|1.0|.	B;B;B;B;B;B;B;B;B|D|.	0.41440|0.78314|.	0.003;0.357;0.169;0.159;0.157;0.003;0.003;0.048;0.159|0.991|.	T|T|T	0.60296|0.60296|0.60296	-0.7291|-0.7291|-0.7291	10|9|5	0.41790|0.08381|.	T|T|.	0.15|0.77|.	.|.|.	19.8869|19.8869|19.8869	0.96915|0.96915|0.96915	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	563;788;868;890;822;820;695;536;496|868|.	B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4|B4E2N6|.	.;.;FAK1_HUMAN;.;.;.;.;.;.|.|.	N|S|K	868;822;496;912;868;820;789;563;540;536;912;178;566|868|832	ENSP00000429911:D868N;ENSP00000438009:D822N;ENSP00000429170:D496N;ENSP00000429082:D912N;ENSP00000429474:D868N;ENSP00000428492:D540N;ENSP00000445742:D536N;ENSP00000429129:D912N;ENSP00000403416:D178N;ENSP00000430603:D566N|ENSP00000378644:G868S;ENSP00000341189:G868S|.	ENSP00000346424:D789N|ENSP00000341189:G868S|.	D|G|R	-|-|-	1|1|2	0|0|0	PTK2|PTK2|PTK2	141754741|141754741|141754741	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.993000|0.993000|0.993000	0.82548|0.82548|0.82548	7.332000|7.332000|7.332000	0.79203|0.79203|0.79203	2.693000|2.693000|2.693000	0.91896|0.91896|0.91896	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAT|GGT|AGA	.	.	.	none		0.383	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	Missense_Mutation
GPT	2875	hgsc.bcm.edu	37	8	145732381	145732381	+	Nonstop_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:145732381T>C	ENST00000528431.1	+	12	1646	c.1489T>C	c.(1489-1491)Tga>Cga	p.*497R	MFSD3_ENST00000301327.4_5'Flank|GPT_ENST00000394955.2_Nonstop_Mutation_p.*497R			P24298	ALAT1_HUMAN	glutamic-pyruvate transaminase (alanine aminotransferase)	0					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|Phenelzine(DB00780)	CGAGTACTCCTGAGCACCCCA	0.617																																					p.X497R		Atlas-SNP	.											.	GPT	31	.	0			c.T1489C						PASS	.						44.0	45.0	45.0					8																	145732381		2201	4300	6501	SO:0001578	stop_lost	2875	exon11			TACTCCTGAGCAC		CCDS6430.1	8q24.3	2013-09-19			ENSG00000167701	ENSG00000167701	2.6.1.2		4552	protein-coding gene	gene with protein product		138200					Standard	NM_005309		Approved	ALT1, GPT1	uc003zdh.4	P24298	OTTHUMG00000165176	ENST00000528431.1:c.1489T>C	chr8.hg19:g.145732381T>C	ENSP00000433586:p.*497Argext*?	135.0	0.0	.		86.0	32.0	.	NM_005309	B0YJ18|D3DWM7|P78398|Q93076	Missense_Mutation	SNP	ENST00000528431.1	hg19	CCDS6430.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.819054	0.32145	.	.	ENSG00000167701	ENST00000528431;ENST00000394955	.	.	.	4.68	4.68	0.58851	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0974	0.53763	0.0:0.0:0.0:1.0	.	.	.	.	R	497	.	.	X	+	1	0	GPT	145703189	1.000000	0.71417	0.992000	0.48379	0.454000	0.32378	2.085000	0.41634	1.736000	0.51660	0.459000	0.35465	TGA	.	.	.	none		0.617	GPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382471.1		
SMARCA2	6595	hgsc.bcm.edu	37	9	2115822	2115822	+	Splice_Site	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr9:2115822G>C	ENST00000382203.1	+	25	3666	c.3457G>C	c.(3457-3459)Gat>Cat	p.D1153H	SMARCA2_ENST00000357248.2_Splice_Site_p.D1153H|SMARCA2_ENST00000349721.2_Splice_Site_p.D1153H|SMARCA2_ENST00000382194.1_Splice_Site_p.D1153H			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1153	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CCCCAAACAGGATCTGCAGGC	0.562																																					p.D1153H		Atlas-SNP	.											.	SMARCA2	313	.	0			c.G3457C						PASS	.						24.0	23.0	23.0					9																	2115822		2203	4300	6503	SO:0001630	splice_region_variant	6595	exon25			AAACAGGATCTGC	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3457-1G>C	chr9.hg19:g.2115822G>C		130.0	0.0	.		236.0	84.0	.	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	hg19	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868893	0.72065	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94	5.67	5.67	0.87782	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.91838	0.7417	H	0.97611	4.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	D	0.94201	0.7450	9	.	.	.	-30.3516	19.7699	0.96359	0.0:0.0:1.0:0.0	.	754;1153;1153	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	H	1153	ENSP00000265773:D1153H;ENSP00000349788:D1153H;ENSP00000371638:D1153H;ENSP00000371629:D1153H	.	D	+	1	0	SMARCA2	2105822	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.869000	0.99810	2.680000	0.91292	0.563000	0.77884	GAT	.	.	.	none		0.562	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	Missense_Mutation
TLN1	7094	hgsc.bcm.edu	37	9	35706215	35706215	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr9:35706215T>C	ENST00000314888.9	-	40	5692	c.5339A>G	c.(5338-5340)aAg>aGg	p.K1780R	TLN1_ENST00000540444.1_Missense_Mutation_p.K1764R|TLN1_ENST00000464379.1_Intron	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1780	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ACCAGCCTCCTTGGCAGTGTA	0.567																																					p.K1780R		Atlas-SNP	.											.	TLN1	185	.	0			c.A5339G						PASS	.						141.0	142.0	141.0					9																	35706215		2203	4300	6503	SO:0001583	missense	7094	exon40			GCCTCCTTGGCAG	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.5339A>G	chr9.hg19:g.35706215T>C	ENSP00000316029:p.Lys1780Arg	29.0	0.0	.		32.0	7.0	.	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	T	19.31	3.802610	0.70682	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.17213	2.29;2.29	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.30696	0.0773	L	0.56769	1.78	0.80722	D	1	D	0.60575	0.988	P	0.54401	0.751	T	0.01684	-1.1296	10	0.41790	T	0.15	-22.297	15.0599	0.71944	0.0:0.0:0.0:1.0	.	1780	Q9Y490	TLN1_HUMAN	R	1780;1764	ENSP00000316029:K1780R;ENSP00000442981:K1764R	ENSP00000316029:K1780R	K	-	2	0	TLN1	35696215	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.036000	0.88901	2.033000	0.60031	0.454000	0.30748	AAG	.	.	.	none		0.567	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
TJP2	9414	hgsc.bcm.edu	37	9	71855017	71855017	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr9:71855017T>G	ENST00000377245.4	+	17	2728	c.2520T>G	c.(2518-2520)ttT>ttG	p.F840L	TJP2_ENST00000535702.1_Missense_Mutation_p.F844L|TJP2_ENST00000453658.2_Missense_Mutation_p.F817L|TJP2_ENST00000265384.7_Missense_Mutation_p.F840L|TJP2_ENST00000348208.4_Missense_Mutation_p.F840L|TJP2_ENST00000539225.1_Missense_Mutation_p.F871L	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	840	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						GAAAGTTATTTGATCAAGCCA	0.353																																					p.F871L		Atlas-SNP	.											.	TJP2	120	.	0			c.T2613G						PASS	.						67.0	66.0	66.0					9																	71855017		2203	4300	6503	SO:0001583	missense	9414	exon17			GTTATTTGATCAA	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.2520T>G	chr9.hg19:g.71855017T>G	ENSP00000366453:p.Phe840Leu	50.0	0.0	.		74.0	14.0	.	NM_001170416	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	ENST00000377245.4	hg19	CCDS6627.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.254434	0.59212	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000265384;ENST00000535702;ENST00000539225	T;T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35;2.35	5.93	0.821	0.18799	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.263501	0.38837	N	0.001554	T	0.13030	0.0316	L	0.29908	0.895	0.36065	D	0.841715	B;B;B;B;B	0.32188	0.073;0.026;0.073;0.066;0.359	B;B;B;B;B	0.36092	0.053;0.138;0.053;0.217;0.157	T	0.16305	-1.0407	10	0.45353	T	0.12	.	10.2592	0.43416	0.0:0.2837:0.0:0.7163	.	871;844;840;840;840	F5H301;F5H886;Q9UDY2-2;Q9UDY2;Q9UDY2-5	.;.;.;ZO2_HUMAN;.	L	817;840;840;840;844;871	ENSP00000392178:F817L;ENSP00000366453:F840L;ENSP00000345893:F840L;ENSP00000265384:F840L;ENSP00000442090:F844L;ENSP00000438262:F871L	ENSP00000265384:F840L	F	+	3	2	TJP2	71044837	0.944000	0.32072	0.950000	0.38849	0.987000	0.75469	0.031000	0.13710	-0.088000	0.12506	0.533000	0.62120	TTT	.	.	.	none		0.353	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	NM_201629	
TMEM245	23731	hgsc.bcm.edu	37	9	111849612	111849612	+	Silent	SNP	G	G	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr9:111849612G>A	ENST00000374586.3	-	6	1192	c.1161C>T	c.(1159-1161)ctC>ctT	p.L387L		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	387						integral component of membrane (GO:0016021)											CAAGCTTTTTGAGTATCCAGA	0.358																																					p.L387L		Atlas-SNP	.											.	.	.	.	0			c.C1161T						PASS	.						72.0	65.0	67.0					9																	111849612		1808	4078	5886	SO:0001819	synonymous_variant	23731	exon6			CTTTTTGAGTATC	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1161C>T	chr9.hg19:g.111849612G>A		35.0	0.0	.		64.0	23.0	.	NM_032012	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Silent	SNP	ENST00000374586.3	hg19	CCDS43858.1																																																																																			.	.	.	none		0.358	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053587.2	NM_032012	
DENND1A	57706	hgsc.bcm.edu	37	9	126143930	126143930	+	Silent	SNP	C	C	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr9:126143930C>T	ENST00000373624.2	-	22	3012	c.2811G>A	c.(2809-2811)aaG>aaA	p.K937K	DENND1A_ENST00000542603.1_Silent_p.K722K|DENND1A_ENST00000394219.3_Silent_p.K948K|DENND1A_ENST00000473039.1_5'UTR	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	937	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						CCAGCCCCTGCTTGGTCTCAG	0.692																																					p.K937K		Atlas-SNP	.											.	DENND1A	112	.	0			c.G2811A						PASS	.						10.0	13.0	12.0					9																	126143930		2174	4283	6457	SO:0001819	synonymous_variant	57706	exon22			CCCCTGCTTGGTC	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.2811G>A	chr9.hg19:g.126143930C>T		176.0	0.0	.		91.0	24.0	.	NM_020946	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Silent	SNP	ENST00000373624.2	hg19	CCDS35133.1																																																																																			.	.	.	none		0.692	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820	
ABL1	25	hgsc.bcm.edu	37	9	133748374	133748374	+	Silent	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr9:133748374T>C	ENST00000318560.5	+	6	1416	c.1035T>C	c.(1033-1035)acT>acC	p.T345T		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	345	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	ACATGGCCACTCAGATCTCGT	0.582			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.T364T		Atlas-SNP	.		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	.	ABL1	1632	.	0			c.T1092C						PASS	.						72.0	58.0	63.0					9																	133748374		2203	4300	6503	SO:0001819	synonymous_variant	25	exon6			GGCCACTCAGATC	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1035T>C	chr9.hg19:g.133748374T>C		71.0	0.0	.		105.0	34.0	.	NM_007313	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Silent	SNP	ENST00000318560.5	hg19	CCDS35166.1																																																																																			.	.	.	none		0.582	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
PPP1R26	9858	hgsc.bcm.edu	37	9	138379517	138379517	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr9:138379517G>C	ENST00000356818.2	+	4	3710	c.3161G>C	c.(3160-3162)gGc>gCc	p.G1054A	PPP1R26_ENST00000605660.1_Missense_Mutation_p.G1054A|PPP1R26_ENST00000605286.1_Missense_Mutation_p.G1054A|PPP1R26_ENST00000401470.3_Missense_Mutation_p.G1054A|PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000604351.1_Missense_Mutation_p.G1054A	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	1054					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										TGGAGGGGGGGCGTCGGGAGC	0.731																																					p.G1054A		Atlas-SNP	.											.	.	.	.	0			c.G3161C						PASS	.						3.0	4.0	3.0					9																	138379517		1868	3764	5632	SO:0001583	missense	9858	exon4			GGGGGGGCGTCGG	AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.3161G>C	chr9.hg19:g.138379517G>C	ENSP00000349274:p.Gly1054Ala	101.0	0.0	.		49.0	18.0	.	NM_014811	Q86WU0|Q8WVV0|Q9Y4D3	Missense_Mutation	SNP	ENST00000356818.2	hg19	CCDS6988.1	.	.	.	.	.	.	.	.	.	.	G	1.308	-0.602936	0.03744	.	.	ENSG00000196422	ENST00000356818	T	0.09538	2.97	4.83	-2.28	0.06826	.	0.939982	0.08989	N	0.864613	T	0.04861	0.0131	L	0.29908	0.895	0.09310	N	1	B	0.31459	0.324	B	0.31686	0.134	T	0.36841	-0.9731	10	0.02654	T	1	-13.12	0.8556	0.01182	0.2412:0.1264:0.3609:0.2714	.	1054	Q5T8A7	PPR26_HUMAN	A	1054	ENSP00000349274:G1054A	ENSP00000349274:G1054A	G	+	2	0	KIAA0649	137519338	0.153000	0.22777	0.000000	0.03702	0.003000	0.03518	0.409000	0.21082	-0.377000	0.07930	0.555000	0.69702	GGC	.	.	.	none		0.731	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054987.1	NM_014811	
SEC16A	9919	hgsc.bcm.edu	37	9	139369535	139369535	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr9:139369535A>G	ENST00000371706.3	-	1	2032	c.1999T>C	c.(1999-2001)Ttt>Ctt	p.F667L	SEC16A_ENST00000431893.2_Missense_Mutation_p.F667L|SEC16A_ENST00000313050.7_Missense_Mutation_p.F845L|SEC16A_ENST00000290037.6_Missense_Mutation_p.F667L			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	667					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GACACAGAAAAGTTAATGGGC	0.498																																					p.F845L		Atlas-SNP	.											.	SEC16A	249	.	0			c.T2533C						PASS	.						43.0	43.0	43.0					9																	139369535		1941	4138	6079	SO:0001583	missense	9919	exon3			CAGAAAAGTTAAT	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.1999T>C	chr9.hg19:g.139369535A>G	ENSP00000360771:p.Phe667Leu	101.0	0.0	.		57.0	18.0	.	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	hg19		.	.	.	.	.	.	.	.	.	.	A	13.94	2.387911	0.42308	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893	T;T;T;T	0.22539	1.95;1.96;1.95;1.96	5.64	-3.27	0.05048	.	0.400968	0.28042	N	0.016839	T	0.13372	0.0324	M	0.64997	1.995	0.09310	N	0.999999	B;B;B	0.14438	0.006;0.01;0.01	B;B;B	0.13407	0.004;0.009;0.009	T	0.20075	-1.0286	10	0.23891	T	0.37	-5.91	0.7546	0.00996	0.4548:0.1181:0.199:0.2281	.	845;667;667	F1T0I1;O15027-5;O15027-4	.;.;.	L	845;667;667;667	ENSP00000325827:F845L;ENSP00000360771:F667L;ENSP00000290037:F667L;ENSP00000387583:F667L	ENSP00000290037:F667L	F	-	1	0	SEC16A	138489356	0.012000	0.17670	0.000000	0.03702	0.039000	0.13416	0.012000	0.13287	-0.356000	0.08187	0.528000	0.53228	TTT	.	.	.	none		0.498	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
ATP5C1	509	hgsc.bcm.edu	37	10	7842038	7842038	+	Silent	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr10:7842038T>C	ENST00000356708.7	+	6	700	c.621T>C	c.(619-621)aaT>aaC	p.N207N	ATP5C1_ENST00000493053.1_3'UTR|ATP5C1_ENST00000541227.1_Silent_p.N160N|ATP5C1_ENST00000335698.4_Silent_p.N207N	NM_001001973.1	NP_001001973.1	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1	207					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	16						TTTCCCTTAATACCGTTGCAA	0.323																																					p.N207N	Melanoma(143;1012 1820 16249 30920 33158)	Atlas-SNP	.											.	ATP5C1	32	.	0			c.T621C						PASS	.						114.0	122.0	119.0					10																	7842038		2203	4300	6503	SO:0001819	synonymous_variant	509	exon6			CCTTAATACCGTT	D16561	CCDS7081.1, CCDS31142.1	10p14	2012-10-12			ENSG00000165629	ENSG00000165629		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	833	protein-coding gene	gene with protein product		108729		ATP5CL1, ATP5C		8168843, 8227057	Standard	NM_005174		Approved		uc001iju.3	P36542	OTTHUMG00000017639	ENST00000356708.7:c.621T>C	chr10.hg19:g.7842038T>C		67.0	0.0	.		67.0	18.0	.	NM_001001973	A8KA31|Q5VYP3|Q6I9V2|Q96AS8	Silent	SNP	ENST00000356708.7	hg19	CCDS31142.1																																																																																			.	.	.	none		0.323	ATP5C1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046708.1	NM_005174	
ARID5B	84159	hgsc.bcm.edu	37	10	63851119	63851119	+	Silent	SNP	C	C	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr10:63851119C>T	ENST00000279873.7	+	10	2307	c.1897C>T	c.(1897-1899)Ctg>Ttg	p.L633L	ARID5B_ENST00000309334.5_Silent_p.L390L	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	633					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					GGTGGACCAGCTGGGCAGTGA	0.552																																					p.L633L		Atlas-SNP	.											.	ARID5B	125	.	0			c.C1897T						PASS	.						65.0	58.0	60.0					10																	63851119		2203	4300	6503	SO:0001819	synonymous_variant	84159	exon10			GACCAGCTGGGCA	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.1897C>T	chr10.hg19:g.63851119C>T		53.0	0.0	.		140.0	53.0	.	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Silent	SNP	ENST00000279873.7	hg19	CCDS31208.1																																																																																			.	.	.	none		0.552	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
PDZD8	118987	hgsc.bcm.edu	37	10	119044910	119044910	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr10:119044910T>C	ENST00000334464.5	-	5	1573	c.1334A>G	c.(1333-1335)tAt>tGt	p.Y445C	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	445	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		AGGCCTTTCATAGTACACCAG	0.433																																					p.Y445C		Atlas-SNP	.											.	PDZD8	85	.	0			c.A1334G						PASS	.						62.0	61.0	61.0					10																	119044910		2203	4300	6503	SO:0001583	missense	118987	exon5			CTTTCATAGTACA	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.1334A>G	chr10.hg19:g.119044910T>C	ENSP00000334642:p.Tyr445Cys	62.0	0.0	.		82.0	34.0	.	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	hg19	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	T	19.19	3.779065	0.70107	.	.	ENSG00000165650	ENST00000334464	T	0.73575	-0.76	5.82	5.82	0.92795	PDZ/DHR/GLGF (3);	0.000000	0.85682	D	0.000000	D	0.86062	0.5843	M	0.74546	2.27	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.87636	0.2519	10	0.87932	D	0	-11.1467	16.1776	0.81862	0.0:0.0:0.0:1.0	.	445	Q8NEN9	PDZD8_HUMAN	C	445	ENSP00000334642:Y445C	ENSP00000334642:Y445C	Y	-	2	0	PDZD8	119034900	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.139000	0.71728	2.222000	0.72286	0.477000	0.44152	TAT	.	.	.	none		0.433	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
SFXN4	119559	hgsc.bcm.edu	37	10	120919242	120919242	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr10:120919242T>A	ENST00000355697.2	-	6	377	c.358A>T	c.(358-360)Acg>Tcg	p.T120S	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Missense_Mutation_p.T111S	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	120					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		TTGCTCACCGTGGGTGCCATG	0.602																																					p.T120S		Atlas-SNP	.											.	SFXN4	24	.	0			c.A358T						PASS	.						116.0	89.0	98.0					10																	120919242		2203	4300	6503	SO:0001583	missense	119559	exon6			TCACCGTGGGTGC		CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.358A>T	chr10.hg19:g.120919242T>A	ENSP00000347924:p.Thr120Ser	61.0	0.0	.		89.0	50.0	.	NM_213649	Q6WSU4|Q86TD9	Missense_Mutation	SNP	ENST00000355697.2	hg19	CCDS7610.1	.	.	.	.	.	.	.	.	.	.	T	0.212	-1.035964	0.02029	.	.	ENSG00000183605	ENST00000355697;ENST00000330036;ENST00000369131;ENST00000419372	T;T	0.30714	1.52;1.52	3.76	-5.8	0.02347	.	1.090950	0.07109	N	0.841756	T	0.19765	0.0475	L	0.36672	1.1	0.09310	N	1	B	0.21225	0.053	B	0.27076	0.076	T	0.40924	-0.9537	10	0.87932	D	0	-9.8843	2.055	0.03579	0.5105:0.0894:0.134:0.266	.	120	Q6P4A7	SFXN4_HUMAN	S	120;111;4;4	ENSP00000347924:T120S;ENSP00000333200:T111S	ENSP00000333200:T111S	T	-	1	0	SFXN4	120909232	0.530000	0.26330	0.224000	0.23877	0.001000	0.01503	-0.849000	0.04322	-1.211000	0.02624	-2.509000	0.00188	ACG	.	.	.	none		0.602	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050642.3	XM_058406	
ACADSB	36	hgsc.bcm.edu	37	10	124793964	124793964	+	Silent	SNP	A	A	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr10:124793964A>C	ENST00000358776.4	+	2	149	c.135A>C	c.(133-135)acA>acC	p.T45T	ACADSB_ENST00000368869.4_5'UTR|ACADSB_ENST00000496730.2_3'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	45					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	TCAATATAACAAATAATGGAA	0.373																																					p.T45T		Atlas-SNP	.											.	ACADSB	45	.	0			c.A135C						PASS	.						99.0	98.0	98.0					10																	124793964		2203	4300	6503	SO:0001819	synonymous_variant	36	exon2			TATAACAAATAAT	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.135A>C	chr10.hg19:g.124793964A>C		29.0	0.0	.		26.0	10.0	.	NM_001609	B4DQ51|Q5SQN6|Q96CX7	Silent	SNP	ENST00000358776.4	hg19	CCDS7634.1	.	.	.	.	.	.	.	.	.	.	A	3.942	-0.014024	0.07681	.	.	ENSG00000196177	ENST00000411816	.	.	.	4.92	-2.44	0.06502	.	.	.	.	.	T	0.29223	0.0727	.	.	.	0.20196	N	0.999925	.	.	.	.	.	.	T	0.32613	-0.9900	4	.	.	.	.	7.4231	0.27083	0.349:0.5011:0.1499:0.0	.	.	.	.	P	51	.	.	Q	+	2	0	ACADSB	124783954	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.032000	0.13732	-0.640000	0.05495	0.482000	0.46254	CAA	.	.	.	none		0.373	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1	NM_001609	
RRP8	23378	hgsc.bcm.edu	37	11	6624661	6624661	+	Silent	SNP	A	A	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr11:6624661A>T	ENST00000254605.6	-	1	189	c.72T>A	c.(70-72)ccT>ccA	p.P24P	ILK_ENST00000396751.2_5'Flank|RRP8_ENST00000534343.1_Silent_p.P24P|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000537806.1_5'Flank|ILK_ENST00000420936.2_5'Flank|ILK_ENST00000299421.4_5'Flank|ILK_ENST00000528995.1_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	24					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						CCGCAGGCGGAGGTCGTGAGA	0.662																																					p.P24P		Atlas-SNP	.											.	RRP8	40	.	0			c.T72A						PASS	.						18.0	19.0	19.0					11																	6624661		2195	4290	6485	SO:0001819	synonymous_variant	23378	exon1			AGGCGGAGGTCGT	AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.72T>A	chr11.hg19:g.6624661A>T		154.0	0.0	.		76.0	27.0	.	NM_015324	Q7KZ78|Q9BVM6	Silent	SNP	ENST00000254605.6	hg19	CCDS31411.1																																																																																			.	.	.	none		0.662	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384505.1	NM_015324	
GLYAT	10249	hgsc.bcm.edu	37	11	58482795	58482795	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr11:58482795C>A	ENST00000344743.3	-	3	324	c.183G>T	c.(181-183)caG>caT	p.Q61H	GLYAT_ENST00000278400.3_Missense_Mutation_p.Q61H|GLYAT_ENST00000529732.1_Missense_Mutation_p.Q61H	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	61					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	TTACCTGCTCCTGAGGGCAGA	0.403																																					p.Q61H		Atlas-SNP	.											.	GLYAT	53	.	0			c.G183T						PASS	.						95.0	83.0	87.0					11																	58482795		2201	4295	6496	SO:0001583	missense	10249	exon3			CTGCTCCTGAGGG	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.183G>T	chr11.hg19:g.58482795C>A	ENSP00000340200:p.Gln61His	5.0	0.0	.		29.0	8.0	.	NM_005838	O14833|Q96QK7	Missense_Mutation	SNP	ENST00000344743.3	hg19	CCDS7970.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407287	0.42715	.	.	ENSG00000149124	ENST00000344743;ENST00000529732;ENST00000278400	T;T;T	0.19105	2.17;2.17;2.17	5.45	-0.0385	0.13880	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, N-terminal (1);	0.572184	0.17708	N	0.164699	T	0.28665	0.0710	M	0.92077	3.27	0.28386	N	0.919319	B;B	0.26041	0.043;0.14	B;B	0.28709	0.033;0.093	T	0.35226	-0.9797	10	0.72032	D	0.01	-7.5927	3.2923	0.06953	0.1842:0.3996:0.0:0.4162	.	61;61	Q6IB77-2;Q6IB77	.;GLYAT_HUMAN	H	61	ENSP00000340200:Q61H;ENSP00000431688:Q61H;ENSP00000278400:Q61H	ENSP00000278400:Q61H	Q	-	3	2	GLYAT	58239371	0.343000	0.24818	0.996000	0.52242	0.948000	0.59901	0.352000	0.20113	0.105000	0.17753	0.650000	0.86243	CAG	.	.	.	none		0.403	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1		
PLA2G16	11145	hgsc.bcm.edu	37	11	63342507	63342507	+	Silent	SNP	G	G	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr11:63342507G>A	ENST00000323646.5	-	4	753	c.399C>T	c.(397-399)gtC>gtT	p.V133V	PLA2G16_ENST00000394613.3_5'UTR|PLA2G16_ENST00000415826.1_Silent_p.V133V	NM_007069.3	NP_009000.2	P53816	HRSL3_HUMAN	phospholipase A2, group XVI	133					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|negative regulation of cell cycle (GO:0045786)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	1-acyl-2-lysophosphatidylserine acylhydrolase activity (GO:0052740)|phosphatidylcholine 1-acylhydrolase activity (GO:0008970)|phosphatidylserine 1-acylhydrolase activity (GO:0052739)|phospholipase A2 activity (GO:0004623)			kidney(2)|lung(1)|ovary(1)|skin(1)	5						CAGCGATGATGACATCTCTGA	0.483																																					p.V133V		Atlas-SNP	.											.	PLA2G16	12	.	0			c.C399T						PASS	.						90.0	79.0	83.0					11																	63342507		2201	4298	6499	SO:0001819	synonymous_variant	11145	exon5			GATGATGACATCT	X92814	CCDS8047.1	11q12.3	2014-03-14	2008-09-19	2008-09-19	ENSG00000176485	ENSG00000176485	3.1.1.4		17825	protein-coding gene	gene with protein product	"""adipose-specific PLA2"""	613867	"""HRAS-like suppressor 3"""	HRASLS3		9771974, 18614531	Standard	NM_007069		Approved	HREV107, H-REV107-1, HREV107-3, MGC118754., AdPLA	uc009you.1	P53816	OTTHUMG00000167852	ENST00000323646.5:c.399C>T	chr11.hg19:g.63342507G>A		23.0	0.0	.		41.0	16.0	.	NM_001128203	B2R7Q4|B7XAK5|Q3SYI3|Q9HDD1	Silent	SNP	ENST00000323646.5	hg19	CCDS8047.1																																																																																			.	.	.	none		0.483	PLA2G16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396632.1	NM_001128203	
RTN3	10313	hgsc.bcm.edu	37	11	63487846	63487846	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr11:63487846A>T	ENST00000377819.5	+	3	2026	c.1872A>T	c.(1870-1872)gaA>gaT	p.E624D	RTN3_ENST00000540798.1_Missense_Mutation_p.E512D|RTN3_ENST00000354497.4_Intron|RTN3_ENST00000339997.4_Missense_Mutation_p.E605D|RTN3_ENST00000356000.3_Intron|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000537981.1_Intron	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	624					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						ATGAGACAGAATTCTCATTAA	0.393																																					p.E624D		Atlas-SNP	.											.	RTN3	104	.	0			c.A1872T						PASS	.						69.0	74.0	72.0					11																	63487846		2201	4298	6499	SO:0001583	missense	10313	exon3			GACAGAATTCTCA	AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.1872A>T	chr11.hg19:g.63487846A>T	ENSP00000367050:p.Glu624Asp	58.0	0.0	.		75.0	31.0	.	NM_001265589	B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	ENST00000377819.5	hg19	CCDS58141.1	.	.	.	.	.	.	.	.	.	.	A	11.66	1.704085	0.30232	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798	T;T;T	0.25749	1.78;1.78;1.78	4.6	2.0	0.26442	.	0.000000	0.33040	N	0.005359	T	0.13030	0.0316	N	0.14661	0.345	0.09310	N	0.999999	P;P;P	0.46512	0.879;0.808;0.879	B;B;B	0.39590	0.304;0.16;0.304	T	0.11991	-1.0565	10	0.54805	T	0.06	0.0791	8.2702	0.31840	0.5995:0.4005:0.0:0.0	.	512;624;605	F5H774;O95197;O95197-2	.;RTN3_HUMAN;.	D	624;605;512	ENSP00000367050:E624D;ENSP00000344106:E605D;ENSP00000442733:E512D	ENSP00000344106:E605D	E	+	3	2	RTN3	63244422	0.150000	0.22732	0.061000	0.19648	0.633000	0.38033	1.087000	0.30865	0.853000	0.35312	0.459000	0.35465	GAA	.	.	.	none		0.393	RTN3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000397846.1	NM_006054	
NAALADL1	10004	hgsc.bcm.edu	37	11	64811959	64811959	+	IGR	SNP	C	C	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr11:64811959C>T	ENST00000358658.3	-	0	2699				SAC3D1_ENST00000398846.1_Silent_p.V279V|SAC3D1_ENST00000530213.1_3'UTR|SAC3D1_ENST00000531072.1_Silent_p.V279V	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						GCTTCATGGTCAACCTCTTGG	0.657																																					p.V279V		Atlas-SNP	.											.	SAC3D1	13	.	0			c.C837T						PASS	.						44.0	48.0	47.0					11																	64811959		1994	4161	6155	SO:0001628	intergenic_variant	29901	exon2			CATGGTCAACCTC	AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595		chr11.hg19:g.64811959C>T		79.0	0.0	.		53.0	26.0	.	NM_013299	C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Silent	SNP	ENST00000358658.3	hg19	CCDS31604.1																																																																																			.	.	.	none		0.657	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385162.1	NM_005468	
PPFIA1	8500	hgsc.bcm.edu	37	11	70179622	70179622	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr11:70179622A>C	ENST00000253925.7	+	10	1474	c.1259A>C	c.(1258-1260)gAa>gCa	p.E420A	AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.E420A	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	420					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CGACAGATGGAAGCACAGTTG	0.532																																					p.E420A		Atlas-SNP	.											.	PPFIA1	114	.	0			c.A1259C						PASS	.						145.0	118.0	128.0					11																	70179622		2200	4294	6494	SO:0001583	missense	8500	exon10			AGATGGAAGCACA	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.1259A>C	chr11.hg19:g.70179622A>C	ENSP00000253925:p.Glu420Ala	213.0	0.0	.		200.0	83.0	.	NM_177423	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	hg19	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.904811	0.92035	.	.	ENSG00000131626	ENST00000253925;ENST00000389547	D;D	0.83837	-1.77;-1.77	5.48	5.48	0.80851	.	0.000000	0.64402	U	0.000001	D	0.88804	0.6536	M	0.80616	2.505	0.58432	D	0.999999	P;D	0.54964	0.762;0.969	P;P	0.53593	0.542;0.73	D	0.90559	0.4514	10	0.87932	D	0	.	15.6079	0.76689	1.0:0.0:0.0:0.0	.	420;420	Q13136;Q13136-2	LIPA1_HUMAN;.	A	420	ENSP00000253925:E420A;ENSP00000374198:E420A	ENSP00000253925:E420A	E	+	2	0	PPFIA1	69857270	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.070000	0.93974	2.087000	0.62958	0.454000	0.30748	GAA	.	.	.	none		0.532	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
KIAA1551	55196	hgsc.bcm.edu	37	12	32134899	32134899	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr12:32134899T>A	ENST00000312561.4	+	4	1424	c.1010T>A	c.(1009-1011)tTc>tAc	p.F337Y	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	337																	ATTGGAAATTTCACTAACTTG	0.398																																					p.F337Y		Atlas-SNP	.											.	.	.	.	0			c.T1010A						PASS	.						87.0	84.0	85.0					12																	32134899		2203	4300	6503	SO:0001583	missense	55196	exon4			GAAATTTCACTAA	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1010T>A	chr12.hg19:g.32134899T>A	ENSP00000310338:p.Phe337Tyr	104.0	0.0	.		174.0	62.0	.	NM_018169	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	hg19	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	T	16.32	3.090401	0.55968	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.07908	3.77;3.15	5.45	-2.32	0.06745	.	0.655283	0.14267	N	0.330452	T	0.04407	0.0121	N	0.24115	0.695	0.09310	N	1	B	0.18013	0.025	B	0.17433	0.018	T	0.42207	-0.9465	9	.	.	.	.	5.6415	0.17567	0.1296:0.3781:0.0:0.4923	.	337	Q9HCM1	CL035_HUMAN	Y	337	ENSP00000310338:F337Y;ENSP00000370442:F337Y	.	F	+	2	0	C12orf35	32026166	0.000000	0.05858	0.001000	0.08648	0.163000	0.22366	-0.100000	0.10990	-0.329000	0.08527	0.454000	0.30748	TTC	.	.	.	none		0.398	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
GXYLT1	283464	hgsc.bcm.edu	37	12	42481670	42481671	+	Missense_Mutation	DNP	CA	CA	TG	rs202200134|rs200973030		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr12:42481670_42481671CA>TG	ENST00000398675.3	-	8	1472_1473	c.1240_1241TG>CA	c.(1240-1242)TGt>CAt	p.C414H	GXYLT1_ENST00000280876.6_Missense_Mutation_p.C383H	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	414					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						AATTTTTCCACAGTATGTATGC	0.312																																					p.C414Y|p.C414R		Atlas-SNP	.											Q8IXV1_HUMAN,NS,carcinoma,-1,2|Q8IXV1_HUMAN,NS,carcinoma,0,2	GXYLT1	47	.	0			c.G1241A|c.T1240C						PASS	.																																			SO:0001583	missense	283464	exon8			TTTCCACAGTATG|TTCCACAGTATGT	BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.1240_1241delinsTG	chr12.hg19:g.42481670_42481671delinsTG	ENSP00000381666:p.Cys414His	30.0|31.0	0.0	.		42.0	5.0	.	NM_173601	B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	ENST00000398675.3	hg19	CCDS41772.1																																																																																			.	.	.	weak		0.312	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403778.1	XM_290597	
KRT2	3849	hgsc.bcm.edu	37	12	53040651	53040651	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr12:53040651C>A	ENST00000309680.3	-	7	1363	c.1342G>T	c.(1342-1344)Gcc>Tcc	p.A448S		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	448	Coil 2.|Rod.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		TGCTGCAGGGCCTCCTCCAGG	0.587																																					p.A448S		Atlas-SNP	.											KRT2,NS,carcinoma,0,1	KRT2	94	.	0			c.G1342T						PASS	.						104.0	92.0	96.0					12																	53040651		2203	4300	6503	SO:0001583	missense	3849	exon7			GCAGGGCCTCCTC		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.1342G>T	chr12.hg19:g.53040651C>A	ENSP00000310861:p.Ala448Ser	30.0	1.0	.		38.0	13.0	.	NM_000423	Q4VAQ2	Missense_Mutation	SNP	ENST00000309680.3	hg19	CCDS8835.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707130	0.89018	.	.	ENSG00000172867	ENST00000309680	D	0.88818	-2.43	4.48	3.59	0.41128	Filament (1);	.	.	.	.	D	0.94905	0.8353	M	0.89601	3.045	0.40673	D	0.98223	D	0.89917	1.0	D	0.87578	0.998	D	0.95802	0.8834	9	0.87932	D	0	.	12.9841	0.58581	0.0:0.9208:0.0:0.0792	.	448	P35908	K22E_HUMAN	S	448	ENSP00000310861:A448S	ENSP00000310861:A448S	A	-	1	0	KRT2	51326918	1.000000	0.71417	0.991000	0.47740	0.969000	0.65631	4.827000	0.62723	1.257000	0.44085	0.563000	0.77884	GCC	.	.	.	none		0.587	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
MTERF2	80298	hgsc.bcm.edu	37	12	107372223	107372223	+	Silent	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr12:107372223A>G	ENST00000552029.1	-	2	2338	c.270T>C	c.(268-270)gaT>gaC	p.D90D	C12orf23_ENST00000551237.1_3'UTR|MTERFD3_ENST00000240050.4_Silent_p.D90D|MTERFD3_ENST00000392830.2_Silent_p.D90D			Q49AM1	MTEF2_HUMAN		90					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	transcription regulatory region DNA binding (GO:0044212)			breast(1)|kidney(1)|large_intestine(2)|lung(3)	7						CAGCAGTCTCATCGGCACCTA	0.423																																					p.D90D		Atlas-SNP	.											.	MTERFD3	32	.	0			c.T270C						PASS	.						128.0	134.0	132.0					12																	107372223		2203	4300	6503	SO:0001819	synonymous_variant	80298	exon3			AGTCTCATCGGCA																												ENST00000552029.1:c.270T>C	chr12.hg19:g.107372223A>G		59.0	0.0	.		48.0	18.0	.	NM_001033050	Q53HM2|Q9H4L6|Q9H7Y9	Silent	SNP	ENST00000552029.1	hg19	CCDS9111.1																																																																																			.	.	.	none		0.423	MTERFD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406835.1		
CDADC1	81602	hgsc.bcm.edu	37	13	49852539	49852539	+	Silent	SNP	T	T	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr13:49852539T>A	ENST00000251108.6	+	7	1217	c.1104T>A	c.(1102-1104)gcT>gcA	p.A368A	CDADC1_ENST00000444959.1_Silent_p.A170A	NM_001193478.1|NM_030911.3	NP_001180407.1|NP_112173.1	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	368							hydrolase activity (GO:0016787)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	16		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		GTTACAATGCTTTTCCTGTTG	0.408																																					p.A368A		Atlas-SNP	.											.	CDADC1	40	.	0			c.T1104A						PASS	.						411.0	350.0	370.0					13																	49852539		2203	4300	6503	SO:0001819	synonymous_variant	81602	exon7			CAATGCTTTTCCT	AY027525	CCDS9415.1	13q14.11	2008-02-05			ENSG00000102543	ENSG00000102543			20299	protein-coding gene	gene with protein product							Standard	NM_001193478		Approved	NYD-SP15	uc001vcu.3	Q9BWV3	OTTHUMG00000016913	ENST00000251108.6:c.1104T>A	chr13.hg19:g.49852539T>A		53.0	0.0	.		79.0	31.0	.	NM_030911	Q49A08|Q4G119|Q5TAW9|Q7Z764|Q9NT36	Silent	SNP	ENST00000251108.6	hg19	CCDS9415.1																																																																																			.	.	.	none		0.408	CDADC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044902.2	NM_030911	
MYH6	4624	hgsc.bcm.edu	37	14	23862152	23862152	+	Missense_Mutation	SNP	C	C	T	rs375169402		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr14:23862152C>T	ENST00000356287.3	-	23	3249	c.3220G>A	c.(3220-3222)Gat>Aat	p.D1074N	MYH6_ENST00000405093.3_Missense_Mutation_p.D1074N			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1074					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TGCAGTTTATCATTTTCCAGG	0.542																																					p.D1074N		Atlas-SNP	.											MYH6,neck,malignant_melanoma,0,1	MYH6	274	.	0			c.G3220A						PASS	.	C	ASN/ASP	0,4406		0,0,2203	131.0	116.0	121.0		3220	4.8	1.0	14		121	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYH6	NM_002471.3	23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1074/1940	23862152	1,13005	2203	4300	6503	SO:0001583	missense	4624	exon24			GTTTATCATTTTC	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.3220G>A	chr14.hg19:g.23862152C>T	ENSP00000348634:p.Asp1074Asn	40.0	1.0	.		42.0	17.0	.	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	hg19	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	c	35	5.538945	0.96474	0.0	1.16E-4	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.77750	-1.12;-1.12	4.82	4.82	0.62117	Myosin tail (1);	.	.	.	.	D	0.87398	0.6167	M	0.82323	2.585	0.80722	D	1	D	0.58620	0.983	P	0.60682	0.878	D	0.86950	0.2085	9	0.34782	T	0.22	.	18.2902	0.90127	0.0:1.0:0.0:0.0	.	1074	P13533	MYH6_HUMAN	N	1074	ENSP00000386041:D1074N;ENSP00000348634:D1074N	ENSP00000348634:D1074N	D	-	1	0	MYH6	22931992	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.591000	0.82666	2.391000	0.81399	0.557000	0.71058	GAT	.	.	.	weak		0.542	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
SIPA1L1	26037	hgsc.bcm.edu	37	14	72200389	72200389	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr14:72200389T>C	ENST00000555818.1	+	19	5279	c.4931T>C	c.(4930-4932)tTc>tCc	p.F1644S	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.F1623S|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.F1098S|SIPA1L1_ENST00000554874.1_3'UTR|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.F1623S	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1644					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GCAGGAGAGTTCTCAGCCTCG	0.562																																					p.F1644S		Atlas-SNP	.											.	SIPA1L1	219	.	0			c.T4931C						PASS	.						86.0	87.0	87.0					14																	72200389		2203	4300	6503	SO:0001583	missense	26037	exon19			GAGAGTTCTCAGC	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.4931T>C	chr14.hg19:g.72200389T>C	ENSP00000450832:p.Phe1644Ser	28.0	0.0	.		28.0	12.0	.	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	hg19	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.241374	0.58995	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.09	5.09	0.68999	.	0.048982	0.85682	D	0.000000	T	0.50548	0.1622	L	0.55990	1.75	0.58432	D	0.999995	D;D;D;D;D	0.71674	0.998;0.982;0.995;0.981;0.994	P;P;D;P;D	0.75020	0.898;0.677;0.962;0.642;0.985	T	0.52434	-0.8576	10	0.66056	D	0.02	-24.1525	15.1848	0.72993	0.0:0.0:0.0:1.0	.	1098;1644;1098;1623;1644	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	S	1623;1644;1623;1098	ENSP00000370630:F1623S;ENSP00000450832:F1644S;ENSP00000351352:F1623S;ENSP00000440682:F1098S	ENSP00000351352:F1644S	F	+	2	0	SIPA1L1	71270142	1.000000	0.71417	1.000000	0.80357	0.151000	0.21798	7.655000	0.83696	2.044000	0.60594	0.459000	0.35465	TTC	.	.	.	none		0.562	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
COQ6	51004	hgsc.bcm.edu	37	14	74422588	74422588	+	Silent	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr14:74422588T>C	ENST00000334571.2	+	4	478	c.438T>C	c.(436-438)gaT>gaC	p.D146D	COQ6_ENST00000394026.4_Silent_p.D121D|COQ6_ENST00000555552.1_3'UTR|COQ6_ENST00000554920.1_Silent_p.D146D|COQ6_ENST00000238709.4_Silent_p.D71D	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	146					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		TGGAGAATGATGTCATCATGC	0.473																																					p.D146D		Atlas-SNP	.											.	COQ6	27	.	0			c.T438C						PASS	.						178.0	167.0	171.0					14																	74422588		2203	4300	6503	SO:0001819	synonymous_variant	51004	exon4			GAATGATGTCATC	AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.438T>C	chr14.hg19:g.74422588T>C		38.0	0.0	.		29.0	12.0	.	NM_182476	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Silent	SNP	ENST00000334571.2	hg19	CCDS9823.1																																																																																			.	.	.	none		0.473	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412616.1		
INO80	54617	hgsc.bcm.edu	37	15	41313309	41313309	+	Silent	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr15:41313309T>C	ENST00000361937.3	-	26	3487	c.3063A>G	c.(3061-3063)ccA>ccG	p.P1021P	RP11-540O11.4_ENST00000558967.1_RNA|INO80_ENST00000401393.3_Silent_p.P1021P			Q9ULG1	INO80_HUMAN	INO80 complex subunit	1021	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						AAGAATCCAATGGCACTGCGG	0.473																																					p.P1021P		Atlas-SNP	.											.	INO80	122	.	0			c.A3063G						PASS	.						72.0	66.0	68.0					15																	41313309		2203	4300	6503	SO:0001819	synonymous_variant	54617	exon26			ATCCAATGGCACT	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.3063A>G	chr15.hg19:g.41313309T>C		35.0	0.0	.		45.0	20.0	.	NM_017553	A6H8X4|Q9NTG6	Silent	SNP	ENST00000361937.3	hg19	CCDS10071.1																																																																																			.	.	.	none		0.473	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
GANC	2595	hgsc.bcm.edu	37	15	42640335	42640335	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr15:42640335C>A	ENST00000318010.8	+	21	2579	c.2339C>A	c.(2338-2340)cCa>cAa	p.P780Q	RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000356316.3_5'UTR	NM_198141.2	NP_937784.2	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C	780					carbohydrate metabolic process (GO:0005975)		alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)	Miglitol(DB00491)	AGTGTGATACCAATAAAGACA	0.413																																					p.P780Q		Atlas-SNP	.											.	GANC	57	.	0			c.C2339A						PASS	.						89.0	85.0	86.0					15																	42640335		2203	4299	6502	SO:0001583	missense	2595	exon21			TGATACCAATAAA	AF545045	CCDS10084.1	15q15.2	2012-10-02			ENSG00000214013	ENSG00000214013	3.2.1.20		4139	protein-coding gene	gene with protein product		104180				6995030, 12370436	Standard	NM_198141		Approved		uc001zpi.3	Q8TET4	OTTHUMG00000130487	ENST00000318010.8:c.2339C>A	chr15.hg19:g.42640335C>A	ENSP00000326227:p.Pro780Gln	52.0	0.0	.		64.0	29.0	.	NM_198141	Q52LQ4|Q8IWZ0|Q8IZM4|Q8IZM5	Missense_Mutation	SNP	ENST00000318010.8	hg19	CCDS10084.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428560	0.83667	.	.	ENSG00000214013	ENST00000318010	D	0.91945	-2.94	6.02	6.02	0.97574	.	0.105339	0.64402	D	0.000002	D	0.96818	0.8961	M	0.87097	2.86	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.96665	0.9492	10	0.87932	D	0	-7.3534	20.547	0.99278	0.0:1.0:0.0:0.0	.	780	Q8TET4	GANC_HUMAN	Q	780	ENSP00000326227:P780Q	ENSP00000447925:P12Q	P	+	2	0	GANC	40427627	0.685000	0.27652	0.792000	0.32020	0.547000	0.35210	2.956000	0.49129	2.850000	0.98022	0.650000	0.86243	CCA	.	.	.	none		0.413	GANC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252887.2	NM_198141	
SLC28A1	9154	hgsc.bcm.edu	37	15	85438656	85438656	+	Intron	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr15:85438656A>G	ENST00000286749.3	+	5	551				SLC28A1_ENST00000338602.2_Missense_Mutation_p.Q170R|SLC28A1_ENST00000538177.1_Intron|SLC28A1_ENST00000394573.1_Intron|SLC28A1_ENST00000537703.1_Intron|SLC28A1_ENST00000537216.1_Intron|SLC28A1_ENST00000537624.1_Intron			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1						nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	TACCTCCCtcagatcacctgg	0.562																																					p.Q170R		Atlas-SNP	.											.	SLC28A1	118	.	0			c.A509G						PASS	.						66.0	54.0	58.0					15																	85438656		2203	4299	6502	SO:0001627	intron_variant	9154	exon7			TCCCTCAGATCAC	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.461+302A>G	chr15.hg19:g.85438656A>G		104.0	0.0	.		123.0	55.0	.	NM_201651	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	ENST00000286749.3	hg19	CCDS10334.1	.	.	.	.	.	.	.	.	.	.	A	10.09	1.255659	0.22965	.	.	ENSG00000156222	ENST00000338602	T	0.12672	2.66	3.41	2.29	0.28610	.	.	.	.	.	T	0.10337	0.0253	.	.	.	0.09310	N	0.999999	B	0.12013	0.005	B	0.10450	0.005	T	0.27331	-1.0077	8	0.72032	D	0.01	.	5.4062	0.16323	0.8714:0.0:0.1286:0.0	.	170	O00337-2	.	R	170	ENSP00000341629:Q170R	ENSP00000341629:Q170R	Q	+	2	0	SLC28A1	83239660	0.000000	0.05858	0.006000	0.13384	0.008000	0.06430	0.098000	0.15189	0.691000	0.31592	0.460000	0.39030	CAG	.	.	.	none		0.562	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2		
TMEM8A	58986	hgsc.bcm.edu	37	16	426371	426371	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr16:426371G>A	ENST00000431232.2	-	6	1149	c.989C>T	c.(988-990)tCc>tTc	p.S330F	TMEM8A_ENST00000250930.3_Missense_Mutation_p.S137F|TMEM8A_ENST00000476735.1_5'Flank	NM_021259.2	NP_067082.2	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A	330					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						GGGGCTCGGGGACAGCAGACC	0.642																																					p.S330F		Atlas-SNP	.											.	TMEM8A	49	.	0			c.C989T						PASS	.						42.0	40.0	41.0					16																	426371		2202	4298	6500	SO:0001583	missense	58986	exon6			CTCGGGGACAGCA	AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000431232.2:c.989C>T	chr16.hg19:g.426371G>A	ENSP00000401338:p.Ser330Phe	110.0	0.0	.		57.0	27.0	.	NM_021259	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	Missense_Mutation	SNP	ENST00000431232.2	hg19	CCDS10407.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.827992	0.50845	.	.	ENSG00000129925	ENST00000431232;ENST00000250930	T;T	0.33216	1.83;1.42	4.71	3.76	0.43208	.	1.026870	0.07737	N	0.946183	T	0.37100	0.0991	L	0.47716	1.5	0.09310	N	1	D	0.57899	0.981	P	0.50231	0.635	T	0.17077	-1.0381	10	0.56958	D	0.05	.	8.027	0.30442	0.2011:0.0:0.7989:0.0	.	330	Q9HCN3	TMM8A_HUMAN	F	330;137	ENSP00000401338:S330F;ENSP00000250930:S137F	ENSP00000250930:S137F	S	-	2	0	TMEM8A	366372	0.001000	0.12720	0.005000	0.12908	0.002000	0.02628	0.149000	0.16243	1.202000	0.43218	0.655000	0.94253	TCC	.	.	.	none		0.642	TMEM8A-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000109257.2	NM_021259	
RHOT2	89941	hgsc.bcm.edu	37	16	720472	720472	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr16:720472T>C	ENST00000315082.4	+	8	569	c.455T>C	c.(454-456)cTg>cCg	p.L152P	RHOT2_ENST00000569943.2_3'UTR	NM_138769.2	NP_620124.1	Q8IXI1	MIRO2_HUMAN	ras homolog family member T2	152					cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|pancreas(2)|prostate(1)	13		Hepatocellular(780;0.0218)				GCCAAGAACCTGAGGAACATC	0.612																																					p.L152P		Atlas-SNP	.											.	RHOT2	35	.	0			c.T455C						PASS	.						102.0	103.0	103.0					16																	720472		2200	4300	6500	SO:0001583	missense	89941	exon8			AGAACCTGAGGAA	BC014942	CCDS10417.1	16p13.3	2013-01-10	2012-02-27	2004-03-24	ENSG00000140983	ENSG00000140983		"""EF-hand domain containing"""	21169	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 2"""	613889	"""chromosome 16 open reading frame 39"", ""ras homolog gene family, member T2"""	C16orf39, ARHT2		12482879	Standard	NM_138769		Approved	MIRO-2	uc002cip.3	Q8IXI1	OTTHUMG00000121139	ENST00000315082.4:c.455T>C	chr16.hg19:g.720472T>C	ENSP00000321971:p.Leu152Pro	117.0	0.0	.		56.0	16.0	.	NM_138769	A2IDC2|Q8NF53|Q96C13|Q96S17|Q9BT60|Q9H7M8	Missense_Mutation	SNP	ENST00000315082.4	hg19	CCDS10417.1	.	.	.	.	.	.	.	.	.	.	T	11.67	1.708096	0.30322	.	.	ENSG00000140983	ENST00000315082	T	0.69561	-0.41	5.11	4.0	0.46444	.	0.141279	0.48767	D	0.000179	T	0.77745	0.4176	M	0.68728	2.09	0.80722	D	1	P;D	0.89917	0.503;1.0	B;D	0.87578	0.384;0.998	T	0.76547	-0.2919	10	0.51188	T	0.08	-1.6952	10.2105	0.43138	0.149:0.0:0.0:0.851	.	25;152	Q8IXI1-2;Q8IXI1	.;MIRO2_HUMAN	P	152	ENSP00000321971:L152P	ENSP00000321971:L152P	L	+	2	0	RHOT2	660473	1.000000	0.71417	0.586000	0.28679	0.001000	0.01503	5.906000	0.69900	0.760000	0.33108	-0.496000	0.04628	CTG	.	.	.	none		0.612	RHOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241617.1	NM_138769	
DNAH3	55567	hgsc.bcm.edu	37	16	21147803	21147803	+	Missense_Mutation	SNP	C	C	T	rs200178510		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr16:21147803C>T	ENST00000261383.3	-	6	727	c.728G>A	c.(727-729)cGc>cAc	p.R243H	DNAH3_ENST00000415178.1_Missense_Mutation_p.R243H	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	243	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CATGTCTTTGCGAATTCCATT	0.473																																					p.R243H		Atlas-SNP	.											.	DNAH3	1142	.	0			c.G728A						PASS	.						179.0	167.0	171.0					16																	21147803		2201	4300	6501	SO:0001583	missense	55567	exon6			TCTTTGCGAATTC	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.728G>A	chr16.hg19:g.21147803C>T	ENSP00000261383:p.Arg243His	59.0	0.0	.		106.0	39.0	.	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383171	0.42207	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.22945	1.93;2.08	5.53	-3.06	0.05379	.	1.226080	0.05829	N	0.617229	T	0.19208	0.0461	L	0.53249	1.67	0.09310	N	1	B;P	0.34662	0.002;0.462	B;B	0.23018	0.0;0.043	T	0.24012	-1.0172	10	0.48119	T	0.1	.	6.1464	0.20289	0.0:0.3114:0.2689:0.4197	.	243;214	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	H	243;243;214	ENSP00000261383:R243H;ENSP00000394245:R243H	ENSP00000261383:R243H	R	-	2	0	DNAH3	21055304	0.000000	0.05858	0.101000	0.21167	0.871000	0.50021	-0.672000	0.05244	-0.547000	0.06207	0.655000	0.94253	CGC	.	C|0.999;T|0.001	0.001	weak		0.473	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
E2F4	1874	hgsc.bcm.edu	37	16	67226969	67226969	+	Silent	SNP	G	G	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr16:67226969G>A	ENST00000379378.3	+	3	362	c.303G>A	c.(301-303)aaG>aaA	p.K101K	E2F4_ENST00000564718.1_3'UTR|EXOC3L1_ENST00000562887.1_5'Flank|EXOC3L1_ENST00000314586.6_5'Flank	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	101	Dimerization. {ECO:0000255}.				blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		TTGAGCTCAAGGCAGAGATCG	0.592																																					p.K101K		Atlas-SNP	.											.	E2F4	25	.	0			c.G303A						PASS	.						38.0	32.0	34.0					16																	67226969		2190	4288	6478	SO:0001819	synonymous_variant	1874	exon3			GCTCAAGGCAGAG	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.303G>A	chr16.hg19:g.67226969G>A		64.0	0.0	.		40.0	17.0	.	NM_001950	A6NGR8|B5BU56|Q12991|Q15328	Silent	SNP	ENST00000379378.3	hg19	CCDS32464.1																																																																																			.	.	.	none		0.592	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
ZFHX3	463	hgsc.bcm.edu	37	16	72845510	72845510	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr16:72845510A>G	ENST00000268489.5	-	7	4502	c.3830T>C	c.(3829-3831)gTg>gCg	p.V1277A	RP5-991G20.2_ENST00000558618.1_RNA|ZFHX3_ENST00000397992.5_Missense_Mutation_p.V363A	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1277					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GTCAGGTGCCACGCTGTGGAG	0.587																																					p.V1277A		Atlas-SNP	.											.	ZFHX3	404	.	0			c.T3830C						PASS	.						65.0	58.0	60.0					16																	72845510		2198	4300	6498	SO:0001583	missense	463	exon7			GGTGCCACGCTGT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.3830T>C	chr16.hg19:g.72845510A>G	ENSP00000268489:p.Val1277Ala	36.0	0.0	.		43.0	22.0	.	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	hg19	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	A	19.34	3.809308	0.70797	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.78707	-1.2;-1.19	5.4	5.4	0.78164	.	0.000000	0.45126	D	0.000397	D	0.85344	0.5675	L	0.53617	1.68	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	D	0.86875	0.2038	10	0.87932	D	0	.	15.3888	0.74726	1.0:0.0:0.0:0.0	.	1277	Q15911	ZFHX3_HUMAN	A	1277;363	ENSP00000268489:V1277A;ENSP00000438926:V363A	ENSP00000268489:V1277A	V	-	2	0	ZFHX3	71403011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.164000	0.68074	0.533000	0.62120	GTG	.	.	.	none		0.587	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
DEF8	54849	hgsc.bcm.edu	37	16	90021581	90021581	+	Silent	SNP	C	C	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr16:90021581C>A	ENST00000268676.7	+	4	401	c.312C>A	c.(310-312)gcC>gcA	p.A104A	DEF8_ENST00000563594.1_Silent_p.A43A|DEF8_ENST00000418391.2_Silent_p.A43A|DEF8_ENST00000567874.1_De_novo_Start_InFrame|DEF8_ENST00000570182.1_Silent_p.A43A|DEF8_ENST00000569453.1_Silent_p.A43A|DEF8_ENST00000563795.1_Silent_p.A43A	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)	104					intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		CTCCAGAGGCCCTGCCTGAGC	0.642																																					p.A104A		Atlas-SNP	.											.	DEF8	28	.	0			c.C312A						PASS	.						67.0	67.0	67.0					16																	90021581		2198	4300	6498	SO:0001819	synonymous_variant	54849	exon4			AGAGGCCCTGCCT	AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.312C>A	chr16.hg19:g.90021581C>A		37.0	0.0	.		34.0	9.0	.	NM_207514	B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Silent	SNP	ENST00000268676.7	hg19	CCDS10989.1																																																																																			.	.	.	none		0.642	DEF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000272878.1	NM_207514	
SPAG7	9552	hgsc.bcm.edu	37	17	4863151	4863151	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr17:4863151C>A	ENST00000206020.3	-	6	545	c.478G>T	c.(478-480)Gcc>Tcc	p.A160S	SPAG7_ENST00000575142.1_Missense_Mutation_p.A149S|SPAG7_ENST00000573366.1_Missense_Mutation_p.A109S	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	160						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						TAGTCGCTGGCAGGGCTCACC	0.632																																					p.A160S		Atlas-SNP	.											.	SPAG7	22	.	0			c.G478T						PASS	.						72.0	77.0	75.0					17																	4863151		2152	4249	6401	SO:0001583	missense	9552	exon6			CGCTGGCAGGGCT	AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.478G>T	chr17.hg19:g.4863151C>A	ENSP00000206020:p.Ala160Ser	31.0	0.0	.		54.0	12.0	.	NM_004890	Q96EU5	Missense_Mutation	SNP	ENST00000206020.3	hg19	CCDS42240.1	.	.	.	.	.	.	.	.	.	.	C	9.879	1.201019	0.22121	.	.	ENSG00000091640	ENST00000206020	.	.	.	5.1	2.0	0.26442	.	0.275517	0.41194	D	0.000922	T	0.14657	0.0354	N	0.04508	-0.205	0.24039	N	0.996084	B	0.10296	0.003	B	0.06405	0.002	T	0.26608	-1.0098	9	0.16420	T	0.52	0.0294	8.9143	0.35572	0.0:0.7497:0.0:0.2503	.	160	O75391	SPAG7_HUMAN	S	160	.	ENSP00000206020:A160S	A	-	1	0	SPAG7	4803874	0.998000	0.40836	0.178000	0.23040	0.860000	0.49131	1.596000	0.36718	0.315000	0.23110	0.561000	0.74099	GCC	.	.	.	none		0.632	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438747.1	NM_004890	
CLDN7	1366	hgsc.bcm.edu	37	17	7164034	7164034	+	Silent	SNP	A	A	G			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr17:7164034A>G	ENST00000360325.7	-	3	834	c.400T>C	c.(400-402)Ttg>Ctg	p.L134L	CLDN7_ENST00000397317.4_Silent_p.L134L|CLDN7_ENST00000573745.1_5'Flank|CLDN7_ENST00000538261.3_Intron|RP1-4G17.5_ENST00000577138.1_Intron|CLDN7_ENST00000571881.2_Missense_Mutation_p.L125P	NM_001307.5	NP_001298.3	O95471	CLD7_HUMAN	claudin 7	134					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	6						CAAGCTACCAAGGCGGCAAGA	0.537																																					p.L134L		Atlas-SNP	.											.	CLDN7	11	.	0			c.T400C						PASS	.						82.0	91.0	88.0					17																	7164034		2203	4300	6503	SO:0001819	synonymous_variant	1366	exon3			CTACCAAGGCGGC	AJ011497	CCDS11096.1, CCDS54081.1	17p13.1	2013-09-20			ENSG00000181885	ENSG00000181885		"""Claudins"""	2049	protein-coding gene	gene with protein product		609131		CEPTRL2, CPETRL2		9892664	Standard	NM_001307		Approved	Hs.84359	uc002gfm.4	O95471	OTTHUMG00000178005	ENST00000360325.7:c.400T>C	chr17.hg19:g.7164034A>G		124.0	0.0	.		123.0	29.0	.	NM_001307	B2R9X7|D3DTP0|Q6IPN3|Q7Z4Y7|Q9BVN0	Silent	SNP	ENST00000360325.7	hg19	CCDS11096.1																																																																																			.	.	.	none		0.537	CLDN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440204.2	NM_001307	
MPRIP	23164	hgsc.bcm.edu	37	17	17049353	17049353	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr17:17049353G>A	ENST00000341712.4	+	10	1153	c.1153G>A	c.(1153-1155)Gac>Aac	p.D385N	MPRIP_ENST00000395804.3_Missense_Mutation_p.D385N|MPRIP_ENST00000395811.5_Missense_Mutation_p.D385N|MPRIP_ENST00000444976.1_Missense_Mutation_p.D347N			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	385						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.D385N(1)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						TTCTCAGCCCGACCTGCTGAA	0.547																																					p.D385N		Atlas-SNP	.											MPRIP,NS,carcinoma,0,1	MPRIP	87	.	1	Substitution - Missense(1)	endometrium(1)	c.G1153A						PASS	.						76.0	66.0	69.0					17																	17049353		2203	4300	6503	SO:0001583	missense	23164	exon10			CAGCCCGACCTGC	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.1153G>A	chr17.hg19:g.17049353G>A	ENSP00000342379:p.Asp385Asn	80.0	0.0	.		114.0	35.0	.	NM_015134	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	ENST00000341712.4	hg19	CCDS32578.1	.	.	.	.	.	.	.	.	.	.	G	36	5.698781	0.96802	.	.	ENSG00000133030	ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712	T;T;T;T	0.26957	1.7;1.98;1.98;1.98	5.97	5.97	0.96955	Pleckstrin homology-type (1);	.	.	.	.	T	0.44623	0.1302	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.28713	-1.0035	9	0.87932	D	0	.	20.428	0.99075	0.0:0.0:1.0:0.0	.	385;385	Q6WCQ1-2;Q6WCQ1	.;MPRIP_HUMAN	N	347;385;385;385	ENSP00000400189:D347N;ENSP00000379156:D385N;ENSP00000379149:D385N;ENSP00000342379:D385N	ENSP00000342379:D385N	D	+	1	0	MPRIP	16990078	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	9.184000	0.94893	2.837000	0.97791	0.655000	0.94253	GAC	.	.	.	none		0.547	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
TSHZ1	10194	hgsc.bcm.edu	37	18	72999615	72999615	+	Silent	SNP	C	C	A			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr18:72999615C>A	ENST00000580243.1	+	2	2601	c.2253C>A	c.(2251-2253)tcC>tcA	p.S751S	TSHZ1_ENST00000322038.5_Silent_p.S706S			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	751					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		CTTTGCAGTCCATCATGAACA	0.572																																					p.S706S		Atlas-SNP	.											.	TSHZ1	104	.	0			c.C2118A						PASS	.						83.0	78.0	79.0					18																	72999615		2203	4300	6503	SO:0001819	synonymous_variant	10194	exon2			GCAGTCCATCATG	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2253C>A	chr18.hg19:g.72999615C>A		91.0	0.0	.		63.0	24.0	.	NM_005786	O60534|Q4LE29|Q53EU4	Silent	SNP	ENST00000580243.1	hg19																																																																																				.	.	.	none		0.572	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
DCAF15	90379	hgsc.bcm.edu	37	19	14063934	14063934	+	Intron	SNP	G	G	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr19:14063934G>T	ENST00000254337.6	+	1	153				PODNL1_ENST00000538517.2_Silent_p.T5T|PODNL1_ENST00000588317.1_5'UTR|PODNL1_ENST00000538371.2_Silent_p.T5T	NM_138353.2	NP_612362.2	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15						protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)	11						CCAGTACCTGGGTGGGCCTCC	0.612																																					p.T5T		Atlas-SNP	.											.	PODNL1	27	.	0			c.C15A						PASS	.						49.0	47.0	47.0					19																	14063934		692	1591	2283	SO:0001627	intron_variant	79883	exon1			TACCTGGGTGGGC	BC002926	CCDS32926.1	19p13.12	2009-07-17	2009-07-17	2009-07-17	ENSG00000132017	ENSG00000132017		"""DDB1 and CUL4 associated factors"""	25095	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 72"""	C19orf72			Standard	NM_138353		Approved	MGC99481	uc002mxt.3	Q66K64		ENST00000254337.6:c.132+478G>T	chr19.hg19:g.14063934G>T		84.0	0.0	.		58.0	17.0	.	NM_001146255	B3KS86|Q96DW0|Q9BU31	Silent	SNP	ENST00000254337.6	hg19	CCDS32926.1																																																																																			.	.	.	none		0.612	DCAF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458099.1	NM_138353	
LPHN1	22859	hgsc.bcm.edu	37	19	14281546	14281546	+	Silent	SNP	G	G	A	rs149098258		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr19:14281546G>A	ENST00000340736.6	-	4	639	c.342C>T	c.(340-342)ccC>ccT	p.P114P	LPHN1_ENST00000361434.3_Silent_p.P114P|CTB-55O6.12_ENST00000592086.1_RNA|LPHN1_ENST00000591528.1_5'UTR|CTB-55O6.12_ENST00000588387.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	114	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCCCAGGACAGGGGTCAGGAA	0.567													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19572	0.0		0.0	False		,,,				2504	0.0				p.P114P		Atlas-SNP	.											.	LPHN1	107	.	0			c.C342T						PASS	.	G	,	1,4405	2.1+/-5.4	0,1,2202	89.0	61.0	71.0		342,342	3.3	1.0	19	dbSNP_134	71	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	LPHN1	NM_001008701.2,NM_014921.4	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	114/1475,114/1470	14281546	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	22859	exon4			AGGACAGGGGTCA	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.342C>T	chr19.hg19:g.14281546G>A		104.0	0.0	.		91.0	43.0	.	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Silent	SNP	ENST00000340736.6	hg19	CCDS32928.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.567	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
ZBTB32	27033	hgsc.bcm.edu	37	19	36205878	36205878	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr19:36205878C>T	ENST00000392197.2	+	3	668	c.350C>T	c.(349-351)gCt>gTt	p.A117V	ZBTB32_ENST00000262630.3_Missense_Mutation_p.A117V			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	117					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGGGACAGGGCTAAAAAGCCA	0.597																																					p.A117V		Atlas-SNP	.											.	ZBTB32	33	.	0			c.C350T						PASS	.						46.0	49.0	48.0					19																	36205878		2203	4300	6503	SO:0001583	missense	27033	exon2			ACAGGGCTAAAAA	AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.350C>T	chr19.hg19:g.36205878C>T	ENSP00000376035:p.Ala117Val	92.0	0.0	.		99.0	42.0	.	NM_014383	Q8WVP2	Missense_Mutation	SNP	ENST00000392197.2	hg19	CCDS12471.1	.	.	.	.	.	.	.	.	.	.	C	10.10	1.256716	0.22965	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.09723	2.95;2.95	5.43	1.98	0.26296	BTB/POZ-like (1);	1.171210	0.06374	N	0.714002	T	0.08891	0.0220	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.37957	-0.9683	10	0.52906	T	0.07	1.7382	6.4857	0.22087	0.317:0.5964:0.0:0.0867	.	117	Q9Y2Y4	ZBT32_HUMAN	V	117	ENSP00000262630:A117V;ENSP00000376035:A117V	ENSP00000262630:A117V	A	+	2	0	ZBTB32	40897718	0.000000	0.05858	0.001000	0.08648	0.081000	0.17604	0.161000	0.16481	0.292000	0.22492	0.655000	0.94253	GCT	.	.	.	none		0.597	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109491.3	NM_014383	
SIPA1L3	23094	hgsc.bcm.edu	37	19	38684203	38684203	+	Silent	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr19:38684203G>C	ENST00000222345.6	+	18	5132	c.4623G>C	c.(4621-4623)cgG>cgC	p.R1541R		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1541					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GCCTGCAGCGGACGCTGTCGG	0.687																																					p.R1541R		Atlas-SNP	.											.	SIPA1L3	150	.	0			c.G4623C						PASS	.						12.0	14.0	13.0					19																	38684203		2191	4288	6479	SO:0001819	synonymous_variant	23094	exon18			GCAGCGGACGCTG	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.4623G>C	chr19.hg19:g.38684203G>C		100.0	0.0	.		35.0	12.0	.	NM_015073	Q2TV87	Silent	SNP	ENST00000222345.6	hg19	CCDS33007.1																																																																																			.	.	.	none		0.687	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
ATP1A3	478	hgsc.bcm.edu	37	19	42492528	42492528	+	Splice_Site	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr19:42492528G>C	ENST00000302102.5	-	3	245	c.95C>G	c.(94-96)aCa>aGa	p.T32R	ATP1A3_ENST00000543770.1_Splice_Site_p.T43R|ATP1A3_ENST00000545399.1_Splice_Site_p.T45R|ATP1A3_ENST00000468774.2_5'UTR|ATP1A3_ENST00000602133.1_Splice_Site_p.T2R	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	32					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						CTTGTGCTCTGTCTGAGGAAC	0.607																																					p.T45R		Atlas-SNP	.											.	ATP1A3	117	.	0			c.C134G						PASS	.						176.0	172.0	173.0					19																	42492528		2203	4300	6503	SO:0001630	splice_region_variant	478	exon3			TGCTCTGTCTGAG		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.94-1C>G	chr19.hg19:g.42492528G>C		73.0	0.0	.		42.0	15.0	.	NM_001256214	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	hg19	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787354	0.70337	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000543770;ENST00000448429	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	4.62	4.62	0.57501	ATPase, P-type cation-transporter, N-terminal (1);	0.328937	0.27811	N	0.017754	T	0.77525	0.4143	N	0.08118	0	0.80722	D	1	B;B;B;B	0.32893	0.187;0.249;0.389;0.161	B;B;B;B	0.35114	0.091;0.091;0.196;0.042	T	0.80743	-0.1246	10	0.87932	D	0	.	15.4001	0.74834	0.0:0.0:1.0:0.0	.	45;43;32;32	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	R	32;32;45;2;43;45	ENSP00000302397:T32R;ENSP00000411503:T32R;ENSP00000444688:T45R;ENSP00000437577:T43R	ENSP00000302397:T32R	T	-	2	0	ATP1A3	47184368	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.752000	0.68728	2.328000	0.79073	0.485000	0.47835	ACA	.	.	.	none		0.607	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	Missense_Mutation
RTN2	6253	hgsc.bcm.edu	37	19	45991773	45991773	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr19:45991773C>T	ENST00000245923.4	-	9	1688	c.1453G>A	c.(1453-1455)Gtg>Atg	p.V485M	RTN2_ENST00000590526.1_Missense_Mutation_p.V211M|PPM1N_ENST00000401705.1_5'Flank|RTN2_ENST00000430715.2_Missense_Mutation_p.V145M|RTN2_ENST00000344680.4_Missense_Mutation_p.V412M	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	485	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		AGACCAATCACTCCTGTGGGT	0.577																																					p.V485M		Atlas-SNP	.											.	RTN2	45	.	0			c.G1453A						PASS	.						97.0	93.0	94.0					19																	45991773		2203	4300	6503	SO:0001583	missense	6253	exon9			CAATCACTCCTGT	AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1453G>A	chr19.hg19:g.45991773C>T	ENSP00000245923:p.Val485Met	83.0	0.0	.		85.0	7.0	.	NM_005619	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	hg19	CCDS12665.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665718	0.67700	.	.	ENSG00000125744	ENST00000344680;ENST00000245923;ENST00000430715	T;T;T	0.53857	0.6;0.6;0.6	5.45	5.45	0.79879	.	0.061059	0.64402	D	0.000004	T	0.72614	0.3482	M	0.77103	2.36	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.87578	0.982;0.998	T	0.74575	-0.3620	10	0.54805	T	0.06	-8.7254	14.8394	0.70212	0.0:1.0:0.0:0.0	.	412;485	O75298-2;O75298	.;RTN2_HUMAN	M	412;485;145	ENSP00000345127:V412M;ENSP00000245923:V485M;ENSP00000398178:V145M	ENSP00000245923:V485M	V	-	1	0	RTN2	50683613	1.000000	0.71417	1.000000	0.80357	0.487000	0.33371	3.022000	0.49659	2.580000	0.87095	0.555000	0.69702	GTG	.	.	.	none		0.577	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619	
GRIN2D	2906	hgsc.bcm.edu	37	19	48945411	48945411	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr19:48945411G>C	ENST00000263269.3	+	12	2533	c.2445G>C	c.(2443-2445)gaG>gaC	p.E815D		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	815					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCCTAGATGAGATCGAGATGC	0.562																																					p.E815D		Atlas-SNP	.											.	GRIN2D	76	.	0			c.G2445C						PASS	.						105.0	103.0	104.0					19																	48945411		2203	4300	6503	SO:0001583	missense	2906	exon12			AGATGAGATCGAG	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2445G>C	chr19.hg19:g.48945411G>C	ENSP00000263269:p.Glu815Asp	77.0	0.0	.		45.0	14.0	.	NM_000836		Missense_Mutation	SNP	ENST00000263269.3	hg19	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633555	0.29068	.	.	ENSG00000105464	ENST00000263269	T	0.32023	1.47	4.5	0.644	0.17776	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.17492	0.0420	N	0.25825	0.765	0.40143	D	0.976859	B	0.16166	0.016	B	0.15052	0.012	T	0.06552	-1.0820	10	0.33940	T	0.23	.	6.9597	0.24590	0.1793:0.1404:0.6803:0.0	.	815	O15399	NMDE4_HUMAN	D	815	ENSP00000263269:E815D	ENSP00000263269:E815D	E	+	3	2	GRIN2D	53637223	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	0.723000	0.25939	0.146000	0.19002	0.456000	0.33151	GAG	.	.	.	none		0.562	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
RIPK4	54101	hgsc.bcm.edu	37	21	43164161	43164161	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr21:43164161T>C	ENST00000352483.2	-	8	1284	c.1220A>G	c.(1219-1221)gAg>gGg	p.E407G	RIPK4_ENST00000542057.1_Missense_Mutation_p.E296G|AP001615.9_ENST00000423276.1_RNA|RIPK4_ENST00000332512.3_Missense_Mutation_p.E359G|RIPK4_ENST00000544709.1_Missense_Mutation_p.E296G			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	407					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CAGCTTGGACTCAGAGGAGCT	0.617																																					p.E359G		Atlas-SNP	.											.	RIPK4	151	.	0			c.A1076G						PASS	.						38.0	40.0	40.0					21																	43164161		2203	4300	6503	SO:0001583	missense	54101	exon7			TTGGACTCAGAGG	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.1220A>G	chr21.hg19:g.43164161T>C	ENSP00000330161:p.Glu407Gly	98.0	0.0	.		70.0	28.0	.	NM_020639	Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	hg19		.	.	.	.	.	.	.	.	.	.	T	19.83	3.899939	0.72754	.	.	ENSG00000183421	ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057;ENST00000330470	T;T;T;T	0.78707	-0.96;-1.03;-1.2;-1.2	5.12	3.96	0.45880	.	0.000000	0.64402	D	0.000007	T	0.75019	0.3793	N	0.08118	0	0.46061	D	0.998849	D	0.89917	1.0	D	0.80764	0.994	T	0.78056	-0.2353	10	0.66056	D	0.02	-32.5994	11.4902	0.50377	0.0:0.0:0.1505:0.8495	.	359	P57078-2	.	G	359;407;296;296;98	ENSP00000332454:E359G;ENSP00000330161:E407G;ENSP00000441754:E296G;ENSP00000442901:E296G	ENSP00000330975:E98G	E	-	2	0	RIPK4	42037230	1.000000	0.71417	0.455000	0.27031	0.995000	0.86356	3.720000	0.54933	0.777000	0.33496	0.533000	0.62120	GAG	.	.	.	none		0.617	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718226	142718226	+	Nonsense_Mutation	SNP	A	A	C			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chrX:142718226A>C	ENST00000381779.4	-	2	924	c.699T>G	c.(697-699)taT>taG	p.Y233*	SLITRK4_ENST00000356928.1_Nonsense_Mutation_p.Y233*|SLITRK4_ENST00000338017.4_Nonsense_Mutation_p.Y233*	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	233	LRRCT 1.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TGTAAATGTTATATGGCATGT	0.423																																					p.Y233X		Atlas-SNP	.											.	SLITRK4	162	.	0			c.T699G						PASS	.						82.0	76.0	78.0					X																	142718226		2203	4300	6503	SO:0001587	stop_gained	139065	exon2			AATGTTATATGGC	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.699T>G	chrX.hg19:g.142718226A>C	ENSP00000371198:p.Tyr233*	107.0	0.0	.		101.0	78.0	.	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Nonsense_Mutation	SNP	ENST00000381779.4	hg19	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	A	36	5.612265	0.96637	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	.	.	.	5.73	4.57	0.56435	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-9.3393	9.7669	0.40565	0.918:0.0:0.082:0.0	.	.	.	.	X	233	.	ENSP00000336627:Y233X	Y	-	3	2	SLITRK4	142545892	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.982000	0.49337	0.803000	0.34113	-0.323000	0.08544	TAT	.	.	.	none		0.423	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
MSH2	4436	hgsc.bcm.edu	37	2	47637500	47637500	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr2:47637500delA	ENST00000233146.2	+	3	857	c.634delA	c.(634-636)aaafs	p.K212fs	MSH2_ENST00000543555.1_Frame_Shift_Del_p.K146fs|MSH2_ENST00000406134.1_Frame_Shift_Del_p.K212fs	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	212					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AGACATGGGGAAACTGAGACA	0.433			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.G211fs		Atlas-Indel,Pindel	.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	.	MSH2	198	.	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)	c.633delG						PASS	.						92.0	93.0	93.0					2																	47637500		2203	4300	6503	SO:0001589	frameshift_variant	4436	exon3	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	.	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.634delA	chr2.hg19:g.47637500delA	ENSP00000233146:p.Lys212fs	80.0	0.0	0		105.0	42.0	0.4	NM_000251	B4E2Z2|O75488	Frame_Shift_Del	DEL	ENST00000233146.2	hg19	CCDS1834.1																																																																																			.	.	.	none		0.433	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3		
CASC5	57082	hgsc.bcm.edu	37	15	40915982	40915983	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr15:40915982_40915983insT	ENST00000346991.5	+	11	3988_3989	c.3598_3599insT	c.(3598-3600)attfs	p.I1200fs	CASC5_ENST00000399668.2_Frame_Shift_Ins_p.I1174fs			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	1200	2 X 104 AA approximate repeats.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TACTGTTTTCATTGACTGTCAA	0.381																																					p.I1200fs		Atlas-Indel,Pindel	.											.	CASC5	269	.	0			c.3598_3599insT						PASS	.																																			SO:0001589	frameshift_variant	57082	exon11			.	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.3600dupT	chr15.hg19:g.40915984_40915984dupT	ENSP00000335463:p.Ile1200fs	82.0	0.0	0		99.0	33.0	0.333333	NM_170589	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Frame_Shift_Ins	INS	ENST00000346991.5	hg19	CCDS42023.1																																																																																			.	.	.	none		0.381	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
WDR81	124997	hgsc.bcm.edu	37	17	1634093	1634093	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr17:1634093delC	ENST00000409644.1	+	3	3820	c.3820delC	c.(3820-3822)ccgfs	p.P1274fs	WDR81_ENST00000545662.1_5'UTR|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000437219.2_Frame_Shift_Del_p.P71fs|WDR81_ENST00000419248.1_Frame_Shift_Del_p.P47fs|WDR81_ENST00000446363.1_5'UTR|WDR81_ENST00000309182.5_Frame_Shift_Del_p.P223fs	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1274					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CGAGAGCCCACCGCTGAGCGC	0.677																																					p.P1273fs		Atlas-Indel,Pindel	.											.	WDR81	180	.	0			c.3819delA						PASS	.						32.0	35.0	34.0					17																	1634093		2202	4296	6498	SO:0001589	frameshift_variant	124997	exon3			.	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.3820delC	chr17.hg19:g.1634093delC	ENSP00000386609:p.Pro1274fs	88.0	0.0	0		81.0	29.0	0.358025	NM_001163809	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Frame_Shift_Del	DEL	ENST00000409644.1	hg19	CCDS54062.1																																																																																			.	.	.	none		0.677	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
PDZK1	5174	hgsc.bcm.edu	37	1	145756430	145756430	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:145756430delG	ENST00000344770.2	+	6	880	c.807delG	c.(805-807)aagfs	p.K269fs	PDZK1_ENST00000451928.2_Frame_Shift_Del_p.K158fs|PDZK1_ENST00000417171.1_Frame_Shift_Del_p.K269fs	NM_002614.4	NP_002605.2	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	269	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				carnitine transport (GO:0015879)|cell proliferation (GO:0008283)|drug transport (GO:0015893)|establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of ion transmembrane transport (GO:0034767)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of anion transport (GO:0044070)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|transporter activity (GO:0005215)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			AAATCATCAAGGACATAGATT	0.453																																					p.K269fs		Atlas-Indel,Pindel	.											.	PDZK1	15	.	0			c.806delA						PASS	.																																			SO:0001589	frameshift_variant	5174	exon7			.	AF012281	CCDS72859.1, CCDS72860.1	1q21	2009-08-21			ENSG00000174827	ENSG00000174827			8821	protein-coding gene	gene with protein product		603831				9461128	Standard	NM_002614		Approved	PDZD1, NHERF3	uc001eoo.2	Q5T2W1	OTTHUMG00000013735	ENST00000344770.2:c.807delG	chr1.hg19:g.145756430delG	ENSP00000342143:p.Lys269fs	167.0	0.0	0		286.0	31.0	0.108392	NM_002614	B4DPB9|E7EU02|O60450|Q5T5P6|Q9BQ41	Frame_Shift_Del	DEL	ENST00000344770.2	hg19	CCDS924.1																																																																																			.	.	.	none		0.453	PDZK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038502.2	NM_002614	
FBLN5	10516	hgsc.bcm.edu	37	14	92336630	92336630	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr14:92336630delT	ENST00000342058.4	-	11	1878	c.1285delA	c.(1285-1287)atcfs	p.I429fs	TC2N_ENST00000555302.1_5'Flank|TC2N_ENST00000435962.2_5'Flank|FBLN5_ENST00000267620.10_Frame_Shift_Del_p.I470fs|FBLN5_ENST00000556154.1_Frame_Shift_Del_p.I434fs|FBLN5_ENST00000556961.1_5'UTR	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	429					cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				CTGAAGTTGATGACAGTGTTG	0.582																																					p.I429fs		Atlas-Indel,Pindel	.											.	FBLN5	60	.	0			c.1286delT						PASS	.						113.0	115.0	115.0					14																	92336630		2203	4300	6503	SO:0001589	frameshift_variant	10516	exon11			.	AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.1285delA	chr14.hg19:g.92336630delT	ENSP00000345008:p.Ile429fs	61.0	0.0	0		97.0	33.0	0.340206	NM_006329	O75966|Q6IAL4|Q6UWA3	Frame_Shift_Del	DEL	ENST00000342058.4	hg19	CCDS9898.1																																																																																			.	.	.	none		0.582	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411787.1		
SWI5	375757	hgsc.bcm.edu	37	9	131038966	131038966	+	Frame_Shift_Del	DEL	C	C	-	rs191475291	byFrequency	TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr9:131038966delC	ENST00000320188.5	+	2	358	c.358delC	c.(358-360)cccfs	p.P120fs	SWI5_ENST00000419867.2_Frame_Shift_Del_p.P55fs|GOLGA2_ENST00000490628.1_5'Flank|GOLGA2_ENST00000421699.2_5'Flank|SWI5_ENST00000608796.1_Frame_Shift_Del_p.P55fs|SWI5_ENST00000418976.1_Intron|SWI5_ENST00000495313.1_Intron|GOLGA2_ENST00000609374.1_5'Flank	NM_001040011.1	NP_001035100.1	Q1ZZU3	SWI5_HUMAN	SWI5 recombination repair homolog (yeast)	120					cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											ATCAGACTTTCCCCTCGGATT	0.602																																					p.F119fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.357delT						PASS	.						120.0	127.0	125.0					9																	131038966		1912	4128	6040	SO:0001589	frameshift_variant	375757	exon2			.	BC029911	CCDS43883.1	9q34.13	2011-07-29	2011-07-29	2011-07-29	ENSG00000175854	ENSG00000175854			31412	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 119"""	C9orf119		21252223, 20976249	Standard	NM_001040011		Approved	bA395P17.9	uc004bup.3	Q1ZZU3	OTTHUMG00000020729	ENST00000320188.5:c.358delC	chr9.hg19:g.131038966delC	ENSP00000316609:p.Pro120fs	60.0	0.0	0		52.0	15.0	0.288462	NM_001040011	Q5SYX7|Q5SYX8|Q8N2W6	Frame_Shift_Del	DEL	ENST00000320188.5	hg19	CCDS43883.1																																																																																			.	.	.	none		0.602	SWI5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001040011	
PRKAG2	51422	hgsc.bcm.edu	37	7	151372596	151372597	+	Frame_Shift_Ins	INS	-	-	G	rs41317142|rs397517276|rs397517275		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr7:151372596_151372597insG	ENST00000287878.4	-	4	1097_1098	c.593_594insC	c.(592-594)ccgfs	p.P198fs	PRKAG2_ENST00000433631.2_Frame_Shift_Ins_p.P74fs|PRKAG2_ENST00000461529.1_5'Flank|PRKAG2_ENST00000492843.1_Frame_Shift_Ins_p.P74fs|PRKAG2_ENST00000392801.2_Frame_Shift_Ins_p.P154fs	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	198					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	GCCCTGTGTCCGGGGGGGAAGA	0.584																																					p.P198fs		Atlas-Indel,Pindel	.											.,4	PRKAG2	86	.	0			c.594_595insC						PASS	.																																			SO:0001589	frameshift_variant	51422	exon4			.	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.594dupC	chr7.hg19:g.151372603_151372603dupG	ENSP00000287878:p.Pro198fs	81.0	0.0	0		166.0	85.0	0.512048	NM_016203	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Frame_Shift_Ins	INS	ENST00000287878.4	hg19	CCDS5928.1																																																																																			.	.	.	none		0.584	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	
DYNC2LI1	51626	hgsc.bcm.edu	37	2	44014392	44014392	+	Intron	DEL	A	A	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr2:44014392delA	ENST00000260605.8	+	4	331				DYNC2LI1_ENST00000605786.1_Intron|DYNC2LI1_ENST00000443170.3_Intron|DYNC2LI1_ENST00000489222.2_Intron|DYNC2LI1_ENST00000398823.2_Intron|DYNC2LI1_ENST00000406852.3_Intron	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ACAACACAGTAAGTGTCTTTT	0.363																																					.		Atlas-Indel,Pindel	.											.	DYNC2LI1	46	.	0			c.231+2A>-						PASS	.						108.0	99.0	102.0					2																	44014392		2203	4300	6503	SO:0001627	intron_variant	51626	exon4			.		CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.231+3A>-	chr2.hg19:g.44014392delA		53.0	0.0	0		83.0	27.0	0.325301	NM_016008	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Splice_Site	DEL	ENST00000260605.8	hg19	CCDS1813.1																																																																																			.	.	.	none		0.363	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250536.2	NM_016008	
EP400	57634	hgsc.bcm.edu	37	12	132505838	132505838	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr12:132505838delC	ENST00000333577.4	+	24	4879	c.4770delC	c.(4768-4770)ctcfs	p.L1590fs	EP400_ENST00000389562.2_Frame_Shift_Del_p.L1553fs|EP400_ENST00000332482.4_Frame_Shift_Del_p.L1517fs|EP400_ENST00000389561.2_Frame_Shift_Del_p.L1554fs|EP400_ENST00000330386.6_Intron			Q96L91	EP400_HUMAN	E1A binding protein p400	1590					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GGCTGGTGCTCCCCTCGCAGG	0.682																																					p.L1554fs		Atlas-Indel,Pindel	.											.	EP400	370	.	0			c.4661delT						PASS	.						5.0	4.0	4.0					12																	132505838		1830	3662	5492	SO:0001589	frameshift_variant	57634	exon23			.	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.4770delC	chr12.hg19:g.132505838delC	ENSP00000333602:p.Leu1590fs	111.0	0.0	0		56.0	20.0	0.357143	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Frame_Shift_Del	DEL	ENST00000333577.4	hg19																																																																																				.	.	.	none		0.682	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
NUGGC	389643	hgsc.bcm.edu	37	8	27931921	27931923	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr8:27931921_27931923delCTG	ENST00000413272.2	-	2	147_149	c.5_7delCAG	c.(4-9)gcagaa>gaa	p.A2del	NUGGC_ENST00000341513.6_In_Frame_Del_p.A2del	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	2					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										TCCTTCGTTTCTGCCATTCCTTG	0.438																																					p.2_3del		Atlas-Indel,Pindel	.											.	.	.	.	0			c.6_8del						PASS	.																																			SO:0001651	inframe_deletion	389643	exon2			.	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.5_7delCAG	chr8.hg19:g.27931921_27931923delCTG	ENSP00000408697:p.Ala2del	32.0	0.0	0		59.0	12.0	0.20339	NM_001010906	Q6ZP73	In_Frame_Del	DEL	ENST00000413272.2	hg19	CCDS47833.1																																																																																			.	.	.	none		0.438	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906	
LDB3	11155	hgsc.bcm.edu	37	10	88441289	88441290	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr10:88441289_88441290delCC	ENST00000361373.4	+	4	439_440	c.418_419delCC	c.(418-420)cccfs	p.P140fs	LDB3_ENST00000372056.4_Frame_Shift_Del_p.P140fs|LDB3_ENST00000372066.3_Intron|LDB3_ENST00000310944.6_Frame_Shift_Del_p.P140fs|LDB3_ENST00000542786.1_Frame_Shift_Del_p.P140fs|LDB3_ENST00000458213.2_Intron|LDB3_ENST00000352360.5_Intron|LDB3_ENST00000429277.2_Frame_Shift_Del_p.P140fs|LDB3_ENST00000263066.6_Intron	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						GGAGCTCAGGCCCACCTTTAGC	0.733																																					p.139_140del		Atlas-Indel,Pindel	.											LDB3_ENST00000429277,NS,carcinoma,0,3	LDB3	164	.	0			c.417_418del						PASS	.																																			SO:0001589	frameshift_variant	11155	exon4			.	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.418_419delCC	chr10.hg19:g.88441289_88441290delCC	ENSP00000355296:p.Pro140fs	176.0	0.0	0		79.0	27.0	0.341772	NM_001171611		Frame_Shift_Del	DEL	ENST00000361373.4	hg19	CCDS7377.1																																																																																			.	.	.	none		0.733	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2		
RERE	473	hgsc.bcm.edu	37	1	8425963	8425975	+	Frame_Shift_Del	DEL	CCTACGATGGGCT	CCTACGATGGGCT	-	rs527863652		TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	CCTACGATGGGCT	CCTACGATGGGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr1:8425963_8425975delCCTACGATGGGCT	ENST00000337907.3	-	14	1978_1990	c.1344_1356delAGCCCATCGTAGG	c.(1342-1356)cgagcccatcgtaggfs	p.RAHRR448fs	RERE_ENST00000460659.1_5'UTR|RERE_ENST00000400907.2_Frame_Shift_Del_p.RAHRR448fs|RERE_ENST00000400908.2_Frame_Shift_Del_p.RAHRR448fs|RERE_ENST00000476556.1_5'UTR|RERE_ENST00000377464.1_Frame_Shift_Del_p.RAHRR180fs	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	448					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GCCTGCGGTGCCTACGATGGGCTCGGGAGCTGG	0.61																																					p.449_453del		Atlas-Indel,Pindel	.											.	RERE	129	.	0			c.1345_1357del						PASS	.																																			SO:0001589	frameshift_variant	473	exon14			.	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1344_1356delAGCCCATCGTAGG	chr1.hg19:g.8425963_8425975delCCTACGATGGGCT	ENSP00000338629:p.Arg448fs	70.0	0.0	0		54.0	14.0	0.259259	NM_012102	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Frame_Shift_Del	DEL	ENST00000337907.3	hg19	CCDS95.1																																																																																			.	.	.	none		0.610	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
SGK1	6446	hgsc.bcm.edu	37	6	134494465	134494467	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr6:134494465_134494467delCTT	ENST00000237305.7	-	5	450_452	c.362_364delAAG	c.(361-366)gaagtg>gtg	p.E121del	SGK1_ENST00000367857.5_In_Frame_Del_p.E111del|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000413996.3_In_Frame_Del_p.E135del|SGK1_ENST00000475719.2_In_Frame_Del_p.E121del|SGK1_ENST00000528577.1_In_Frame_Del_p.E149del|SGK1_ENST00000367858.5_In_Frame_Del_p.E216del	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	121	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GCATAGAACACTTCTTCTGCCTT	0.389																																					p.216_217del		Atlas-Indel,Pindel	.											.	SGK1	387	.	0			c.648_650del						PASS	.		,,,	0,4264		0,0,2132					,,,	-3.9	0.0			112	7,8247		3,1,4123	no	coding,coding,coding,coding	SGK1	NM_005627.3,NM_001143678.1,NM_001143677.1,NM_001143676.1	,,,	3,1,6255	A1A1,A1R,RR		0.0848,0.0,0.0559	,,,	,,,		7,12511				SO:0001651	inframe_deletion	6446	exon7			.	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.362_364delAAG	chr6.hg19:g.134494468_134494470delCTT	ENSP00000237305:p.Glu121del	141.0	0.0	0		119.0	38.0	0.319328	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	In_Frame_Del	DEL	ENST00000237305.7	hg19	CCDS5170.1																																																																																			.	.	.	none		0.389	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
BAP1	8314	hgsc.bcm.edu	37	3	52437652	52437652	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr3:52437652delG	ENST00000460680.1	-	13	1980	c.1509delC	c.(1507-1509)ttcfs	p.F503fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.F485fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GTGGCGAGTTGAAAGCACTGC	0.632			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.N504fs	GBM(101;493 1458 7992 21037 25532)	Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.1510delA						PASS	.						49.0	51.0	50.0					3																	52437652		2203	4300	6503	SO:0001589	frameshift_variant	8314	exon13			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1509delC	chr3.hg19:g.52437652delG	ENSP00000417132:p.Phe503fs	112.0	0.0	0		50.0	39.0	0.78	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.	.	none		0.632	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
RP3-331H24.5	0	hgsc.bcm.edu	37	6	72113259	72113260	+	lincRNA	INS	-	-	GCAAAC			TCGA-2Z-A9JD-01A-11D-A42J-10	TCGA-2Z-A9JD-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0c6a1f3-cb7d-4abc-b7be-b60b373335bb	edf87796-76e3-4a71-8bb0-cb01677c6e77	g.chr6:72113259_72113260insGCAAAC	ENST00000602823.1	-	0	267				MIR30A_ENST00000385092.1_RNA																							AGTAGGCAGCTGCAAACATCCG	0.431																																					.		Pindel	.											.	.	.	.	0			.						PASS	.																																					407029	.			.																													chr6.hg19:g.72113260_72113265dupGCAAAC		21.0	0.0	.		51.0	14.0	0.275	.		RNA	INS	ENST00000602823.1	hg19																																																																																				.	.	.	none		0.431	RP3-331H24.5-001	KNOWN	basic|readthrough_transcript	lincRNA	lincRNA	OTTHUMT00000467928.1		
