#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CAMTA1	23261	hgsc.bcm.edu	37	1	7811258	7811258	+	Splice_Site	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:7811258G>T	ENST00000303635.7	+	20	4896		c.e20-1		CAMTA1_ENST00000439411.2_Splice_Site|CAMTA1_ENST00000476864.1_Splice_Site	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TTCCCCTGCAGTACGCACTTT	0.483			T	WWTR1	epitheliod hemangioendothelioma																																.		Atlas-SNP	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	0			c.4690-1G>T						PASS	.						191.0	204.0	200.0					1																	7811258		2203	4300	6503	SO:0001630	splice_region_variant	23261	exon20			CCTGCAGTACGCA	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.4690-1G>T	chr1.hg19:g.7811258G>T		99.0	0.0	.		92.0	6.0	.	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Splice_Site	SNP	ENST00000303635.7	hg19	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759921	0.89932	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646;ENST00000495233;ENST00000490905;ENST00000476864	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7272	0.96168	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CAMTA1	7733845	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.646000	0.89796	0.655000	0.94253	.	.	.	.	none		0.483	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	Intron
MFN2	9927	hgsc.bcm.edu	37	1	12067262	12067262	+	Silent	SNP	T	T	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:12067262T>A	ENST00000235329.5	+	17	2347	c.2025T>A	c.(2023-2025)ctT>ctA	p.L675L	MFN2_ENST00000444836.1_Silent_p.L675L	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	675					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AGCTGCAGCTTGTCATCAGCT	0.607																																					p.L675L		Atlas-SNP	.											.	MFN2	83	.	0			c.T2025A						PASS	.						54.0	48.0	50.0					1																	12067262		2203	4300	6503	SO:0001819	synonymous_variant	9927	exon17			GCAGCTTGTCATC	AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.2025T>A	chr1.hg19:g.12067262T>A		177.0	0.0	.		139.0	57.0	.	NM_014874	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Silent	SNP	ENST00000235329.5	hg19	CCDS30587.1																																																																																			.	.	.	none		0.607	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006859.2	NM_014874	
TNFRSF1B	7133	hgsc.bcm.edu	37	1	12254074	12254074	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:12254074A>C	ENST00000376259.3	+	7	939	c.850A>C	c.(850-852)Atg>Ctg	p.M284L	TNFRSF1B_ENST00000492361.1_3'UTR|MIR4632_ENST00000584158.1_RNA	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	284					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	CTGTGTCATCATGACCCAGGT	0.483																																					p.M284L		Atlas-SNP	.											.	TNFRSF1B	28	.	0			c.A850C						PASS	.						204.0	191.0	195.0					1																	12254074		2203	4300	6503	SO:0001583	missense	7133	exon7			GTCATCATGACCC	M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.850A>C	chr1.hg19:g.12254074A>C	ENSP00000365435:p.Met284Leu	130.0	0.0	.		92.0	42.0	.	NM_001066	B1AJZ3|Q16042|Q6YI29|Q9UIH1	Missense_Mutation	SNP	ENST00000376259.3	hg19	CCDS145.1	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.854484	0.00558	.	.	ENSG00000028137	ENST00000376259	D	0.84800	-1.9	4.12	-8.25	0.01025	.	3.614700	0.00710	N	0.000824	T	0.72518	0.3470	L	0.36672	1.1	0.20403	N	0.999903	B	0.02656	0.0	B	0.01281	0.0	T	0.62863	-0.6764	10	0.10636	T	0.68	-4.0556	5.32	0.15876	0.1423:0.3801:0.3863:0.0912	.	284	P20333	TNR1B_HUMAN	L	284	ENSP00000365435:M284L	ENSP00000365435:M284L	M	+	1	0	TNFRSF1B	12176661	0.001000	0.12720	0.085000	0.20634	0.704000	0.40688	-2.970000	0.00668	-2.877000	0.00320	-0.290000	0.09829	ATG	.	.	.	none		0.483	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005133.1	NM_001066	
UBR4	23352	hgsc.bcm.edu	37	1	19430633	19430633	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:19430633C>A	ENST00000375254.3	-	87	12873	c.12846G>T	c.(12844-12846)aaG>aaT	p.K4282N	UBR4_ENST00000543981.1_5'Flank|UBR4_ENST00000375217.2_Missense_Mutation_p.K4275N|UBR4_ENST00000375267.2_Missense_Mutation_p.K4282N|UBR4_ENST00000375224.1_5'UTR|UBR4_ENST00000375226.2_Missense_Mutation_p.K4258N	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	4282					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CATCGATCAGCTTGGTCCTCT	0.537																																					p.K4282N		Atlas-SNP	.											.	UBR4	415	.	0			c.G12846T						PASS	.						149.0	121.0	131.0					1																	19430633		2203	4300	6503	SO:0001583	missense	23352	exon87			GATCAGCTTGGTC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.12846G>T	chr1.hg19:g.19430633C>A	ENSP00000364403:p.Lys4282Asn	98.0	0.0	.		121.0	68.0	.	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	hg19	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	18.64	3.668267	0.67814	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.38	2.51	0.30379	.	0.098404	0.64402	D	0.000002	T	0.66177	0.2763	L	0.41415	1.275	0.80722	D	1	D	0.57899	0.981	D	0.67231	0.95	T	0.62685	-0.6802	10	0.48119	T	0.1	.	8.5074	0.33195	0.0:0.7562:0.0:0.2438	.	4282	Q5T4S7	UBR4_HUMAN	N	4282;4282;4275;4258	ENSP00000364403:K4282N;ENSP00000364416:K4282N;ENSP00000364365:K4275N;ENSP00000364374:K4258N	ENSP00000364365:K4275N	K	-	3	2	UBR4	19303220	0.996000	0.38824	1.000000	0.80357	0.880000	0.50808	0.488000	0.22371	0.405000	0.25532	0.655000	0.94253	AAG	.	.	.	none		0.537	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
PUM1	9698	hgsc.bcm.edu	37	1	31452956	31452956	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:31452956G>T	ENST00000257075.5	-	9	1400	c.1307C>A	c.(1306-1308)cCa>cAa	p.P436Q	PUM1_ENST00000373741.4_Missense_Mutation_p.P472Q|PUM1_ENST00000440538.2_Missense_Mutation_p.P437Q|PUM1_ENST00000426105.2_Missense_Mutation_p.P436Q|PUM1_ENST00000373742.2_Missense_Mutation_p.P377Q|PUM1_ENST00000373747.3_Missense_Mutation_p.P437Q|PUM1_ENST00000490546.1_5'UTR|PUM1_ENST00000423018.2_Missense_Mutation_p.P340Q|PUM1_ENST00000424085.2_Missense_Mutation_p.P194Q	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	436	Ala-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GTCCGTCCCTGGGGGAGCAGC	0.498																																					p.P436Q		Atlas-SNP	.											.	PUM1	107	.	0			c.C1307A						PASS	.						60.0	55.0	57.0					1																	31452956		2203	4300	6503	SO:0001583	missense	9698	exon9			GTCCCTGGGGGAG	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.1307C>A	chr1.hg19:g.31452956G>T	ENSP00000257075:p.Pro436Gln	79.0	0.0	.		71.0	26.0	.	NM_014676	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	hg19	CCDS338.1	.	.	.	.	.	.	.	.	.	.	G	35	5.426313	0.96131	.	.	ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742;ENST00000543952	T;T;T;T;T;T;T;T	0.18810	2.26;2.19;2.47;2.48;2.42;2.46;2.4;2.22	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.47820	0.1466	M	0.66939	2.045	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.998;0.998;0.996;0.999;0.993;0.996;0.993;0.996	D;D;D;D;P;P;P;P	0.83275	0.927;0.991;0.927;0.996;0.878;0.878;0.878;0.878	T	0.28808	-1.0032	10	0.48119	T	0.1	-6.3805	19.8328	0.96642	0.0:0.0:1.0:0.0	.	377;340;472;437;436;436;437;436	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.;.;.;.;PUM1_HUMAN;.;.;.	Q	194;436;437;174;436;437;472;340;377;436	ENSP00000400141:P194Q;ENSP00000257075:P436Q;ENSP00000362852:P437Q;ENSP00000391723:P436Q;ENSP00000401777:P437Q;ENSP00000362846:P472Q;ENSP00000399440:P340Q;ENSP00000362847:P377Q	ENSP00000257075:P436Q	P	-	2	0	PUM1	31225543	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.785000	0.99042	2.758000	0.94735	0.591000	0.81541	CCA	.	.	.	none		0.498	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
CFAP57	149465	hgsc.bcm.edu	37	1	43681027	43681027	+	Silent	SNP	A	A	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:43681027A>G	ENST00000372492.4	+	12	2355	c.2031A>G	c.(2029-2031)cgA>cgG	p.R677R		NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		677										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GAATCAAGCGAGAGAGGGAGG	0.478																																					p.R677R		Atlas-SNP	.											.	WDR65	76	.	0			c.A2031G						PASS	.																																			SO:0001819	synonymous_variant	149465	exon12			CAAGCGAGAGAGG																												ENST00000372492.4:c.2031A>G	chr1.hg19:g.43681027A>G		110.0	0.0	.		131.0	66.0	.	NM_001195831	A6NKQ3|Q17RI9|Q5TAI0	Silent	SNP	ENST00000372492.4	hg19																																																																																				.	.	.	none		0.478	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
C8A	731	hgsc.bcm.edu	37	1	57383327	57383327	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:57383327C>T	ENST00000361249.3	+	11	1789	c.1693C>T	c.(1693-1695)Cca>Tca	p.P565S		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	565	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						GTGTGACAATCCAGCACCTCA	0.582																																					p.P565S		Atlas-SNP	.											.	C8A	103	.	0			c.C1693T						PASS	.						68.0	66.0	67.0					1																	57383327		2203	4300	6503	SO:0001583	missense	731	exon11			GACAATCCAGCAC	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1693C>T	chr1.hg19:g.57383327C>T	ENSP00000354458:p.Pro565Ser	253.0	0.0	.		260.0	125.0	.	NM_000562	A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	hg19	CCDS606.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917645	0.52546	.	.	ENSG00000157131	ENST00000361249	T	0.54479	0.57	4.82	4.82	0.62117	.	0.099528	0.64402	D	0.000001	T	0.78941	0.4363	M	0.92649	3.33	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.84585	0.0663	10	0.87932	D	0	-13.7116	16.2551	0.82510	0.0:1.0:0.0:0.0	.	565	P07357	CO8A_HUMAN	S	565	ENSP00000354458:P565S	ENSP00000354458:P565S	P	+	1	0	C8A	57155915	1.000000	0.71417	0.397000	0.26308	0.211000	0.24417	5.614000	0.67695	2.487000	0.83934	0.563000	0.77884	CCA	.	.	.	none		0.582	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	
HAPLN2	60484	hgsc.bcm.edu	37	1	156594250	156594250	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:156594250C>G	ENST00000255039.1	+	5	954	c.547C>G	c.(547-549)Ctc>Gtc	p.L183V	HAPLN2_ENST00000494218.1_3'UTR	NM_021817.2	NP_068589.1	Q9GZV7	HPLN2_HUMAN	hyaluronan and proteoglycan link protein 2	183	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|establishment of blood-nerve barrier (GO:0008065)|extracellular matrix assembly (GO:0085029)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	7	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTACTCCCAGCTCTACCAGGG	0.672																																					p.L183V		Atlas-SNP	.											.	HAPLN2	20	.	0			c.C547G						PASS	.						23.0	23.0	23.0					1																	156594250		2202	4300	6502	SO:0001583	missense	60484	exon5			TCCCAGCTCTACC	AB049054	CCDS1148.1	1q23.1	2013-01-11			ENSG00000132702	ENSG00000132702		"""Immunoglobulin superfamily / V-set domain containing"""	17410	protein-coding gene	gene with protein product	"""brain link protein 1"""					11027579, 11873941	Standard	NM_021817		Approved	BRAL1	uc001fpn.1	Q9GZV7	OTTHUMG00000033205	ENST00000255039.1:c.547C>G	chr1.hg19:g.156594250C>G	ENSP00000255039:p.Leu183Val	201.0	0.0	.		145.0	56.0	.	NM_021817	Q5T3J0	Missense_Mutation	SNP	ENST00000255039.1	hg19	CCDS1148.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.488481	0.44249	.	.	ENSG00000132702	ENST00000255039;ENST00000544775;ENST00000456112	T;T	0.12879	2.64;2.64	4.15	3.23	0.37069	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.30603	0.0770	M	0.89414	3.03	0.52501	D	0.99995	D	0.89917	1.0	D	0.91635	0.999	T	0.27262	-1.0079	10	0.87932	D	0	-16.7817	10.9343	0.47237	0.0:0.9065:0.0:0.0935	.	183	Q9GZV7	HPLN2_HUMAN	V	183;156;183	ENSP00000255039:L183V;ENSP00000388835:L183V	ENSP00000255039:L183V	L	+	1	0	HAPLN2	154860874	1.000000	0.71417	1.000000	0.80357	0.028000	0.11728	5.552000	0.67281	1.100000	0.41517	-0.136000	0.14681	CTC	.	.	.	none		0.672	HAPLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081039.1	NM_021817	
ATP1A2	477	hgsc.bcm.edu	37	1	160104412	160104412	+	Splice_Site	SNP	T	T	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:160104412T>G	ENST00000361216.3	+	14	2053		c.e14+2		ATP1A2_ENST00000392233.3_Splice_Site	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide						adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CAACCCCAGGTGAGGCCTCTG	0.557																																					.		Atlas-SNP	.											.	ATP1A2	167	.	0			c.1964+2T>G						PASS	.						97.0	81.0	87.0					1																	160104412		2203	4300	6503	SO:0001630	splice_region_variant	477	exon14			CCCAGGTGAGGCC	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1964+2T>G	chr1.hg19:g.160104412T>G		90.0	0.0	.		111.0	53.0	.	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Splice_Site	SNP	ENST00000361216.3	hg19	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.037149	0.75617	.	.	ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000447527;ENST00000435866	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.994	0.64386	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP1A2	158371036	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.802000	0.85969	1.997000	0.58415	0.459000	0.35465	.	.	.	.	none		0.557	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	Intron
NEK2	4751	hgsc.bcm.edu	37	1	211846908	211846908	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:211846908C>A	ENST00000366999.4	-	3	610	c.472G>T	c.(472-474)Gga>Tga	p.G158*	NEK2_ENST00000540251.1_Nonsense_Mutation_p.G115*|NEK2_ENST00000366998.3_Nonsense_Mutation_p.G158*|NEK2_ENST00000462283.1_5'Flank|RP11-122M14.1_ENST00000415202.1_RNA	NM_002497.3	NP_002488.1	P51955	NEK2_HUMAN	NIMA-related kinase 2	158	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blastocyst development (GO:0001824)|centrosome separation (GO:0051299)|chromosome segregation (GO:0007059)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of centriole-centriole cohesion (GO:1903126)|negative regulation of DNA binding (GO:0043392)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of mitosis (GO:0007088)|regulation of mitotic centrosome separation (GO:0046602)|spindle assembly (GO:0051225)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|microtubule (GO:0005874)|midbody (GO:0030496)|nucleus (GO:0005634)|protein complex (GO:0043234)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		CCAAAGTCTCCAAGCTTGACG	0.423																																					p.G158X		Atlas-SNP	.											.	NEK2	49	.	0			c.G472T						PASS	.						103.0	101.0	101.0					1																	211846908		2203	4300	6503	SO:0001587	stop_gained	4751	exon3			AGTCTCCAAGCTT	U11050	CCDS1500.1, CCDS55682.1, CCDS73024.1	1q32.3	2014-06-12	2012-11-15		ENSG00000117650	ENSG00000117650			7745	protein-coding gene	gene with protein product	"""HsPK 21"", ""protein phosphatase 1, regulatory subunit 111"""	604043	"""NIMA (never in mitosis gene a)-related kinase 2"""			8274451, 24043777	Standard	NM_002497		Approved	NLK1, NEK2A, RP67, PPP1R111	uc001hir.2	P51955	OTTHUMG00000037121	ENST00000366999.4:c.472G>T	chr1.hg19:g.211846908C>A	ENSP00000355966:p.Gly158*	117.0	0.0	.		92.0	33.0	.	NM_002497	Q53FD6|Q5I1Z9|Q5VXZ1|Q6NZX8|Q7Z634|Q86XH2|Q96QN9	Nonsense_Mutation	SNP	ENST00000366999.4	hg19	CCDS1500.1	.	.	.	.	.	.	.	.	.	.	C	39	7.512866	0.98329	.	.	ENSG00000117650	ENST00000366999;ENST00000540251;ENST00000366998	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.1585	0.93522	0.0:1.0:0.0:0.0	.	.	.	.	X	158;115;158	.	ENSP00000355965:G158X	G	-	1	0	NEK2	209913531	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.438000	0.80431	2.591000	0.87537	0.563000	0.77884	GGA	.	.	.	none		0.423	NEK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090154.1	NM_002497	
TMEM63A	9725	hgsc.bcm.edu	37	1	226040425	226040425	+	Silent	SNP	G	G	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:226040425G>A	ENST00000366835.3	-	20	2113	c.1843C>T	c.(1843-1845)Ctg>Ttg	p.L615L		NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	615					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					AAGACACACAGCATCCATGCA	0.552																																					p.L615L		Atlas-SNP	.											.	TMEM63A	75	.	0			c.C1843T						PASS	.						198.0	123.0	148.0					1																	226040425		2203	4300	6503	SO:0001819	synonymous_variant	9725	exon20			CACACAGCATCCA		CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1843C>T	chr1.hg19:g.226040425G>A		67.0	0.0	.		85.0	47.0	.	NM_014698	Q53GI7|Q5TE96|Q8N2U2	Silent	SNP	ENST00000366835.3	hg19	CCDS31042.1																																																																																			.	.	.	none		0.552	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091154.2	NM_014698	
ROCK2	9475	hgsc.bcm.edu	37	2	11333932	11333932	+	Silent	SNP	A	A	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:11333932A>G	ENST00000315872.6	-	30	4108	c.3660T>C	c.(3658-3660)gaT>gaC	p.D1220D	ROCK2_ENST00000401753.1_Silent_p.D977D	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	1220	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TTTCTTTAGCATCTGCTCTAT	0.313																																					p.D1220D		Atlas-SNP	.											.	ROCK2	224	.	0			c.T3660C						PASS	.						96.0	87.0	90.0					2																	11333932		1821	4078	5899	SO:0001819	synonymous_variant	9475	exon30			TTTAGCATCTGCT	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.3660T>C	chr2.hg19:g.11333932A>G		51.0	0.0	.		54.0	27.0	.	NM_004850	Q53QZ0|Q53SJ7|Q9UQN5	Silent	SNP	ENST00000315872.6	hg19	CCDS42654.1																																																																																			.	.	.	none		0.313	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3		
EPAS1	2034	hgsc.bcm.edu	37	2	46583908	46583908	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:46583908G>A	ENST00000263734.3	+	4	925	c.415G>A	c.(415-417)Gac>Aac	p.D139N		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	139	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			TCATCCCTGCGACCATGAGGA	0.438																																					p.D139N		Atlas-SNP	.											EPAS1,caecum,carcinoma,0,1	EPAS1	83	.	0			c.G415A						PASS	.						150.0	143.0	145.0					2																	46583908		2203	4300	6503	SO:0001583	missense	2034	exon4			CCCTGCGACCATG	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.415G>A	chr2.hg19:g.46583908G>A	ENSP00000263734:p.Asp139Asn	60.0	0.0	.		64.0	27.0	.	NM_001430	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	hg19	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	G	35	5.583690	0.96578	.	.	ENSG00000116016	ENST00000449347;ENST00000263734	T;T	0.28069	1.63;1.63	5.31	5.31	0.75309	PAS (3);PAS fold (1);	0.045322	0.85682	D	0.000000	T	0.73385	0.3580	H	0.98276	4.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84327	0.0519	10	0.87932	D	0	.	19.1734	0.93590	0.0:0.0:1.0:0.0	.	139	Q99814	EPAS1_HUMAN	N	139	ENSP00000406137:D139N;ENSP00000263734:D139N	ENSP00000263734:D139N	D	+	1	0	EPAS1	46437412	1.000000	0.71417	0.999000	0.59377	0.894000	0.52154	9.618000	0.98365	2.767000	0.95098	0.561000	0.74099	GAC	.	.	.	none		0.438	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250752.2	NM_001430	
ADD2	119	hgsc.bcm.edu	37	2	70931525	70931525	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:70931525T>C	ENST00000264436.4	-	4	694	c.250A>G	c.(250-252)Atc>Gtc	p.I84V	ADD2_ENST00000355733.3_Missense_Mutation_p.I84V|ADD2_ENST00000413157.2_Missense_Mutation_p.I84V|ADD2_ENST00000407644.2_Missense_Mutation_p.I84V|ADD2_ENST00000473232.1_5'Flank|ADD2_ENST00000430656.1_Missense_Mutation_p.I100V	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	84					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						AGGGCCCAGATGTTGGAGGAG	0.597																																					p.I100V		Atlas-SNP	.											.	ADD2	261	.	0			c.A298G						PASS	.						157.0	135.0	142.0					2																	70931525		2203	4300	6503	SO:0001583	missense	119	exon3			CCCAGATGTTGGA	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.250A>G	chr2.hg19:g.70931525T>C	ENSP00000264436:p.Ile84Val	65.0	0.0	.		52.0	16.0	.	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	hg19	CCDS1906.1	.	.	.	.	.	.	.	.	.	.	T	14.25	2.479766	0.44044	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000522886;ENST00000356565;ENST00000517596;ENST00000413157;ENST00000430656;ENST00000415348;ENST00000425976	T;T;T;T;T;T;T;T	0.31247	3.48;3.48;1.5;1.5;1.5;1.5;1.5;1.5	5.14	3.95	0.45737	.	0.140051	0.49305	N	0.000141	T	0.22627	0.0546	L	0.29908	0.895	0.38061	D	0.93606	B;B;B;B;B;B	0.23185	0.0;0.002;0.006;0.007;0.011;0.081	B;B;B;B;B;B	0.24006	0.001;0.009;0.003;0.005;0.007;0.05	T	0.09228	-1.0684	10	0.72032	D	0.01	-26.4503	9.2523	0.37562	0.0:0.0863:0.0:0.9137	.	100;84;84;84;84;84	B4DM17;P35612-4;E9PAN1;Q05DK5;P35612;P35612-3	.;.;.;.;ADDB_HUMAN;.	V	84;84;84;84;84;84;84;84;100;84;84	ENSP00000264436:I84V;ENSP00000384677:I84V;ENSP00000347972:I84V;ENSP00000430243:I84V;ENSP00000388072:I84V;ENSP00000398112:I100V;ENSP00000412357:I84V;ENSP00000412681:I84V	ENSP00000264436:I84V	I	-	1	0	ADD2	70785033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.225000	0.42954	0.940000	0.37473	0.533000	0.62120	ATC	.	.	.	none		0.597	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
ANKRD23	200539	hgsc.bcm.edu	37	2	97505808	97505808	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:97505808C>A	ENST00000318357.4	-	7	690	c.649G>T	c.(649-651)Gca>Tca	p.A217S	ANKRD23_ENST00000476975.1_5'UTR|ANKRD23_ENST00000418232.1_Missense_Mutation_p.A217S|ANKRD23_ENST00000331001.2_Missense_Mutation_p.A175S	NM_144994.7	NP_659431.5	Q86SG2	ANR23_HUMAN	ankyrin repeat domain 23	217					fatty acid metabolic process (GO:0006631)|response to mechanical stimulus (GO:0009612)	I band (GO:0031674)|intercalated disc (GO:0014704)|nucleus (GO:0005634)	titin binding (GO:0031432)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)	9						GTGCGCACTGCCACGTGCAGG	0.632																																					p.A217S		Atlas-SNP	.											.	ANKRD23	28	.	0			c.G649T						PASS	.						20.0	18.0	19.0					2																	97505808		2181	4275	6456	SO:0001583	missense	200539	exon7			GCACTGCCACGTG		CCDS2027.1	2q11.2	2013-01-10			ENSG00000163126	ENSG00000163126		"""Ankyrin repeat domain containing"""	24470	protein-coding gene	gene with protein product	"""diabetes related ankyrin repeat protein"""	610736				12456686	Standard	NM_144994		Approved	DARP, FLJ32449, MARP3	uc002sxa.3	Q86SG2	OTTHUMG00000130534	ENST00000318357.4:c.649G>T	chr2.hg19:g.97505808C>A	ENSP00000321679:p.Ala217Ser	58.0	0.0	.		30.0	16.0	.	NM_144994	Q711K7|Q8NAJ7	Missense_Mutation	SNP	ENST00000318357.4	hg19	CCDS2027.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.152672	0.78001	.	.	ENSG00000163126	ENST00000318357;ENST00000418232;ENST00000331001	T;T;T	0.80824	-1.42;-1.42;-1.42	4.73	4.73	0.59995	Ankyrin repeat-containing domain (4);	0.193284	0.25447	N	0.030603	D	0.89480	0.6727	M	0.85373	2.75	0.80722	D	1	P;D	0.69078	0.692;0.997	P;D	0.69142	0.534;0.962	D	0.90821	0.4709	10	0.87932	D	0	-13.8287	13.0871	0.59146	0.0:1.0:0.0:0.0	.	175;217	Q86SG2-2;Q86SG2	.;ANR23_HUMAN	S	217;217;175	ENSP00000321679:A217S;ENSP00000398987:A217S;ENSP00000333108:A175S	ENSP00000321679:A217S	A	-	1	0	ANKRD23	96869535	1.000000	0.71417	0.994000	0.49952	0.600000	0.36913	4.133000	0.57983	2.450000	0.82876	0.650000	0.86243	GCA	.	.	.	none		0.632	ANKRD23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252956.1	NM_144994	
MYO7B	4648	hgsc.bcm.edu	37	2	128341726	128341726	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:128341726A>G	ENST00000409816.2	+	12	1405	c.1373A>G	c.(1372-1374)aAc>aGc	p.N458S	MYO7B_ENST00000389524.4_Missense_Mutation_p.N458S|MYO7B_ENST00000428314.1_Missense_Mutation_p.N458S			Q6PIF6	MYO7B_HUMAN	myosin VIIB	458	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AACTTCGCCAACGAGCACCTG	0.602																																					p.N458S		Atlas-SNP	.											.	MYO7B	359	.	0			c.A1373G						PASS	.						62.0	64.0	64.0					2																	128341726		2203	4300	6503	SO:0001583	missense	4648	exon13			TCGCCAACGAGCA		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1373A>G	chr2.hg19:g.128341726A>G	ENSP00000386461:p.Asn458Ser	78.0	0.0	.		94.0	45.0	.	NM_001080527	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	hg19	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.531422	0.85706	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.91351	-2.83;-2.83;-2.83	4.7	4.7	0.59300	Myosin head, motor domain (3);	0.110919	0.64402	D	0.000018	D	0.96327	0.8802	H	0.94385	3.53	0.58432	D	0.999999	D	0.76494	0.999	D	0.68483	0.958	D	0.97450	1.0027	10	0.87932	D	0	.	14.6119	0.68522	1.0:0.0:0.0:0.0	.	458	Q6PIF6	MYO7B_HUMAN	S	458	ENSP00000374175:N458S;ENSP00000415090:N458S;ENSP00000386461:N458S	ENSP00000374175:N458S	N	+	2	0	MYO7B	128058196	1.000000	0.71417	0.869000	0.34112	0.923000	0.55619	9.021000	0.93673	2.104000	0.64026	0.533000	0.62120	AAC	.	.	.	none		0.602	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
GPR155	151556	hgsc.bcm.edu	37	2	175346273	175346273	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:175346273G>A	ENST00000392552.2	-	2	650	c.412C>T	c.(412-414)Cct>Tct	p.P138S	GPR155_ENST00000295500.4_Missense_Mutation_p.P138S|GPR155_ENST00000392551.2_Missense_Mutation_p.P138S	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	138					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						GCAAAAATAGGGAATAGTCCA	0.294																																					p.P138S		Atlas-SNP	.											.	GPR155	76	.	0			c.C412T						PASS	.						141.0	152.0	148.0					2																	175346273		2203	4299	6502	SO:0001583	missense	151556	exon2			AAATAGGGAATAG	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.412C>T	chr2.hg19:g.175346273G>A	ENSP00000376335:p.Pro138Ser	115.0	0.0	.		105.0	52.0	.	NM_001267051	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	ENST00000392552.2	hg19	CCDS2259.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.436500	0.43224	.	.	ENSG00000163328	ENST00000392552;ENST00000392551;ENST00000295500	T;T;T	0.39229	1.09;1.09;1.09	6.03	6.03	0.97812	.	0.047770	0.85682	D	0.000000	T	0.30198	0.0757	N	0.04994	-0.135	0.58432	D	0.999998	P	0.35684	0.515	B	0.38225	0.268	T	0.13361	-1.0512	10	0.36615	T	0.2	-16.4904	20.5568	0.99304	0.0:0.0:1.0:0.0	.	138	Q7Z3F1	GP155_HUMAN	S	138	ENSP00000376335:P138S;ENSP00000376334:P138S;ENSP00000295500:P138S	ENSP00000295500:P138S	P	-	1	0	GPR155	175054519	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.945000	0.63568	2.861000	0.98227	0.655000	0.94253	CCT	.	.	.	none		0.294	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529	
USP37	57695	hgsc.bcm.edu	37	2	219360546	219360546	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:219360546G>T	ENST00000258399.3	-	14	1821	c.1409C>A	c.(1408-1410)gCa>gAa	p.A470E	USP37_ENST00000454775.1_Missense_Mutation_p.A470E|USP37_ENST00000415516.1_Missense_Mutation_p.A398E|USP37_ENST00000418019.1_Missense_Mutation_p.A470E	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	470	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		GCAAGTGTATGCTCTGGTAGC	0.358																																					p.A470E		Atlas-SNP	.											.	USP37	76	.	0			c.C1409A						PASS	.						106.0	106.0	106.0					2																	219360546		2203	4300	6503	SO:0001583	missense	57695	exon14			GTGTATGCTCTGG	AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.1409C>A	chr2.hg19:g.219360546G>T	ENSP00000258399:p.Ala470Glu	73.0	0.0	.		106.0	49.0	.	NM_020935	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	ENST00000258399.3	hg19	CCDS2418.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.846484	0.51164	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.49	3.12	0.35913	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.291794	0.36101	N	0.002789	T	0.15089	0.0364	N	0.10733	0.035	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.04013	0.001;0.001	T	0.06075	-1.0847	10	0.33141	T	0.24	-3.8005	9.7959	0.40735	0.8596:0.0:0.1404:0.0	.	398;470	Q86T82-2;Q86T82	.;UBP37_HUMAN	E	470;470;398;470	ENSP00000258399:A470E;ENSP00000393662:A470E;ENSP00000400902:A398E;ENSP00000396585:A470E	ENSP00000258399:A470E	A	-	2	0	USP37	219068790	1.000000	0.71417	0.985000	0.45067	0.983000	0.72400	5.379000	0.66196	0.383000	0.24910	-0.383000	0.06682	GCA	.	.	.	none		0.358	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256779.3	NM_020935	
COL4A3	1285	hgsc.bcm.edu	37	2	228174025	228174025	+	Silent	SNP	A	A	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:228174025A>T	ENST00000396578.3	+	50	4908	c.4746A>T	c.(4744-4746)tcA>tcT	p.S1582S	AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000433324.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	1582	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		AAGGATTTTCATTCATCATGG	0.473																																					p.S1582S		Atlas-SNP	.											.	COL4A3	293	.	0			c.A4746T						PASS	.						55.0	55.0	55.0					2																	228174025		1943	4165	6108	SO:0001819	synonymous_variant	1285	exon50			ATTTTCATTCATC		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.4746A>T	chr2.hg19:g.228174025A>T		61.0	0.0	.		45.0	23.0	.	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Silent	SNP	ENST00000396578.3	hg19	CCDS42829.1																																																																																			.	.	.	none		0.473	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
ARMC9	80210	hgsc.bcm.edu	37	2	232141353	232141353	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:232141353C>A	ENST00000349938.4	+	15	1533	c.1339C>A	c.(1339-1341)Ccg>Acg	p.P447T	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	447						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		TCCCAGGCGCCCGCTGCAGAC	0.507																																					p.P447T		Atlas-SNP	.											.	ARMC9	129	.	0			c.C1339A						PASS	.						112.0	108.0	110.0					2																	232141353		2203	4300	6503	SO:0001583	missense	80210	exon15			AGGCGCCCGCTGC	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1339C>A	chr2.hg19:g.232141353C>A	ENSP00000258417:p.Pro447Thr	46.0	0.0	.		46.0	25.0	.	NM_025139	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	ENST00000349938.4	hg19	CCDS2484.1	.	.	.	.	.	.	.	.	.	.	C	2.253	-0.371083	0.05034	.	.	ENSG00000135931	ENST00000349938;ENST00000359743;ENST00000436339;ENST00000446447	T;T;T	0.52057	0.68;0.68;0.68	5.42	3.56	0.40772	Armadillo-like helical (1);Armadillo-type fold (1);	0.410909	0.25958	N	0.027202	T	0.21427	0.0516	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.20472	-1.0274	10	0.06236	T	0.91	-13.5235	8.8812	0.35376	0.1329:0.4254:0.4417:0.0	.	447	Q7Z3E5	ARMC9_HUMAN	T	447;447;164;89	ENSP00000258417:P447T;ENSP00000392086:P164T;ENSP00000411778:P89T	ENSP00000258417:P447T	P	+	1	0	ARMC9	231849597	0.114000	0.22134	0.675000	0.29917	0.451000	0.32288	1.453000	0.35167	1.281000	0.44480	0.563000	0.77884	CCG	.	.	.	none		0.507	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139	
UGT1A6	54578	hgsc.bcm.edu	37	2	234602011	234602011	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:234602011C>A	ENST00000305139.6	+	1	500	c.361C>A	c.(361-363)Ctg>Atg	p.L121M	UGT1A10_ENST00000373445.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000373450.4_Intron|AC114812.8_ENST00000439336.1_RNA|UGT1A6_ENST00000406651.1_5'Flank|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000480628.1_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	121					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	TGTTATTGGCCTGTACTTCAT	0.458																																					p.L121M		Atlas-SNP	.											.	UGT1A6	63	.	0			c.C361A						PASS	.						88.0	74.0	79.0					2																	234602011		2203	4300	6503	SO:0001583	missense	54578	exon1			ATTGGCCTGTACT	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.361C>A	chr2.hg19:g.234602011C>A	ENSP00000303174:p.Leu121Met	56.0	0.0	.		73.0	25.0	.	NM_001072	A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	ENST00000305139.6	hg19	CCDS2507.1	.	.	.	.	.	.	.	.	.	.	C	0.098	-1.155968	0.01686	.	.	ENSG00000167165	ENST00000441351;ENST00000305139	T;T	0.60920	0.15;0.15	5.31	-3.87	0.04218	.	.	.	.	.	T	0.21347	0.0514	N	0.02368	-0.58	0.09310	N	0.999996	B;B	0.06786	0.001;0.001	B;B	0.15484	0.01;0.013	T	0.25537	-1.0129	9	0.09084	T	0.74	.	3.2857	0.06931	0.3165:0.3751:0.0657:0.2427	.	121;121	B8K289;P19224	.;UD16_HUMAN	M	121	ENSP00000389637:L121M;ENSP00000303174:L121M	ENSP00000303174:L121M	L	+	1	2	UGT1A6	234266750	0.000000	0.05858	0.007000	0.13788	0.022000	0.10575	-1.635000	0.02018	-0.410000	0.07542	-0.256000	0.11100	CTG	.	.	.	none		0.458	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862	
ANO7	50636	hgsc.bcm.edu	37	2	242149796	242149796	+	Silent	SNP	T	T	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:242149796T>G	ENST00000274979.8	+	14	1711	c.1608T>G	c.(1606-1608)ctT>ctG	p.L536L	ANO7_ENST00000402430.3_Silent_p.L535L	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	536					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GCAACACCCTTCTCGCAGCCT	0.677																																					p.L536L		Atlas-SNP	.											.	ANO7	136	.	0			c.T1608G						PASS	.						97.0	77.0	84.0					2																	242149796		2203	4300	6503	SO:0001819	synonymous_variant	50636	exon14			CACCCTTCTCGCA	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1608T>G	chr2.hg19:g.242149796T>G		64.0	0.0	.		52.0	19.0	.	NM_001001891	Q6IWH6	Silent	SNP	ENST00000274979.8	hg19	CCDS33423.1																																																																																			.	.	.	none		0.677	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
XYLB	9942	hgsc.bcm.edu	37	3	38404498	38404498	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr3:38404498G>A	ENST00000207870.3	+	4	371	c.281G>A	c.(280-282)gGg>gAg	p.G94E	XYLB_ENST00000542835.1_Intron	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	94					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		GCCTTGTCCGGGGCGGGCCAG	0.537																																					p.G94E		Atlas-SNP	.											.	XYLB	50	.	0			c.G281A						PASS	.						85.0	85.0	85.0					3																	38404498		2203	4300	6503	SO:0001583	missense	9942	exon4			TGTCCGGGGCGGG	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.281G>A	chr3.hg19:g.38404498G>A	ENSP00000207870:p.Gly94Glu	50.0	0.0	.		38.0	36.0	.	NM_005108	B2RAW4|B4DDT2|B9EH64	Missense_Mutation	SNP	ENST00000207870.3	hg19	CCDS2678.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266815	0.80469	.	.	ENSG00000093217	ENST00000207870	T	0.45668	0.89	4.74	4.74	0.60224	Carbohydrate kinase, FGGY, N-terminal (1);	0.098371	0.64402	D	0.000001	T	0.72285	0.3441	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.79852	-0.1628	10	0.72032	D	0.01	.	16.0139	0.80422	0.0:0.0:1.0:0.0	.	94	O75191	XYLB_HUMAN	E	94	ENSP00000207870:G94E	ENSP00000207870:G94E	G	+	2	0	XYLB	38379502	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.862000	0.87013	2.554000	0.86153	0.455000	0.32223	GGG	.	.	.	none		0.537	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254062.2	NM_005108	
BAP1	8314	hgsc.bcm.edu	37	3	52439781	52439781	+	Splice_Site	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr3:52439781C>A	ENST00000460680.1	-	10	1402	c.931G>T	c.(931-933)Gat>Tat	p.D311Y	BAP1_ENST00000296288.5_Splice_Site_p.D293Y	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CCCCCAGTACCTGTGTGGTTG	0.577			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.D311Y	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.G931T						PASS	.						43.0	45.0	44.0					3																	52439781		2203	4300	6503	SO:0001630	splice_region_variant	8314	exon10			CAGTACCTGTGTG	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.931+1G>T	chr3.hg19:g.52439781C>A		72.0	0.0	.		60.0	53.0	.	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575175	0.65878	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.57752	0.38;0.39	5.38	5.38	0.77491	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.050678	0.85682	D	0.000000	T	0.48132	0.1483	L	0.54323	1.7	0.58432	D	0.999994	B	0.33379	0.41	B	0.25884	0.064	T	0.43540	-0.9385	9	.	.	.	-1.5677	19.0887	0.93217	0.0:1.0:0.0:0.0	.	311	Q92560	BAP1_HUMAN	Y	311;293	ENSP00000417132:D311Y;ENSP00000296288:D293Y	.	D	-	1	0	BAP1	52414821	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	5.016000	0.64041	2.674000	0.91012	0.655000	0.94253	GAT	.	.	.	none		0.577	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		Missense_Mutation
SPON2	10417	hgsc.bcm.edu	37	4	1165761	1165761	+	Silent	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr4:1165761G>T	ENST00000290902.5	-	2	431	c.99C>A	c.(97-99)tcC>tcA	p.S33S	SPON2_ENST00000431380.1_Silent_p.S33S	NM_012445.3	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	33	Spondin. {ECO:0000255|PROSITE- ProRule:PRU00364}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)		CGGAACAGATGGACTCTCCCC	0.682																																					p.S33S		Atlas-SNP	.											.	SPON2	22	.	0			c.C99A						PASS	.						29.0	41.0	37.0					4																	1165761		2193	4276	6469	SO:0001819	synonymous_variant	10417	exon2			ACAGATGGACTCT	AB027466	CCDS3347.1	4p16.3	2008-07-29			ENSG00000159674	ENSG00000159674			11253	protein-coding gene	gene with protein product	"""Mindin"", ""M-spondin"""	605918				10512675, 15094111	Standard	NM_012445		Approved	DIL1	uc003gco.4	Q9BUD6	OTTHUMG00000089002	ENST00000290902.5:c.99C>A	chr4.hg19:g.1165761G>T		235.0	0.0	.		146.0	59.0	.	NM_012445	D3DVN9|Q4W5N4|Q9ULW1	Silent	SNP	ENST00000290902.5	hg19	CCDS3347.1																																																																																			.	.	.	none		0.682	SPON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202080.2		
ZGRF1	55345	hgsc.bcm.edu	37	4	113539801	113539801	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr4:113539801C>A	ENST00000505019.1	-	6	1522	c.1397G>T	c.(1396-1398)gGa>gTa	p.G466V	C4orf21_ENST00000445203.2_Missense_Mutation_p.G435V|C4orf21_ENST00000309071.5_Missense_Mutation_p.G466V	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		466						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.G466V(2)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TTCCAGTGTTCCACATGTATT	0.338																																					p.G466V		Atlas-SNP	.											C4orf21_ENST00000505019,NS,carcinoma,0,1	C4orf21	223	.	2	Substitution - Missense(2)	lung(2)	c.G1397T						PASS	.						104.0	112.0	109.0					4																	113539801		2203	4300	6503	SO:0001583	missense	55345	exon6			AGTGTTCCACATG																												ENST00000505019.1:c.1397G>T	chr4.hg19:g.113539801C>A	ENSP00000424737:p.Gly466Val	66.0	0.0	.		67.0	27.0	.	NM_018392	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	ENST00000505019.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.56	2.274501	0.40194	.	.	ENSG00000138658	ENST00000505019;ENST00000309071;ENST00000445203	D;T;T	0.82619	-1.63;1.87;1.45	4.86	-3.04	0.05412	.	1.350960	0.04855	N	0.443112	T	0.70894	0.3276	L	0.32530	0.975	0.09310	N	1	B;B	0.32893	0.389;0.1	B;B	0.32211	0.142;0.027	T	0.59075	-0.7522	10	0.66056	D	0.02	-0.8765	2.4375	0.04486	0.0987:0.3354:0.1808:0.3851	.	466;466	Q86YA3;G5EA02	CD021_HUMAN;.	V	466;466;435	ENSP00000424737:G466V;ENSP00000309095:G466V;ENSP00000390505:G435V	ENSP00000309095:G466V	G	-	2	0	C4orf21	113759250	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.202000	0.03023	-0.666000	0.05310	-0.262000	0.10625	GGA	.	.	.	none		0.338	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1		
KIAA0922	23240	hgsc.bcm.edu	37	4	154517528	154517528	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr4:154517528T>C	ENST00000409663.3	+	20	2163	c.2111T>C	c.(2110-2112)aTa>aCa	p.I704T	KIAA0922_ENST00000409959.3_Missense_Mutation_p.I705T|KIAA0922_ENST00000440693.1_Missense_Mutation_p.I621T	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	704						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				ACCTCACTCATACTAATCCGG	0.423																																					p.I705T		Atlas-SNP	.											.	KIAA0922	214	.	0			c.T2114C						PASS	.						140.0	124.0	130.0					4																	154517528		2203	4300	6503	SO:0001583	missense	23240	exon20			CACTCATACTAAT	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.2111T>C	chr4.hg19:g.154517528T>C	ENSP00000386574:p.Ile704Thr	39.0	0.0	.		59.0	24.0	.	NM_001131007	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	hg19	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	T	22.2	4.261278	0.80246	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.22336	2.24;1.96;2.24;1.96	5.65	5.65	0.86999	.	0.100685	0.64402	D	0.000003	T	0.48624	0.1510	M	0.79475	2.455	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.85130	0.997;0.987;0.918	T	0.52593	-0.8555	10	0.87932	D	0	-10.8786	14.8705	0.70453	0.0:0.0:0.0:1.0	.	621;705;704	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	T	704;621;705;482	ENSP00000386574:I704T;ENSP00000409663:I621T;ENSP00000386787:I705T;ENSP00000240487:I482T	ENSP00000240487:I482T	I	+	2	0	KIAA0922	154736978	1.000000	0.71417	0.903000	0.35520	0.997000	0.91878	6.265000	0.72534	2.163000	0.67991	0.533000	0.62120	ATA	.	.	.	none		0.423	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	
CMBL	134147	hgsc.bcm.edu	37	5	10282333	10282333	+	Missense_Mutation	SNP	A	A	T	rs115129340	byFrequency	TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr5:10282333A>T	ENST00000296658.3	-	5	954	c.534T>A	c.(532-534)aaT>aaA	p.N178K	CMBL_ENST00000510532.1_Intron	NM_138809.3	NP_620164.1	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase homolog (Pseudomonas)	178						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(9)|skin(1)|stomach(1)	13						TCACAACATCATTTTCAGCAA	0.403																																					p.N178K		Atlas-SNP	.											.	CMBL	24	.	0			c.T534A						PASS	.						102.0	104.0	103.0					5																	10282333		2203	4300	6503	SO:0001583	missense	134147	exon5			AACATCATTTTCA		CCDS3878.1	5p15.2	2010-06-25	2006-09-12		ENSG00000164237	ENSG00000164237	3.1.-.-		25090	protein-coding gene	gene with protein product		613379	"""carboxymethylenebutenolidase-like (Pseudomonas)"""			3804974, 20177059	Standard	NM_138809		Approved	FLJ23617	uc003jes.3	Q96DG6	OTTHUMG00000131043	ENST00000296658.3:c.534T>A	chr5.hg19:g.10282333A>T	ENSP00000296658:p.Asn178Lys	253.0	0.0	.		201.0	71.0	.	NM_138809	D3DTC7|Q8TED6	Missense_Mutation	SNP	ENST00000296658.3	hg19	CCDS3878.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.317951	0.40996	.	.	ENSG00000164237	ENST00000296658	T	0.39592	1.07	5.23	-5.94	0.02247	Dienelactone hydrolase (1);	0.494575	0.21750	N	0.069694	T	0.16642	0.0400	N	0.16201	0.385	0.31061	N	0.714115	B	0.06786	0.001	B	0.12156	0.007	T	0.11867	-1.0570	10	0.20519	T	0.43	-25.4727	5.87	0.18799	0.2378:0.0:0.4348:0.3274	.	178	Q96DG6	CMBL_HUMAN	K	178	ENSP00000296658:N178K	ENSP00000296658:N178K	N	-	3	2	CMBL	10335333	0.000000	0.05858	0.528000	0.27938	0.911000	0.54048	-2.751000	0.00792	-1.004000	0.03421	0.533000	0.62120	AAT	.	A|0.990;G|0.010	.	alt		0.403	CMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253689.1	NM_138809	
DDX46	9879	hgsc.bcm.edu	37	5	134118720	134118720	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr5:134118720T>A	ENST00000354283.4	+	9	1266	c.1131T>A	c.(1129-1131)tgT>tgA	p.C377*	DDX46_ENST00000452510.2_Nonsense_Mutation_p.C377*|DDX46_ENST00000509178.1_3'UTR			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	377					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGGTCCAGTGTGGAATTTCCA	0.408																																					p.C377X	Colon(13;391 453 4901 21675 24897)	Atlas-SNP	.											.	DDX46	77	.	0			c.T1131A						PASS	.						181.0	166.0	171.0					5																	134118720		2203	4300	6503	SO:0001587	stop_gained	9879	exon9			CCAGTGTGGAATT		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.1131T>A	chr5.hg19:g.134118720T>A	ENSP00000346236:p.Cys377*	145.0	0.0	.		150.0	65.0	.	NM_014829	O94894|Q96EI0|Q9Y658	Nonsense_Mutation	SNP	ENST00000354283.4	hg19	CCDS34240.1	.	.	.	.	.	.	.	.	.	.	T	37	6.395914	0.97533	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	.	.	.	5.16	4.01	0.46588	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.8672	10.2948	0.43618	0.0:0.0776:0.0:0.9224	.	.	.	.	X	377	.	ENSP00000346236:C377X	C	+	3	2	DDX46	134146619	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.230000	0.58632	1.946000	0.56461	0.528000	0.53228	TGT	.	.	.	none		0.408	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
PCDHGA1	56114	hgsc.bcm.edu	37	5	140712543	140712543	+	Silent	SNP	G	G	A	rs560568026		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr5:140712543G>A	ENST00000517417.1	+	1	2292	c.2292G>A	c.(2290-2292)cgG>cgA	p.R764R	PCDHGA1_ENST00000378105.3_Silent_p.R764R	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	764					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGACTCGCGGAAGAGCCACC	0.577																																					p.R764R		Atlas-SNP	.											.	PCDHGA1	397	.	0			c.G2292A						PASS	.						105.0	115.0	112.0					5																	140712543		2203	4298	6501	SO:0001819	synonymous_variant	56114	exon1			CTCGCGGAAGAGC	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2292G>A	chr5.hg19:g.140712543G>A		283.0	0.0	.		207.0	59.0	.	NM_018912	Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	hg19	CCDS54922.1																																																																																			.	.	.	none		0.577	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
PCDHGB4	8641	hgsc.bcm.edu	37	5	140769788	140769788	+	Silent	SNP	C	C	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr5:140769788C>T	ENST00000519479.1	+	1	2337	c.2337C>T	c.(2335-2337)tgC>tgT	p.C779C	PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	779					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACATACTTTGCGGTGATTCAT	0.388																																					p.C779C		Atlas-SNP	.											.	PCDHGB4	125	.	0			c.C2337T						PASS	.						222.0	223.0	223.0					5																	140769788		1904	4126	6030	SO:0001819	synonymous_variant	8641	exon1			ACTTTGCGGTGAT	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.2337C>T	chr5.hg19:g.140769788C>T		177.0	0.0	.		112.0	27.0	.	NM_032098	O15099|Q2M267|Q9UN64	Silent	SNP	ENST00000519479.1	hg19	CCDS54928.1																																																																																			.	.	.	none		0.388	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736	
FAT2	2196	hgsc.bcm.edu	37	5	150920245	150920245	+	Silent	SNP	G	G	A	rs111242057		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr5:150920245G>A	ENST00000261800.5	-	10	8934	c.8922C>T	c.(8920-8922)cgC>cgT	p.R2974R		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2974	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGTATGCTCGCGGTCCAGGG	0.532																																					p.R2974R		Atlas-SNP	.											.	FAT2	465	.	0			c.C8922T						PASS	.						107.0	89.0	95.0					5																	150920245		2203	4300	6503	SO:0001819	synonymous_variant	2196	exon10			ATGCTCGCGGTCC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8922C>T	chr5.hg19:g.150920245G>A		82.0	0.0	.		74.0	32.0	.	NM_001447	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	hg19	CCDS4317.1																																																																																			.	G|0.500;A|0.500	0.500	weak		0.532	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
DAAM2	23500	hgsc.bcm.edu	37	6	39869623	39869623	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr6:39869623G>T	ENST00000398904.2	+	25	3199	c.3017G>T	c.(3016-3018)cGg>cTg	p.R1006L	RP11-61I13.3_ENST00000437947.1_RNA|DAAM2_ENST00000538976.1_Missense_Mutation_p.R1005L|DAAM2_ENST00000274867.4_Missense_Mutation_p.R1006L			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	1006					actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					CGGTGGCAGCGGCAGCGGAAG	0.682																																					p.R1006L		Atlas-SNP	.											.	DAAM2	101	.	0			c.G3017T						PASS	.						21.0	28.0	26.0					6																	39869623		2083	4209	6292	SO:0001583	missense	23500	exon25			GGCAGCGGCAGCG	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.3017G>T	chr6.hg19:g.39869623G>T	ENSP00000381876:p.Arg1006Leu	19.0	0.0	.		37.0	20.0	.	NM_001201427	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	hg19	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598634	0.87055	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.80123	-1.34;-1.34;-1.34	5.51	5.51	0.81932	Actin-binding FH2/DRF autoregulatory (1);	0.162307	0.43260	D	0.000587	T	0.75057	0.3798	L	0.50333	1.59	0.80722	D	1	P;P	0.51933	0.949;0.915	P;B	0.44447	0.45;0.263	T	0.79624	-0.1726	10	0.72032	D	0.01	.	18.9986	0.92824	0.0:0.0:1.0:0.0	.	1005;1006	G5EA45;Q86T65	.;DAAM2_HUMAN	L	1006;1006;1005	ENSP00000274867:R1006L;ENSP00000381876:R1006L;ENSP00000437808:R1005L	ENSP00000274867:R1006L	R	+	2	0	DAAM2	39977601	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.632000	0.67819	2.586000	0.87340	0.561000	0.74099	CGG	.	.	.	none		0.682	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
SMPDL3A	10924	hgsc.bcm.edu	37	6	123116945	123116945	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr6:123116945T>C	ENST00000368440.4	+	2	413	c.236T>C	c.(235-237)gTt>gCt	p.V79A	SMPDL3A_ENST00000487215.1_3'UTR|SMPDL3A_ENST00000539041.1_Intron	NM_006714.3	NP_006705.1	Q92484	ASM3A_HUMAN	sphingomyelin phosphodiesterase, acid-like 3A	79					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|cervix(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	10				GBM - Glioblastoma multiforme(226;0.236)		TTTGGAGATGTTCTGTGTGAT	0.388																																					p.V79A		Atlas-SNP	.											.	SMPDL3A	31	.	0			c.T236C						PASS	.						165.0	150.0	155.0					6																	123116945		2203	4300	6503	SO:0001583	missense	10924	exon2			GAGATGTTCTGTG	AK000184	CCDS5128.1, CCDS69190.1	6q22.32	2006-04-12			ENSG00000172594	ENSG00000172594			17389	protein-coding gene	gene with protein product	"""acid sphingomyelinase-like phosphodiesterase 3a"""	610728				12442002	Standard	XM_005266798		Approved	FLJ20177, ASM3A, ASML3a, yR36GH4.1	uc003pzg.3	Q92484	OTTHUMG00000015490	ENST00000368440.4:c.236T>C	chr6.hg19:g.123116945T>C	ENSP00000357425:p.Val79Ala	88.0	0.0	.		65.0	31.0	.	NM_006714	B7Z729|Q8WV13	Missense_Mutation	SNP	ENST00000368440.4	hg19	CCDS5128.1	.	.	.	.	.	.	.	.	.	.	T	18.15	3.560482	0.65538	.	.	ENSG00000172594	ENST00000368440	D	0.94966	-3.57	5.27	5.27	0.74061	Metallophosphoesterase domain (1);	0.160331	0.56097	D	0.000031	D	0.86585	0.5968	L	0.29908	0.895	0.80722	D	1	B	0.31655	0.334	B	0.28385	0.089	D	0.87329	0.2323	10	0.51188	T	0.08	-12.4189	15.4763	0.75481	0.0:0.0:0.0:1.0	.	79	Q92484	ASM3A_HUMAN	A	79	ENSP00000357425:V79A	ENSP00000357425:V79A	V	+	2	0	SMPDL3A	123158644	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	7.651000	0.83577	2.112000	0.64535	0.528000	0.53228	GTT	.	.	.	none		0.388	SMPDL3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042039.1	NM_006714	
FAM20C	56975	hgsc.bcm.edu	37	7	288293	288293	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr7:288293C>A	ENST00000313766.5	+	5	1200	c.969C>A	c.(967-969)ttC>ttA	p.F323L		NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	323					dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		TCCTGGACTTCCGCCGGGTCC	0.622																																					p.F323L		Atlas-SNP	.											.	FAM20C	18	.	0			c.C969A						PASS	.						52.0	62.0	59.0					7																	288293		692	1591	2283	SO:0001583	missense	56975	exon5			GGACTTCCGCCGG	BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.969C>A	chr7.hg19:g.288293C>A	ENSP00000322323:p.Phe323Leu	921.0	0.0	.		1126.0	524.0	.	NM_020223	A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Missense_Mutation	SNP	ENST00000313766.5	hg19	CCDS47522.1	.	.	.	.	.	.	.	.	.	.	.	11.93	1.786487	0.31593	.	.	ENSG00000177706	ENST00000313766	D	0.89343	-2.5	5.22	1.35	0.21983	.	.	.	.	.	D	0.85071	0.5613	L	0.60904	1.88	0.80722	D	1	B	0.29481	0.245	B	0.30105	0.111	T	0.80402	-0.1397	9	0.42905	T	0.14	.	10.0575	0.42255	0.0:0.7237:0.0:0.2763	.	323	Q8IXL6	DMP4_HUMAN	L	323	ENSP00000322323:F323L	ENSP00000322323:F323L	F	+	3	2	FAM20C	.	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.131000	0.31406	0.592000	0.29728	0.549000	0.68633	TTC	.	.	.	none		0.622	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322476.2	NM_020223	
SEMA3E	9723	hgsc.bcm.edu	37	7	82997040	82997040	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr7:82997040C>G	ENST00000307792.3	-	17	2657	c.2190G>C	c.(2188-2190)gaG>gaC	p.E730D	SEMA3E_ENST00000427262.1_Missense_Mutation_p.E670D	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	730					axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				ACCATACTTTCTCGCAGTATT	0.463																																					p.E730D		Atlas-SNP	.											.	SEMA3E	125	.	0			c.G2190C						PASS	.						171.0	168.0	169.0					7																	82997040		2203	4300	6503	SO:0001583	missense	9723	exon17			TACTTTCTCGCAG	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.2190G>C	chr7.hg19:g.82997040C>G	ENSP00000303212:p.Glu730Asp	118.0	0.0	.		226.0	111.0	.	NM_012431	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	hg19	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180104	0.57800	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.80123	-1.34;-1.34	5.74	0.768	0.18487	.	0.000000	0.85682	D	0.000000	D	0.82683	0.5090	M	0.80746	2.51	0.51012	D	0.999905	B	0.33612	0.419	B	0.43018	0.405	T	0.79431	-0.1806	10	0.59425	D	0.04	.	10.2558	0.43397	0.0:0.3408:0.0:0.6592	.	730	O15041	SEM3E_HUMAN	D	730;670;730	ENSP00000303212:E730D;ENSP00000405052:E670D	ENSP00000303212:E730D	E	-	3	2	SEMA3E	82834976	0.988000	0.35896	0.971000	0.41717	0.958000	0.62258	0.183000	0.16919	-0.090000	0.12462	-0.482000	0.04802	GAG	.	.	.	none		0.463	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
CCDC71L	168455	hgsc.bcm.edu	37	7	106301196	106301196	+	Silent	SNP	C	C	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr7:106301196C>G	ENST00000523505.1	-	1	246	c.147G>C	c.(145-147)ctG>ctC	p.L49L		NM_175884.4	NP_787080.2	Q8N9Z2	CC71L_HUMAN	coiled-coil domain containing 71-like	49										endometrium(1)	1						TGCTGTCAGCCAGCGACAGTT	0.677																																					p.L49L		Atlas-SNP	.											.	CCDC71L	2	.	0			c.G147C						PASS	.						13.0	16.0	15.0					7																	106301196		2068	4201	6269	SO:0001819	synonymous_variant	168455	exon1			GTCAGCCAGCGAC		CCDS55151.1	7q22.3	2011-12-12	2011-12-12	2011-12-12	ENSG00000253276	ENSG00000253276			26685	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 74"""	C7orf74		12477932	Standard	NM_175884		Approved	FLJ36031	uc003vdt.3	Q8N9Z2	OTTHUMG00000164150	ENST00000523505.1:c.147G>C	chr7.hg19:g.106301196C>G		103.0	0.0	.		127.0	73.0	.	NM_175884	Q7Z756	Silent	SNP	ENST00000523505.1	hg19	CCDS55151.1																																																																																			.	.	.	none		0.677	CCDC71L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377493.1	NM_175884	
OMD	4958	hgsc.bcm.edu	37	9	95179162	95179162	+	Missense_Mutation	SNP	T	T	C	rs376323161		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr9:95179162T>C	ENST00000375550.4	-	2	954	c.679A>G	c.(679-681)Atg>Gtg	p.M227V	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	227					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						CCAGGAGGCATTGATTCTAAT	0.333			T	USP6	aneurysmal bone cysts																																p.M227V		Atlas-SNP	.		Dom	yes		9	9q22.31	4958	osteomodulin		M	.	OMD	42	.	0			c.A679G						PASS	.	T	,VAL/MET	0,4406		0,0,2203	106.0	107.0	107.0		,679	5.5	1.0	9		107	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	OMD,CENPP	NM_001012267.1,NM_005014.2	,21	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,possibly-damaging	,227/422	95179162	1,13005	2203	4300	6503	SO:0001583	missense	4958	exon2			GAGGCATTGATTC	AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.679A>G	chr9.hg19:g.95179162T>C	ENSP00000364700:p.Met227Val	66.0	0.0	.		88.0	37.0	.	NM_005014	Q5TBF4	Missense_Mutation	SNP	ENST00000375550.4	hg19	CCDS6696.1	.	.	.	.	.	.	.	.	.	.	t	13.99	2.403284	0.42613	0.0	1.16E-4	ENSG00000127083	ENST00000375550	T	0.03951	3.75	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.03136	0.0092	N	0.00436	-1.5	0.42460	D	0.992789	D	0.60575	0.988	P	0.52109	0.69	T	0.67833	-0.5568	10	0.52906	T	0.07	-16.0215	15.9136	0.79491	0.0:0.0:0.0:1.0	.	227	Q99983	OMD_HUMAN	V	227	ENSP00000364700:M227V	ENSP00000364700:M227V	M	-	1	0	OMD	94218983	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	3.112000	0.50368	2.216000	0.71823	0.528000	0.53228	ATG	.	.	.	weak		0.333	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053090.1	NM_005014	
GRIN3A	116443	hgsc.bcm.edu	37	9	104433388	104433388	+	Splice_Site	SNP	A	A	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr9:104433388A>T	ENST00000361820.3	-	3	1906	c.1306T>A	c.(1306-1308)Ttt>Att	p.F436I		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	436					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TTGGCTAGAAACCTGGGAAAG	0.408																																					p.F436I		Atlas-SNP	.											.	GRIN3A	186	.	0			c.T1306A						PASS	.						71.0	74.0	73.0					9																	104433388		2203	4300	6503	SO:0001630	splice_region_variant	116443	exon3			CTAGAAACCTGGG		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1305-1T>A	chr9.hg19:g.104433388A>T		62.0	0.0	.		93.0	43.0	.	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	hg19	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198025	0.79015	.	.	ENSG00000198785	ENST00000361820	D	0.86497	-2.13	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.92639	0.7661	M	0.79258	2.445	0.58432	D	0.999994	D	0.59767	0.986	P	0.61533	0.89	D	0.93383	0.6745	10	0.72032	D	0.01	.	16.3634	0.83296	1.0:0.0:0.0:0.0	.	436	Q8TCU5	NMD3A_HUMAN	I	436	ENSP00000355155:F436I	ENSP00000355155:F436I	F	-	1	0	GRIN3A	103473209	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.248000	0.95456	2.324000	0.78689	0.533000	0.62120	TTT	.	.	.	none		0.408	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		Missense_Mutation
FBXW2	26190	hgsc.bcm.edu	37	9	123533652	123533652	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr9:123533652C>G	ENST00000608872.1	-	7	1237	c.1050G>C	c.(1048-1050)tgG>tgC	p.W350C	FBXW2_ENST00000493559.1_5'UTR|FBXW2_ENST00000340778.5_Missense_Mutation_p.W285C	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	350					cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						TGGCAAAGTCCCACTGGTAGA	0.428																																					p.W350C		Atlas-SNP	.											.	FBXW2	34	.	0			c.G1050C						PASS	.						101.0	90.0	93.0					9																	123533652		1905	4133	6038	SO:0001583	missense	26190	exon7			AAAGTCCCACTGG	AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.1050G>C	chr9.hg19:g.123533652C>G	ENSP00000476369:p.Trp350Cys	68.0	0.0	.		82.0	29.0	.	NM_012164	B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	ENST00000608872.1	hg19	CCDS43872.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.824693	0.90955	.	.	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833	T;T	0.30981	1.51;1.51	5.77	5.77	0.91146	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	M	0.74467	2.265	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.999	P;D;D	0.77557	0.823;0.99;0.99	T	0.58792	-0.7574	10	0.87932	D	0	-4.808	17.8518	0.88748	0.0:1.0:0.0:0.0	.	285;350;350	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	C	350;285;350	ENSP00000363036:W350C;ENSP00000341161:W285C	ENSP00000341161:W285C	W	-	3	0	FBXW2	122573473	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	TGG	.	.	.	none		0.428	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053834.2		
ZNF79	7633	hgsc.bcm.edu	37	9	130197411	130197411	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr9:130197411G>A	ENST00000342483.5	+	3	554	c.148G>A	c.(148-150)Gaa>Aaa	p.E50K	ZNF79_ENST00000543471.1_Missense_Mutation_p.E26K	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	50	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						TTTTGCACAGGAAAGGTGGAG	0.507																																					p.E50K		Atlas-SNP	.											.	ZNF79	47	.	0			c.G148A						PASS	.						140.0	135.0	137.0					9																	130197411		2203	4300	6503	SO:0001583	missense	7633	exon3			GCACAGGAAAGGT	X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.148G>A	chr9.hg19:g.130197411G>A	ENSP00000362446:p.Glu50Lys	129.0	0.0	.		141.0	59.0	.	NM_007135	Q5VVW1|Q96NV1	Missense_Mutation	SNP	ENST00000342483.5	hg19	CCDS6871.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.671323	0.29693	.	.	ENSG00000196152	ENST00000342483;ENST00000543471	T;T	0.01295	5.04;5.04	3.19	0.134	0.14771	Krueppel-associated box (3);	.	.	.	.	T	0.01800	0.0057	L	0.56396	1.775	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43327	-0.9398	9	0.62326	D	0.03	.	3.6122	0.08065	0.2508:0.2087:0.5405:0.0	.	50	Q15937	ZNF79_HUMAN	K	50;26	ENSP00000362446:E50K;ENSP00000438418:E26K	ENSP00000362446:E50K	E	+	1	0	ZNF79	129237232	0.009000	0.17119	0.000000	0.03702	0.032000	0.12392	0.751000	0.26348	-0.088000	0.12506	0.462000	0.41574	GAA	.	.	.	none		0.507	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054188.1	NM_007135	
KIAA1462	57608	hgsc.bcm.edu	37	10	30315194	30315194	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr10:30315194G>A	ENST00000375377.1	-	3	3984	c.3883C>T	c.(3883-3885)Cag>Tag	p.Q1295*		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1295					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						AGCCCGGCCTGGCCCCTTGTG	0.612																																					p.Q1295X		Atlas-SNP	.											.	KIAA1462	162	.	0			c.C3883T						PASS	.						50.0	50.0	50.0					10																	30315194		1881	4108	5989	SO:0001587	stop_gained	57608	exon3			CGGCCTGGCCCCT	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3883C>T	chr10.hg19:g.30315194G>A	ENSP00000364526:p.Gln1295*	38.0	0.0	.		37.0	17.0	.	NM_020848	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Nonsense_Mutation	SNP	ENST00000375377.1	hg19	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	G	40	8.310626	0.98754	.	.	ENSG00000165757	ENST00000375377	.	.	.	4.92	4.01	0.46588	.	1.055720	0.07447	N	0.898331	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	0.0089	10.5989	0.45354	0.0947:0.0:0.9053:0.0	.	.	.	.	X	1295	.	ENSP00000364526:Q1295X	Q	-	1	0	KIAA1462	30355200	0.000000	0.05858	0.002000	0.10522	0.066000	0.16364	0.115000	0.15540	1.069000	0.40788	0.655000	0.94253	CAG	.	.	.	none		0.612	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
C10orf10	11067	hgsc.bcm.edu	37	10	45473410	45473410	+	Silent	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr10:45473410C>A	ENST00000298295.3	-	2	286	c.69G>T	c.(67-69)ctG>ctT	p.L23L	RASSF4_ENST00000334940.6_Intron|RASSF4_ENST00000374417.2_Intron|RASSF4_ENST00000340258.5_Intron|C10orf10_ENST00000496638.1_Intron|RASSF4_ENST00000472561.1_Intron	NM_007021.3	NP_008952.1	Q9NTK1	DEPP_HUMAN	chromosome 10 open reading frame 10	23						mitochondrion (GO:0005739)				lung(1)	1						GACCCCCAAGCAGCATCTCCT	0.617																																					p.L23L		Atlas-SNP	.											.	C10orf10	6	.	0			c.G69T						PASS	.						47.0	51.0	50.0					10																	45473410		2202	4296	6498	SO:0001819	synonymous_variant	11067	exon2			CCCAAGCAGCATC	AB022718	CCDS7210.1	10q11.21	2014-07-31			ENSG00000165507	ENSG00000165507			23355	protein-coding gene	gene with protein product	"""decidual protein induced by progesterone"", ""fasting induced"", ""fat-specific expressed gene"""	611309				24530860, 19937567, 16123073	Standard	NM_007021		Approved	DEPP, FIG, Fseg	uc001jbr.4	Q9NTK1	OTTHUMG00000018063	ENST00000298295.3:c.69G>T	chr10.hg19:g.45473410C>A		98.0	0.0	.		88.0	42.0	.	NM_007021	B2R6A1|O94997|Q5T735|Q76MX8	Silent	SNP	ENST00000298295.3	hg19	CCDS7210.1																																																																																			.	.	.	none		0.617	C10orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047758.1	NM_007021	
TIMM23	100287932	hgsc.bcm.edu	37	10	51623127	51623127	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr10:51623127C>T	ENST00000260867.4	-	1	211	c.88G>A	c.(88-90)Gat>Aat	p.D30N	TIMM23_ENST00000374065.3_Missense_Mutation_p.D30N|TIMM23_ENST00000374064.3_Missense_Mutation_p.D30N	NM_006327.3	NP_006318.1	O14925	TIM23_HUMAN	translocase of inner mitochondrial membrane 23 homolog (yeast)	30					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			endometrium(1)|large_intestine(1)|pancreas(1)	3						CCAGCCAAATCCGCGTGCGAG	0.562																																					p.D30N		Atlas-SNP	.											.	TIMM23	4	.	0			c.G88A						PASS	.						14.0	14.0	14.0					10																	51623127		2190	4252	6442	SO:0001583	missense	100287932	exon1			CCAAATCCGCGTG	AF030162	CCDS73091.1	10q11.21-q11.23	2010-03-17			ENSG00000138297				17312	protein-coding gene	gene with protein product		605034				10339406	Standard	NM_006327		Approved	TIM23	uc010qha.2	O14925	OTTHUMG00000018213	ENST00000260867.4:c.88G>A	chr10.hg19:g.51623127C>T	ENSP00000260867:p.Asp30Asn	617.0	1.0	.		656.0	126.0	.	NM_006327	Q53FF8|Q5T1E6|Q6P5S5	Missense_Mutation	SNP	ENST00000260867.4	hg19	CCDS7238.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.10|16.10	3.026269|3.026269	0.54683|0.54683	.|.	.|.	ENSG00000138297|ENSG00000138297	ENST00000260867;ENST00000374064;ENST00000374065|ENST00000444743	.|.	.|.	.|.	4.5|4.5	3.59|3.59	0.41128|0.41128	.|.	0.052211|.	0.85682|.	D|.	0.000000|.	T|T	0.49270|0.49270	0.1547|0.1547	L|L	0.27053|0.27053	0.805|0.805	0.45704|0.45704	D|D	0.998618|0.998618	P;P|.	0.42078|.	0.77;0.608|.	B;B|.	0.42827|.	0.399;0.202|.	T|T	0.39057|0.39057	-0.9632|-0.9632	9|5	0.33940|.	T|.	0.23|.	-6.7486|-6.7486	11.0311|11.0311	0.47774|0.47774	0.0:0.9103:0.0:0.0897|0.0:0.9103:0.0:0.0897	.|.	30;30|.	B1APJ0;O14925|.	.;TIM23_HUMAN|.	N|E	30|26	.|.	ENSP00000260867:D30N|.	D|G	-|-	1|2	0|0	TIMM23|TIMM23	51293133|51293133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.781000|0.781000	0.44180|0.44180	6.170000|6.170000	0.71920|0.71920	1.237000|1.237000	0.43756|0.43756	-0.216000|-0.216000	0.12614|0.12614	GAT|GGA	.	.	.	none		0.562	TIMM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048040.1	NM_006327.2	
RAG1	5896	hgsc.bcm.edu	37	11	36596889	36596889	+	Missense_Mutation	SNP	A	A	C	rs143227621		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr11:36596889A>C	ENST00000299440.5	+	2	2147	c.2035A>C	c.(2035-2037)Att>Ctt	p.I679L		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	679					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				GAGTCCTCTCATTGCTGAGAG	0.512									Familial Hemophagocytic Lymphohistiocytosis																												p.I679L	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	Atlas-SNP	.											.	RAG1	151	.	0			c.A2035C						PASS	.						56.0	51.0	52.0					11																	36596889		2202	4298	6500	SO:0001583	missense	5896	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	CCTCTCATTGCTG	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2035A>C	chr11.hg19:g.36596889A>C	ENSP00000299440:p.Ile679Leu	51.0	0.0	.		72.0	32.0	.	NM_000448	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	hg19	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	A	16.37	3.103025	0.56183	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.85702	-2.02;-2.02	5.98	3.67	0.42095	.	0.171732	0.49916	D	0.000132	D	0.83069	0.5174	M	0.69248	2.105	0.44816	D	0.997826	B	0.21520	0.057	B	0.27076	0.076	T	0.78453	-0.2198	10	0.87932	D	0	.	9.4229	0.38561	0.8006:0.0:0.1994:0.0	.	679	P15918	RAG1_HUMAN	L	679	ENSP00000434610:I679L;ENSP00000299440:I679L	ENSP00000299440:I679L	I	+	1	0	RAG1	36553465	1.000000	0.71417	0.939000	0.37840	0.991000	0.79684	3.264000	0.51553	0.519000	0.28406	0.524000	0.50904	ATT	.	A|1.000;G|0.000	.	alt		0.512	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
SSRP1	6749	hgsc.bcm.edu	37	11	57102553	57102553	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr11:57102553T>A	ENST00000278412.2	-	2	309	c.43A>T	c.(43-45)Aaa>Taa	p.K15*		NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	15					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						ATGGAACCTTTCACCTCCTGA	0.522																																					p.K15X	Colon(89;1000 1340 6884 23013 41819)	Atlas-SNP	.											.	SSRP1	75	.	0			c.A43T						PASS	.						392.0	378.0	383.0					11																	57102553		2201	4296	6497	SO:0001587	stop_gained	6749	exon2			AACCTTTCACCTC	M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.43A>T	chr11.hg19:g.57102553T>A	ENSP00000278412:p.Lys15*	87.0	0.0	.		64.0	28.0	.	NM_003146	Q5BJG8	Nonsense_Mutation	SNP	ENST00000278412.2	hg19	CCDS7952.1	.	.	.	.	.	.	.	.	.	.	T	40	8.368646	0.98781	.	.	ENSG00000149136	ENST00000278412	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-22.8175	16.0566	0.80812	0.0:0.0:0.0:1.0	.	.	.	.	X	15	.	ENSP00000278412:K15X	K	-	1	0	SSRP1	56859129	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.528000	0.81941	2.272000	0.75746	0.460000	0.39030	AAA	.	.	.	none		0.522	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392460.1	NM_003146	
DAK	26007	hgsc.bcm.edu	37	11	61111630	61111630	+	Silent	SNP	G	G	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr11:61111630G>A	ENST00000394900.3	+	13	1354	c.1125G>A	c.(1123-1125)gcG>gcA	p.A375A		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	375	DhaL. {ECO:0000255|PROSITE- ProRule:PRU00813}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						AGCGGATGGCGCTGGTGCTGG	0.627																																					p.A375A		Atlas-SNP	.											.	DAK	52	.	0			c.G1125A						PASS	.						58.0	52.0	54.0					11																	61111630		2203	4299	6502	SO:0001819	synonymous_variant	26007	exon13			GATGGCGCTGGTG		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.1125G>A	chr11.hg19:g.61111630G>A		73.0	0.0	.		82.0	37.0	.	NM_015533	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Silent	SNP	ENST00000394900.3	hg19	CCDS8003.1																																																																																			.	.	.	none		0.627	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4	NM_015533	
FAM86C1	55199	hgsc.bcm.edu	37	11	71504494	71504494	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr11:71504494G>T	ENST00000359244.4	+	3	251	c.228G>T	c.(226-228)aaG>aaT	p.K76N	FAM86C1_ENST00000346333.6_Intron|FAM86C1_ENST00000426628.2_Intron	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	76										lung(1)	1						TGATGGCCAAGGAGTCCACCC	0.582																																					p.K76N		Atlas-SNP	.											.	FAM86C1	27	.	0			c.G228T						PASS	.						31.0	29.0	30.0					11																	71504494		2146	4258	6404	SO:0001583	missense	55199	exon3			GGCCAAGGAGTCC	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.228G>T	chr11.hg19:g.71504494G>T	ENSP00000352182:p.Lys76Asn	164.0	0.0	.		136.0	67.0	.	NM_018172	Q8N5D3	Missense_Mutation	SNP	ENST00000359244.4	hg19	CCDS41686.1	.	.	.	.	.	.	.	.	.	.	.	3.988	-0.005114	0.07773	.	.	ENSG00000158483	ENST00000359244	T	0.03689	3.84	2.05	1.07	0.20283	.	.	.	.	.	T	0.03477	0.0100	L	0.43152	1.355	0.80722	D	1	B	0.24920	0.114	B	0.17098	0.017	T	0.42548	-0.9445	9	0.72032	D	0.01	.	4.3775	0.11277	0.2179:0.0:0.7821:0.0	.	76	Q9NVL1	FA86C_HUMAN	N	76	ENSP00000352182:K76N	ENSP00000352182:K76N	K	+	3	2	FAM86C1	71182142	0.990000	0.36364	0.357000	0.25798	0.051000	0.14879	0.917000	0.28665	0.181000	0.19994	0.184000	0.17185	AAG	.	.	.	none		0.582	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
PATE1	160065	hgsc.bcm.edu	37	11	125618623	125618623	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr11:125618623C>T	ENST00000305738.5	+	5	388	c.376C>T	c.(376-378)Ctt>Ttt	p.L126F	PATE1_ENST00000437148.2_Missense_Mutation_p.L114F	NM_138294.2	NP_612151.1	Q8WXA2	PATE1_HUMAN	prostate and testis expressed 1	126						extracellular region (GO:0005576)				large_intestine(1)|lung(5)	6						CAATGAAGACCTTTAGAAGTT	0.448																																					p.L126F		Atlas-SNP	.											.	PATE1	21	.	0			c.C376T						PASS	.						159.0	140.0	146.0					11																	125618623		2201	4299	6500	SO:0001583	missense	160065	exon5			GAAGACCTTTAGA	AF462605	CCDS8464.1	11q24.2	2008-12-17				ENSG00000171053		"""PATE family"""	24664	protein-coding gene	gene with protein product	"""expressed in prostate and testis"""	606861				11880645, 15798027	Standard	NM_138294		Approved	PATE	uc001qct.3	Q8WXA2		ENST00000305738.5:c.376C>T	chr11.hg19:g.125618623C>T	ENSP00000307164:p.Leu126Phe	78.0	0.0	.		71.0	24.0	.	NM_138294	Q3KNX2	Missense_Mutation	SNP	ENST00000305738.5	hg19	CCDS8464.1	.	.	.	.	.	.	.	.	.	.	C	5.470	0.271808	0.10349	.	.	ENSG00000171053	ENST00000305738;ENST00000437148	T;T	0.28255	1.62;1.68	4.07	-4.44	0.03557	.	0.700859	0.11743	N	0.533837	T	0.13415	0.0325	N	0.14661	0.345	0.09310	N	1	B;B	0.15930	0.015;0.015	B;B	0.19946	0.016;0.027	T	0.18493	-1.0335	10	0.35671	T	0.21	-0.2771	4.3005	0.10922	0.5287:0.2:0.0:0.2713	.	114;126	Q8WXA2-2;Q8WXA2	.;PATE1_HUMAN	F	126;114	ENSP00000307164:L126F;ENSP00000396056:L114F	ENSP00000307164:L126F	L	+	1	0	PATE1	125123833	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.846000	0.04336	-0.985000	0.03503	-0.143000	0.13931	CTT	.	.	.	none		0.448	PATE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386726.2	NM_138294	
TAS2R19	259294	hgsc.bcm.edu	37	12	11174899	11174899	+	Missense_Mutation	SNP	G	G	A	rs550008134		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr12:11174899G>A	ENST00000390673.2	-	1	320	c.272C>T	c.(271-273)aCg>aTg	p.T91M	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176888.1	NP_795369.1	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	91					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						GAAATGGTTCGTTACAGCCCA	0.393													.|||	1	0.000199681	0.0008	0.0	5008	,	,		22828	0.0		0.0	False		,,,				2504	0.0				p.T91M		Atlas-SNP	.											.	TAS2R19	30	.	0			c.C272T						PASS	.						84.0	85.0	85.0					12																	11174899		2203	4299	6502	SO:0001583	missense	259294	exon1			TGGTTCGTTACAG	AX097730, AF494234	CCDS8640.1	12p13.2	2012-08-22			ENSG00000212124	ENSG00000212124		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19108	protein-coding gene	gene with protein product		613961	"""taste receptor, type 2, member 48"", ""taste receptor, type 2, member 23"""	TAS2R48, TAS2R23			Standard	NM_176888		Approved	T2R19, T2R23	uc010shj.2	P59542	OTTHUMG00000162687	ENST00000390673.2:c.272C>T	chr12.hg19:g.11174899G>A	ENSP00000375091:p.Thr91Met	123.0	0.0	.		120.0	44.0	.	NM_176888	Q3MIJ4|Q645X8	Missense_Mutation	SNP	ENST00000390673.2	hg19	CCDS8640.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.420729	0.25639	.	.	ENSG00000212124	ENST00000390673	T	0.37752	1.18	2.55	-5.1	0.02911	.	2.297980	0.02805	N	0.123574	T	0.55353	0.1915	M	0.87456	2.885	0.09310	N	1	D	0.59767	0.986	D	0.63113	0.911	T	0.61332	-0.7084	10	0.62326	D	0.03	.	1.2085	0.01899	0.2053:0.1607:0.3984:0.2355	.	91	P59542	T2R19_HUMAN	M	91	ENSP00000375091:T91M	ENSP00000375091:T91M	T	-	2	0	TAS2R19	11066166	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.414000	0.00479	-2.602000	0.00450	-1.220000	0.01600	ACG	.	.	.	none		0.393	TAS2R19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370080.1	NM_176888	
GPR133	283383	hgsc.bcm.edu	37	12	131466438	131466438	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr12:131466438T>C	ENST00000261654.5	+	5	879	c.320T>C	c.(319-321)tTt>tCt	p.F107S	GPR133_ENST00000535015.1_Missense_Mutation_p.F139S	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	107					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GGGGTCACGTTTTCTTTTTTC	0.458																																					p.F107S		Atlas-SNP	.											.	GPR133	136	.	0			c.T320C						PASS	.						100.0	98.0	99.0					12																	131466438		2203	4300	6503	SO:0001583	missense	283383	exon5			TCACGTTTTCTTT	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.320T>C	chr12.hg19:g.131466438T>C	ENSP00000261654:p.Phe107Ser	113.0	0.0	.		105.0	44.0	.	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	hg19	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	T	14.63	2.593261	0.46214	.	.	ENSG00000111452	ENST00000261654;ENST00000535015	T;T	0.75154	-0.91;-0.91	4.28	4.28	0.50868	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.140598	0.47852	D	0.000204	D	0.84705	0.5531	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86671	0.1910	10	0.87932	D	0	.	12.924	0.58249	0.0:0.0:0.0:1.0	.	139;107	B7ZLF7;Q6QNK2	.;GP133_HUMAN	S	107;139	ENSP00000261654:F107S;ENSP00000444425:F139S	ENSP00000261654:F107S	F	+	2	0	GPR133	130032391	1.000000	0.71417	0.019000	0.16419	0.079000	0.17450	6.609000	0.74173	1.703000	0.51240	0.460000	0.39030	TTT	.	.	.	none		0.458	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
PROX2	283571	hgsc.bcm.edu	37	14	75321933	75321933	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr14:75321933C>A	ENST00000445876.1	-	5	1680	c.1681G>T	c.(1681-1683)Gac>Tac	p.D561Y	PROX2_ENST00000556084.2_Missense_Mutation_p.D334Y|RP11-316E14.6_ENST00000553381.1_RNA|PROX2_ENST00000556489.2_Missense_Mutation_p.D561Y			Q3B8N5	PROX2_HUMAN	prospero homeobox 2	561	Prospero-like.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(3)	6			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		GGATCTGAGTCTCTCCCTGCG	0.448																																					p.D561Y		Atlas-SNP	.											.	PROX2	44	.	0			c.G1681T						PASS	.						51.0	49.0	49.0					14																	75321933		1854	4093	5947	SO:0001583	missense	283571	exon4			CTGAGTCTCTCCC		CCDS45136.1, CCDS45136.2, CCDS73663.1	14q24.3	2012-10-02			ENSG00000119608	ENSG00000119608		"""Homeoboxes / PROS class"""	26715	protein-coding gene	gene with protein product		615094					Standard	NM_001080408		Approved	FLJ36749	uc031qpi.1	Q3B8N5	OTTHUMG00000171481	ENST00000445876.1:c.1681G>T	chr14.hg19:g.75321933C>A	ENSP00000405932:p.Asp561Tyr	79.0	0.0	.		62.0	32.0	.	NM_001243007	C9J5W1|Q8N9Q3	Missense_Mutation	SNP	ENST00000445876.1	hg19	CCDS45136.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.9|25.9	4.682820|4.682820	0.88542|0.88542	.|.	.|.	ENSG00000119608|ENSG00000119608	ENST00000556489;ENST00000389664;ENST00000424024;ENST00000445876|ENST00000556084	T;T|.	0.59906|.	0.23;0.23|.	5.22|5.22	5.22|5.22	0.72569|0.72569	.|.	0.157197|.	0.56097|.	D|.	0.000038|.	T|T	0.77870|0.77870	0.4195|0.4195	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.78417|0.78417	-0.2212|-0.2212	10|5	0.87932|.	D|.	0|.	.|.	18.7863|18.7863	0.91955|0.91955	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	561;334|.	G3V3G0;Q3B8N5-2|.	.;.|.	Y|D	561;561;334;561|333	ENSP00000451223:D561Y;ENSP00000405932:D561Y|.	ENSP00000374315:D561Y|.	D|E	-|-	1|3	0|2	PROX2|PROX2	74391686|74391686	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	7.818000|7.818000	0.86416|0.86416	2.446000|2.446000	0.82766|0.82766	0.462000|0.462000	0.41574|0.41574	GAC|GAG	.	.	.	none		0.448	PROX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ANGEL1	23357	hgsc.bcm.edu	37	14	77275538	77275538	+	Silent	SNP	T	T	C			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr14:77275538T>C	ENST00000251089.2	-	2	625	c.513A>G	c.(511-513)acA>acG	p.T171T	ANGEL1_ENST00000554941.1_5'Flank	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	171										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		CCCACTGCTCTGTGGCCAGGG	0.657																																					p.T171T		Atlas-SNP	.											.	ANGEL1	63	.	0			c.A513G						PASS	.						29.0	28.0	29.0					14																	77275538		2203	4300	6503	SO:0001819	synonymous_variant	23357	exon2			CTGCTCTGTGGCC	AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.513A>G	chr14.hg19:g.77275538T>C		64.0	0.0	.		72.0	27.0	.	NM_015305	B4DWL7|O94859|Q8NCS9	Silent	SNP	ENST00000251089.2	hg19	CCDS9852.1																																																																																			.	.	.	none		0.657	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413712.2	NM_015305	
MYO1E	4643	hgsc.bcm.edu	37	15	59466345	59466345	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr15:59466345T>C	ENST00000288235.4	-	20	2543	c.2144A>G	c.(2143-2145)tAc>tGc	p.Y715C	MIR2116_ENST00000517221.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	715	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		CATTTGAACGTATTTCTTCCG	0.343																																					p.Y715C		Atlas-SNP	.											.	MYO1E	99	.	0			c.A2144G						PASS	.						130.0	134.0	133.0					15																	59466345		2191	4291	6482	SO:0001583	missense	4643	exon20			TGAACGTATTTCT	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.2144A>G	chr15.hg19:g.59466345T>C	ENSP00000288235:p.Tyr715Cys	62.0	0.0	.		78.0	32.0	.	NM_004998	Q14778	Missense_Mutation	SNP	ENST00000288235.4	hg19	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	T	19.63	3.863662	0.71949	.	.	ENSG00000157483	ENST00000288235	D	0.96073	-3.9	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.97383	0.9144	M	0.85373	2.75	0.80722	D	1	D	0.67145	0.996	P	0.60886	0.88	D	0.97585	1.0113	10	0.51188	T	0.08	.	15.4114	0.74923	0.0:0.0:0.0:1.0	.	715	Q12965	MYO1E_HUMAN	C	715	ENSP00000288235:Y715C	ENSP00000288235:Y715C	Y	-	2	0	MYO1E	57253637	1.000000	0.71417	0.962000	0.40283	0.856000	0.48823	6.126000	0.71635	2.220000	0.72140	0.533000	0.62120	TAC	.	.	.	none		0.343	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
ATF7IP2	80063	hgsc.bcm.edu	37	16	10525251	10525251	+	Silent	SNP	T	T	C			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr16:10525251T>C	ENST00000396560.2	+	3	1001	c.774T>C	c.(772-774)agT>agC	p.S258S	ATF7IP2_ENST00000324570.5_Silent_p.S258S|ATF7IP2_ENST00000356427.2_Silent_p.S258S|ATF7IP2_ENST00000543967.1_Intron|ATF7IP2_ENST00000396559.1_Silent_p.S258S	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	258					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						GTAGAACCAGTATTTCAAATT	0.338																																					p.S258S		Atlas-SNP	.											.	ATF7IP2	40	.	0			c.T774C						PASS	.						62.0	63.0	63.0					16																	10525251		2197	4300	6497	SO:0001819	synonymous_variant	80063	exon3			AACCAGTATTTCA	AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.774T>C	chr16.hg19:g.10525251T>C		194.0	0.0	.		181.0	73.0	.	NM_024997	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Silent	SNP	ENST00000396560.2	hg19	CCDS10540.1																																																																																			.	.	.	none		0.338	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251961.1	NM_024997	
TXNDC11	51061	hgsc.bcm.edu	37	16	11782282	11782282	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr16:11782282G>T	ENST00000356957.3	-	10	2108	c.2001C>A	c.(1999-2001)ttC>ttA	p.F667L	TXNDC11_ENST00000570917.1_5'UTR|TXNDC11_ENST00000283033.5_Missense_Mutation_p.F640L			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	667	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						AGAGAACGCTGAAGTTTTGAA	0.378																																					p.F640L		Atlas-SNP	.											.	TXNDC11	75	.	0			c.C1920A						PASS	.						46.0	48.0	47.0					16																	11782282		2197	4300	6497	SO:0001583	missense	51061	exon9			AACGCTGAAGTTT	BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.2001C>A	chr16.hg19:g.11782282G>T	ENSP00000349439:p.Phe667Leu	47.0	0.0	.		65.0	26.0	.	NM_015914	O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	ENST00000356957.3	hg19		.	.	.	.	.	.	.	.	.	.	G	19.95	3.922136	0.73213	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	T;T	0.21543	2.0;2.0	5.97	5.02	0.67125	Thioredoxin-like fold (1);	0.098588	0.64402	D	0.000001	T	0.30293	0.0760	M	0.64170	1.965	0.58432	D	0.999998	P;P	0.41498	0.752;0.649	P;B	0.44732	0.459;0.149	T	0.06716	-1.0811	10	0.72032	D	0.01	-23.2994	14.0652	0.64824	0.0718:0.0:0.9282:0.0	.	667;640	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	L	667;640	ENSP00000349439:F667L;ENSP00000283033:F640L	ENSP00000283033:F640L	F	-	3	2	TXNDC11	11689783	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.999000	0.76283	1.535000	0.49220	0.655000	0.94253	TTC	.	.	.	none		0.378	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000437057.1	NM_015914	
MKL2	57496	hgsc.bcm.edu	37	16	14355241	14355241	+	Silent	SNP	G	G	A	rs150140535		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr16:14355241G>A	ENST00000341243.5	+	15	3207	c.3207G>A	c.(3205-3207)gcG>gcA	p.A1069A	MKL2_ENST00000318282.5_Silent_p.A1030A|MKL2_ENST00000574045.1_Silent_p.A1030A|MKL2_ENST00000571589.1_Silent_p.A1080A			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	1069					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GCACCACCGCGCCGAGCATGT	0.507																																					p.A1030A		Atlas-SNP	.											.	MKL2	103	.	0			c.G3090A						PASS	.	G		0,4394		0,0,2197	72.0	69.0	70.0		3090	-4.2	0.0	16	dbSNP_134	70	1,8599		0,1,4299	no	coding-synonymous	MKL2	NM_014048.3		0,1,6496	AA,AG,GG		0.0116,0.0,0.0077		1030/1050	14355241	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	57496	exon17			CACCGCGCCGAGC	AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.3207G>A	chr16.hg19:g.14355241G>A		79.0	0.0	.		78.0	41.0	.	NM_014048	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Silent	SNP	ENST00000341243.5	hg19																																																																																				.	G|1.000;A|0.000	0.000	weak		0.507	MKL2-202	KNOWN	basic	protein_coding	protein_coding		NM_014048	
KIAA0430	9665	hgsc.bcm.edu	37	16	15702262	15702262	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr16:15702262C>T	ENST00000396368.3	-	21	4274	c.4068G>A	c.(4066-4068)atG>atA	p.M1356I	CTB-193M12.1_ENST00000549756.1_RNA|KIAA0430_ENST00000540441.2_Missense_Mutation_p.M1191I|KIAA0430_ENST00000548025.1_Missense_Mutation_p.M1353I|KIAA0430_ENST00000547936.1_5'Flank|KIAA0430_ENST00000602337.1_Missense_Mutation_p.M1353I|KIAA0430_ENST00000344181.3_Missense_Mutation_p.M958I|KIAA0430_ENST00000551742.1_Missense_Mutation_p.M1356I	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1356	HTH OST-type 6. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GATCTGTCATCATAAGGCAGT	0.408																																					p.M1356I		Atlas-SNP	.											.	KIAA0430	154	.	0			c.G4068A						PASS	.						97.0	94.0	95.0					16																	15702262		1863	4103	5966	SO:0001583	missense	9665	exon21			TGTCATCATAAGG	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4068G>A	chr16.hg19:g.15702262C>T	ENSP00000379654:p.Met1356Ile	130.0	0.0	.		155.0	70.0	.	NM_014647	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	hg19	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554977	0.45487	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.87	4.87	0.63330	.	0.198570	0.56097	D	0.000028	T	0.28433	0.0703	N	0.14661	0.345	0.33689	D	0.613049	B;B;B;B	0.34399	0.274;0.452;0.452;0.32	B;B;B;B	0.35182	0.124;0.117;0.117;0.197	T	0.44003	-0.9356	10	0.48119	T	0.1	.	13.6513	0.62312	0.2707:0.7293:0.0:0.0	.	1355;1353;1352;1355	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	I	1356;1191;1296;958;1353;1356;1136	ENSP00000379654:M1356I;ENSP00000439819:M1191I;ENSP00000341939:M958I;ENSP00000449376:M1353I;ENSP00000450309:M1356I	ENSP00000315718:M1296I	M	-	3	0	KIAA0430	15609763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.870000	0.39529	2.781000	0.95711	0.655000	0.94253	ATG	.	.	.	none		0.408	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	
MAZ	4150	hgsc.bcm.edu	37	16	29820995	29820995	+	Intron	SNP	C	C	T	rs71143751|rs561533545		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr16:29820995C>T	ENST00000322945.6	+	5	1444				PRRT2_ENST00000300797.6_5'Flank|AC009133.15_ENST00000566537.1_RNA|PRRT2_ENST00000358758.7_5'Flank|MAZ_ENST00000563402.1_Intron|MAZ_ENST00000566906.2_Intron|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000219782.6_Nonsense_Mutation_p.Q472*|MAZ_ENST00000568544.1_Intron|AC009133.14_ENST00000569981.1_RNA|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000545521.1_Intron|MAZ_ENST00000562337.1_Intron|PRRT2_ENST00000567659.1_5'Flank|MAZ_ENST00000568282.1_Nonsense_Mutation_p.Q73*	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						CGGCCACATGCAGACCCATCT	0.736																																					p.Q472X	Colon(72;875 1167 15364 30899 37091)	Atlas-SNP	.											.	MAZ	48	.	0			c.C1414T						PASS	.						7.0	9.0	8.0					16																	29820995		1899	4077	5976	SO:0001627	intron_variant	4150	exon5			CACATGCAGACCC	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1280-403C>T	chr16.hg19:g.29820995C>T		102.0	0.0	.		65.0	29.0	.	NM_001042539	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Nonsense_Mutation	SNP	ENST00000322945.6	hg19	CCDS42143.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839048	0.91117	.	.	ENSG00000103495	ENST00000219782	.	.	.	4.64	3.67	0.42095	.	11.966600	0.00496	U	0.000156	.	.	.	.	.	.	0.53688	A	0.999978	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	10.112	0.42568	0.0:0.9001:0.0:0.0999	.	.	.	.	X	472	.	ENSP00000219782:Q472X	Q	+	1	0	MAZ	29728496	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.967000	0.56802	2.313000	0.78055	0.561000	0.74099	CAG	.	.	.	none		0.736	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435536.1	NM_002383	
ITGAE	3682	hgsc.bcm.edu	37	17	3638168	3638168	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr17:3638168G>T	ENST00000263087.4	-	21	2696	c.2598C>A	c.(2596-2598)taC>taA	p.Y866*	ITGAE_ENST00000571185.1_5'UTR	NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	866					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		TGCTTGTCATGTAGGAATCTT	0.507																																					p.Y866X	NSCLC(182;635 2928 8995 38788)	Atlas-SNP	.											.	ITGAE	96	.	0			c.C2598A						PASS	.						280.0	262.0	268.0					17																	3638168		2203	4300	6503	SO:0001587	stop_gained	3682	exon21			TGTCATGTAGGAA	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.2598C>A	chr17.hg19:g.3638168G>T	ENSP00000263087:p.Tyr866*	103.0	0.0	.		145.0	43.0	.	NM_002208	Q17RS6|Q9NZU9	Nonsense_Mutation	SNP	ENST00000263087.4	hg19	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	G	39	7.651620	0.98412	.	.	ENSG00000083457	ENST00000263087	.	.	.	5.05	1.99	0.26369	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.383	0.26866	0.2781:0.0:0.7219:0.0	.	.	.	.	X	866	.	ENSP00000263087:Y866X	Y	-	3	2	ITGAE	3584917	0.982000	0.34865	0.996000	0.52242	0.761000	0.43186	0.794000	0.26958	0.275000	0.22094	-0.199000	0.12753	TAC	.	.	.	none		0.507	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208	
CAMTA2	23125	hgsc.bcm.edu	37	17	4883018	4883018	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr17:4883018G>T	ENST00000348066.3	-	9	1722	c.1599C>A	c.(1597-1599)agC>agA	p.S533R	CAMTA2_ENST00000358183.4_Missense_Mutation_p.S533R|CAMTA2_ENST00000571831.1_5'Flank|CAMTA2_ENST00000381311.5_Missense_Mutation_p.S535R|CAMTA2_ENST00000572543.1_Missense_Mutation_p.S538R|CAMTA2_ENST00000414043.3_Missense_Mutation_p.S556R|CAMTA2_ENST00000361571.5_Missense_Mutation_p.S532R	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	533					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)	p.S533S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						CTGTGATGGTGCTAAGAGCAG	0.542																																					p.S556R		Atlas-SNP	.											CAMTA2,NS,carcinoma,0,1	CAMTA2	93	.	1	Substitution - coding silent(1)	endometrium(1)	c.C1668A						PASS	.						104.0	107.0	106.0					17																	4883018		2203	4300	6503	SO:0001583	missense	23125	exon9			GATGGTGCTAAGA	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.1599C>A	chr17.hg19:g.4883018G>T	ENSP00000321813:p.Ser533Arg	61.0	0.0	.		89.0	23.0	.	NM_001171167	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	hg19	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	G	8.773	0.926378	0.18056	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.31510	2.71;1.72;1.49;1.72;1.5	4.79	0.537	0.17144	Immunoglobulin-like fold (1);	0.266108	0.34777	N	0.003688	T	0.21103	0.0508	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B	0.27380	0.096;0.177;0.096;0.117;0.001	B;B;B;B;B	0.35655	0.094;0.042;0.131;0.207;0.002	T	0.16276	-1.0408	10	0.25106	T	0.35	-7.7034	4.4993	0.11856	0.3542:0.1555:0.4903:0.0	.	509;556;535;533;532	B7ZM30;E7EWU5;O94983-3;O94983;O94983-4	.;.;.;CMTA2_HUMAN;.	R	556;535;532;533;533	ENSP00000412886:S556R;ENSP00000370712:S535R;ENSP00000354828:S532R;ENSP00000350910:S533R;ENSP00000321813:S533R	ENSP00000321813:S533R	S	-	3	2	CAMTA2	4823742	0.526000	0.26298	0.938000	0.37757	0.972000	0.66771	0.949000	0.29109	0.318000	0.23185	-0.126000	0.14955	AGC	.	.	.	none		0.542	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099	
PER1	5187	hgsc.bcm.edu	37	17	8053954	8053954	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr17:8053954C>A	ENST00000317276.4	-	2	308	c.71G>T	c.(70-72)gGc>gTc	p.G24V	PER1_ENST00000581082.1_Missense_Mutation_p.G24V|PER1_ENST00000354903.5_Intron	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	24	Interaction with BTRC. {ECO:0000269|PubMed:15917222}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GGATGGGACGCCCCCAGGACA	0.642			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.G24V		Atlas-SNP	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	PER1,colon,carcinoma,0,1	PER1	104	.	0			c.G71T						PASS	.						49.0	53.0	51.0					17																	8053954		2203	4299	6502	SO:0001583	missense	5187	exon2			GGGACGCCCCCAG	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.71G>T	chr17.hg19:g.8053954C>A	ENSP00000314420:p.Gly24Val	35.0	0.0	.		39.0	18.0	.	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	hg19	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	C	9.788	1.177180	0.21787	.	.	ENSG00000179094	ENST00000317276	T	0.13196	2.61	5.38	1.21	0.21127	.	0.547369	0.18544	N	0.138112	T	0.12646	0.0307	L	0.38175	1.15	0.24187	N	0.995562	B;P	0.41366	0.235;0.747	P;B	0.45913	0.497;0.283	T	0.22173	-1.0224	10	0.20519	T	0.43	-3.3931	8.5305	0.33331	0.0:0.6761:0.0:0.3239	.	24;24	Q6IN51;O15534	.;PER1_HUMAN	V	24	ENSP00000314420:G24V	ENSP00000314420:G24V	G	-	2	0	PER1	7994679	0.283000	0.24277	0.131000	0.22000	0.193000	0.23685	0.608000	0.24223	0.025000	0.15241	0.563000	0.77884	GGC	.	.	.	none		0.642	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
NCOR1	9611	hgsc.bcm.edu	37	17	15952256	15952256	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr17:15952256A>T	ENST00000268712.3	-	41	6696	c.6439T>A	c.(6439-6441)Tac>Aac	p.Y2147N	NCOR1_ENST00000395857.3_Missense_Mutation_p.Y731N|NCOR1_ENST00000395851.1_Missense_Mutation_p.Y2044N	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2147	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ATGGGCTCGTAGGGCTCCGAA	0.517																																					p.Y2147N		Atlas-SNP	.											.	NCOR1	240	.	0			c.T6439A						PASS	.						82.0	74.0	77.0					17																	15952256		2203	4300	6503	SO:0001583	missense	9611	exon41			GCTCGTAGGGCTC	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.6439T>A	chr17.hg19:g.15952256A>T	ENSP00000268712:p.Tyr2147Asn	82.0	0.0	.		137.0	83.0	.	NM_006311	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	hg19	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.758738	0.49468	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.50001	0.76;1.32;0.77	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.63462	0.2513	L	0.52573	1.65	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.998;1.0;0.999	D;D;D;D;D;D	0.87578	0.998;0.993;0.994;0.989;0.996;0.974	T	0.66006	-0.6030	10	0.72032	D	0.01	-5.9972	14.5928	0.68383	1.0:0.0:0.0:0.0	.	957;2051;2147;2044;667;161	B4DZ48;E7EVK1;O75376;O75376-2;Q86YY1;Q86YY2	.;.;NCOR1_HUMAN;.;.;.	N	2147;2044;2051;731	ENSP00000268712:Y2147N;ENSP00000379192:Y2044N;ENSP00000379198:Y731N	ENSP00000268712:Y2147N	Y	-	1	0	NCOR1	15892981	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.393000	0.90182	2.117000	0.64856	0.533000	0.62120	TAC	.	.	.	none		0.517	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
IFI35	3430	hgsc.bcm.edu	37	17	41166305	41166305	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr17:41166305G>A	ENST00000415816.2	+	7	1073	c.850G>A	c.(850-852)Gag>Aag	p.E284K	IFI35_ENST00000438323.2_Missense_Mutation_p.E286K	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35	284				EVEALTVVPQGQQGLAVFTSESG -> GRGPDSRTPRTAGP SSLHL (in Ref. 1; no nucleotide entry). {ECO:0000305}.	cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		CTTCACCTCTGAGTCAGGCTA	0.637																																					p.E286K		Atlas-SNP	.											.	IFI35	23	.	0			c.G856A						PASS	.						52.0	45.0	48.0					17																	41166305		2203	4300	6503	SO:0001583	missense	3430	exon7			ACCTCTGAGTCAG	BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720	ENST00000415816.2:c.850G>A	chr17.hg19:g.41166305G>A	ENSP00000394579:p.Glu284Lys	58.0	0.0	.		79.0	17.0	.	NM_005533	C9JGX1|Q92984|Q99537|Q9BV98	Missense_Mutation	SNP	ENST00000415816.2	hg19		.	.	.	.	.	.	.	.	.	.	G	11.04	1.522297	0.27211	.	.	ENSG00000068079	ENST00000415816;ENST00000438323	T;T	0.46063	0.88;0.88	5.8	-0.216	0.13153	.	0.759943	0.12402	N	0.472023	T	0.27134	0.0665	L	0.27053	0.805	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.18241	-1.0343	10	0.38643	T	0.18	.	8.4304	0.32755	0.454:0.0:0.546:0.0	.	284	P80217	IN35_HUMAN	K	284;286	ENSP00000394579:E284K;ENSP00000395590:E286K	ENSP00000394579:E284K	E	+	1	0	IFI35	38419831	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.264000	0.08658	-0.250000	0.09555	-0.379000	0.06801	GAG	.	.	.	none		0.637	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000395851.1	NM_005533	
NFKBID	84807	hgsc.bcm.edu	37	19	36387912	36387912	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr19:36387912G>A	ENST00000396901.1	-	5	628	c.55C>T	c.(55-57)Ccc>Tcc	p.P19S	NFKBID_ENST00000606253.1_Missense_Mutation_p.P19S|NFKBID_ENST00000352614.2_Missense_Mutation_p.P171S|NFKBID_ENST00000585544.1_5'Flank	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta	19					inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						ACCACAGCGGGGAACTGTGGG	0.642																																					p.P19S		Atlas-SNP	.											.	NFKBID	30	.	0			c.C55T						PASS	.						44.0	47.0	46.0					19																	36387912		1902	4111	6013	SO:0001583	missense	84807	exon5			CAGCGGGGAACTG	AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.55C>T	chr19.hg19:g.36387912G>A	ENSP00000380109:p.Pro19Ser	221.0	0.0	.		184.0	80.0	.	NM_139239	Q8NI39|Q9BRG9	Missense_Mutation	SNP	ENST00000396901.1	hg19	CCDS42552.1	.	.	.	.	.	.	.	.	.	.	G	0.991	-0.693860	0.03303	.	.	ENSG00000167604	ENST00000352614;ENST00000396901	T;T	0.55588	0.51;1.21	4.65	1.2	0.21068	.	1.284560	0.04994	N	0.467779	T	0.36138	0.0956	L	0.29908	0.895	0.09310	N	0.999999	P;B	0.36909	0.573;0.001	B;B	0.33690	0.168;0.001	T	0.17684	-1.0361	10	0.21014	T	0.42	.	4.3062	0.10947	0.0894:0.1562:0.5932:0.1613	.	171;19	Q8NI38-2;Q8NI38	.;IKBD_HUMAN	S	171;19	ENSP00000252985:P171S;ENSP00000380109:P19S	ENSP00000252985:P171S	P	-	1	0	NFKBID	41079752	0.117000	0.22190	0.035000	0.18076	0.055000	0.15305	1.330000	0.33781	0.168000	0.19655	0.491000	0.48974	CCC	.	.	.	none		0.642	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452927.3	NM_032721	
ZC3H4	23211	hgsc.bcm.edu	37	19	47570155	47570155	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr19:47570155G>T	ENST00000253048.5	-	15	3407	c.3370C>A	c.(3370-3372)Cgc>Agc	p.R1124S	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1124							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GCCAGCACGCGGGGGTCGTAG	0.746																																					p.R1124S		Atlas-SNP	.											ZC3H4,NS,carcinoma,0,1	ZC3H4	96	.	0			c.C3370A						PASS	.						8.0	11.0	10.0					19																	47570155		1843	3992	5835	SO:0001583	missense	23211	exon15			GCACGCGGGGGTC	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.3370C>A	chr19.hg19:g.47570155G>T	ENSP00000253048:p.Arg1124Ser	38.0	0.0	.		34.0	2.0	.	NM_015168	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	hg19	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.251319	0.39797	.	.	ENSG00000130749	ENST00000253048	T	0.20598	2.06	5.54	3.28	0.37604	.	0.000000	0.64402	D	0.000001	T	0.41994	0.1183	M	0.63843	1.955	0.58432	D	0.999996	D	0.89917	1.0	D	0.85130	0.997	T	0.35549	-0.9784	10	0.52906	T	0.07	.	13.642	0.62257	0.0:0.0:0.7192:0.2808	.	1124	Q9UPT8	ZC3H4_HUMAN	S	1124	ENSP00000253048:R1124S	ENSP00000253048:R1124S	R	-	1	0	ZC3H4	52261995	0.921000	0.31238	0.330000	0.25442	0.016000	0.09150	1.525000	0.35953	1.302000	0.44855	0.563000	0.77884	CGC	.	.	.	none		0.746	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
PEG3	5178	hgsc.bcm.edu	37	19	57328814	57328814	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr19:57328814C>A	ENST00000326441.9	-	10	1359	c.996G>T	c.(994-996)agG>agT	p.R332S	ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R206S|PEG3_ENST00000598410.1_Missense_Mutation_p.R208S|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.R332S	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	332					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CGCTTGACTCCCTTGCTCTTC	0.493																																					p.R332S		Atlas-SNP	.											.	PEG3	414	.	0			c.G996T						PASS	.						76.0	72.0	74.0					19																	57328814		2203	4300	6503	SO:0001583	missense	5178	exon9			TGACTCCCTTGCT	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.996G>T	chr19.hg19:g.57328814C>A	ENSP00000326581:p.Arg332Ser	85.0	0.0	.		103.0	47.0	.	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	hg19	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.558552	0.45590	.	.	ENSG00000198300	ENST00000326441;ENST00000423103;ENST00000292074	T;T	0.02525	4.26;4.26	4.27	1.01	0.19927	.	0.000000	0.50627	D	0.000103	T	0.05686	0.0149	L	0.36672	1.1	.	.	.	D;D;D	0.76494	0.999;0.999;0.988	D;D;P	0.71184	0.972;0.972;0.815	T	0.39623	-0.9605	9	0.21014	T	0.42	-34.9522	6.1823	0.20478	0.0:0.6841:0.0:0.3159	.	208;332;267	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	S	332;332;302	ENSP00000326581:R332S;ENSP00000403051:R332S	ENSP00000292074:R302S	R	-	3	2	ZIM2	62020626	0.000000	0.05858	0.145000	0.22337	0.716000	0.41182	-0.873000	0.04214	0.335000	0.23614	0.561000	0.74099	AGG	.	.	.	none		0.493	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
ZNF776	284309	hgsc.bcm.edu	37	19	58265364	58265364	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr19:58265364A>G	ENST00000317178.5	+	3	1129	c.866A>G	c.(865-867)gAa>gGa	p.E289G		NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	289					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		CACACTGGAGAAAGACCTTAT	0.423																																					p.E289G		Atlas-SNP	.											.	ZNF776	115	.	0			c.A866G						PASS	.						93.0	83.0	86.0					19																	58265364		2203	4300	6503	SO:0001583	missense	284309	exon3			CTGGAGAAAGACC	AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.866A>G	chr19.hg19:g.58265364A>G	ENSP00000321812:p.Glu289Gly	52.0	0.0	.		47.0	26.0	.	NM_173632	Q6ZS36|Q8N968	Missense_Mutation	SNP	ENST00000317178.5	hg19	CCDS12962.2	.	.	.	.	.	.	.	.	.	.	A	25.7	4.660779	0.88154	.	.	ENSG00000152443	ENST00000317178	T	0.27557	1.66	1.92	0.722	0.18225	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47525	0.1450	M	0.71581	2.175	0.80722	D	1	B;D	0.89917	0.349;1.0	B;D	0.91635	0.127;0.999	T	0.39396	-0.9616	9	0.87932	D	0	.	5.8253	0.18550	0.7628:0.0:0.0:0.2372	.	289;289	Q68DI1;B4DSC6	ZN776_HUMAN;.	G	289	ENSP00000321812:E289G	ENSP00000321812:E289G	E	+	2	0	ZNF776	62957176	0.110000	0.22057	0.524000	0.27887	0.982000	0.71751	1.099000	0.31013	-0.012000	0.14223	0.254000	0.18369	GAA	.	.	.	none		0.423	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346722.2	NM_173632	
ZNF217	7764	hgsc.bcm.edu	37	20	52194908	52194908	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr20:52194908T>C	ENST00000371471.2	-	3	1873	c.1448A>G	c.(1447-1449)aAt>aGt	p.N483S	ZNF217_ENST00000302342.3_Missense_Mutation_p.N483S			O75362	ZN217_HUMAN	zinc finger protein 217	483					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GAGGTAATAATTTGAACGGAA	0.259																																					p.N483S		Atlas-SNP	.											.	ZNF217	227	.	0			c.A1448G						PASS	.						79.0	78.0	78.0					20																	52194908		2201	4294	6495	SO:0001583	missense	7764	exon2			TAATAATTTGAAC	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1448A>G	chr20.hg19:g.52194908T>C	ENSP00000360526:p.Asn483Ser	512.0	0.0	.		407.0	197.0	.	NM_006526	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	hg19	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.016204	0.54468	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.07216	3.21;3.21	5.0	3.83	0.44106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.056391	0.64402	D	0.000002	T	0.18299	0.0439	M	0.66939	2.045	0.42547	D	0.993093	D	0.62365	0.991	P	0.57101	0.813	T	0.02519	-1.1147	10	0.25751	T	0.34	-48.1811	11.2946	0.49272	0.1361:0.0:0.0:0.8639	.	483	O75362	ZN217_HUMAN	S	483	ENSP00000360526:N483S;ENSP00000304308:N483S	ENSP00000304308:N483S	N	-	2	0	ZNF217	51628315	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.445000	0.52921	2.010000	0.58986	0.533000	0.62120	AAT	.	.	.	none		0.259	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
USP25	29761	hgsc.bcm.edu	37	21	17135271	17135271	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr21:17135271T>A	ENST00000285679.6	+	2	476	c.107T>A	c.(106-108)cTa>cAa	p.L36Q	USP25_ENST00000351097.5_Missense_Mutation_p.L36Q|USP25_ENST00000400183.2_Missense_Mutation_p.L36Q|USP25_ENST00000285681.2_Missense_Mutation_p.L36Q	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	36	UBA-like.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		ACCCAGATACTACAGCAAGCC	0.363																																					p.L36Q		Atlas-SNP	.											.	USP25	156	.	0			c.T107A						PASS	.						139.0	140.0	140.0					21																	17135271		2203	4300	6503	SO:0001583	missense	29761	exon2			AGATACTACAGCA	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.107T>A	chr21.hg19:g.17135271T>A	ENSP00000285679:p.Leu36Gln	46.0	0.0	.		67.0	40.0	.	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	hg19	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.460251	0.84317	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000351097;ENST00000400183	T;T;T;T	0.56776	0.89;0.93;0.44;0.95	5.33	5.33	0.75918	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.68430	0.3000	L	0.55990	1.75	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.998;1.0;0.999	D;D;D;D	0.97110	0.999;0.995;1.0;0.997	T	0.71768	-0.4493	10	0.87932	D	0	.	15.3004	0.73945	0.0:0.0:0.0:1.0	.	36;36;36;36	Q9UHP3-3;Q96B65;Q9UHP3-1;Q9UHP3	.;.;.;UBP25_HUMAN	Q	36	ENSP00000285681:L36Q;ENSP00000285679:L36Q;ENSP00000299574:L36Q;ENSP00000383044:L36Q	ENSP00000285679:L36Q	L	+	2	0	USP25	16057142	1.000000	0.71417	0.988000	0.46212	0.992000	0.81027	7.673000	0.83973	2.024000	0.59613	0.459000	0.35465	CTA	.	.	.	none		0.363	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042470	36042470	+	Silent	SNP	A	A	G	rs557556798|rs62213790	byFrequency	TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr21:36042470A>G	ENST00000360731.3	+	1	783	c.783A>G	c.(781-783)gaA>gaG	p.E261E	CLIC6_ENST00000349499.2_Silent_p.E261E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	261	13 X 10 AA tandem repeat of G-D-[SNG]- [VIM]-[DEQ]-A-[EAG]-[GDVE]-[PRG]-[LAVP].					chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						ACGGCGTAGAAGCGGGGGTCC	0.761																																					p.E261E		Atlas-SNP	.											CLIC6,NS,carcinoma,0,1	CLIC6	49	.	0			c.A783G						PASS	.						1.0	2.0	2.0					21																	36042470		755	1897	2652	SO:0001819	synonymous_variant	54102	exon1			CGTAGAAGCGGGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.783A>G	chr21.hg19:g.36042470A>G		23.0	0.0	.		14.0	4.0	.	NM_053277	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	hg19																																																																																				.	.	.	weak		0.761	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
KRTAP10-8	386681	hgsc.bcm.edu	37	21	46032738	46032738	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr21:46032738C>T	ENST00000334662.2	+	1	743	c.721C>T	c.(721-723)Cac>Tac	p.H241Y	TSPEAR_ENST00000323084.4_Intron	NM_198695.2	NP_941968.2	P60410	KR108_HUMAN	keratin associated protein 10-8	241	19 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	17						cagctgctgccacccggcctc	0.711																																					p.H241Y		Atlas-SNP	.											.	KRTAP10-8	34	.	0			c.C721T						PASS	.						37.0	45.0	42.0					21																	46032738		2203	4298	6501	SO:0001583	missense	386681	exon1			TGCTGCCACCCGG	AB076355	CCDS13713.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000187766	ENSG00000187766		"""Keratin associated proteins"""	20525	protein-coding gene	gene with protein product			"""keratin associated protein 18-8"""	KRTAP18-8			Standard	NM_198695		Approved	KRTAP18.8, KAP10.8	uc002zfo.1	P60410	OTTHUMG00000057632	ENST00000334662.2:c.721C>T	chr21.hg19:g.46032738C>T	ENSP00000335565:p.His241Tyr	59.0	0.0	.		37.0	20.0	.	NM_198695	A0JNW4	Missense_Mutation	SNP	ENST00000334662.2	hg19	CCDS13713.1	.	.	.	.	.	.	.	.	.	.	c	3.898	-0.022702	0.07634	.	.	ENSG00000187766	ENST00000334662	T	0.00717	5.79	3.24	-3.04	0.05412	.	.	.	.	.	T	0.00608	0.0020	N	0.14661	0.345	0.09310	N	1	B	0.25521	0.128	B	0.29663	0.105	T	0.45101	-0.9284	9	0.56958	D	0.05	.	5.7146	0.17952	0.0:0.4714:0.1368:0.3918	.	241	P60410	KR108_HUMAN	Y	241	ENSP00000335565:H241Y	ENSP00000335565:H241Y	H	+	1	0	KRTAP10-8	44857166	0.000000	0.05858	0.374000	0.26016	0.007000	0.05969	-3.222000	0.00551	-0.687000	0.05162	-1.250000	0.01514	CAC	.	.	.	none		0.711	KRTAP10-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128035.1	NM_198695	
FANCB	2187	hgsc.bcm.edu	37	X	14863248	14863248	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chrX:14863248T>G	ENST00000324138.3	-	7	1810	c.1657A>C	c.(1657-1659)Acg>Ccg	p.T553P	FANCB_ENST00000398334.1_Missense_Mutation_p.T553P	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	553					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					GGGGTCAACGTGACCCTTTTT	0.403								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.T553P		Atlas-SNP	.											.	FANCB	78	.	0			c.A1657C						PASS	.						101.0	90.0	93.0					X																	14863248		2203	4300	6503	SO:0001583	missense	2187	exon7	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TCAACGTGACCCT	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1657A>C	chrX.hg19:g.14863248T>G	ENSP00000326819:p.Thr553Pro	130.0	0.0	.		141.0	124.0	.	NM_152633	B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	ENST00000324138.3	hg19	CCDS14161.1	.	.	.	.	.	.	.	.	.	.	T	7.265	0.606039	0.14002	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	5.36	4.17	0.49024	.	0.080592	0.52532	D	0.000066	T	0.24084	0.0583	N	0.08118	0	0.09310	N	0.999997	B	0.10296	0.003	B	0.06405	0.002	T	0.20605	-1.0270	9	0.72032	D	0.01	-5.8518	11.0343	0.47791	0.0:0.0:0.1533:0.8467	.	553	Q8NB91	FANCB_HUMAN	P	553	.	ENSP00000326819:T553P	T	-	1	0	FANCB	14773169	1.000000	0.71417	0.224000	0.23877	0.027000	0.11550	3.643000	0.54374	0.657000	0.30906	0.425000	0.28330	ACG	.	.	.	none		0.403	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633	
LPAR4	2846	hgsc.bcm.edu	37	X	78010830	78010830	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chrX:78010830C>G	ENST00000435339.3	+	2	850	c.464C>G	c.(463-465)tCt>tGt	p.S155C		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	155					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						AGGAGGAATTCTGCCATTGTG	0.468																																					p.S155C		Atlas-SNP	.											.	LPAR4	83	.	0			c.C464G						PASS	.						191.0	127.0	149.0					X																	78010830		2203	4300	6503	SO:0001583	missense	2846	exon2			GGAATTCTGCCAT	U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.464C>G	chrX.hg19:g.78010830C>G	ENSP00000408205:p.Ser155Cys	28.0	0.0	.		50.0	47.0	.	NM_005296	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	hg19	CCDS14441.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.317040	0.60524	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.35789	1.29;1.29	4.21	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.149396	0.45867	D	0.000329	T	0.48259	0.1490	L	0.38733	1.17	0.52501	D	0.99995	D	0.69078	0.997	D	0.69142	0.962	T	0.50398	-0.8833	10	0.59425	D	0.04	.	14.3969	0.67018	0.0:1.0:0.0:0.0	.	155	Q99677	LPAR4_HUMAN	C	155	ENSP00000408205:S155C;ENSP00000362398:S155C	ENSP00000362398:S155C	S	+	2	0	LPAR4	77897486	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.233000	0.78125	1.943000	0.56356	0.422000	0.28245	TCT	.	.	.	none		0.468	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296	
NASP	4678	hgsc.bcm.edu	37	1	46073205	46073206	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:46073205_46073206insA	ENST00000350030.3	+	6	709_710	c.622_623insA	c.(622-624)gaafs	p.E208fs	NASP_ENST00000537798.1_Frame_Shift_Ins_p.E144fs|NASP_ENST00000351223.3_Intron|NASP_ENST00000402363.3_Frame_Shift_Ins_p.E210fs|NASP_ENST00000372052.4_Intron	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	208	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					TTGGTTAACTGAAACCTCTGAA	0.465																																					p.E208fs		Atlas-Indel,Pindel	.											.	NASP	77	.	0			c.622_623insA						PASS	.																																			SO:0001589	frameshift_variant	4678	exon6			.	M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.625dupA	chr1.hg19:g.46073208_46073208dupA	ENSP00000255120:p.Glu208fs	207.0	0.0	0		210.0	104.0	0.495238	NM_002482	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Frame_Shift_Ins	INS	ENST00000350030.3	hg19	CCDS524.1																																																																																			.	.	.	none		0.465	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2	NM_002482	
CCDC146	57639	hgsc.bcm.edu	37	7	76885742	76885744	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr7:76885742_76885744delAGA	ENST00000285871.4	+	6	727_729	c.600_602delAGA	c.(598-603)cgagaa>cga	p.E201del	AC073635.5_ENST00000476561.2_RNA|CCDC146_ENST00000431197.1_5'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	201										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AAAATTTACGAGAAGATTTGGCA	0.325																																					p.200_201del		Atlas-Indel,Pindel	.											.	CCDC146	87	.	0			c.599_601del						PASS	.																																			SO:0001651	inframe_deletion	57639	exon6			.	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.600_602delAGA	chr7.hg19:g.76885745_76885747delAGA	ENSP00000285871:p.Glu201del	195.0	0.0	0		398.0	83.0	0.208543	NM_020879	A8K8X6|Q9P223	In_Frame_Del	DEL	ENST00000285871.4	hg19	CCDS34671.1																																																																																			.	.	.	none		0.325	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879	
KRT2	3849	hgsc.bcm.edu	37	12	53045631	53045632	+	In_Frame_Ins	INS	-	-	CGCCTCCAAAGCCGCTGC			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr12:53045631_53045632insCGCCTCCAAAGCCGCTGC	ENST00000309680.3	-	1	316_317	c.295_296insGCAGCGGCTTTGGAGGCG	c.(295-297)ggc>gGCAGCGGCTTTGGAGGCGgc	p.99_99G>GSGFGGG		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	99	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		aaagctgctgccgcctccaaaa	0.619																																					p.G99delinsGSGFGGG		Atlas-INDEL	.											.	KRT2	94	.	0			c.296_297insGCAGCGGCTTTGGAGGCG						PASS	.																																			SO:0001652	inframe_insertion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.295_296insGCAGCGGCTTTGGAGGCG	chr12.hg19:g.53045631_53045632insCGCCTCCAAAGCCGCTGC	Exception_encountered	146.0	0.0	0		171.0	32.0	0.187135	NM_000423	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	hg19	CCDS8835.1																																																																																			.	.	.	none		0.619	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
GRINA	2907	hgsc.bcm.edu	37	8	145066228	145066230	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr8:145066228_145066230delCTG	ENST00000313269.5	+	4	953_955	c.675_677delCTG	c.(673-678)ccctgg>ccg	p.W226del	GRINA_ENST00000395068.4_In_Frame_Del_p.W226del	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	226						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GAAAGCACCCCTGGAACCTTGTT	0.581																																					p.225_226del		Atlas-Indel,Pindel	.											.	GRINA	25	.	0			c.674_676del						PASS	.																																			SO:0001651	inframe_deletion	2907	exon4			.	NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.675_677delCTG	chr8.hg19:g.145066228_145066230delCTG	ENSP00000314380:p.Trp226del	62.0	0.0	0		66.0	29.0	0.439394	NM_001009184	B3KXM7|O43836|Q8IVW7	In_Frame_Del	DEL	ENST00000313269.5	hg19	CCDS34961.1																																																																																			.	.	.	none		0.581	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384048.1	NM_001009184	
INTS10	55174	hgsc.bcm.edu	37	8	19680900	19680901	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr8:19680900_19680901insT	ENST00000397977.3	+	6	1010_1011	c.612_613insT	c.(613-615)tttfs	p.F205fs		NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	205					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		AAGCAGCTGAATTTTATATCAA	0.327																																					p.E204fs		Atlas-Indel,Pindel	.											.	INTS10	46	.	0			c.612_613insT						PASS	.																																			SO:0001589	frameshift_variant	55174	exon6			.	AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.616dupT	chr8.hg19:g.19680904_19680904dupT	ENSP00000381064:p.Phe205fs	104.0	0.0	0		75.0	27.0	0.36	NM_018142	Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Frame_Shift_Ins	INS	ENST00000397977.3	hg19	CCDS6011.2																																																																																			.	.	.	none		0.327	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253724.2	NM_018142	
CELF1	10658	hgsc.bcm.edu	37	11	47498949	47498950	+	Frame_Shift_Ins	INS	-	-	A	rs35704230		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr11:47498949_47498950insA	ENST00000358597.3	-	8	790_791	c.791_792insT	c.(790-792)ttgfs	p.L264fs	CELF1_ENST00000539455.1_5'Flank|CELF1_ENST00000310513.5_Frame_Shift_Ins_p.L260fs|CELF1_ENST00000361904.3_Frame_Shift_Ins_p.L260fs|CELF1_ENST00000531165.1_Frame_Shift_Ins_p.L291fs|CELF1_ENST00000395292.2_Frame_Shift_Ins_p.L260fs|CELF1_ENST00000395290.2_Frame_Shift_Ins_p.L263fs|CELF1_ENST00000532048.1_Frame_Shift_Ins_p.L290fs			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	264					embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						CTAGTGCAGCCAAATTCTGTAA	0.485																																					p.L290fs	Pancreas(163;1949 1966 9906 43218 43785)	Atlas-Indel,Pindel	.											.	CELF1	43	.	0			c.870_871insT						PASS	.																																			SO:0001589	frameshift_variant	10658	exon11			.	U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.792dupT	chr11.hg19:g.47498952_47498952dupA	ENSP00000351409:p.Leu264fs	50.0	0.0	0		46.0	15.0	0.326087	NM_001172639	B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Frame_Shift_Ins	INS	ENST00000358597.3	hg19	CCDS31482.1																																																																																			.	.	.	none		0.485	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398352.1	NM_006560	
BACH1	571	hgsc.bcm.edu	37	21	30699093	30699114	+	Frame_Shift_Del	DEL	CCCTCATGGACTTTATTCTTTG	CCCTCATGGACTTTATTCTTTG	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	CCCTCATGGACTTTATTCTTTG	CCCTCATGGACTTTATTCTTTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr21:30699093_30699114delCCCTCATGGACTTTATTCTTTG	ENST00000399921.1	+	3	1191_1212	c.948_969delCCCTCATGGACTTTATTCTTTG	c.(946-969)gaccctcatggactttattctttgfs	p.DPHGLYSL316fs	BACH1_ENST00000286800.3_Frame_Shift_Del_p.DPHGLYSL316fs	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						CTTCCATAGACCCTCATGGACTTTATTCTTTGTCTCTTTTAC	0.405																																					p.316_323del		Atlas-Indel,Pindel	.											.	BACH1	66	.	0			c.947_968del						PASS	.																																			SO:0001589	frameshift_variant	571	exon3			.	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.948_969delCCCTCATGGACTTTATTCTTTG	chr21.hg19:g.30699093_30699114delCCCTCATGGACTTTATTCTTTG	ENSP00000382805:p.Asp316fs	60.0	0.0	0		49.0	19.0	0.387755	NM_206866	Q3MJE2|Q8NCI5	Frame_Shift_Del	DEL	ENST00000399921.1	hg19	CCDS13585.1																																																																																			.	.	.	none		0.405	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866	
REPS1	85021	hgsc.bcm.edu	37	6	139262521	139262521	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr6:139262521delT	ENST00000450536.2	-	8	1660	c.1086delA	c.(1084-1086)aaafs	p.K362fs	REPS1_ENST00000415951.2_Frame_Shift_Del_p.K362fs|REPS1_ENST00000258062.5_Frame_Shift_Del_p.K362fs|REPS1_ENST00000367663.4_Frame_Shift_Del_p.K362fs|REPS1_ENST00000409812.2_Frame_Shift_Del_p.K362fs			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	362	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		TTTCAGGAAGTTTTTCTGGTA	0.403																																					p.L363fs		Atlas-Indel,Pindel	.											.	REPS1	58	.	0			c.1087delC						PASS	.						175.0	177.0	176.0					6																	139262521		2203	4300	6503	SO:0001589	frameshift_variant	85021	exon8			.		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1086delA	chr6.hg19:g.139262521delT	ENSP00000392065:p.Lys362fs	99.0	0.0	0		91.0	39.0	0.428571	NM_001128617	B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Frame_Shift_Del	DEL	ENST00000450536.2	hg19																																																																																				.	.	.	none		0.403	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3		
TTC4	7268	hgsc.bcm.edu	37	1	55197174	55197174	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:55197174delC	ENST00000371281.3	+	7	784	c.697delC	c.(697-699)ctcfs	p.L233fs	MROH7-TTC4_ENST00000414150.2_3'UTR|TTC4_ENST00000371284.5_3'UTR	NM_004623.4	NP_004614.3	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	233										breast(2)|endometrium(3)|kidney(1)|lung(2)|stomach(1)	9						GAATATCAGGCTCTCAGAAGC	0.468																																					p.R232fs		Atlas-Indel,Pindel	.											.	TTC4	21	.	0			c.696delG						PASS	.						56.0	51.0	53.0					1																	55197174		2203	4300	6503	SO:0001589	frameshift_variant	7268	exon7			.		CCDS596.1	1p32	2013-01-11			ENSG00000243725	ENSG00000243725		"""Tetratricopeptide (TTC) repeat domain containing"""	12394	protein-coding gene	gene with protein product		606753				9933562	Standard	NM_004623		Approved	MGC5097, FLJ41930	uc001cxx.4	O95801	OTTHUMG00000009914	ENST00000371281.3:c.697delC	chr1.hg19:g.55197174delC	ENSP00000360329:p.Leu233fs	51.0	0.0	0		56.0	23.0	0.410714	NM_004623	Q53Y95|Q5TA96|Q9H3I2	Frame_Shift_Del	DEL	ENST00000371281.3	hg19	CCDS596.1																																																																																			.	.	.	none		0.468	TTC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027432.1	NM_004623	
KCNS3	3790	hgsc.bcm.edu	37	2	18112835	18112835	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr2:18112835delT	ENST00000403915.1	+	3	1011	c.560delT	c.(559-561)atcfs	p.I187fs	KCNS3_ENST00000304101.4_Frame_Shift_Del_p.I187fs|KCNS3_ENST00000465292.1_Intron	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	187					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GCTAAGCTTATCGCTATCTCC	0.517																																					p.I187fs		Atlas-Indel,Pindel	.											KCNS3,NS,carcinoma,0,1	KCNS3	85	.	0			c.559delA						PASS	.						71.0	71.0	71.0					2																	18112835		2203	4300	6503	SO:0001589	frameshift_variant	3790	exon3			.	AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.560delT	chr2.hg19:g.18112835delT	ENSP00000385968:p.Ile187fs	93.0	0.0	0		117.0	49.0	0.418803	NM_002252	D6W520|O43651|Q4ZFY1|Q96B56	Frame_Shift_Del	DEL	ENST00000403915.1	hg19	CCDS1692.1																																																																																			.	.	.	none		0.517	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323808.1	NM_002252	
NPY4R	5540	hgsc.bcm.edu	37	10	47086821	47086842	+	Frame_Shift_Del	DEL	AATCTCCACAAGGTGAAAACAG	AATCTCCACAAGGTGAAAACAG	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	AATCTCCACAAGGTGAAAACAG	AATCTCCACAAGGTGAAAACAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr10:47086821_47086842delAATCTCCACAAGGTGAAAACAG	ENST00000395716.1	+	2	123_144	c.38_59delAATCTCCACAAGGTGAAAACAG	c.(37-60)aaatctccacaaggtgaaaacagafs	p.KSPQGENR13fs	NPY4R_ENST00000374312.1_Frame_Shift_Del_p.KSPQGENR13fs			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	13					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										CTGCTCCCAAAATCTCCACAAGGTGAAAACAGAAGCAAACCC	0.491																																					p.13_20del		Atlas-Indel,Pindel	.											.	PPYR1	54	.	0			c.37_58del						PASS	.																																			SO:0001589	frameshift_variant	5540	exon3			.		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.38_59delAATCTCCACAAGGTGAAAACAG	chr10.hg19:g.47086821_47086842delAATCTCCACAAGGTGAAAACAG	ENSP00000379066:p.Lys13fs	225.0	0.0	0		228.0	27.0	0.118421	NM_005972	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Frame_Shift_Del	DEL	ENST00000395716.1	hg19	CCDS31193.1																																																																																			.	.	.	none		0.491	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1		
UNC5C	8633	hgsc.bcm.edu	37	4	96140151	96140151	+	Frame_Shift_Del	DEL	C	C	-	rs61741188	byFrequency	TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr4:96140151delC	ENST00000453304.1	-	9	1962	c.1614delG	c.(1612-1614)tcgfs	p.S538fs	UNC5C_ENST00000506749.1_Frame_Shift_Del_p.S557fs	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	538	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GACCTCCCAGCGAGTTGAAGC	0.443																																					p.L539fs		Atlas-Indel,Pindel	.											.	UNC5C	141	.	0			c.1615delC						PASS	.						108.0	86.0	94.0					4																	96140151		2203	4300	6503	SO:0001589	frameshift_variant	8633	exon9			.	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1614delG	chr4.hg19:g.96140151delC	ENSP00000406022:p.Ser538fs	43.0	0.0	0		54.0	25.0	0.462963	NM_003728	Q8IUT0	Frame_Shift_Del	DEL	ENST00000453304.1	hg19	CCDS3643.1																																																																																			.	.	.	none		0.443	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
MFN2	9927	hgsc.bcm.edu	37	1	12067259	12067260	+	Frame_Shift_Del	DEL	GC	GC	-	rs531748892		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:12067259_12067260delGC	ENST00000235329.5	+	17	2344_2345	c.2022_2023delGC	c.(2020-2025)cagcttfs	p.QL674fs	MFN2_ENST00000444836.1_Frame_Shift_Del_p.QL674fs	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	674					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AGAAGCTGCAGCTTGTCATCAG	0.604																																					p.674_674del		Atlas-INDEL	.											.	MFN2	83	.	0			c.2021_2022del						PASS	.																																			SO:0001589	frameshift_variant	9927	exon17			.	AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.2022_2023delGC	chr1.hg19:g.12067259_12067260delGC	ENSP00000235329:p.Gln674fs	171.0	0.0	0		138.0	57.0	0.413043	NM_014874	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Frame_Shift_Del	DEL	ENST00000235329.5	hg19	CCDS30587.1																																																																																			.	.	.	none		0.604	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006859.2	NM_014874	
CMTM3	123920	hgsc.bcm.edu	37	16	66643431	66643431	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr16:66643431delG	ENST00000424011.2	+	4	923	c.397delG	c.(397-399)gggfs	p.G133fs	CMTM3_ENST00000568477.1_Frame_Shift_Del_p.G47fs|CMTM3_ENST00000562707.1_Frame_Shift_Del_p.G133fs|CMTM3_ENST00000566121.1_Frame_Shift_Del_p.G47fs|CMTM3_ENST00000460097.1_Frame_Shift_Del_p.G47fs|CMTM3_ENST00000564060.1_Intron|CMTM3_ENST00000565666.1_Frame_Shift_Del_p.G48fs|CMTM3_ENST00000565922.1_Intron|CMTM3_ENST00000565003.1_Frame_Shift_Del_p.G47fs|CMTM3_ENST00000360086.4_Intron|CMTM3_ENST00000361909.4_Frame_Shift_Del_p.G133fs|CMTM3_ENST00000567572.1_Frame_Shift_Del_p.G133fs			Q96MX0	CKLF3_HUMAN	CKLF-like MARVEL transmembrane domain containing 3	133	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)|positive regulation of B cell receptor signaling pathway (GO:0050861)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				central_nervous_system(1)|endometrium(1)|lung(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0671)|Epithelial(162;0.164)		CAAAGCCGCTGGGGTGAGCAG	0.642																																					p.A132fs		Atlas-INDEL	.											.	CMTM3	13	.	0			c.396delT						PASS	.						26.0	24.0	25.0					16																	66643431		2197	4298	6495	SO:0001589	frameshift_variant	123920	exon3			.	AK056324	CCDS10815.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140931	ENSG00000140931			19174	protein-coding gene	gene with protein product		607886	"""chemokine-like factor superfamily 3"""	CKLFSF3		15087455	Standard	NM_144601		Approved	FLJ31762, BNAS2	uc002epv.3	Q96MX0	OTTHUMG00000137503	ENST00000424011.2:c.397delG	chr16.hg19:g.66643431delG	ENSP00000400482:p.Gly133fs	54.0	0.0	0		25.0	11.0	0.44	NM_181553	A6NCL9|Q8IUU8|Q8IWQ6|Q8IYE2|Q8IZ39|Q8IZ59	Frame_Shift_Del	DEL	ENST00000424011.2	hg19	CCDS10815.1																																																																																			.	.	.	none		0.642	CMTM3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268814.2	NM_144601	
ADARB2	105	hgsc.bcm.edu	37	10	1279742	1279743	+	Frame_Shift_Del	DEL	TT	TT	-	rs191642114		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr10:1279742_1279743delTT	ENST00000381312.1	-	6	1731_1732	c.1406_1407delAA	c.(1405-1407)aaafs	p.K469fs	ADARB2_ENST00000469464.1_5'UTR	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	469	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		AGCCACCTTCTTTTAACCGCAC	0.53																																					p.469_470del		Atlas-Indel,Pindel	.											.	ADARB2	95	.	0			c.1407_1408del						PASS	.																																			SO:0001589	frameshift_variant	105	exon6			.	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1406_1407delAA	chr10.hg19:g.1279744_1279745delTT	ENSP00000370713:p.Lys469fs	104.0	0.0	0		99.0	45.0	0.454545	NM_018702	B2RPJ5|Q5VUT6|Q5VW42	Frame_Shift_Del	DEL	ENST00000381312.1	hg19	CCDS7058.1																																																																																			.	.	.	none		0.530	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702	
USP42	84132	hgsc.bcm.edu	37	7	6180604	6180605	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr7:6180604_6180605insTA	ENST00000306177.5	+	7	942_943	c.784_785insTA	c.(784-786)ttgfs	p.L262fs		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	262	USP.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		TGATATAACATTGGAGATAAAG	0.248																																					p.L262fs		Atlas-Indel,Pindel	.											.	USP42	138	.	0			c.784_785insTA						PASS	.																																			SO:0001589	frameshift_variant	84132	exon7			.	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	Exception_encountered	chr7.hg19:g.6180604_6180605insTA	ENSP00000301962:p.Leu262fs	634.0	0.0	0		990.0	431.0	0.435354	NM_032172	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Frame_Shift_Ins	INS	ENST00000306177.5	hg19	CCDS47535.1																																																																																			.	.	.	none		0.248	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
MFN2	9927	hgsc.bcm.edu	37	1	12067259	12067262	+	Frame_Shift_Del	DEL	GCTT	GCTT	-	rs531748892		TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	GCTT	GCTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr1:12067259_12067262delGCTT	ENST00000235329.5	+	17	2344_2347	c.2022_2025delGCTT	c.(2020-2025)cagcttfs	p.QL674fs	MFN2_ENST00000444836.1_Frame_Shift_Del_p.QL674fs	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	674					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AGAAGCTGCAGCTTGTCATCAGCT	0.603																																					p.674_675del		Pindel	.											.	MFN2	83	.	0			c.2021_2024del						PASS	.																																			SO:0001589	frameshift_variant	9927	exon17			.	AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.2022_2025delGCTT	chr1.hg19:g.12067259_12067262delGCTT	ENSP00000235329:p.Gln674fs	175.0	0.0	.		142.0	40.0	0.282	NM_014874	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Frame_Shift_Del	DEL	ENST00000235329.5	hg19	CCDS30587.1																																																																																			.	.	.	none		0.603	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006859.2	NM_014874	
KIAA2018	205717	hgsc.bcm.edu	37	3	113392215	113392215	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr3:113392215delT	ENST00000478658.1	-	2	73	c.56delA	c.(55-57)aacfs	p.N19fs	KIAA2018_ENST00000316407.4_Frame_Shift_Del_p.N19fs|KIAA2018_ENST00000491165.1_Frame_Shift_Del_p.N19fs			Q68DE3	K2018_HUMAN	KIAA2018	19	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TGTCTCCCGGTTTTTCTTTCT	0.259																																					p.N19fs		Pindel	.											.	KIAA2018	180	.	0			c.57delC						PASS	.						56.0	52.0	53.0					3																	113392215		1782	4045	5827	SO:0001589	frameshift_variant	205717	exon4			.	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.56delA	chr3.hg19:g.113392215delT	ENSP00000420721:p.Asn19fs	388.0	0.0	.		393.0	139.0	0.354	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Frame_Shift_Del	DEL	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.	.	none		0.259	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ITPR1	3708	hgsc.bcm.edu	37	3	4821261	4821263	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-2Z-A9JE-01A-11D-A42J-10	TCGA-2Z-A9JE-10A-01D-A42M-10	ATC	ATC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa7ded84-a75d-4ee6-b8c4-cb4858ba6c62	0ce30bd0-7241-4ecb-aa30-df5138e4b738	g.chr3:4821261_4821263delATC	ENST00000443694.2	+	46	6274_6276	c.6274_6276delATC	c.(6274-6276)atcdel	p.I2092del	ITPR1_ENST00000354582.6_In_Frame_Del_p.I2092del|ITPR1_ENST00000302640.8_In_Frame_Del_p.I2092del|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000423119.2_In_Frame_Del_p.I2059del|ITPR1_ENST00000357086.4_In_Frame_Del_p.I2059del|ITPR1_ENST00000456211.2_In_Frame_Del_p.I2044del			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2107					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GCTCCTGGCCATCATGGAAAGCA	0.532																																					p.2091_2092del		Pindel	.											.	ITPR1	659	.	0			c.6273_6275del						PASS	.																																			SO:0001651	inframe_deletion	3708	exon48			.	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.6274_6276delATC	chr3.hg19:g.4821261_4821263delATC	ENSP00000401671:p.Ile2092del	160.0	0.0	.		152.0	88.0	0.579	NM_001168272	E7EPX7|E9PDE9|Q14660|Q99897	In_Frame_Del	DEL	ENST00000443694.2	hg19	CCDS54551.1																																																																																			.	.	.	none		0.532	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
