#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	hgsc.bcm.edu	37	1	1267767	1267767	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr1:1267767T>C	ENST00000339381.5	+	3	888	c.856T>C	c.(856-858)Tac>Cac	p.Y286H		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	286					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		CCTCTTCAACTACAGCATCAG	0.672																																					p.Y286H		Atlas-SNP	.											.	TAS1R3	39	.	0			c.T856C						PASS	.						25.0	21.0	22.0					1																	1267767		2187	4285	6472	SO:0001583	missense	83756	exon3			TTCAACTACAGCA	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.856T>C	chr1.hg19:g.1267767T>C	ENSP00000344411:p.Tyr286His	133.0	0.0	.		54.0	19.0	.	NM_152228	Q5TA49|Q8NGW9	Missense_Mutation	SNP	ENST00000339381.5	hg19	CCDS30556.1	.	.	.	.	.	.	.	.	.	.	T	0.130	-1.114776	0.01799	.	.	ENSG00000169962	ENST00000339381	D	0.82619	-1.63	4.6	-1.77	0.07982	Extracellular ligand-binding receptor (1);	0.501897	0.20842	N	0.084691	T	0.64438	0.2598	N	0.13235	0.315	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.53641	-0.8410	10	0.48119	T	0.1	.	7.3836	0.26870	0.1219:0.4662:0.0:0.4119	.	286	Q7RTX0	TS1R3_HUMAN	H	286	ENSP00000344411:Y286H	ENSP00000344411:Y286H	Y	+	1	0	TAS1R3	1257630	0.000000	0.05858	0.018000	0.16275	0.007000	0.05969	-2.021000	0.01440	-0.213000	0.10094	-0.411000	0.06167	TAC	.	.	.	none		0.672	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008493.1		
LEPR	3953	hgsc.bcm.edu	37	1	66088612	66088612	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr1:66088612A>G	ENST00000349533.6	+	19	2806	c.2621A>G	c.(2620-2622)gAt>gGt	p.D874G	LEPR_ENST00000344610.8_Missense_Mutation_p.D874G|LEPR_ENST00000371060.3_Missense_Mutation_p.D874G|LEPR_ENST00000371059.3_Missense_Mutation_p.D874G|LEPR_ENST00000371058.1_Missense_Mutation_p.D874G|LEPR_ENST00000406510.3_Intron	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TTTTGGGAAGATGTTCCGAAC	0.338																																					p.D874G		Atlas-SNP	.											.	LEPR	284	.	0			c.A2621G						PASS	.						96.0	97.0	96.0					1																	66088612		2203	4300	6503	SO:0001583	missense	3953	exon19			GGGAAGATGTTCC	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2621A>G	chr1.hg19:g.66088612A>G	ENSP00000330393:p.Asp874Gly	59.0	0.0	.		92.0	32.0	.	NM_001003680	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	hg19	CCDS631.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.971394	0.74246	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.71817	-0.31;-0.28;-0.29;-0.6;-0.31	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.79540	0.4463	M	0.72479	2.2	0.80722	D	1	P;P;D	0.89917	0.864;0.917;1.0	B;P;D	0.97110	0.416;0.62;1.0	T	0.82283	-0.0534	10	0.62326	D	0.03	-22.0107	15.1416	0.72615	1.0:0.0:0.0:0.0	.	874;874;874	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	G	874	ENSP00000340884:D874G;ENSP00000330393:D874G;ENSP00000360099:D874G;ENSP00000360098:D874G;ENSP00000360097:D874G	ENSP00000340884:D874G	D	+	2	0	LEPR	65861200	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	6.605000	0.74155	2.019000	0.59389	0.528000	0.53228	GAT	.	.	.	none		0.338	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
PRCC	5546	hgsc.bcm.edu	37	1	156767106	156767106	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr1:156767106A>C	ENST00000271526.4	+	6	1634	c.1362A>C	c.(1360-1362)aaA>aaC	p.K454N	PRCC_ENST00000353233.3_Missense_Mutation_p.K422N	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	454					mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)			PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGCGGCGGAAACACCAGATCA	0.473			T	TFE3	papillary renal						OREG0013886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K454N		Atlas-SNP	.		Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	.	PRCC	39	.	0			c.A1362C						PASS	.						85.0	92.0	90.0					1																	156767106		2203	4300	6503	SO:0001583	missense	5546	exon6			GCGGAAACACCAG	X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.1362A>C	chr1.hg19:g.156767106A>C	ENSP00000271526:p.Lys454Asn	77.0	0.0	.	1781	118.0	44.0	.	NM_005973	A8K1F7|O00665|O00724|Q5SZ06	Missense_Mutation	SNP	ENST00000271526.4	hg19	CCDS1157.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.33|18.33	3.599257|3.599257	0.66332|0.66332	.|.	.|.	ENSG00000143294|ENSG00000143294	ENST00000271526;ENST00000353233;ENST00000368201;ENST00000526188|ENST00000454659	T;T|.	0.69306|.	-0.39;-0.27|.	5.43|5.43	3.09|3.09	0.35607|0.35607	Mitotic checkpoint protein PRCC, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53546|0.53546	0.1803|0.1803	M|M	0.78456|0.78456	2.415|2.415	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.54702|0.54702	-0.8254|-0.8254	10|5	0.87932|.	D|.	0|.	-12.1328|-12.1328	7.4238|7.4238	0.27088|0.27088	0.7463:0.0:0.2537:0.0|0.7463:0.0:0.2537:0.0	.|.	422;454|.	A6NG79;Q92733|.	.;PRCC_HUMAN|.	N|T	454;422;430;161|220	ENSP00000271526:K454N;ENSP00000339300:K422N|.	ENSP00000271526:K454N|.	K|N	+|+	3|2	2|0	PRCC|PRCC	155033730|155033730	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.177000|1.177000	0.31969|0.31969	0.493000|0.493000	0.27837|0.27837	-0.261000|-0.261000	0.10672|0.10672	AAA|AAC	.	.	.	none		0.473	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098941.2	NM_005973	
SOAT1	6646	hgsc.bcm.edu	37	1	179310206	179310206	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr1:179310206T>G	ENST00000367619.3	+	7	684	c.541T>G	c.(541-543)Ttt>Gtt	p.F181V	SOAT1_ENST00000539888.1_Missense_Mutation_p.F116V|SOAT1_ENST00000540564.1_Missense_Mutation_p.F123V|SOAT1_ENST00000535686.1_De_novo_Start_InFrame	NM_003101.5	NP_003092.4	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	181					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol storage (GO:0010878)|macrophage derived foam cell differentiation (GO:0010742)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|sterol O-acyltransferase activity (GO:0004772)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|stomach(1)	20					Ezetimibe(DB00973)|Hesperetin(DB01094)	TTTTGGCAAATTTCCTACCGT	0.423																																					p.F181V		Atlas-SNP	.											.	SOAT1	53	.	0			c.T541G						PASS	.						144.0	134.0	137.0					1																	179310206		2203	4300	6503	SO:0001583	missense	6646	exon7			GGCAAATTTCCTA	L21934	CCDS1330.1, CCDS58047.1, CCDS58048.1	1q25	2008-08-26	2008-08-26		ENSG00000057252	ENSG00000057252	2.3.1.26		11177	protein-coding gene	gene with protein product	"""acyl-Coenzyme A: cholesterol acyltransferase"""	102642	"""sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1"""	SOAT, STAT		8407899	Standard	NM_003101		Approved	ACAT	uc001gml.3	P35610	OTTHUMG00000035253	ENST00000367619.3:c.541T>G	chr1.hg19:g.179310206T>G	ENSP00000356591:p.Phe181Val	57.0	0.0	.		85.0	41.0	.	NM_003101	A6NC40|A8K3P4|A9Z1V7|B4DU95|Q5T0X4|Q8N1E4	Missense_Mutation	SNP	ENST00000367619.3	hg19	CCDS1330.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527498	0.44969	.	.	ENSG00000057252	ENST00000539888;ENST00000540564;ENST00000367619;ENST00000426956	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	5.96	-2.2	0.06994	.	0.382132	0.35013	N	0.003507	T	0.19846	0.0477	M	0.61703	1.905	0.80722	D	1	B;B	0.25850	0.006;0.136	B;B	0.35312	0.026;0.2	T	0.06826	-1.0805	10	0.52906	T	0.07	-32.5711	11.9488	0.52944	0.0:0.2527:0.0:0.7473	.	123;181	A8K3P4;P35610	.;SOAT1_HUMAN	V	116;123;181;181	ENSP00000441356:F116V;ENSP00000445315:F123V;ENSP00000356591:F181V;ENSP00000411309:F181V	ENSP00000356591:F181V	F	+	1	0	SOAT1	177576829	0.994000	0.37717	0.005000	0.12908	0.977000	0.68977	0.305000	0.19254	-0.663000	0.05331	-0.290000	0.09829	TTT	.	.	.	none		0.423	SOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085286.2	NM_003101	
SMG7	9887	hgsc.bcm.edu	37	1	183495889	183495889	+	Silent	SNP	C	C	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr1:183495889C>T	ENST00000347615.2	+	5	590	c.471C>T	c.(469-471)caC>caT	p.H157H	SMG7_ENST00000507406.1_3'UTR|SMG7_ENST00000507469.1_Silent_p.H157H|SMG7_ENST00000515829.2_Silent_p.H157H|SMG7_ENST00000367537.3_Silent_p.H186H|SMG7_ENST00000456731.2_Silent_p.H115H|SMG7_ENST00000508461.1_Silent_p.H115H	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	157					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						GCCTCGTCCACCTTGGAGACA	0.443																																					p.H157H		Atlas-SNP	.											.	SMG7	165	.	0			c.C471T						PASS	.						208.0	179.0	189.0					1																	183495889		2203	4300	6503	SO:0001819	synonymous_variant	9887	exon5			CGTCCACCTTGGA	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.471C>T	chr1.hg19:g.183495889C>T		51.0	0.0	.		59.0	24.0	.	NM_201569	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Silent	SNP	ENST00000347615.2	hg19	CCDS1355.1																																																																																			.	.	.	none		0.443	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234743069	234743069	+	Silent	SNP	C	C	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr1:234743069C>G	ENST00000366609.3	-	2	1608	c.1578G>C	c.(1576-1578)tcG>tcC	p.S526S	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_Silent_p.S510S|IRF2BP2_ENST00000491430.1_5'UTR	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	526	Cys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			AGAACTTGTGCGAAGGGACGG	0.592																																					p.S526S		Atlas-SNP	.											.	IRF2BP2	37	.	0			c.G1578C						PASS	.						79.0	84.0	83.0					1																	234743069		2203	4300	6503	SO:0001819	synonymous_variant	359948	exon2			CTTGTGCGAAGGG	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1578G>C	chr1.hg19:g.234743069C>G		115.0	0.0	.		64.0	29.0	.	NM_182972	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	hg19	CCDS1602.1																																																																																			.	.	.	none		0.592	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
DESI2	51029	hgsc.bcm.edu	37	1	244849928	244849928	+	Silent	SNP	T	T	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr1:244849928T>A	ENST00000302550.11	+	2	451	c.72T>A	c.(70-72)atT>atA	p.I24I	DESI2_ENST00000263831.7_Silent_p.I24I	NM_016076.3	NP_057160.2	Q9BSY9	DESI2_HUMAN	desumoylating isopeptidase 2	24	PPPDE peptidase.					cytoplasm (GO:0005737)	peptidase activity (GO:0008233)										CCTCATCCATTGGAATTGGAG	0.358																																					p.I24I		Atlas-SNP	.											.	.	.	.	0			c.T72A						PASS	.						130.0	130.0	130.0					1																	244849928		2203	4300	6503	SO:0001819	synonymous_variant	51029	exon2			ATCCATTGGAATT	AK025651	CCDS1626.1, CCDS73055.1	1q44	2012-05-16	2012-05-16	2012-05-16	ENSG00000121644	ENSG00000121644			24264	protein-coding gene	gene with protein product		614638	"""chromosome 1 open reading frame 121"", ""family with sequence similarity 152, member A"", ""PPPDE peptidase domain containing 1"""	C1orf121, FAM152A, PPPDE1		10810093, 22370726	Standard	XM_005273154		Approved	CGI-146, FLJ21998	uc001iao.3	Q9BSY9	OTTHUMG00000040398	ENST00000302550.11:c.72T>A	chr1.hg19:g.244849928T>A		46.0	0.0	.		37.0	10.0	.	NM_016076	B1APK6|Q5VVC6|Q9NYS2|Q9Y3E4	Silent	SNP	ENST00000302550.11	hg19	CCDS1626.1																																																																																			.	.	.	none		0.358	DESI2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097168.1	NM_016076	
CAD	790	hgsc.bcm.edu	37	2	27456276	27456276	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr2:27456276C>A	ENST00000403525.1	+	19	3043	c.2899C>A	c.(2899-2901)Cag>Aag	p.Q967K	CAD_ENST00000264705.4_Missense_Mutation_p.Q1030K			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTGCATCGGCAGCAGTGCCG	0.572																																					p.Q1030K		Atlas-SNP	.											.	CAD	199	.	0			c.C3088A						PASS	.						56.0	55.0	55.0					2																	27456276		2203	4300	6503	SO:0001583	missense	790	exon20			CATCGGCAGCAGT	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2899C>A	chr2.hg19:g.27456276C>A	ENSP00000384510:p.Gln967Lys	53.0	0.0	.		88.0	4.0	.	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	hg19		.	.	.	.	.	.	.	.	.	.	C	29.1	4.976973	0.92982	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.97232	-4.3;-4.3	5.62	5.62	0.85841	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97275	0.9109	L	0.41632	1.29	0.80722	D	1	D;D	0.69078	0.968;0.997	P;P	0.62885	0.808;0.908	D	0.97473	1.0042	10	0.54805	T	0.06	-0.5919	18.5877	0.91196	0.0:1.0:0.0:0.0	.	967;1030	F8VPD4;P27708	.;PYR1_HUMAN	K	1030;967	ENSP00000264705:Q1030K;ENSP00000384510:Q967K	ENSP00000264705:Q1030K	Q	+	1	0	CAD	27309780	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.375000	0.59549	2.804000	0.96469	0.655000	0.94253	CAG	.	.	.	none		0.572	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
POLR1A	25885	hgsc.bcm.edu	37	2	86272888	86272888	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr2:86272888G>A	ENST00000263857.6	-	20	3116	c.2738C>T	c.(2737-2739)tCg>tTg	p.S913L	POLR1A_ENST00000409681.1_Missense_Mutation_p.S913L			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	913					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CAGCAGGCACGAGATCTGGAG	0.522																																					p.S913L		Atlas-SNP	.											.	POLR1A	137	.	0			c.C2738T						PASS	.						44.0	48.0	47.0					2																	86272888		1910	4133	6043	SO:0001583	missense	25885	exon20			AGGCACGAGATCT	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.2738C>T	chr2.hg19:g.86272888G>A	ENSP00000263857:p.Ser913Leu	183.0	0.0	.		337.0	96.0	.	NM_015425	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	hg19	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658584	0.88154	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.76709	-1.04;-1.04	5.95	5.95	0.96441	RNA polymerase Rpb1, domain 4 (1);	0.129604	0.53938	D	0.000043	D	0.90383	0.6990	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	D	0.91550	0.5256	10	0.87932	D	0	-16.9868	18.5659	0.91116	0.0:0.0:1.0:0.0	.	913	O95602	RPA1_HUMAN	L	913	ENSP00000263857:S913L;ENSP00000386300:S913L	ENSP00000263857:S913L	S	-	2	0	POLR1A	86126399	1.000000	0.71417	0.956000	0.39512	0.960000	0.62799	9.038000	0.93771	2.825000	0.97269	0.655000	0.94253	TCG	.	.	.	none		0.522	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
PAX8	7849	hgsc.bcm.edu	37	2	114000281	114000281	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr2:114000281G>T	ENST00000429538.3	-	5	658	c.464C>A	c.(463-465)cCc>cAc	p.P155H	AC016683.6_ENST00000556070.1_RNA|PAX8_ENST00000263334.5_Missense_Mutation_p.P155H|AC016683.6_ENST00000422956.2_RNA|PAX8_ENST00000397647.3_Missense_Mutation_p.P155H|AC016683.6_ENST00000437551.1_RNA|PAX8_ENST00000263335.7_Missense_Mutation_p.P155H|PAX8_ENST00000348715.5_Missense_Mutation_p.P155H|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000333145.5_RNA|AC016683.6_ENST00000553869.2_RNA|AC016683.6_ENST00000445745.1_RNA|RP11-65I12.1_ENST00000553319.1_RNA	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	155					anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						CGTGTGTCCGGGACTCAGGGA	0.537			T	PPARG	follicular thyroid		Thyroid dysgenesis																														p.P155H	Ovarian(188;7 2067 9084 29802 29892)	Atlas-SNP	.		Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8	42	.	0			c.C464A						PASS	.						156.0	159.0	158.0					2																	114000281		2151	4261	6412	SO:0001583	missense	7849	exon5			TGTCCGGGACTCA	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.464C>A	chr2.hg19:g.114000281G>T	ENSP00000395498:p.Pro155His	126.0	0.0	.		155.0	39.0	.	NM_013952	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	hg19	CCDS46398.1	.	.	.	.	.	.	.	.	.	.	g	25.0	4.591911	0.86953	.	.	ENSG00000125618	ENST00000263335;ENST00000397647;ENST00000348715;ENST00000429538;ENST00000263334	D;D;D;D;D	0.97959	-4.62;-4.63;-4.41;-3.99;-4.41	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.98261	0.9424	L	0.60455	1.87	0.80722	D	1	D;D;D;B;D	0.89917	1.0;0.994;1.0;0.01;0.986	D;D;D;B;P	0.85130	0.996;0.927;0.997;0.039;0.808	D	0.99094	1.0841	10	0.59425	D	0.04	.	16.774	0.85546	0.0:0.0:1.0:0.0	.	155;155;155;155;155	Q06710-2;Q06710-3;Q06710;Q06710-5;Q06710-4	.;.;PAX8_HUMAN;.;.	H	155	ENSP00000263335:P155H;ENSP00000380768:P155H;ENSP00000314750:P155H;ENSP00000395498:P155H;ENSP00000263334:P155H	ENSP00000263334:P155H	P	-	2	0	PAX8	113716751	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.038000	0.88943	2.550000	0.86006	0.552000	0.68991	CCC	.	.	.	none		0.537	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		
HOXD1	3231	hgsc.bcm.edu	37	2	177054137	177054137	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr2:177054137G>T	ENST00000331462.4	+	1	831	c.608G>T	c.(607-609)aGc>aTc	p.S203I	HOXD-AS1_ENST00000436126.1_RNA|HOXD-AS1_ENST00000417086.1_RNA|HOXD-AS1_ENST00000413969.1_RNA|HOXD-AS1_ENST00000452365.1_RNA|HOXD-AS1_ENST00000425005.1_RNA	NM_024501.2	NP_078777.1	Q9GZZ0	HXD1_HUMAN	homeobox D1	203					embryonic skeletal system development (GO:0048706)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.0226)		GCCGCCTTCAGCACGTTCGAG	0.662																																					p.S203I		Atlas-SNP	.											.	HOXD1	33	.	0			c.G608T						PASS	.						26.0	30.0	28.0					2																	177054137		2160	4210	6370	SO:0001583	missense	3231	exon1			CCTTCAGCACGTT		CCDS2271.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128645	ENSG00000128645		"""Homeoboxes / ANTP class : HOXL subclass"""	5132	protein-coding gene	gene with protein product		142987	"""homeo box D1"""	HOX4, HOX4G		1973146, 1358459	Standard	NM_024501		Approved		uc002ukv.5	Q9GZZ0	OTTHUMG00000132512	ENST00000331462.4:c.608G>T	chr2.hg19:g.177054137G>T	ENSP00000328598:p.Ser203Ile	258.0	0.0	.		152.0	91.0	.	NM_024501	B2RAB4	Missense_Mutation	SNP	ENST00000331462.4	hg19	CCDS2271.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448129	0.84101	.	.	ENSG00000128645	ENST00000331462;ENST00000375170	D	0.90844	-2.74	5.43	5.43	0.79202	.	0.000000	0.53938	D	0.000044	D	0.93628	0.7965	L	0.56769	1.78	0.41132	D	0.985896	D;D;D	0.76494	0.99;0.999;0.993	P;D;P	0.71656	0.802;0.974;0.806	D	0.92749	0.6214	10	0.36615	T	0.2	.	15.5055	0.75735	0.0:0.1387:0.8613:0.0	.	203;142;203	Q96CA4;Q8IZ25;Q9GZZ0	.;.;HXD1_HUMAN	I	203;142	ENSP00000328598:S203I	ENSP00000328598:S203I	S	+	2	0	HOXD1	176762383	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.488000	0.45276	2.532000	0.85374	0.561000	0.74099	AGC	.	.	.	none		0.662	HOXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255693.2		
CAPN7	23473	hgsc.bcm.edu	37	3	15287046	15287046	+	Silent	SNP	A	A	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr3:15287046A>G	ENST00000253693.2	+	17	2131	c.1878A>G	c.(1876-1878)ccA>ccG	p.P626P		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	626	Domain III.				positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						ACCCACCTCCATACATTGATG	0.368																																					p.P626P		Atlas-SNP	.											.	CAPN7	63	.	0			c.A1878G						PASS	.						141.0	140.0	140.0					3																	15287046		2203	4300	6503	SO:0001819	synonymous_variant	23473	exon17			ACCTCCATACATT	AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.1878A>G	chr3.hg19:g.15287046A>G		64.0	0.0	.		86.0	27.0	.	NM_014296		Silent	SNP	ENST00000253693.2	hg19	CCDS2624.1																																																																																			.	.	.	none		0.368	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252105.2	NM_014296	
UBE2K	3093	hgsc.bcm.edu	37	4	39779353	39779353	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr4:39779353G>A	ENST00000261427.5	+	6	735	c.451G>A	c.(451-453)Gtg>Atg	p.V151M	UBE2K_ENST00000295963.6_Missense_Mutation_p.V90M|UBE2K_ENST00000445950.2_Intron|UBE2K_ENST00000503368.1_Missense_Mutation_p.V100M|UBE2K_ENST00000438068.2_3'UTR	NM_001111112.1|NM_005339.4	NP_001104582.1|NP_005330.1	P61086	UBE2K_HUMAN	ubiquitin-conjugating enzyme E2K	151					intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein K48-linked ubiquitination (GO:0070936)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)			large_intestine(1)|lung(1)|ovary(2)	4						TTGGGCACATGTGTATGCTGG	0.378																																					p.V151M	NSCLC(101;689 1592 16105 29682 31745)	Atlas-SNP	.											.	UBE2K	16	.	0			c.G451A						PASS	.						106.0	110.0	108.0					4																	39779353		2203	4300	6503	SO:0001583	missense	3093	exon6			GCACATGTGTATG	U58522	CCDS33976.1, CCDS47043.1, CCDS47044.1	4p14	2011-05-19	2011-05-19	2007-12-04	ENSG00000078140	ENSG00000078140		"""Ubiquitin-conjugating enzymes E2"""	4914	protein-coding gene	gene with protein product		602846	"""huntingtin interacting protein 2"", ""ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)"""	HIP2		8702625, 17873885	Standard	NM_005339		Approved	HYPG, UBC1	uc003guu.4	P61086	OTTHUMG00000160543	ENST00000261427.5:c.451G>A	chr4.hg19:g.39779353G>A	ENSP00000261427:p.Val151Met	144.0	0.0	.		181.0	52.0	.	NM_005339	A6NJC1|A8K5Y9|B2RDF8|C9JGP1|O54806|P27924|Q16721|Q9CVV9|Q9Y2D3	Missense_Mutation	SNP	ENST00000261427.5	hg19	CCDS33976.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.246872	0.59103	.	.	ENSG00000078140	ENST00000261427;ENST00000295963;ENST00000510934;ENST00000503368	T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63	5.55	5.55	0.83447	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.85682	D	0.000000	T	0.65575	0.2704	L	0.28274	0.84	0.52501	D	0.999954	B;P;B	0.50156	0.008;0.932;0.24	B;B;P	0.45712	0.003;0.327;0.491	T	0.64262	-0.6449	10	0.33940	T	0.23	-15.8268	19.8764	0.96873	0.0:0.0:1.0:0.0	.	90;151;100	B4DIZ2;P61086;P61086-2	.;UBE2K_HUMAN;.	M	151;90;90;100	ENSP00000261427:V151M;ENSP00000295963:V90M;ENSP00000425301:V90M;ENSP00000421203:V100M	ENSP00000261427:V151M	V	+	1	0	UBE2K	39455748	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	4.143000	0.58051	2.768000	0.95171	0.655000	0.94253	GTG	.	.	.	none		0.378	UBE2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361061.1	NM_005339	
EPHA5	2044	hgsc.bcm.edu	37	4	66535302	66535302	+	Silent	SNP	G	G	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr4:66535302G>T	ENST00000273854.3	-	1	759	c.159C>A	c.(157-159)ctC>ctA	p.L53L	RP11-807H7.1_ENST00000509473.1_lincRNA|EPHA5_ENST00000511294.1_Silent_p.L53L|EPHA5_ENST00000432638.2_Silent_p.L53L|EPHA5_ENST00000354839.4_Silent_p.L53L	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	53					axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GGCTGGCCAGGAGGGTCCGGA	0.711										TSP Lung(17;0.13)																											p.L53L		Atlas-SNP	.											.	EPHA5	315	.	0			c.C159A						PASS	.						13.0	16.0	15.0					4																	66535302		2176	4272	6448	SO:0001819	synonymous_variant	2044	exon1			GGCCAGGAGGGTC	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.159C>A	chr4.hg19:g.66535302G>T		275.0	0.0	.		183.0	120.0	.	NM_004439	Q7Z3F2	Silent	SNP	ENST00000273854.3	hg19	CCDS3513.1																																																																																			.	.	.	none		0.711	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
FAT4	79633	hgsc.bcm.edu	37	4	126239708	126239708	+	Silent	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr4:126239708T>C	ENST00000394329.3	+	1	2155	c.2142T>C	c.(2140-2142)acT>acC	p.T714T		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	714	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TGTCTGCCACTGACCCAGACT	0.463																																					p.T714T		Atlas-SNP	.											.	FAT4	1752	.	0			c.T2142C						PASS	.						75.0	78.0	77.0					4																	126239708		2014	4191	6205	SO:0001819	synonymous_variant	79633	exon1			TGCCACTGACCCA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.2142T>C	chr4.hg19:g.126239708T>C		84.0	0.0	.		120.0	30.0	.	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	hg19	CCDS3732.3																																																																																			.	.	.	none		0.463	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
POU5F2	134187	hgsc.bcm.edu	37	5	93076747	93076747	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr5:93076747C>T	ENST00000510627.4	-	1	596	c.523G>A	c.(523-525)Gcc>Acc	p.A175T	FAM172A_ENST00000509739.1_Intron|FAM172A_ENST00000509163.1_Intron|FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000505869.1_Intron|RP11-185E12.2_ENST00000606528.1_RNA|POU5F2_ENST00000606183.1_5'UTR	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	175	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		CACATGTTGGCGACGCTTAGC	0.557																																					p.A175T		Atlas-SNP	.											.	POU5F2	10	.	0			c.G523A						PASS	.						85.0	87.0	86.0					5																	93076747		2162	4282	6444	SO:0001583	missense	134187	exon1			TGTTGGCGACGCT		CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.523G>A	chr5.hg19:g.93076747C>T	ENSP00000464890:p.Ala175Thr	31.0	0.0	.		44.0	26.0	.	NM_153216	Q15169|Q6MZL7|Q8N748	Missense_Mutation	SNP	ENST00000510627.4	hg19	CCDS59489.1																																																																																			.	.	.	none		0.557	POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369873.5	NM_153216	
GLRA1	2741	hgsc.bcm.edu	37	5	151231003	151231003	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr5:151231003G>A	ENST00000455880.2	-	7	1146	c.860C>T	c.(859-861)aCt>aTt	p.T287I	GLRA1_ENST00000274576.4_Missense_Mutation_p.T287I|GLRA1_ENST00000545569.1_Missense_Mutation_p.T204I|GLRA1_ENST00000471351.2_5'UTR			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	287					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GGTGAGCACAGTGGTGATGCC	0.537																																					p.T287I		Atlas-SNP	.											.	GLRA1	61	.	0			c.C860T						PASS	.						138.0	120.0	126.0					5																	151231003		2203	4300	6503	SO:0001583	missense	2741	exon7			AGCACAGTGGTGA		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.860C>T	chr5.hg19:g.151231003G>A	ENSP00000411593:p.Thr287Ile	83.0	0.0	.		155.0	39.0	.	NM_000171	B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	hg19	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960480	0.92791	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	D;D;D	0.86562	-2.14;-2.14;-2.14	5.2	5.2	0.72013	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94072	0.8100	M	0.84433	2.695	0.80722	D	1	D;D;D	0.69078	0.974;0.997;0.993	D;D;D	0.69479	0.916;0.964;0.939	D	0.94738	0.7916	10	0.87932	D	0	.	19.1084	0.93307	0.0:0.0:1.0:0.0	.	287;204;287	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	I	287;287;204	ENSP00000274576:T287I;ENSP00000411593:T287I;ENSP00000445913:T204I	ENSP00000274576:T287I	T	-	2	0	GLRA1	151211196	1.000000	0.71417	0.963000	0.40424	0.991000	0.79684	9.640000	0.98453	2.579000	0.87056	0.655000	0.94253	ACT	.	.	.	none		0.537	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1		
NEDD9	4739	hgsc.bcm.edu	37	6	11185765	11185765	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr6:11185765T>C	ENST00000379446.5	-	7	2301	c.2135A>G	c.(2134-2136)tAt>tGt	p.Y712C	NEDD9_ENST00000504387.1_Missense_Mutation_p.Y712C|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	712	Divergent helix-loop-helix motif.				actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			ACATTGGTCATAGTAGAAGCA	0.547																																					p.Y712C		Atlas-SNP	.											.	NEDD9	191	.	0			c.A2135G						PASS	.						163.0	135.0	145.0					6																	11185765		2203	4300	6503	SO:0001583	missense	4739	exon8			TGGTCATAGTAGA	L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.2135A>G	chr6.hg19:g.11185765T>C	ENSP00000368759:p.Tyr712Cys	54.0	0.0	.		56.0	25.0	.	NM_001142393	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	ENST00000379446.5	hg19	CCDS4520.1	.	.	.	.	.	.	.	.	.	.	T	17.14	3.312654	0.60414	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.21734	1.99;1.99	6.11	4.89	0.63831	CAS family, DUF3513 (1);	0.387436	0.30869	N	0.008715	T	0.11452	0.0279	N	0.08118	0	0.80722	D	1	P;D;D	0.58970	0.933;0.973;0.984	P;P;P	0.62649	0.77;0.852;0.905	T	0.06844	-1.0804	10	0.39692	T	0.17	-19.1901	7.3267	0.26560	0.1154:0.0:0.2691:0.6154	.	712;712;712	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	C	712	ENSP00000368759:Y712C;ENSP00000422871:Y712C	ENSP00000368759:Y712C	Y	-	2	0	NEDD9	11293751	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	4.547000	0.60712	2.343000	0.79666	0.533000	0.62120	TAT	.	.	.	none		0.547	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403	
SYNE1	23345	hgsc.bcm.edu	37	6	152497619	152497619	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr6:152497619G>A	ENST00000367255.5	-	130	24138	c.23537C>T	c.(23536-23538)gCc>gTc	p.A7846V	SYNE1_ENST00000356820.4_Missense_Mutation_p.A2370V|SYNE1_ENST00000341594.5_Missense_Mutation_p.A7458V|SYNE1_ENST00000265368.4_Missense_Mutation_p.A7846V|SYNE1_ENST00000423061.1_Missense_Mutation_p.A7775V|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000448038.1_Missense_Mutation_p.A7775V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7846					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCATGGCTGGCTTTAGCAAG	0.443										HNSCC(10;0.0054)																											p.A7846V		Atlas-SNP	.											.	SYNE1	3227	.	0			c.C23537T						PASS	.						291.0	276.0	281.0					6																	152497619		2203	4300	6503	SO:0001583	missense	23345	exon130			TGGCTGGCTTTAG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.23537C>T	chr6.hg19:g.152497619G>A	ENSP00000356224:p.Ala7846Val	65.0	0.0	.		82.0	29.0	.	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	35	5.446314	0.96187	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367251	T;T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.75	5.75	0.90469	.	0.000000	0.56097	D	0.000025	T	0.65344	0.2682	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.996;0.996;0.993;0.996;0.986	T	0.66118	-0.6003	10	0.62326	D	0.03	.	19.9341	0.97130	0.0:0.0:1.0:0.0	.	7846;7846;7775;7775;48	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	V	7846;492;7775;7846;7775;7458;2370;8;768	ENSP00000356224:A7846V;ENSP00000356226:A492V;ENSP00000396024:A7775V;ENSP00000265368:A7846V;ENSP00000390975:A7775V;ENSP00000341887:A7458V;ENSP00000349276:A2370V;ENSP00000356220:A768V	ENSP00000265368:A7846V	A	-	2	0	SYNE1	152539312	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	9.692000	0.98682	2.711000	0.92665	0.563000	0.77884	GCC	.	.	.	none		0.443	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
BUD31	8896	hgsc.bcm.edu	37	7	99008752	99008752	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr7:99008752G>A	ENST00000403633.2	+	3	566	c.37G>A	c.(37-39)Gat>Aat	p.D13N	snoU13_ENST00000458831.1_RNA|PDAP1_ENST00000350498.3_5'Flank|BUD31_ENST00000456893.1_Missense_Mutation_p.D13N|BUD31_ENST00000222969.5_Missense_Mutation_p.D13N			P41223	BUD31_HUMAN	BUD31 homolog (S. cerevisiae)	13					regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	4	all_cancers(62;1.76e-08)|all_epithelial(64;1.63e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			AGCACCCCCAGATGGCTGGGA	0.473																																					p.D13N		Atlas-SNP	.											.	BUD31	12	.	0			c.G37A						PASS	.						72.0	75.0	74.0					7																	99008752		2203	4300	6503	SO:0001583	missense	8896	exon3			CCCCCAGATGGCT	BC022821	CCDS5663.1	7q22.1	2012-06-07	2007-01-12	2006-03-16	ENSG00000106245	ENSG00000106245			29629	protein-coding gene	gene with protein product	"""G10 maternal transcript homolog (Xenopus laevis)"", ""functional spliceosome-associated protein 17"""	603477	"""BUD31 homolog (yeast)"""			7841202	Standard	NM_003910		Approved	YCR063W, EDG-2, EDG2, G10, fSAP17, Cwc14	uc003uqg.4	P41223	OTTHUMG00000154602	ENST00000403633.2:c.37G>A	chr7.hg19:g.99008752G>A	ENSP00000386023:p.Asp13Asn	136.0	0.0	.		148.0	90.0	.	NM_003910	A4D274|B7Z4S9|D6W5S6|Q6IB53|Q9UDV1	Missense_Mutation	SNP	ENST00000403633.2	hg19	CCDS5663.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447418	0.84101	.	.	ENSG00000106245	ENST00000403633;ENST00000222969;ENST00000456893	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.57066	0.2028	L	0.35644	1.08	0.80722	D	1	B;B	0.17038	0.02;0.002	B;B	0.18871	0.023;0.008	T	0.53940	-0.8367	9	0.59425	D	0.04	-21.7032	19.2823	0.94057	0.0:0.0:1.0:0.0	.	13;13	B7Z4S9;P41223	.;BUD31_HUMAN	N	13	.	ENSP00000222969:D13N	D	+	1	0	BUD31	98846688	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.128000	0.94424	2.550000	0.86006	0.655000	0.94253	GAT	.	.	.	none		0.473	BUD31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336275.1	NM_003910	
MBLAC1	255374	hgsc.bcm.edu	37	7	99725163	99725163	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr7:99725163C>T	ENST00000398075.2	+	2	544	c.145C>T	c.(145-147)Ccc>Tcc	p.P49S	RP11-506M12.1_ENST00000494221.1_RNA	NM_203397.1	NP_981942.1	A4D2B0	MBLC1_HUMAN	metallo-beta-lactamase domain containing 1	49							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	7						CCTGGTCCTACCCCAGACCCG	0.751																																					p.P49S		Atlas-SNP	.											.	MBLAC1	13	.	0			c.C145T						PASS	.						7.0	8.0	8.0					7																	99725163		1845	4050	5895	SO:0001583	missense	255374	exon2			GTCCTACCCCAGA	BC031288	CCDS43620.1	7q22	2014-02-12	2009-04-08		ENSG00000214309	ENSG00000214309			22180	protein-coding gene	gene with protein product							Standard	XM_005250250		Approved	MGC49416	uc003utp.3	A4D2B0	OTTHUMG00000154846	ENST00000398075.2:c.145C>T	chr7.hg19:g.99725163C>T	ENSP00000381150:p.Pro49Ser	169.0	0.0	.		94.0	31.0	.	NM_203397	Q8N5X8	Missense_Mutation	SNP	ENST00000398075.2	hg19	CCDS43620.1	.	.	.	.	.	.	.	.	.	.	C	12.04	1.818874	0.32145	.	.	ENSG00000214309	ENST00000398075;ENST00000421390	T;T	0.50001	1.19;0.76	4.23	4.23	0.50019	.	.	.	.	.	T	0.54481	0.1861	L	0.29908	0.895	0.36843	D	0.88752	D	0.89917	1.0	D	0.80764	0.994	T	0.55768	-0.8089	9	0.27785	T	0.31	.	14.4901	0.67645	0.0:1.0:0.0:0.0	.	49	A4D2B0	MBLC1_HUMAN	S	49	ENSP00000381150:P49S;ENSP00000406055:P49S	ENSP00000381150:P49S	P	+	1	0	MBLAC1	99563099	0.957000	0.32711	0.694000	0.30210	0.029000	0.11900	0.489000	0.22387	2.361000	0.80049	0.561000	0.74099	CCC	.	.	.	none		0.751	MBLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337353.1	NM_203397	
KLHDC10	23008	hgsc.bcm.edu	37	7	129760626	129760626	+	Silent	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr7:129760626T>C	ENST00000335420.5	+	4	647	c.513T>C	c.(511-513)ggT>ggC	p.G171G		NM_014997.3	NP_055812.1	Q6PID8	KLD10_HUMAN	kelch domain containing 10	171						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|liver(2)|lung(10)|prostate(1)	17						TATTTGGAGGTACGGGCATCC	0.468																																					p.G171G		Atlas-SNP	.											.	KLHDC10	36	.	0			c.T513C						PASS	.						219.0	193.0	202.0					7																	129760626		2203	4300	6503	SO:0001819	synonymous_variant	23008	exon4			TGGAGGTACGGGC		CCDS5815.1	7q32.2	2008-08-20			ENSG00000128607	ENSG00000128607			22194	protein-coding gene	gene with protein product	"""scruin like at the midline homolog (Drosophila)"""	615152					Standard	NM_014997		Approved	KIAA0265, slim	uc003vpj.2	Q6PID8	OTTHUMG00000157654	ENST00000335420.5:c.513T>C	chr7.hg19:g.129760626T>C		96.0	0.0	.		164.0	51.0	.	NM_014997	Q86Y99|Q92554	Silent	SNP	ENST00000335420.5	hg19	CCDS5815.1																																																																																			.	.	.	none		0.468	KLHDC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349347.2		
ESYT2	57488	hgsc.bcm.edu	37	7	158528197	158528197	+	Silent	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr7:158528197G>A	ENST00000251527.5	-	20	2648	c.2583C>T	c.(2581-2583)ggC>ggT	p.G861G	ESYT2_ENST00000435514.2_Silent_p.G296G	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	889	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						CACTTACTTTGCCAAGGAGCC	0.468																																					p.G861G		Atlas-SNP	.											.	ESYT2	70	.	0			c.C2583T						PASS	.						153.0	158.0	156.0					7																	158528197		2203	4300	6503	SO:0001819	synonymous_variant	57488	exon20			TACTTTGCCAAGG	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.2583C>T	chr7.hg19:g.158528197G>A		69.0	0.0	.		50.0	10.0	.	NM_020728	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Silent	SNP	ENST00000251527.5	hg19	CCDS34791.1																																																																																			.	.	.	none		0.468	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728	
RB1CC1	9821	hgsc.bcm.edu	37	8	53596456	53596456	+	Silent	SNP	A	A	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr8:53596456A>G	ENST00000025008.5	-	4	712	c.189T>C	c.(187-189)agT>agC	p.S63S	RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000435644.2_Silent_p.S63S|RB1CC1_ENST00000539297.1_Silent_p.S63S	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	63					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CCGTCCCAGCACTGTAGGTAC	0.428																																					p.S63S	GBM(180;1701 2102 13475 42023 52570)	Atlas-SNP	.											.	RB1CC1	163	.	0			c.T189C						PASS	.						124.0	100.0	108.0					8																	53596456		2203	4300	6503	SO:0001819	synonymous_variant	9821	exon4			CCCAGCACTGTAG	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.189T>C	chr8.hg19:g.53596456A>G		47.0	0.0	.		61.0	17.0	.	NM_001083617	Q86YR4|Q8WVU9|Q92601	Silent	SNP	ENST00000025008.5	hg19	CCDS34892.1																																																																																			.	.	.	none		0.428	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
TLN1	7094	hgsc.bcm.edu	37	9	35714845	35714845	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr9:35714845G>T	ENST00000314888.9	-	22	3136	c.2783C>A	c.(2782-2784)gCc>gAc	p.A928D	TLN1_ENST00000540444.1_Missense_Mutation_p.A928D	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	928					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGTCTGTGTGGCTGAGGCTGC	0.627																																					p.A928D		Atlas-SNP	.											.	TLN1	185	.	0			c.C2783A						PASS	.						43.0	48.0	47.0					9																	35714845		2202	4299	6501	SO:0001583	missense	7094	exon22			TGTGTGGCTGAGG	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.2783C>A	chr9.hg19:g.35714845G>T	ENSP00000316029:p.Ala928Asp	29.0	0.0	.		21.0	6.0	.	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	G	31	5.060455	0.93846	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.76186	-1.0;-0.99	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.87645	0.6229	M	0.83223	2.63	0.80722	D	1	D	0.71674	0.998	D	0.71414	0.973	D	0.88934	0.3375	10	0.87932	D	0	-11.6429	19.5343	0.95242	0.0:0.0:1.0:0.0	.	928	Q9Y490	TLN1_HUMAN	D	928	ENSP00000316029:A928D;ENSP00000442981:A928D	ENSP00000316029:A928D	A	-	2	0	TLN1	35704845	1.000000	0.71417	0.911000	0.35937	0.993000	0.82548	9.753000	0.98904	2.601000	0.87937	0.655000	0.94253	GCC	.	.	.	none		0.627	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
ANKS6	203286	hgsc.bcm.edu	37	9	101546386	101546386	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr9:101546386A>C	ENST00000353234.4	-	4	1008	c.961T>G	c.(961-963)Ttg>Gtg	p.L321V	ANKS6_ENST00000375018.1_Missense_Mutation_p.L321V|ANKS6_ENST00000540940.1_Missense_Mutation_p.L126V|ANKS6_ENST00000375019.2_Missense_Mutation_p.L20V			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	321						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				CCATTGACCAAGTTCACGTGG	0.587																																					p.L321V		Atlas-SNP	.											.	ANKS6	59	.	0			c.T961G						PASS	.						68.0	72.0	71.0					9																	101546386		2118	4226	6344	SO:0001583	missense	203286	exon4			TGACCAAGTTCAC	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.961T>G	chr9.hg19:g.101546386A>C	ENSP00000297837:p.Leu321Val	49.0	0.0	.		27.0	6.0	.	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	hg19	CCDS43856.1	.	.	.	.	.	.	.	.	.	.	A	9.120	1.008825	0.19199	.	.	ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940	T;T;T;T	0.53423	1.37;1.37;1.37;0.62	5.52	2.4	0.29515	Ankyrin repeat-containing domain (4);	0.526064	0.21137	N	0.079547	T	0.21841	0.0526	N	0.13299	0.325	0.30021	N	0.814303	B	0.13145	0.007	B	0.17433	0.018	T	0.11131	-1.0600	10	0.14252	T	0.57	-2.3181	0.9732	0.01420	0.2075:0.1252:0.3954:0.2718	.	321	Q68DC2	ANKS6_HUMAN	V	20;321;321;126	ENSP00000364159:L20V;ENSP00000364158:L321V;ENSP00000297837:L321V;ENSP00000442189:L126V	ENSP00000297837:L321V	L	-	1	2	ANKS6	100586207	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	1.386000	0.34419	0.281000	0.22233	-0.248000	0.11899	TTG	.	.	.	none		0.587	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
FAM102A	399665	hgsc.bcm.edu	37	9	130742371	130742371	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr9:130742371A>C	ENST00000373095.1	-	1	421	c.46T>G	c.(46-48)Ttc>Gtc	p.F16V		NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	16										breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						TCCAGGGTGAAAGTAGTTTGG	0.527																																					p.F16V		Atlas-SNP	.											.	FAM102A	32	.	0			c.T46G						PASS	.						118.0	133.0	128.0					9																	130742371		2203	4300	6503	SO:0001583	missense	399665	exon1			GGGTGAAAGTAGT		CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.46T>G	chr9.hg19:g.130742371A>C	ENSP00000362187:p.Phe16Val	183.0	0.0	.		93.0	30.0	.	NM_001035254	A2A329|Q8TEL4	Missense_Mutation	SNP	ENST00000373095.1	hg19	CCDS35150.1	.	.	.	.	.	.	.	.	.	.	A	13.06	2.125094	0.37533	.	.	ENSG00000167106	ENST00000373095	T	0.35789	1.29	4.87	4.87	0.63330	.	0.300781	0.36374	N	0.002623	T	0.24509	0.0594	N	0.20807	0.61	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.04870	-1.0921	10	0.25106	T	0.35	-14.1942	13.6554	0.62336	1.0:0.0:0.0:0.0	.	16	Q5T9C2	F102A_HUMAN	V	16	ENSP00000362187:F16V	ENSP00000362187:F16V	F	-	1	0	FAM102A	129782192	1.000000	0.71417	0.978000	0.43139	0.992000	0.81027	3.399000	0.52586	1.821000	0.53095	0.379000	0.24179	TTC	.	.	.	none		0.527	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054298.2		
STKLD1	169436	hgsc.bcm.edu	37	9	136253234	136253234	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr9:136253234T>G	ENST00000371957.3	+	5	405	c.298T>G	c.(298-300)Tct>Gct	p.S100A	C9orf96_ENST00000426926.2_Missense_Mutation_p.S100A|C9orf96_ENST00000371955.1_5'UTR	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		100	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCAGCAGATCTCTTCTCTGTA	0.562																																					p.S100A		Atlas-SNP	.											.	C9orf96	77	.	0			c.T298G						PASS	.						88.0	73.0	78.0					9																	136253234		2203	4300	6503	SO:0001583	missense	169436	exon5			CAGATCTCTTCTC																												ENST00000371957.3:c.298T>G	chr9.hg19:g.136253234T>G	ENSP00000361025:p.Ser100Ala	109.0	0.0	.		68.0	30.0	.	NM_153710	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	ENST00000371957.3	hg19	CCDS35169.1	.	.	.	.	.	.	.	.	.	.	T	10.80	1.451340	0.26074	.	.	ENSG00000198870	ENST00000426926;ENST00000371957	T;T	0.20463	2.07;2.07	4.12	2.93	0.34026	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.113616	0.39341	N	0.001387	T	0.19927	0.0479	L	0.60455	1.87	0.80722	D	1	B	0.18968	0.032	B	0.19391	0.025	T	0.04495	-1.0947	10	0.59425	D	0.04	-19.6937	6.8088	0.23792	0.2081:0.0:0.0:0.7919	.	100	Q8NE28	SGK71_HUMAN	A	100	ENSP00000398807:S100A;ENSP00000361025:S100A	ENSP00000361025:S100A	S	+	1	0	C9orf96	135243055	1.000000	0.71417	0.994000	0.49952	0.495000	0.33615	2.499000	0.45372	0.537000	0.28751	0.459000	0.35465	TCT	.	.	.	none		0.562	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1		
ARID5B	84159	hgsc.bcm.edu	37	10	63829547	63829547	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr10:63829547A>G	ENST00000279873.7	+	8	1600	c.1190A>G	c.(1189-1191)cAt>cGt	p.H397R	ARID5B_ENST00000309334.5_Missense_Mutation_p.H154R	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	397	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					ACCCGCAGACATTATGAAAGG	0.418																																					p.H397R		Atlas-SNP	.											.	ARID5B	125	.	0			c.A1190G						PASS	.						47.0	47.0	47.0					10																	63829547		2203	4300	6503	SO:0001583	missense	84159	exon8			GCAGACATTATGA	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.1190A>G	chr10.hg19:g.63829547A>G	ENSP00000279873:p.His397Arg	53.0	0.0	.		100.0	53.0	.	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	hg19	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.710719	0.89112	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.64085	-0.08;-0.08	6.1	6.1	0.99115	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.85682	D	0.000000	T	0.81365	0.4807	M	0.83312	2.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.83956	0.0319	10	0.87932	D	0	-17.5963	16.686	0.85306	1.0:0.0:0.0:0.0	.	154;397	Q14865-2;Q14865	.;ARI5B_HUMAN	R	397;154	ENSP00000279873:H397R;ENSP00000308862:H154R	ENSP00000279873:H397R	H	+	2	0	ARID5B	63499553	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.791000	0.91849	2.340000	0.79590	0.528000	0.53228	CAT	.	.	.	none		0.418	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
DPYSL4	10570	hgsc.bcm.edu	37	10	134011925	134011925	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr10:134011925A>T	ENST00000338492.4	+	7	792	c.628A>T	c.(628-630)Aag>Tag	p.K210*	DPYSL4_ENST00000368629.1_Intron|DPYSL4_ENST00000368627.1_Intron	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	210					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		TTAGGAGCAGAAGCGGTTGCT	0.632																																					p.K210X		Atlas-SNP	.											.	DPYSL4	91	.	0			c.A628T						PASS	.						54.0	48.0	50.0					10																	134011925		2191	4296	6487	SO:0001587	stop_gained	10570	exon7			GAGCAGAAGCGGT	AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.628A>T	chr10.hg19:g.134011925A>T	ENSP00000339850:p.Lys210*	63.0	0.0	.		41.0	25.0	.	NM_006426	B2RMQ1|D3DRG5|O00240|Q5T0Q7	Nonsense_Mutation	SNP	ENST00000338492.4	hg19	CCDS7665.1	.	.	.	.	.	.	.	.	.	.	A	37	6.019877	0.97205	.	.	ENSG00000151640	ENST00000338492	.	.	.	3.7	3.7	0.42460	.	0.166643	0.51477	D	0.000090	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4525	12.9144	0.58197	1.0:0.0:0.0:0.0	.	.	.	.	X	210	.	ENSP00000339850:K210X	K	+	1	0	DPYSL4	133861915	0.974000	0.33945	0.998000	0.56505	0.612000	0.37316	2.815000	0.48018	1.704000	0.51252	0.454000	0.30748	AAG	.	.	.	none		0.632	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2		
FRG2B	441581	hgsc.bcm.edu	37	10	135438923	135438923	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr10:135438923T>C	ENST00000425520.1	-	4	569	c.517A>G	c.(517-519)Aaa>Gaa	p.K173E	FRG2B_ENST00000443774.1_Missense_Mutation_p.K174E	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	173						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ACCAAGCTTTTTCGAATTGAC	0.562																																					p.K173E		Atlas-SNP	.											.	FRG2B	47	.	0			c.A517G						PASS	.						123.0	147.0	139.0					10																	135438923		2190	4294	6484	SO:0001583	missense	441581	exon4			AGCTTTTTCGAAT	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.517A>G	chr10.hg19:g.135438923T>C	ENSP00000401310:p.Lys173Glu	303.0	0.0	.		293.0	127.0	.	NM_001080998	Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	hg19	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	12.42	1.931878	0.34096	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.64260	-0.09;-0.09	.	.	.	.	0.384192	0.19253	N	0.118862	T	0.62998	0.2474	L	0.34521	1.04	0.09310	N	1	D	0.56035	0.974	D	0.67725	0.953	T	0.53436	-0.8439	8	0.87932	D	0	-16.2917	.	.	.	.	173	Q96QU4	FRG2B_HUMAN	E	174;173	ENSP00000408343:K174E;ENSP00000401310:K173E	ENSP00000401310:K173E	K	-	1	0	FRG2B	135288913	0.016000	0.18221	0.226000	0.23910	0.228000	0.25075	0.264000	0.18497	0.103000	0.17682	0.102000	0.15555	AAA	.	.	.	none		0.562	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
KCNQ1	3784	hgsc.bcm.edu	37	11	2608884	2608884	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr11:2608884C>G	ENST00000155840.5	+	9	1321	c.1213C>G	c.(1213-1215)Ctg>Gtg	p.L405V	KCNQ1_ENST00000335475.5_Missense_Mutation_p.L278V	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	405					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	GAGCCACACTCTGCTGTCACC	0.652																																					p.L405V		Atlas-SNP	.											.	KCNQ1	60	.	0			c.C1213G						PASS	.						76.0	81.0	79.0					11																	2608884		2202	4299	6501	SO:0001583	missense	3784	exon9			CACACTCTGCTGT	AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1213C>G	chr11.hg19:g.2608884C>G	ENSP00000155840:p.Leu405Val	122.0	0.0	.		65.0	23.0	.	NM_000218	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Missense_Mutation	SNP	ENST00000155840.5	hg19	CCDS7736.1	.	.	.	.	.	.	.	.	.	.	C	0.313	-0.966773	0.02232	.	.	ENSG00000053918	ENST00000155840;ENST00000335475	D;D	0.99239	-5.61;-5.51	4.86	2.9	0.33743	.	0.361282	0.26983	N	0.021502	D	0.96519	0.8864	L	0.35854	1.095	0.24869	N	0.992293	B;B;B	0.18610	0.003;0.002;0.029	B;B;B	0.13407	0.009;0.004;0.009	D	0.91555	0.5260	10	0.30078	T	0.28	-13.9224	4.0468	0.09776	0.1633:0.5886:0.1585:0.0896	.	278;278;405	P51787-2;Q14D14;P51787	.;.;KCNQ1_HUMAN	V	405;278	ENSP00000155840:L405V;ENSP00000334497:L278V	ENSP00000155840:L405V	L	+	1	2	KCNQ1	2565460	0.048000	0.20356	0.242000	0.24170	0.042000	0.13812	0.264000	0.18497	0.519000	0.28406	0.650000	0.86243	CTG	.	.	.	none		0.652	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218	
OR4A5	81318	hgsc.bcm.edu	37	11	51411524	51411524	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr11:51411524A>C	ENST00000319760.6	-	1	924	c.872T>G	c.(871-873)aTg>aGg	p.M291R		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	291						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AGCATTTCTCATCTCTGAATT	0.353																																					p.M291R		Atlas-SNP	.											.	OR4A5	116	.	0			c.T872G						PASS	.						30.0	32.0	31.0					11																	51411524		2201	4294	6495	SO:0001583	missense	81318	exon1			TTTCTCATCTCTG	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.872T>G	chr11.hg19:g.51411524A>C	ENSP00000367664:p.Met291Arg	39.0	0.0	.		104.0	45.0	.	NM_001005272	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	hg19	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	11.66	1.703620	0.30232	.	.	ENSG00000221840	ENST00000319760	T	0.37584	1.19	2.2	2.2	0.27929	.	0.425474	0.20570	N	0.089751	T	0.40372	0.1114	L	0.38175	1.15	0.26994	N	0.965077	D	0.54964	0.969	P	0.58780	0.845	T	0.11446	-1.0587	10	0.87932	D	0	.	8.3006	0.32012	1.0:0.0:0.0:0.0	.	291	Q8NH83	OR4A5_HUMAN	R	291	ENSP00000367664:M291R	ENSP00000367664:M291R	M	-	2	0	OR4A5	51268100	0.141000	0.22595	0.071000	0.20095	0.246000	0.25737	3.336000	0.52113	1.270000	0.44297	0.136000	0.15936	ATG	.	.	.	none		0.353	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
PCNXL3	399909	hgsc.bcm.edu	37	11	65395000	65395000	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr11:65395000C>G	ENST00000355703.3	+	22	4188	c.3649C>G	c.(3649-3651)Ctc>Gtc	p.L1217V		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1217						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CTACCCGCGCCTCTCCCAGGG	0.612																																					p.L1217V		Atlas-SNP	.											.	PCNXL3	140	.	0			c.C3649G						PASS	.						175.0	174.0	175.0					11																	65395000		2052	4183	6235	SO:0001583	missense	399909	exon22			CCGCGCCTCTCCC	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.3649C>G	chr11.hg19:g.65395000C>G	ENSP00000347931:p.Leu1217Val	72.0	0.0	.		25.0	10.0	.	NM_032223	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	hg19	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586169	0.46110	.	.	ENSG00000197136	ENST00000355703	T	0.07327	3.2	5.47	5.47	0.80525	.	0.063724	0.64402	D	0.000005	T	0.08223	0.0205	L	0.34521	1.04	0.29366	N	0.86432	B;B	0.31705	0.336;0.3	B;B	0.35550	0.205;0.066	T	0.15694	-1.0428	10	0.25106	T	0.35	.	12.2064	0.54355	0.1703:0.8297:0.0:0.0	.	104;1217	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	V	1217	ENSP00000347931:L1217V	ENSP00000347931:L1217V	L	+	1	0	PCNXL3	65151576	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.969000	0.63735	2.735000	0.93741	0.655000	0.94253	CTC	.	.	.	none		0.612	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
KIAA1377	57562	hgsc.bcm.edu	37	11	101829047	101829047	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr11:101829047C>G	ENST00000263468.8	+	5	925	c.655C>G	c.(655-657)Ctg>Gtg	p.L219V	KIAA1377_ENST00000537689.1_Missense_Mutation_p.L20V	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	219										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		CCAGCTTAAACTGGAGGAAAC	0.333																																					p.L219V		Atlas-SNP	.											.	KIAA1377	111	.	0			c.C655G						PASS	.						124.0	133.0	130.0					11																	101829047		2203	4299	6502	SO:0001583	missense	57562	exon5			CTTAAACTGGAGG	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.655C>G	chr11.hg19:g.101829047C>G	ENSP00000263468:p.Leu219Val	68.0	0.0	.		102.0	32.0	.	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	hg19	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.935593	0.52866	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.18338	2.22;2.22	5.68	3.82	0.43975	.	0.000000	0.47455	D	0.000228	T	0.39517	0.1081	M	0.76002	2.32	0.29116	N	0.880558	D	0.89917	1.0	D	0.91635	0.999	T	0.30621	-0.9972	10	0.56958	D	0.05	-4.4834	11.0161	0.47689	0.0:0.8476:0.0:0.1524	.	219	Q9P2H0	K1377_HUMAN	V	219;20	ENSP00000263468:L219V;ENSP00000443184:L20V	ENSP00000263468:L219V	L	+	1	2	KIAA1377	101334257	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.310000	0.51911	0.753000	0.32945	0.650000	0.86243	CTG	.	.	.	none		0.333	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
VWF	7450	hgsc.bcm.edu	37	12	6103203	6103203	+	Silent	SNP	G	G	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr12:6103203G>T	ENST00000261405.5	-	37	6677	c.6423C>A	c.(6421-6423)gtC>gtA	p.V2141V		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2141	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GTAAGAGGAGGACCTGGCAGT	0.582																																					p.V2141V		Atlas-SNP	.											.	VWF	338	.	0			c.C6423A						PASS	.						89.0	78.0	82.0					12																	6103203		2203	4300	6503	SO:0001819	synonymous_variant	7450	exon37			GAGGAGGACCTGG		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.6423C>A	chr12.hg19:g.6103203G>T		62.0	0.0	.		141.0	40.0	.	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	hg19	CCDS8539.1																																																																																			.	.	.	none		0.582	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
KLHL42	57542	hgsc.bcm.edu	37	12	27950834	27950834	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr12:27950834T>A	ENST00000381271.2	+	3	1564	c.1253T>A	c.(1252-1254)gTg>gAg	p.V418E	RP11-860B13.3_ENST00000543527.1_RNA	NM_020782.1	NP_065833.1	Q9P2K6	KLH42_HUMAN	kelch-like family member 42	418					mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of microtubule-based process (GO:0032886)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											ATGCTCACCGTGCAGTCCTAC	0.587																																					p.V418E		Atlas-SNP	.											.	.	.	.	0			c.T1253A						PASS	.						121.0	84.0	97.0					12																	27950834		2203	4300	6503	SO:0001583	missense	57542	exon3			TCACCGTGCAGTC	AB037761	CCDS31763.1	12p11.22	2013-04-24	2013-02-22	2013-01-30	ENSG00000087448	ENSG00000087448		"""Kelch-like"""	29252	protein-coding gene	gene with protein product			"""kelch domain containing 5"""	KLHDC5		19261606	Standard	NM_020782		Approved	KIAA1340, Ctb9	uc001rij.3	Q9P2K6	OTTHUMG00000169217	ENST00000381271.2:c.1253T>A	chr12.hg19:g.27950834T>A	ENSP00000370671:p.Val418Glu	91.0	0.0	.		264.0	86.0	.	NM_020782	Q2VPK1|Q8N334	Missense_Mutation	SNP	ENST00000381271.2	hg19	CCDS31763.1	.	.	.	.	.	.	.	.	.	.	T	31	5.074624	0.94000	.	.	ENSG00000087448	ENST00000381271	T	0.70749	-0.51	5.56	5.56	0.83823	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.82001	0.4942	M	0.65975	2.015	0.54753	D	0.999987	D	0.89917	1.0	D	0.69307	0.963	D	0.84164	0.0430	10	0.87932	D	0	.	14.9054	0.70715	0.0:0.0:0.0:1.0	.	418	Q9P2K6	KLDC5_HUMAN	E	418	ENSP00000370671:V418E	ENSP00000370671:V418E	V	+	2	0	KLHDC5	27842101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.474000	0.81024	2.109000	0.64355	0.533000	0.62120	GTG	.	.	.	none		0.587	KLHL42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402904.1	NM_020782	
SMAGP	57228	hgsc.bcm.edu	37	12	51639787	51639787	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr12:51639787C>T	ENST00000603798.1	-	4	904	c.232G>A	c.(232-234)Gcc>Acc	p.A78T	DAZAP2_ENST00000425012.2_Intron|DAZAP2_ENST00000604900.1_Intron|SMAGP_ENST00000603864.1_Missense_Mutation_p.A78T|SMAGP_ENST00000398453.3_Missense_Mutation_p.A78T|SMAGP_ENST00000605627.1_Missense_Mutation_p.A64T	NM_001031628.1	NP_001026798.1	Q0VAQ4	SMAGP_HUMAN	small cell adhesion glycoprotein	78						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)											TGGACGATGGCACTGGGCTCA	0.507																																					p.A78T		Atlas-SNP	.											.	SMAGP	7	.	0			c.G232A						PASS	.						140.0	133.0	135.0					12																	51639787		2012	4176	6188	SO:0001583	missense	57228	exon4			CGATGGCACTGGG		CCDS44889.1	12q13.13	2010-02-17			ENSG00000170545	ENSG00000170545			26918	protein-coding gene	gene with protein product	"""small trans-membrane and glycosylated protein"""					15021913	Standard	NM_001031628		Approved	MGC149453, MGC149454, hSMAGP	uc001rye.1	Q0VAQ4		ENST00000603798.1:c.232G>A	chr12.hg19:g.51639787C>T	ENSP00000475068:p.Ala78Thr	82.0	0.0	.		198.0	113.0	.	NM_001031628	A6NIL5	Missense_Mutation	SNP	ENST00000603798.1	hg19	CCDS44889.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937529	0.52972	.	.	ENSG00000170545	ENST00000380103;ENST00000398453	T	0.79033	-1.23	5.28	3.33	0.38152	.	0.384184	0.18291	U	0.145714	T	0.68559	0.3014	.	.	.	0.80722	D	1	B	0.12630	0.006	B	0.15052	0.012	T	0.63686	-0.6581	9	0.66056	D	0.02	2.7494	8.1908	0.31368	0.0:0.7302:0.0:0.2698	.	78	Q0VAQ4	SMAGP_HUMAN	T	78	ENSP00000381471:A78T	ENSP00000369446:A78T	A	-	1	0	SMAGP	49926054	0.000000	0.05858	1.000000	0.80357	0.993000	0.82548	-0.024000	0.12435	0.630000	0.30394	0.655000	0.94253	GCC	.	.	.	none		0.507	SMAGP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469789.1	NM_020467	
CUX2	23316	hgsc.bcm.edu	37	12	111729279	111729279	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr12:111729279G>A	ENST00000261726.6	+	5	513	c.359G>A	c.(358-360)aGc>aAc	p.S120N		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	120					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CAGCCCCCCAGCTTTGACCCC	0.622																																					p.S120N		Atlas-SNP	.											.	CUX2	145	.	0			c.G359A						PASS	.						48.0	55.0	53.0					12																	111729279		1950	4145	6095	SO:0001583	missense	23316	exon5			CCCCCAGCTTTGA	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.359G>A	chr12.hg19:g.111729279G>A	ENSP00000261726:p.Ser120Asn	100.0	0.0	.		133.0	20.0	.	NM_015267	A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	hg19	CCDS41837.1	.	.	.	.	.	.	.	.	.	.	g	16.86	3.238901	0.58995	.	.	ENSG00000111249	ENST00000261726;ENST00000397643;ENST00000552889	T	0.47869	0.83	4.7	3.8	0.43715	.	0.460095	0.27143	N	0.020730	T	0.32526	0.0832	L	0.29908	0.895	0.30049	N	0.81191	B;B	0.30281	0.275;0.139	B;B	0.28232	0.087;0.04	T	0.19289	-1.0310	10	0.18276	T	0.48	-16.1008	12.2036	0.54340	0.0831:0.0:0.9169:0.0	.	180;120	F5GWR6;O14529	.;CUX2_HUMAN	N	120;180;58	ENSP00000261726:S120N	ENSP00000261726:S120N	S	+	2	0	CUX2	110213662	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.435000	0.66532	2.161000	0.67846	0.556000	0.70494	AGC	.	.	.	none		0.622	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
MSI1	4440	hgsc.bcm.edu	37	12	120795647	120795647	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr12:120795647A>T	ENST00000257552.2	-	8	594	c.506T>A	c.(505-507)aTt>aAt	p.I169N	MSI1_ENST00000546622.1_5'UTR	NM_002442.3	NP_002433.1	O43347	MSI1H_HUMAN	musashi RNA-binding protein 1	169	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				epithelial cell differentiation (GO:0030855)|nervous system development (GO:0007399)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(4)|central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATGAAAATGAATTTCACACAC	0.498																																					p.I169N		Atlas-SNP	.											.	MSI1	40	.	0			c.T506A						PASS	.						132.0	100.0	111.0					12																	120795647		2203	4300	6503	SO:0001583	missense	4440	exon8			AAATGAATTTCAC	AB012851	CCDS9196.1	12q24	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	7330	protein-coding gene	gene with protein product		603328	"""Musashi (Drosophila) homolog 1"", ""musashi homolog 1 (Drosophila)"""			9790759	Standard	NM_002442		Approved		uc001tye.2	O43347	OTTHUMG00000169344	ENST00000257552.2:c.506T>A	chr12.hg19:g.120795647A>T	ENSP00000257552:p.Ile169Asn	125.0	0.0	.		143.0	29.0	.	NM_002442	Q96PU0|Q96PU1|Q96PU2|Q96PU3	Missense_Mutation	SNP	ENST00000257552.2	hg19	CCDS9196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.6|21.6	4.172958|4.172958	0.78452|0.78452	.|.	.|.	ENSG00000135097|ENSG00000135097	ENST00000546985|ENST00000257552	.|T	.|0.74526	.|-0.85	4.83|4.83	4.83|4.83	0.62350|0.62350	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.092070	.|0.45867	.|D	.|0.000324	T|T	0.73992|0.73992	0.3658|0.3658	N|N	0.11023|0.11023	0.085|0.085	0.80722|0.80722	D|D	1|1	.|D	.|0.63046	.|0.992	.|D	.|0.75020	.|0.985	T|T	0.79995|0.79995	-0.1568|-0.1568	5|10	.|0.72032	.|D	.|0.01	.|.	14.7048|14.7048	0.69183|0.69183	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|169	.|O43347	.|MSI1H_HUMAN	I|N	101|169	.|ENSP00000257552:I169N	.|ENSP00000257552:I169N	F|I	-|-	1|2	0|0	MSI1|MSI1	119280030|119280030	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	8.830000|8.830000	0.92063|0.92063	1.942000|1.942000	0.56320|0.56320	0.454000|0.454000	0.30748|0.30748	TTC|ATT	.	.	.	none		0.498	MSI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403629.1	NM_002442	
PAN3	255967	hgsc.bcm.edu	37	13	28794514	28794514	+	Splice_Site	SNP	A	A	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr13:28794514A>G	ENST00000380958.3	+	6	1151	c.999A>G	c.(997-999)ccA>ccG	p.P333P	PAN3_ENST00000399613.1_Splice_Site_p.P133P	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		GATTAGCGCCAGGTAAGTTGA	0.423																																					p.P333P		Atlas-SNP	.											.	PAN3	123	.	0			c.A999G						PASS	.						153.0	156.0	155.0					13																	28794514		2203	4300	6503	SO:0001630	splice_region_variant	255967	exon6			AGCGCCAGGTAAG	AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.1000+1A>G	chr13.hg19:g.28794514A>G		38.0	0.0	.		55.0	24.0	.	NM_175854		Silent	SNP	ENST00000380958.3	hg19	CCDS9329.2																																																																																			.	.	.	none		0.423	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854	Silent
FRY	10129	hgsc.bcm.edu	37	13	32808840	32808840	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr13:32808840T>C	ENST00000380250.3	+	42	6153	c.5657T>C	c.(5656-5658)tTa>tCa	p.L1886S		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1886						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GCACATGCCTTATCTGACCTT	0.517																																					p.L1886S		Atlas-SNP	.											.	FRY	312	.	0			c.T5657C						PASS	.						100.0	97.0	98.0					13																	32808840		1988	4170	6158	SO:0001583	missense	10129	exon42			ATGCCTTATCTGA	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.5657T>C	chr13.hg19:g.32808840T>C	ENSP00000369600:p.Leu1886Ser	71.0	0.0	.		104.0	14.0	.	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	hg19	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.899503	0.91962	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.41758	0.99	6.07	6.07	0.98685	.	0.072441	0.56097	D	0.000028	T	0.60170	0.2248	M	0.81112	2.525	0.80722	D	1	P	0.46512	0.879	P	0.51550	0.673	T	0.65500	-0.6153	10	0.87932	D	0	.	16.6277	0.84984	0.0:0.0:0.0:1.0	.	1886	Q5TBA9	FRY_HUMAN	S	1886;723	ENSP00000369600:L1886S	ENSP00000369600:L1886S	L	+	2	0	FRY	31706840	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.841000	0.86834	2.330000	0.79161	0.528000	0.53228	TTA	.	.	.	none		0.517	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
SAV1	60485	hgsc.bcm.edu	37	14	51111608	51111608	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr14:51111608A>T	ENST00000324679.4	-	3	1023	c.660T>A	c.(658-660)caT>caA	p.H220Q		NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	220	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					TATTTGTGTTATGATCTATAT	0.433																																					p.H220Q		Atlas-SNP	.											.	SAV1	18	.	0			c.T660A						PASS	.						119.0	110.0	113.0					14																	51111608		2203	4300	6503	SO:0001583	missense	60485	exon3			TGTGTTATGATCT	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.660T>A	chr14.hg19:g.51111608A>T	ENSP00000324729:p.His220Gln	46.0	0.0	.		58.0	27.0	.	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Missense_Mutation	SNP	ENST00000324679.4	hg19	CCDS9701.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.162805	0.78226	.	.	ENSG00000151748	ENST00000555720;ENST00000324679;ENST00000535862	D;D	0.84442	-1.85;-1.85	6.17	2.69	0.31865	WW/Rsp5/WWP (5);	0.000000	0.85682	D	0.000000	D	0.91971	0.7457	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90365	0.4376	10	0.87932	D	0	-19.637	8.5304	0.33331	0.5208:0.0:0.4792:0.0	.	220	Q9H4B6	SAV1_HUMAN	Q	152;220;187	ENSP00000451492:H152Q;ENSP00000324729:H220Q	ENSP00000324729:H220Q	H	-	3	2	SAV1	50181358	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.498000	0.35660	0.241000	0.21283	0.533000	0.62120	CAT	.	.	.	none		0.433	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
ARHGAP11A	9824	hgsc.bcm.edu	37	15	32928491	32928491	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr15:32928491T>C	ENST00000361627.3	+	12	2239	c.1517T>C	c.(1516-1518)tTa>tCa	p.L506S	ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.L317S|ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.L317S	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	506					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GAGGAAACCTTACTAACTCCA	0.363																																					p.L506S	Colon(45;757 1134 30003 36652)	Atlas-SNP	.											.	ARHGAP11A	84	.	0			c.T1517C						PASS	.						54.0	56.0	55.0					15																	32928491		2201	4300	6501	SO:0001583	missense	9824	exon12			AAACCTTACTAAC	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.1517T>C	chr15.hg19:g.32928491T>C	ENSP00000355090:p.Leu506Ser	88.0	0.0	.		90.0	33.0	.	NM_014783	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	hg19	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	18.14	3.557614	0.65425	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.23348	1.91	5.86	4.75	0.60458	.	0.316141	0.22955	N	0.053611	T	0.49098	0.1537	M	0.74881	2.28	0.46028	D	0.998824	D	0.89917	1.0	D	0.81914	0.995	T	0.51655	-0.8678	10	0.87932	D	0	.	11.3555	0.49613	0.0:0.0705:0.0:0.9295	.	506	Q6P4F7	RHGBA_HUMAN	S	506;317	ENSP00000355090:L506S	ENSP00000355090:L506S	L	+	2	0	ARHGAP11A	30715783	1.000000	0.71417	0.956000	0.39512	0.776000	0.43924	5.480000	0.66820	2.226000	0.72624	0.528000	0.53228	TTA	.	.	.	none		0.363	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	
TP53BP1	7158	hgsc.bcm.edu	37	15	43769942	43769942	+	Silent	SNP	A	A	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr15:43769942A>C	ENST00000263801.3	-	8	1041	c.789T>G	c.(787-789)ccT>ccG	p.P263P	TP53BP1_ENST00000382044.4_Silent_p.P268P|TP53BP1_ENST00000450115.2_Silent_p.P268P|TP53BP1_ENST00000382039.3_Silent_p.P268P	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	263					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TGGGGCTAAAAGGCATGTCCT	0.393								Other conserved DNA damage response genes																													p.P268P		Atlas-SNP	.											.	TP53BP1	157	.	0			c.T804G						PASS	.						90.0	90.0	90.0					15																	43769942		2201	4298	6499	SO:0001819	synonymous_variant	7158	exon8			GCTAAAAGGCATG	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.789T>G	chr15.hg19:g.43769942A>C		89.0	0.0	.		62.0	21.0	.	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Silent	SNP	ENST00000263801.3	hg19	CCDS10096.1																																																																																			.	.	.	none		0.393	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
MEX3B	84206	hgsc.bcm.edu	37	15	82336360	82336360	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr15:82336360T>C	ENST00000329713.4	-	2	1286	c.851A>G	c.(850-852)tAc>tGc	p.Y284C	MEX3B_ENST00000558133.1_3'UTR|AC026956.1_ENST00000410589.1_RNA	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	284					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						GTCGTTGCGGTAGCTAGAGAA	0.677																																					p.Y284C		Atlas-SNP	.											.	MEX3B	50	.	0			c.A851G						PASS	.						26.0	33.0	31.0					15																	82336360		2197	4294	6491	SO:0001583	missense	84206	exon2			TTGCGGTAGCTAG	AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.851A>G	chr15.hg19:g.82336360T>C	ENSP00000329918:p.Tyr284Cys	45.0	0.0	.		25.0	10.0	.	NM_032246	Q4G0W1|Q8IVG2|Q9H0J0	Missense_Mutation	SNP	ENST00000329713.4	hg19	CCDS10319.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.224775	0.58668	.	.	ENSG00000183496	ENST00000329713	T	0.25414	1.8	4.53	3.38	0.38709	.	0.078776	0.53938	D	0.000055	T	0.41789	0.1174	M	0.65498	2.005	0.80722	D	1	D	0.71674	0.998	P	0.61328	0.887	T	0.25293	-1.0136	10	0.66056	D	0.02	-27.3162	8.9376	0.35708	0.2958:0.0:0.0:0.7042	.	284	Q6ZN04	MEX3B_HUMAN	C	284	ENSP00000329918:Y284C	ENSP00000329918:Y284C	Y	-	2	0	MEX3B	80123415	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.620000	0.61226	0.730000	0.32425	0.460000	0.39030	TAC	.	.	.	none		0.677	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304000.1	XM_290645	
GTF3C1	2975	hgsc.bcm.edu	37	16	27523094	27523094	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr16:27523094T>C	ENST00000356183.4	-	7	1117	c.1102A>G	c.(1102-1104)Atg>Gtg	p.M368V	GTF3C1_ENST00000561623.1_Missense_Mutation_p.M368V	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	368					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						TGTGTGAGCATATCCCGCTCG	0.502																																					p.M368V		Atlas-SNP	.											.	GTF3C1	210	.	0			c.A1102G						PASS	.						200.0	149.0	166.0					16																	27523094		2197	4300	6497	SO:0001583	missense	2975	exon7			TGAGCATATCCCG	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1102A>G	chr16.hg19:g.27523094T>C	ENSP00000348510:p.Met368Val	79.0	0.0	.		103.0	55.0	.	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	hg19	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	T	18.17	3.565410	0.65651	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.22336	1.96	5.64	5.64	0.86602	.	0.138042	0.64402	D	0.000005	T	0.34454	0.0898	L	0.29908	0.895	0.41036	D	0.985195	P;D	0.63046	0.539;0.992	B;D	0.74674	0.113;0.984	T	0.06041	-1.0849	10	0.41790	T	0.15	-5.9122	15.5262	0.75910	0.0:0.0:0.0:1.0	.	368;368	Q12789;Q12789-3	TF3C1_HUMAN;.	V	368;366	ENSP00000348510:M368V	ENSP00000348510:M368V	M	-	1	0	GTF3C1	27430595	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	4.439000	0.59968	2.146000	0.66826	0.528000	0.53228	ATG	.	.	.	none		0.502	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
ZNF629	23361	hgsc.bcm.edu	37	16	30795034	30795034	+	Silent	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr16:30795034G>A	ENST00000262525.4	-	3	822	c.615C>T	c.(613-615)ccC>ccT	p.P205P		NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GGCACTTGTAGGGCTTCTCGC	0.652																																					p.P205P		Atlas-SNP	.											.	ZNF629	44	.	0			c.C615T						PASS	.						55.0	58.0	57.0					16																	30795034		2197	4300	6497	SO:0001819	synonymous_variant	23361	exon3			CTTGTAGGGCTTC	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.615C>T	chr16.hg19:g.30795034G>A		132.0	0.0	.		60.0	39.0	.	NM_001080417	Q15938	Silent	SNP	ENST00000262525.4	hg19	CCDS45463.1																																																																																			.	.	.	none		0.652	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
IRX6	79190	hgsc.bcm.edu	37	16	55359021	55359021	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr16:55359021T>G	ENST00000290552.7	+	1	1350	c.18T>G	c.(16-18)ttT>ttG	p.F6L	RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	6					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TCCCACACTTTGGACACCCGT	0.652																																					p.F6L		Atlas-SNP	.											.	IRX6	66	.	0			c.T18G						PASS	.						57.0	54.0	55.0					16																	55359021		2198	4300	6498	SO:0001583	missense	79190	exon1			ACACTTTGGACAC	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.18T>G	chr16.hg19:g.55359021T>G	ENSP00000290552:p.Phe6Leu	96.0	0.0	.		50.0	25.0	.	NM_024335	B2RN06|Q7Z2K0	Missense_Mutation	SNP	ENST00000290552.7	hg19	CCDS32449.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232797	0.79688	.	.	ENSG00000159387	ENST00000290552	D	0.92965	-3.14	5.02	-1.06	0.10002	.	0.385027	0.28606	N	0.014743	D	0.92260	0.7545	L	0.48935	1.535	0.45690	D	0.998605	D	0.71674	0.998	D	0.79784	0.993	D	0.88273	0.2931	10	0.45353	T	0.12	-11.0867	8.3205	0.32126	0.0:0.4967:0.1265:0.3768	.	6	P78412	IRX6_HUMAN	L	6	ENSP00000290552:F6L	ENSP00000290552:F6L	F	+	3	2	IRX6	53916522	0.995000	0.38212	0.992000	0.48379	0.986000	0.74619	0.251000	0.18257	-0.377000	0.07930	0.454000	0.30748	TTT	.	.	.	none		0.652	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335	
KARS	3735	hgsc.bcm.edu	37	16	75674216	75674216	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr16:75674216T>C	ENST00000302445.3	-	3	293	c.254A>G	c.(253-255)cAt>cGt	p.H85R	KARS_ENST00000319410.5_Missense_Mutation_p.H113R|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	85					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	CTTCAGCTGATGAATTGCTTG	0.448																																					p.H113R		Atlas-SNP	.											.	KARS	77	.	0			c.A338G						PASS	.						228.0	222.0	224.0					16																	75674216		2198	4300	6498	SO:0001583	missense	3735	exon4			AGCTGATGAATTG	AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.254A>G	chr16.hg19:g.75674216T>C	ENSP00000303043:p.His85Arg	58.0	0.0	.		76.0	46.0	.	NM_001130089	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Missense_Mutation	SNP	ENST00000302445.3	hg19	CCDS10923.1	.	.	.	.	.	.	.	.	.	.	T	10.46	1.356197	0.24598	.	.	ENSG00000065427	ENST00000319410;ENST00000302445	T;T	0.62232	0.04;0.04	5.72	5.72	0.89469	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.241798	0.49916	D	0.000134	T	0.51363	0.1670	L	0.34521	1.04	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.44528	-0.9322	10	0.25106	T	0.35	-17.2345	14.8506	0.70295	0.0:0.0:0.0:1.0	.	113;85	Q15046-2;Q15046	.;SYK_HUMAN	R	113;85	ENSP00000325448:H113R;ENSP00000303043:H85R	ENSP00000303043:H85R	H	-	2	0	KARS	74231717	1.000000	0.71417	0.996000	0.52242	0.123000	0.20343	4.811000	0.62606	2.189000	0.69895	0.533000	0.62120	CAT	.	.	.	none		0.448	KARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269023.1	NM_005548	
TMEM88	92162	hgsc.bcm.edu	37	17	7758984	7758984	+	Silent	SNP	C	C	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr17:7758984C>G	ENST00000301599.6	+	2	442	c.432C>G	c.(430-432)gcC>gcG	p.A144A	CYB5D1_ENST00000571846.1_5'Flank|CYB5D1_ENST00000332439.4_5'Flank|CYB5D1_ENST00000570446.1_5'Flank|TMEM88_ENST00000574668.1_Intron|LSMD1_ENST00000570555.1_5'Flank	NM_203411.1	NP_981956.1	Q6PEY1	TMM88_HUMAN	transmembrane protein 88	144					multicellular organismal development (GO:0007275)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				lung(1)	1		all_cancers(10;0.00528)|Prostate(122;0.202)				AAATCCGGGCCTCACCAGGGT	0.667																																					p.A144A		Atlas-SNP	.											.	TMEM88	6	.	0			c.C432G						PASS	.						8.0	9.0	9.0					17																	7758984		2138	4187	6325	SO:0001819	synonymous_variant	92162	exon2			CCGGGCCTCACCA	BC057812	CCDS11121.1	17p13.1	2005-12-13				ENSG00000167874			32371	protein-coding gene	gene with protein product							Standard	NM_203411		Approved	MGC71744, FLJ20025	uc002giy.3	Q6PEY1		ENST00000301599.6:c.432C>G	chr17.hg19:g.7758984C>G		87.0	0.0	.		36.0	8.0	.	NM_203411		Silent	SNP	ENST00000301599.6	hg19	CCDS11121.1																																																																																			.	.	.	none		0.667	TMEM88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440252.1	NM_203411	
AOC2	314	hgsc.bcm.edu	37	17	41002294	41002294	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr17:41002294C>T	ENST00000253799.3	+	4	2227	c.2200C>T	c.(2200-2202)Cct>Tct	p.P734S	AOC3_ENST00000308423.2_5'Flank|AOC2_ENST00000452774.2_Missense_Mutation_p.P707S	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	734					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CAGCATCAATCCTGTGGCCTG	0.597																																					p.P734S		Atlas-SNP	.											.	AOC2	61	.	0			c.C2200T						PASS	.						164.0	172.0	170.0					17																	41002294		2203	4300	6503	SO:0001583	missense	314	exon4			ATCAATCCTGTGG	AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.2200C>T	chr17.hg19:g.41002294C>T	ENSP00000253799:p.Pro734Ser	84.0	0.0	.		76.0	43.0	.	NM_009590	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	hg19	CCDS11443.1	.	.	.	.	.	.	.	.	.	.	C	6.560	0.471616	0.12461	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.03468	3.92;3.92	5.19	4.23	0.50019	Copper amine oxidase, C-terminal (1);	0.669731	0.15067	N	0.282419	T	0.03136	0.0092	N	0.19112	0.55	0.38233	D	0.941088	B;B	0.11235	0.002;0.004	B;B	0.18871	0.005;0.023	T	0.35699	-0.9778	10	0.09338	T	0.73	-35.8049	13.9375	0.64034	0.0:0.9263:0.0:0.0737	.	734;707	O75106;O75106-2	AOC2_HUMAN;.	S	734;707	ENSP00000253799:P734S;ENSP00000406134:P707S	ENSP00000253799:P734S	P	+	1	0	AOC2	38255820	0.811000	0.29063	0.992000	0.48379	0.319000	0.28217	2.760000	0.47581	1.195000	0.43115	-0.254000	0.11334	CCT	.	.	.	none		0.597	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158	
FZD2	2535	hgsc.bcm.edu	37	17	42636200	42636200	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr17:42636200G>A	ENST00000315323.3	+	1	1276	c.1144G>A	c.(1144-1146)Gtc>Atc	p.V382I		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	382					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CGTGCCGGCCGTCAAGACCAT	0.672																																					p.V382I		Atlas-SNP	.											.	FZD2	81	.	0			c.G1144A						PASS	.						68.0	68.0	68.0					17																	42636200		2203	4299	6502	SO:0001583	missense	2535	exon1			CCGGCCGTCAAGA	L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1144G>A	chr17.hg19:g.42636200G>A	ENSP00000323901:p.Val382Ile	80.0	0.0	.		48.0	13.0	.	NM_001466	Q0VG82	Missense_Mutation	SNP	ENST00000315323.3	hg19	CCDS11484.1	.	.	.	.	.	.	.	.	.	.	g	10.67	1.416262	0.25552	.	.	ENSG00000180340	ENST00000541149;ENST00000315323	D	0.83755	-1.76	5.0	5.0	0.66597	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.74238	0.3690	N	0.21373	0.66	0.47584	D	0.999468	B	0.24368	0.102	B	0.20955	0.032	T	0.69680	-0.5080	10	0.31617	T	0.26	.	17.9002	0.88901	0.0:0.0:1.0:0.0	.	382	Q14332	FZD2_HUMAN	I	458;382	ENSP00000323901:V382I	ENSP00000323901:V382I	V	+	1	0	FZD2	39991726	0.999000	0.42202	0.998000	0.56505	0.978000	0.69477	2.822000	0.48073	2.291000	0.77112	0.561000	0.74099	GTC	.	.	.	none		0.672	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466	
MYL12A	10627	hgsc.bcm.edu	37	18	3254019	3254019	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr18:3254019C>T	ENST00000217652.3	+	3	709	c.314C>T	c.(313-315)gCc>gTc	p.A105V	MYL12A_ENST00000536605.1_Missense_Mutation_p.A105V|RP13-270P17.1_ENST00000578800.1_RNA|RP13-270P17.1_ENST00000581905.1_RNA|MYL12A_ENST00000580887.1_Missense_Mutation_p.A111V|MYL12A_ENST00000578611.1_Missense_Mutation_p.A105V|MYL12A_ENST00000579226.1_Missense_Mutation_p.A105V	NM_006471.2	NP_006462.1	P19105	ML12A_HUMAN	myosin, light chain 12A, regulatory, non-sarcomeric	105	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				platelet aggregation (GO:0070527)|protein targeting to plasma membrane (GO:0072661)|regulation of cell shape (GO:0008360)	extracellular vesicular exosome (GO:0070062)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)			NS(1)|kidney(2)|large_intestine(2)	5						ATCAGAAATGCCTTTGCTTGC	0.368																																					p.A105V		Atlas-SNP	.											.	MYL12A	12	.	0			c.C314T						PASS	.						91.0	83.0	86.0					18																	3254019		2203	4300	6503	SO:0001583	missense	10627	exon3			GAAATGCCTTTGC	X54304	CCDS11830.1	18p11.31	2013-01-10	2002-08-29		ENSG00000101608	ENSG00000101608		"""Myosins / Light chain"", ""EF-hand domain containing"""	16701	protein-coding gene	gene with protein product	"""myosin regulatory light chain 3"""		"""myosin, light polypeptide, regulatory, non-sarcomeric (20kD)"""			2216787	Standard	NM_006471		Approved	MLCB, MYL2B, MRLC3, MRCL3	uc002klr.3	P19105	OTTHUMG00000131509	ENST00000217652.3:c.314C>T	chr18.hg19:g.3254019C>T	ENSP00000217652:p.Ala105Val	223.0	0.0	.		199.0	73.0	.	NM_006471	Q53X45	Missense_Mutation	SNP	ENST00000217652.3	hg19	CCDS11830.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.564221	0.86335	.	.	ENSG00000101608	ENST00000217652;ENST00000536605	D;D	0.81996	-1.56;-1.56	5.42	5.42	0.78866	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.88040	0.6330	M	0.90705	3.14	0.80722	D	1	B;B	0.29886	0.26;0.26	B;B	0.33295	0.161;0.161	D	0.87864	0.2666	10	0.72032	D	0.01	.	19.4096	0.94665	0.0:1.0:0.0:0.0	.	105;105	Q53X45;P19105	.;ML12A_HUMAN	V	105	ENSP00000217652:A105V;ENSP00000441231:A105V	ENSP00000217652:A105V	A	+	2	0	MYL12A	3244019	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	7.651000	0.83577	2.817000	0.96982	0.563000	0.77884	GCC	.	.	.	none		0.368	MYL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254364.2	NM_006471	
LAMA1	284217	hgsc.bcm.edu	37	18	7016662	7016662	+	Silent	SNP	A	A	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr18:7016662A>G	ENST00000389658.3	-	21	2910	c.2817T>C	c.(2815-2817)taT>taC	p.Y939Y		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	939	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCAGCCCATAATAGCCATGCT	0.517																																					p.Y939Y		Atlas-SNP	.											.	LAMA1	458	.	0			c.T2817C						PASS	.						35.0	28.0	30.0					18																	7016662		2203	4300	6503	SO:0001819	synonymous_variant	284217	exon21			CCCATAATAGCCA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2817T>C	chr18.hg19:g.7016662A>G		21.0	0.0	.		42.0	14.0	.	NM_005559		Silent	SNP	ENST00000389658.3	hg19	CCDS32787.1																																																																																			.	.	.	none		0.517	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
DUS3L	56931	hgsc.bcm.edu	37	19	5786483	5786483	+	Silent	SNP	A	A	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr19:5786483A>T	ENST00000309061.7	-	10	1653	c.1557T>A	c.(1555-1557)atT>atA	p.I519I	PRR22_ENST00000419421.2_5'Flank|CTB-54O9.9_ENST00000586012.1_5'Flank|DUS3L_ENST00000590681.1_5'Flank|DUS3L_ENST00000320699.8_Silent_p.I277I	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	519							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						CTTACCGGGCAATCATGATCC	0.582																																					p.I519I		Atlas-SNP	.											.	DUS3L	42	.	0			c.T1557A						PASS	.						109.0	77.0	88.0					19																	5786483		2203	4299	6502	SO:0001819	synonymous_variant	56931	exon10			CCGGGCAATCATG		CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.1557T>A	chr19.hg19:g.5786483A>T		74.0	0.0	.		28.0	12.0	.	NM_020175	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Silent	SNP	ENST00000309061.7	hg19	CCDS32880.1																																																																																			.	.	.	none		0.582	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451870.2	NM_020175	
ZNF565	147929	hgsc.bcm.edu	37	19	36674230	36674230	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr19:36674230T>A	ENST00000355114.5	-	5	1484	c.758A>T	c.(757-759)cAt>cTt	p.H253L	ZNF565_ENST00000392173.2_Missense_Mutation_p.H213L|ZNF565_ENST00000304116.5_Missense_Mutation_p.H213L			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			AATTCTCTGATGCTGAACAAG	0.443																																					p.H213L		Atlas-SNP	.											.	ZNF565	46	.	0			c.A638T						PASS	.						74.0	67.0	69.0					19																	36674230		2203	4300	6503	SO:0001583	missense	147929	exon5			CTCTGATGCTGAA	AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.758A>T	chr19.hg19:g.36674230T>A	ENSP00000347234:p.His253Leu	58.0	0.0	.		56.0	22.0	.	NM_001042474	B3KQ35|Q6NUS2	Missense_Mutation	SNP	ENST00000355114.5	hg19		.	.	.	.	.	.	.	.	.	.	t	19.57	3.852244	0.71719	.	.	ENSG00000196357	ENST00000392173;ENST00000304116;ENST00000355114	D;D;D	0.86865	-2.18;-2.18;-2.18	4.33	3.22	0.36961	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.177862	0.27473	N	0.019217	D	0.94689	0.8287	H	0.97682	4.055	0.34458	D	0.701394	D	0.89917	1.0	D	0.66602	0.945	D	0.96372	0.9274	10	0.87932	D	0	.	9.2445	0.37518	0.0:0.0:0.181:0.819	.	213	Q8N9K5	ZN565_HUMAN	L	213;213;253	ENSP00000376013:H213L;ENSP00000306869:H213L;ENSP00000347234:H253L	ENSP00000306869:H213L	H	-	2	0	ZNF565	41366070	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	3.769000	0.55303	1.955000	0.56771	0.456000	0.33151	CAT	.	.	.	none		0.443	ZNF565-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000451697.1	NM_152477	
MYH14	79784	hgsc.bcm.edu	37	19	50747513	50747513	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr19:50747513G>A	ENST00000596571.1	+	9	1105	c.1105G>A	c.(1105-1107)Gtc>Atc	p.V369I	MYH14_ENST00000376970.2_Missense_Mutation_p.V369I|MYH14_ENST00000440075.2_Missense_Mutation_p.V377I|MYH14_ENST00000262269.8_Missense_Mutation_p.V377I|MYH14_ENST00000601313.1_Missense_Mutation_p.V377I|MYH14_ENST00000425460.1_Missense_Mutation_p.V377I|MYH14_ENST00000598205.1_Missense_Mutation_p.V377I			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	369	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GCTGCGGATGGTCTCAGCAGT	0.552																																					p.V377I		Atlas-SNP	.											.	MYH14	261	.	0			c.G1129A						PASS	.						84.0	89.0	87.0					19																	50747513		2125	4242	6367	SO:0001583	missense	79784	exon11			CGGATGGTCTCAG	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.1105G>A	chr19.hg19:g.50747513G>A	ENSP00000472819:p.Val369Ile	125.0	0.0	.		66.0	30.0	.	NM_001077186	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	hg19	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	8.469	0.857136	0.17106	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39	3.42	2.37	0.29283	Myosin head, motor domain (2);	.	.	.	.	D	0.82829	0.5122	L	0.42632	1.34	0.49582	D	0.999809	P;B;B	0.37864	0.61;0.198;0.063	B;B;B	0.36666	0.23;0.056;0.028	T	0.79492	-0.1781	9	0.41790	T	0.15	.	9.1808	0.37141	0.1121:0.0:0.8879:0.0	.	377;369;377	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	I	369;377;369;377;369;377	ENSP00000406273:V377I;ENSP00000366169:V369I;ENSP00000407879:V377I;ENSP00000262269:V377I	ENSP00000262269:V377I	V	+	1	0	MYH14	55439325	1.000000	0.71417	0.354000	0.25760	0.137000	0.21094	2.140000	0.42159	1.017000	0.39495	0.462000	0.41574	GTC	.	.	.	none		0.552	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
PTPRT	11122	hgsc.bcm.edu	37	20	40713469	40713469	+	Missense_Mutation	SNP	C	C	T	rs528913627		TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr20:40713469C>T	ENST00000373187.1	-	29	3988	c.3989G>A	c.(3988-3990)cGt>cAt	p.R1330H	PTPRT_ENST00000373193.3_Missense_Mutation_p.R1333H|PTPRT_ENST00000373184.1_Missense_Mutation_p.R1340H|PTPRT_ENST00000373190.1_Missense_Mutation_p.R1329H|PTPRT_ENST00000373198.4_Missense_Mutation_p.R1349H|PTPRT_ENST00000356100.2_Missense_Mutation_p.R1339H|PTPRT_ENST00000373201.1_Missense_Mutation_p.R1320H			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1330	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CTGGACTATACGATAACCATC	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		20626	0.0		0.001	False		,,,				2504	0.0				p.R1349H		Atlas-SNP	.											.	PTPRT	372	.	0			c.G4046A						PASS	.						61.0	66.0	65.0					20																	40713469		2077	4194	6271	SO:0001583	missense	11122	exon30			ACTATACGATAAC	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3989G>A	chr20.hg19:g.40713469C>T	ENSP00000362283:p.Arg1330His	39.0	0.0	.		109.0	43.0	.	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	hg19	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	35	5.441039	0.96168	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23;2.23;2.23	5.55	5.55	0.83447	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.37517	0.1006	L	0.49640	1.575	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.66716	0.944;0.946	T	0.00800	-1.1561	10	0.46703	T	0.11	.	19.6982	0.96039	0.0:1.0:0.0:0.0	.	1352;1330	O14522-1;O14522	.;PTPRT_HUMAN	H	1329;1330;1333;1339;1352;1340;1320	ENSP00000362286:R1329H;ENSP00000362283:R1330H;ENSP00000362289:R1333H;ENSP00000348408:R1339H;ENSP00000362294:R1352H;ENSP00000362280:R1340H;ENSP00000362297:R1320H	ENSP00000348408:R1339H	R	-	2	0	PTPRT	40146883	0.995000	0.38212	0.990000	0.47175	0.981000	0.71138	3.067000	0.50010	2.894000	0.99253	0.655000	0.94253	CGT	.	.	.	none		0.587	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
PARD6B	84612	hgsc.bcm.edu	37	20	49354557	49354557	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr20:49354557A>C	ENST00000371610.2	+	2	473	c.230A>C	c.(229-231)aAt>aCt	p.N77T	PARD6B_ENST00000396039.1_Missense_Mutation_p.N77T	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	77	OPR.				axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						AATGATGATAATTATCACAAA	0.338																																					p.N77T		Atlas-SNP	.											.	PARD6B	31	.	0			c.A230C						PASS	.						82.0	79.0	80.0					20																	49354557		2203	4300	6503	SO:0001583	missense	84612	exon2			ATGATAATTATCA	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.230A>C	chr20.hg19:g.49354557A>C	ENSP00000360672:p.Asn77Thr	132.0	0.0	.		244.0	87.0	.	NM_032521	A2A2A7|Q9Y510	Missense_Mutation	SNP	ENST00000371610.2	hg19	CCDS33485.1	.	.	.	.	.	.	.	.	.	.	A	19.74	3.883714	0.72410	.	.	ENSG00000124171	ENST00000371610;ENST00000396039	T;T	0.23552	1.9;1.9	6.17	5.08	0.68730	Phox/Bem1p (2);	0.000000	0.85682	D	0.000000	T	0.52757	0.1754	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.57849	-0.7740	10	0.87932	D	0	-43.1371	11.3759	0.49728	0.9302:0.0:0.0698:0.0	.	77	Q9BYG5	PAR6B_HUMAN	T	77	ENSP00000360672:N77T;ENSP00000379354:N77T	ENSP00000360672:N77T	N	+	2	0	PARD6B	48787964	1.000000	0.71417	0.830000	0.32933	0.794000	0.44872	8.920000	0.92779	1.160000	0.42584	0.533000	0.62120	AAT	.	.	.	none		0.338	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521	
KRTAP27-1	643812	hgsc.bcm.edu	37	21	31709386	31709386	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr21:31709386C>A	ENST00000382835.2	-	1	626	c.601G>T	c.(601-603)Ggt>Tgt	p.G201C		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	201						intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						AATTGAGAACCACCAGTAACA	0.408																																					p.G201C		Atlas-SNP	.											.	KRTAP27-1	53	.	0			c.G601T						PASS	.						66.0	64.0	65.0					21																	31709386		2203	4300	6503	SO:0001583	missense	643812	exon1			GAGAACCACCAGT	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.601G>T	chr21.hg19:g.31709386C>A	ENSP00000372286:p.Gly201Cys	59.0	0.0	.		166.0	35.0	.	NM_001077711		Missense_Mutation	SNP	ENST00000382835.2	hg19	CCDS33532.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727069	0.48833	.	.	ENSG00000206107	ENST00000382835	T	0.60920	0.15	4.13	4.13	0.48395	.	0.307763	0.20789	U	0.085656	T	0.72195	0.3430	M	0.65975	2.015	0.40737	D	0.982795	D	0.89917	1.0	D	0.97110	1.0	T	0.75172	-0.3411	10	0.87932	D	0	-10.8309	12.1805	0.54210	0.0:1.0:0.0:0.0	.	201	Q3LI81	KR271_HUMAN	C	201	ENSP00000372286:G201C	ENSP00000372286:G201C	G	-	1	0	KRTAP27-1	30631257	1.000000	0.71417	0.999000	0.59377	0.511000	0.34104	2.904000	0.48719	2.586000	0.87340	0.484000	0.47621	GGT	.	.	.	none		0.408	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
BCL2L13	23786	hgsc.bcm.edu	37	22	18138483	18138483	+	Silent	SNP	G	G	C	rs144712899	byFrequency	TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr22:18138483G>C	ENST00000317582.5	+	2	353	c.6G>C	c.(4-6)gcG>gcC	p.A2A	BCL2L13_ENST00000355028.3_Silent_p.A2A|BCL2L13_ENST00000493680.1_Silent_p.A2A|BCL2L13_ENST00000543133.1_5'UTR|BCL2L13_ENST00000337612.5_5'UTR|BCL2L13_ENST00000538149.1_5'UTR|BCL2L13_ENST00000399782.1_Silent_p.A2A|BCL2L13_ENST00000418951.2_Silent_p.A2A	NM_015367.3	NP_056182.2	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	2					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			breast(2)|central_nervous_system(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(3)|urinary_tract(2)	15		all_epithelial(15;0.123)		Lung(27;0.199)		ATTCAATGGCGTCCTCTTCTA	0.393																																					p.A2A		Atlas-SNP	.											BCL2L13,NS,adenocarcinoma,0,2	BCL2L13	27	.	0			c.G6C						PASS	.						131.0	119.0	123.0					22																	18138483		2203	4300	6503	SO:0001819	synonymous_variant	23786	exon2			AATGGCGTCCTCT	AF146568	CCDS13746.1, CCDS59447.1, CCDS59448.1, CCDS74810.1, CCDS74811.1, CCDS74812.1, CCDS74813.1, CCDS74814.1	22q11	2014-03-07			ENSG00000099968	ENSG00000099968			17164	protein-coding gene	gene with protein product						11262395, 11381032	Standard	NM_015367		Approved	MIL1, BCL-RAMBO	uc002zmw.4	Q9BXK5	OTTHUMG00000150088	ENST00000317582.5:c.6G>C	chr22.hg19:g.18138483G>C		69.0	1.0	.		58.0	26.0	.	NM_001270732	B3KPE7|Q96B37|Q96IB7|Q9BY01|Q9HC05|Q9UFE0|Q9UKN3	Silent	SNP	ENST00000317582.5	hg19	CCDS13746.1																																																																																			.	G|1.000;A|0.000	.	alt		0.393	BCL2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316184.1	NM_015367	
RANBP1	5902	hgsc.bcm.edu	37	22	20109854	20109854	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr22:20109854G>T	ENST00000331821.3	+	3	322	c.220G>T	c.(220-222)Gac>Tac	p.D74Y	RANBP1_ENST00000402752.1_Missense_Mutation_p.D74Y|RANBP1_ENST00000430524.1_5'UTR	NM_002882.2	NP_002873.1	P43487	RANG_HUMAN	RAN binding protein 1	74	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|positive regulation of mitotic centrosome separation (GO:0046604)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|spindle organization (GO:0007051)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Ran GTPase binding (GO:0008536)			breast(1)|large_intestine(1)|lung(1)|ovary(1)	4	Colorectal(54;0.0993)					AGGCACTGGTGACGTCAAGCT	0.552																																					p.D74Y		Atlas-SNP	.											.	RANBP1	19	.	0			c.G220T						PASS	.						77.0	67.0	71.0					22																	20109854		2203	4300	6503	SO:0001583	missense	5902	exon3			ACTGGTGACGTCA	D38076	CCDS13775.1, CCDS63408.1, CCDS74823.1	22q11.21	2008-06-16			ENSG00000099901	ENSG00000099901			9847	protein-coding gene	gene with protein product		601180				7616957, 10330396	Standard	NM_001278639		Approved	HTF9A	uc002zro.1	P43487	OTTHUMG00000150490	ENST00000331821.3:c.220G>T	chr22.hg19:g.20109854G>T	ENSP00000327583:p.Asp74Tyr	132.0	0.0	.		84.0	29.0	.	NM_002882	Q53EY3	Missense_Mutation	SNP	ENST00000331821.3	hg19	CCDS13775.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848424	0.91277	.	.	ENSG00000099901	ENST00000432879;ENST00000402752;ENST00000447917;ENST00000331821;ENST00000411892;ENST00000416427;ENST00000421656;ENST00000423859;ENST00000418705	T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.53	5.53	0.82687	Pleckstrin homology-type (1);Ran binding protein 1 (3);	0.000000	0.85682	D	0.000000	T	0.74061	0.3667	M	0.87038	2.855	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.994	D;D;D	0.70935	0.923;0.971;0.954	T	0.78685	-0.2108	10	0.87932	D	0	-53.8354	19.4537	0.94878	0.0:0.0:1.0:0.0	.	74;74;74	B4DE76;Q53EY3;P43487	.;.;RANG_HUMAN	Y	151;74;74;74;74;24;24;24;24	ENSP00000404724:D151Y;ENSP00000384925:D74Y;ENSP00000327583:D74Y;ENSP00000395472:D74Y;ENSP00000404126:D24Y;ENSP00000400940:D24Y;ENSP00000404298:D24Y;ENSP00000413502:D24Y	ENSP00000327583:D74Y	D	+	1	0	RANBP1	18489854	1.000000	0.71417	0.376000	0.26042	0.865000	0.49528	9.618000	0.98365	2.606000	0.88127	0.563000	0.77884	GAC	.	.	.	none		0.552	RANBP1-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343733.1	NM_002882	
CSNK1E	1454	hgsc.bcm.edu	37	22	38690505	38690505	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr22:38690505C>G	ENST00000396832.1	-	8	1181	c.921G>C	c.(919-921)gaG>gaC	p.E307D	CSNK1E_ENST00000359867.3_Missense_Mutation_p.E307D|CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000403904.1_Missense_Mutation_p.E307D|CSNK1E_ENST00000400206.2_Missense_Mutation_p.E307D	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	307					cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GTTCTCGCCGCTCCCGGTCCA	0.706																																					p.E307D	Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	Atlas-SNP	.											.	CSNK1E	143	.	0			c.G921C						PASS	.						15.0	11.0	12.0					22																	38690505		2191	4283	6474	SO:0001583	missense	1454	exon8			TCGCCGCTCCCGG		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.921G>C	chr22.hg19:g.38690505C>G	ENSP00000380044:p.Glu307Asp	146.0	0.0	.		52.0	24.0	.	NM_001894		Missense_Mutation	SNP	ENST00000396832.1	hg19	CCDS13970.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.10|17.10|17.10	3.303339|3.303339|3.303339	0.60195|0.60195|0.60195	.|.|.	.|.|.	ENSG00000213923|ENSG00000213923|ENSG00000213923	ENST00000431632|ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904|ENST00000366216	.|T;T;T;T|.	.|0.56611|.	.|0.45;0.45;0.45;0.45|.	5.56|5.56|5.56	2.28|2.28|2.28	0.28536|0.28536|0.28536	.|.|.	.|0.045920|.	.|0.85682|.	.|N|.	.|0.000000|.	T|T|T	0.50752|0.50752|0.50752	0.1634|0.1634|0.1634	L|L|L	0.36672|0.36672|0.36672	1.1|1.1|1.1	0.46044|0.46044|0.46044	D|D|D	0.998836|0.998836|0.998836	.|B|.	.|0.02656|.	.|0.0|.	.|B|.	.|0.08055|.	.|0.003|.	T|T|T	0.31392|0.31392|0.31392	-0.9945|-0.9945|-0.9945	5|10|5	.|0.16896|.	.|T|.	.|0.51|.	.|.|.	9.1766|9.1766|9.1766	0.37116|0.37116|0.37116	0.0:0.7182:0.0:0.2818|0.0:0.7182:0.0:0.2818|0.0:0.7182:0.0:0.2818	.|.|.	.|307|.	.|P49674|.	.|KC1E_HUMAN|.	P|D|T	35|307|10	.|ENSP00000352929:E307D;ENSP00000380044:E307D;ENSP00000383067:E307D;ENSP00000384074:E307D|.	.|ENSP00000352929:E307D|.	A|E|S	-|-|-	1|3|2	0|2|0	CSNK1E|CSNK1E|CSNK1E	37020451|37020451|37020451	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.997000|0.997000|0.997000	0.53966|0.53966|0.53966	0.575000|0.575000|0.575000	0.36095|0.36095|0.36095	1.803000|1.803000|1.803000	0.38863|0.38863|0.38863	0.286000|0.286000|0.286000	0.22352|0.22352|0.22352	-0.142000|-0.142000|-0.142000	0.14014|0.14014|0.14014	GCG|GAG|AGC	.	.	.	none		0.706	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894	
MOV10L1	54456	hgsc.bcm.edu	37	22	50591546	50591546	+	Silent	SNP	A	A	C	rs529208457		TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr22:50591546A>C	ENST00000262794.5	+	22	3048	c.2965A>C	c.(2965-2967)Agg>Cgg	p.R989R	MOV10L1_ENST00000540615.1_Silent_p.R969R|MOV10L1_ENST00000395843.1_Silent_p.R32R|MOV10L1_ENST00000395852.1_Silent_p.R116R|MOV10L1_ENST00000545383.1_Silent_p.R989R|MOV10L1_ENST00000354853.2_Silent_p.R32R|MOV10L1_ENST00000395858.3_Silent_p.R989R	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	989					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GTTCTACCACAGGGAACTCGA	0.587																																					p.R989R		Atlas-SNP	.											.	MOV10L1	238	.	0			c.A2965C						PASS	.						178.0	170.0	172.0					22																	50591546		2203	4300	6503	SO:0001819	synonymous_variant	54456	exon22			TACCACAGGGAAC	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2965A>C	chr22.hg19:g.50591546A>C		163.0	0.0	.		79.0	32.0	.	NM_018995	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	hg19	CCDS14084.1																																																																																			.	.	.	none		0.587	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995	
DCAF8L2	347442	hgsc.bcm.edu	37	X	27765728	27765728	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chrX:27765728G>A	ENST00000451261.2	+	5	1115	c.716G>A	c.(715-717)cGt>cAt	p.R239H		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	239										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						TTTAACCAGCGTGGCACCCGG	0.537																																					p.R239H		Atlas-SNP	.											.	DCAF8L2	79	.	0			c.G716A						PASS	.						91.0	69.0	76.0					X																	27765728		692	1591	2283	SO:0001583	missense	347442	exon1			ACCAGCGTGGCAC		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.716G>A	chrX.hg19:g.27765728G>A	ENSP00000462745:p.Arg239His	45.0	0.0	.		83.0	69.0	.	NM_001136533	B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	hg19	CCDS59162.1																																																																																			.	.	.	none		0.537	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
MT-CO1	4512	hgsc.bcm.edu	37	M	6955	6955	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chrM:6955G>A	ENST00000361624.2	+	1	1052	c.1052G>A	c.(1051-1053)gGt>gAt	p.G351D	MT-CO2_ENST00000361739.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	351					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TTTCACCGTAGGTGGCCTGAC	0.458																																					p.G351D		Atlas-SNP	.											.	.	.	.	0			c.G1052A						PASS	.																																			SO:0001583	missense	5742	exon1			CCGTAGGTGGCCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1052G>A	chrM.hg19:g.6955G>A	ENSP00000354499:p.Gly351Asp	3.0	0.0	.		22.0	13.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	weak		0.458	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
PHF3	23469	hgsc.bcm.edu	37	6	64421622	64421622	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr6:64421622delA	ENST00000262043.3	+	16	4478	c.4138delA	c.(4138-4140)aaafs	p.K1381fs	PHF3_ENST00000393387.1_Frame_Shift_Del_p.K1381fs			Q92576	PHF3_HUMAN	PHD finger protein 3	1381					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			GCCACCTGATAAAAAAAGTAA	0.378																																					p.D1379fs	GBM(135;136 1820 29512 34071 46235)	Atlas-Indel,Pindel	.											.	PHF3	191	.	0			c.4137delT						PASS	.						89.0	99.0	96.0					6																	64421622		2203	4300	6503	SO:0001589	frameshift_variant	23469	exon15			.	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.4138delA	chr6.hg19:g.64421622delA	ENSP00000262043:p.Lys1381fs	86.0	0.0	0		185.0	76.0	0.410811	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Frame_Shift_Del	DEL	ENST00000262043.3	hg19	CCDS4966.1																																																																																			.	.	.	none		0.378	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
AHCTF1	25909	hgsc.bcm.edu	37	1	247081550	247081560	+	Splice_Site	DEL	TTATGTTTACC	TTATGTTTACC	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	TTATGTTTACC	TTATGTTTACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr1:247081550_247081560delTTATGTTTACC	ENST00000391829.2	-	2	236_245	c.113_122delGGTAAACATAA	c.(112-123)tggtaaacataa>ta	p.W*T*38fs	AHCTF1_ENST00000366508.1_Splice_Site_p.W*T*73fs|AHCTF1_ENST00000326225.3_Splice_Site_p.W*T*47fs			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	38	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CATTATGTTTACCTGCAGCAAACTTTCCACG	0.346																																					.	Colon(145;197 1800 4745 15099 26333)	Atlas-Indel,Pindel	.											.	AHCTF1	187	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	25909	.			.		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.121+1GGTAAACATAA>-	chr1.hg19:g.247081550_247081560delTTATGTTTACC		147.0	0.0	0		139.0	25.0	0.179856	.	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Splice_Site	DEL	ENST00000391829.2	hg19																																																																																				.	.	.	none		0.346	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	Frame_Shift_Del
USH1G	124590	hgsc.bcm.edu	37	17	72919094	72919094	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr17:72919094delC	ENST00000319642.1	-	1	257	c.75delG	c.(73-75)ctgfs	p.L25fs	OTOP2_ENST00000580223.1_5'Flank|OTOP2_ENST00000331427.4_5'Flank	NM_001282489.1|NM_173477.2	NP_001269418.1|NP_775748.2	Q495M9	USH1G_HUMAN	Usher syndrome 1G (autosomal recessive)	25					equilibrioception (GO:0050957)|inner ear morphogenesis (GO:0042472)|inner ear receptor cell differentiation (GO:0060113)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	spectrin binding (GO:0030507)		HN1/USH1G(2)	endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(3)	14	all_lung(278;0.172)|Lung NSC(278;0.207)					CGGGGGCATTCAGCTCCTTTC	0.667																																					p.N26fs		Atlas-INDEL	.											.	USH1G	40	.	0			c.76delA						PASS	.						31.0	24.0	27.0					17																	72919094		2191	4292	6483	SO:0001589	frameshift_variant	124590	exon1			.	AK091243	CCDS32725.1	17q25.1	2013-01-10			ENSG00000182040	ENSG00000182040		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	16356	protein-coding gene	gene with protein product		607696				12588794	Standard	NM_001282489		Approved	Sans, FLJ33924, ANKS4A	uc002jme.1	Q495M9	OTTHUMG00000178864	ENST00000319642.1:c.75delG	chr17.hg19:g.72919094delC	ENSP00000320076:p.Leu25fs	192.0	0.0	0		123.0	41.0	0.333333	NM_173477	Q8N251	Frame_Shift_Del	DEL	ENST00000319642.1	hg19	CCDS32725.1																																																																																			.	.	.	none		0.667	USH1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443676.1	NM_173477	
GGH	8836	hgsc.bcm.edu	37	8	63936714	63936714	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr8:63936714delA	ENST00000260118.6	-	6	933	c.531delT	c.(529-531)tttfs	p.F177fs	GGH_ENST00000518113.1_5'UTR|RP11-659E9.4_ENST00000521556.1_RNA	NM_003878.2	NP_003869.1	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)	177	Gamma-glutamyl hydrolase. {ECO:0000255|PROSITE-ProRule:PRU00607}.				glutamine metabolic process (GO:0006541)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	exopeptidase activity (GO:0008238)|gamma-glutamyl-peptidase activity (GO:0034722)|omega peptidase activity (GO:0008242)			breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(6)|stomach(1)	11	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|Methotrexate(DB00563)	ACTCAGTAGGAAAATTCTGGA	0.353																																					p.P178fs		Atlas-Indel,Pindel	.											.	GGH	32	.	0			c.532delC						PASS	.						44.0	43.0	43.0					8																	63936714		2203	4300	6503	SO:0001589	frameshift_variant	8836	exon6			.	U55206	CCDS6177.1	8q12.3	2008-02-05			ENSG00000137563	ENSG00000137563	3.4.19.9		4248	protein-coding gene	gene with protein product		601509				8816764, 10570974	Standard	NM_003878		Approved		uc003xuw.3	Q92820	OTTHUMG00000164365	ENST00000260118.6:c.531delT	chr8.hg19:g.63936714delA	ENSP00000260118:p.Phe177fs	111.0	0.0	0		248.0	61.0	0.245968	NM_003878		Frame_Shift_Del	DEL	ENST00000260118.6	hg19	CCDS6177.1																																																																																			.	.	.	none		0.353	GGH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378453.1		
ASPN	54829	hgsc.bcm.edu	37	9	95237024	95237025	+	In_Frame_Ins	INS	-	-	TCCTCA	rs113747060|rs71362392|rs111419727|rs3078372|rs397838876|rs376433743|rs557103556	byFrequency	TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr9:95237024_95237025insTCCTCA	ENST00000375544.3	-	2	398_399	c.155_156insTGAGGA	c.(154-156)gag>gaTGAGGAg	p.51_52insDE	ASPN_ENST00000395538.3_In_Frame_Ins_p.51_52insDE|ASPN_ENST00000450139.2_In_Frame_Ins_p.23_24insDE|CENPP_ENST00000375587.3_Intron|ASPN_ENST00000375543.1_In_Frame_Ins_p.51_52insDE	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	51	Poly-Asp.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						GAGAGTTGTCCtcatcatcatc	0.396																																					p.E52delinsDEE		Atlas-INDEL	.											.,2	ASPN	52	.	0			c.156_157insTGAGGA						PASS	.																																			SO:0001652	inframe_insertion	54829	exon2			.	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.155_156insTGAGGA	chr9.hg19:g.95237024_95237025insTCCTCA	ENSP00000364694:p.Asp51_Glu52insAspGlu	49.0	0.0	0		67.0	24.0	0.358209	NM_001193335	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	In_Frame_Ins	INS	ENST00000375544.3	hg19																																																																																				.	-|0.500;TCA|0.500	.	alt		0.396	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680	
JADE3	9767	hgsc.bcm.edu	37	X	46918210	46918210	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chrX:46918210delA	ENST00000218343.4	+	11	2501	c.2203delA	c.(2203-2205)aagfs	p.K735fs	PHF16_ENST00000397189.1_Frame_Shift_Del_p.K735fs	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						GTGCTATGTGAAGCCAACCAA	0.488																																					p.V734fs		Atlas-INDEL	.											.	PHF16	72	.	0			c.2202delG						PASS	.						56.0	50.0	52.0					X																	46918210		2203	4300	6503	SO:0001589	frameshift_variant	9767	exon11			.																												ENST00000218343.4:c.2203delA	chrX.hg19:g.46918210delA	ENSP00000218343:p.Lys735fs	28.0	0.0	0		45.0	36.0	0.8	NM_014735		Frame_Shift_Del	DEL	ENST00000218343.4	hg19	CCDS14271.1																																																																																			.	.	.	none		0.488	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056376.1		
DNAH1	25981	hgsc.bcm.edu	37	3	52392687	52392687	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr3:52392687delG	ENST00000420323.2	+	25	4461	c.4200delG	c.(4198-4200)gagfs	p.E1400fs		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1400	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGCTGCGGGAGGTGGAGCGCA	0.632																																					p.E1400fs		Atlas-Indel,Pindel	.											.	DNAH1	534	.	0			c.4199delA						PASS	.						50.0	58.0	55.0					3																	52392687		2169	4259	6428	SO:0001589	frameshift_variant	25981	exon25			.	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.4200delG	chr3.hg19:g.52392687delG	ENSP00000401514:p.Glu1400fs	216.0	0.0	0		131.0	62.0	0.473282	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Frame_Shift_Del	DEL	ENST00000420323.2	hg19	CCDS46842.1																																																																																			.	.	.	none		0.632	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
CEP95	90799	hgsc.bcm.edu	37	17	62518864	62518864	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr17:62518864delG	ENST00000556440.2	+	8	1270	c.760delG	c.(760-762)gggfs	p.G254fs	CEP95_ENST00000553412.1_Frame_Shift_Del_p.G90fs	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	254						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						TAGGAAGCTAGGGGAGCCTAT	0.443																																					p.L253fs		Atlas-Indel,Pindel	.											.	CEP95	103	.	0			c.759delA						PASS	.						88.0	87.0	87.0					17																	62518864		1892	4115	6007	SO:0001589	frameshift_variant	90799	exon8			.	AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.760delG	chr17.hg19:g.62518864delG	ENSP00000450461:p.Gly254fs	89.0	0.0	0		141.0	75.0	0.531915	NM_138363	B4DMD2|Q96M81	Frame_Shift_Del	DEL	ENST00000556440.2	hg19	CCDS45763.1																																																																																			.	.	.	none		0.443	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2	NM_138363	
VTA1	51534	hgsc.bcm.edu	37	6	142491530	142491530	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr6:142491530delT	ENST00000367630.4	+	4	441	c.383delT	c.(382-384)atafs	p.I128fs	VTA1_ENST00000452973.2_Frame_Shift_Del_p.I70fs|VTA1_ENST00000367621.1_Frame_Shift_Del_p.I70fs|VTA1_ENST00000491881.1_3'UTR	NM_016485.3	NP_057569.2	Q9NP79	VTA1_HUMAN	vesicle (multivesicular body) trafficking 1	128	Interaction with IST1.				endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		ATAGATGTCATAACAGTATTT	0.318																																					p.I128X		Atlas-INDEL	.											.	VTA1	29	.	0			c.382delA						PASS	.						132.0	144.0	140.0					6																	142491530		2203	4294	6497	SO:0001589	frameshift_variant	51534	exon4			.	AF060225	CCDS5197.1, CCDS69214.1, CCDS75531.1	6q24.1	2013-08-05	2013-08-05	2007-04-03	ENSG00000009844	ENSG00000009844			20954	protein-coding gene	gene with protein product		610902	"""chromosome 6 open reading frame 55"", ""Vps20-associated 1 homolog (S. cerevisiae)"""	C6orf55		11489251, 15644320	Standard	NM_001286372		Approved	HSPC228, My012	uc003qiw.3	Q9NP79	OTTHUMG00000015707	ENST00000367630.4:c.383delT	chr6.hg19:g.142491530delT	ENSP00000356602:p.Ile128fs	15.0	0.0	0		28.0	10.0	0.357143	NM_016485	B4DW55|E1P594|E7ETQ7|Q5TGM1|Q6IAE8|Q9H0R2|Q9H3K9|Q9P0Q0	Frame_Shift_Del	DEL	ENST00000367630.4	hg19	CCDS5197.1																																																																																			.	.	.	none		0.318	VTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042483.2	NM_016485	
ROCK1	6093	hgsc.bcm.edu	37	18	18600173	18600174	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr18:18600173_18600174delTA	ENST00000399799.2	-	12	2239_2240	c.1299_1300delTA	c.(1297-1302)tataagfs	p.YK433fs		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	433	Interaction with FHOD1.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					TCTTCCAGCTTATAGATTGTTT	0.267																																					p.434_434del		Atlas-INDEL	.											.	ROCK1	162	.	0			c.1300_1301del						PASS	.																																			SO:0001589	frameshift_variant	6093	exon12			.		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.1299_1300delTA	chr18.hg19:g.18600175_18600176delTA	ENSP00000382697:p.Tyr433fs	40.0	0.0	0		20.0	10.0	0.5	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Frame_Shift_Del	DEL	ENST00000399799.2	hg19	CCDS11870.2																																																																																			.	.	.	none		0.267	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
CEP290	80184	hgsc.bcm.edu	37	12	88523531	88523532	+	Frame_Shift_Ins	INS	-	-	AAAA			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr12:88523531_88523532insAAAA	ENST00000552810.1	-	10	1134_1135	c.791_792insTTTT	c.(790-792)gtgfs	p.-264fs	CEP290_ENST00000309041.7_Frame_Shift_Ins_p.-264fs|CEP290_ENST00000397838.3_5'Flank	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CTGTCTGATGCACAATAGCTTT	0.272																																					p.V264fs		Atlas-INDEL	.											.	CEP290	195	.	0			c.792_793insTTTT						PASS	.																																			SO:0001589	frameshift_variant	80184	exon10			.	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.791_792insTTTT	chr12.hg19:g.88523531_88523532insAAAA	ENSP00000448012:p.Val264fs	56.0	0.0	0		145.0	12.0	0.0827586	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Frame_Shift_Ins	INS	ENST00000552810.1	hg19	CCDS55858.1																																																																																			.	.	.	none		0.272	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
LIAS	11019	hgsc.bcm.edu	37	4	39465225	39465225	+	Splice_Site	DEL	G	G	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr4:39465225delG	ENST00000261434.3	+	4	511	c.393delG	c.(391-393)atg>at	p.M131fs	LIAS_ENST00000381846.1_Splice_Site_p.M131fs|LIAS_ENST00000515061.1_3'UTR|LIAS_ENST00000340169.2_Splice_Site_p.M131fs|LIAS_ENST00000513731.1_Intron	NM_006859.2	NP_006850.2			lipoic acid synthetase											breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)|ovary(2)	12						CCACGATCATGGTAGGGCCAG	0.463																																					p.M131fs		Atlas-Indel,Pindel	.											.	LIAS	26	.	0			c.392delT						PASS	.						70.0	65.0	67.0					4																	39465225		2203	4300	6503	SO:0001630	splice_region_variant	11019	exon4			.	AJ224162	CCDS3453.1, CCDS3454.1, CCDS63950.1	4p14	2008-02-05			ENSG00000121897	ENSG00000121897			16429	protein-coding gene	gene with protein product		607031				11124703	Standard	NM_006859		Approved	LAS	uc003guf.3	O43766	OTTHUMG00000099369	ENST00000261434.3:c.393+1G>-	chr4.hg19:g.39465225delG		50.0	0.0	0		53.0	40.0	0.754717	NM_194451		Frame_Shift_Del	DEL	ENST00000261434.3	hg19	CCDS3453.1																																																																																			.	.	.	none		0.463	LIAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216815.1	NM_194451	Frame_Shift_Del
TPR	7175	hgsc.bcm.edu	37	1	186289494	186289494	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr1:186289494delG	ENST00000367478.4	-	46	6814	c.6518delC	c.(6517-6519)ccafs	p.P2173fs		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	2173					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ACTTGTTTGTGGCATATCTTC	0.398			T	NTRK1	papillary thyroid																																p.P2173fs		Atlas-Indel,Pindel	.		Dom	yes		1	1q25	7175	translocated promoter region		E	TPR_ENST00000367478,NS,carcinoma,0,2	TPR	441	.	0			c.6519delA						PASS	.						87.0	82.0	84.0					1																	186289494		1872	4103	5975	SO:0001589	frameshift_variant	7175	exon46			.	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.6518delC	chr1.hg19:g.186289494delG	ENSP00000356448:p.Pro2173fs	53.0	0.0	0		85.0	38.0	0.447059	NM_003292	Q15655|Q5SWY0|Q99968	Frame_Shift_Del	DEL	ENST00000367478.4	hg19	CCDS41446.1																																																																																			.	.	.	none		0.398	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
TMPRSS7	344805	hgsc.bcm.edu	37	3	111799843	111799844	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr3:111799843_111799844delGA	ENST00000452346.2	+	18	2447_2448	c.2444_2445delGA	c.(2443-2445)ggafs	p.G815fs	TMPRSS7_ENST00000419127.1_Frame_Shift_Del_p.G689fs			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	815	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TGGGGACATGGAAGTGGACGAC	0.411																																					p.689_689del		Atlas-INDEL	.											.	TMPRSS7	126	.	0			c.2065_2066del						PASS	.																																			SO:0001589	frameshift_variant	344805	exon16			.	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.2444_2445delGA	chr3.hg19:g.111799843_111799844delGA	ENSP00000398236:p.Gly815fs	197.0	0.0	0		147.0	43.0	0.292517	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Frame_Shift_Del	DEL	ENST00000452346.2	hg19																																																																																				.	.	.	none		0.411	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
CEP290	80184	hgsc.bcm.edu	37	12	88523533	88523534	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr12:88523533_88523534insA	ENST00000552810.1	-	10	1132_1133	c.789_790insT	c.(787-792)attgtgfs	p.V264fs	CEP290_ENST00000309041.7_Frame_Shift_Ins_p.V264fs|CEP290_ENST00000397838.3_5'Flank	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	264					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						GTCTGATGCACAATAGCTTTCA	0.272																																					p.V264fs		Atlas-INDEL	.											.	CEP290	195	.	0			c.790_791insT						PASS	.																																			SO:0001589	frameshift_variant	80184	exon10			.	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.790dupT	chr12.hg19:g.88523535_88523535dupA	ENSP00000448012:p.Val264fs	56.0	0.0	0		144.0	12.0	0.0833333	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Frame_Shift_Ins	INS	ENST00000552810.1	hg19	CCDS55858.1																																																																																			.	.	.	none		0.272	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
ZNF540	163255	hgsc.bcm.edu	37	19	38102608	38102609	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr19:38102608_38102609delAA	ENST00000592533.1	+	5	759_760	c.427_428delAA	c.(427-429)aaafs	p.K143fs	ZNF540_ENST00000343599.5_Frame_Shift_Del_p.K143fs|ZNF540_ENST00000586792.1_3'UTR|ZNF540_ENST00000316433.4_Frame_Shift_Del_p.K143fs|ZNF540_ENST00000589117.1_Frame_Shift_Del_p.K111fs	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	143					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAGTCAAAAGAAAATCGTCTCT	0.366																																					p.142_143del		Atlas-Indel,Pindel	.											.	ZNF540	75	.	0			c.426_427del						PASS	.																																			SO:0001589	frameshift_variant	163255	exon5			.	AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.427_428delAA	chr19.hg19:g.38102610_38102611delAA	ENSP00000466274:p.Lys143fs	127.0	0.0	0		137.0	55.0	0.40146	NM_152606	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Frame_Shift_Del	DEL	ENST00000592533.1	hg19	CCDS12506.1																																																																																			.	.	.	none		0.366	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459481.1	NM_152606	
TMPRSS7	344805	hgsc.bcm.edu	37	3	111799843	111799845	+	In_Frame_Del	DEL	GAA	GAA	-	rs340151	byFrequency	TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr3:111799843_111799845delGAA	ENST00000452346.2	+	18	2447_2449	c.2444_2446delGAA	c.(2443-2448)ggaagt>ggt	p.S816del	TMPRSS7_ENST00000419127.1_In_Frame_Del_p.S690del			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	816	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			S -> C (in Ref. 2; BAD18401 and 3; AAI17323). {ECO:0000305}.	proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TGGGGACATGGAAGTGGACGACC	0.409																																					p.689_689del		Pindel	.											.	TMPRSS7	126	.	0			c.2065_2067del						PASS	.																																			SO:0001651	inframe_deletion	344805	exon16			.	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.2444_2446delGAA	chr3.hg19:g.111799843_111799845delGAA	ENSP00000398236:p.Ser816del	200.0	0.0	.		148.0	36.0	0.243	NM_001042575	C9J8P7|E9PAS3|Q17RH4	In_Frame_Del	DEL	ENST00000452346.2	hg19																																																																																				.	.	.	none		0.409	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
JADE3	9767	hgsc.bcm.edu	37	X	46918210	46918211	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chrX:46918210_46918211delAA	ENST00000218343.4	+	11	2501_2502	c.2203_2204delAA	c.(2203-2205)aagfs	p.K735fs	PHF16_ENST00000397189.1_Frame_Shift_Del_p.K735fs	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						GTGCTATGTGAAGCCAACCAAG	0.49																																					p.734_735del		Pindel	.											.	PHF16	72	.	0			c.2202_2203del						PASS	.																																			SO:0001589	frameshift_variant	9767	exon11			.																												ENST00000218343.4:c.2203_2204delAA	chrX.hg19:g.46918210_46918211delAA	ENSP00000218343:p.Lys735fs	28.0	0.0	.		45.0	26.0	0.578	NM_014735		Frame_Shift_Del	DEL	ENST00000218343.4	hg19	CCDS14271.1																																																																																			.	.	.	none		0.490	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056376.1		
USH1G	124590	hgsc.bcm.edu	37	17	72919094	72919095	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr17:72919094_72919095delCA	ENST00000319642.1	-	1	256_257	c.74_75delTG	c.(73-75)ctgfs	p.L25fs	OTOP2_ENST00000580223.1_5'Flank|OTOP2_ENST00000331427.4_5'Flank	NM_001282489.1|NM_173477.2	NP_001269418.1|NP_775748.2	Q495M9	USH1G_HUMAN	Usher syndrome 1G (autosomal recessive)	25					equilibrioception (GO:0050957)|inner ear morphogenesis (GO:0042472)|inner ear receptor cell differentiation (GO:0060113)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	spectrin binding (GO:0030507)		HN1/USH1G(2)	endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(3)	14	all_lung(278;0.172)|Lung NSC(278;0.207)					CGGGGGCATTCAGCTCCTTTCG	0.668																																					p.25_26del		Pindel	.											.	USH1G	40	.	0			c.75_76del						PASS	.																																			SO:0001589	frameshift_variant	124590	exon1			.	AK091243	CCDS32725.1	17q25.1	2013-01-10			ENSG00000182040	ENSG00000182040		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	16356	protein-coding gene	gene with protein product		607696				12588794	Standard	NM_001282489		Approved	Sans, FLJ33924, ANKS4A	uc002jme.1	Q495M9	OTTHUMG00000178864	ENST00000319642.1:c.74_75delTG	chr17.hg19:g.72919094_72919095delCA	ENSP00000320076:p.Leu25fs	194.0	0.0	.		127.0	30.0	0.236	NM_173477	Q8N251	Frame_Shift_Del	DEL	ENST00000319642.1	hg19	CCDS32725.1																																																																																			.	.	.	none		0.668	USH1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443676.1	NM_173477	
CEP290	80184	hgsc.bcm.edu	37	12	88523533	88523533	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JG-01A-11D-A42J-10	TCGA-2Z-A9JG-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7c8dab16-b1ab-45d2-b73f-239d8a74c8c3	c6173f98-c359-458d-a604-779cc45d612f	g.chr12:88523533delC	ENST00000552810.1	-	10	1133	c.790delG	c.(790-792)gtgfs	p.V264fs	CEP290_ENST00000309041.7_Frame_Shift_Del_p.V264fs|CEP290_ENST00000397838.3_5'Flank	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	264					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						GTCTGATGCACAATAGCTTTC	0.274																																					p.V264fs		Pindel	.											.	CEP290	195	.	0			c.791delT						PASS	.						50.0	46.0	47.0					12																	88523533		1744	3947	5691	SO:0001589	frameshift_variant	80184	exon10			.	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.790delG	chr12.hg19:g.88523533delC	ENSP00000448012:p.Val264fs	56.0	0.0	.		145.0	12.0	0.083	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Frame_Shift_Del	DEL	ENST00000552810.1	hg19	CCDS55858.1																																																																																			.	.	.	none		0.274	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
