#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLOD1	5351	hgsc.bcm.edu	37	1	12030830	12030830	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:12030830T>G	ENST00000196061.4	+	17	1886	c.1859T>G	c.(1858-1860)aTt>aGt	p.I620S	PLOD1_ENST00000376369.3_Missense_Mutation_p.I667S	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	620					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	CTGGAGTACATTGCGCCCATG	0.592																																					p.I620S		Atlas-SNP	.											.	PLOD1	75	.	0			c.T1859G						PASS	.						100.0	83.0	89.0					1																	12030830		2203	4300	6503	SO:0001583	missense	5351	exon17			AGTACATTGCGCC	BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1859T>G	chr1.hg19:g.12030830T>G	ENSP00000196061:p.Ile620Ser	151.0	0.0	.		70.0	13.0	.	NM_000302	B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	ENST00000196061.4	hg19	CCDS142.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.681482	0.88542	.	.	ENSG00000083444	ENST00000414311;ENST00000376369;ENST00000196061	T;T	0.68765	-0.35;-0.35	5.94	5.94	0.96194	Prolyl 4-hydroxylase, alpha subunit (1);	0.150032	0.56097	D	0.000024	T	0.69169	0.3081	M	0.83953	2.67	0.80722	D	1	P;B	0.40431	0.717;0.434	B;B	0.35413	0.202;0.202	T	0.75816	-0.3184	10	0.87932	D	0	.	15.579	0.76418	0.0:0.0:0.0:1.0	.	667;620	B4DR87;Q02809	.;PLOD1_HUMAN	S	284;667;620	ENSP00000365548:I667S;ENSP00000196061:I620S	ENSP00000196061:I620S	I	+	2	0	PLOD1	11953417	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.267000	0.72546	2.279000	0.76181	0.459000	0.35465	ATT	.	.	.	none		0.592	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	NM_000302	
PTPRU	10076	hgsc.bcm.edu	37	1	29585229	29585229	+	Missense_Mutation	SNP	G	G	T	rs145487041		TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:29585229G>T	ENST00000345512.3	+	3	547	c.418G>T	c.(418-420)Ggc>Tgc	p.G140C	PTPRU_ENST00000428026.2_Missense_Mutation_p.G140C|PTPRU_ENST00000356870.3_Missense_Mutation_p.G140C|PTPRU_ENST00000460170.2_Missense_Mutation_p.G140C|PTPRU_ENST00000323874.8_Missense_Mutation_p.G140C|PTPRU_ENST00000373779.3_Missense_Mutation_p.G140C	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	140	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		TGGATCCCACGGCCGTCAGTG	0.642																																					p.G140C		Atlas-SNP	.											.	PTPRU	374	.	0			c.G418T						PASS	.						58.0	58.0	58.0					1																	29585229		2203	4300	6503	SO:0001583	missense	10076	exon3			TCCCACGGCCGTC	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.418G>T	chr1.hg19:g.29585229G>T	ENSP00000334941:p.Gly140Cys	130.0	0.0	.		107.0	6.0	.	NM_001195001	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	hg19	CCDS334.1	.	.	.	.	.	.	.	.	.	.	G	32	5.152038	0.94645	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.02974	4.09;4.09;4.09;4.09;4.09;4.09	5.72	5.72	0.89469	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.140445	0.46145	D	0.000315	T	0.20941	0.0504	M	0.89478	3.035	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.994;0.994;0.994;0.996;0.996	T	0.00446	-1.1734	9	.	.	.	.	18.8634	0.92281	0.0:0.0:1.0:0.0	.	140;140;140;140;140	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	C	140	ENSP00000334941:G140C;ENSP00000362884:G140C;ENSP00000349333:G140C;ENSP00000314987:G140C;ENSP00000392332:G140C;ENSP00000432906:G140C	.	G	+	1	0	PTPRU	29457816	1.000000	0.71417	0.961000	0.40146	0.975000	0.68041	9.869000	0.99810	2.699000	0.92147	0.591000	0.81541	GGC	.	G|1.000;A|0.000	.	alt		0.642	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
B4GALT2	8704	hgsc.bcm.edu	37	1	44447485	44447485	+	Silent	SNP	G	G	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:44447485G>T	ENST00000356836.6	+	3	1228	c.438G>T	c.(436-438)gcG>gcT	p.A146A	B4GALT2_ENST00000434555.2_Silent_p.A80A|B4GALT2_ENST00000309519.7_Silent_p.A175A|B4GALT2_ENST00000372324.1_Silent_p.A146A	NM_001005417.2|NM_030587.2	NP_001005417.1|NP_085076.2	O60909	B4GT2_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2	146					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)	p.A146A(1)		endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			N-Acetyl-D-glucosamine(DB00141)	AGACGGTGGCGGTCATCATCC	0.657																																					p.A175A		Atlas-SNP	.											B4GALT2,pharynx,carcinoma,0,1	B4GALT2	35	.	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.G525T						PASS	.						73.0	63.0	67.0					1																	44447485		2203	4300	6503	SO:0001819	synonymous_variant	8704	exon3			GGTGGCGGTCATC	AF038660	CCDS506.1, CCDS55596.1	1p34-p33	2013-02-19			ENSG00000117411	ENSG00000117411		"""Beta 4-glycosyltransferases"""	925	protein-coding gene	gene with protein product		604013				9405390, 9597550	Standard	NM_003780		Approved	beta4Gal-T2	uc010okl.2	O60909	OTTHUMG00000008296	ENST00000356836.6:c.438G>T	chr1.hg19:g.44447485G>T		235.0	0.0	.		139.0	31.0	.	NM_030587	B3KTP0|B4DE14|D3DPY6|D3DPY7|O60511|Q4V9L9|Q5T4X5|Q5T4Y5|Q9BUP6|Q9NSY7	Silent	SNP	ENST00000356836.6	hg19	CCDS506.1																																																																																			.	.	.	none		0.657	B4GALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022840.1	NM_003780	
DOCK7	85440	hgsc.bcm.edu	37	1	63096983	63096983	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:63096983G>T	ENST00000340370.5	-	11	1227	c.1210C>A	c.(1210-1212)Cat>Aat	p.H404N	DOCK7_ENST00000404627.2_Missense_Mutation_p.H404N|DOCK7_ENST00000251157.5_Missense_Mutation_p.H404N	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	404					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TTCATTAAATGGATTGCAGTC	0.373																																					p.H404N		Atlas-SNP	.											.	DOCK7	184	.	0			c.C1210A						PASS	.						90.0	86.0	87.0					1																	63096983		2202	4300	6502	SO:0001583	missense	85440	exon11			TTAAATGGATTGC		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.1210C>A	chr1.hg19:g.63096983G>T	ENSP00000340742:p.His404Asn	344.0	0.0	.		259.0	66.0	.	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	hg19	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723622	0.48728	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000404627	T;T;T	0.40756	1.02;1.02;1.02	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.50240	0.1604	L	0.52126	1.63	0.80722	D	1	P;D;B;D;B	0.89917	0.823;1.0;0.383;0.998;0.036	B;D;B;D;B	0.83275	0.414;0.991;0.219;0.996;0.034	T	0.32745	-0.9895	10	0.27785	T	0.31	.	18.2163	0.89886	0.0:0.0:1.0:0.0	.	404;404;404;404;404	Q96NI0;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3	.;.;.;.;.	N	404	ENSP00000251157:H404N;ENSP00000340742:H404N;ENSP00000384446:H404N	ENSP00000251157:H404N	H	-	1	0	DOCK7	62869571	1.000000	0.71417	0.999000	0.59377	0.353000	0.29299	9.652000	0.98499	2.519000	0.84933	0.655000	0.94253	CAT	.	.	.	none		0.373	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
RBM8A	9939	hgsc.bcm.edu	37	1	145507671	145507671	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:145507671C>T	ENST00000330165.8	+	1	74	c.5C>T	c.(4-6)gCg>gTg	p.A2V	RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000596355.1_RNA|RP11-315I20.1_ENST00000447686.2_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RBM8A_ENST00000369307.3_Missense_Mutation_p.A2V|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|GNRHR2_ENST00000312753.5_RNA|RP11-315I20.1_ENST00000595494.1_RNA	NM_005105.3	NP_005096.1	Q9Y5S9	RBM8A_HUMAN	RNA binding motif protein 8A	2					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGCGAGATGGCGGACGTGCTA	0.597											OREG0013748	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A2V		Atlas-SNP	.											.	RBM8A	18	.	0			c.C5T						PASS	.						43.0	32.0	36.0					1																	145507671		2203	4296	6499	SO:0001583	missense	9939	exon1			AGATGGCGGACGT	AF127761	CCDS72872.1	1q21.1	2013-02-12			ENSG00000131795			"""RNA binding motif (RRM) containing"""	9905	protein-coding gene	gene with protein product		605313		RBM8		11004516, 11013075	Standard	NM_005105		Approved	ZNRP, BOV-1A, BOV-1B, BOV-1C, RBM8B, Y14	uc001ent.2	Q9Y5S9	OTTHUMG00000013736	ENST00000330165.8:c.5C>T	chr1.hg19:g.145507671C>T	ENSP00000333001:p.Ala2Val	140.0	0.0	.	1695	81.0	20.0	.	NM_005105	B3KQI9|Q6FHD1|Q6IQ40|Q9GZX8|Q9NZI4	Missense_Mutation	SNP	ENST00000330165.8	hg19	CCDS916.1	.	.	.	.	.	.	.	.	.	.	C	32	5.170105	0.94768	.	.	ENSG00000131795	ENST00000330165;ENST00000369307	T;T	0.16743	2.37;2.32	4.83	3.9	0.45041	.	0.059004	0.64402	D	0.000003	T	0.29652	0.0740	M	0.80847	2.515	0.58432	D	0.999996	D;D	0.76494	0.999;0.994	P;P	0.61940	0.896;0.575	T	0.21008	-1.0258	10	0.87932	D	0	-0.8918	13.1116	0.59277	0.0:0.8376:0.1624:0.0	.	2;2	Q9Y5S9-2;Q9Y5S9	.;RBM8A_HUMAN	V	2	ENSP00000333001:A2V;ENSP00000358313:A2V	ENSP00000333001:A2V	A	+	2	0	RBM8A	144219028	1.000000	0.71417	0.999000	0.59377	0.907000	0.53573	4.593000	0.61034	1.380000	0.46344	0.650000	0.86243	GCG	.	.	.	none		0.597	RBM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038503.2	NM_005105	
CACNA1E	777	hgsc.bcm.edu	37	1	181727893	181727893	+	Splice_Site	SNP	G	G	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:181727893G>T	ENST00000367573.2	+	32	4494		c.e32-1		CACNA1E_ENST00000367570.1_Splice_Site|CACNA1E_ENST00000367567.4_Splice_Site|CACNA1E_ENST00000526775.1_Splice_Site|CACNA1E_ENST00000357570.5_Splice_Site|CACNA1E_ENST00000358338.5_Splice_Site|CACNA1E_ENST00000360108.3_Splice_Site	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit						calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CTTCCTGGCAGTATTATTCTG	0.483																																					.		Atlas-SNP	.											.	CACNA1E	778	.	0			c.4495-1G>T						PASS	.						212.0	189.0	196.0					1																	181727893		1933	4148	6081	SO:0001630	splice_region_variant	777	exon32			CTGGCAGTATTAT	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4495-1G>T	chr1.hg19:g.181727893G>T		85.0	0.0	.		56.0	4.0	.	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Splice_Site	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703404	0.88924	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0045	0.92844	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1E	179994516	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.338000	0.96553	2.583000	0.87209	0.561000	0.74099	.	.	.	.	none		0.483	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	Intron
ZNF648	127665	hgsc.bcm.edu	37	1	182027010	182027010	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:182027010C>G	ENST00000339948.3	-	2	343	c.136G>C	c.(136-138)Gag>Cag	p.E46Q		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	46					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						GCGGTGCCCTCTTTTTCGGCC	0.572																																					p.E46Q	NSCLC(71;908 1374 5429 20458 35642)	Atlas-SNP	.											.	ZNF648	111	.	0			c.G136C						PASS	.						94.0	90.0	92.0					1																	182027010		2203	4300	6503	SO:0001583	missense	127665	exon2			TGCCCTCTTTTTC	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.136G>C	chr1.hg19:g.182027010C>G	ENSP00000344129:p.Glu46Gln	142.0	0.0	.		85.0	22.0	.	NM_001009992	B2RP16	Missense_Mutation	SNP	ENST00000339948.3	hg19	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	C	4.143	0.024840	0.08054	.	.	ENSG00000179930	ENST00000339948	T	0.08546	3.08	2.36	-0.605	0.11623	.	.	.	.	.	T	0.02342	0.0072	N	0.03608	-0.345	0.09310	N	1	B	0.29432	0.244	B	0.14578	0.011	T	0.44711	-0.9310	9	0.13853	T	0.58	.	2.579	0.04814	0.2206:0.3541:0.0:0.4253	.	46	Q5T619	ZN648_HUMAN	Q	46	ENSP00000344129:E46Q	ENSP00000344129:E46Q	E	-	1	0	ZNF648	180293633	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.574000	0.05868	-0.145000	0.11294	-0.140000	0.14226	GAG	.	.	.	none		0.572	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
PRG4	10216	hgsc.bcm.edu	37	1	186276990	186276990	+	Silent	SNP	T	T	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:186276990T>A	ENST00000445192.2	+	7	2184	c.2139T>A	c.(2137-2139)gcT>gcA	p.A713A	PRG4_ENST00000367486.3_Silent_p.A670A|PRG4_ENST00000367483.4_Silent_p.A672A|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_Silent_p.A620A	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	713	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AAGGGACTGCTCCAACTACCC	0.587																																					p.A713A		Atlas-SNP	.											.	PRG4	259	.	0			c.T2139A						PASS	.						163.0	176.0	172.0					1																	186276990		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon7			GACTGCTCCAACT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2139T>A	chr1.hg19:g.186276990T>A		114.0	0.0	.		96.0	29.0	.	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	hg19	CCDS1369.1																																																																																			.	.	.	none		0.587	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
SLC30A10	55532	hgsc.bcm.edu	37	1	220101416	220101416	+	Missense_Mutation	SNP	C	C	G	rs575895791		TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:220101416C>G	ENST00000366926.3	-	1	528	c.367G>C	c.(367-369)Ggg>Cgg	p.G123R	SLC30A10_ENST00000536992.1_Missense_Mutation_p.G123R|SLC30A10_ENST00000536446.1_Intron	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	123					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		ACCAACAGCCCCAGGACGCCG	0.701																																					p.G123R	Colon(76;360 1614 43677 51136)	Atlas-SNP	.											.	SLC30A10	58	.	0			c.G367C						PASS	.						6.0	7.0	7.0					1																	220101416		2096	4139	6235	SO:0001583	missense	55532	exon1			ACAGCCCCAGGAC	AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.367G>C	chr1.hg19:g.220101416C>G	ENSP00000355893:p.Gly123Arg	378.0	0.0	.		207.0	50.0	.	NM_018713	Q49AL9|Q9NPW0	Missense_Mutation	SNP	ENST00000366926.3	hg19	CCDS31026.1	.	.	.	.	.	.	.	.	.	.	C	33	5.218613	0.95104	.	.	ENSG00000196660	ENST00000366926;ENST00000536992	T;T	0.67698	-0.28;-0.28	3.83	3.83	0.44106	.	0.068464	0.56097	D	0.000024	D	0.86401	0.5924	H	0.97540	4.025	0.58432	D	0.999998	D	0.65815	0.995	P	0.60345	0.873	D	0.92052	0.5649	9	.	.	.	-26.9391	16.2635	0.82563	0.0:1.0:0.0:0.0	.	123	Q6XR72	ZNT10_HUMAN	R	123	ENSP00000355893:G123R;ENSP00000440627:G123R	.	G	-	1	0	SLC30A10	218168039	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.241000	0.78201	2.120000	0.65058	0.491000	0.48974	GGG	.	.	.	none		0.701	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713	
CEP170	9859	hgsc.bcm.edu	37	1	243329104	243329104	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr1:243329104G>A	ENST00000366542.1	-	13	2209	c.2158C>T	c.(2158-2160)Ctt>Ttt	p.L720F	RP11-261C10.4_ENST00000422938.1_RNA|CEP170_ENST00000366544.1_Missense_Mutation_p.L622F|CEP170_ENST00000490813.1_5'Flank|RP11-261C10.4_ENST00000437499.1_RNA|CEP170_ENST00000366543.1_Missense_Mutation_p.L622F	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	720						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			CCTAAGTGAAGTAGGGTTTTA	0.383																																					p.L720F		Atlas-SNP	.											.	CEP170	153	.	0			c.C2158T						PASS	.						147.0	135.0	138.0					1																	243329104		1831	4076	5907	SO:0001583	missense	9859	exon13			AGTGAAGTAGGGT	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.2158C>T	chr1.hg19:g.243329104G>A	ENSP00000355500:p.Leu720Phe	33.0	0.0	.		97.0	18.0	.	NM_014812	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	ENST00000366542.1	hg19	CCDS44339.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.417794	0.00188	.	.	ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543	T;T;T	0.46063	0.9;0.89;0.88	5.25	3.19	0.36642	.	0.544947	0.17645	N	0.166872	T	0.18383	0.0441	N	0.08118	0	0.09310	N	0.999998	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.10450	0.005;0.001;0.001;0.002	T	0.27673	-1.0067	10	0.09590	T	0.72	-0.0301	6.3901	0.21581	0.3865:0.0:0.6135:0.0	.	683;622;622;720	B1ARM6;Q5SW79-3;Q5SW79-2;Q5SW79	.;.;.;CE170_HUMAN	F	720;622;622	ENSP00000355500:L720F;ENSP00000355502:L622F;ENSP00000355501:L622F	ENSP00000355500:L720F	L	-	1	0	CEP170	241395727	0.877000	0.30153	0.039000	0.18376	0.213000	0.24496	1.532000	0.36029	0.496000	0.27904	0.484000	0.47621	CTT	.	.	.	none		0.383	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
CGREF1	10669	hgsc.bcm.edu	37	2	27324530	27324530	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr2:27324530T>G	ENST00000260595.5	-	6	861	c.569A>C	c.(568-570)gAa>gCa	p.E190A	CGREF1_ENST00000404694.3_Missense_Mutation_p.E312A|CGREF1_ENST00000402550.1_Intron|CGREF1_ENST00000402394.1_Missense_Mutation_p.E190A|CGREF1_ENST00000452318.2_Intron|CGREF1_ENST00000312734.4_Missense_Mutation_p.E190A|CGREF1_ENST00000405600.1_Missense_Mutation_p.E190A			Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1	190					cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			kidney(1)|lung(4)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCCTTTGCTTCTTCTCTGGG	0.572																																					p.E190A		Atlas-SNP	.											.	CGREF1	31	.	0			c.A569C						PASS	.						113.0	127.0	122.0					2																	27324530		2203	4300	6503	SO:0001583	missense	10669	exon6			TTTGCTTCTTCTC	BC034764	CCDS33162.1, CCDS33162.2, CCDS54339.1	2p23.3	2013-01-10			ENSG00000138028	ENSG00000138028		"""EF-hand domain containing"""	16962	protein-coding gene	gene with protein product		606137				8968090	Standard	NM_006569		Approved	CGR11	uc002riq.3	Q99674	OTTHUMG00000152009	ENST00000260595.5:c.569A>C	chr2.hg19:g.27324530T>G	ENSP00000260595:p.Glu190Ala	76.0	0.0	.		48.0	8.0	.	NM_001166239	A6NHV7|B4DXY8|B5MCB7|B5MCC9|B5MCP5|E7EU99|Q8N4B7	Missense_Mutation	SNP	ENST00000260595.5	hg19		.	.	.	.	.	.	.	.	.	.	T	9.570	1.120780	0.20877	.	.	ENSG00000138028	ENST00000402394;ENST00000405600;ENST00000389521;ENST00000312734;ENST00000404694;ENST00000260595	T;T;T;T;T	0.79141	-1.16;-1.16;-1.16;-1.19;-1.24	5.0	-0.767	0.11016	.	1.119980	0.06665	N	0.765091	T	0.66376	0.2783	.	.	.	0.09310	N	1	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.12156	0.007;0.004;0.004	T	0.53641	-0.8410	9	0.48119	T	0.1	-19.8	7.492	0.27466	0.0:0.079:0.4061:0.5149	.	312;190;190	B5MCC9;B5MCP5;Q99674	.;.;CGRE1_HUMAN	A	190;190;190;190;312;190	ENSP00000385452:E190A;ENSP00000386113:E190A;ENSP00000324025:E190A;ENSP00000385574:E312A;ENSP00000260595:E190A	ENSP00000260595:E190A	E	-	2	0	CGREF1	27178034	0.000000	0.05858	0.011000	0.14972	0.004000	0.04260	-0.031000	0.12287	-0.061000	0.13110	-0.817000	0.03123	GAA	.	.	.	none		0.572	CGREF1-201	KNOWN	basic	protein_coding	protein_coding		NM_006569	
SULT1C4	27233	hgsc.bcm.edu	37	2	108998295	108998295	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr2:108998295C>T	ENST00000272452.2	+	2	573	c.247C>T	c.(247-249)Cat>Tat	p.H83Y	SULT1C4_ENST00000409309.3_Missense_Mutation_p.H83Y	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	83					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						GGCACCGACTCATCAACGATT	0.398																																					p.H83Y		Atlas-SNP	.											.	SULT1C4	41	.	0			c.C247T						PASS	.						141.0	121.0	128.0					2																	108998295		2203	4300	6503	SO:0001583	missense	27233	exon2			CCGACTCATCAAC	AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.247C>T	chr2.hg19:g.108998295C>T	ENSP00000272452:p.His83Tyr	192.0	0.0	.		166.0	38.0	.	NM_006588	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000272452.2	hg19	CCDS2077.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.590686	0.00126	.	.	ENSG00000198075	ENST00000272452;ENST00000409309	D;D	0.82526	-1.62;-1.62	4.33	2.52	0.30459	Sulfotransferase domain (1);	0.595797	0.15452	N	0.261600	T	0.65616	0.2708	N	0.25957	0.775	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.001	B;B;B	0.12837	0.008;0.005;0.006	T	0.49624	-0.8920	10	0.02654	T	1	.	5.8095	0.18457	0.0:0.5749:0.0:0.4251	.	83;83;83	Q08AS5;O75897;Q6PD90	.;ST1C4_HUMAN;.	Y	83	ENSP00000272452:H83Y;ENSP00000387225:H83Y	ENSP00000272452:H83Y	H	+	1	0	SULT1C4	108364727	0.000000	0.05858	0.002000	0.10522	0.071000	0.16799	0.010000	0.13242	0.569000	0.29329	0.609000	0.83330	CAT	.	.	.	none		0.398	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125192134	125192134	+	Silent	SNP	C	C	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr2:125192134C>G	ENST00000431078.1	+	5	967	c.603C>G	c.(601-603)ctC>ctG	p.L201L		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	201	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGAGTACTCTCAAAGATGTGA	0.483																																					p.L201L		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.C603G						PASS	.						123.0	118.0	120.0					2																	125192134		2000	4194	6194	SO:0001819	synonymous_variant	129684	exon5			TACTCTCAAAGAT	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.603C>G	chr2.hg19:g.125192134C>G		121.0	0.0	.		92.0	25.0	.	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	hg19	CCDS46401.1																																																																																			.	.	.	none		0.483	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
CCDC115	84317	hgsc.bcm.edu	37	2	131099478	131099478	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr2:131099478C>T	ENST00000259229.2	-	2	374	c.151G>A	c.(151-153)Gcc>Acc	p.A51T	CCDC115_ENST00000409127.1_Missense_Mutation_p.A46T|IMP4_ENST00000409935.1_5'Flank|IMP4_ENST00000259239.3_5'Flank|CCDC115_ENST00000437688.2_Missense_Mutation_p.A46T	NM_032357.2	NP_115733.2	Q96NT0	CC115_HUMAN	coiled-coil domain containing 115	51						endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	7	Colorectal(110;0.1)					ACCGACTTGGCGCCCATCGCG	0.672																																					p.A51T		Atlas-SNP	.											.	CCDC115	19	.	0			c.G151A						PASS	.						37.0	40.0	39.0					2																	131099478		2203	4300	6503	SO:0001583	missense	84317	exon2			ACTTGGCGCCCAT	AK054693	CCDS2159.1	2q21.1	2010-12-24			ENSG00000136710	ENSG00000136710			28178	protein-coding gene	gene with protein product		613734				21118521	Standard	XM_005263825		Approved	MGC12981, FLJ30131, ccp1	uc002tqy.1	Q96NT0	OTTHUMG00000131631	ENST00000259229.2:c.151G>A	chr2.hg19:g.131099478C>T	ENSP00000259229:p.Ala51Thr	131.0	0.0	.		94.0	4.0	.	NM_032357	B4DJ47|Q9BR88	Missense_Mutation	SNP	ENST00000259229.2	hg19	CCDS2159.1	.	.	.	.	.	.	.	.	.	.	C	0.224	-1.026510	0.02045	.	.	ENSG00000136710	ENST00000259229;ENST00000409127;ENST00000437688	D;D;D	0.93488	-3.23;-3.23;-3.23	4.81	3.93	0.45458	.	0.385448	0.29034	N	0.013355	D	0.90721	0.7088	M	0.72118	2.19	0.23356	N	0.997847	B;B;B;B	0.24132	0.023;0.006;0.098;0.023	B;B;B;B	0.17433	0.018;0.011;0.018;0.018	T	0.76801	-0.2825	10	0.14252	T	0.57	-10.8785	12.2248	0.54453	0.0:0.9104:0.0:0.0896	.	46;51;51;46	B4DJ47;F8WCZ3;Q96NT0;B8ZZ99	.;.;CC115_HUMAN;.	T	51;46;46	ENSP00000259229:A51T;ENSP00000387301:A46T;ENSP00000399756:A46T	ENSP00000259229:A51T	A	-	1	0	CCDC115	130815948	0.527000	0.26306	0.976000	0.42696	0.085000	0.17905	0.339000	0.19875	0.761000	0.33130	-0.797000	0.03246	GCC	.	.	.	none		0.672	CCDC115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254524.2	NM_032357	
XRN1	54464	hgsc.bcm.edu	37	3	142137718	142137718	+	Silent	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr3:142137718C>T	ENST00000264951.4	-	11	1296	c.1179G>A	c.(1177-1179)caG>caA	p.Q393Q	XRN1_ENST00000544157.1_Silent_p.Q183Q|RNU1-100P_ENST00000365255.1_RNA|XRN1_ENST00000392981.2_Silent_p.Q393Q|XRN1_ENST00000463916.1_Silent_p.Q393Q	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	393					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						GAGAATTTTCCTGGCCCTGTA	0.333																																					p.Q393Q		Atlas-SNP	.											.	XRN1	138	.	0			c.G1179A						PASS	.						83.0	82.0	83.0					3																	142137718		2202	4298	6500	SO:0001819	synonymous_variant	54464	exon11			ATTTTCCTGGCCC	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1179G>A	chr3.hg19:g.142137718C>T		189.0	0.0	.		155.0	25.0	.	NM_001042604	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Silent	SNP	ENST00000264951.4	hg19	CCDS3123.1																																																																																			.	.	.	none		0.333	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
PPARGC1A	10891	hgsc.bcm.edu	37	4	23886468	23886468	+	Silent	SNP	A	A	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr4:23886468A>G	ENST00000264867.2	-	2	260	c.141T>C	c.(139-141)gaT>gaC	p.D47D	PPARGC1A_ENST00000509702.1_5'Flank|PPARGC1A_ENST00000507380.1_Silent_p.D47D	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	47					androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				AGCTGTCTGTATCCAAGTCGT	0.453																																					p.D47D	Esophageal Squamous(29;694 744 13796 34866 44181)	Atlas-SNP	.											.	PPARGC1A	129	.	0			c.T141C						PASS	.						105.0	96.0	99.0					4																	23886468		2203	4300	6503	SO:0001819	synonymous_variant	10891	exon2			GTCTGTATCCAAG	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.141T>C	chr4.hg19:g.23886468A>G		68.0	0.0	.		84.0	19.0	.	NM_013261	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Silent	SNP	ENST00000264867.2	hg19	CCDS3429.1																																																																																			.	.	.	none		0.453	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261	
TMPRSS11D	9407	hgsc.bcm.edu	37	4	68699085	68699085	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr4:68699085G>C	ENST00000283916.6	-	7	627	c.529C>G	c.(529-531)Cca>Gca	p.P177A	TMPRSS11D_ENST00000509584.1_5'UTR|TMPRSS11D_ENST00000545541.1_Missense_Mutation_p.P60A|UBA6-AS1_ENST00000500538.2_RNA	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	177					proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						ATTAGGTCTGGACCGGCCCCA	0.473																																					p.P177A		Atlas-SNP	.											.	TMPRSS11D	68	.	0			c.C529G						PASS	.						119.0	112.0	115.0					4																	68699085		2203	4300	6503	SO:0001583	missense	9407	exon7			GGTCTGGACCGGC	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.529C>G	chr4.hg19:g.68699085G>C	ENSP00000283916:p.Pro177Ala	78.0	0.0	.		56.0	10.0	.	NM_004262	Q08AF6	Missense_Mutation	SNP	ENST00000283916.6	hg19	CCDS3518.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081750	0.36758	.	.	ENSG00000153802	ENST00000283916;ENST00000545541	D;D	0.88354	-2.37;-2.33	5.6	0.928	0.19443	Peptidase cysteine/serine, trypsin-like (1);	0.225492	0.31612	N	0.007344	T	0.69655	0.3135	N	0.08118	0	0.25528	N	0.987309	B	0.30406	0.278	B	0.30179	0.112	T	0.59616	-0.7421	10	0.10636	T	0.68	.	3.9107	0.09202	0.337:0.0:0.5055:0.1575	.	177	O60235	TM11D_HUMAN	A	177;60	ENSP00000283916:P177A;ENSP00000442045:P60A	ENSP00000283916:P177A	P	-	1	0	TMPRSS11D	68381680	0.020000	0.18652	0.951000	0.38953	0.767000	0.43475	0.094000	0.15107	0.053000	0.16036	-0.142000	0.14014	CCA	.	.	.	none		0.473	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251430.3	NM_004262	
C4orf3	401152	hgsc.bcm.edu	37	4	120221611	120221611	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr4:120221611T>G	ENST00000504110.1	-	1	465	c.80A>C	c.(79-81)aAc>aCc	p.N27T	C4orf3_ENST00000399075.4_Missense_Mutation_p.N160T	NM_001001701.3	NP_001001701.2	Q8WVX3	CD003_HUMAN	chromosome 4 open reading frame 3	27						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(4)	6						CACATCGAAGTTCTGCCTCCC	0.572																																					p.N160T		Atlas-SNP	.											.	C4orf3	16	.	0			c.A479C						PASS	.						159.0	168.0	165.0					4																	120221611		2000	4164	6164	SO:0001583	missense	401152	exon2			TCGAAGTTCTGCC		CCDS43266.1, CCDS54798.1	4q26	2012-02-24			ENSG00000164096	ENSG00000164096			19225	protein-coding gene	gene with protein product	"""HCV F-transactivated protein 1"""						Standard	NM_001001701		Approved		uc021xrf.1	Q8WVX3	OTTHUMG00000161333	ENST00000504110.1:c.80A>C	chr4.hg19:g.120221611T>G	ENSP00000427214:p.Asn27Thr	130.0	0.0	.		85.0	19.0	.	NM_001170330	Q6J203	Missense_Mutation	SNP	ENST00000504110.1	hg19	CCDS43266.1	.	.	.	.	.	.	.	.	.	.	T	15.24	2.774317	0.49786	.	.	ENSG00000164096	ENST00000399075;ENST00000504110	T;T	0.36340	1.26;1.29	4.91	-3.88	0.04205	.	1.224740	0.06070	N	0.659986	T	0.25044	0.0608	.	.	.	0.26239	N	0.978893	B	0.24368	0.102	B	0.24701	0.055	T	0.42982	-0.9419	8	0.72032	D	0.01	0.36	5.526	0.16959	0.0:0.3354:0.2671:0.3975	.	27	Q8WVX3	CD003_HUMAN	T	160;27	ENSP00000382026:N160T;ENSP00000427214:N27T	ENSP00000382026:N160T	N	-	2	0	C4orf3	120441059	0.000000	0.05858	0.000000	0.03702	0.152000	0.21847	-0.401000	0.07232	-0.254000	0.09500	0.460000	0.39030	AAC	.	.	.	none		0.572	C4orf3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364576.3	NM_001001701	
PCSK1	5122	hgsc.bcm.edu	37	5	95768715	95768715	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr5:95768715G>A	ENST00000311106.3	-	1	269	c.32C>T	c.(31-33)aCt>aTt	p.T11I	CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000508626.1_5'Flank	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	11					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GACGAAAGCAGTGCACTGCAG	0.522																																					p.T11I		Atlas-SNP	.											.	PCSK1	93	.	0			c.C32T						PASS	.						122.0	128.0	126.0					5																	95768715		2203	4300	6503	SO:0001583	missense	5122	exon1			AAAGCAGTGCACT		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.32C>T	chr5.hg19:g.95768715G>A	ENSP00000308024:p.Thr11Ile	241.0	0.0	.		136.0	39.0	.	NM_000439	B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	ENST00000311106.3	hg19	CCDS4081.1	.	.	.	.	.	.	.	.	.	.	G	1.548	-0.540118	0.04053	.	.	ENSG00000175426	ENST00000311106;ENST00000509190	T;T	0.62639	0.01;0.58	5.24	3.43	0.39272	.	0.676173	0.16441	N	0.214310	T	0.38134	0.1029	N	0.13003	0.285	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.16012	-1.0417	10	0.12766	T	0.61	-2.7841	6.8983	0.24269	0.3283:0.0:0.6717:0.0	.	11	P29120	NEC1_HUMAN	I	11	ENSP00000308024:T11I;ENSP00000427294:T11I	ENSP00000308024:T11I	T	-	2	0	PCSK1	95794471	0.059000	0.20769	0.005000	0.12908	0.831000	0.47069	1.742000	0.38248	1.439000	0.47511	0.655000	0.94253	ACT	.	.	.	none		0.522	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439	
CEP120	153241	hgsc.bcm.edu	37	5	122682287	122682287	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr5:122682287G>A	ENST00000306467.5	-	20	3191	c.2887C>T	c.(2887-2889)Cac>Tac	p.H963Y	CEP120_ENST00000306481.6_Missense_Mutation_p.H937Y|CEP120_ENST00000328236.5_Missense_Mutation_p.H963Y			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	963					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						CGATCCTCGTGATTATACACA	0.403																																					p.H963Y		Atlas-SNP	.											.	CEP120	72	.	0			c.C2887T						PASS	.						171.0	170.0	171.0					5																	122682287		2203	4300	6503	SO:0001583	missense	153241	exon21			CCTCGTGATTATA	AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.2887C>T	chr5.hg19:g.122682287G>A	ENSP00000303058:p.His963Tyr	57.0	0.0	.		95.0	19.0	.	NM_153223	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Missense_Mutation	SNP	ENST00000306467.5	hg19	CCDS4134.2	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497201	0.64186	.	.	ENSG00000168944	ENST00000306467;ENST00000328236;ENST00000306481	T;T;T	0.19394	2.15;2.15;2.15	5.27	5.27	0.74061	.	0.000000	0.64402	U	0.000002	T	0.30978	0.0782	L	0.46157	1.445	0.80722	D	1	D	0.62365	0.991	P	0.53518	0.728	T	0.00878	-1.1530	10	0.34782	T	0.22	-10.3632	15.2858	0.73828	0.0:0.0:0.8595:0.1405	.	963	Q8N960	CE120_HUMAN	Y	963;963;937	ENSP00000303058:H963Y;ENSP00000327504:H963Y;ENSP00000307419:H937Y	ENSP00000303058:H963Y	H	-	1	0	CEP120	122710186	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.378000	0.73150	2.476000	0.83614	0.655000	0.94253	CAC	.	.	.	none		0.403	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250899.2	NM_153223	
DOCK2	1794	hgsc.bcm.edu	37	5	169463523	169463523	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr5:169463523T>A	ENST00000256935.8	+	36	3709	c.3629T>A	c.(3628-3630)tTc>tAc	p.F1210Y	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.F702Y|DOCK2_ENST00000540750.1_Missense_Mutation_p.F271Y	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1210	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACCTAGAATTTCTACAAAGAT	0.413																																					p.F1210Y		Atlas-SNP	.											.	DOCK2	389	.	0			c.T3629A						PASS	.						138.0	135.0	136.0					5																	169463523		2203	4300	6503	SO:0001583	missense	1794	exon36			AGAATTTCTACAA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3629T>A	chr5.hg19:g.169463523T>A	ENSP00000256935:p.Phe1210Tyr	97.0	0.0	.		72.0	32.0	.	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.394444	0.83011	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.56444	0.46;0.46;0.46	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.58221	0.2107	L	0.58925	1.835	0.48185	D	0.999609	D;B	0.52996	0.957;0.053	P;B	0.50617	0.646;0.035	T	0.54906	-0.8223	10	0.22109	T	0.4	.	15.5299	0.75952	0.0:0.0:0.0:1.0	.	702;1210	E7ERW7;Q92608	.;DOCK2_HUMAN	Y	1210;702;271	ENSP00000256935:F1210Y;ENSP00000429283:F702Y;ENSP00000438827:F271Y	ENSP00000256935:F1210Y	F	+	2	0	DOCK2	169396101	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.216000	0.77974	2.147000	0.66899	0.533000	0.62120	TTC	.	.	.	none		0.413	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
GPR116	221395	hgsc.bcm.edu	37	6	46836697	46836697	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr6:46836697C>A	ENST00000283296.7	-	12	1832	c.1544G>T	c.(1543-1545)aGa>aTa	p.R515I	GPR116_ENST00000362015.4_Missense_Mutation_p.R515I|GPR116_ENST00000545669.1_5'UTR|GPR116_ENST00000265417.7_Missense_Mutation_p.R515I|GPR116_ENST00000456426.2_Missense_Mutation_p.R373I	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	515	Ig-like 3.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			GGTATAAAATCTTTGGTATAT	0.418																																					p.R515I	NSCLC(59;410 1274 8751 36715 50546)	Atlas-SNP	.											GPR116,colon,carcinoma,0,2	GPR116	133	.	0			c.G1544T						PASS	.						99.0	101.0	100.0					6																	46836697		2203	4300	6503	SO:0001583	missense	221395	exon12			TAAAATCTTTGGT	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.1544G>T	chr6.hg19:g.46836697C>A	ENSP00000283296:p.Arg515Ile	76.0	0.0	.		72.0	16.0	.	NM_015234	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	hg19	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	C	11.42	1.634757	0.29068	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000265417	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.47	-3.16	0.05217	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.789290	0.11856	N	0.522870	T	0.05593	0.0147	N	0.24115	0.695	0.58432	D	0.999999	B;P;P;P	0.45126	0.346;0.533;0.851;0.533	B;B;B;B	0.37650	0.052;0.183;0.255;0.183	T	0.32666	-0.9898	10	0.56958	D	0.05	-8.9279	12.8097	0.57634	0.0:0.1961:0.0:0.8039	.	70;515;373;515	B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;GP116_HUMAN	I	515;515;515;373;515	ENSP00000283296:R515I;ENSP00000354563:R515I;ENSP00000412866:R373I;ENSP00000265417:R515I	ENSP00000265417:R515I	R	-	2	0	GPR116	46944656	0.851000	0.29673	0.344000	0.25628	0.337000	0.28794	0.065000	0.14466	-0.513000	0.06496	0.591000	0.81541	AGA	.	.	.	none		0.418	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	
KATNA1	11104	hgsc.bcm.edu	37	6	149922828	149922828	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr6:149922828T>A	ENST00000335647.5	-	6	834	c.790A>T	c.(790-792)Aca>Tca	p.T264S	KATNA1_ENST00000335643.8_Missense_Mutation_p.T188S|KATNA1_ENST00000494504.1_5'UTR|KATNA1_ENST00000367411.2_Missense_Mutation_p.T264S					katanin p60 (ATPase containing) subunit A 1											endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	12		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		TTGCATTCTGTAGCTACTGCT	0.453																																					p.T264S		Atlas-SNP	.											.	KATNA1	34	.	0			c.A790T						PASS	.						116.0	105.0	109.0					6																	149922828		2203	4300	6503	SO:0001583	missense	11104	exon7			ATTCTGTAGCTAC	AF056022	CCDS5217.1, CCDS56456.1	6q24.3	2011-01-25	2011-01-25		ENSG00000186625	ENSG00000186625		"""ATPases / AAA-type"""	6216	protein-coding gene	gene with protein product		606696	"""katanin p60 (ATPase-containing) subunit A 1"""			9658175	Standard	NM_007044		Approved		uc003qms.3	O75449	OTTHUMG00000015787	ENST00000335647.5:c.790A>T	chr6.hg19:g.149922828T>A	ENSP00000335106:p.Thr264Ser	138.0	0.0	.		97.0	25.0	.	NM_007044		Missense_Mutation	SNP	ENST00000335647.5	hg19	CCDS5217.1	.	.	.	.	.	.	.	.	.	.	T	29.5	5.007563	0.93287	.	.	ENSG00000186625	ENST00000335647;ENST00000335643;ENST00000367411;ENST00000444282	D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09	5.85	5.85	0.93711	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.87605	0.6219	N	0.04355	-0.22	0.80722	D	1	D;B;D	0.89917	0.991;0.282;1.0	D;B;D	0.97110	0.973;0.317;1.0	D	0.89105	0.3492	9	.	.	.	.	16.2365	0.82377	0.0:0.0:0.0:1.0	.	264;188;264	A8K7S5;O75449-2;O75449	.;.;KTNA1_HUMAN	S	264;188;264;264	ENSP00000335106:T264S;ENSP00000335180:T188S;ENSP00000356381:T264S;ENSP00000390322:T264S	.	T	-	1	0	KATNA1	149964521	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	8.013000	0.88655	2.238000	0.73509	0.477000	0.44152	ACA	.	.	.	none		0.453	KATNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042641.2	NM_007044	
TIAM2	26230	hgsc.bcm.edu	37	6	155572110	155572110	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr6:155572110C>A	ENST00000461783.3	+	24	5288	c.4015C>A	c.(4015-4017)Ctg>Atg	p.L1339M	TIAM2_ENST00000275246.7_Missense_Mutation_p.L264M|RP11-477D19.2_ENST00000435295.1_RNA|TIAM2_ENST00000360366.4_Missense_Mutation_p.L1363M|TIAM2_ENST00000318981.5_Missense_Mutation_p.L1339M|TIAM2_ENST00000529824.2_Missense_Mutation_p.L1368M|TIAM2_ENST00000456877.2_Missense_Mutation_p.L651M|TIAM2_ENST00000456144.1_Missense_Mutation_p.L1368M|TIAM2_ENST00000528391.2_Missense_Mutation_p.L675M|TIAM2_ENST00000367174.2_Missense_Mutation_p.L715M			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1339					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L1339L(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GAATCCATTTCTGTCTCTAGG	0.428																																					p.L1339M		Atlas-SNP	.											TIAM2,mouth,carcinoma,0,1	TIAM2	161	.	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C4015A						PASS	.						166.0	158.0	160.0					6																	155572110		2203	4300	6503	SO:0001583	missense	26230	exon21			CCATTTCTGTCTC		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.4015C>A	chr6.hg19:g.155572110C>A	ENSP00000437188:p.Leu1339Met	97.0	0.0	.		90.0	29.0	.	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	hg19	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.186124	0.57909	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391;ENST00000275246	T;T;T;T;T;T;T;T;T;T	0.08458	3.56;3.5;3.56;3.56;3.39;3.56;3.56;3.39;3.39;3.09	5.43	3.65	0.41850	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.152382	0.42964	D	0.000622	T	0.03739	0.0106	N	0.08118	0	0.27056	N	0.963673	P;D;D;D	0.65815	0.944;0.995;0.995;0.991	P;P;P;P	0.62560	0.497;0.904;0.861;0.73	T	0.29941	-0.9995	10	0.46703	T	0.11	.	7.1279	0.25482	0.0:0.709:0.1414:0.1496	.	675;1368;1363;1339	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	M	1339;1585;1339;1368;1339;715;1363;1368;651;675;264	ENSP00000437188:L1339M;ENSP00000434901:L1339M;ENSP00000407746:L1368M;ENSP00000327315:L1339M;ENSP00000356142:L715M;ENSP00000353528:L1363M;ENSP00000433348:L1368M;ENSP00000407183:L651M;ENSP00000435335:L675M;ENSP00000275246:L264M	ENSP00000275246:L264M	L	+	1	2	TIAM2	155613802	0.939000	0.31865	1.000000	0.80357	0.997000	0.91878	0.940000	0.28992	1.312000	0.45043	0.655000	0.94253	CTG	.	.	.	none		0.428	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
TMEM106B	54664	hgsc.bcm.edu	37	7	12254528	12254528	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr7:12254528T>G	ENST00000396667.3	+	3	414	c.92T>G	c.(91-93)gTt>gGt	p.V31G	TMEM106B_ENST00000396668.3_Missense_Mutation_p.V31G|TMEM106B_ENST00000453686.1_3'UTR	NM_018374.3	NP_060844.2	Q9NUM4	T106B_HUMAN	transmembrane protein 106B	31					cell death (GO:0008219)|dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(8)|large_intestine(2)|lung(7)	18				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)		AATGGACTGGTTAATAGTGAA	0.393																																					p.V31G		Atlas-SNP	.											.	TMEM106B	34	.	0			c.T92G						PASS	.						112.0	103.0	106.0					7																	12254528		2203	4300	6503	SO:0001583	missense	54664	exon2			GACTGGTTAATAG	BC033901	CCDS5358.1	7p21.3	2012-06-06			ENSG00000106460	ENSG00000106460			22407	protein-coding gene	gene with protein product		613413				20154673, 22511793	Standard	NM_018374		Approved	MGC33727, FLJ11273	uc003ssh.3	Q9NUM4	OTTHUMG00000125537	ENST00000396667.3:c.92T>G	chr7.hg19:g.12254528T>G	ENSP00000379901:p.Val31Gly	66.0	0.0	.		85.0	16.0	.	NM_001134232	A4D108|Q53FL9|Q8N4L0	Missense_Mutation	SNP	ENST00000396667.3	hg19	CCDS5358.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.612576	0.28712	.	.	ENSG00000106460	ENST00000396668;ENST00000444443;ENST00000396667	T;T;T	0.21543	2.0;2.0;2.0	5.41	5.41	0.78517	.	0.496686	0.20899	N	0.083673	T	0.16300	0.0392	N	0.22421	0.69	0.58432	D	0.999995	B	0.22909	0.077	B	0.33392	0.163	T	0.13072	-1.0523	10	0.23891	T	0.37	-18.5982	10.1599	0.42844	0.0:0.0745:0.0:0.9255	.	31	Q9NUM4	T106B_HUMAN	G	31	ENSP00000379902:V31G;ENSP00000401302:V31G;ENSP00000379901:V31G	ENSP00000379901:V31G	V	+	2	0	TMEM106B	12221053	0.996000	0.38824	0.980000	0.43619	0.448000	0.32197	3.752000	0.55172	2.197000	0.70478	0.533000	0.62120	GTT	.	.	.	none		0.393	TMEM106B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246870.3	NM_018374	
MFHAS1	9258	hgsc.bcm.edu	37	8	8747815	8747815	+	Silent	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr8:8747815G>A	ENST00000276282.6	-	1	3340	c.2754C>T	c.(2752-2754)gcC>gcT	p.A918A		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	918										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		TCCCTCTATAGGCAAAGATCT	0.483																																					p.A918A	Melanoma(103;1201 2045 17515 28966)	Atlas-SNP	.											.	MFHAS1	58	.	0			c.C2754T						PASS	.						80.0	82.0	81.0					8																	8747815		2203	4300	6503	SO:0001819	synonymous_variant	9258	exon1			TCTATAGGCAAAG	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2754C>T	chr8.hg19:g.8747815G>A		118.0	0.0	.		120.0	29.0	.	NM_004225	Q96CI0	Silent	SNP	ENST00000276282.6	hg19	CCDS34844.1																																																																																			.	.	.	none		0.483	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
PDLIM2	64236	hgsc.bcm.edu	37	8	22442384	22442384	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr8:22442384T>C	ENST00000397760.4	+	4	696	c.296T>C	c.(295-297)gTg>gCg	p.V99A	PDLIM2_ENST00000448520.1_3'UTR|PDLIM2_ENST00000339162.7_Missense_Mutation_p.V99A|PDLIM2_ENST00000308354.7_Missense_Mutation_p.V349A|PDLIM2_ENST00000265810.4_Missense_Mutation_p.V99A|PDLIM2_ENST00000409141.1_Missense_Mutation_p.V99A|PDLIM2_ENST00000397761.2_Missense_Mutation_p.V99A|PDLIM2_ENST00000409417.1_Missense_Mutation_p.V99A			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	99						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		TCCTTGGAAGTGCTGGCGACT	0.627																																					p.V349A		Atlas-SNP	.											.	PDLIM2	42	.	0			c.T1046C						PASS	.						133.0	104.0	114.0					8																	22442384		2203	4300	6503	SO:0001583	missense	64236	exon4			TGGAAGTGCTGGC	AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.296T>C	chr8.hg19:g.22442384T>C	ENSP00000380867:p.Val99Ala	106.0	0.0	.		67.0	7.0	.	NM_021630	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	ENST00000397760.4	hg19		.	.	.	.	.	.	.	.	.	.	T	10.93	1.490481	0.26686	.	.	ENSG00000120913	ENST00000456545;ENST00000308354;ENST00000452226;ENST00000397760;ENST00000339162;ENST00000381194;ENST00000397761;ENST00000436754;ENST00000426493;ENST00000429812;ENST00000409141;ENST00000265810;ENST00000409417	T;T;T;T;T;T;T;T;T;T;T;T	0.11169	2.8;2.8;2.8;2.8;2.8;2.8;2.8;2.8;2.8;2.8;2.8;2.8	4.64	3.46	0.39613	.	0.669254	0.14051	N	0.344789	T	0.10294	0.0252	M	0.65975	2.015	0.25771	N	0.984832	P;P;B;B	0.36837	0.571;0.571;0.043;0.255	B;B;B;B	0.33392	0.163;0.163;0.027;0.078	T	0.16660	-1.0395	10	0.07030	T	0.85	-10.5924	8.8203	0.35020	0.0:0.0:0.1903:0.8097	.	99;99;99;99	Q96JY6-3;Q96JY6-4;Q96JY6;C9JS55	.;.;PDLI2_HUMAN;.	A	99;349;99;99;99;99;99;99;99;99;99;99;99	ENSP00000401992:V99A;ENSP00000312634:V349A;ENSP00000394376:V99A;ENSP00000380867:V99A;ENSP00000342035:V99A;ENSP00000380868:V99A;ENSP00000397738:V99A;ENSP00000392920:V99A;ENSP00000407643:V99A;ENSP00000386868:V99A;ENSP00000265810:V99A;ENSP00000387084:V99A	ENSP00000265810:V99A	V	+	2	0	PDLIM2	22498329	0.202000	0.23423	0.987000	0.45799	0.658000	0.38924	0.550000	0.23345	0.856000	0.35383	0.482000	0.46254	GTG	.	.	.	none		0.627	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334167.1		
RP1	6101	hgsc.bcm.edu	37	8	55538963	55538963	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr8:55538963G>A	ENST00000220676.1	+	4	2669	c.2521G>A	c.(2521-2523)Gaa>Aaa	p.E841K		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	841					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ATCTCAAGCAGAAGTGGCATC	0.323																																					p.E841K	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											.	RP1	429	.	0			c.G2521A						PASS	.						43.0	46.0	45.0					8																	55538963		2201	4300	6501	SO:0001583	missense	6101	exon4			CAAGCAGAAGTGG	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2521G>A	chr8.hg19:g.55538963G>A	ENSP00000220676:p.Glu841Lys	115.0	0.0	.		181.0	60.0	.	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	hg19	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.159150	0.38119	.	.	ENSG00000104237	ENST00000220676	T	0.60424	0.19	4.91	4.02	0.46733	.	0.613701	0.15204	N	0.274879	T	0.49406	0.1555	M	0.62723	1.935	0.09310	N	0.999995	P	0.37441	0.595	B	0.31290	0.127	T	0.53464	-0.8435	10	0.72032	D	0.01	-10.8547	8.0414	0.30523	0.227:0.0:0.773:0.0	.	841	P56715	RP1_HUMAN	K	841	ENSP00000220676:E841K	ENSP00000220676:E841K	E	+	1	0	RP1	55701516	0.996000	0.38824	0.220000	0.23810	0.508000	0.34012	2.176000	0.42500	2.642000	0.89623	0.655000	0.94253	GAA	.	.	.	none		0.323	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
LAPTM4B	55353	hgsc.bcm.edu	37	8	98788210	98788210	+	Silent	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr8:98788210G>A	ENST00000445593.2	+	1	926	c.246G>A	c.(244-246)gcG>gcA	p.A82A	LAPTM4B_ENST00000521545.2_5'UTR|RNU7-177P_ENST00000517101.1_RNA	NM_018407.4	NP_060877.3	Q86VI4	LAP4B_HUMAN	lysosomal protein transmembrane 4 beta	135					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	10	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			AAACTTGCGCGCGCGCTCGCG	0.736																																					p.A82A		Atlas-SNP	.											.	LAPTM4B	26	.	0			c.G246A						PASS	.						8.0	9.0	9.0					8																	98788210		2092	4153	6245	SO:0001819	synonymous_variant	55353	exon1			TTGCGCGCGCGCT	AF317417	CCDS6275.1	8q22.1	2008-08-11	2008-08-11		ENSG00000104341	ENSG00000104341			13646	protein-coding gene	gene with protein product		613296					Standard	NM_018407		Approved	LC27	uc003yia.3	Q86VI4	OTTHUMG00000164740	ENST00000445593.2:c.246G>A	chr8.hg19:g.98788210G>A		63.0	0.0	.		38.0	10.0	.	NM_018407	Q3ZCV5|Q7L909|Q86VH8|Q9H060	Silent	SNP	ENST00000445593.2	hg19	CCDS6275.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933237	0.34096	.	.	ENSG00000104341	ENST00000517924	.	.	.	3.43	2.54	0.30619	.	.	.	.	.	T	0.52484	0.1737	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43572	-0.9383	4	.	.	.	-0.9742	5.4195	0.16392	0.1221:0.2784:0.5995:0.0	.	.	.	.	H	45	.	.	R	+	2	0	LAPTM4B	98857386	0.368000	0.25031	0.934000	0.37439	0.097000	0.18754	3.208000	0.51114	0.762000	0.33152	0.643000	0.83706	CGC	.	.	.	none		0.736	LAPTM4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380014.1		
SMC2	10592	hgsc.bcm.edu	37	9	106882315	106882315	+	Silent	SNP	A	A	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr9:106882315A>T	ENST00000286398.7	+	16	2292	c.2004A>T	c.(2002-2004)cgA>cgT	p.R668R	SMC2_ENST00000374787.3_Silent_p.R668R|SMC2_ENST00000374793.3_Silent_p.R668R|SMC2_ENST00000303219.8_Silent_p.R668R	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	668	Flexible hinge.				kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						CAGGTGCTCGATCCCAGGCAG	0.393																																					p.R668R		Atlas-SNP	.											.	SMC2	127	.	0			c.A2004T						PASS	.						124.0	131.0	129.0					9																	106882315		2203	4300	6503	SO:0001819	synonymous_variant	10592	exon16			TGCTCGATCCCAG	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.2004A>T	chr9.hg19:g.106882315A>T		75.0	0.0	.		84.0	17.0	.	NM_006444	Q6IEE0|Q9P1P2	Silent	SNP	ENST00000286398.7	hg19	CCDS35086.1																																																																																			.	.	.	none		0.393	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		
SH2D3C	10044	hgsc.bcm.edu	37	9	130511796	130511796	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr9:130511796T>C	ENST00000314830.8	-	5	946	c.833A>G	c.(832-834)tAc>tGc	p.Y278C	SH2D3C_ENST00000373277.4_Missense_Mutation_p.Y121C|SH2D3C_ENST00000471939.1_Intron|SH2D3C_ENST00000429553.1_5'UTR|SH2D3C_ENST00000373276.3_Missense_Mutation_p.Y210C|SH2D3C_ENST00000420366.1_Missense_Mutation_p.Y120C|SH2D3C_ENST00000373274.3_Missense_Mutation_p.Y118C	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C	278	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GATGTGTGTGTAGCTCTCGCC	0.592																																					p.Y278C		Atlas-SNP	.											.	SH2D3C	102	.	0			c.A833G						PASS	.						95.0	81.0	86.0					9																	130511796		2203	4300	6503	SO:0001583	missense	10044	exon5			TGTGTGTAGCTCT	AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.833A>G	chr9.hg19:g.130511796T>C	ENSP00000317817:p.Tyr278Cys	89.0	0.0	.		73.0	25.0	.	NM_170600	A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	Missense_Mutation	SNP	ENST00000314830.8	hg19	CCDS6877.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.88|18.88	3.717121|3.717121	0.68844|0.68844	.|.	.|.	ENSG00000095370|ENSG00000095370	ENST00000440630|ENST00000373277;ENST00000420366;ENST00000373276;ENST00000373274;ENST00000314830;ENST00000414380	.|T;T;T;T;T;T	.|0.43294	.|2.38;2.38;2.13;2.39;2.35;0.95	5.67|5.67	5.67|5.67	0.87782|0.87782	.|SH2 motif (4);	.|0.341438	.|0.31268	.|N	.|0.007942	T|T	0.58524|0.58524	0.2128|0.2128	M|M	0.63169|0.63169	1.94|1.94	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.71674	.|0.996;0.998;0.998;0.992;0.998	.|D;D;P;P;D	.|0.67231	.|0.926;0.95;0.815;0.719;0.917	T|T	0.61903|0.61903	-0.6967|-0.6967	5|10	.|0.72032	.|D	.|0.01	0.3469|0.3469	11.0757|11.0757	0.48030|0.48030	0.0:0.0746:0.0:0.9254|0.0:0.0746:0.0:0.9254	.|.	.|118;278;210;121;120	.|E9PG48;Q8N5H7;E7EUN5;Q8N5H7-2;Q8N5H7-5	.|.;SH2D3_HUMAN;.;.;.	A|C	115|121;120;210;118;278;95	.|ENSP00000362374:Y121C;ENSP00000388536:Y120C;ENSP00000362373:Y210C;ENSP00000362371:Y118C;ENSP00000317817:Y278C;ENSP00000413760:Y95C	.|ENSP00000317817:Y278C	T|Y	-|-	1|2	0|0	SH2D3C|SH2D3C	129551617|129551617	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.686000|1.686000	0.37669|0.37669	2.169000|2.169000	0.68431|0.68431	0.459000|0.459000	0.35465|0.35465	ACA|TAC	.	.	.	none		0.592	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054264.1	NM_005489	
HERC4	26091	hgsc.bcm.edu	37	10	69749982	69749982	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr10:69749982G>A	ENST00000395198.3	-	14	1866	c.1619C>T	c.(1618-1620)cCa>cTa	p.P540L	HERC4_ENST00000373700.4_Missense_Mutation_p.P540L|HERC4_ENST00000412272.2_Missense_Mutation_p.P540L|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000277817.6_Missense_Mutation_p.P430L	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	540					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						TACTTTCAGTGGTGCCTTTTC	0.353																																					p.P540L		Atlas-SNP	.											.	HERC4	78	.	0			c.C1619T						PASS	.						90.0	88.0	89.0					10																	69749982		2203	4300	6503	SO:0001583	missense	26091	exon14			TTCAGTGGTGCCT	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.1619C>T	chr10.hg19:g.69749982G>A	ENSP00000378624:p.Pro540Leu	30.0	0.0	.		47.0	11.0	.	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	hg19	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711019	0.89112	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.46819	1.14;0.86;0.89;0.89	5.53	5.53	0.82687	.	0.050900	0.85682	D	0.000000	T	0.65365	0.2684	M	0.69185	2.1	0.80722	D	1	D;P;B;P;D;P	0.63046	0.992;0.694;0.024;0.952;0.972;0.918	P;B;B;P;P;P	0.58721	0.826;0.379;0.016;0.703;0.844;0.613	T	0.68209	-0.5469	10	0.87932	D	0	.	19.4511	0.94867	0.0:0.0:1.0:0.0	.	540;430;540;390;540;540	Q5GLZ8-3;Q5GLZ8-6;A8K9U4;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;.;HERC4_HUMAN	L	430;540;540;540	ENSP00000277817:P430L;ENSP00000416504:P540L;ENSP00000378624:P540L;ENSP00000362804:P540L	ENSP00000277817:P430L	P	-	2	0	HERC4	69419988	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.930000	0.92872	2.599000	0.87857	0.591000	0.81541	CCA	.	.	.	none		0.353	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
PPA1	5464	hgsc.bcm.edu	37	10	71974287	71974287	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr10:71974287T>C	ENST00000373232.3	-	5	452	c.353A>G	c.(352-354)gAc>gGc	p.D118G	PPA1_ENST00000608321.1_Missense_Mutation_p.D118G	NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	118					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						ATCAATTGGGTCATTGTCACC	0.333																																					p.D118G		Atlas-SNP	.											.	PPA1	24	.	0			c.A353G						PASS	.						115.0	105.0	108.0					10																	71974287		2203	4300	6503	SO:0001583	missense	5464	exon5			ATTGGGTCATTGT	AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.353A>G	chr10.hg19:g.71974287T>C	ENSP00000362329:p.Asp118Gly	65.0	0.0	.		46.0	11.0	.	NM_021129	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Missense_Mutation	SNP	ENST00000373232.3	hg19	CCDS7299.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.859975	0.91433	.	.	ENSG00000180817	ENST00000373232;ENST00000373230	T;T	0.71103	-0.54;-0.54	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.88514	0.6457	H	0.96460	3.825	0.80722	D	1	P	0.44776	0.843	P	0.61940	0.896	D	0.91533	0.5244	10	0.87932	D	0	-2.9842	14.5337	0.67944	0.0:0.0:0.0:1.0	.	118	Q15181	IPYR_HUMAN	G	118	ENSP00000362329:D118G;ENSP00000362327:D118G	ENSP00000362327:D118G	D	-	2	0	PPA1	71644293	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.819000	0.86621	2.113000	0.64589	0.482000	0.46254	GAC	.	.	.	none		0.333	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048490.2	NM_021129	
CDH23	64072	hgsc.bcm.edu	37	10	73572275	73572275	+	Missense_Mutation	SNP	T	T	A	rs371829335		TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr10:73572275T>A	ENST00000224721.6	+	66	9439	c.9434T>A	c.(9433-9435)cTg>cAg	p.L3145Q	CDH23_ENST00000398788.3_Missense_Mutation_p.L900Q|CDH23_ENST00000475158.1_3'UTR	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	3140					calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						TGTCGGAACCTGGAGCTGGCC	0.637											OREG0020259	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L3140Q		Atlas-SNP	.											.	CDH23	365	.	0			c.T9419A						PASS	.	T	GLN/LEU,GLN/LEU,GLN/LEU,GLN/LEU,GLN/LEU	0,3978		0,0,1989	70.0	77.0	74.0		2699,2699,110,110,9419	5.5	1.0	10		74	1,8311		0,1,4155	no	missense,missense,missense,missense,missense	CDH23	NM_001171933.1,NM_001171934.1,NM_001171935.1,NM_001171936.1,NM_022124.5	113,113,113,113,113	0,1,6144	AA,AT,TT		0.012,0.0,0.0081	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	900/1115,900/1080,37/252,37/217,3140/3355	73572275	1,12289	1989	4156	6145	SO:0001583	missense	64072	exon65			GGAACCTGGAGCT	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.9434T>A	chr10.hg19:g.73572275T>A	ENSP00000224721:p.Leu3145Gln	101.0	0.0	.	1146	57.0	20.0	.	NM_022124	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	hg19		.	.	.	.	.	.	.	.	.	.	T	23.5	4.428786	0.83667	0.0	1.2E-4	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	D	0.82893	-1.66	5.54	5.54	0.83059	.	0.093214	0.45867	D	0.000338	D	0.86916	0.6048	L	0.36672	1.1	0.54753	D	0.999982	D;D;P;P	0.71674	0.996;0.998;0.938;0.938	P;D;P;P	0.71184	0.859;0.972;0.523;0.523	D	0.88372	0.2995	10	0.87932	D	0	.	15.8465	0.78895	0.0:0.0:0.0:1.0	.	37;37;3140;3140	Q5QGS5;Q5QGS6;E9PEX1;Q9H251	.;.;.;CAD23_HUMAN	Q	3145;3140;3143;900	ENSP00000381768:L900Q	ENSP00000224721:L3145Q	L	+	2	0	CDH23	73242281	1.000000	0.71417	1.000000	0.80357	0.628000	0.37860	7.836000	0.86788	2.326000	0.78906	0.533000	0.62120	CTG	.	.	.	none		0.637	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
TNKS2	80351	hgsc.bcm.edu	37	10	93588096	93588096	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr10:93588096G>A	ENST00000371627.4	+	9	1416	c.1037G>A	c.(1036-1038)cGa>cAa	p.R346Q		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	346					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.R346Q(1)		biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				GATGTTACTCGAATCAAAAAA	0.343																																					p.R346Q		Atlas-SNP	.											TNKS2,rectum,carcinoma,0,1	TNKS2	103	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1037A						PASS	.						66.0	66.0	66.0					10																	93588096		2203	4300	6503	SO:0001583	missense	80351	exon9			TTACTCGAATCAA	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.1037G>A	chr10.hg19:g.93588096G>A	ENSP00000360689:p.Arg346Gln	132.0	2.0	.		213.0	53.0	.	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	hg19	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857368	0.71834	.	.	ENSG00000107854	ENST00000371627	T	0.63913	-0.07	5.5	5.5	0.81552	Ankyrin repeat-containing domain (4);	0.000000	0.50627	D	0.000107	T	0.50411	0.1614	N	0.25245	0.725	0.46096	D	0.998866	B	0.25351	0.124	B	0.23150	0.044	T	0.41574	-0.9501	10	0.22109	T	0.4	.	19.4011	0.94630	0.0:0.0:1.0:0.0	.	346	Q9H2K2	TNKS2_HUMAN	Q	346	ENSP00000360689:R346Q	ENSP00000360689:R346Q	R	+	2	0	TNKS2	93578076	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.480000	0.66820	2.591000	0.87537	0.462000	0.41574	CGA	.	.	.	none		0.343	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
LCOR	84458	hgsc.bcm.edu	37	10	98715299	98715299	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr10:98715299G>C	ENST00000371097.4	+	8	1468	c.922G>C	c.(922-924)Gga>Cga	p.G308R	LCOR_ENST00000540664.1_Missense_Mutation_p.G308R|LCOR_ENST00000356016.3_Missense_Mutation_p.G308R|LCOR_ENST00000498444.1_Intron|LCOR_ENST00000371103.3_Missense_Mutation_p.G308R			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	308					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		GTTAGATGCTGGACCCGATTC	0.478																																					p.G308R		Atlas-SNP	.											.	LCOR	32	.	0			c.G922C						PASS	.						44.0	46.0	45.0					10																	98715299		2203	4300	6503	SO:0001583	missense	84458	exon8			GATGCTGGACCCG		CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.922G>C	chr10.hg19:g.98715299G>C	ENSP00000360138:p.Gly308Arg	116.0	0.0	.		142.0	33.0	.	NM_001170766	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Missense_Mutation	SNP	ENST00000371097.4	hg19	CCDS7451.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265945	0.40095	.	.	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	5.65	5.65	0.86999	.	0.275445	0.42548	D	0.000696	T	0.35480	0.0933	N	0.14661	0.345	0.37180	D	0.903461	B;B	0.29037	0.148;0.231	B;B	0.23716	0.022;0.048	T	0.39035	-0.9633	9	0.48119	T	0.1	-3.1435	13.3313	0.60488	0.0722:0.0:0.9278:0.0	.	308;308	Q96JN0;Q96JN0-2	LCOR_HUMAN;.	R	308	.	ENSP00000348298:G308R	G	+	1	0	LCOR	98705289	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.971000	0.63749	2.827000	0.97445	0.650000	0.86243	GGA	.	.	.	none		0.478	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049628.2		
TRIM8	81603	hgsc.bcm.edu	37	10	104404444	104404444	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr10:104404444G>A	ENST00000302424.7	+	1	192	c.70G>A	c.(70-72)Gag>Aag	p.E24K	RP11-47A8.5_ENST00000607967.1_lincRNA	NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	24					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CGTTTTCGTGGAGCCAGTGCA	0.662																																					p.E24K		Atlas-SNP	.											.	TRIM8	35	.	0			c.G70A						PASS	.						33.0	37.0	36.0					10																	104404444		2202	4299	6501	SO:0001583	missense	81603	exon1			TTCGTGGAGCCAG	AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.70G>A	chr10.hg19:g.104404444G>A	ENSP00000302120:p.Glu24Lys	231.0	0.0	.		153.0	33.0	.	NM_030912	A6NI31|Q9C028	Missense_Mutation	SNP	ENST00000302424.7	hg19	CCDS31274.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941410	0.92526	.	.	ENSG00000171206	ENST00000302424;ENST00000369896	T	0.19105	2.17	4.06	4.06	0.47325	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.057637	0.64402	D	0.000002	T	0.32436	0.0829	L	0.35644	1.08	0.58432	D	0.999999	D	0.56968	0.978	P	0.57911	0.829	T	0.13602	-1.0503	10	0.72032	D	0.01	.	16.81	0.85717	0.0:0.0:1.0:0.0	.	24	Q9BZR9	TRIM8_HUMAN	K	24	ENSP00000302120:E24K	ENSP00000302120:E24K	E	+	1	0	TRIM8	104394434	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.463000	0.80869	2.277000	0.76020	0.561000	0.74099	GAG	.	.	.	none		0.662	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050084.3	NM_030912	
OR51E2	81285	hgsc.bcm.edu	37	11	4703309	4703309	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr11:4703309C>T	ENST00000396950.3	-	2	872	c.633G>A	c.(631-633)atG>atA	p.M211I		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	211					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		AGGAGATGAACATTACGTCCA	0.488																																					p.M211I		Atlas-SNP	.											.	OR51E2	77	.	0			c.G633A						PASS	.						100.0	89.0	93.0					11																	4703309		2201	4298	6499	SO:0001583	missense	81285	exon2			GATGAACATTACG	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.633G>A	chr11.hg19:g.4703309C>T	ENSP00000380153:p.Met211Ile	140.0	0.0	.		88.0	18.0	.	NM_030774	B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	hg19	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	C	3.080	-0.189220	0.06299	.	.	ENSG00000167332	ENST00000396950	T	0.32988	1.43	5.07	2.07	0.26955	GPCR, rhodopsin-like superfamily (1);	0.278770	0.25645	N	0.029258	T	0.08179	0.0204	N	0.02225	-0.63	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.29274	-1.0017	10	0.07030	T	0.85	.	2.2245	0.03980	0.1478:0.4044:0.2869:0.1609	.	211	Q9H255	O51E2_HUMAN	I	211	ENSP00000380153:M211I	ENSP00000380153:M211I	M	-	3	0	OR51E2	4659885	0.000000	0.05858	0.538000	0.28064	0.770000	0.43624	-1.295000	0.02764	0.273000	0.22049	0.655000	0.94253	ATG	.	.	.	none		0.488	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774	
TUT1	64852	hgsc.bcm.edu	37	11	62346467	62346467	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr11:62346467G>T	ENST00000476907.1	-	5	1417	c.726C>A	c.(724-726)gaC>gaA	p.D242E	TUT1_ENST00000308436.7_Missense_Mutation_p.D280E|MIR3654_ENST00000496634.2_Missense_Mutation_p.D242E			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	242	Pro-rich.				mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CCAGGGCCGAGTCCAGCGATG	0.562																																					p.D280E		Atlas-SNP	.											.	TUT1	122	.	0			c.C840A						PASS	.						32.0	38.0	36.0					11																	62346467		2202	4299	6501	SO:0001583	missense	64852	exon5			GGCCGAGTCCAGC	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.726C>A	chr11.hg19:g.62346467G>T	ENSP00000419607:p.Asp242Glu	135.0	0.0	.		108.0	23.0	.	NM_022830	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	ENST00000476907.1	hg19		.	.	.	.	.	.	.	.	.	.	G	18.86	3.712700	0.68730	.	.	ENSG00000149016	ENST00000308436;ENST00000476907;ENST00000278279	T;T	0.40225	1.04;1.08	5.44	1.53	0.23141	.	0.150712	0.44097	D	0.000493	T	0.48169	0.1485	L	0.44542	1.39	0.21064	N	0.999795	D	0.76494	0.999	D	0.80764	0.994	T	0.27157	-1.0082	10	0.33940	T	0.23	-19.8764	6.6964	0.23201	0.3737:0.0:0.6263:0.0	.	280	F5H0R1	.	E	280;242;103	ENSP00000308000:D280E;ENSP00000419607:D242E	ENSP00000441670:D242E	D	-	3	2	TUT1	62103043	1.000000	0.71417	0.999000	0.59377	0.766000	0.43426	0.664000	0.25068	0.289000	0.22422	0.563000	0.77884	GAC	.	.	.	none		0.562	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000351319.2	NM_022830	
CTSF	8722	hgsc.bcm.edu	37	11	66332038	66332038	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr11:66332038A>G	ENST00000310325.5	-	11	1421	c.1312T>C	c.(1312-1314)Tac>Cac	p.Y438H	ACTN3_ENST00000502692.1_RNA|CTSF_ENST00000533168.1_5'Flank|ACTN3_ENST00000513398.1_RNA	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F	438					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						CGGTTGCCGTAGCCCACAAGC	0.622																																					p.Y438H		Atlas-SNP	.											.	CTSF	42	.	0			c.T1312C						PASS	.						21.0	21.0	21.0					11																	66332038		2180	4276	6456	SO:0001583	missense	8722	exon11			TGCCGTAGCCCAC	AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090	ENST00000310325.5:c.1312T>C	chr11.hg19:g.66332038A>G	ENSP00000310832:p.Tyr438His	148.0	0.0	.		104.0	19.0	.	NM_003793	B2R964|O95240|Q9NSU4|Q9UKQ5	Missense_Mutation	SNP	ENST00000310325.5	hg19	CCDS8144.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472758	0.84640	.	.	ENSG00000174080	ENST00000310325	T	0.37411	1.2	4.97	4.97	0.65823	Peptidase C1A, papain C-terminal (3);	0.131244	0.53938	D	0.000058	T	0.76709	0.4025	H	0.99726	4.73	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.86364	0.1719	10	0.87932	D	0	.	12.6418	0.56714	1.0:0.0:0.0:0.0	.	438	Q9UBX1	CATF_HUMAN	H	438	ENSP00000310832:Y438H	ENSP00000310832:Y438H	Y	-	1	0	CTSF	66088614	1.000000	0.71417	0.974000	0.42286	0.886000	0.51366	7.567000	0.82357	1.880000	0.54463	0.459000	0.35465	TAC	.	.	.	none		0.622	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393047.1	NM_003793	
ATM	472	hgsc.bcm.edu	37	11	108178695	108178695	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr11:108178695A>G	ENST00000452508.2	+	39	5935	c.5746A>G	c.(5746-5748)Atg>Gtg	p.M1916V	ATM_ENST00000278616.4_Missense_Mutation_p.M1916V			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1916			M -> I (in a breast pleomorphic lobular carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TGTGGACTACATGAGAAGACA	0.358			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.M1916V		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	ATM_ENST00000278616,colon,carcinoma,0,4	ATM	1657	.	0			c.A5746G						PASS	.						157.0	143.0	148.0					11																	108178695		2201	4298	6499	SO:0001583	missense	472	exon38	Familial Cancer Database	AT, Louis-Bar syndrome	GACTACATGAGAA	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.5746A>G	chr11.hg19:g.108178695A>G	ENSP00000388058:p.Met1916Val	70.0	0.0	.		57.0	4.0	.	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	13.57	2.275921	0.40294	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.74209	-0.82;-0.82	6.03	2.2	0.27929	Armadillo-type fold (1);	0.154649	0.64402	N	0.000014	T	0.61350	0.2340	L	0.44542	1.39	0.23492	N	0.997568	B	0.16166	0.016	B	0.08055	0.003	T	0.53954	-0.8365	10	0.54805	T	0.06	.	5.5933	0.17313	0.4052:0.2709:0.0:0.3239	.	1916	Q13315	ATM_HUMAN	V	1916	ENSP00000278616:M1916V;ENSP00000388058:M1916V	ENSP00000278616:M1916V	M	+	1	0	ATM	107683905	0.535000	0.26370	0.999000	0.59377	0.996000	0.88848	-0.063000	0.11655	0.490000	0.27771	0.533000	0.62120	ATG	.	.	.	none		0.358	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
ALG9	79796	hgsc.bcm.edu	37	11	111707006	111707006	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr11:111707006T>A	ENST00000531154.1	-	13	1443	c.971A>T	c.(970-972)cAg>cTg	p.Q324L	ALG9_ENST00000524880.1_3'UTR|ALG9_ENST00000398006.2_Missense_Mutation_p.Q317L|ALG9_ENST00000527228.1_5'UTR	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	488					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		TGGAATGAACTGAAGCTGCCA	0.418																																					p.Q495L		Atlas-SNP	.											.	ALG9	77	.	0			c.A1484T						PASS	.						71.0	67.0	68.0					11																	111707006		1858	4094	5952	SO:0001583	missense	79796	exon14			ATGAACTGAAGCT		CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.971A>T	chr11.hg19:g.111707006T>A	ENSP00000435517:p.Gln324Leu	70.0	0.0	.		51.0	10.0	.	NM_024740	Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Missense_Mutation	SNP	ENST00000531154.1	hg19	CCDS41714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.88|19.88	3.908962|3.908962	0.72868|0.72868	.|.	.|.	ENSG00000086848|ENSG00000086848	ENST00000531154;ENST00000398006;ENST00000428306|ENST00000532425	T;T|.	0.73575|.	-0.76;-0.76|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.049825|.	0.85682|.	D|.	0.000000|.	T|T	0.71221|0.71221	0.3314|0.3314	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	B;B;B|.	0.21225|.	0.031;0.053;0.027|.	B;B;B|.	0.20384|.	0.01;0.029;0.017|.	T|T	0.70710|0.70710	-0.4797|-0.4797	10|5	0.54805|.	T|.	0.06|.	-14.0058|-14.0058	15.3545|15.3545	0.74418|0.74418	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	317;495;488|.	B4DQI3;Q9H6U8-3;Q9H6U8|.	.;.;ALG9_HUMAN|.	L|C	324;317;721|73	ENSP00000435517:Q324L;ENSP00000381090:Q317L|.	ENSP00000381090:Q317L|.	Q|S	-|-	2|1	0|0	ALG9|ALG9	111212216|111212216	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.974000|7.974000	0.88039|0.88039	2.090000|2.090000	0.63153|0.63153	0.460000|0.460000	0.39030|0.39030	CAG|AGT	.	.	.	none		0.418	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391485.1	NM_024740	
CACNA1C	775	hgsc.bcm.edu	37	12	2602503	2602503	+	Missense_Mutation	SNP	C	C	T	rs538694667		TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr12:2602503C>T	ENST00000347598.4	+	7	1064	c.1064C>T	c.(1063-1065)aCg>aTg	p.T355M	CACNA1C_ENST00000344100.3_Missense_Mutation_p.T355M|CACNA1C_ENST00000399637.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399601.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399655.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399591.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399595.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399641.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399644.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399617.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399629.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000402845.3_Missense_Mutation_p.T355M|CACNA1C_ENST00000480911.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000335762.5_Missense_Mutation_p.T355M|CACNA1C_ENST00000327702.7_Missense_Mutation_p.T355M|CACNA1C_ENST00000399597.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000406454.3_Missense_Mutation_p.T355M|CACNA1C_ENST00000399638.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399634.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399603.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399649.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399621.1_Missense_Mutation_p.T355M|CACNA1C_ENST00000399606.1_Missense_Mutation_p.T355M	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	355					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCATGCTCACGGTGTTCCAG	0.622																																					p.T355M		Atlas-SNP	.											.	CACNA1C	1023	.	0			c.C1064T						PASS	.						202.0	194.0	197.0					12																	2602503		2203	4300	6503	SO:0001583	missense	775	exon7			TGCTCACGGTGTT	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.1064C>T	chr12.hg19:g.2602503C>T	ENSP00000266376:p.Thr355Met	137.0	0.0	.		96.0	21.0	.	NM_001129831	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	hg19	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590362	0.86851	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39	4.91	4.91	0.64330	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98874	0.9619	M	0.93854	3.465	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.998;1.0;0.999;0.999;0.997;0.999;1.0;1.0;0.999;0.997;1.0;0.999;0.999;1.0;0.997;1.0;0.999;1.0;0.997;0.999;0.999;0.997;0.997	D	0.99628	1.0985	10	0.87932	D	0	.	18.2978	0.90153	0.0:1.0:0.0:0.0	.	355;352;355;355;355;355;355;355;355;355;355;326;355;355;355;355;355;355;355;355;355;355;355;355	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	M	355;355;355;355;355;355;355;355;355;355;355;355;355;355;355;355;355;355;355;355;355;355;355;196	ENSP00000336982:T355M;ENSP00000382563:T355M;ENSP00000437936:T355M;ENSP00000382552:T355M;ENSP00000382547:T355M;ENSP00000382506:T355M;ENSP00000382530:T355M;ENSP00000382546:T355M;ENSP00000382500:T355M;ENSP00000382549:T355M;ENSP00000266376:T355M;ENSP00000382515:T355M;ENSP00000382510:T355M;ENSP00000341092:T355M;ENSP00000382537:T355M;ENSP00000329877:T355M;ENSP00000382557:T355M;ENSP00000385724:T355M;ENSP00000382512:T355M;ENSP00000382542:T355M;ENSP00000382526:T355M;ENSP00000385896:T355M;ENSP00000382504:T355M	ENSP00000323129:T196M	T	+	2	0	CACNA1C	2472764	1.000000	0.71417	0.618000	0.29105	0.925000	0.55904	7.609000	0.82925	2.560000	0.86352	0.462000	0.41574	ACG	.	.	.	none		0.622	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
TAS2R31	259290	hgsc.bcm.edu	37	12	11183487	11183487	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr12:11183487T>C	ENST00000390675.2	-	1	519	c.448A>G	c.(448-450)Aaa>Gaa	p.K150E	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	150					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						ACAATCTCTTTCATGTTTATC	0.388																																					p.K150E		Atlas-SNP	.											.	TAS2R31	24	.	0			c.A448G						PASS	.						80.0	81.0	81.0					12																	11183487		2099	4256	6355	SO:0001583	missense	259290	exon1			TCTCTTTCATGTT	AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.448A>G	chr12.hg19:g.11183487T>C	ENSP00000375093:p.Lys150Glu	174.0	0.0	.		173.0	37.0	.	NM_176885	P59547|Q17R84|Q645X5	Missense_Mutation	SNP	ENST00000390675.2	hg19	CCDS53747.1	.	.	.	.	.	.	.	.	.	.	.	5.887	0.347768	0.11126	.	.	ENSG00000256436	ENST00000390675	T	0.00705	5.81	2.45	-4.89	0.03103	.	.	.	.	.	T	0.00440	0.0014	N	0.11756	0.17	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.45026	-0.9289	9	0.26408	T	0.33	.	0.8461	0.01161	0.1672:0.3487:0.1681:0.316	.	150	P59538	T2R31_HUMAN	E	150	ENSP00000375093:K150E	ENSP00000375093:K150E	K	-	1	0	TAS2R31	11074754	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-3.555000	0.00432	-1.724000	0.01373	0.163000	0.16589	AAA	.	.	.	none		0.388	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885	
LRRK2	120892	hgsc.bcm.edu	37	12	40757356	40757356	+	Splice_Site	SNP	G	G	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr12:40757356G>T	ENST00000298910.7	+	48	7239	c.7181G>T	c.(7180-7182)aGg>aTg	p.R2394M		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2394					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CACTTTTTAAGGTAAATTCTG	0.368																																					p.R2394M		Atlas-SNP	.											.	LRRK2	763	.	0			c.G7181T						PASS	.						87.0	90.0	89.0					12																	40757356		2203	4300	6503	SO:0001630	splice_region_variant	120892	exon48			TTTTAAGGTAAAT	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.7181+1G>T	chr12.hg19:g.40757356G>T		38.0	0.0	.		73.0	4.0	.	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	hg19	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.706286	0.30232	.	.	ENSG00000188906	ENST00000298910	T	0.73047	-0.71	5.28	4.14	0.48551	WD40 repeat-like-containing domain (1);	0.140743	0.64402	D	0.000006	T	0.54062	0.1835	N	0.14661	0.345	0.80722	D	1	P;P	0.45348	0.856;0.856	B;B	0.41946	0.371;0.371	T	0.58482	-0.7629	10	0.87932	D	0	.	10.141	0.42736	0.9181:0.0:0.0819:0.0	.	2394;2394	Q17RV3;Q5S007	.;LRRK2_HUMAN	M	2394	ENSP00000298910:R2394M	ENSP00000298910:R2394M	R	+	2	0	LRRK2	39043623	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	4.153000	0.58118	0.853000	0.35312	-0.373000	0.07131	AGG	.	.	.	none		0.368	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	Missense_Mutation
ADCY6	112	hgsc.bcm.edu	37	12	49171000	49171000	+	Silent	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr12:49171000C>T	ENST00000307885.4	-	5	1957	c.1263G>A	c.(1261-1263)ctG>ctA	p.L421L	ADCY6_ENST00000550422.1_Silent_p.L421L|ADCY6_ENST00000552090.1_5'Flank|ADCY6_ENST00000357869.3_Silent_p.L421L	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	421					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						TCTTGATCCTCAGGCAGTGAT	0.582																																					p.L421L		Atlas-SNP	.											.	ADCY6	81	.	0			c.G1263A						PASS	.						102.0	103.0	103.0					12																	49171000		2203	4300	6503	SO:0001819	synonymous_variant	112	exon6			GATCCTCAGGCAG		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.1263G>A	chr12.hg19:g.49171000C>T		68.0	0.0	.		37.0	6.0	.	NM_020983	Q9NR75|Q9UDB0	Silent	SNP	ENST00000307885.4	hg19	CCDS8767.1																																																																																			.	.	.	none		0.582	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983	
XPOT	11260	hgsc.bcm.edu	37	12	64825465	64825465	+	Silent	SNP	T	T	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr12:64825465T>A	ENST00000332707.5	+	18	2653	c.2124T>A	c.(2122-2124)ctT>ctA	p.L708L		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	708	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		GTACTTTCCTTCATCGAATGA	0.428																																					p.L708L		Atlas-SNP	.											.	XPOT	105	.	0			c.T2124A						PASS	.						96.0	85.0	88.0					12																	64825465		2203	4300	6503	SO:0001819	synonymous_variant	11260	exon18			TTTCCTTCATCGA	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.2124T>A	chr12.hg19:g.64825465T>A		90.0	0.0	.		108.0	27.0	.	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Silent	SNP	ENST00000332707.5	hg19	CCDS31852.1																																																																																			.	.	.	none		0.428	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
TPH2	121278	hgsc.bcm.edu	37	12	72335374	72335374	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr12:72335374C>G	ENST00000333850.3	+	2	257	c.116C>G	c.(115-117)cCt>cGt	p.P39R	TPH2_ENST00000546576.1_3'UTR	NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	39					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	CTAAATAAACCTAACTCTGGC	0.388																																					p.P39R		Atlas-SNP	.											.	TPH2	81	.	0			c.C116G						PASS	.						67.0	62.0	64.0					12																	72335374		2203	4300	6503	SO:0001583	missense	121278	exon2			ATAAACCTAACTC	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.116C>G	chr12.hg19:g.72335374C>G	ENSP00000329093:p.Pro39Arg	43.0	0.0	.		62.0	16.0	.	NM_173353	A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	hg19	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.480817	0.44044	.	.	ENSG00000139287	ENST00000333850;ENST00000266669	D	0.99422	-5.88	5.91	5.01	0.66863	.	0.525534	0.21326	N	0.076363	D	0.96626	0.8899	N	0.08118	0	0.24376	N	0.994812	B	0.02656	0.0	B	0.01281	0.0	D	0.92945	0.6375	10	0.44086	T	0.13	-2.874	10.3721	0.44060	0.0:0.7946:0.1359:0.0695	.	39	Q8IWU9	TPH2_HUMAN	R	39	ENSP00000329093:P39R	ENSP00000266669:P39R	P	+	2	0	TPH2	70621641	0.321000	0.24625	1.000000	0.80357	0.956000	0.61745	1.432000	0.34936	1.475000	0.48197	0.650000	0.86243	CCT	.	.	.	none		0.388	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
IPO4	79711	hgsc.bcm.edu	37	14	24651547	24651547	+	Silent	SNP	C	C	A	rs374946858		TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr14:24651547C>A	ENST00000354464.6	-	25	2711	c.2535G>T	c.(2533-2535)gcG>gcT	p.A845A	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	845					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		CTCCCCCAGCCGCGGCTGCCA	0.617																																					p.A845A		Atlas-SNP	.											.	IPO4	74	.	0			c.G2535T						PASS	.						24.0	30.0	28.0					14																	24651547		2100	4212	6312	SO:0001819	synonymous_variant	79711	exon25			CCCAGCCGCGGCT	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.2535G>T	chr14.hg19:g.24651547C>A		229.0	0.0	.		135.0	35.0	.	NM_024658	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Silent	SNP	ENST00000354464.6	hg19	CCDS9616.1																																																																																			.	.	.	alt		0.617	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
CREBBP	1387	hgsc.bcm.edu	37	16	3778974	3778974	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr16:3778974G>T	ENST00000262367.5	-	31	6883	c.6074C>A	c.(6073-6075)cCc>cAc	p.P2025H	CREBBP_ENST00000382070.3_Missense_Mutation_p.P1987H	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2025					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CTGGGGAAGGGGCGCCTGCTG	0.716			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.P2025H		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.C6074A						PASS	.						8.0	10.0	10.0					16																	3778974		2177	4282	6459	SO:0001583	missense	1387	exon31			GGAAGGGGCGCCT	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.6074C>A	chr16.hg19:g.3778974G>T	ENSP00000262367:p.Pro2025His	67.0	0.0	.		32.0	8.0	.	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	hg19	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	g	9.873	1.199349	0.22121	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.84589	-1.87;-1.74	5.11	5.11	0.69529	Nuclear receptor coactivator, CREB-bp-like, interlocking (1);	0.174784	0.40908	D	0.000996	T	0.79958	0.4536	L	0.36672	1.1	0.40858	D	0.983818	P;P	0.42123	0.771;0.771	B;B	0.43623	0.425;0.425	T	0.76908	-0.2785	10	0.16420	T	0.52	-5.7528	13.5145	0.61533	0.0:0.0:0.844:0.156	.	2055;2025	Q4LE28;Q92793	.;CBP_HUMAN	H	2025;2055;1987;560	ENSP00000262367:P2025H;ENSP00000371502:P1987H	ENSP00000262367:P2025H	P	-	2	0	CREBBP	3718975	0.990000	0.36364	0.985000	0.45067	0.936000	0.57629	2.389000	0.44407	2.387000	0.81309	0.655000	0.94253	CCC	.	.	.	none		0.716	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
MARVELD3	91862	hgsc.bcm.edu	37	16	71668183	71668183	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr16:71668183G>C	ENST00000268485.3	+	3	727	c.683G>C	c.(682-684)gGc>gCc	p.G228A	MARVELD3_ENST00000565261.1_Intron|MARVELD3_ENST00000567501.1_Silent_p.G41G|MARVELD3_ENST00000299952.4_Intron	NM_052858.4	NP_443090.4	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	228	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				GGCTACACGGGCATCACCAGC	0.557																																					p.G228A		Atlas-SNP	.											MARVELD3_ENST00000268485,lower_third,carcinoma,0,1	MARVELD3	63	.	0			c.G683C						PASS	.						95.0	98.0	97.0					16																	71668183		2198	4300	6498	SO:0001583	missense	91862	exon3			ACACGGGCATCAC	BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000268485.3:c.683G>C	chr16.hg19:g.71668183G>C	ENSP00000268485:p.Gly228Ala	87.0	0.0	.		59.0	16.0	.	NM_052858	A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	ENST00000268485.3	hg19	CCDS10904.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014124	0.35511	.	.	ENSG00000140832	ENST00000268485	T	0.40756	1.02	5.91	5.91	0.95273	Marvel (1);	.	.	.	.	T	0.57169	0.2035	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.41179	-0.9523	9	0.12766	T	0.61	.	19.2867	0.94077	0.0:0.0:1.0:0.0	.	228	Q96A59	MALD3_HUMAN	A	228	ENSP00000268485:G228A	ENSP00000268485:G228A	G	+	2	0	MARVELD3	70225684	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.076000	0.71267	2.793000	0.96121	0.655000	0.94253	GGC	.	.	.	none		0.557	MARVELD3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268991.2	NM_052858	
ANKRD11	29123	hgsc.bcm.edu	37	16	89341269	89341269	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr16:89341269T>C	ENST00000301030.4	-	11	8126	c.7666A>G	c.(7666-7668)Acg>Gcg	p.T2556A	ANKRD11_ENST00000378330.2_Missense_Mutation_p.T2556A	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2556					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		AGCAGCATCGTGCAGGCGCTG	0.632																																					p.T2556A		Atlas-SNP	.											.	ANKRD11	195	.	0			c.A7666G						PASS	.						63.0	60.0	61.0					16																	89341269		2198	4300	6498	SO:0001583	missense	29123	exon11			GCATCGTGCAGGC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7666A>G	chr16.hg19:g.89341269T>C	ENSP00000301030:p.Thr2556Ala	94.0	0.0	.		65.0	12.0	.	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	hg19	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.716462	0.68844	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.45668	0.89;0.89	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000002	T	0.66781	0.2824	M	0.83953	2.67	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.71163	-0.4673	10	0.52906	T	0.07	.	14.9521	0.71083	0.0:0.0:0.0:1.0	.	2556	Q6UB99	ANR11_HUMAN	A	2556	ENSP00000301030:T2556A;ENSP00000367581:T2556A	ENSP00000301030:T2556A	T	-	1	0	ANKRD11	87868770	1.000000	0.71417	1.000000	0.80357	0.633000	0.38033	7.859000	0.86982	2.077000	0.62373	0.533000	0.62120	ACG	.	.	.	none		0.632	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
SMYD4	114826	hgsc.bcm.edu	37	17	1687738	1687738	+	Silent	SNP	G	G	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr17:1687738G>C	ENST00000305513.7	-	8	2069	c.1902C>G	c.(1900-1902)cgC>cgG	p.R634R		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	634							metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						TGCTGCCACAGCGCAGCACGT	0.542											OREG0024075	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R634R		Atlas-SNP	.											.	SMYD4	50	.	0			c.C1902G						PASS	.						133.0	123.0	126.0					17																	1687738		2203	4300	6503	SO:0001819	synonymous_variant	114826	exon8			GCCACAGCGCAGC	AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1902C>G	chr17.hg19:g.1687738G>C		88.0	0.0	.	597	62.0	14.0	.	NM_052928	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Silent	SNP	ENST00000305513.7	hg19	CCDS11013.1																																																																																			.	.	.	none		0.542	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207108.4	XM_056082	
PAFAH1B1	5048	hgsc.bcm.edu	37	17	2577395	2577395	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr17:2577395G>A	ENST00000397195.5	+	8	1164	c.713G>A	c.(712-714)cGt>cAt	p.R238H	PAFAH1B1_ENST00000451360.2_Missense_Mutation_p.R67H|PAFAH1B1_ENST00000572915.2_Intron	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)											endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						GAATGGGTACGTATGGTACGG	0.448																																					p.R238H		Atlas-SNP	.											.	PAFAH1B1	26	.	0			c.G713A						PASS	.						130.0	102.0	112.0					17																	2577395		2203	4300	6503	SO:0001583	missense	5048	exon8			GGGTACGTATGGT	L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.713G>A	chr17.hg19:g.2577395G>A	ENSP00000380378:p.Arg238His	373.0	0.0	.		267.0	20.0	.	NM_000430		Missense_Mutation	SNP	ENST00000397195.5	hg19	CCDS32528.1	.	.	.	.	.	.	.	.	.	.	G	34	5.372309	0.95923	.	.	ENSG00000007168	ENST00000397195;ENST00000397193;ENST00000451360	T;T	0.62105	0.05;0.05	5.74	5.74	0.90152	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67599	0.2910	L	0.52011	1.625	0.80722	D	1	P;D	0.59767	0.9;0.986	P;P	0.53035	0.554;0.716	T	0.60969	-0.7157	10	0.18276	T	0.48	.	18.9232	0.92534	0.0:0.0:1.0:0.0	.	67;238	B4DF38;P43034	.;LIS1_HUMAN	H	238;67;67	ENSP00000380378:R238H;ENSP00000395628:R67H	ENSP00000380377:R67H	R	+	2	0	PAFAH1B1	2524145	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.703000	0.92315	0.655000	0.94253	CGT	.	.	.	none		0.448	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437797.2	NM_000430	
GLP2R	9340	hgsc.bcm.edu	37	17	9792980	9792980	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr17:9792980G>A	ENST00000262441.5	+	13	2133	c.1620G>A	c.(1618-1620)atG>atA	p.M540I	GLP2R_ENST00000574745.1_Missense_Mutation_p.M360I	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	540					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	ATGTCACCATGGCCAACACCA	0.642																																					p.M540I		Atlas-SNP	.											.	GLP2R	90	.	0			c.G1620A						PASS	.						32.0	27.0	29.0					17																	9792980		2203	4300	6503	SO:0001583	missense	9340	exon13			CACCATGGCCAAC	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.1620G>A	chr17.hg19:g.9792980G>A	ENSP00000262441:p.Met540Ile	96.0	0.0	.		73.0	31.0	.	NM_004246	Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	hg19	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.023235	0.35701	.	.	ENSG00000065325	ENST00000396206;ENST00000262441	T	0.53423	0.62	5.97	2.5	0.30297	.	0.263906	0.20265	N	0.095796	T	0.24624	0.0597	N	0.08118	0	0.21652	N	0.9996	B	0.02656	0.0	B	0.01281	0.0	T	0.14227	-1.0480	10	0.40728	T	0.16	.	8.2404	0.31656	0.0:0.3617:0.3907:0.2476	.	540	O95838	GLP2R_HUMAN	I	540	ENSP00000262441:M540I	ENSP00000262441:M540I	M	+	3	0	GLP2R	9733705	0.146000	0.22672	1.000000	0.80357	0.985000	0.73830	0.185000	0.16958	1.468000	0.48064	0.655000	0.94253	ATG	.	.	.	none		0.642	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4		
MYO18A	399687	hgsc.bcm.edu	37	17	27437065	27437065	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr17:27437065G>C	ENST00000527372.1	-	19	3322	c.3142C>G	c.(3142-3144)Ctg>Gtg	p.L1048V	MYO18A_ENST00000531253.1_Missense_Mutation_p.L1048V|MYO18A_ENST00000354329.4_Missense_Mutation_p.L1048V|MYO18A_ENST00000533112.1_Missense_Mutation_p.L1048V	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1048	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GCTACAGGCAGGAAGCAGTGC	0.637																																					p.L1048V	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.C3142G						PASS	.						39.0	49.0	46.0					17																	27437065		2178	4283	6461	SO:0001583	missense	399687	exon19			CAGGCAGGAAGCA	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.3142C>G	chr17.hg19:g.27437065G>C	ENSP00000437073:p.Leu1048Val	85.0	0.0	.		66.0	19.0	.	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	hg19	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.555798	0.45487	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000458428	D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21	5.06	4.09	0.47781	Myosin head, motor domain (2);	0.000000	0.64402	D	0.000001	D	0.89058	0.6607	L	0.35793	1.09	0.36621	D	0.875739	P;D;D;D;D	0.71674	0.537;0.998;0.998;0.998;0.998	B;D;D;D;D	0.83275	0.219;0.996;0.996;0.996;0.983	D	0.88752	0.3251	10	0.27082	T	0.32	.	13.476	0.61308	0.0772:0.0:0.9228:0.0	.	717;660;1048;1048;1048	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	V	1048;1048;1048;1048;1048;660	ENSP00000346291:L1048V;ENSP00000435932:L1048V;ENSP00000434228:L1048V;ENSP00000437073:L1048V	ENSP00000346291:L1048V	L	-	1	2	MYO18A	24461191	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	3.662000	0.54510	1.268000	0.44264	0.561000	0.74099	CTG	.	.	.	none		0.637	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
RNF213	57674	hgsc.bcm.edu	37	17	78321044	78321044	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr17:78321044C>T	ENST00000582970.1	+	29	9052	c.8909C>T	c.(8908-8910)tCa>tTa	p.S2970L	RNF213_ENST00000336301.6_Missense_Mutation_p.S1043L|RNF213_ENST00000508628.2_Missense_Mutation_p.S3019L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2970					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCAAAGGCTTCAAATAGAAAG	0.483																																					p.S2970L		Atlas-SNP	.											.	RNF213	766	.	0			c.C8909T						PASS	.						36.0	32.0	34.0					17																	78321044		2203	4300	6503	SO:0001583	missense	57674	exon29			AGGCTTCAAATAG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.8909C>T	chr17.hg19:g.78321044C>T	ENSP00000464087:p.Ser2970Leu	86.0	0.0	.		84.0	17.0	.	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	hg19	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	5.507	0.278473	0.10403	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.31510	1.49	5.82	5.82	0.92795	.	0.215070	0.40144	N	0.001174	T	0.39253	0.1071	M	0.72576	2.205	0.18873	N	0.999983	B	0.25441	0.126	B	0.21546	0.035	T	0.32079	-0.9920	10	0.59425	D	0.04	.	20.093	0.97828	0.0:1.0:0.0:0.0	.	1043	Q63HN8	RN213_HUMAN	L	2970;3019;1043	ENSP00000338218:S1043L	ENSP00000338218:S1043L	S	+	2	0	RNF213	75935639	0.971000	0.33674	0.008000	0.14137	0.003000	0.03518	4.793000	0.62474	2.751000	0.94390	0.563000	0.77884	TCA	.	.	.	none		0.483	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
ZCCHC2	54877	hgsc.bcm.edu	37	18	60241523	60241523	+	Missense_Mutation	SNP	G	G	A	rs377112503		TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr18:60241523G>A	ENST00000269499.5	+	13	2627	c.2209G>A	c.(2209-2211)Gtt>Att	p.V737I	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.V416I	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	737						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TGAAGTTGTCGTTCCTGCACC	0.448																																					p.V737I		Atlas-SNP	.											.	ZCCHC2	64	.	0			c.G2209A						PASS	.	G	ILE/VAL	1,3945		0,1,1972	103.0	101.0	102.0		2209	0.9	0.0	18		102	0,8358		0,0,4179	no	missense	ZCCHC2	NM_017742.4	29	0,1,6151	AA,AG,GG		0.0,0.0253,0.0081	benign	737/1179	60241523	1,12303	1973	4179	6152	SO:0001583	missense	54877	exon13			GTTGTCGTTCCTG	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.2209G>A	chr18.hg19:g.60241523G>A	ENSP00000269499:p.Val737Ile	121.0	0.0	.		117.0	25.0	.	NM_017742	B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	hg19	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	G	6.618	0.482373	0.12581	2.53E-4	0.0	ENSG00000141664	ENST00000269499	T	0.24723	1.84	5.58	0.954	0.19595	.	0.920531	0.09269	N	0.825430	T	0.11324	0.0276	N	0.12182	0.205	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.37686	-0.9695	10	0.07030	T	0.85	-3.16	6.2352	0.20758	0.1872:0.1457:0.6671:0.0	.	737	Q9C0B9	ZCHC2_HUMAN	I	737	ENSP00000269499:V737I	ENSP00000269499:V737I	V	+	1	0	ZCCHC2	58392503	0.009000	0.17119	0.002000	0.10522	0.823000	0.46562	0.222000	0.17699	-0.134000	0.11516	0.655000	0.94253	GTT	.	.	.	weak		0.448	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
CD226	10666	hgsc.bcm.edu	37	18	67614032	67614032	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr18:67614032G>A	ENST00000280200.4	-	3	588	c.320C>T	c.(319-321)tCc>tTc	p.S107F	CD226_ENST00000577287.1_Intron|CD226_ENST00000581982.1_Intron|CD226_ENST00000582621.1_Missense_Mutation_p.S107F	NM_006566.2	NP_006557.2	Q15762	CD226_HUMAN	CD226 molecule	107	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)|cytokine production (GO:0001816)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	24		Esophageal squamous(42;0.129)				AAGAGAGCAGGAATAGTAGCC	0.403																																					p.S107F	NSCLC(184;838 2130 8673 21498 50749)	Atlas-SNP	.											.	CD226	51	.	0			c.C320T						PASS	.						112.0	104.0	107.0					18																	67614032		2203	4300	6503	SO:0001583	missense	10666	exon3			GAGCAGGAATAGT	U56102	CCDS11997.1	18q22.3	2013-01-11	2006-03-28		ENSG00000150637	ENSG00000150637		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	16961	protein-coding gene	gene with protein product		605397	"""CD226 antigen"""			8673704	Standard	NM_006566		Approved	DNAM-1, DNAM1, PTA1, TLiSA1	uc002lkm.4	Q15762	OTTHUMG00000132809	ENST00000280200.4:c.320C>T	chr18.hg19:g.67614032G>A	ENSP00000280200:p.Ser107Phe	192.0	0.0	.		167.0	39.0	.	NM_006566	B2R818	Missense_Mutation	SNP	ENST00000280200.4	hg19	CCDS11997.1	.	.	.	.	.	.	.	.	.	.	G	1.423	-0.572473	0.03882	.	.	ENSG00000150637	ENST00000280200	T	0.63913	-0.07	5.51	1.31	0.21738	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.347798	0.34314	N	0.004071	T	0.50446	0.1616	M	0.72479	2.2	0.30526	N	0.767936	P	0.35077	0.483	B	0.28553	0.091	T	0.50659	-0.8802	10	0.09843	T	0.71	.	9.698	0.40169	0.0:0.4401:0.4089:0.151	.	107	Q15762	CD226_HUMAN	F	107	ENSP00000280200:S107F	ENSP00000280200:S107F	S	-	2	0	CD226	65765012	0.975000	0.34042	0.882000	0.34594	0.201000	0.24016	0.136000	0.15974	0.340000	0.23745	-0.176000	0.13171	TCC	.	.	.	none		0.403	CD226-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256226.3	NM_006566	
SALL3	27164	hgsc.bcm.edu	37	18	76753052	76753052	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr18:76753052C>T	ENST00000537592.2	+	2	1061	c.1061C>T	c.(1060-1062)gCg>gTg	p.A354V	SALL3_ENST00000575389.2_Missense_Mutation_p.A354V|SALL3_ENST00000536229.3_Missense_Mutation_p.A221V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	354					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CTGCTGGGTGCGGCGCCCGGC	0.751																																					p.A354V		Atlas-SNP	.											.	SALL3	162	.	0			c.C1061T						PASS	.						8.0	10.0	9.0					18																	76753052		2140	4216	6356	SO:0001583	missense	27164	exon2			TGGGTGCGGCGCC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1061C>T	chr18.hg19:g.76753052C>T	ENSP00000441823:p.Ala354Val	84.0	0.0	.		54.0	11.0	.	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	hg19	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.712415	0.48517	.	.	ENSG00000256463	ENST00000537592;ENST00000536229	T	0.09163	3.01	4.37	4.37	0.52481	.	0.274240	0.25671	N	0.029076	T	0.04227	0.0117	N	0.02916	-0.46	0.28697	N	0.904262	P	0.37158	0.585	B	0.25140	0.058	T	0.29274	-1.0017	10	0.20519	T	0.43	-6.7884	17.1219	0.86704	0.0:1.0:0.0:0.0	.	354	Q9BXA9	SALL3_HUMAN	V	354	ENSP00000441823:A354V	ENSP00000299466:A354V	A	+	2	0	SALL3	74854040	0.982000	0.34865	0.003000	0.11579	0.005000	0.04900	5.445000	0.66594	2.269000	0.75478	0.460000	0.39030	GCG	.	.	.	none		0.751	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
ZNF823	55552	hgsc.bcm.edu	37	19	11833714	11833714	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr19:11833714C>A	ENST00000341191.6	-	4	788	c.635G>T	c.(634-636)aGa>aTa	p.R212I	ZNF823_ENST00000545749.1_Missense_Mutation_p.R30I	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	212					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						AGTGTGTGTTCTTTCGTGCAA	0.433										HNSCC(68;0.2)																											p.R212I		Atlas-SNP	.											.	ZNF823	104	.	0			c.G635T						PASS	.						103.0	109.0	107.0					19																	11833714		2199	4299	6498	SO:0001583	missense	55552	exon4			TGTGTTCTTTCGT	X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.635G>T	chr19.hg19:g.11833714C>A	ENSP00000340683:p.Arg212Ile	80.0	0.0	.		95.0	25.0	.	NM_001080493	A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	ENST00000341191.6	hg19	CCDS45981.1	.	.	.	.	.	.	.	.	.	.	c	16.91	3.253614	0.59212	.	.	ENSG00000197933	ENST00000545749;ENST00000341191;ENST00000431998	T;T;T	0.24908	1.83;1.83;1.83	0.632	0.632	0.17705	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47432	0.1445	M	0.81179	2.53	0.39861	D	0.973379	D	0.89917	1.0	D	0.91635	0.999	T	0.51325	-0.8720	9	0.59425	D	0.04	.	8.7993	0.34898	0.0:1.0:0.0:0.0	.	212	P16415	ZN823_HUMAN	I	30;212;168	ENSP00000440162:R30I;ENSP00000340683:R212I;ENSP00000410654:R168I	ENSP00000340683:R212I	R	-	2	0	ZNF823	11694714	0.000000	0.05858	0.361000	0.25849	0.489000	0.33432	-1.844000	0.01679	0.618000	0.30179	0.298000	0.19748	AGA	.	.	.	none		0.433	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344516.2	NM_001080493	
ZNF546	339327	hgsc.bcm.edu	37	19	40521590	40521590	+	Missense_Mutation	SNP	T	T	C	rs371824172		TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr19:40521590T>C	ENST00000347077.4	+	7	2629	c.2413T>C	c.(2413-2415)Tat>Cat	p.Y805H	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Missense_Mutation_p.Y779H	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	805					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TGAAAAACCCTATCAATGTAA	0.358																																					p.Y805H		Atlas-SNP	.											.	ZNF546	93	.	0			c.T2413C						PASS	.						55.0	56.0	56.0					19																	40521590		2203	4300	6503	SO:0001583	missense	339327	exon7			AAACCCTATCAAT	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.2413T>C	chr19.hg19:g.40521590T>C	ENSP00000339823:p.Tyr805His	180.0	0.0	.		172.0	43.0	.	NM_178544	A8K913	Missense_Mutation	SNP	ENST00000347077.4	hg19	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	t	16.66	3.184714	0.57909	.	.	ENSG00000187187	ENST00000347077;ENST00000392042	T	0.21734	1.99	3.08	3.08	0.35506	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26484	0.0647	L	0.34521	1.04	0.22500	N	0.999044	P	0.50710	0.938	P	0.54238	0.746	T	0.05354	-1.0890	9	0.62326	D	0.03	.	9.8957	0.41318	0.0:0.0:0.0:1.0	.	805	Q86UE3	ZN546_HUMAN	H	805;414	ENSP00000339823:Y805H	ENSP00000339823:Y805H	Y	+	1	0	ZNF546	45213430	0.002000	0.14202	0.877000	0.34402	0.988000	0.76386	1.274000	0.33132	1.639000	0.50556	0.533000	0.62120	TAT	.	.	.	alt		0.358	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544	
ZNF534	147658	hgsc.bcm.edu	37	19	52941686	52941686	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr19:52941686C>T	ENST00000332323.6	+	4	1073	c.1012C>T	c.(1012-1014)Cct>Tct	p.P338S	ZNF534_ENST00000433050.1_Missense_Mutation_p.P325S|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Intron	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	338					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						TGGAGAGAAACCTTATGATTG	0.408																																					p.P338S		Atlas-SNP	.											ZNF534_ENST00000332323,NS,carcinoma,0,1	ZNF534	105	.	0			c.C1012T						PASS	.						60.0	54.0	56.0					19																	52941686		1568	3582	5150	SO:0001583	missense	147658	exon4			GAGAAACCTTATG	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1012C>T	chr19.hg19:g.52941686C>T	ENSP00000327538:p.Pro338Ser	72.0	0.0	.		79.0	28.0	.	NM_001143939	Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	hg19	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162751	0.57368	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.16743	2.32;2.32	1.82	1.82	0.25136	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36580	0.0972	M	0.72576	2.205	0.80722	D	1	D;D	0.89917	1.0;0.977	D;P	0.73380	0.98;0.724	T	0.22977	-1.0201	9	0.72032	D	0.01	.	10.6089	0.45410	0.0:1.0:0.0:0.0	.	325;338	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	S	338;325;337	ENSP00000327538:P338S;ENSP00000391358:P325S	ENSP00000327538:P338S	P	+	1	0	ZNF534	57633498	0.017000	0.18338	0.171000	0.22900	0.041000	0.13682	2.724000	0.47285	0.983000	0.38602	0.467000	0.42956	CCT	.	.	.	none		0.408	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
CEP250	11190	hgsc.bcm.edu	37	20	34091233	34091233	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr20:34091233A>T	ENST00000397527.1	+	30	5756	c.5036A>T	c.(5035-5037)aAg>aTg	p.K1679M	CEP250_ENST00000342580.4_Missense_Mutation_p.K1623M	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1679	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CGGCAGACCAAGATCCTGGAG	0.572																																					p.K1679M		Atlas-SNP	.											.	CEP250	141	.	0			c.A5036T						PASS	.						108.0	116.0	113.0					20																	34091233		2203	4300	6503	SO:0001583	missense	11190	exon30			AGACCAAGATCCT	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.5036A>T	chr20.hg19:g.34091233A>T	ENSP00000380661:p.Lys1679Met	171.0	0.0	.		111.0	20.0	.	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	hg19	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	A	13.90	2.374127	0.42105	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.50813	2.82;2.81;0.73	4.51	3.38	0.38709	.	0.096996	0.45361	D	0.000370	T	0.50905	0.1643	L	0.29908	0.895	0.20307	N	0.999913	D	0.89917	1.0	D	0.75484	0.986	T	0.28332	-1.0047	10	0.72032	D	0.01	.	7.1017	0.25340	0.8007:0.0:0.1993:0.0	.	1679	Q9BV73	CP250_HUMAN	M	1679;1623;167	ENSP00000380661:K1679M;ENSP00000341541:K1623M;ENSP00000395992:K167M	ENSP00000341541:K1623M	K	+	2	0	CEP250	33554647	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	1.847000	0.39299	1.906000	0.55180	0.374000	0.22700	AAG	.	.	.	none		0.572	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
DIDO1	11083	hgsc.bcm.edu	37	20	61528138	61528138	+	Missense_Mutation	SNP	A	A	T	rs545443252		TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr20:61528138A>T	ENST00000266070.4	-	7	2124	c.1799T>A	c.(1798-1800)cTc>cAc	p.L600H	DIDO1_ENST00000395343.1_Missense_Mutation_p.L600H|DIDO1_ENST00000395340.1_Missense_Mutation_p.L600H|DIDO1_ENST00000395335.2_Missense_Mutation_p.L600H	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	600					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GGTAGCGGAGAGCCATGGCCT	0.602																																					p.L600H	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											.	DIDO1	321	.	0			c.T1799A						PASS	.						68.0	70.0	69.0					20																	61528138		2203	4300	6503	SO:0001583	missense	11083	exon7			GCGGAGAGCCATG	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1799T>A	chr20.hg19:g.61528138A>T	ENSP00000266070:p.Leu600His	120.0	0.0	.		82.0	15.0	.	NM_080797	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	hg19	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	A	12.70	2.017626	0.35606	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.13307	2.93;2.93;2.6;2.6	5.7	-0.659	0.11424	.	0.514056	0.13468	U	0.385637	T	0.11707	0.0285	M	0.62723	1.935	0.09310	N	1	B;B	0.23854	0.092;0.056	B;B	0.22880	0.042;0.019	T	0.29640	-1.0005	10	0.46703	T	0.11	-5.1348	2.052	0.03573	0.3424:0.145:0.3719:0.1407	.	600;600	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	H	600	ENSP00000266070:L600H;ENSP00000378752:L600H;ENSP00000378749:L600H;ENSP00000378744:L600H	ENSP00000266070:L600H	L	-	2	0	DIDO1	60998583	0.253000	0.23982	0.004000	0.12327	0.017000	0.09413	0.678000	0.25277	-0.398000	0.07679	-0.691000	0.03719	CTC	.	.	.	none		0.602	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
HELZ2	85441	hgsc.bcm.edu	37	20	62191860	62191860	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr20:62191860T>A	ENST00000467148.1	-	16	7541	c.7472A>T	c.(7471-7473)aAg>aTg	p.K2491M	HELZ2_ENST00000427522.2_Missense_Mutation_p.K1922M	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2491	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CAGGTTGGCCTTGGAGTTCTC	0.632																																					p.K2491M		Atlas-SNP	.											.	.	.	.	0			c.A7472T						PASS	.						183.0	172.0	176.0					20																	62191860		2203	4300	6503	SO:0001583	missense	85441	exon17			TTGGCCTTGGAGT	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7472A>T	chr20.hg19:g.62191860T>A	ENSP00000417401:p.Lys2491Met	49.0	0.0	.		28.0	7.0	.	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	hg19	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.426968	0.62733	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.92446	-3.04;-3.04	4.12	1.67	0.24075	ATPase, AAA+ type, core (1);	0.371166	0.26804	N	0.022405	D	0.92743	0.7693	M	0.69823	2.125	0.35376	D	0.78947	P;D	0.52996	0.943;0.957	P;P	0.56648	0.803;0.734	D	0.92434	0.5956	10	0.66056	D	0.02	-29.268	6.5428	0.22390	0.0:0.5434:0.0:0.4566	.	2491;1922	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	M	1922;2491	ENSP00000393257:K1922M;ENSP00000417401:K2491M	ENSP00000393257:K1922M	K	-	2	0	RP4-697K14.7	61662304	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	0.575000	0.23729	0.508000	0.28173	0.402000	0.26972	AAG	.	.	.	none		0.632	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HELZ2	85441	hgsc.bcm.edu	37	20	62202151	62202151	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr20:62202151G>A	ENST00000467148.1	-	2	418	c.349C>T	c.(349-351)Cgg>Tgg	p.R117W	HELZ2_ENST00000427522.2_5'Flank|HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	117					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TGCGTGCGCCGGACCCACTCC	0.697																																					p.R117W		Atlas-SNP	.											.	.	.	.	0			c.C349T						PASS	.						20.0	19.0	20.0					20																	62202151		2197	4293	6490	SO:0001583	missense	85441	exon3			TGCGCCGGACCCA	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.349C>T	chr20.hg19:g.62202151G>A	ENSP00000417401:p.Arg117Trp	162.0	0.0	.		101.0	20.0	.	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	hg19	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	G	9.347	1.064605	0.20067	.	.	ENSG00000130589	ENST00000467148	T	0.02682	4.2	4.57	0.183	0.15082	.	0.900092	0.09600	N	0.780350	T	0.02304	0.0071	N	0.22421	0.69	0.09310	N	1	B;B	0.20052	0.041;0.002	B;B	0.10450	0.005;0.001	T	0.45293	-0.9271	10	0.72032	D	0.01	-17.7927	5.2244	0.15385	0.245:0.2695:0.4855:0.0	.	117;117	Q4VXQ0;Q9BYK8	.;PR285_HUMAN	W	117	ENSP00000417401:R117W	ENSP00000417401:R117W	R	-	1	2	RP4-697K14.7	61672595	0.012000	0.17670	0.000000	0.03702	0.001000	0.01503	1.831000	0.39141	0.087000	0.17167	-0.125000	0.14975	CGG	.	.	.	none		0.697	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
YWHAH	7533	hgsc.bcm.edu	37	22	32352566	32352566	+	Silent	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr22:32352566C>T	ENST00000248975.5	+	2	801	c.528C>T	c.(526-528)gcC>gcT	p.A176A	YWHAH_ENST00000397492.1_3'UTR|YWHAH_ENST00000471374.1_3'UTR	NM_003405.3	NP_003396.1	Q04917	1433F_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta	176					apoptotic process (GO:0006915)|glucocorticoid catabolic process (GO:0006713)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular protein transport (GO:0006886)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane depolarization during action potential (GO:0086010)|membrane organization (GO:0061024)|negative regulation of dendrite morphogenesis (GO:0050774)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of sodium ion transport (GO:0002028)|regulation of synaptic plasticity (GO:0048167)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|glucocorticoid receptor binding (GO:0035259)|insulin-like growth factor receptor binding (GO:0005159)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|large_intestine(1)|upper_aerodigestive_tract(1)	4						TGGGCCTGGCCCTCAACTTCT	0.522																																					p.A176A	Ovarian(98;460 2060 9263 44007)	Atlas-SNP	.											.	YWHAH	14	.	0			c.C528T						PASS	.						73.0	63.0	66.0					22																	32352566		2203	4300	6503	SO:0001819	synonymous_variant	7533	exon2			CCTGGCCCTCAAC	X78138	CCDS13901.1	22q12.1-q13.1	2013-12-03	2013-12-03		ENSG00000128245	ENSG00000128245			12853	protein-coding gene	gene with protein product	"""14-3-3 eta"""	113508	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide"""	YWHA1			Standard	NM_003405		Approved		uc003alz.3	Q04917	OTTHUMG00000030833	ENST00000248975.5:c.528C>T	chr22.hg19:g.32352566C>T		90.0	0.0	.		61.0	18.0	.	NM_003405		Silent	SNP	ENST00000248975.5	hg19	CCDS13901.1																																																																																			.	.	.	none		0.522	YWHAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075721.2	NM_003405	
DDX17	10521	hgsc.bcm.edu	37	22	38897263	38897263	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr22:38897263C>A	ENST00000396821.3	-	2	409	c.310G>T	c.(310-312)Ggc>Tgc	p.G104C	DDX17_ENST00000432525.1_5'UTR|DDX17_ENST00000381633.3_Missense_Mutation_p.G25C	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	104	Poly-Gly.				ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					GGGGGAAGGCCACCACCACCT	0.388																																					p.G104C	Ovarian(55;1085 1454 6392 21425)	Atlas-SNP	.											.	DDX17	73	.	0			c.G310T						PASS	.						72.0	73.0	73.0					22																	38897263		2203	4300	6503	SO:0001583	missense	10521	exon2			GAAGGCCACCACC	U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.310G>T	chr22.hg19:g.38897263C>A	ENSP00000380033:p.Gly104Cys	85.0	0.0	.		108.0	28.0	.	NM_006386	B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	ENST00000396821.3	hg19	CCDS46706.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.476078	0.84640	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.31510	1.49;1.49;1.49	5.58	5.58	0.84498	.	0.187005	0.56097	D	0.000023	T	0.37732	0.1014	N	0.19112	0.55	0.80722	D	1	P;D;D	0.65815	0.938;0.992;0.995	B;P;P	0.60473	0.282;0.754;0.875	T	0.18429	-1.0337	10	0.56958	D	0.05	-11.3755	15.4155	0.74962	0.0:0.8215:0.1785:0.0	.	25;106;104	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	C	104;25;104;106	ENSP00000380033:G104C;ENSP00000371046:G25C;ENSP00000385536:G104C	ENSP00000371046:G25C	G	-	1	0	DDX17	37227209	0.996000	0.38824	1.000000	0.80357	0.985000	0.73830	3.659000	0.54489	2.625000	0.88918	0.591000	0.81541	GGC	.	.	.	none		0.388	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321476.2	NM_030881	
LDOC1L	84247	hgsc.bcm.edu	37	22	44892956	44892956	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr22:44892956G>C	ENST00000341255.3	-	2	990	c.481C>G	c.(481-483)Ccc>Gcc	p.P161A		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	161										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		TTGCGCAAGGGGCTGTCAGGT	0.627																																					p.P161A		Atlas-SNP	.											.	LDOC1L	24	.	0			c.C481G						PASS	.						44.0	45.0	44.0					22																	44892956		2203	4300	6503	SO:0001583	missense	84247	exon2			GCAAGGGGCTGTC	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.481C>G	chr22.hg19:g.44892956G>C	ENSP00000340434:p.Pro161Ala	114.0	0.0	.		63.0	17.0	.	NM_032287	Q6ZTR1	Missense_Mutation	SNP	ENST00000341255.3	hg19	CCDS33662.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.636050	0.67130	.	.	ENSG00000188636	ENST00000341255	T	0.20598	2.06	3.1	3.1	0.35709	.	0.000000	0.46442	D	0.000284	T	0.26629	0.0651	L	0.39898	1.24	0.31559	N	0.657769	D	0.53151	0.958	P	0.54759	0.76	T	0.11690	-1.0577	10	0.54805	T	0.06	-18.0316	9.9334	0.41537	0.0:0.0:1.0:0.0	.	161	Q6ICC9	LDOCL_HUMAN	A	161	ENSP00000340434:P161A	ENSP00000340434:P161A	P	-	1	0	LDOC1L	43271620	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.858000	0.55979	2.054000	0.61138	0.591000	0.81541	CCC	.	.	.	none		0.627	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	
TAF7L	54457	hgsc.bcm.edu	37	X	100533091	100533091	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chrX:100533091C>T	ENST00000372907.3	-	8	792	c.781G>A	c.(781-783)Gtg>Atg	p.V261M	TAF7L_ENST00000324762.6_Missense_Mutation_p.V175M|TAF7L_ENST00000372905.2_Missense_Mutation_p.V175M|TAF7L_ENST00000356784.1_Missense_Mutation_p.V175M	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	261					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						TCATTTTCCACGTCTGGAGAT	0.448																																					p.V261M	Ovarian(104;431 1530 3210 15406 18594)	Atlas-SNP	.											.	TAF7L	64	.	0			c.G781A						PASS	.						108.0	94.0	98.0					X																	100533091		2203	4300	6503	SO:0001583	missense	54457	exon8			TTTCCACGTCTGG	AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.781G>A	chrX.hg19:g.100533091C>T	ENSP00000361998:p.Val261Met	32.0	0.0	.		26.0	6.0	.	NM_024885	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	ENST00000372907.3	hg19	CCDS35347.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.001964	0.54254	.	.	ENSG00000102387	ENST00000372907;ENST00000372905;ENST00000324762;ENST00000356784	T;T;T;T	0.29917	3.63;1.55;1.55;3.03	5.08	4.21	0.49690	TAFII55 protein, conserved region (1);Armadillo-like helical (1);	0.597438	0.13950	N	0.351626	T	0.64305	0.2586	M	0.91249	3.19	0.42809	D	0.993953	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.992	T	0.70536	-0.4845	10	0.87932	D	0	-4.719	14.2598	0.66078	0.1501:0.8499:0.0:0.0	.	261;175	Q5H9L4;Q5H9L4-3	TAF7L_HUMAN;.	M	261;175;175;175	ENSP00000361998:V261M;ENSP00000361996:V175M;ENSP00000320283:V175M;ENSP00000349235:V175M	ENSP00000320283:V175M	V	-	1	0	TAF7L	100419747	1.000000	0.71417	0.971000	0.41717	0.421000	0.31385	5.391000	0.66266	1.000000	0.39049	0.600000	0.82982	GTG	.	.	.	none		0.448	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2		
GLRA4	441509	hgsc.bcm.edu	37	X	102979831	102979831	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chrX:102979831A>G	ENST00000372617.4	-	2	617	c.197T>C	c.(196-198)tTt>tCt	p.F66S	GLRA4_ENST00000469567.1_5'Flank	NM_001024452.2	NP_001019623.2	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4	66						cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			cervix(1)|endometrium(2)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						CTTACCTTTAAAATTGGGCCG	0.498																																					p.F66S		Atlas-SNP	.											.	GLRA4	86	.	0			c.T197C						PASS	.						67.0	66.0	66.0					X																	102979831		1924	4150	6074	SO:0001583	missense	441509	exon2			CCTTTAAAATTGG	Z93848	CCDS43980.2	Xq22.2	2012-01-16			ENSG00000188828	ENSG00000188828		"""Ligand-gated ion channels / Glycine receptors"""	31715	protein-coding gene	gene with protein product							Standard	NM_001024452		Approved		uc011mse.2	Q5JXX5	OTTHUMG00000022110	ENST00000372617.4:c.197T>C	chrX.hg19:g.102979831A>G	ENSP00000361700:p.Phe66Ser	53.0	0.0	.		46.0	23.0	.	NM_001024452		Missense_Mutation	SNP	ENST00000372617.4	hg19	CCDS43980.2	.	.	.	.	.	.	.	.	.	.	A	18.89	3.718769	0.68844	.	.	ENSG00000188828	ENST00000372617	T	0.78246	-1.16	5.79	5.79	0.91817	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.81612	0.4859	M	0.68952	2.095	0.58432	D	0.999995	B;P	0.36712	0.389;0.566	P;B	0.46208	0.507;0.378	T	0.83188	-0.0085	10	0.87932	D	0	.	12.8792	0.58008	1.0:0.0:0.0:0.0	.	66;25	Q5JXX5;B9WSA6	GLRA4_HUMAN;.	S	66	ENSP00000361700:F66S	ENSP00000361700:F66S	F	-	2	0	GLRA4	102866487	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	9.339000	0.96797	1.949000	0.56562	0.430000	0.28490	TTT	.	.	.	none		0.498	GLRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057742.2	NM_001024452	
BCORL1	63035	hgsc.bcm.edu	37	X	129189870	129189870	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chrX:129189870T>G	ENST00000218147.7	+	13	5092	c.4895T>G	c.(4894-4896)cTg>cGg	p.L1632R	BCORL1_ENST00000540052.1_Missense_Mutation_p.L1632R|BCORL1_ENST00000359304.2_Missense_Mutation_p.L1502R|BCORL1_ENST00000303743.5_Missense_Mutation_p.L1706R			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1632					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TTGAAGAGGCTGAAGCTTTCC	0.572																																					p.L1632R		Atlas-SNP	.											.	BCORL1	213	.	0			c.T4895G						PASS	.						138.0	132.0	134.0					X																	129189870		2203	4300	6503	SO:0001583	missense	63035	exon12			AGAGGCTGAAGCT	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4895T>G	chrX.hg19:g.129189870T>G	ENSP00000218147:p.Leu1632Arg	70.0	0.0	.		52.0	28.0	.	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	hg19	CCDS14616.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.374672	0.61735	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	T;T;T;T;T	0.55052	0.66;0.54;0.68;0.66;0.59	4.6	4.6	0.57074	.	0.000000	0.28166	N	0.016356	T	0.68686	0.3028	M	0.71036	2.16	0.53688	D	0.999976	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	T	0.71738	-0.4502	10	0.87932	D	0	-9.3763	9.9728	0.41765	0.1531:0.0:0.0:0.8469	.	1706;1632	Q5H9F3-3;Q5H9F3	.;BCORL_HUMAN	R	1632;1706;1502;1632;1306	ENSP00000218147:L1632R;ENSP00000307541:L1706R;ENSP00000352253:L1502R;ENSP00000437775:L1632R;ENSP00000399483:L1306R	ENSP00000218147:L1632R	L	+	2	0	BCORL1	129017551	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.720000	0.68470	1.704000	0.51252	0.417000	0.27973	CTG	.	.	.	none		0.572	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
MT-ND5	4540	hgsc.bcm.edu	37	M	13721	13721	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chrM:13721T>C	ENST00000361567.2	+	1	1385	c.1385T>C	c.(1384-1386)cTa>cCa	p.L462P	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	462					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AGCCGGAAGCCTATTCGCAGG	0.493																																					p.L462P		Atlas-SNP	.											.	.	.	.	0			c.T1385C						PASS	.																																			SO:0001583	missense	0	exon1			GAAGCCTATTCGC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1385T>C	chrM.hg19:g.13721T>C	ENSP00000354813:p.Leu462Pro	13.0	0.0	.		33.0	5.0	.	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.493	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
CPSF6	11052	hgsc.bcm.edu	37	12	69656194	69656194	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr12:69656194delA	ENST00000435070.2	+	9	1621	c.1511delA	c.(1510-1512)gaafs	p.E504fs	CPSF6_ENST00000456847.3_Frame_Shift_Del_p.E431fs|CPSF6_ENST00000551516.1_Intron|CPSF6_ENST00000266679.8_Frame_Shift_Del_p.E541fs	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	504	Arg-rich.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			AGATCACGAGAAAAGAGTCGA	0.428																																					p.E504fs		Atlas-Indel,Pindel	.											.	CPSF6	96	.	0			c.1510delG						PASS	.						139.0	121.0	127.0					12																	69656194		2203	4300	6503	SO:0001589	frameshift_variant	11052	exon9			.	X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1511delA	chr12.hg19:g.69656194delA	ENSP00000391774:p.Glu504fs	145.0	0.0	0		103.0	35.0	0.339806	NM_007007	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Frame_Shift_Del	DEL	ENST00000435070.2	hg19	CCDS8988.1																																																																																			.	.	.	none		0.428	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403609.1	NM_007007	
EIF2AK3	9451	hgsc.bcm.edu	37	2	88926504	88926505	+	Frame_Shift_Ins	INS	-	-	T	rs13034488		TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr2:88926504_88926505insT	ENST00000303236.3	-	1	589_590	c.288_289insA	c.(286-291)acagagfs	p.E97fs	AC062029.1_ENST00000606164.1_RNA|AC062029.1_ENST00000453008.2_RNA|EIF2AK3_ENST00000419748.1_5'Flank	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	97					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						GGTCGCAACTCTGTCTCATCGT	0.723																																					p.E97fs	GBM(138;671 1851 16235 39058 45249)	Atlas-Indel,Pindel	.											.	EIF2AK3	160	.	0			c.289_290insA						PASS	.																																			SO:0001589	frameshift_variant	9451	exon1			.	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.289dupA	chr2.hg19:g.88926505_88926505dupT	ENSP00000307235:p.Glu97fs	476.0	0.0	0		219.0	50.0	0.22831	NM_004836	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Frame_Shift_Ins	INS	ENST00000303236.3	hg19	CCDS33241.1																																																																																			.	.	.	none		0.723	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836	
EME1	146956	hgsc.bcm.edu	37	17	48452912	48452918	+	Frame_Shift_Del	DEL	TCTAGCT	TCTAGCT	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	TCTAGCT	TCTAGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr17:48452912_48452918delTCTAGCT	ENST00000338165.4	+	2	425_431	c.343_349delTCTAGCT	c.(343-351)tctagctccfs	p.SSS115fs	EME1_ENST00000511648.2_Frame_Shift_Del_p.SSS115fs|MRPL27_ENST00000507088.1_5'Flank|MRPL27_ENST00000503633.1_5'Flank|MRPL27_ENST00000225969.4_5'Flank|EME1_ENST00000393271.2_Frame_Shift_Del_p.SSS115fs|MRPL27_ENST00000442592.3_5'Flank	NM_152463.2	NP_689676.2	Q96AY2	EME1_HUMAN	essential meiotic structure-specific endonuclease 1	115					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	19	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			CCCTGAGGACTCTAGCTCCCCAGTTAA	0.43								Direct reversal of damage;Homologous recombination																													p.114_116del		Atlas-Indel,Pindel	.											.	EME1	39	.	0			c.342_348del						PASS	.																																			SO:0001589	frameshift_variant	146956	exon2			.	BC016470	CCDS11565.1, CCDS54141.1	17q21.33	2013-07-03	2013-07-03			ENSG00000154920			24965	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog A (S. cerevisiae)"""	610885	"""essential meiotic endonuclease 1 homolog 1 (S. pombe)"""			12721304	Standard	NM_001166131		Approved	FLJ31364, MMS4L, SLX2A	uc010dbp.2	Q96AY2		ENST00000338165.4:c.343_349delTCTAGCT	chr17.hg19:g.48452912_48452918delTCTAGCT	ENSP00000339897:p.Ser115fs	162.0	0.0	0		112.0	19.0	0.169643	NM_152463	Q96N62	Frame_Shift_Del	DEL	ENST00000338165.4	hg19	CCDS11565.1																																																																																			.	.	.	none		0.430	EME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367118.3	NM_152463	
DOCK2	1794	hgsc.bcm.edu	37	5	169463521	169463521	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr5:169463521delT	ENST00000256935.8	+	36	3707	c.3627delT	c.(3625-3627)aatfs	p.N1209fs	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Frame_Shift_Del_p.N701fs|DOCK2_ENST00000540750.1_Frame_Shift_Del_p.N270fs	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1209	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTACCTAGAATTTCTACAAAG	0.418																																					p.N1209fs		Atlas-INDEL	.											.	DOCK2	389	.	0			c.3626delA						PASS	.						139.0	136.0	137.0					5																	169463521		2203	4300	6503	SO:0001589	frameshift_variant	1794	exon36			.	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3627delT	chr5.hg19:g.169463521delT	ENSP00000256935:p.Asn1209fs	93.0	0.0	0		70.0	31.0	0.442857	NM_004946	Q2M3I0|Q96AK7	Frame_Shift_Del	DEL	ENST00000256935.8	hg19	CCDS4371.1																																																																																			.	.	.	none		0.418	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
C15orf39	56905	hgsc.bcm.edu	37	15	75499492	75499494	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	CAT	CAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr15:75499492_75499494delCAT	ENST00000360639.2	+	2	1423_1425	c.1103_1105delCAT	c.(1102-1107)ccattg>ctg	p.P368del	C15orf39_ENST00000394987.4_In_Frame_Del_p.P368del|C15orf39_ENST00000567617.1_In_Frame_Del_p.P368del			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	368						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						CCACGGTGCCCATTGGACTTTGC	0.621																																					p.368_368del		Atlas-Indel,Pindel	.											C15orf39,colon,carcinoma,0,1	C15orf39	64	.	0			c.1102_1104del						PASS	.																																			SO:0001651	inframe_deletion	56905	exon2			.	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.1103_1105delCAT	chr15.hg19:g.75499492_75499494delCAT	ENSP00000353854:p.Pro368del	149.0	0.0	0		104.0	34.0	0.326923	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	In_Frame_Del	DEL	ENST00000360639.2	hg19	CCDS10276.1																																																																																			.	.	.	none		0.621	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
KLHL15	80311	hgsc.bcm.edu	37	X	24006241	24006241	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chrX:24006241delT	ENST00000328046.8	-	4	1867	c.1612delA	c.(1612-1614)actfs	p.T538fs		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	538					protein ubiquitination (GO:0016567)					autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						TCCAGCACAGTCACACCATGG	0.458																																					p.T538fs		Atlas-Indel,Pindel	.											.	KLHL15	50	.	0			c.1613delC						PASS	.						210.0	179.0	190.0					X																	24006241		2203	4300	6503	SO:0001589	frameshift_variant	80311	exon4			.	AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.1612delA	chrX.hg19:g.24006241delT	ENSP00000332791:p.Thr538fs	117.0	0.0	0		137.0	65.0	0.474453	NM_030624	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	Frame_Shift_Del	DEL	ENST00000328046.8	hg19	CCDS35217.1																																																																																			.	.	.	none		0.458	KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056078.1	XM_040383	
BAP1	8314	hgsc.bcm.edu	37	3	52441229	52441230	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr3:52441229_52441230delAG	ENST00000460680.1	-	7	1011_1012	c.540_541delCT	c.(538-543)ctctttfs	p.F181fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.F181fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TCCAGCTCAAAGAGCCGGCCTG	0.599			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.181_181del	GBM(101;493 1458 7992 21037 25532)	Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.541_542del						PASS	.																																			SO:0001589	frameshift_variant	8314	exon7			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.540_541delCT	chr3.hg19:g.52441231_52441232delAG	ENSP00000417132:p.Phe181fs	172.0	0.0	0		67.0	23.0	0.343284	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.	.	none		0.599	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
SEMA6A	57556	hgsc.bcm.edu	37	5	115803312	115803312	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr5:115803312delC	ENST00000343348.6	-	18	2648	c.1861delG	c.(1861-1863)gcafs	p.A621fs	SEMA6A_ENST00000513137.1_Frame_Shift_Del_p.A48fs|SEMA6A_ENST00000257414.8_Frame_Shift_Del_p.A638fs|CTB-118N6.3_ENST00000508640.1_RNA|CTB-118N6.3_ENST00000508424.1_RNA|SEMA6A_ENST00000510263.1_Frame_Shift_Del_p.A621fs|SEMA6A_ENST00000282394.6_Intron|CTB-118N6.3_ENST00000510682.1_RNA|CTB-118N6.3_ENST00000514214.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	621					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GAAGACACTGCCCCCAAAGGG	0.542																																					p.A621fs		Atlas-INDEL	.											.	SEMA6A	93	.	0			c.1862delC						PASS	.						81.0	79.0	80.0					5																	115803312		1974	4167	6141	SO:0001589	frameshift_variant	57556	exon18			.	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.1861delG	chr5.hg19:g.115803312delC	ENSP00000345512:p.Ala621fs	84.0	0.0	0		90.0	12.0	0.133333	NM_020796	Q9P2H9	Frame_Shift_Del	DEL	ENST00000343348.6	hg19	CCDS47256.1																																																																																			.	.	.	none		0.542	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796	
CMYA5	202333	hgsc.bcm.edu	37	5	79041105	79041106	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr5:79041105_79041106insT	ENST00000446378.2	+	4	10826_10827	c.10795_10796insT	c.(10795-10797)gttfs	p.V3599fs		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3599	B-box coiled-coil; BBC.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GATGAAGAAGGTTTTAGCACAG	0.401																																					p.V3599fs		Atlas-Indel,Pindel	.											.	CMYA5	643	.	0			c.10795_10796insT						PASS	.																																			SO:0001589	frameshift_variant	202333	exon4			.	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.10799dupT	chr5.hg19:g.79041109_79041109dupT	ENSP00000394770:p.Val3599fs	444.0	0.0	0		348.0	28.0	0.0804598	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Frame_Shift_Ins	INS	ENST00000446378.2	hg19	CCDS47238.1																																																																																			.	.	.	none		0.401	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
ATG14	22863	hgsc.bcm.edu	37	14	55836392	55836395	+	Frame_Shift_Del	DEL	GAGA	GAGA	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	GAGA	GAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr14:55836392_55836395delGAGA	ENST00000247178.5	-	10	1456_1459	c.1421_1424delTCTC	c.(1420-1425)atctccfs	p.IS474fs		NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14	474	BATS. {ECO:0000250}.				autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						TGCTGCAGAGGAGATCATCCCACC	0.539																																					p.474_475del		Atlas-Indel,Pindel	.											.	ATG14	36	.	0			c.1422_1425del						PASS	.																																			SO:0001589	frameshift_variant	22863	exon10			.	AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129	ENST00000247178.5:c.1421_1424delTCTC	chr14.hg19:g.55836392_55836395delGAGA	ENSP00000247178:p.Ile474fs	182.0	0.0	0		75.0	29.0	0.386667	NM_014924	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Frame_Shift_Del	DEL	ENST00000247178.5	hg19	CCDS32087.1																																																																																			.	.	.	none		0.539	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416992.1	NM_014924	
VKORC1L1	154807	hgsc.bcm.edu	37	7	65413712	65413713	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr7:65413712_65413713delAA	ENST00000360768.3	+	2	354_355	c.249_250delAA	c.(247-252)ttaaacfs	p.N84fs	VKORC1L1_ENST00000434382.2_Intron	NM_001284342.1|NM_173517.4	NP_001271271.1|NP_775788.2	Q8N0U8	VKORL_HUMAN	vitamin K epoxide reductase complex, subunit 1-like 1	84					cellular response to oxidative stress (GO:0034599)|peptidyl-glutamic acid carboxylation (GO:0017187)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			large_intestine(1)|prostate(1)	2		Lung NSC(55;0.197)			Menadione(DB00170)	ATGGTGTATTAAACCAGCCAAA	0.317																																					p.83_83del		Atlas-INDEL	.											.	VKORC1L1	14	.	0			c.248_249del						PASS	.																																			SO:0001589	frameshift_variant	154807	exon2			.		CCDS5529.1, CCDS64663.1	7q11.21	2013-10-07			ENSG00000196715	ENSG00000196715			21492	protein-coding gene	gene with protein product		608838				23928358	Standard	NM_001284342		Approved		uc003tul.3	Q8N0U8	OTTHUMG00000129449	ENST00000360768.3:c.249_250delAA	chr7.hg19:g.65413712_65413713delAA	ENSP00000353998:p.Asn84fs	894.0	0.0	0		763.0	78.0	0.102228	NM_173517	B4E222|E7ETM5|Q6AHW9|Q6TEK6	Frame_Shift_Del	DEL	ENST00000360768.3	hg19	CCDS5529.1																																																																																			.	.	.	none		0.317	VKORC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251612.3	NM_173517	
DOCK2	1794	hgsc.bcm.edu	37	5	169463522	169463523	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr5:169463522_169463523delTT	ENST00000256935.8	+	36	3708_3709	c.3628_3629delTT	c.(3628-3630)ttcfs	p.F1210fs	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Frame_Shift_Del_p.F702fs|DOCK2_ENST00000540750.1_Frame_Shift_Del_p.F271fs	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1210	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACCTAGAATTTCTACAAAGAT	0.411																																					p.1209_1210del		Pindel	.											.	DOCK2	389	.	0			c.3627_3628del						PASS	.																																			SO:0001589	frameshift_variant	1794	exon36			.	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3628_3629delTT	chr5.hg19:g.169463522_169463523delTT	ENSP00000256935:p.Phe1210fs	96.0	0.0	.		72.0	26.0	0.361	NM_004946	Q2M3I0|Q96AK7	Frame_Shift_Del	DEL	ENST00000256935.8	hg19	CCDS4371.1																																																																																			.	.	.	none		0.411	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
MUC4	4585	hgsc.bcm.edu	37	3	195510678	195510773	+	In_Frame_Del	DEL	GGTGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGCGGAAGTGTCGGTGACAGGAAGAGA	GGTGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGCGGAAGTGTCGGTGACAGGAAGAGA	-	rs71291868|rs74420943|rs551802747|rs2453138|rs62282480|rs74504395|rs201326853|rs546259913|rs556508625|rs79949955|rs200958281|rs548141268|rs575062122|rs529922492|rs560841020|rs556241243|rs75657645|rs200842185|rs142559357|rs199521230|rs76839144|rs572428494|rs568512201|rs200554304|rs2911272|rs2911273|rs562508581|rs80145081|rs80005560|rs76889457	byFrequency	TCGA-2Z-A9JK-01A-11D-A42J-10	TCGA-2Z-A9JK-10A-01D-A42M-10	GGTGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGCGGAAGTGTCGGTGACAGGAAGAGA	GGTGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGCGGAAGTGTCGGTGACAGGAAGAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3603eaf-6e76-43f5-b87f-ab5d8e0f825f	8d7349a0-4f31-4374-9461-c37dd99f05ed	g.chr3:195510678_195510773delGGTGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGCGGAAGTGTCGGTGACAGGAAGAGA	ENST00000463781.3	-	2	8137_8232	c.7678_7773delTCTCTTCCTGTCACCGACACTTCCGCAGCATCCACAGGTCACGCCACCCCTCTTCCTGTCACCAGCACTTCCTCAGCATCCACAGGTGACACCACC	c.(7678-7773)tctcttcctgtcaccgacacttccgcagcatccacaggtcacgccacccctcttcctgtcaccagcacttcctcagcatccacaggtgacaccaccdel	p.SLPVTDTSAASTGHATPLPVTSTSSASTGDTT2560del	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_In_Frame_Del_p.SLPVTDTSAASTGHATPLPVTSTSSASTGDTT2560del	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V2563V(2)|p.T2582P(2)|p.T2587S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGCGGAAGTGTCGGTGACAGGAAGAGAGGTGGCGTGA	0.581																																					p.2560_2592del		Pindel	.											.	MUC4	1505	.	5	Substitution - Missense(3)|Substitution - coding silent(2)	stomach(4)|endometrium(1)	c.7679_7774del						PASS	.																																			SO:0001651	inframe_deletion	4585	exon2			.	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7678_7773delTCTCTTCCTGTCACCGACACTTCCGCAGCATCCACAGGTCACGCCACCCCTCTTCCTGTCACCAGCACTTCCTCAGCATCCACAGGTGACACCACC	chr3.hg19:g.195510678_195510773delGGTGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGCGGAAGTGTCGGTGACAGGAAGAGA	ENSP00000417498:p.Ser2560_Thr2591del	364.0	0.0	.		225.0	12.0	0.053	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Del	DEL	ENST00000463781.3	hg19	CCDS54700.1																																																																																			.	.	.	none		0.581	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
