#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZBTB48	3104	hgsc.bcm.edu	37	1	6640799	6640799	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:6640799C>T	ENST00000377674.4	+	2	288	c.130C>T	c.(130-132)Ctt>Ttt	p.L44F		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	44	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		CTGGAGTGTCCTTGCCTGCTG	0.602																																					p.L44F	Esophageal Squamous(125;1449 1657 4031 29866 49542)	Atlas-SNP	.											.	ZBTB48	33	.	0			c.C130T						PASS	.						110.0	102.0	105.0					1																	6640799		2203	4300	6503	SO:0001583	missense	3104	exon2			AGTGTCCTTGCCT	BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.130C>T	chr1.hg19:g.6640799C>T	ENSP00000366902:p.Leu44Phe	143.0	0.0	.		131.0	59.0	.	NM_005341	Q5SY19	Missense_Mutation	SNP	ENST00000377674.4	hg19	CCDS84.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035982	0.75617	.	.	ENSG00000204859	ENST00000319084;ENST00000435905;ENST00000377674	T;T;T	0.64991	-0.13;-0.13;-0.13	5.72	2.83	0.33086	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.065722	0.64402	D	0.000011	D	0.83613	0.5292	H	0.98466	4.24	0.58432	D	0.999995	D	0.89917	1.0	D	0.71870	0.975	T	0.81543	-0.0885	10	0.87932	D	0	-16.7317	5.8832	0.18866	0.0:0.636:0.1391:0.2249	.	44	P10074	ZBT48_HUMAN	F	44	ENSP00000313416:L44F;ENSP00000416054:L44F;ENSP00000366902:L44F	ENSP00000313416:L44F	L	+	1	0	ZBTB48	6563386	0.985000	0.35326	0.031000	0.17742	0.925000	0.55904	3.095000	0.50235	0.338000	0.23692	-0.176000	0.13171	CTT	.	.	.	none		0.602	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004193.1	NM_005341	
NIPAL3	57185	hgsc.bcm.edu	37	1	24782759	24782759	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:24782759G>A	ENST00000374399.4	+	8	1137	c.769G>A	c.(769-771)Gct>Act	p.A257T	NIPAL3_ENST00000339255.2_Missense_Mutation_p.A257T|NIPAL3_ENST00000003912.3_Missense_Mutation_p.A175T	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	257						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						CGTCTATCAGGCTGCGTGAGT	0.552																																					p.A257T		Atlas-SNP	.											.	NIPAL3	36	.	0			c.G769A						PASS	.						400.0	354.0	370.0					1																	24782759		2203	4300	6503	SO:0001583	missense	57185	exon8			TATCAGGCTGCGT	BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	ENST00000374399.4:c.769G>A	chr1.hg19:g.24782759G>A	ENSP00000363520:p.Ala257Thr	56.0	0.0	.		45.0	18.0	.	NM_020448	A2A298|Q6MZT9|Q9BVE6	Missense_Mutation	SNP	ENST00000374399.4	hg19	CCDS30631.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.7|23.7	4.445577|4.445577	0.84101|0.84101	.|.	.|.	ENSG00000001461|ENSG00000001461	ENST00000374399;ENST00000003912;ENST00000339255|ENST00000432012	D;D;D|.	0.90004|.	-2.6;-2.6;-2.6|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.043600|.	0.85682|.	D|.	0.000000|.	T|T	0.74898|0.74898	0.3777|0.3777	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;1.0;1.0|.	D;D;D|.	0.91635|.	0.974;0.999;0.999|.	T|T	0.72669|0.72669	-0.4223|-0.4223	10|5	0.72032|.	D|.	0.01|.	-25.3634|-25.3634	18.717|18.717	0.91679|0.91679	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	35;257;257|.	Q7Z354;Q6P499;A6NN97|.	.;NPAL3_HUMAN;.|.	T|D	257;175;257|35	ENSP00000363520:A257T;ENSP00000003912:A175T;ENSP00000343549:A257T|.	ENSP00000003912:A175T|.	A|G	+|+	1|2	0|0	NIPAL3|NIPAL3	24655346|24655346	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.538000|0.538000	0.34931|0.34931	7.419000|7.419000	0.80179|0.80179	2.745000|2.745000	0.94114|0.94114	0.561000|0.561000	0.74099|0.74099	GCT|GGC	.	.	.	none		0.552	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276996.1	NM_020448	
MAN1C1	57134	hgsc.bcm.edu	37	1	26107539	26107539	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:26107539A>G	ENST00000374332.4	+	10	1916	c.1586A>G	c.(1585-1587)tAc>tGc	p.Y529C	MAN1C1_ENST00000263979.3_Missense_Mutation_p.Y349C|MAN1C1_ENST00000374329.1_Missense_Mutation_p.Y300C	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	529					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		GTGGAGAGCTACATGTACCTG	0.632																																					p.Y529C		Atlas-SNP	.											.	MAN1C1	48	.	0			c.A1586G						PASS	.						85.0	86.0	86.0					1																	26107539		2203	4300	6503	SO:0001583	missense	57134	exon10			AGAGCTACATGTA	AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.1586A>G	chr1.hg19:g.26107539A>G	ENSP00000363452:p.Tyr529Cys	130.0	0.0	.		117.0	44.0	.	NM_020379	A6NNE2|B2RNP2|Q9Y545	Missense_Mutation	SNP	ENST00000374332.4	hg19	CCDS265.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.609272	0.87258	.	.	ENSG00000117643	ENST00000374332;ENST00000374331;ENST00000263979;ENST00000374329	T;T;T	0.72051	-0.62;-0.62;-0.62	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.86723	0.6001	M	0.89840	3.065	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.89675	0.3886	10	0.87932	D	0	.	15.1618	0.72791	1.0:0.0:0.0:0.0	.	529	Q9NR34	MA1C1_HUMAN	C	529;349;349;300	ENSP00000363452:Y529C;ENSP00000263979:Y349C;ENSP00000363449:Y300C	ENSP00000263979:Y349C	Y	+	2	0	MAN1C1	25980126	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.257000	0.78362	1.990000	0.58119	0.459000	0.35465	TAC	.	.	.	none		0.632	MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012828.3	NM_020379	
MED18	54797	hgsc.bcm.edu	37	1	28661029	28661029	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:28661029C>A	ENST00000373842.4	+	3	384	c.175C>A	c.(175-177)Ctc>Atc	p.L59I	MED18_ENST00000398997.2_Missense_Mutation_p.L59I|MED18_ENST00000479574.1_3'UTR	NM_001127350.1|NM_017638.2	NP_001120822.1|NP_060108.2	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	59						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		GATGGTATTCCTCCTTAAGGG	0.542																																					p.L59I		Atlas-SNP	.											.	MED18	30	.	0			c.C175A						PASS	.						201.0	198.0	199.0					1																	28661029		2203	4300	6503	SO:0001583	missense	54797	exon3			GTATTCCTCCTTA	BC002694	CCDS322.1	1p35.3	2007-07-30	2007-07-30		ENSG00000130772	ENSG00000130772			25944	protein-coding gene	gene with protein product		612384	"""mediator of RNA polymerase II transcription, subunit 18 homolog (S. cerevisiae)"""			15175163	Standard	NM_001127350		Approved	FLJ20045, p28b	uc009vtg.3	Q9BUE0	OTTHUMG00000003537	ENST00000373842.4:c.175C>A	chr1.hg19:g.28661029C>A	ENSP00000362948:p.Leu59Ile	64.0	0.0	.		70.0	22.0	.	NM_017638	D3DPM1|Q9NXU9	Missense_Mutation	SNP	ENST00000373842.4	hg19	CCDS322.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.511243	0.44660	.	.	ENSG00000130772	ENST00000373842;ENST00000398997	.	.	.	5.75	4.82	0.62117	Mediator complex, subunit Med18, metazoa/fungi (1);	0.122337	0.56097	N	0.000029	T	0.28433	0.0703	N	0.16478	0.41	0.25320	N	0.989127	B	0.11235	0.004	B	0.10450	0.005	T	0.13683	-1.0500	9	0.31617	T	0.26	-17.3861	13.8543	0.63517	0.1541:0.8459:0.0:0.0	.	59	Q9BUE0	MED18_HUMAN	I	59	.	ENSP00000362948:L59I	L	+	1	0	MED18	28533616	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	5.634000	0.67833	1.418000	0.47098	0.655000	0.94253	CTC	.	.	.	none		0.542	MED18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009856.1	NM_017638	
MAGI3	260425	hgsc.bcm.edu	37	1	113933805	113933805	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:113933805G>C	ENST00000307546.9	+	1	225	c.150G>C	c.(148-150)gaG>gaC	p.E50D	MAGI3_ENST00000369617.4_Missense_Mutation_p.E50D|MAGI3_ENST00000369615.1_Missense_Mutation_p.E50D|MAGI3_ENST00000369611.4_Missense_Mutation_p.E50D|MAGI3_ENST00000486456.1_3'UTR	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	50	Interaction with ADRB1 and TGFA. {ECO:0000250}.|PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGCTCCGCGAGGAGCCCGGCG	0.751																																					p.E50D		Atlas-SNP	.											.	MAGI3	181	.	0			c.G150C						PASS	.						6.0	8.0	7.0					1																	113933805		2042	4028	6070	SO:0001583	missense	260425	exon1			CCGCGAGGAGCCC	AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.150G>C	chr1.hg19:g.113933805G>C	ENSP00000304604:p.Glu50Asp	105.0	0.0	.		89.0	33.0	.	NM_152900	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	ENST00000307546.9	hg19	CCDS44196.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.383157	0.42207	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.15603	2.54;2.41;2.55;2.55	3.94	0.539	0.17156	.	0.435271	0.20391	N	0.093244	T	0.04724	0.0128	L	0.42245	1.32	0.23784	N	0.996855	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.43442	-0.9391	10	0.17369	T	0.5	-0.2476	13.3417	0.60549	0.0:0.4771:0.5229:0.0	.	50;50;50	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	D	50	ENSP00000358630:E50D;ENSP00000304604:E50D;ENSP00000358628:E50D;ENSP00000358624:E50D	ENSP00000304604:E50D	E	+	3	2	MAGI3	113735328	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	1.935000	0.40173	0.126000	0.18424	0.456000	0.33151	GAG	.	.	.	none		0.751	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900	
VANGL1	81839	hgsc.bcm.edu	37	1	116228127	116228127	+	Silent	SNP	C	C	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:116228127C>T	ENST00000355485.2	+	7	1564	c.1293C>T	c.(1291-1293)atC>atT	p.I431I	VANGL1_ENST00000369509.1_Silent_p.I431I|VANGL1_ENST00000310260.3_Silent_p.I431I|VANGL1_ENST00000369510.4_Silent_p.I429I	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	431					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CCTTCTGCATCACCAACGGCA	0.607																																					p.I431I		Atlas-SNP	.											.	VANGL1	65	.	0			c.C1293T						PASS	.						54.0	45.0	48.0					1																	116228127		2203	4300	6503	SO:0001819	synonymous_variant	81839	exon7			CTGCATCACCAAC	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.1293C>T	chr1.hg19:g.116228127C>T		126.0	0.0	.		103.0	32.0	.	NM_138959	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Silent	SNP	ENST00000355485.2	hg19	CCDS883.1																																																																																			.	.	.	none		0.607	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033096.1		
LOR	4014	hgsc.bcm.edu	37	1	153233991	153233991	+	Missense_Mutation	SNP	A	A	G	rs11272549|rs561634896	byFrequency	TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:153233991A>G	ENST00000368742.3	+	2	623	c.566A>G	c.(565-567)tAc>tGc	p.Y189C		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	189			Y -> YSGGG (in dbSNP:rs11275959). {ECO:0000269|PubMed:1355480, ECO:0000269|PubMed:2007607}.		keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtctgcggctactctggcggc	0.741																																					p.Y189C		Atlas-SNP	.											.	LOR	19	.	0			c.A566G						PASS	.						1.0	1.0	1.0					1																	153233991		409	1072	1481	SO:0001583	missense	4014	exon2			GCGGCTACTCTGG	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.566A>G	chr1.hg19:g.153233991A>G	ENSP00000357731:p.Tyr189Cys	7.0	0.0	.		9.0	4.0	.	NM_000427	Q5T869|Q5XKF8	Missense_Mutation	SNP	ENST00000368742.3	hg19	CCDS30870.1	.	.	.	.	.	.	.	.	.	.	A	4.164	0.028992	0.08054	.	.	ENSG00000203782	ENST00000368742;ENST00000392652	T	0.38401	1.14	3.99	-7.07	0.01563	.	.	.	.	.	T	0.06462	0.0166	N	0.08118	0	0.09310	N	1	P	0.49447	0.924	B	0.43301	0.415	T	0.21895	-1.0232	9	0.87932	D	0	.	6.6851	0.23140	0.1469:0.4008:0.4523:0.0	.	189	P23490	LORI_HUMAN	C	189	ENSP00000357731:Y189C	ENSP00000357731:Y189C	Y	+	2	0	LOR	151500615	0.010000	0.17322	0.007000	0.13788	0.401000	0.30781	-0.173000	0.09854	-1.412000	0.02030	-0.817000	0.03123	TAC	.	.	.	none		0.741	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
MEF2D	4209	hgsc.bcm.edu	37	1	156444934	156444934	+	Silent	SNP	G	G	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:156444934G>A	ENST00000348159.4	-	9	1452	c.972C>T	c.(970-972)ctC>ctT	p.L324L	MEF2D_ENST00000360595.3_Silent_p.L317L|MEF2D_ENST00000464356.2_Silent_p.L316L|MEF2D_ENST00000340875.5_Silent_p.L323L|MEF2D_ENST00000353795.3_Silent_p.L278L|MEF2D_ENST00000368240.2_Silent_p.L317L	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	324					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AAGAGAAGGGGAGGCCCTGGC	0.562																																					p.L324L		Atlas-SNP	.											.	MEF2D	43	.	0			c.C972T						PASS	.						125.0	113.0	117.0					1																	156444934		2203	4300	6503	SO:0001819	synonymous_variant	4209	exon9			GAAGGGGAGGCCC	BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.972C>T	chr1.hg19:g.156444934G>A		91.0	0.0	.		73.0	30.0	.	NM_005920	D3DVC0|Q14815|Q5T9U5|Q5T9U6	Silent	SNP	ENST00000348159.4	hg19	CCDS1143.1																																																																																			.	.	.	none		0.562	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080562.2	NM_005920	
IGSF8	93185	hgsc.bcm.edu	37	1	160063548	160063548	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:160063548T>G	ENST00000368086.1	-	3	1072	c.856A>C	c.(856-858)Att>Ctt	p.I286L	IGSF8_ENST00000314485.7_Missense_Mutation_p.I286L|IGSF8_ENST00000460351.1_5'Flank			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	286	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TTCTCTGCAATCTGGGCCCAG	0.607																																					p.I286L		Atlas-SNP	.											.	IGSF8	59	.	0			c.A856C						PASS	.						40.0	35.0	36.0					1																	160063548		2203	4300	6503	SO:0001583	missense	93185	exon3			CTGCAATCTGGGC	AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.856A>C	chr1.hg19:g.160063548T>G	ENSP00000357065:p.Ile286Leu	50.0	0.0	.		46.0	16.0	.	NM_052868	Q8NG09|Q96DP4|Q9BTG9	Missense_Mutation	SNP	ENST00000368086.1	hg19	CCDS1195.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.603020	0.46423	.	.	ENSG00000162729	ENST00000314485;ENST00000368086;ENST00000358475;ENST00000448417	T;T;T	0.09817	3.4;3.4;2.94	3.64	2.5	0.30297	Immunoglobulin subtype (1);	0.369184	0.25747	N	0.028562	T	0.02119	0.0066	L	0.29908	0.895	0.34147	D	0.667062	B	0.28055	0.199	B	0.20577	0.03	T	0.46331	-0.9199	10	0.21540	T	0.41	-5.507	7.4263	0.27100	0.0:0.1134:0.0:0.8866	.	286	Q969P0	IGSF8_HUMAN	L	286	ENSP00000316664:I286L;ENSP00000357065:I286L;ENSP00000397464:I286L	ENSP00000316664:I286L	I	-	1	0	IGSF8	158330172	1.000000	0.71417	0.843000	0.33291	0.928000	0.56348	4.346000	0.59367	0.595000	0.29777	0.402000	0.26972	ATT	.	.	.	none		0.607	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	NM_052868	
UAP1	6675	hgsc.bcm.edu	37	1	162551113	162551113	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:162551113A>G	ENST00000367925.1	+	4	730	c.698A>G	c.(697-699)cAg>cGg	p.Q233R	UAP1_ENST00000367926.4_Missense_Mutation_p.Q233R|UAP1_ENST00000367924.1_Missense_Mutation_p.Q233R|UAP1_ENST00000271469.3_Missense_Mutation_p.Q233R			Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1	233					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|UDP-N-acetylglucosamine diphosphorylase activity (GO:0003977)			breast(2)|cervix(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)|skin(2)|stomach(1)	22	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			CTTGCAGCCCAGAATATTGTG	0.408																																					p.Q233R		Atlas-SNP	.											.	UAP1	47	.	0			c.A698G						PASS	.						221.0	224.0	223.0					1																	162551113		2203	4300	6503	SO:0001583	missense	6675	exon5			CAGCCCAGAATAT	AB011004	CCDS1240.1	1q23.2	2014-07-31	2014-07-31		ENSG00000117143	ENSG00000117143	2.7.7.23		12457	protein-coding gene	gene with protein product		602862		SPAG2		9603950, 8025165	Standard	NM_003115		Approved	AGX1, AgX	uc001gce.4	Q16222	OTTHUMG00000034419	ENST00000367925.1:c.698A>G	chr1.hg19:g.162551113A>G	ENSP00000356902:p.Gln233Arg	127.0	0.0	.		99.0	37.0	.	NM_003115	B2R6R8|Q5VTA9|Q5VTB0|Q5VTB1|Q96GM2	Missense_Mutation	SNP	ENST00000367925.1	hg19		.	.	.	.	.	.	.	.	.	.	A	11.45	1.642238	0.29157	.	.	ENSG00000117143	ENST00000367926;ENST00000271469;ENST00000367925;ENST00000367924	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	5.14	4.01	0.46588	.	0.337918	0.35838	N	0.002956	T	0.03220	0.0094	N	0.16266	0.395	0.37520	D	0.917514	B	0.02656	0.0	B	0.04013	0.001	T	0.39663	-0.9603	9	0.18710	T	0.47	-3.3684	10.0169	0.42020	0.9193:0.0:0.0807:0.0	.	233	Q16222-2	.	R	233	ENSP00000356903:Q233R;ENSP00000271469:Q233R;ENSP00000356902:Q233R;ENSP00000356901:Q233R	ENSP00000271469:Q233R	Q	+	2	0	UAP1	160817737	0.998000	0.40836	0.995000	0.50966	0.996000	0.88848	5.904000	0.69886	0.902000	0.36520	0.482000	0.46254	CAG	.	.	.	none		0.408	UAP1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000083203.1	NM_003115	
RGL1	23179	hgsc.bcm.edu	37	1	183775571	183775571	+	Silent	SNP	A	A	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr1:183775571A>G	ENST00000360851.3	+	2	268	c.90A>G	c.(88-90)aaA>aaG	p.K30K	RGL1_ENST00000536277.1_Intron|RGL1_ENST00000304685.4_Silent_p.K65K|RGL1_ENST00000539189.1_Silent_p.K30K			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	30					cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						TCACCCTCAAAAGAGTCCAGA	0.478																																					p.K65K		Atlas-SNP	.											.	RGL1	91	.	0			c.A195G						PASS	.						108.0	101.0	103.0					1																	183775571		2203	4300	6503	SO:0001819	synonymous_variant	23179	exon3			CCTCAAAAGAGTC	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.90A>G	chr1.hg19:g.183775571A>G		76.0	0.0	.		54.0	20.0	.	NM_015149	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Silent	SNP	ENST00000360851.3	hg19																																																																																				.	.	.	none		0.478	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	
TPO	7173	hgsc.bcm.edu	37	2	1507790	1507790	+	Silent	SNP	C	C	T	rs529772798		TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr2:1507790C>T	ENST00000345913.4	+	14	2548	c.2457C>T	c.(2455-2457)ggC>ggT	p.G819G	TPO_ENST00000497517.2_3'UTR|TPO_ENST00000349624.3_Silent_p.G646G|TPO_ENST00000382201.3_Silent_p.G762G|TPO_ENST00000329066.4_Silent_p.G819G|TPO_ENST00000382198.1_Silent_p.G646G|TPO_ENST00000337415.3_Silent_p.G819G|TPO_ENST00000346956.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	819	EGF-like; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	ACACCAAAGGCGGCTTCCAGT	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		15689	0.0		0.0	False		,,,				2504	0.001				p.G819G		Atlas-SNP	.											.	TPO	224	.	0			c.C2457T						PASS	.						80.0	77.0	78.0					2																	1507790		2203	4300	6503	SO:0001819	synonymous_variant	7173	exon14			CAAAGGCGGCTTC		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2457C>T	chr2.hg19:g.1507790C>T		56.0	0.0	.		46.0	9.0	.	NM_001206744	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Silent	SNP	ENST00000345913.4	hg19	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	C	1.431	-0.570373	0.03910	.	.	ENSG00000115705	ENST00000446278	.	.	.	4.4	0.28	0.15682	.	.	.	.	.	T	0.51075	0.1653	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34104	-0.9842	4	.	.	.	-25.6411	5.437	0.16486	0.4042:0.4402:0.0:0.1556	.	.	.	.	V	294	.	.	A	+	2	0	TPO	1486797	0.097000	0.21791	0.962000	0.40283	0.072000	0.16883	-0.085000	0.11250	-0.290000	0.09025	-0.898000	0.02899	GCG	.	.	.	none		0.612	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
ODC1	4953	hgsc.bcm.edu	37	2	10584694	10584694	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr2:10584694C>G	ENST00000234111.4	-	4	692	c.182G>C	c.(181-183)cGt>cCt	p.R61P	ODC1_ENST00000446285.1_Intron|ODC1_ENST00000405333.1_Missense_Mutation_p.R61P|SNORA80B_ENST00000383906.1_RNA	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	61					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)			NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	GGGGGTGACACGAGGGAGAGC	0.473																																					p.R61P		Atlas-SNP	.											.	ODC1	40	.	0			c.G182C						PASS	.						100.0	96.0	98.0					2																	10584694		2203	4300	6503	SO:0001583	missense	4953	exon4			GTGACACGAGGGA		CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.182G>C	chr2.hg19:g.10584694C>G	ENSP00000234111:p.Arg61Pro	78.0	0.0	.		78.0	26.0	.	NM_002539	Q53TU3|Q6LDS9	Missense_Mutation	SNP	ENST00000234111.4	hg19	CCDS1672.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.427288	0.83667	.	.	ENSG00000115758	ENST00000234111;ENST00000405333;ENST00000443218	T;T	0.51817	0.69;0.69	5.37	4.46	0.54185	Orn/DAP/Arg decarboxylase 2, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70378	0.3217	M	0.91920	3.255	0.80722	D	1	P	0.52170	0.951	P	0.56648	0.803	T	0.77988	-0.2380	10	0.56958	D	0.05	.	16.1391	0.81512	0.0:0.8669:0.1331:0.0	.	61	P11926	DCOR_HUMAN	P	61	ENSP00000234111:R61P;ENSP00000385333:R61P	ENSP00000234111:R61P	R	-	2	0	ODC1	10502145	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	4.865000	0.62998	2.508000	0.84585	0.655000	0.94253	CGT	.	.	.	none		0.473	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206896.2		
APOB	338	hgsc.bcm.edu	37	2	21266783	21266783	+	Missense_Mutation	SNP	A	A	G	rs17240441	byFrequency	TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr2:21266783A>G	ENST00000233242.1	-	1	162	c.35T>C	c.(34-36)cTg>cCg	p.L12P	APOB_ENST00000399256.4_Missense_Mutation_p.L12P	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	12			Missing. {ECO:0000269|PubMed:22095935}.	Missing (in Ref. 5; AAB60718/CAA28420). {ECO:0000305}.	artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					aggcagcgccagcagcgccag	0.806																																					p.L12P		Atlas-SNP	.											.	APOB	761	.	0			c.T35C						PASS	.						1.0	1.0	1.0					2																	21266783		310	673	983	SO:0001583	missense	338	exon1			AGCGCCAGCAGCG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.35T>C	chr2.hg19:g.21266783A>G	ENSP00000233242:p.Leu12Pro	30.0	0.0	.		19.0	4.0	.	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	A	9.939	1.216839	0.22373	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.10763	5.13;2.84	2.53	-2.89	0.05665	.	2.226600	0.02990	N	0.146703	T	0.08714	0.0216	L	0.27053	0.805	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.41324	-0.9515	10	0.66056	D	0.02	.	7.1381	0.25539	0.5833:0.0:0.4167:0.0	.	12	P04114	APOB_HUMAN	P	12	ENSP00000233242:L12P;ENSP00000382200:L12P	ENSP00000233242:L12P	L	-	2	0	APOB	21120288	0.325000	0.24660	0.003000	0.11579	0.001000	0.01503	-0.176000	0.09811	-0.683000	0.05190	-1.342000	0.01247	CTG	.	.	.	none		0.806	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
USP34	9736	hgsc.bcm.edu	37	2	61415653	61415653	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr2:61415653T>A	ENST00000398571.2	-	80	10301	c.10225A>T	c.(10225-10227)Aat>Tat	p.N3409Y	AHSA2_ENST00000394457.3_3'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3409					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			ACAGAACTATTTTCAGGGGAA	0.443																																					p.N3409Y		Atlas-SNP	.											.	USP34	334	.	0			c.A10225T						PASS	.						103.0	96.0	98.0					2																	61415653		1910	4131	6041	SO:0001583	missense	9736	exon80			AACTATTTTCAGG	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.10225A>T	chr2.hg19:g.61415653T>A	ENSP00000381577:p.Asn3409Tyr	131.0	0.0	.		121.0	39.0	.	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	hg19	CCDS42686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	15.19|15.19	2.760105|2.760105	0.49468|0.49468	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000411912|ENST00000263989;ENST00000398569;ENST00000398571;ENST00000436269	.|T	.|0.03860	.|3.78	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.196719	.|0.53938	.|D	.|0.000049	T|T	0.05686|0.05686	0.0149|0.0149	N|N	0.24115|0.24115	0.695|0.695	0.40804|0.40804	D|D	0.98336|0.98336	.|P	.|0.42785	.|0.79	.|B	.|0.41723	.|0.365	T|T	0.42275|0.42275	-0.9461|-0.9461	5|10	.|0.59425	.|D	.|0.04	.|.	15.9357|15.9357	0.79704|0.79704	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|3409	.|Q70CQ2	.|UBP34_HUMAN	I|Y	1085|3257;3174;3409;287	.|ENSP00000381577:N3409Y	.|ENSP00000263989:N3257Y	K|N	-|-	2|1	0|0	USP34|USP34	61269157|61269157	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.873000|0.873000	0.50193|0.50193	5.146000|5.146000	0.64845|0.64845	2.218000|2.218000	0.71995|0.71995	0.482000|0.482000	0.46254|0.46254	AAA|AAT	.	.	.	none		0.443	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
TMEM237	65062	hgsc.bcm.edu	37	2	202507331	202507331	+	Intron	SNP	C	C	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr2:202507331C>G	ENST00000409883.2	-	1	159				TMEM237_ENST00000409444.2_Splice_Site	NM_001044385.2	NP_001037850.1	Q96Q45	TM237_HUMAN	transmembrane protein 237						cilium assembly (GO:0042384)|regulation of Wnt signaling pathway (GO:0030111)	ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(2)|kidney(1)|large_intestine(1)|lung(3)	7						GGCTCGCTTACCACAGGATTC	0.602																																					.		Atlas-SNP	.											.	TMEM237	21	.	0			c.18+1G>C						PASS	.						54.0	53.0	54.0					2																	202507331		1839	4091	5930	SO:0001627	intron_variant	65062	exon2			CGCTTACCACAGG	AB053301	CCDS46489.1, CCDS46490.1	2q33	2012-05-08	2011-05-20	2011-05-20	ENSG00000155755	ENSG00000155755			14432	protein-coding gene	gene with protein product		614423	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4"""	ALS2CR4		11586298, 20375344	Standard	NM_001044385		Approved	JBTS14	uc021vvg.2	Q96Q45	OTTHUMG00000154526	ENST00000409883.2:c.42+750G>C	chr2.hg19:g.202507331C>G		155.0	0.0	.		133.0	43.0	.	NM_152388	B4E1R8|B4E2R8|E9PAR8|E9PBF8|E9PG24|E9PGX0|Q53TS9|Q53TT2|Q7Z3B6|Q8IZ18|Q8NBF8|Q96CY1	Splice_Site	SNP	ENST00000409883.2	hg19	CCDS46489.1	.	.	.	.	.	.	.	.	.	.	C	9.997	1.232443	0.22626	.	.	ENSG00000155755	ENST00000409444;ENST00000426684	.	.	.	4.24	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3694	0.55246	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM237	202215576	1.000000	0.71417	1.000000	0.80357	0.077000	0.17291	3.211000	0.51137	2.378000	0.81104	0.650000	0.86243	.	.	.	.	none		0.602	TMEM237-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335753.1	NM_152388	
TIGD1	200765	hgsc.bcm.edu	37	2	233414485	233414485	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr2:233414485T>C	ENST00000408957.3	-	1	741	c.108A>G	c.(106-108)atA>atG	p.I36M	EIF4E2_ENST00000258416.3_5'Flank|EIF4E2_ENST00000409394.1_5'Flank|EIF4E2_ENST00000409514.1_5'Flank|EIF4E2_ENST00000409167.3_5'Flank|MIR5001_ENST00000580185.1_RNA|EIF4E2_ENST00000409098.1_5'Flank|EIF4E2_ENST00000409322.1_5'Flank|EIF4E2_ENST00000409495.1_5'Flank	NM_145702.1	NP_663748.1	Q96MW7	TIGD1_HUMAN	tigger transposable element derived 1	36	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|skin(1)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;2e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|LUSC - Lung squamous cell carcinoma(224;0.00746)|Lung(119;0.00842)|GBM - Glioblastoma multiforme(43;0.233)		gccttcggcctatctcggctt	0.418																																					p.I36M		Atlas-SNP	.											.	TIGD1	17	.	0			c.A108G						PASS	.						79.0	87.0	84.0					2																	233414485		1327	2309	3636	SO:0001583	missense	200765	exon1			TCGGCCTATCTCG		CCDS2495.1	2q37.1	2011-01-17			ENSG00000221944	ENSG00000221944			14523	protein-coding gene	gene with protein product		612972					Standard	NM_145702		Approved	EEYORE	uc002vsy.2	Q96MW7	OTTHUMG00000133260	ENST00000408957.3:c.108A>G	chr2.hg19:g.233414485T>C	ENSP00000386186:p.Ile36Met	98.0	0.0	.		83.0	5.0	.	NM_145702	Q6P4D2|Q6PIF9	Missense_Mutation	SNP	ENST00000408957.3	hg19	CCDS2495.1	.	.	.	.	.	.	.	.	.	.	T	17.96	3.516244	0.64634	.	.	ENSG00000221944	ENST00000408957	T	0.56275	0.47	0.685	0.685	0.18009	Homeodomain-related (1);Homeodomain-like (1);Helix-turn-helix, Psq-like (1);Centromere protein Cenp-B, DNA-binding domain 1 (1);	.	.	.	.	T	0.49609	0.1567	L	0.38175	1.15	0.25379	N	0.988638	P	0.43826	0.818	P	0.50378	0.639	T	0.41963	-0.9479	8	0.72032	D	0.01	.	.	.	.	.	36	Q96MW7	TIGD1_HUMAN	M	36	ENSP00000386186:I36M	ENSP00000386186:I36M	I	-	3	3	TIGD1	233122729	0.816000	0.29132	0.982000	0.44146	0.981000	0.71138	0.449000	0.21744	0.539000	0.28788	0.528000	0.53228	ATA	.	.	.	none		0.418	TIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257037.1	NM_145702	
UGT1A5	54579	hgsc.bcm.edu	37	2	234621902	234621902	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr2:234621902T>A	ENST00000373414.3	+	1	265	c.265T>A	c.(265-267)Ttt>Att	p.F89I	UGT1A6_ENST00000406651.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000608381.1_Missense_Mutation_p.F89I|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	89						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		CCAGGACGAATTTGATCGCCT	0.418																																					p.F89I		Atlas-SNP	.											.	UGT1A5	66	.	0			c.T265A						PASS	.						113.0	107.0	109.0					2																	234621902		2203	4300	6503	SO:0001583	missense	54579	exon1			GACGAATTTGATC	M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.265T>A	chr2.hg19:g.234621902T>A	ENSP00000362513:p.Phe89Ile	106.0	0.0	.		75.0	35.0	.	NM_019078	B8K294	Missense_Mutation	SNP	ENST00000373414.3	hg19	CCDS33404.1	.	.	.	.	.	.	.	.	.	.	T	11.60	1.687353	0.29962	.	.	ENSG00000240224	ENST00000373414	T	0.64085	-0.08	4.72	3.54	0.40534	.	0.648102	0.15890	N	0.239620	T	0.53045	0.1772	L	0.41710	1.295	0.09310	N	1	B;B	0.32467	0.372;0.372	B;B	0.35727	0.209;0.209	T	0.42327	-0.9458	10	0.37606	T	0.19	.	9.8612	0.41116	0.3562:0.0:0.0:0.6438	.	89;89	Q5DSZ9;P35504	.;UD15_HUMAN	I	89	ENSP00000362513:F89I	ENSP00000362513:F89I	F	+	1	0	UGT1A5	234286641	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-4.003000	0.00316	0.661000	0.30985	-0.522000	0.04353	TTT	.	.	.	none		0.418	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130985.1	NM_019078	
TRAK1	22906	hgsc.bcm.edu	37	3	42240711	42240711	+	Silent	SNP	C	C	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr3:42240711C>T	ENST00000327628.5	+	11	1556	c.1156C>T	c.(1156-1158)Ctg>Ttg	p.L386L	TRAK1_ENST00000341421.3_Silent_p.L328L|TRAK1_ENST00000449246.1_Silent_p.L312L|TRAK1_ENST00000396175.1_Silent_p.L328L|TRAK1_ENST00000487159.1_3'UTR	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	386	Interaction with HGS.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						GCGCAAGGAGCTGCAGTTGGA	0.493																																					p.L386L	GBM(44;195 884 22595 31865 41850)	Atlas-SNP	.											.	TRAK1	188	.	0			c.C1156T						PASS	.						119.0	103.0	109.0					3																	42240711		2203	4300	6503	SO:0001819	synonymous_variant	22906	exon11			AAGGAGCTGCAGT		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1156C>T	chr3.hg19:g.42240711C>T		124.0	0.0	.		85.0	36.0	.	NM_001265608	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Silent	SNP	ENST00000327628.5	hg19	CCDS43072.1																																																																																			.	.	.	none		0.493	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
SETD2	29072	hgsc.bcm.edu	37	3	47163553	47163553	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr3:47163553C>G	ENST00000409792.3	-	3	2615	c.2573G>C	c.(2572-2574)aGc>aCc	p.S858T		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	858					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGAACTAGTGCTACCGATGCT	0.353			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.S858T		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.G2573C						PASS	.						61.0	64.0	63.0					3																	47163553		2203	4299	6502	SO:0001583	missense	29072	exon3			CTAGTGCTACCGA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.2573G>C	chr3.hg19:g.47163553C>G	ENSP00000386759:p.Ser858Thr	63.0	0.0	.		55.0	20.0	.	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	11.25	1.583267	0.28268	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.88664	-2.41;1.46	5.18	5.18	0.71444	.	0.316635	0.28230	N	0.016105	T	0.79690	0.4489	N	0.14661	0.345	0.29982	N	0.81761	B;B	0.31100	0.308;0.149	B;B	0.26969	0.075;0.047	T	0.77988	-0.2380	10	0.51188	T	0.08	.	14.0566	0.64774	0.0:1.0:0.0:0.0	.	858;858	F2Z317;Q9BYW2	.;SETD2_HUMAN	T	858;858;858;814	ENSP00000386759:S858T;ENSP00000416401:S814T	ENSP00000386759:S858T	S	-	2	0	SETD2	47138557	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	0.895000	0.28363	2.679000	0.91253	0.655000	0.94253	AGC	.	.	.	none		0.353	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
CFAP44	55779	hgsc.bcm.edu	37	3	113115478	113115478	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr3:113115478C>T	ENST00000295868.2	-	14	1828	c.1666G>A	c.(1666-1668)Gga>Aga	p.G556R	WDR52_ENST00000475568.1_5'UTR|WDR52_ENST00000393845.2_Missense_Mutation_p.G556R	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TTCTTCCGTCCCGCAAAAATC	0.393																																					p.G556R		Atlas-SNP	.											.	WDR52	151	.	0			c.G1666A						PASS	.						99.0	101.0	100.0					3																	113115478		2203	4300	6503	SO:0001583	missense	55779	exon14			TCCGTCCCGCAAA																												ENST00000295868.2:c.1666G>A	chr3.hg19:g.113115478C>T	ENSP00000295868:p.Gly556Arg	125.0	0.0	.		79.0	35.0	.	NM_001164496		Missense_Mutation	SNP	ENST00000295868.2	hg19	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.796236	0.50208	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.65549	-0.16;0.57	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.	.	.	.	T	0.53270	0.1786	L	0.44542	1.39	0.80722	D	1	P	0.47350	0.894	B	0.39935	0.314	T	0.54912	-0.8222	9	0.38643	T	0.18	.	13.4572	0.61206	0.0:0.9237:0.0:0.0763	.	556	Q96MT7	WDR52_HUMAN	R	556	ENSP00000377428:G556R;ENSP00000295868:G556R	ENSP00000295868:G556R	G	-	1	0	WDR52	114598168	1.000000	0.71417	0.981000	0.43875	0.044000	0.14063	4.867000	0.63013	2.690000	0.91761	0.655000	0.94253	GGA	.	.	.	none		0.393	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		
ADPRH	141	hgsc.bcm.edu	37	3	119305359	119305359	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr3:119305359G>A	ENST00000478399.1	+	3	1931	c.526G>A	c.(526-528)Gct>Act	p.A176T	ADPRH_ENST00000357003.3_Missense_Mutation_p.A176T|ADPRH_ENST00000471850.1_3'UTR|ADPRH_ENST00000478927.1_Missense_Mutation_p.A176T|ADPRH_ENST00000465513.1_Missense_Mutation_p.A176T			P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase	176					cellular protein modification process (GO:0006464)|protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			breast(1)|kidney(1)|lung(10)|ovary(1)	13		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		CCTTGCGTCTGCTCTTTTTAC	0.532																																					p.A176T	GBM(133;579 1804 5989 9967 40052)	Atlas-SNP	.											ADPRH,NS,carcinoma,0,1	ADPRH	33	.	0			c.G526A						PASS	.						117.0	121.0	120.0					3																	119305359		2203	4300	6503	SO:0001583	missense	141	exon4			GCGTCTGCTCTTT	L13291	CCDS2990.1	3q13.31-q13.33	2004-02-27			ENSG00000144843	ENSG00000144843			269	protein-coding gene	gene with protein product		603081				8349667, 12070318	Standard	NM_001125		Approved	ARH1	uc003ecs.3	P54922	OTTHUMG00000159420	ENST00000478399.1:c.526G>A	chr3.hg19:g.119305359G>A	ENSP00000420200:p.Ala176Thr	74.0	0.0	.		65.0	27.0	.	NM_001125	B2R8H1|D3DN83	Missense_Mutation	SNP	ENST00000478399.1	hg19	CCDS2990.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673577	0.67928	.	.	ENSG00000144843	ENST00000478399;ENST00000478927;ENST00000357003;ENST00000465513	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.54	5.54	0.83059	.	0.054304	0.64402	D	0.000001	T	0.69387	0.3105	M	0.92923	3.36	0.54753	D	0.999986	D	0.89917	1.0	D	0.68039	0.955	T	0.75542	-0.3281	10	0.72032	D	0.01	-25.2229	11.8438	0.52371	0.0:0.0:0.8258:0.1742	.	176	P54922	ADPRH_HUMAN	T	176	ENSP00000420200:A176T;ENSP00000417528:A176T;ENSP00000349496:A176T;ENSP00000417430:A176T	ENSP00000349496:A176T	A	+	1	0	ADPRH	120788049	1.000000	0.71417	0.967000	0.41034	0.139000	0.21198	6.774000	0.75012	2.884000	0.98904	0.655000	0.94253	GCT	.	.	.	none		0.532	ADPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355199.1	NM_001125	
MBD4	8930	hgsc.bcm.edu	37	3	129152076	129152076	+	Missense_Mutation	SNP	G	G	T	rs376050040		TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr3:129152076G>T	ENST00000249910.1	-	6	1601	c.1426C>A	c.(1426-1428)Cct>Act	p.P476T	MBD4_ENST00000503197.1_Missense_Mutation_p.P476T|MBD4_ENST00000429544.2_Missense_Mutation_p.P470T|MBD4_ENST00000393278.2_Missense_Mutation_p.P158T|MBD4_ENST00000507208.1_Missense_Mutation_p.P476T|MBD4_ENST00000509587.1_5'Flank	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	476					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						CAAAGCACAGGTATTGCCATT	0.423								Base excision repair (BER), DNA glycosylases																													p.P476T		Atlas-SNP	.											.	MBD4	53	.	0			c.C1426A						PASS	.						85.0	86.0	86.0					3																	129152076		2203	4300	6503	SO:0001583	missense	8930	exon6			GCACAGGTATTGC	AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.1426C>A	chr3.hg19:g.129152076G>T	ENSP00000249910:p.Pro476Thr	82.0	0.0	.		83.0	33.0	.	NM_003925	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000249910.1	hg19	CCDS3058.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834013	0.91036	.	.	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000503197;ENST00000393278;ENST00000507208	D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99	6.14	6.14	0.99180	HhH-GPD domain (1);DNA glycosylase (2);	0.000000	0.85682	D	0.000000	D	0.94221	0.8145	M	0.89840	3.065	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.99;1.0;0.998	D;D;D;D;D	0.77557	0.983;0.99;0.933;0.987;0.976	D	0.93945	0.7227	10	0.62326	D	0.03	-10.1723	20.4701	0.99162	0.0:0.0:1.0:0.0	.	476;158;470;476;476	E9PEE4;Q2MD36;O95243-2;O95243-3;O95243	.;.;.;.;MBD4_HUMAN	T	470;476;476;158;476	ENSP00000394080:P470T;ENSP00000249910:P476T;ENSP00000424873:P476T;ENSP00000376959:P158T;ENSP00000422327:P476T	ENSP00000249910:P476T	P	-	1	0	MBD4	130634766	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.414000	0.80117	2.937000	0.99478	0.650000	0.86243	CCT	.	.	.	alt		0.423	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355529.1	NM_003925	
NOP14	8602	hgsc.bcm.edu	37	4	2956275	2956275	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr4:2956275G>T	ENST00000314262.6	-	4	536	c.488C>A	c.(487-489)gCc>gAc	p.A163D	NOP14_ENST00000398071.4_Missense_Mutation_p.A163D|NOP14_ENST00000502735.1_Missense_Mutation_p.A163D|NOP14_ENST00000416614.2_Missense_Mutation_p.A163D|NOP14-AS1_ENST00000503709.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	163					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TCCAAAGTGGGCAGCAGTCAG	0.587																																					p.A163D		Atlas-SNP	.											.	NOP14	69	.	0			c.C488A						PASS	.						56.0	55.0	56.0					4																	2956275		2203	4300	6503	SO:0001583	missense	8602	exon4			AAGTGGGCAGCAG	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.488C>A	chr4.hg19:g.2956275G>T	ENSP00000315674:p.Ala163Asp	32.0	0.0	.		21.0	7.0	.	NM_003703	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Missense_Mutation	SNP	ENST00000314262.6	hg19	CCDS33945.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.533447	0.64972	.	.	ENSG00000087269	ENST00000416614;ENST00000314262;ENST00000502735;ENST00000398071;ENST00000546137	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.04	5.04	0.67666	.	0.446649	0.26143	N	0.026084	T	0.34395	0.0896	L	0.56769	1.78	0.46149	D	0.998894	P;P	0.41080	0.737;0.601	B;B	0.37833	0.259;0.259	T	0.35450	-0.9788	10	0.87932	D	0	-7.8632	17.9807	0.89140	0.0:0.0:1.0:0.0	.	163;163	E9PFK5;P78316	.;NOP14_HUMAN	D	163;163;163;163;62	ENSP00000405068:A163D;ENSP00000315674:A163D;ENSP00000427415:A163D;ENSP00000381146:A163D	ENSP00000315674:A163D	A	-	2	0	NOP14	2926073	1.000000	0.71417	0.491000	0.27477	0.060000	0.15804	9.636000	0.98440	2.336000	0.79503	0.650000	0.86243	GCC	.	.	.	none		0.587	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358135.2	NM_003703	
DSPP	1834	hgsc.bcm.edu	37	4	88537513	88537513	+	Missense_Mutation	SNP	A	A	C	rs112275895		TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr4:88537513A>C	ENST00000282478.7	+	4	3732	c.3699A>C	c.(3697-3699)gaA>gaC	p.E1233D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.E1233D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1233	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcaatgaaagcagcgaca	0.547																																					p.E1233D		Atlas-SNP	.											.	DSPP	174	.	0			c.A3699C						PASS	.																																			SO:0001583	missense	1834	exon5			CAATGAAAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3699A>C	chr4.hg19:g.88537513A>C	ENSP00000282478:p.Glu1233Asp	334.0	0.0	.		294.0	34.0	.	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.785366	0.00628	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88741	-2.42;-2.42	2.61	-5.21	0.02815	.	.	.	.	.	T	0.57213	0.2038	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57347	-0.7827	9	0.02654	T	1	.	0.7125	0.00926	0.2623:0.1881:0.1298:0.4197	.	1233	Q9NZW4	DSPP_HUMAN	D	1233	ENSP00000382213:E1233D;ENSP00000282478:E1233D	ENSP00000282478:E1233D	E	+	3	2	DSPP	88756537	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	-2.769000	0.00780	-2.252000	0.00699	-3.496000	0.00033	GAA	.	A|0.500;C|0.500	0.500	weak		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
TAF9	6880	hgsc.bcm.edu	37	5	68661336	68661336	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr5:68661336A>G	ENST00000328663.4	-	3	695	c.229T>C	c.(229-231)Tgc>Cgc	p.C77R	TAF9_ENST00000506736.1_Missense_Mutation_p.C77R|TAF9_ENST00000380818.3_Intron|TAF9_ENST00000502819.1_Intron|TAF9_ENST00000217893.5_Missense_Mutation_p.C77R|TAF9_ENST00000512561.1_Intron|TAF9_ENST00000380822.4_Intron	NM_001015892.1	NP_001015892.1	Q16594	TAF9_HUMAN	TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa	77					cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of cell growth (GO:0030307)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|response to interleukin-1 (GO:0070555)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|pre-snoRNP complex (GO:0070761)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	activating transcription factor binding (GO:0033613)|C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|urinary_tract(1)	8		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.1e-56)|Epithelial(20;9.54e-53)|all cancers(19;2.2e-48)|Lung(70;0.0176)		TCAGCGCGGCACTGGATTGCC	0.413																																					p.C77R		Atlas-SNP	.											.	TAF9	28	.	0			c.T229C						PASS	.						99.0	97.0	98.0					5																	68661336		2203	4300	6503	SO:0001583	missense	6880	exon3			CGCGGCACTGGAT	U21858	CCDS4001.1, CCDS4002.1, CCDS43324.1	5q13.2	2013-09-26	2002-08-29	2001-12-07	ENSG00000085231	ENSG00000085231			11542	protein-coding gene	gene with protein product		600822	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, G, 32kD"""	TAF2G		10191103, 15630091, 16079131	Standard	NM_001015892		Approved	TAFII31, TAFII32, TAFIID32, MGC5067, CGI-137, MGC1603, MGC3647, AD-004	uc003jwa.3	Q16594	OTTHUMG00000099359	ENST00000328663.4:c.229T>C	chr5.hg19:g.68661336A>G	ENSP00000370193:p.Cys77Arg	110.0	0.0	.		73.0	28.0	.	NM_003187	D3DWA3|Q5U0D1|Q9BTS1	Missense_Mutation	SNP	ENST00000328663.4	hg19	CCDS4002.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.261584	0.39995	.	.	ENSG00000085231	ENST00000506736;ENST00000328663;ENST00000217893;ENST00000503245;ENST00000509462;ENST00000504109;ENST00000512152;ENST00000508954	T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.69	4.53	0.55603	Histone-fold (2);	0.000000	0.85682	D	0.000000	T	0.42200	0.1192	L	0.47716	1.5	0.80722	D	1	B	0.29432	0.244	B	0.41135	0.348	T	0.35724	-0.9777	10	0.38643	T	0.18	-9.3942	9.4418	0.38673	0.9167:0.0:0.0833:0.0	.	77	Q16594	TAF9_HUMAN	R	77	ENSP00000421873:C77R;ENSP00000370193:C77R;ENSP00000217893:C77R;ENSP00000425944:C77R;ENSP00000427343:C77R;ENSP00000426283:C77R;ENSP00000425798:C77R;ENSP00000427617:C77R	ENSP00000217893:C77R	C	-	1	0	TAF9	68697092	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.840000	0.75369	2.306000	0.77630	0.533000	0.62120	TGC	.	.	.	none		0.413	TAF9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216803.1	NM_003187	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573697	140573697	+	Silent	SNP	G	G	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr5:140573697G>C	ENST00000239446.4	+	1	1756	c.1572G>C	c.(1570-1572)ctG>ctC	p.L524L		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	524	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGAGGCCCTGCAGGCTTTCG	0.697																																					p.L524L		Atlas-SNP	.											.	PCDHB10	177	.	0			c.G1572C						PASS	.						87.0	106.0	100.0					5																	140573697		2203	4298	6501	SO:0001819	synonymous_variant	56126	exon1			GGCCCTGCAGGCT	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1572G>C	chr5.hg19:g.140573697G>C		138.0	0.0	.		114.0	38.0	.	NM_018930	Q96T99	Silent	SNP	ENST00000239446.4	hg19	CCDS4252.1																																																																																			.	.	.	none		0.697	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140810981	140810981	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr5:140810981G>C	ENST00000252085.3	+	1	797	c.655G>C	c.(655-657)Gac>Cac	p.D219H	PCDHGA7_ENST00000518325.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	219	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGACGGGGGCGACCCGGTGCG	0.652																																					p.D219H		Atlas-SNP	.											.	PCDHGA12	271	.	0			c.G655C						PASS	.						50.0	52.0	51.0					5																	140810981		2203	4300	6503	SO:0001583	missense	26025	exon1			GGGGGCGACCCGG	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.655G>C	chr5.hg19:g.140810981G>C	ENSP00000252085:p.Asp219His	74.0	0.0	.		61.0	20.0	.	NM_032094	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	hg19	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	g	8.895	0.955017	0.18431	.	.	ENSG00000253159	ENST00000252085	T	0.01854	4.6	5.27	2.48	0.30137	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.07007	0.0178	M	0.75264	2.295	0.09310	N	1	B;B	0.33198	0.401;0.163	B;P	0.47573	0.339;0.55	T	0.21042	-1.0257	9	0.56958	D	0.05	.	5.9038	0.18982	0.2123:0.0:0.653:0.1347	.	219;219	O60330-2;O60330	.;PCDGC_HUMAN	H	219	ENSP00000252085:D219H	ENSP00000252085:D219H	D	+	1	0	PCDHGA12	140791165	0.003000	0.15002	0.136000	0.22124	0.024000	0.10985	1.587000	0.36622	0.802000	0.34089	0.655000	0.94253	GAC	.	.	.	none		0.652	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
RARS2	57038	hgsc.bcm.edu	37	6	88229389	88229389	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr6:88229389C>T	ENST00000369536.5	-	14	1194	c.1149G>A	c.(1147-1149)atG>atA	p.M383I	RARS2_ENST00000497828.1_5'Flank	NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	383					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		TTCGAGTCTTCATTCCCTGTA	0.403																																					p.M383I		Atlas-SNP	.											.	RARS2	61	.	0			c.G1149A						PASS	.						106.0	99.0	101.0					6																	88229389		2203	4300	6503	SO:0001583	missense	57038	exon14			AGTCTTCATTCCC	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.1149G>A	chr6.hg19:g.88229389C>T	ENSP00000358549:p.Met383Ile	117.0	0.0	.		130.0	52.0	.	NM_020320	B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	ENST00000369536.5	hg19	CCDS5011.1	.	.	.	.	.	.	.	.	.	.	C	34	5.353278	0.95830	.	.	ENSG00000146282	ENST00000369536	T	0.75260	-0.92	5.97	5.97	0.96955	Arginyl-tRNA synthetase, class Ia, core (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.86276	0.5894	M	0.81802	2.56	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.85130	0.99;0.997	D	0.85995	0.1491	10	0.62326	D	0.03	.	20.4324	0.99085	0.0:1.0:0.0:0.0	.	383;208	Q5T160;E1P510	SYRM_HUMAN;.	I	383	ENSP00000358549:M383I	ENSP00000358549:M383I	M	-	3	0	RARS2	88286108	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.158000	0.77470	2.833000	0.97629	0.585000	0.79938	ATG	.	.	.	none		0.403	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	NM_020320	
AP5Z1	9907	hgsc.bcm.edu	37	7	4827394	4827394	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr7:4827394G>T	ENST00000348624.4	+	11	1535	c.1441G>T	c.(1441-1443)Gac>Tac	p.D481Y	MIR4656_ENST00000579503.1_RNA|AP5Z1_ENST00000401897.1_Missense_Mutation_p.D481Y	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	481					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											GGCGGTGCTGGACCTGCAGCT	0.697																																					p.D481Y		Atlas-SNP	.											.	.	.	.	0			c.G1441T						PASS	.						16.0	20.0	19.0					7																	4827394		2014	3994	6008	SO:0001583	missense	9907	exon11			GTGCTGGACCTGC	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1441G>T	chr7.hg19:g.4827394G>T	ENSP00000297562:p.Asp481Tyr	24.0	0.0	.		46.0	12.0	.	NM_014855	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	hg19	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.119517	0.56505	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.45668	0.89;0.89	4.73	3.83	0.44106	.	0.125660	0.53938	D	0.000051	T	0.61098	0.2320	M	0.80982	2.52	0.53688	D	0.999978	D	0.61080	0.989	P	0.59643	0.861	T	0.67114	-0.5752	10	0.66056	D	0.02	.	13.1808	0.59653	0.0:0.0:0.8389:0.1611	.	481	O43299	K0415_HUMAN	Y	481	ENSP00000297562:D481Y;ENSP00000384980:D481Y	ENSP00000297562:D481Y	D	+	1	0	KIAA0415	4793920	1.000000	0.71417	0.993000	0.49108	0.425000	0.31504	7.524000	0.81866	1.095000	0.41419	0.549000	0.68633	GAC	.	.	.	none		0.697	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
ZNF212	7988	hgsc.bcm.edu	37	7	148947362	148947362	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr7:148947362C>A	ENST00000335870.2	+	2	265	c.137C>A	c.(136-138)gCc>gAc	p.A46D		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	46					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			ACGGTGGTGGCCGCTATTCAG	0.567																																					p.A46D		Atlas-SNP	.											.	ZNF212	28	.	0			c.C137A						PASS	.						50.0	52.0	52.0					7																	148947362		2203	4300	6503	SO:0001583	missense	7988	exon2			TGGTGGCCGCTAT	U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.137C>A	chr7.hg19:g.148947362C>A	ENSP00000338572:p.Ala46Asp	128.0	0.0	.		127.0	65.0	.	NM_012256	B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	ENST00000335870.2	hg19	CCDS5896.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660661	0.67586	.	.	ENSG00000170260	ENST00000335870	T	0.78707	-1.2	5.6	5.6	0.85130	.	0.392655	0.21983	N	0.066263	D	0.87593	0.6216	M	0.74258	2.255	0.39801	D	0.972575	D	0.89917	1.0	D	0.85130	0.997	D	0.89043	0.3450	10	0.87932	D	0	-7.1207	15.118	0.72419	0.0:1.0:0.0:0.0	.	46	Q9UDV6	ZN212_HUMAN	D	46	ENSP00000338572:A46D	ENSP00000338572:A46D	A	+	2	0	ZNF212	148578295	1.000000	0.71417	0.965000	0.40720	0.607000	0.37147	3.387000	0.52501	2.653000	0.90120	0.563000	0.77884	GCC	.	.	.	none		0.567	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352710.1	NM_012256	
CSMD3	114788	hgsc.bcm.edu	37	8	113303751	113303751	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr8:113303751G>T	ENST00000297405.5	-	56	9206	c.8962C>A	c.(8962-8964)Cca>Aca	p.P2988T	CSMD3_ENST00000343508.3_Missense_Mutation_p.P2948T|CSMD3_ENST00000455883.2_Missense_Mutation_p.P2819T|CSMD3_ENST00000352409.3_Missense_Mutation_p.P2918T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2988	Sushi 20. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATACATTCTGGTAAAGGTTTG	0.328										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.P2988T		Atlas-SNP	.											.	CSMD3	2325	.	0			c.C8962A						PASS	.						84.0	77.0	79.0					8																	113303751		2202	4299	6501	SO:0001583	missense	114788	exon56			ATTCTGGTAAAGG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8962C>A	chr8.hg19:g.113303751G>T	ENSP00000297405:p.Pro2988Thr	92.0	0.0	.		103.0	29.0	.	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633524	0.87660	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	D;D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13;-2.13	5.74	5.74	0.90152	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000002	D	0.95427	0.8515	M	0.92923	3.36	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.984	D;D;P	0.97110	0.996;1.0;0.839	D	0.95785	0.8820	10	0.72032	D	0.01	.	19.9351	0.97137	0.0:0.0:1.0:0.0	.	2819;2988;2948	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	T	2948;2988;2258;2819;2918	ENSP00000345799:P2948T;ENSP00000297405:P2988T;ENSP00000341558:P2258T;ENSP00000412263:P2819T;ENSP00000343124:P2918T	ENSP00000297405:P2988T	P	-	1	0	CSMD3	113372927	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.030000	0.88816	2.703000	0.92315	0.655000	0.94253	CCA	.	.	.	none		0.328	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
SPATA31D1	389763	hgsc.bcm.edu	37	9	84606600	84606600	+	Silent	SNP	A	A	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr9:84606600A>T	ENST00000344803.2	+	4	1262	c.1215A>T	c.(1213-1215)tcA>tcT	p.S405S		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	405					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TTAACATCTCATTTCTCAGCC	0.458																																					p.S405S		Atlas-SNP	.											FAM75D4,rectum,carcinoma,0,2	.	.	.	0			c.A1215T						PASS	.						95.0	82.0	86.0					9																	84606600		1852	4102	5954	SO:0001819	synonymous_variant	389763	exon4			CATCTCATTTCTC		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1215A>T	chr9.hg19:g.84606600A>T		116.0	1.0	.		107.0	7.0	.	NM_001001670		Silent	SNP	ENST00000344803.2	hg19	CCDS47986.1																																																																																			.	.	.	none		0.458	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
C9orf84	158401	hgsc.bcm.edu	37	9	114538143	114538143	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr9:114538143T>C	ENST00000318737.4	-	3	306	c.178A>G	c.(178-180)Atg>Gtg	p.M60V	C9orf84_ENST00000374287.3_Missense_Mutation_p.M60V|C9orf84_ENST00000374283.5_Missense_Mutation_p.M124V	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	60										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTGTAGTCCATGTGGGTGTAT	0.363																																					p.M60V		Atlas-SNP	.											.	C9orf84	207	.	0			c.A178G						PASS	.						104.0	101.0	102.0					9																	114538143		2203	4300	6503	SO:0001583	missense	158401	exon3			AGTCCATGTGGGT	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.178A>G	chr9.hg19:g.114538143T>C	ENSP00000322108:p.Met60Val	140.0	0.0	.		121.0	48.0	.	NM_173521	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	hg19	CCDS6781.3	.	.	.	.	.	.	.	.	.	.	T	9.217	1.032346	0.19590	.	.	ENSG00000165181	ENST00000374287;ENST00000318737;ENST00000374283	T;T;T	0.42513	3.69;3.69;0.97	4.97	-1.86	0.07760	.	1.063880	0.07355	N	0.883056	T	0.20861	0.0502	N	0.08118	0	0.09310	N	1	B;B	0.15930	0.006;0.015	B;B	0.15870	0.001;0.014	T	0.21314	-1.0249	10	0.49607	T	0.09	0.116	5.3357	0.15957	0.0:0.4239:0.1725:0.4037	.	124;60	Q5VXU9-2;Q5VXU9	.;CI084_HUMAN	V	60;60;124	ENSP00000363405:M60V;ENSP00000322108:M60V;ENSP00000363401:M124V	ENSP00000322108:M60V	M	-	1	0	C9orf84	113577964	0.000000	0.05858	0.000000	0.03702	0.173000	0.22820	-0.000000	0.12993	-0.496000	0.06650	0.477000	0.44152	ATG	.	.	.	none		0.363	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521	
RGS3	5998	hgsc.bcm.edu	37	9	116345868	116345868	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr9:116345868A>G	ENST00000374140.2	+	21	2385	c.2176A>G	c.(2176-2178)Aag>Gag	p.K726E	RGS3_ENST00000350696.5_Missense_Mutation_p.K726E|RP11-168K11.2_ENST00000428429.1_RNA|RGS3_ENST00000343817.5_Missense_Mutation_p.K445E|RGS3_ENST00000394646.3_Intron|RGS3_ENST00000462143.1_Missense_Mutation_p.K47E|RGS3_ENST00000342620.5_Intron|RGS3_ENST00000374134.3_Missense_Mutation_p.K47E	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	726	Pro-rich.				inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						TCCACCCAACAAGGACTCCCC	0.622																																					p.K726E		Atlas-SNP	.											.	RGS3	251	.	0			c.A2176G						PASS	.						93.0	89.0	90.0					9																	116345868		2203	4300	6503	SO:0001583	missense	5998	exon21			CCCAACAAGGACT	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.2176A>G	chr9.hg19:g.116345868A>G	ENSP00000363255:p.Lys726Glu	79.0	0.0	.		81.0	29.0	.	NM_144488	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	ENST00000374140.2	hg19	CCDS43869.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.42|12.42	1.932043|1.932043	0.34096|0.34096	.|.	.|.	ENSG00000138835|ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000343817;ENST00000474719;ENST00000462143;ENST00000374134;ENST00000471324;ENST00000467805|ENST00000496113	T;T;T;T;T;T|.	0.78481|.	0.91;0.91;0.41;0.28;0.28;-1.18|.	4.82|4.82	-3.87|-3.87	0.04218|0.04218	.|.	0.808466|.	0.10976|.	N|.	0.613237|.	T|T	0.39279|0.39279	0.1072|0.1072	L|L	0.27053|0.27053	0.805|0.805	0.37119|0.37119	D|D	0.900721|0.900721	B;B;B;B;B;B|.	0.20052|.	0.041;0.001;0.01;0.001;0.001;0.001|.	B;B;B;B;B;B|.	0.14578|.	0.011;0.004;0.006;0.003;0.002;0.002|.	T|T	0.39461|0.39461	-0.9613|-0.9613	10|5	0.44086|.	T|.	0.13|.	.|.	9.8023|9.8023	0.40773|0.40773	0.33:0.5866:0.0834:0.0|0.33:0.5866:0.0834:0.0	.|.	65;622;47;445;616;726|.	B4DWF9;P49796-6;Q6ZV17;P49796-4;B3KWG8;P49796|.	.;.;.;.;.;RGS3_HUMAN|.	E|R	726;726;445;47;47;47;47;47|180	ENSP00000363255:K726E;ENSP00000259406:K726E;ENSP00000340284:K445E;ENSP00000420356:K47E;ENSP00000363249:K47E;ENSP00000417994:K47E|.	ENSP00000340284:K445E|.	K|Q	+|+	1|2	0|0	RGS3|RGS3	115385689|115385689	0.003000|0.003000	0.15002|0.15002	0.030000|0.030000	0.17652|0.17652	0.251000|0.251000	0.25915|0.25915	-0.237000|-0.237000	0.08990|0.08990	-0.347000|-0.347000	0.08299|0.08299	0.533000|0.533000	0.62120|0.62120	AAG|CAA	.	.	.	none		0.622	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790	
RXRA	6256	hgsc.bcm.edu	37	9	137323760	137323760	+	Silent	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr9:137323760G>T	ENST00000481739.1	+	8	1105	c.1053G>T	c.(1051-1053)acG>acT	p.T351T	RXRA_ENST00000540193.1_Silent_p.T254T|RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	351	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GGGTGCTGACGGAGCTTGTGT	0.627																																					p.T351T		Atlas-SNP	.											.	RXRA	52	.	0			c.G1053T						PASS	.						120.0	93.0	102.0					9																	137323760		2203	4300	6503	SO:0001819	synonymous_variant	6256	exon8			GCTGACGGAGCTT	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.1053G>T	chr9.hg19:g.137323760G>T		89.0	0.0	.		77.0	21.0	.	NM_002957	B3KY83|Q2NL52|Q2V504	Silent	SNP	ENST00000481739.1	hg19	CCDS35172.1																																																																																			.	.	.	none		0.627	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	NM_002957	
TMEM254	80195	hgsc.bcm.edu	37	10	81850575	81850575	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr10:81850575C>T	ENST00000372281.3	+	4	304	c.274C>T	c.(274-276)Cgg>Tgg	p.R92W	TMEM254_ENST00000372274.1_3'UTR|TMEM254_ENST00000372275.1_3'UTR|TMEM254_ENST00000467529.1_3'UTR	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254	92						integral component of membrane (GO:0016021)		p.R92W(1)									CACAAGTGGTCGGGCTCAGCT	0.383																																					p.R116W		Atlas-SNP	.											C10orf57,NS,carcinoma,0,1	TMEM254	1	.	1	Substitution - Missense(1)	endometrium(1)	c.C346T						PASS	.						148.0	136.0	140.0					10																	81850575		2203	4300	6503	SO:0001583	missense	80195	exon4			AGTGGTCGGGCTC	BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.274C>T	chr10.hg19:g.81850575C>T	ENSP00000361355:p.Arg92Trp	62.0	0.0	.		52.0	22.0	.	NM_001270367	D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	Missense_Mutation	SNP	ENST00000372281.3	hg19	CCDS7363.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.293|7.293	0.611430|0.611430	0.14066|0.14066	.|.	.|.	ENSG00000133678|ENSG00000133678	ENST00000372281|ENST00000450179	.|.	.|.	.|.	4.22|4.22	2.3|2.3	0.28687|0.28687	.|.	1.156350|.	0.06000|.	N|.	0.647577|.	T|T	0.31888|0.31888	0.0811|0.0811	L|L	0.33485|0.33485	1.01|1.01	0.09310|0.09310	N|N	1|1	B;B|.	0.18741|.	0.025;0.03|.	B;B|.	0.12156|.	0.007;0.003|.	T|T	0.20840|0.20840	-1.0263|-1.0263	9|5	0.42905|.	T|.	0.14|.	-11.936|-11.936	6.4042|6.4042	0.21656|0.21656	0.0:0.7479:0.0:0.2521|0.0:0.7479:0.0:0.2521	.|.	116;92|.	E7ERB9;Q8TBM7|.	.;CJ057_HUMAN|.	W|L	92|69	.|.	ENSP00000361355:R92W|.	R|S	+|+	1|2	2|0	C10orf57|C10orf57	81840555|81840555	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.557000|0.557000	0.35523|0.35523	-0.093000|-0.093000	0.11111|0.11111	0.473000|0.473000	0.27368|0.27368	0.557000|0.557000	0.71058|0.71058	CGG|TCG	.	.	.	none		0.383	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049030.1	NM_025125	
SLC25A28	81894	hgsc.bcm.edu	37	10	101379882	101379882	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr10:101379882T>A	ENST00000370495.4	-	1	239	c.211A>T	c.(211-213)Act>Tct	p.T71S	RP11-85A1.3_ENST00000566847.1_RNA|SLC25A28_ENST00000496035.1_Intron	NM_031212.3	NP_112489.3	Q96A46	MFRN2_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 28	71					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|stomach(1)	11		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)		GTGGTGACAGTGGCTCCAGCC	0.721																																					p.T71S		Atlas-SNP	.											.	SLC25A28	34	.	0			c.A211T						PASS	.						10.0	13.0	12.0					10																	101379882		1896	3945	5841	SO:0001583	missense	81894	exon1			TGACAGTGGCTCC	AF327402	CCDS41559.1	10q24.2	2013-05-22	2012-03-29		ENSG00000155287	ENSG00000155287		"""Solute carriers"""	23472	protein-coding gene	gene with protein product	"""mitoferrin 2"""	609767	"""solute carrier family 25, member 28"""			11297739	Standard	NM_031212		Approved	MRS3/4, MRS4L	uc001kpx.2	Q96A46	OTTHUMG00000018886	ENST00000370495.4:c.211A>T	chr10.hg19:g.101379882T>A	ENSP00000359526:p.Thr71Ser	26.0	0.0	.		19.0	6.0	.	NM_031212	Q4VBZ0|Q5T777|Q86VX5|Q969G8|Q9H2J3	Missense_Mutation	SNP	ENST00000370495.4	hg19	CCDS41559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	5.859|5.859	0.342667|0.342667	0.11069|0.11069	.|.	.|.	ENSG00000155287|ENSG00000155287	ENST00000434701|ENST00000370495	T|T	0.78481|0.78003	-1.18|-1.14	4.49|4.49	4.49|4.49	0.54785|0.54785	.|Mitochondrial carrier domain (1);	.|0.078181	.|0.51477	.|D	.|0.000096	T|T	0.45756|0.45756	0.1358|0.1358	N|N	0.01686|0.01686	-0.76|-0.76	0.31508|0.31508	N|N	0.663909|0.663909	.|B	.|0.06786	.|0.001	.|B	.|0.12156	.|0.007	T|T	0.48422|0.48422	-0.9037|-0.9037	7|10	0.33141|0.02654	T|T	0.24|1	-51.6351|-51.6351	8.2084|8.2084	0.31469|0.31469	0.0:0.0953:0.0:0.9047|0.0:0.0953:0.0:0.9047	.|.	.|71	.|Q96A46	.|MFRN2_HUMAN	L|S	8|71	ENSP00000399102:H8L|ENSP00000359526:T71S	ENSP00000399102:H8L|ENSP00000359526:T71S	H|T	-|-	2|1	0|0	SLC25A28|SLC25A28	101369872|101369872	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	2.051000|2.051000	0.41307|0.41307	1.873000|1.873000	0.54277|0.54277	0.375000|0.375000	0.23000|0.23000	CAC|ACT	.	.	.	none		0.721	SLC25A28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049801.1	NM_031212	
SEC31B	25956	hgsc.bcm.edu	37	10	102265129	102265129	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr10:102265129C>A	ENST00000370345.3	-	10	1265	c.1168G>T	c.(1168-1170)Gtt>Ttt	p.V390F	SEC31B_ENST00000451524.1_Missense_Mutation_p.V390F	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	390					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GCAAATGAAACACCTGTTGGT	0.502																																					p.V390F		Atlas-SNP	.											.	SEC31B	84	.	0			c.G1168T						PASS	.						208.0	208.0	208.0					10																	102265129		2203	4300	6503	SO:0001583	missense	25956	exon10			ATGAAACACCTGT	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.1168G>T	chr10.hg19:g.102265129C>A	ENSP00000359370:p.Val390Phe	81.0	0.0	.		58.0	19.0	.	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	hg19	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.509524	0.85282	.	.	ENSG00000075826	ENST00000370345;ENST00000451524	T;T	0.60797	0.44;0.16	5.82	4.91	0.64330	.	0.291232	0.38111	N	0.001804	T	0.76543	0.4002	M	0.83953	2.67	0.80722	D	1	D;D	0.58268	0.982;0.969	D;P	0.64506	0.926;0.845	T	0.81072	-0.1098	10	0.87932	D	0	-3.3194	15.336	0.74255	0.1408:0.8592:0.0:0.0	.	389;390	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	F	390	ENSP00000359370:V390F;ENSP00000391178:V390F	ENSP00000359370:V390F	V	-	1	0	SEC31B	102255119	0.997000	0.39634	0.933000	0.37362	0.852000	0.48524	3.525000	0.53502	1.448000	0.47680	0.561000	0.74099	GTT	.	.	.	none		0.502	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
AP2A2	161	hgsc.bcm.edu	37	11	993296	993296	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr11:993296C>T	ENST00000448903.2	+	12	1606	c.1465C>T	c.(1465-1467)Ccc>Tcc	p.P489S	AP2A2_ENST00000534328.1_Intron|AP2A2_ENST00000332231.5_Missense_Mutation_p.P490S	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	489					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCTTCAGGCTCCCGCGTGCCA	0.622																																					p.P490S		Atlas-SNP	.											.	AP2A2	50	.	0			c.C1468T						PASS	.						35.0	41.0	39.0					11																	993296		1981	4155	6136	SO:0001583	missense	161	exon12			CAGGCTCCCGCGT	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1465C>T	chr11.hg19:g.993296C>T	ENSP00000413234:p.Pro489Ser	48.0	0.0	.		44.0	12.0	.	NM_001242837	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	ENST00000448903.2	hg19	CCDS44512.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.257403	0.39896	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310	T;T	0.37915	1.17;1.17	3.66	3.66	0.41972	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51550	0.1681	L	0.48877	1.53	0.80722	D	1	D;P;P	0.69078	0.997;0.787;0.882	D;P;P	0.77557	0.99;0.469;0.604	T	0.49224	-0.8962	10	0.33141	T	0.24	-10.2646	16.226	0.82293	0.0:1.0:0.0:0.0	.	228;490;489	B7Z1Q4;O94973-2;O94973	.;.;AP2A2_HUMAN	S	489;490;490;226;229	ENSP00000413234:P489S;ENSP00000327694:P490S	ENSP00000327694:P490S	P	+	1	0	AP2A2	983296	1.000000	0.71417	0.248000	0.24265	0.485000	0.33311	4.879000	0.63100	1.979000	0.57680	0.462000	0.41574	CCC	.	.	.	none		0.622	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385431.2	NM_012305	
PPFIBP2	8495	hgsc.bcm.edu	37	11	7660962	7660962	+	Splice_Site	SNP	G	G	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr11:7660962G>A	ENST00000299492.4	+	15	1624		c.e15-1		PPFIBP2_ENST00000533792.1_Splice_Site|PPFIBP2_ENST00000530181.1_Splice_Site|PPFIBP2_ENST00000528883.1_Splice_Site|PPFIBP2_ENST00000530582.1_Splice_Site	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)						cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CCTTCCAATAGGACAGCCCTT	0.493																																					.		Atlas-SNP	.											.	PPFIBP2	87	.	0			c.1237-1G>A						PASS	.						182.0	189.0	186.0					11																	7660962		2201	4296	6497	SO:0001630	splice_region_variant	8495	exon15			CCAATAGGACAGC	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1237-1G>A	chr11.hg19:g.7660962G>A		135.0	0.0	.		109.0	42.0	.	NM_003621	B7Z433|E9PK77|O75337|Q8WW26	Splice_Site	SNP	ENST00000299492.4	hg19	CCDS31419.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631854	0.29068	.	.	ENSG00000166387	ENST00000299492;ENST00000533792;ENST00000537467;ENST00000541115;ENST00000528883;ENST00000530181;ENST00000534409;ENST00000530081	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5173	0.75833	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PPFIBP2	7617538	1.000000	0.71417	0.995000	0.50966	0.317000	0.28152	6.002000	0.70693	2.731000	0.93534	0.557000	0.71058	.	.	.	.	none		0.493	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	Intron
NAV2	89797	hgsc.bcm.edu	37	11	19854129	19854129	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr11:19854129C>G	ENST00000396087.3	+	2	466	c.367C>G	c.(367-369)Cag>Gag	p.Q123E	NAV2_ENST00000527559.2_Missense_Mutation_p.Q52E|NAV2_ENST00000349880.4_Missense_Mutation_p.Q123E|NAV2_ENST00000360655.4_Missense_Mutation_p.Q59E|NAV2_ENST00000540292.1_Missense_Mutation_p.Q54E|NAV2_ENST00000396085.1_Missense_Mutation_p.Q123E|NAV2_ENST00000534229.1_3'UTR	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	123	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CCTCCTGGCCCAGATTATCCA	0.527																																					p.Q123E		Atlas-SNP	.											.	NAV2	255	.	0			c.C367G						PASS	.						195.0	201.0	199.0					11																	19854129		2199	4293	6492	SO:0001583	missense	89797	exon2			CTGGCCCAGATTA	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.367C>G	chr11.hg19:g.19854129C>G	ENSP00000379396:p.Gln123Glu	45.0	0.0	.		27.0	8.0	.	NM_145117	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	ENST00000396087.3	hg19	CCDS58126.1	.	.	.	.	.	.	.	.	.	.	C	5.035	0.192111	0.09599	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292	T;T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3;0.3	5.83	4.9	0.64082	.	0.100385	0.42964	D	0.000629	T	0.31734	0.0806	N	0.03903	-0.33	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17868	-1.0355	9	.	.	.	.	13.0026	0.58685	0.0:0.6311:0.3689:0.0	.	123;59	Q8IVL1-3;Q8IVL1-4	.;.	E	59;123;123;123;52;54	ENSP00000353871:Q59E;ENSP00000379394:Q123E;ENSP00000309577:Q123E;ENSP00000379396:Q123E;ENSP00000435395:Q52E;ENSP00000443489:Q54E	.	Q	+	1	0	NAV2	19810705	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.992000	0.56980	2.763000	0.94921	0.561000	0.74099	CAG	.	.	.	none		0.527	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
GPHA2	170589	hgsc.bcm.edu	37	11	64702479	64702479	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr11:64702479A>G	ENST00000279168.2	-	3	326	c.272T>C	c.(271-273)aTc>aCc	p.I91T	GPHA2_ENST00000533257.1_Missense_Mutation_p.I91T|GPHA2_ENST00000532246.1_Missense_Mutation_p.I91T	NM_130769.3	NP_570125.1	Q96T91	GPHA2_HUMAN	glycoprotein hormone alpha 2	91						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|prostate(1)	3						CAGGCCACTGATGGTGCAGCA	0.617																																					p.I91T		Atlas-SNP	.											.	GPHA2	13	.	0			c.T272C						PASS	.						118.0	119.0	119.0					11																	64702479		2201	4297	6498	SO:0001583	missense	170589	exon3			CCACTGATGGTGC	AF260739	CCDS8086.1	11q13.1	2008-07-18				ENSG00000149735			18054	protein-coding gene	gene with protein product	"""glycoprotein alpha 2"", ""cysteine knot protein"""	609651				11809971	Standard	NM_130769		Approved	GPA2, ZSIG51, A2, MGC126572	uc001oca.3	Q96T91		ENST00000279168.2:c.272T>C	chr11.hg19:g.64702479A>G	ENSP00000279168:p.Ile91Thr	77.0	0.0	.		64.0	24.0	.	NM_130769	Q52LE2	Missense_Mutation	SNP	ENST00000279168.2	hg19	CCDS8086.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.178283	0.78564	.	.	ENSG00000149735	ENST00000279168;ENST00000533257;ENST00000532246	T;T	0.28666	1.6;1.6	4.27	4.27	0.50696	Cystine knot, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.55545	0.1927	M	0.80616	2.505	0.58432	D	0.999998	D	0.76494	0.999	D	0.83275	0.996	T	0.61633	-0.7023	10	0.87932	D	0	.	11.7091	0.51614	1.0:0.0:0.0:0.0	.	91	Q96T91	GPHA2_HUMAN	T	91	ENSP00000279168:I91T;ENSP00000432918:I91T	ENSP00000279168:I91T	I	-	2	0	GPHA2	64459055	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	8.005000	0.88553	1.937000	0.56155	0.533000	0.62120	ATC	.	.	.	none		0.617	GPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385470.1	NM_130769	
NPAS4	266743	hgsc.bcm.edu	37	11	66190646	66190646	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr11:66190646T>G	ENST00000311034.2	+	5	927	c.751T>G	c.(751-753)Tat>Gat	p.Y251D		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	251	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						TAAATCATGGTATGGACTGCT	0.537																																					p.Y251D		Atlas-SNP	.											.	NPAS4	133	.	0			c.T751G						PASS	.						122.0	93.0	103.0					11																	66190646		2200	4295	6495	SO:0001583	missense	266743	exon5			TCATGGTATGGAC	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.751T>G	chr11.hg19:g.66190646T>G	ENSP00000311196:p.Tyr251Asp	90.0	0.0	.		58.0	23.0	.	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	hg19	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572924	0.86542	.	.	ENSG00000174576	ENST00000311034	T	0.19394	2.15	5.65	5.65	0.86999	PAS fold-3 (1);PAS (2);	0.000000	0.49916	D	0.000132	T	0.51890	0.1701	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60047	-0.7339	10	0.87932	D	0	-6.2055	13.8382	0.63421	0.0:0.0:0.0:1.0	.	251	Q8IUM7	NPAS4_HUMAN	D	251	ENSP00000311196:Y251D	ENSP00000311196:Y251D	Y	+	1	0	NPAS4	65947222	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.350000	0.79385	2.150000	0.67090	0.528000	0.53228	TAT	.	.	.	none		0.537	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
CARNS1	57571	hgsc.bcm.edu	37	11	67186483	67186483	+	Silent	SNP	C	C	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr11:67186483C>G	ENST00000307823.3	+	4	704	c.252C>G	c.(250-252)gcC>gcG	p.A84A	CARNS1_ENST00000445895.2_Silent_p.A207A|CARNS1_ENST00000531040.1_Silent_p.A207A|CARNS1_ENST00000423745.2_Silent_p.A84A	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	84					ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						CTGAGCTGGCCCGGCTGCTGG	0.692																																					p.A207A		Atlas-SNP	.											.	CARNS1	60	.	0			c.C621G						PASS	.						5.0	8.0	7.0					11																	67186483		2021	4137	6158	SO:0001819	synonymous_variant	57571	exon5			GCTGGCCCGGCTG		CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.252C>G	chr11.hg19:g.67186483C>G		45.0	0.0	.		41.0	18.0	.	NM_001166222	A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Silent	SNP	ENST00000307823.3	hg19	CCDS44658.1																																																																																			.	.	.	none		0.692	CARNS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395501.1	NM_020811	
POU2AF1	5450	hgsc.bcm.edu	37	11	111229622	111229622	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr11:111229622G>A	ENST00000393067.3	-	2	552	c.38C>T	c.(37-39)cCa>cTa	p.P13L		NM_006235.2	NP_006226.2	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	13					humoral immune response (GO:0006959)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(2)|lung(2)	5		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		GGCCGGGGCTGGGGCTTGCTC	0.632			T	BCL6	NHL																																p.P13L		Atlas-SNP	.		Dom	yes		11	11q23.1	5450	"""POU domain, class 2, associating factor 1 (OBF1)"""		L	.	POU2AF1	23	.	0			c.C38T						PASS	.						48.0	49.0	49.0					11																	111229622		2201	4297	6498	SO:0001583	missense	5450	exon2			GGGGCTGGGGCTT		CCDS31675.1	11q23.1	2011-06-01	2007-07-13			ENSG00000110777			9211	protein-coding gene	gene with protein product		601206	"""POU domain class 2, associating factor 1"""			8617501	Standard	NM_006235		Approved	OBF1	uc001plg.4	Q16633		ENST00000393067.3:c.38C>T	chr11.hg19:g.111229622G>A	ENSP00000376786:p.Pro13Leu	58.0	0.0	.		34.0	8.0	.	NM_006235	B2R8Z9|Q14983	Missense_Mutation	SNP	ENST00000393067.3	hg19	CCDS31675.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165888	0.78339	.	.	ENSG00000110777	ENST00000393067;ENST00000531398	T;T	0.32753	1.44;1.44	5.0	5.0	0.66597	.	0.238634	0.35936	N	0.002889	T	0.33990	0.0882	L	0.45581	1.43	0.49389	D	0.999781	P	0.48089	0.905	P	0.47941	0.562	T	0.03761	-1.1006	10	0.15499	T	0.54	-1.2837	16.0815	0.81007	0.0:0.0:1.0:0.0	.	13	Q16633	OBF1_HUMAN	L	13;15	ENSP00000376786:P13L;ENSP00000433527:P15L	ENSP00000376786:P13L	P	-	2	0	POU2AF1	110734832	0.999000	0.42202	0.973000	0.42090	0.656000	0.38851	3.990000	0.56965	2.331000	0.79229	0.305000	0.20034	CCA	.	.	.	none		0.632	POU2AF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391002.1	NM_006235	
PFKM	5213	hgsc.bcm.edu	37	12	48536588	48536588	+	Silent	SNP	A	A	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr12:48536588A>T	ENST00000312352.7	+	18	1716	c.1677A>T	c.(1675-1677)tcA>tcT	p.S559S	PFKM_ENST00000551804.1_Silent_p.S528S|PFKM_ENST00000547587.1_Silent_p.S559S|PFKM_ENST00000359794.5_Silent_p.S559S|PFKM_ENST00000340802.6_Silent_p.S630S|PFKM_ENST00000395233.2_Silent_p.S528S	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	559	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						TCAAGCAGTCAGCAGCTGGCA	0.512																																					p.S630S		Atlas-SNP	.											.	PFKM	117	.	0			c.A1890T						PASS	.						137.0	122.0	127.0					12																	48536588		2203	4300	6503	SO:0001819	synonymous_variant	5213	exon20			GCAGTCAGCAGCT	M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.1677A>T	chr12.hg19:g.48536588A>T		97.0	0.0	.		117.0	65.0	.	NM_001166686	J3KNX3|Q16814|Q16815|Q6ZTT1	Silent	SNP	ENST00000312352.7	hg19	CCDS8760.1																																																																																			.	.	.	none		0.512	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406490.1	NM_000289	
KRT80	144501	hgsc.bcm.edu	37	12	52565443	52565443	+	Splice_Site	SNP	G	G	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr12:52565443G>A	ENST00000394815.2	-	8	1330	c.1233C>T	c.(1231-1233)acC>acT	p.T411T	KRT80_ENST00000313234.5_Splice_Site_p.T411T	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	411	Tail.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		AGGACTCACCGGTTTTGCACC	0.602																																					p.T411T	GBM(178;2309 2916 15678 35873)	Atlas-SNP	.											.	KRT80	68	.	0			c.C1233T						PASS	.						55.0	43.0	47.0					12																	52565443		2200	4298	6498	SO:0001630	splice_region_variant	144501	exon8			CTCACCGGTTTTG	BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.1234+1C>T	chr12.hg19:g.52565443G>A		169.0	0.0	.		169.0	88.0	.	NM_182507	Q6P1A5|Q7Z3Q0	Silent	SNP	ENST00000394815.2	hg19	CCDS8821.2																																																																																			.	.	.	none		0.602	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316757.1	NM_182507	Silent
MYO1A	4640	hgsc.bcm.edu	37	12	57431392	57431392	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr12:57431392G>T	ENST00000442789.2	-	20	2282	c.1995C>A	c.(1993-1995)agC>agA	p.S665R	MYO1A_ENST00000544473.1_Missense_Mutation_p.S503R|MYO1A_ENST00000300119.3_Missense_Mutation_p.S665R|MYO1A_ENST00000476795.1_5'Flank	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	665	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						CCGAGGACATGCTCAGCTCCC	0.512																																					p.S665R		Atlas-SNP	.											.	MYO1A	122	.	0			c.C1995A						PASS	.						227.0	233.0	231.0					12																	57431392		2203	4300	6503	SO:0001583	missense	4640	exon19			GGACATGCTCAGC	L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.1995C>A	chr12.hg19:g.57431392G>T	ENSP00000393392:p.Ser665Arg	77.0	0.0	.		88.0	23.0	.	NM_005379	Q9UQD7	Missense_Mutation	SNP	ENST00000442789.2	hg19	CCDS8929.1	.	.	.	.	.	.	.	.	.	.	G	8.653	0.898793	0.17686	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	D;D;D	0.87412	-2.25;-2.25;-2.25	4.96	0.968	0.19680	Myosin head, motor domain (2);	0.445812	0.26654	N	0.023187	T	0.71728	0.3374	N	0.12182	0.205	0.09310	N	1	B	0.24043	0.096	B	0.28465	0.09	T	0.57923	-0.7727	10	0.23891	T	0.37	.	6.547	0.22412	0.4246:0.0:0.5754:0.0	.	665	Q9UBC5	MYO1A_HUMAN	R	665;665;503	ENSP00000300119:S665R;ENSP00000393392:S665R;ENSP00000440514:S503R	ENSP00000300119:S665R	S	-	3	2	MYO1A	55717659	0.000000	0.05858	0.009000	0.14445	0.955000	0.61496	0.230000	0.17852	0.143000	0.18926	0.591000	0.81541	AGC	.	.	.	none		0.512	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2	NM_005379	
PTPRB	5787	hgsc.bcm.edu	37	12	71016216	71016216	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr12:71016216G>T	ENST00000550358.1	-	3	687	c.662C>A	c.(661-663)tCa>tAa	p.S221*	PTPRB_ENST00000334414.6_Nonsense_Mutation_p.S221*|PTPRB_ENST00000551525.1_Nonsense_Mutation_p.S220*|PTPRB_ENST00000538174.2_5'UTR			P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	0	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CAAAACCCATGATGTGTCTGT	0.512																																					p.S221X		Atlas-SNP	.											.	PTPRB	676	.	0			c.C662A						PASS	.						172.0	184.0	180.0					12																	71016216		2051	4200	6251	SO:0001587	stop_gained	5787	exon3			ACCCATGATGTGT	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000550358.1:c.662C>A	chr12.hg19:g.71016216G>T	ENSP00000448058:p.Ser221*	60.0	0.0	.		90.0	44.0	.	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Nonsense_Mutation	SNP	ENST00000550358.1	hg19		.	.	.	.	.	.	.	.	.	.	G	37	6.457421	0.97581	.	.	ENSG00000127329	ENST00000334414;ENST00000550358;ENST00000544694;ENST00000551525;ENST00000548122	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6503	0.88162	0.0:0.0:1.0:0.0	.	.	.	.	X	221;221;221;220;100	.	ENSP00000334928:S221X	S	-	2	0	PTPRB	69302483	0.599000	0.26891	0.070000	0.20053	0.532000	0.34746	3.878000	0.56130	2.686000	0.91538	0.650000	0.86243	TCA	.	.	.	none		0.512	PTPRB-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404436.1		
NAA25	80018	hgsc.bcm.edu	37	12	112478370	112478370	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr12:112478370T>A	ENST00000261745.4	-	21	2701	c.2453A>T	c.(2452-2454)aAa>aTa	p.K818I	MIR3657_ENST00000584818.1_RNA	NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	818						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						ACCTTTACATTTACTGAAGAC	0.284																																					p.K818I		Atlas-SNP	.											.	NAA25	105	.	0			c.A2453T						PASS	.						66.0	65.0	65.0					12																	112478370		2201	4295	6496	SO:0001583	missense	80018	exon21			TTACATTTACTGA	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.2453A>T	chr12.hg19:g.112478370T>A	ENSP00000261745:p.Lys818Ile	51.0	0.0	.		89.0	51.0	.	NM_024953	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	ENST00000261745.4	hg19	CCDS9159.1	.	.	.	.	.	.	.	.	.	.	T	14.77	2.633358	0.47049	.	.	ENSG00000111300	ENST00000261745;ENST00000550701	T	0.26957	1.7	5.53	0.105	0.14535	.	0.665279	0.15928	N	0.237786	T	0.13713	0.0332	L	0.27053	0.805	0.28371	N	0.920017	B;B	0.20671	0.047;0.047	B;B	0.15052	0.012;0.012	T	0.14587	-1.0467	10	0.59425	D	0.04	-2.7143	2.7285	0.05220	0.1164:0.1349:0.128:0.6207	.	818;818	A8K8X0;Q14CX7	.;NAA25_HUMAN	I	818;24	ENSP00000261745:K818I	ENSP00000261745:K818I	K	-	2	0	NAA25	110962753	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	1.657000	0.37366	0.061000	0.16311	0.533000	0.62120	AAA	.	.	.	none		0.284	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953	
NAA25	80018	hgsc.bcm.edu	37	12	112499043	112499043	+	Silent	SNP	A	A	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr12:112499043A>G	ENST00000261745.4	-	12	1547	c.1299T>C	c.(1297-1299)aaT>aaC	p.N433N	RP1-267L14.3_ENST00000551125.1_RNA	NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	433						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						TCAATTTCTGATTTTTATCCA	0.453																																					p.N433N		Atlas-SNP	.											.	NAA25	105	.	0			c.T1299C						PASS	.						121.0	99.0	106.0					12																	112499043		2203	4300	6503	SO:0001819	synonymous_variant	80018	exon12			TTTCTGATTTTTA	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.1299T>C	chr12.hg19:g.112499043A>G		60.0	0.0	.		48.0	23.0	.	NM_024953	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Silent	SNP	ENST00000261745.4	hg19	CCDS9159.1																																																																																			.	.	.	none		0.453	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953	
EP400	57634	hgsc.bcm.edu	37	12	132547068	132547068	+	Missense_Mutation	SNP	G	G	A	rs68030464|rs367737531|rs60930033		TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr12:132547068G>A	ENST00000333577.4	+	48	8373	c.8264G>A	c.(8263-8265)aGg>aAg	p.R2755K	EP400_ENST00000332482.4_Missense_Mutation_p.R2682K|EP400_ENST00000389561.2_Missense_Mutation_p.R2719K|EP400_ENST00000389562.2_Missense_Mutation_p.R2718K|EP400_ENST00000330386.6_Missense_Mutation_p.R2638K			Q96L91	EP400_HUMAN	E1A binding protein p400	2755	Interaction with ZNF42. {ECO:0000250}.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R2718K(2)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CAGCTTCTCAGgcagcagcag	0.567																																					p.R2719K		Atlas-SNP	.											EP400,NS,carcinoma,0,2	EP400	370	.	2	Substitution - Missense(2)	lung(2)	c.G8156A						PASS	.						48.0	48.0	48.0					12																	132547068		2203	4300	6503	SO:0001583	missense	57634	exon47			TTCTCAGGCAGCA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8264G>A	chr12.hg19:g.132547068G>A	ENSP00000333602:p.Arg2755Lys	67.0	1.0	.		108.0	8.0	.	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	hg19		.	.	.	.	.	.	.	.	.	.	G	15.46	2.840128	0.51057	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62;-2.62	4.89	4.89	0.63831	.	0.266539	0.31542	N	0.007465	D	0.91264	0.7246	L	0.27053	0.805	0.26223	N	0.97913	D;D;D	0.53312	0.959;0.959;0.959	D;D;D	0.65684	0.937;0.937;0.937	D	0.84986	0.0891	10	0.29301	T	0.29	.	17.0403	0.86487	0.0:0.0:1.0:0.0	.	2719;2638;2718	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	K	2755;2719;2718;2682;2638;2719	ENSP00000333602:R2755K;ENSP00000374212:R2719K;ENSP00000374213:R2718K;ENSP00000331737:R2682K;ENSP00000330620:R2638K	ENSP00000330620:R2638K	R	+	2	0	EP400	131113021	1.000000	0.71417	0.878000	0.34440	0.286000	0.27126	5.957000	0.70323	2.236000	0.73375	0.561000	0.74099	AGG	.	.	.	none		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
MEDAG	84935	hgsc.bcm.edu	37	13	31495803	31495803	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr13:31495803G>T	ENST00000380482.4	+	4	932	c.607G>T	c.(607-609)Gat>Tat	p.D203Y	TEX26-AS1_ENST00000586464.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000451495.2_RNA|TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000588425.1_RNA|TEX26-AS1_ENST00000586973.1_RNA|TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000593246.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	203					positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											TGCATTATTTGATTTCTTCTA	0.348																																					p.D203Y		Atlas-SNP	.											.	.	.	.	0			c.G607T						PASS	.						88.0	90.0	89.0					13																	31495803		2203	4300	6503	SO:0001583	missense	84935	exon4			TTATTTGATTTCT	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.607G>T	chr13.hg19:g.31495803G>T	ENSP00000369849:p.Asp203Tyr	118.0	0.0	.		106.0	10.0	.	NM_032849	Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	ENST00000380482.4	hg19	CCDS9338.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427018	0.62733	.	.	ENSG00000102802	ENST00000380482	T	0.60548	0.18	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.67353	0.2884	L	0.32530	0.975	0.43039	D	0.994626	D	0.89917	1.0	D	0.87578	0.998	T	0.70930	-0.4738	10	0.87932	D	0	-23.8071	15.9427	0.79771	0.0:0.0:1.0:0.0	.	203	Q5VYS4	CM033_HUMAN	Y	203	ENSP00000369849:D203Y	ENSP00000369849:D203Y	D	+	1	0	C13orf33	30393803	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	5.741000	0.68638	2.509000	0.84616	0.462000	0.41574	GAT	.	.	.	none		0.348	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849	
FREM2	341640	hgsc.bcm.edu	37	13	39263022	39263022	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr13:39263022C>T	ENST00000280481.7	+	1	1757	c.1541C>T	c.(1540-1542)gCc>gTc	p.A514V		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	514					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GAGCTGGCAGCCGGCCAGGTG	0.602																																					p.A514V		Atlas-SNP	.											.	FREM2	385	.	0			c.C1541T						PASS	.						25.0	25.0	25.0					13																	39263022		2203	4299	6502	SO:0001583	missense	341640	exon1			TGGCAGCCGGCCA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1541C>T	chr13.hg19:g.39263022C>T	ENSP00000280481:p.Ala514Val	70.0	0.0	.		37.0	19.0	.	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985880	0.35036	.	.	ENSG00000150893	ENST00000280481	T	0.21734	1.99	5.4	5.4	0.78164	.	0.174652	0.49916	D	0.000121	T	0.27027	0.0662	M	0.77313	2.365	0.50813	D	0.999898	B	0.31193	0.312	B	0.29524	0.103	T	0.03193	-1.1062	10	0.30854	T	0.27	.	14.0567	0.64774	0.1508:0.8492:0.0:0.0	.	514	Q5SZK8	FREM2_HUMAN	V	514	ENSP00000280481:A514V	ENSP00000280481:A514V	A	+	2	0	FREM2	38161022	1.000000	0.71417	0.192000	0.23308	0.928000	0.56348	4.764000	0.62264	2.538000	0.85594	0.561000	0.74099	GCC	.	.	.	none		0.602	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
PHF11	51131	hgsc.bcm.edu	37	13	50087269	50087269	+	Silent	SNP	A	A	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr13:50087269A>C	ENST00000378319.3	+	3	332	c.291A>C	c.(289-291)tcA>tcC	p.S97S	PHF11_ENST00000357596.3_Silent_p.S58S|PHF11_ENST00000488958.1_Silent_p.S58S	NM_001040443.1	NP_001035533.1	Q9UIL8	PHF11_HUMAN	PHD finger protein 11	97					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(3)|lung(1)	4		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		ATGTGGAATCAGTAAAGAAAG	0.383																																					p.S97S		Atlas-SNP	.											.	PHF11	20	.	0			c.A291C						PASS	.						119.0	117.0	117.0					13																	50087269		2203	4300	6503	SO:0001819	synonymous_variant	51131	exon3			GGAATCAGTAAAG	AB011031	CCDS31975.1, CCDS41887.1	13q14.11	2014-05-20			ENSG00000136147	ENSG00000136147		"""Zinc fingers, PHD-type"""	17024	protein-coding gene	gene with protein product	"""IgE responsiveness (atopic)"""	607796				10508479, 15057823	Standard	XM_005266417		Approved	NY-REN-34, BCAP, IGER	uc001vdb.3	Q9UIL8	OTTHUMG00000016916	ENST00000378319.3:c.291A>C	chr13.hg19:g.50087269A>C		63.0	0.0	.		35.0	7.0	.	NM_001040443	Q5W0A4|Q5W0A6|Q9Y5A2	Silent	SNP	ENST00000378319.3	hg19	CCDS31975.1	.	.	.	.	.	.	.	.	.	.	A	9.279	1.047577	0.19827	.	.	ENSG00000136147	ENST00000426879	.	.	.	4.63	-1.37	0.09056	.	.	.	.	.	T	0.42988	0.1227	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26985	-1.0087	4	.	.	.	-5.0934	3.6917	0.08348	0.5588:0.0:0.2586:0.1826	.	.	.	.	P	52	.	.	Q	+	2	0	PHF11	48985270	0.999000	0.42202	0.990000	0.47175	0.919000	0.55068	0.740000	0.26188	-0.278000	0.09180	-1.161000	0.01788	CAG	.	.	.	none		0.383	PHF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044915.1	NM_016119	
KIAA0586	9786	hgsc.bcm.edu	37	14	59006809	59006809	+	Silent	SNP	C	C	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr14:59006809C>A	ENST00000556134.1	+	31	4679	c.4405C>A	c.(4405-4407)Cgg>Agg	p.R1469R	KIAA0586_ENST00000423743.3_Silent_p.R1440R|KIAA0586_ENST00000261244.5_Silent_p.R1408R|KIAA0586_ENST00000354386.6_Silent_p.R1537R	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	1469					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TGATATGGATCGGACACAAAT	0.299																																					p.R1537R		Atlas-SNP	.											.	KIAA0586	180	.	0			c.C4609A						PASS	.						69.0	67.0	68.0					14																	59006809		1813	4064	5877	SO:0001819	synonymous_variant	9786	exon32			ATGGATCGGACAC	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.4405C>A	chr14.hg19:g.59006809C>A		134.0	0.0	.		99.0	39.0	.	NM_001244189	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Silent	SNP	ENST00000556134.1	hg19	CCDS58321.1																																																																																			.	.	.	none		0.299	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
PCNX	22990	hgsc.bcm.edu	37	14	71514621	71514621	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr14:71514621C>A	ENST00000304743.2	+	22	4704	c.4258C>A	c.(4258-4260)Ctg>Atg	p.L1420M	PCNX_ENST00000439984.3_Missense_Mutation_p.L1309M|PCNX_ENST00000238570.5_Missense_Mutation_p.L1420M	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1420						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CTTTACTGTGCTGTTTTTCAA	0.373																																					p.L1420M		Atlas-SNP	.											.	PCNX	198	.	0			c.C4258A						PASS	.						186.0	165.0	172.0					14																	71514621		2202	4300	6502	SO:0001583	missense	22990	exon22			ACTGTGCTGTTTT	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.4258C>A	chr14.hg19:g.71514621C>A	ENSP00000304192:p.Leu1420Met	58.0	0.0	.		71.0	30.0	.	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	hg19	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.65|17.65	3.441835|3.441835	0.63067|0.63067	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000554691|ENST00000304743;ENST00000238570;ENST00000439984	.|T;T;T	.|0.21932	.|2.37;2.41;1.98	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.121727	.|0.56097	.|D	.|0.000021	.|T	.|0.50735	.|0.1633	M|M	0.86651|0.86651	2.83|2.83	0.58432|0.58432	D|D	0.999995|0.999995	.|D;D;D	.|0.89917	.|1.0;0.997;0.999	.|D;D;D	.|0.87578	.|0.998;0.947;0.996	.|T	.|0.56774	.|-0.7923	.|10	.|0.87932	.|D	.|0	.|.	12.679|12.679	0.56912|0.56912	0.0:0.9242:0.0:0.0757|0.0:0.9242:0.0:0.0757	.|.	.|1420;1309;1420	.|Q96RV3-3;B2RTR6;Q96RV3	.|.;.;PCX1_HUMAN	X|M	478|1420;1420;1309	.|ENSP00000304192:L1420M;ENSP00000238570:L1420M;ENSP00000396617:L1309M	.|ENSP00000238570:L1420M	C|L	+|+	3|1	2|2	PCNX|PCNX	70584374|70584374	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.776000|7.776000	0.85560|0.85560	2.640000|2.640000	0.89533|0.89533	0.591000|0.591000	0.81541|0.81541	TGC|CTG	.	.	.	none		0.373	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
TTLL5	23093	hgsc.bcm.edu	37	14	76156649	76156649	+	Missense_Mutation	SNP	G	G	C	rs374680809		TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr14:76156649G>C	ENST00000298832.9	+	6	691	c.486G>C	c.(484-486)gaG>gaC	p.E162D	TTLL5_ENST00000286650.5_Missense_Mutation_p.E162D|TTLL5_ENST00000557636.1_Missense_Mutation_p.E162D	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	162	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		TGCCAGCTGAGTACGCGGAAT	0.498																																					p.E162D		Atlas-SNP	.											.	TTLL5	102	.	0			c.G486C						PASS	.						124.0	97.0	106.0					14																	76156649		2203	4300	6503	SO:0001583	missense	23093	exon6			AGCTGAGTACGCG	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.486G>C	chr14.hg19:g.76156649G>C	ENSP00000298832:p.Glu162Asp	105.0	0.0	.		59.0	27.0	.	NM_015072	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Missense_Mutation	SNP	ENST00000298832.9	hg19	CCDS32124.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.340819	0.41498	.	.	ENSG00000119685	ENST00000557636;ENST00000286650;ENST00000298832	T;T;T	0.05996	3.36;3.51;3.36	5.26	4.37	0.52481	.	0.096661	0.64402	D	0.000001	T	0.05410	0.0143	N	0.20685	0.6	0.80722	D	1	P;P;P	0.40909	0.478;0.732;0.72	B;P;B	0.46975	0.397;0.533;0.373	T	0.46652	-0.9176	10	0.07990	T	0.79	.	7.3204	0.26523	0.2583:0.0:0.7417:0.0	.	162;162;162	G3V2J9;Q6EMB2;Q6EMB2-3	.;TTLL5_HUMAN;.	D	162	ENSP00000450713:E162D;ENSP00000286650:E162D;ENSP00000298832:E162D	ENSP00000286650:E162D	E	+	3	2	TTLL5	75226402	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	3.128000	0.50492	1.204000	0.43247	0.655000	0.94253	GAG	.	.	.	alt		0.498	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414453.1	NM_015072	
CDAN1	146059	hgsc.bcm.edu	37	15	43023515	43023515	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr15:43023515T>C	ENST00000356231.3	-	12	1777	c.1754A>G	c.(1753-1755)cAg>cGg	p.Q585R		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	585					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CATGAGATGCTGGTTAAACTG	0.547																																					p.Q585R		Atlas-SNP	.											.	CDAN1	70	.	0			c.A1754G						PASS	.						70.0	72.0	72.0					15																	43023515		2203	4299	6502	SO:0001583	missense	146059	exon12			AGATGCTGGTTAA	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.1754A>G	chr15.hg19:g.43023515T>C	ENSP00000348564:p.Gln585Arg	56.0	0.0	.		41.0	18.0	.	NM_138477	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	hg19	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.169073	0.78339	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.87650	-2.28	5.92	5.92	0.95590	.	0.106801	0.64402	D	0.000003	D	0.82930	0.5144	N	0.26042	0.785	0.58432	D	0.999998	P	0.46142	0.873	B	0.44044	0.439	D	0.84011	0.0348	10	0.45353	T	0.12	-20.3702	16.3648	0.83312	0.0:0.0:0.0:1.0	.	585	Q8IWY9	CDAN1_HUMAN	R	585;583	ENSP00000348564:Q585R	ENSP00000267892:Q583R	Q	-	2	0	CDAN1	40810807	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.393000	0.79851	2.263000	0.75096	0.533000	0.62120	CAG	.	.	.	none		0.547	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
VPS13C	54832	hgsc.bcm.edu	37	15	62277127	62277127	+	Silent	SNP	T	T	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr15:62277127T>C	ENST00000261517.5	-	19	1723	c.1650A>G	c.(1648-1650)ccA>ccG	p.P550P	VPS13C_ENST00000249837.3_Silent_p.P507P|VPS13C_ENST00000395898.3_Silent_p.P507P|VPS13C_ENST00000395896.4_Silent_p.P550P	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTAGTATTTCTGGAATATTCT	0.328																																					p.P550P		Atlas-SNP	.											.	VPS13C	506	.	0			c.A1650G						PASS	.						79.0	79.0	79.0					15																	62277127		2203	4300	6503	SO:0001819	synonymous_variant	54832	exon19			TATTTCTGGAATA	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.1650A>G	chr15.hg19:g.62277127T>C		344.0	0.0	.		338.0	122.0	.	NM_020821		Silent	SNP	ENST00000261517.5	hg19	CCDS32257.1																																																																																			.	.	.	none		0.328	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
HAGH	3029	hgsc.bcm.edu	37	16	1869933	1869933	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr16:1869933G>T	ENST00000397356.3	-	4	803	c.397C>A	c.(397-399)Ctg>Atg	p.L133M	HAGH_ENST00000455446.2_Missense_Mutation_p.L133M|HAGH_ENST00000397353.2_Missense_Mutation_p.L85M|HAGH_ENST00000566709.1_Missense_Mutation_p.L85M	NM_005326.4	NP_005317.2	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase	133					glutathione biosynthetic process (GO:0006750)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			kidney(2)|lung(1)|ovary(1)|skin(1)	5		Hepatocellular(780;0.00335)			Glutathione(DB00143)	TTGTGAGTCAGGGCCCCGATA	0.617																																					p.L133M	Pancreas(55;1048 1176 25227 40124 41333)	Atlas-SNP	.											.,1	HAGH	20	.	0			c.C397A						PASS	.						122.0	97.0	105.0					16																	1869933		2199	4300	6499	SO:0001583	missense	3029	exon4			GAGTCAGGGCCCC	X90999	CCDS32366.1, CCDS10447.2, CCDS66900.1	16p13.3	2012-10-02	2003-11-04		ENSG00000063854	ENSG00000063854	3.1.2.6		4805	protein-coding gene	gene with protein product		138760	"""hydroxyacyl glutathione hydrolase"""			3025077, 7327557	Standard	NM_001286249		Approved	GLO2, GLXII, HAGH1	uc002cna.3	Q16775	OTTHUMG00000128662	ENST00000397356.3:c.397C>A	chr16.hg19:g.1869933G>T	ENSP00000380514:p.Leu133Met	80.0	0.0	.		62.0	18.0	.	NM_005326	A8K290|B4DP33|B4DRA7|E7EN93	Missense_Mutation	SNP	ENST00000397356.3	hg19	CCDS10447.2	.	.	.	.	.	.	.	.	.	.	G	13.01	2.110487	0.37242	.	.	ENSG00000063854	ENST00000455446;ENST00000397356;ENST00000397353	D;D;D	0.96334	-3.98;-3.98;-3.98	5.02	3.04	0.35103	Beta-lactamase-like (2);	0.081935	0.48767	D	0.000175	D	0.97225	0.9093	M	0.80422	2.495	0.80722	D	1	D;P;P;P	0.56035	0.974;0.945;0.829;0.877	P;P;B;P	0.61070	0.883;0.726;0.341;0.659	D	0.96217	0.9157	10	0.54805	T	0.06	-8.7923	10.1115	0.42565	0.1539:0.0:0.8461:0.0	.	133;130;85;133	E7EN93;B4DT01;Q16775-2;Q16775	.;.;.;GLO2_HUMAN	M	133;133;85	ENSP00000406552:L133M;ENSP00000380514:L133M;ENSP00000380511:L85M	ENSP00000380511:L85M	L	-	1	2	HAGH	1809934	0.997000	0.39634	0.997000	0.53966	0.127000	0.20565	1.296000	0.33389	0.611000	0.30052	0.561000	0.74099	CTG	.	.	.	none		0.617	HAGH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250548.2	NM_005326	
PLEKHG4	25894	hgsc.bcm.edu	37	16	67320229	67320229	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr16:67320229A>T	ENST00000360461.5	+	14	5030	c.2495A>T	c.(2494-2496)gAt>gTt	p.D832V	PLEKHG4_ENST00000427155.2_Missense_Mutation_p.D832V|PLEKHG4_ENST00000450733.1_Missense_Mutation_p.D751V|PLEKHG4_ENST00000379344.3_Missense_Mutation_p.D832V	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	832	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		CCTCGCTCCGATGCCCTGATG	0.562																																					p.D832V		Atlas-SNP	.											.	PLEKHG4	94	.	0			c.A2495T						PASS	.						158.0	120.0	133.0					16																	67320229		2198	4300	6498	SO:0001583	missense	25894	exon15			GCTCCGATGCCCT	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.2495A>T	chr16.hg19:g.67320229A>T	ENSP00000353646:p.Asp832Val	65.0	0.0	.		54.0	20.0	.	NM_001129728	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Missense_Mutation	SNP	ENST00000360461.5	hg19	CCDS32466.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.332590	0.81801	.	.	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	5.44	5.44	0.79542	Dbl homology (DH) domain (5);	0.000000	0.34338	N	0.004055	T	0.73281	0.3567	M	0.64997	1.995	0.80722	D	1	D;D	0.67145	0.995;0.996	D;D	0.66602	0.909;0.945	T	0.76165	-0.3059	10	0.87932	D	0	.	10.3785	0.44096	0.8444:0.0:0.0:0.1556	.	751;832	Q58EX7-2;Q58EX7	.;PKHG4_HUMAN	V	832;832;832;751	ENSP00000353646:D832V;ENSP00000401118:D832V;ENSP00000368649:D832V;ENSP00000398030:D751V	ENSP00000353646:D832V	D	+	2	0	PLEKHG4	65877730	1.000000	0.71417	0.951000	0.38953	0.919000	0.55068	5.193000	0.65120	2.082000	0.62665	0.459000	0.35465	GAT	.	.	.	none		0.562	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432	
PRPF8	10594	hgsc.bcm.edu	37	17	1564944	1564944	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr17:1564944T>G	ENST00000572621.1	-	25	4428	c.4163A>C	c.(4162-4164)gAg>gCg	p.E1388A	PRPF8_ENST00000304992.6_Missense_Mutation_p.E1388A			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1388	Linker.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GAGTGCGTACTCAGCCCAGAC	0.567																																					p.E1388A		Atlas-SNP	.											.	PRPF8	169	.	0			c.A4163C						PASS	.						105.0	86.0	92.0					17																	1564944		2203	4300	6503	SO:0001583	missense	10594	exon26			GCGTACTCAGCCC	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.4163A>C	chr17.hg19:g.1564944T>G	ENSP00000460348:p.Glu1388Ala	76.0	0.0	.		44.0	16.0	.	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	hg19	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	t	23.6	4.438695	0.83885	.	.	ENSG00000174231	ENST00000304992	D	0.84370	-1.84	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.94318	0.8174	M	0.92970	3.365	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.95339	0.8436	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1388	Q6P2Q9	PRP8_HUMAN	A	1388	ENSP00000304350:E1388A	ENSP00000304350:E1388A	E	-	2	0	PRPF8	1511694	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.013000	0.88655	2.371000	0.80710	0.533000	0.62120	GAG	.	.	.	none		0.567	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
SLC16A11	162515	hgsc.bcm.edu	37	17	6945476	6945476	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr17:6945476A>G	ENST00000308009.1	-	3	1362	c.1025T>C	c.(1024-1026)cTg>cCg	p.L342P	SLC16A11_ENST00000447225.1_Missense_Mutation_p.L310P	NM_153357.1	NP_699188.1	Q8NCK7	MOT11_HUMAN	solute carrier family 16, member 11	342					lipid metabolic process (GO:0006629)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(2)|ovary(1)|skin(2)	9						CGCGGCCAGCAGGGGACCCCC	0.726																																					p.L342P		Atlas-SNP	.											.	SLC16A11	25	.	0			c.T1025C						PASS	.						7.0	11.0	10.0					17																	6945476		2159	4207	6366	SO:0001583	missense	162515	exon3			GCCAGCAGGGGAC	AK074674	CCDS11086.1	17p13.2	2013-07-18	2013-07-18		ENSG00000174326	ENSG00000174326		"""Solute carriers"""	23093	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 11"""	615765	"""solute carrier family 16 (monocarboxylic acid transporters), member 11"""				Standard	NM_153357		Approved	FLJ90193, MCT11	uc002gei.1	Q8NCK7	OTTHUMG00000102087	ENST00000308009.1:c.1025T>C	chr17.hg19:g.6945476A>G	ENSP00000310490:p.Leu342Pro	63.0	0.0	.		56.0	18.0	.	NM_153357		Missense_Mutation	SNP	ENST00000308009.1	hg19	CCDS11086.1	.	.	.	.	.	.	.	.	.	.	A	17.46	3.395782	0.62177	.	.	ENSG00000174326	ENST00000308009;ENST00000447225	T;T	0.62105	0.05;0.05	4.96	4.96	0.65561	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000007	T	0.79347	0.4430	M	0.83603	2.65	0.58432	D	0.999999	D	0.89917	1.0	D	0.75484	0.986	T	0.82629	-0.0363	10	0.87932	D	0	.	12.6448	0.56728	1.0:0.0:0.0:0.0	.	342	Q8NCK7	MOT11_HUMAN	P	342;310	ENSP00000310490:L342P;ENSP00000394449:L310P	ENSP00000310490:L342P	L	-	2	0	SLC16A11	6886200	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	4.801000	0.62532	2.074000	0.62210	0.460000	0.39030	CTG	.	.	.	none		0.726	SLC16A11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219921.1	NM_153357	
NAA38	84316	hgsc.bcm.edu	37	17	7760532	7760532	+	Intron	SNP	C	C	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr17:7760532C>A	ENST00000335155.5	-	2	81				LSMD1_ENST00000570555.1_5'Flank|LSMD1_ENST00000575071.1_Intron|LSMD1_ENST00000333775.5_Missense_Mutation_p.L70F|CYB5D1_ENST00000571846.1_5'Flank|CYB5D1_ENST00000570446.1_5'Flank|LSMD1_ENST00000575208.1_Intron|LSMD1_ENST00000576861.1_Intron|CYB5D1_ENST00000332439.4_5'Flank|LSMD1_ENST00000576384.1_5'UTR|LSMD1_ENST00000575771.1_Intron			Q9BRA0	LSMD1_HUMAN							negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)|nucleus (GO:0005634)				endometrium(1)|lung(2)|ovary(1)	4		all_cancers(10;0.11)|Prostate(122;0.219)				CGGGGTGTAACAAGCGCTCAG	0.697											OREG0024146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L70F	GBM(66;626 1401 29924 42527)	Atlas-SNP	.											.	LSMD1	8	.	0			c.G210T						PASS	.						40.0	43.0	42.0					17																	7760532		2203	4295	6498	SO:0001627	intron_variant	84316	exon1			GTGTAACAAGCGC																												ENST00000335155.5:c.82-16G>T	chr17.hg19:g.7760532C>A		49.0	0.0	.	644	43.0	18.0	.	NM_032356	Q8N4M0	Missense_Mutation	SNP	ENST00000335155.5	hg19		.	.	.	.	.	.	.	.	.	.	C	6.764	0.509883	0.12883	.	.	ENSG00000183011	ENST00000333775	T	0.54675	0.56	4.56	3.59	0.41128	.	0.696299	0.11829	N	0.525380	T	0.35711	0.0941	.	.	.	0.21220	N	0.999753	B	0.21905	0.062	B	0.21360	0.034	T	0.18871	-1.0323	8	.	.	.	.	7.9928	0.30250	0.1821:0.6418:0.1761:0.0	.	70	Q9BRA0-2	.	F	70	ENSP00000332103:L70F	.	L	-	3	2	LSMD1	7701257	0.008000	0.16893	0.153000	0.22517	0.082000	0.17680	1.447000	0.35101	1.282000	0.44496	0.448000	0.29417	TTG	.	.	.	none		0.697	LSMD1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
DSC1	1823	hgsc.bcm.edu	37	18	28712612	28712612	+	Silent	SNP	T	T	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr18:28712612T>C	ENST00000257198.5	-	14	2418	c.2157A>G	c.(2155-2157)acA>acG	p.T719T	DSC1_ENST00000257197.3_Silent_p.T719T|RP11-408H20.2_ENST00000581836.1_RNA|RP11-408H20.3_ENST00000582307.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	719					homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			ATTTCTTGACTGTTCTCTTAG	0.323																																					p.T719T		Atlas-SNP	.											.	DSC1	240	.	0			c.A2157G						PASS	.						118.0	110.0	113.0					18																	28712612		2202	4300	6502	SO:0001819	synonymous_variant	1823	exon14			CTTGACTGTTCTC	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.2157A>G	chr18.hg19:g.28712612T>C		47.0	0.0	.		45.0	16.0	.	NM_004948	Q9HB01	Silent	SNP	ENST00000257198.5	hg19	CCDS11894.1																																																																																			.	.	.	none		0.323	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421	
AMH	268	hgsc.bcm.edu	37	19	2251466	2251466	+	Missense_Mutation	SNP	C	C	T	rs368933314		TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:2251466C>T	ENST00000221496.4	+	5	1215	c.1193C>T	c.(1192-1194)cCg>cTg	p.P398L	MIR4321_ENST00000592276.1_RNA	NM_000479.3	NP_000470	P03971	MIS_HUMAN	anti-Mullerian hormone	398					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			lung(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCTGCCTCCGGCCACAGCC	0.776									Persistant Mullerian Duct Syndrome (type I and II)				C|||	1	0.000199681	0.0	0.0014	5008	,	,		6910	0.0		0.0	False		,,,				2504	0.0				p.P398L		Atlas-SNP	.											.	AMH	12	.	0			c.C1193T						PASS	.						1.0	1.0	1.0					19																	2251466		536	1059	1595	SO:0001583	missense	268	exon5	Familial Cancer Database	PMDS, Persistent Oviduct Syndrome	TGCCTCCGGCCAC	K03474	CCDS12085.1	19p13.3	2014-01-30				ENSG00000104899		"""Endogenous ligands"""	464	protein-coding gene	gene with protein product		600957				3754790, 18784351	Standard	NM_000479		Approved	MIS	uc002lvh.2	P03971		ENST00000221496.4:c.1193C>T	chr19.hg19:g.2251466C>T	ENSP00000221496:p.Pro398Leu	1.0	0.0	.		6.0	4.0	.	NM_000479	O75246|Q6GTN3	Missense_Mutation	SNP	ENST00000221496.4	hg19	CCDS12085.1	.	.	.	.	.	.	.	.	.	.	C	9.562	1.118713	0.20877	.	.	ENSG00000104899	ENST00000221496	D	0.81579	-1.51	4.12	3.04	0.35103	Anti-Mullerian hormone, N-terminal (1);	0.526148	0.17147	U	0.185215	T	0.74390	0.3710	M	0.64997	1.995	0.09310	N	1	B	0.25441	0.126	B	0.16722	0.016	T	0.65434	-0.6169	10	0.52906	T	0.07	-4.6354	7.4131	0.27029	0.0:0.7283:0.1726:0.0991	.	398	P03971	MIS_HUMAN	L	398	ENSP00000221496:P398L	ENSP00000221496:P398L	P	+	2	0	AMH	2202466	0.000000	0.05858	0.001000	0.08648	0.064000	0.16182	0.232000	0.17891	0.675000	0.31264	0.485000	0.47835	CCG	.	.	.	alt		0.776	AMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451276.3	NM_000479	
LRG1	116844	hgsc.bcm.edu	37	19	4538577	4538577	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:4538577G>C	ENST00000306390.6	-	2	879	c.419C>G	c.(418-420)gCc>gGc	p.A140G	CTB-50L17.14_ENST00000586020.1_Intron|LRG1_ENST00000586883.1_5'UTR	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	140					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCAGGGTGGCTGAGGCCTG	0.642																																					p.A140G		Atlas-SNP	.											.	LRG1	25	.	0			c.C419G						PASS	.						30.0	35.0	34.0					19																	4538577		2191	4284	6475	SO:0001583	missense	116844	exon2			AGGGTGGCTGAGG		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.419C>G	chr19.hg19:g.4538577G>C	ENSP00000302621:p.Ala140Gly	39.0	0.0	.		33.0	14.0	.	NM_052972	Q8N4F5|Q96QZ4	Missense_Mutation	SNP	ENST00000306390.6	hg19	CCDS12130.1	.	.	.	.	.	.	.	.	.	.	.	14.52	2.560456	0.45590	.	.	ENSG00000171236	ENST00000306390	T	0.57436	0.4	4.71	2.36	0.29203	.	0.604145	0.13808	N	0.361308	T	0.46698	0.1406	N	0.05306	-0.075	0.28685	N	0.904909	D	0.89917	1.0	D	0.74348	0.983	T	0.34030	-0.9845	10	0.44086	T	0.13	-10.711	7.5892	0.28010	0.0:0.1809:0.6323:0.1868	.	140	P02750	A2GL_HUMAN	G	140	ENSP00000302621:A140G	ENSP00000302621:A140G	A	-	2	0	LRG1	4489577	0.000000	0.05858	0.008000	0.14137	0.349000	0.29174	0.645000	0.24782	1.161000	0.42604	0.655000	0.94253	GCC	.	.	.	none		0.642	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458654.2	NM_052972	
COL5A3	50509	hgsc.bcm.edu	37	19	10085009	10085009	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:10085009A>T	ENST00000264828.3	-	46	3503	c.3418T>A	c.(3418-3420)Ttt>Att	p.F1140I		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1140	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			ACCCCCACAAAGCCTCTGACT	0.612																																					p.F1140I		Atlas-SNP	.											.	COL5A3	243	.	0			c.T3418A						PASS	.						78.0	77.0	78.0					19																	10085009		2203	4300	6503	SO:0001583	missense	50509	exon46			CCACAAAGCCTCT	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3418T>A	chr19.hg19:g.10085009A>T	ENSP00000264828:p.Phe1140Ile	120.0	0.0	.		115.0	44.0	.	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	hg19	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	A	31	5.059224	0.93846	.	.	ENSG00000080573	ENST00000264828	D	0.93189	-3.18	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.91895	0.7434	N	0.16567	0.415	0.46011	D	0.998811	D	0.54207	0.965	P	0.61201	0.885	D	0.91247	0.5026	10	0.35671	T	0.21	.	12.4453	0.55647	1.0:0.0:0.0:0.0	.	1140	P25940	CO5A3_HUMAN	I	1140	ENSP00000264828:F1140I	ENSP00000264828:F1140I	F	-	1	0	COL5A3	9946009	1.000000	0.71417	0.933000	0.37362	0.877000	0.50540	6.360000	0.73064	1.821000	0.53095	0.260000	0.18958	TTT	.	.	.	none		0.612	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
PDE4A	5141	hgsc.bcm.edu	37	19	10578237	10578237	+	Silent	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:10578237G>T	ENST00000352831.6	+	15	2711	c.2601G>T	c.(2599-2601)ggG>ggT	p.G867G	PDE4A_ENST00000440014.2_Silent_p.G806G|PDE4A_ENST00000592685.1_Silent_p.G845G|PDE4A_ENST00000380702.2_Silent_p.G845G|PDE4A_ENST00000344979.3_Silent_p.G628G|PDE4A_ENST00000293683.5_Silent_p.G841G	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	867					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	GGACATTTGGGGAGGACACAT	0.692																																					p.G867G		Atlas-SNP	.											.	PDE4A	236	.	0			c.G2601T						PASS	.						44.0	46.0	45.0					19																	10578237		2158	4226	6384	SO:0001819	synonymous_variant	5141	exon15			ATTTGGGGAGGAC		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.2601G>T	chr19.hg19:g.10578237G>T		42.0	0.0	.		52.0	19.0	.	NM_001111307	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Silent	SNP	ENST00000352831.6	hg19	CCDS45961.1																																																																																			.	.	.	none		0.692	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
SLC5A5	6528	hgsc.bcm.edu	37	19	18001737	18001737	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:18001737G>T	ENST00000222248.3	+	14	2041	c.1694G>T	c.(1693-1695)tGg>tTg	p.W565L		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	565					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)	p.W565*(1)		NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						TTGTTGTGGTGGGACCTCGCA	0.597																																					p.W565L	Melanoma(65;1008 1708 7910 46650)	Atlas-SNP	.											SLC5A5,NS,NS,0,1	SLC5A5	67	.	1	Substitution - Nonsense(1)	NS(1)	c.G1694T						PASS	.						112.0	111.0	111.0					19																	18001737		2203	4300	6503	SO:0001583	missense	6528	exon14			TGTGGTGGGACCT		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1694G>T	chr19.hg19:g.18001737G>T	ENSP00000222248:p.Trp565Leu	52.0	0.0	.		48.0	17.0	.	NM_000453	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	hg19	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977884	0.74360	.	.	ENSG00000105641	ENST00000222248	D	0.84800	-1.9	4.71	4.71	0.59529	.	0.133028	0.56097	D	0.000040	T	0.79907	0.4527	L	0.53249	1.67	0.51012	D	0.999901	P	0.36683	0.565	B	0.24006	0.05	T	0.82890	-0.0233	10	0.66056	D	0.02	.	15.1801	0.72947	0.0:0.0:1.0:0.0	.	565	Q92911	SC5A5_HUMAN	L	565	ENSP00000222248:W565L	ENSP00000222248:W565L	W	+	2	0	SLC5A5	17862737	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	5.732000	0.68563	2.457000	0.83068	0.491000	0.48974	TGG	.	.	.	none		0.597	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
ZNF99	7652	hgsc.bcm.edu	37	19	22941432	22941432	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:22941432A>C	ENST00000596209.1	-	4	1369	c.1279T>G	c.(1279-1281)Tgt>Ggt	p.C427G	ZNF99_ENST00000397104.3_Missense_Mutation_p.C336G	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	427					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CATTCTTCACATTTGCAGGGT	0.373																																					p.C427G		Atlas-SNP	.											.	ZNF99	273	.	0			c.T1279G						PASS	.						49.0	50.0	50.0					19																	22941432		2019	4204	6223	SO:0001583	missense	7652	exon4			CTTCACATTTGCA	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1279T>G	chr19.hg19:g.22941432A>C	ENSP00000472969:p.Cys427Gly	40.0	0.0	.		44.0	21.0	.	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	11.83	1.755283	0.31046	.	.	ENSG00000213973	ENST00000397104	T	0.36878	1.23	1.28	1.28	0.21552	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.62097	0.2400	H	0.97415	4	0.35732	D	0.818029	P	0.41597	0.756	P	0.54174	0.744	T	0.67413	-0.5677	9	0.87932	D	0	.	4.314	0.10984	0.7002:0.0:0.0:0.2998	.	336	A8MXY4	ZNF99_HUMAN	G	336	ENSP00000380293:C336G	ENSP00000380293:C336G	C	-	1	0	ZNF99	22733272	0.726000	0.28059	0.011000	0.14972	0.049000	0.14656	3.018000	0.49625	0.566000	0.29273	0.325000	0.21440	TGT	.	.	.	none		0.373	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
ZNF529	57711	hgsc.bcm.edu	37	19	37038656	37038656	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:37038656T>G	ENST00000591340.1	-	5	962	c.804A>C	c.(802-804)aaA>aaC	p.K268N	ZNF529_ENST00000334116.7_Missense_Mutation_p.K163N	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	268					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	Esophageal squamous(110;0.198)					GTGGAGTAACTTTTCCAACTC	0.343																																					p.K268N		Atlas-SNP	.											.	ZNF529	82	.	0			c.A804C						PASS	.						139.0	137.0	138.0					19																	37038656		1869	4115	5984	SO:0001583	missense	57711	exon6			AGTAACTTTTCCA	AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.804A>C	chr19.hg19:g.37038656T>G	ENSP00000465578:p.Lys268Asn	69.0	0.0	.		60.0	26.0	.	NM_001145649	K7EKE1|Q9H731|Q9HCF7	Missense_Mutation	SNP	ENST00000591340.1	hg19	CCDS54256.1	.	.	.	.	.	.	.	.	.	.	T	1.646	-0.515161	0.04200	.	.	ENSG00000186020	ENST00000334116	T	0.07908	3.15	3.36	2.29	0.28610	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02418	0.0074	N	0.01631	-0.79	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.47341	-0.9125	9	0.12103	T	0.63	.	3.9738	0.09465	0.3664:0.0:0.1882:0.4453	.	163;235	Q6P280-2;Q6P280	.;ZN529_HUMAN	N	268	ENSP00000334695:K268N	ENSP00000334695:K268N	K	-	3	2	ZNF529	41730496	0.000000	0.05858	0.010000	0.14722	0.321000	0.28281	0.374000	0.20501	0.451000	0.26802	-0.468000	0.05107	AAA	.	.	.	none		0.343	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452730.1	NM_020951	
CAPN12	147968	hgsc.bcm.edu	37	19	39233092	39233092	+	Silent	SNP	T	T	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:39233092T>A	ENST00000328867.4	-	3	692	c.384A>T	c.(382-384)ggA>ggT	p.G128G	CAPN12_ENST00000601953.1_5'UTR|CTD-2540F13.2_ENST00000602255.1_RNA	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	128	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			GGAAATCCTGTCCAGGAGGGA	0.602																																					p.G128G		Atlas-SNP	.											.	CAPN12	43	.	0			c.A384T						PASS	.						58.0	51.0	53.0					19																	39233092		2203	4300	6503	SO:0001819	synonymous_variant	147968	exon3			ATCCTGTCCAGGA	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.384A>T	chr19.hg19:g.39233092T>A		289.0	0.0	.		265.0	101.0	.	NM_144691		Silent	SNP	ENST00000328867.4	hg19	CCDS12519.1																																																																																			.	.	.	none		0.602	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
PPP2R1A	5518	hgsc.bcm.edu	37	19	52714553	52714553	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:52714553T>G	ENST00000322088.6	+	4	369	c.311T>G	c.(310-312)gTg>gGg	p.V104G	PPP2R1A_ENST00000462990.1_5'UTR|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.V49G|PPP2R1A_ENST00000473455.2_3'UTR	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	104	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.|SV40 small T antigen binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		GAGACAGTGGTGCGGGACAAG	0.642			Mis		clear cell ovarian carcinoma																																p.V104G		Atlas-SNP	.		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	PPP2R1A	187	.	0			c.T311G						PASS	.						46.0	47.0	47.0					19																	52714553		2203	4300	6503	SO:0001583	missense	5518	exon4			CAGTGGTGCGGGA		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.311T>G	chr19.hg19:g.52714553T>G	ENSP00000324804:p.Val104Gly	76.0	0.0	.		69.0	33.0	.	NM_014225	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	hg19	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.699824	0.48307	.	.	ENSG00000105568	ENST00000454220;ENST00000322088;ENST00000444322	T;T;T	0.41758	0.99;0.99;0.99	4.46	4.46	0.54185	Armadillo-like helical (1);Armadillo-type fold (1);	0.225482	0.29192	N	0.012863	T	0.74816	0.3766	H	0.97240	3.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.99;0.983;0.983	T	0.83177	-0.0091	10	0.87932	D	0	-27.762	12.0292	0.53388	0.0:0.0:0.0:1.0	.	49;104;104	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	G	144;104;49	ENSP00000391905:V144G;ENSP00000324804:V104G;ENSP00000415067:V49G	ENSP00000324804:V104G	V	+	2	0	PPP2R1A	57406365	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	6.983000	0.76180	2.009000	0.58944	0.533000	0.62120	GTG	.	.	.	none		0.642	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
TMC4	147798	hgsc.bcm.edu	37	19	54667538	54667538	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:54667538A>C	ENST00000376591.4	-	8	1344	c.1213T>G	c.(1213-1215)Ttt>Gtt	p.F405V	TMC4_ENST00000301187.4_Missense_Mutation_p.F399V|TMC4_ENST00000416963.1_5'Flank|TMC4_ENST00000476013.2_5'Flank	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	405					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGCAGCACAAAATTGACCCCA	0.572											OREG0003641	type=REGULATORY REGION|Gene=AK124406|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.F405V		Atlas-SNP	.											.	TMC4	89	.	0			c.T1213G						PASS	.						102.0	97.0	99.0					19																	54667538		2203	4300	6503	SO:0001583	missense	147798	exon8			GCACAAAATTGAC	AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.1213T>G	chr19.hg19:g.54667538A>C	ENSP00000365776:p.Phe405Val	115.0	0.0	.	1002	129.0	45.0	.	NM_001145303	Q7Z5M3|Q8N5E4|Q8TBS7	Missense_Mutation	SNP	ENST00000376591.4	hg19	CCDS46174.1	.	.	.	.	.	.	.	.	.	.	A	11.06	1.528689	0.27387	.	.	ENSG00000167608	ENST00000301187;ENST00000376591	T;T	0.58652	0.32;0.32	5.14	3.92	0.45320	.	0.155752	0.56097	D	0.000024	T	0.50973	0.1647	M	0.67953	2.075	0.80722	D	1	B;B	0.19331	0.035;0.008	B;B	0.18263	0.021;0.017	T	0.55205	-0.8177	10	0.51188	T	0.08	-23.9714	6.2359	0.20762	0.8154:0.0:0.1846:0.0	.	405;399	Q7Z404;Q7Z404-1	TMC4_HUMAN;.	V	399;405	ENSP00000301187:F399V;ENSP00000365776:F405V	ENSP00000301187:F399V	F	-	1	0	TMC4	59359350	1.000000	0.71417	0.998000	0.56505	0.233000	0.25261	1.333000	0.33816	2.074000	0.62210	0.418000	0.28097	TTT	.	.	.	none		0.572	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000156164.2		
CENPB	1059	hgsc.bcm.edu	37	20	3766089	3766089	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr20:3766089C>T	ENST00000379751.4	-	1	1248	c.1042G>A	c.(1042-1044)Gcg>Acg	p.A348T	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	348					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						CCCTCTAGCGCGGCCATGGCC	0.677																																					p.A348T		Atlas-SNP	.											.	CENPB	24	.	0			c.G1042A						PASS	.						15.0	13.0	13.0					20																	3766089		2190	4286	6476	SO:0001583	missense	1059	exon1			CTAGCGCGGCCAT	X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1042G>A	chr20.hg19:g.3766089C>T	ENSP00000369075:p.Ala348Thr	61.0	0.0	.		75.0	30.0	.	NM_001810	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	hg19	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	c	14.43	2.534064	0.45073	.	.	ENSG00000125817	ENST00000379751	T	0.43688	0.94	4.04	3.07	0.35406	.	0.000000	0.38548	U	0.001648	T	0.36496	0.0969	L	0.36672	1.1	0.20764	N	0.999853	P	0.49961	0.93	P	0.52066	0.689	T	0.14531	-1.0469	10	0.12103	T	0.63	-10.6982	6.8906	0.24226	0.2009:0.6041:0.195:0.0	.	348	P07199	CENPB_HUMAN	T	348	ENSP00000369075:A348T	ENSP00000369075:A348T	A	-	1	0	CENPB	3714089	0.275000	0.24201	0.311000	0.25182	0.916000	0.54674	3.011000	0.49567	0.647000	0.30713	0.457000	0.33378	GCG	.	.	.	none		0.677	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2	NM_001810	
KIF16B	55614	hgsc.bcm.edu	37	20	16486456	16486456	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr20:16486456T>A	ENST00000354981.2	-	9	1068	c.911A>T	c.(910-912)aAg>aTg	p.K304M	KIF16B_ENST00000355755.3_Missense_Mutation_p.K304M|KIF16B_ENST00000408042.1_Missense_Mutation_p.K304M|KIF16B_ENST00000378003.2_De_novo_Start_InFrame	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	304	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GAAAACTTGCTTCTTCTTTGC	0.363																																					p.K304M		Atlas-SNP	.											.	KIF16B	305	.	0			c.A911T						PASS	.						60.0	57.0	58.0					20																	16486456		2203	4300	6503	SO:0001583	missense	55614	exon9			ACTTGCTTCTTCT	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.911A>T	chr20.hg19:g.16486456T>A	ENSP00000347076:p.Lys304Met	117.0	0.0	.		84.0	32.0	.	NM_001199865	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	ENST00000354981.2	hg19	CCDS13122.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.097820	0.76870	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000408042	T;T;T	0.76968	-1.06;-1.06;-1.06	5.59	5.59	0.84812	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.89044	0.6603	M	0.89534	3.04	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.90593	0.4538	10	0.87932	D	0	.	10.4254	0.44375	0.0:0.0729:0.0:0.9271	.	304;304;304;304	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	M	304	ENSP00000347076:K304M;ENSP00000347995:K304M;ENSP00000384164:K304M	ENSP00000347076:K304M	K	-	2	0	KIF16B	16434456	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	4.962000	0.63687	2.257000	0.74773	0.460000	0.39030	AAG	.	.	.	none		0.363	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
B4GALT5	9334	hgsc.bcm.edu	37	20	48260082	48260082	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr20:48260082T>G	ENST00000371711.4	-	4	657	c.470A>C	c.(469-471)gAt>gCt	p.D157A		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	157					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			AGGCATGCAATCAGAAGGCTT	0.478																																					p.D157A		Atlas-SNP	.											.	B4GALT5	40	.	0			c.A470C						PASS	.						172.0	147.0	156.0					20																	48260082		2203	4300	6503	SO:0001583	missense	9334	exon4			ATGCAATCAGAAG	AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.470A>C	chr20.hg19:g.48260082T>G	ENSP00000360776:p.Asp157Ala	133.0	0.0	.		98.0	29.0	.	NM_004776	E1P625|Q2M394|Q9UJQ8	Missense_Mutation	SNP	ENST00000371711.4	hg19	CCDS13420.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.657772	0.88154	.	.	ENSG00000158470	ENST00000371711	T	0.36340	1.26	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.68988	0.3061	M	0.93283	3.4	0.80722	D	1	D	0.60575	0.988	D	0.69142	0.962	T	0.78430	-0.2207	10	0.72032	D	0.01	-29.6221	15.5342	0.75990	0.0:0.0:0.0:1.0	.	157	O43286	B4GT5_HUMAN	A	157	ENSP00000360776:D157A	ENSP00000360776:D157A	D	-	2	0	B4GALT5	47693489	1.000000	0.71417	0.549000	0.28204	0.993000	0.82548	8.036000	0.88901	2.060000	0.61445	0.459000	0.35465	GAT	.	.	.	none		0.478	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3	NM_004776	
HELZ2	85441	hgsc.bcm.edu	37	20	62190711	62190711	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr20:62190711A>G	ENST00000467148.1	-	19	7907	c.7838T>C	c.(7837-7839)cTt>cCt	p.L2613P	HELZ2_ENST00000427522.2_Missense_Mutation_p.L2044P	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2613	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCAGCGCAGAAGGAGGTGGTC	0.657																																					p.L2613P		Atlas-SNP	.											.	.	.	.	0			c.T7838C						PASS	.						19.0	19.0	19.0					20																	62190711		2195	4289	6484	SO:0001583	missense	85441	exon20			CGCAGAAGGAGGT	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7838T>C	chr20.hg19:g.62190711A>G	ENSP00000417401:p.Leu2613Pro	74.0	0.0	.		64.0	30.0	.	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	hg19	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.131953	0.37630	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.83163	-1.69;-1.69	3.5	3.5	0.40072	.	0.101169	0.40728	N	0.001025	D	0.89146	0.6632	M	0.77103	2.36	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.993;0.999	D	0.89105	0.3492	10	0.87932	D	0	.	8.3308	0.32184	1.0:0.0:0.0:0.0	.	2613;2044	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	P	2044;2613	ENSP00000393257:L2044P;ENSP00000417401:L2613P	ENSP00000393257:L2044P	L	-	2	0	RP4-697K14.7	61661155	0.993000	0.37304	0.961000	0.40146	0.159000	0.22180	4.432000	0.59922	1.481000	0.48307	0.379000	0.24179	CTT	.	.	.	none		0.657	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
NDUFV3	4731	hgsc.bcm.edu	37	21	44324023	44324023	+	Intron	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr21:44324023G>T	ENST00000340344.4	+	3	235				NDUFV3_ENST00000460259.1_3'UTR|NDUFV3_ENST00000354250.2_Missense_Mutation_p.A301S	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		AGGGTTGTCTGCGCCACCGAA	0.517																																					p.A301S		Atlas-SNP	.											.	NDUFV3	23	.	0			c.G901T						PASS	.						68.0	82.0	77.0					21																	44324023		2203	4298	6501	SO:0001627	intron_variant	4731	exon3			TTGTCTGCGCCAC		CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.170-4951G>T	chr21.hg19:g.44324023G>T		103.0	0.0	.		87.0	28.0	.	NM_021075	A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Missense_Mutation	SNP	ENST00000340344.4	hg19	CCDS33573.1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417930	0.42918	.	.	ENSG00000160194	ENST00000354250	T	0.41400	1.0	5.21	-7.83	0.01201	.	0.910228	0.09528	N	0.789978	T	0.15782	0.0380	N	0.24115	0.695	0.09310	N	1	P	0.34462	0.454	B	0.20955	0.032	T	0.09930	-1.0652	10	0.25751	T	0.34	-1.6203	3.1029	0.06331	0.2488:0.2257:0.4144:0.1112	.	301	P56181-2	.	S	301	ENSP00000346196:A301S	ENSP00000346196:A301S	A	+	1	0	NDUFV3	43197092	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.078000	0.01370	-1.555000	0.01697	0.655000	0.94253	GCG	.	.	.	none		0.517	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195448.2		
TRPM2	7226	hgsc.bcm.edu	37	21	45773684	45773684	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr21:45773684G>A	ENST00000397928.1	+	1	546	c.101G>A	c.(100-102)cGg>cAg	p.R34Q	TRPM2_ENST00000300481.9_Missense_Mutation_p.R34Q|TRPM2_ENST00000300482.5_Missense_Mutation_p.R34Q|TRPM2_ENST00000397932.2_Missense_Mutation_p.R34Q	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	34					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TCCAATCTCCGGCGCAGCAAC	0.607																																					p.R34Q		Atlas-SNP	.											.	TRPM2	196	.	0			c.G101A						PASS	.						43.0	36.0	38.0					21																	45773684		2203	4300	6503	SO:0001583	missense	7226	exon1			ATCTCCGGCGCAG	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.101G>A	chr21.hg19:g.45773684G>A	ENSP00000381023:p.Arg34Gln	132.0	0.0	.		117.0	50.0	.	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	hg19	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	G	1.216	-0.628356	0.03610	.	.	ENSG00000142185	ENST00000300482;ENST00000431901;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T;T	0.53206	0.74;0.87;0.74;0.76;0.63	4.4	1.6	0.23607	.	0.523002	0.16025	N	0.233105	T	0.22437	0.0541	N	0.05124	-0.11	0.09310	N	0.999991	B;B	0.18863	0.031;0.018	B;B	0.10450	0.005;0.005	T	0.17440	-1.0369	10	0.26408	T	0.33	-24.3716	6.9762	0.24677	0.3902:0.0:0.6098:0.0	.	34;34	E9PGK7;O94759	.;TRPM2_HUMAN	Q	34	ENSP00000300482:R34Q;ENSP00000393982:R34Q;ENSP00000381023:R34Q;ENSP00000300481:R34Q;ENSP00000381026:R34Q	ENSP00000300481:R34Q	R	+	2	0	TRPM2	44598112	0.005000	0.15991	0.046000	0.18839	0.016000	0.09150	-0.128000	0.10531	0.027000	0.15297	-0.254000	0.11334	CGG	.	.	.	none		0.607	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
SUMO3	6612	hgsc.bcm.edu	37	21	46226870	46226870	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr21:46226870A>C	ENST00000397898.3	-	4	440	c.358T>G	c.(358-360)Tct>Gct	p.S120A	SUMO3_ENST00000411651.2_Missense_Mutation_p.F141C|SUMO3_ENST00000479153.1_5'UTR|SUMO3_ENST00000332859.6_Missense_Mutation_p.F103C|AL773604.8_ENST00000417820.1_RNA					small ubiquitin-like modifier 3											prostate(1)	1				Colorectal(79;0.058)		GGCCCTCTAGAAACTGTGCCC	0.612																																					p.F103C		Atlas-SNP	.											.	SUMO3	11	.	0			c.T308G						PASS	.						58.0	55.0	56.0					21																	46226870		2203	4300	6503	SO:0001583	missense	6612	exon4			CTCTAGAAACTGT		CCDS33587.1, CCDS68220.1	21q22.3	2013-06-05	2013-06-05	2004-05-19	ENSG00000184900	ENSG00000184900			11124	protein-coding gene	gene with protein product		602231	"""SMT3 (suppressor of mif two 3, yeast) homolog 1"", ""SMT3 suppressor of mif two 3 homolog 3 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)"""	SMT3H1		9119407	Standard	NM_006936		Approved	SMT3A	uc002zfz.1	P55854	OTTHUMG00000090256	ENST00000397898.3:c.358T>G	chr21.hg19:g.46226870A>C	ENSP00000380995:p.Ser120Ala	56.0	0.0	.		52.0	23.0	.	NM_006936		Missense_Mutation	SNP	ENST00000397898.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.27|12.27	1.887953|1.887953	0.33348|0.33348	.|.	.|.	ENSG00000184900|ENSG00000184900	ENST00000332859;ENST00000411651|ENST00000397898	T;T|T	0.27256|0.26957	1.82;1.68|1.7	4.8|4.8	-0.774|-0.774	0.10991|0.10991	.|.	.|.	.|.	.|.	.|.	T|T	0.11410|0.11410	0.0278|0.0278	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	P;B|B	0.43352|0.06786	0.804;0.138|0.001	B;B|B	0.37780|0.08055	0.258;0.037|0.003	T|T	0.26052|0.26052	-1.0114|-1.0114	9|9	0.87932|0.44086	D|T	0|0.13	.|.	5.9778|5.9778	0.19391|0.19391	0.6003:0.2568:0.1429:0.0|0.6003:0.2568:0.1429:0.0	.|.	141;103|120	B4DUW4;P55854|A8MUA9	.;SUMO3_HUMAN|.	C|A	103;141|120	ENSP00000330343:F103C;ENSP00000409666:F141C|ENSP00000380995:S120A	ENSP00000330343:F103C|ENSP00000380995:S120A	F|S	-|-	2|1	0|0	SUMO3|SUMO3	45051298|45051298	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	0.535000|0.535000	0.23114|0.23114	-0.196000|-0.196000	0.10366|0.10366	0.533000|0.533000	0.62120|0.62120	TTC|TCT	.	.	.	none		0.612	SUMO3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000206561.1		
GNAZ	2781	hgsc.bcm.edu	37	22	23465473	23465473	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr22:23465473T>C	ENST00000248996.4	+	3	1589	c.923T>C	c.(922-924)tTt>tCt	p.F308S	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	308					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		CAGCGGCAGTTTGAAGACCTG	0.572																																					p.F308S		Atlas-SNP	.											.	GNAZ	45	.	0			c.T923C						PASS	.						128.0	100.0	109.0					22																	23465473		2203	4300	6503	SO:0001583	missense	2781	exon3			GGCAGTTTGAAGA		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.923T>C	chr22.hg19:g.23465473T>C	ENSP00000248996:p.Phe308Ser	87.0	0.0	.		76.0	34.0	.	NM_002073	B2R6C1|Q4QRJ6	Missense_Mutation	SNP	ENST00000248996.4	hg19	CCDS13804.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.849238	0.91277	.	.	ENSG00000128266	ENST00000248996;ENST00000456059	D	0.92199	-2.99	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.97841	0.9291	H	0.99156	4.45	0.80722	D	1	D	0.64830	0.994	D	0.77557	0.99	D	0.99229	1.0881	10	0.87932	D	0	.	14.4404	0.67311	0.0:0.0:0.0:1.0	.	308	P19086	GNAZ_HUMAN	S	308;256	ENSP00000248996:F308S	ENSP00000248996:F308S	F	+	2	0	GNAZ	21795473	1.000000	0.71417	0.997000	0.53966	0.867000	0.49689	7.824000	0.86668	2.085000	0.62840	0.533000	0.62120	TTT	.	.	.	none		0.572	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1	NM_002073	
TNRC6B	23112	hgsc.bcm.edu	37	22	40521834	40521834	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr22:40521834G>T	ENST00000301923.9	+	3	315	c.13G>T	c.(13-15)Gag>Tag	p.E5*	TNRC6B_ENST00000402203.1_Nonsense_Mutation_p.E5*	NM_001024843.1	NP_001020014.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	0	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						GCAAACCAATGAGGGAGAAGT	0.388																																					p.E5X		Atlas-SNP	.											.	TNRC6B	195	.	0			c.G13T						PASS	.						77.0	69.0	71.0					22																	40521834		1835	4086	5921	SO:0001587	stop_gained	23112	exon3			ACCAATGAGGGAG	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000301923.9:c.13G>T	chr22.hg19:g.40521834G>T	ENSP00000306759:p.Glu5*	142.0	0.0	.		122.0	44.0	.	NM_001024843	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Nonsense_Mutation	SNP	ENST00000301923.9	hg19	CCDS46712.1	.	.	.	.	.	.	.	.	.	.	G	37	6.303463	0.97458	.	.	ENSG00000100354	ENST00000441751;ENST00000301923;ENST00000402203	.	.	.	5.06	5.06	0.68205	.	0.000000	0.30076	U	0.010480	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.2021	0.86908	0.0:0.0:1.0:0.0	.	.	.	.	X	5	.	ENSP00000306759:E5X	E	+	1	0	TNRC6B	38851780	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.003000	0.70701	2.333000	0.79357	0.655000	0.94253	GAG	.	.	.	none		0.388	TNRC6B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321393.1		
PKDREJ	10343	hgsc.bcm.edu	37	22	46658026	46658026	+	Silent	SNP	G	G	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr22:46658026G>T	ENST00000253255.5	-	1	1193	c.1194C>A	c.(1192-1194)gtC>gtA	p.V398V		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	398	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CGGGGTGACAGACTTCCTTGC	0.532																																					p.V398V		Atlas-SNP	.											.	PKDREJ	195	.	0			c.C1194A						PASS	.						89.0	94.0	92.0					22																	46658026		2203	4300	6503	SO:0001819	synonymous_variant	10343	exon1			GTGACAGACTTCC	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.1194C>A	chr22.hg19:g.46658026G>T		91.0	0.0	.		83.0	39.0	.	NM_006071	B1AJY3|O95850	Silent	SNP	ENST00000253255.5	hg19	CCDS14073.1																																																																																			.	.	.	none		0.532	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
MOV10L1	54456	hgsc.bcm.edu	37	22	50528560	50528560	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr22:50528560A>T	ENST00000262794.5	+	1	126	c.43A>T	c.(43-45)Acg>Tcg	p.T15S	MOV10L1_ENST00000545383.1_Missense_Mutation_p.T15S|MOV10L1_ENST00000395843.1_De_novo_Start_InFrame|MOV10L1_ENST00000395858.3_Missense_Mutation_p.T15S|MOV10L1_ENST00000540615.1_5'Flank	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	15					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CTTCTGGAGGACGGCGGACAC	0.766																																					p.T15S		Atlas-SNP	.											.	MOV10L1	238	.	0			c.A43T						PASS	.						7.0	7.0	7.0					22																	50528560		1561	2879	4440	SO:0001583	missense	54456	exon1			TGGAGGACGGCGG	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.43A>T	chr22.hg19:g.50528560A>T	ENSP00000262794:p.Thr15Ser	43.0	0.0	.		47.0	9.0	.	NM_018995	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	ENST00000262794.5	hg19	CCDS14084.1	.	.	.	.	.	.	.	.	.	.	A	9.737	1.163791	0.21538	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858	D;D;T	0.83837	-1.77;-1.77;-1.36	4.73	0.995	0.19838	.	0.514876	0.18784	N	0.131244	T	0.68787	0.3039	N	0.19112	0.55	0.80722	D	1	B;B	0.16396	0.017;0.017	B;B	0.09377	0.004;0.004	T	0.56763	-0.7925	10	0.26408	T	0.33	-11.1627	11.8849	0.52596	0.7766:0.2234:0.0:0.0	.	15;15	A8MXC6;Q9BXT6	.;M10L1_HUMAN	S	15	ENSP00000438978:T15S;ENSP00000262794:T15S;ENSP00000379199:T15S	ENSP00000262794:T15S	T	+	1	0	MOV10L1	48870687	0.987000	0.35691	0.666000	0.29783	0.224000	0.24922	1.078000	0.30754	0.249000	0.21456	0.460000	0.39030	ACG	.	.	.	none		0.766	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995	
ATP1B4	23439	hgsc.bcm.edu	37	X	119504978	119504978	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chrX:119504978T>C	ENST00000218008.3	+	4	532	c.475T>C	c.(475-477)Ttc>Ctc	p.F159L	ATP1B4_ENST00000361319.3_Missense_Mutation_p.F155L|ATP1B4_ENST00000539306.1_Missense_Mutation_p.F116L	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	159					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						GATCAGACCCTTCGCCCATAG	0.413																																					p.F159L		Atlas-SNP	.											.	ATP1B4	61	.	0			c.T475C						PASS	.						133.0	109.0	117.0					X																	119504978		2203	4300	6503	SO:0001583	missense	23439	exon4			AGACCCTTCGCCC	AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.475T>C	chrX.hg19:g.119504978T>C	ENSP00000218008:p.Phe159Leu	72.0	0.0	.		40.0	35.0	.	NM_001142447	Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	hg19	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	T	13.30	2.194981	0.38806	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.28255	1.62;1.62;1.62	5.51	5.51	0.81932	.	0.144564	0.64402	D	0.000005	T	0.14743	0.0356	N	0.02751	-0.505	0.40189	D	0.977385	P;B;P;P	0.44877	0.845;0.261;0.729;0.683	B;B;B;B	0.43331	0.416;0.344;0.277;0.181	T	0.16837	-1.0389	10	0.11485	T	0.65	-16.9285	12.2846	0.54786	0.0:0.0:0.0:1.0	.	116;124;159;155	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	L	159;155;116	ENSP00000218008:F159L;ENSP00000355346:F155L;ENSP00000443334:F116L	ENSP00000218008:F159L	F	+	1	0	ATP1B4	119389006	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.467000	0.53078	1.835000	0.53391	0.441000	0.28932	TTC	.	.	.	none		0.413	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447	
FKBP1B	2281	hgsc.bcm.edu	37	2	24283781	24283782	+	Frame_Shift_Del	DEL	AG	AG	-	rs146963692		TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr2:24283781_24283782delAG	ENST00000380986.4	+	3	319_320	c.183_184delAG	c.(181-186)gaagagfs	p.EE61fs	FKBP1B_ENST00000380991.4_Frame_Shift_Del_p.EE61fs|FKBP1B_ENST00000452109.1_Frame_Shift_Del_p.EE32fs	NM_004116.3|NM_054033.2	NP_004107.1|NP_473374.1	P68106	FKB1B_HUMAN	FK506 binding protein 1B, 12.6 kDa	61	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				'de novo' protein folding (GO:0006458)|calcium ion transmembrane transport (GO:0070588)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|chaperone-mediated protein folding (GO:0061077)|cytosolic calcium ion homeostasis (GO:0051480)|insulin secretion (GO:0030073)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neuronal action potential propagation (GO:0019227)|positive regulation of axon regeneration (GO:0048680)|positive regulation of sequestering of calcium ion (GO:0051284)|protein maturation by protein folding (GO:0022417)|protein peptidyl-prolyl isomerization (GO:0000413)|protein refolding (GO:0042026)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to redox state (GO:0051775)|response to vitamin E (GO:0033197)|smooth muscle contraction (GO:0006939)|T cell proliferation (GO:0042098)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	calcium channel inhibitor activity (GO:0019855)|cyclic nucleotide binding (GO:0030551)|FK506 binding (GO:0005528)|ion channel binding (GO:0044325)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|receptor binding (GO:0005102)			lung(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGGTTTTGAAGAGGGTGCAGC	0.49											OREG0014491	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.61_61del		Atlas-Indel,Pindel	.											.	FKBP1B	11	.	0			c.182_183del						PASS	.																																			SO:0001589	frameshift_variant	2281	exon3			.	D38037	CCDS1706.1, CCDS33153.1	2p23.3	2013-03-20	2002-08-29		ENSG00000119782	ENSG00000119782			3712	protein-coding gene	gene with protein product	"""calstabin 2"""	600620	"""FK506-binding protein 1B (12.6 kD)"""	FKBP1L		7513996	Standard	NM_004116		Approved	OTK4, FKBP12.6, PPIase, FKBP9	uc002rer.3	P68106	OTTHUMG00000151889	ENST00000380986.4:c.183_184delAG	chr2.hg19:g.24283783_24283784delAG	ENSP00000370373:p.Glu61fs	106.0	0.0	0	770	73.0	22.0	0.30137	NM_004116	Q13664|Q16645|Q53TM2|Q9BQ40	Frame_Shift_Del	DEL	ENST00000380986.4	hg19	CCDS1706.1																																																																																			.	.	.	none		0.490	FKBP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207622.1	NM_004116	
ZNF469	84627	hgsc.bcm.edu	37	16	88499104	88499104	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr16:88499104delC	ENST00000437464.1	+	2	5142	c.5142delC	c.(5140-5142)agcfs	p.S1714fs	ZNF469_ENST00000565624.1_Frame_Shift_Del_p.S1742fs	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1714					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CAAAGTGCAGCCCCGACCAGG	0.587																																					p.S1714fs		Atlas-Indel,Pindel	.											.	ZNF469	121	.	0			c.5141delG						PASS	.						45.0	45.0	45.0					16																	88499104		692	1591	2283	SO:0001589	frameshift_variant	84627	exon2			.	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.5142delC	chr16.hg19:g.88499104delC	ENSP00000402343:p.Ser1714fs	71.0	0.0	0		56.0	26.0	0.464286	NM_001127464		Frame_Shift_Del	DEL	ENST00000437464.1	hg19	CCDS45544.1																																																																																			.	.	.	none		0.587	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
PMS2	5395	hgsc.bcm.edu	37	7	6018319	6018320	+	Frame_Shift_Del	DEL	GT	GT	-	rs141893001		TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr7:6018319_6018320delGT	ENST00000265849.7	-	13	2287_2288	c.2182_2183delAC	c.(2182-2184)actfs	p.T728fs	PMS2_ENST00000382321.4_Frame_Shift_Del_p.T327fs|PMS2_ENST00000406569.3_Intron|PMS2_ENST00000441476.2_Frame_Shift_Del_p.T622fs	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	728					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TAAGTTGAGAGTCTGAGGTCTG	0.307			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.728_728del		Atlas-INDEL	.	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	PMS2	88	.	0			c.2183_2184del						PASS	.			85,4141		3,79,2031						2.0	1.0			33	1,8179		0,1,4089	no	frameshift	PMS2	NM_000535.5		3,80,6120	A1A1,A1R,RR		0.0122,2.0114,0.6932				86,12320				SO:0001589	frameshift_variant	5395	exon13	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	.		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.2182_2183delAC	chr7.hg19:g.6018319_6018320delGT	ENSP00000265849:p.Thr728fs	226.0	0.0	0		517.0	183.0	0.353965	NM_000535	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Frame_Shift_Del	DEL	ENST00000265849.7	hg19	CCDS5343.1																																																																																			.	.	.	none		0.307	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
WSCD1	23302	hgsc.bcm.edu	37	17	6023951	6023951	+	Frame_Shift_Del	DEL	G	G	-	rs554473306		TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr17:6023951delG	ENST00000574946.1	+	9	2088	c.1698delG	c.(1696-1698)acgfs	p.T566fs	WSCD1_ENST00000573634.1_Frame_Shift_Del_p.T450fs|WSCD1_ENST00000317744.5_Frame_Shift_Del_p.T566fs|WSCD1_ENST00000539421.1_Frame_Shift_Del_p.T566fs|WSCD1_ENST00000574232.1_Frame_Shift_Del_p.T566fs			Q658N2	WSCD1_HUMAN	WSC domain containing 1	566						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						ACAACTGGACGGGGCTGCCCA	0.662																																					p.T566fs		Atlas-Indel,Pindel	.											.	WSCD1	84	.	0			c.1697delC						PASS	.						44.0	49.0	47.0					17																	6023951		2203	4300	6503	SO:0001589	frameshift_variant	23302	exon9			.		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1698delG	chr17.hg19:g.6023951delG	ENSP00000460825:p.Thr566fs	55.0	0.0	0		35.0	13.0	0.371429	NM_015253	A8K0N8|D3DTM3|O60276|Q96G45	Frame_Shift_Del	DEL	ENST00000574946.1	hg19	CCDS32538.1																																																																																			.	.	.	none		0.662	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253	
PDE4A	5141	hgsc.bcm.edu	37	19	10572554	10572554	+	Splice_Site	DEL	T	T	-			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr19:10572554delT	ENST00000352831.6	+	13	1732	c.1622delT	c.(1621-1623)gtg>gg	p.V541fs	PDE4A_ENST00000440014.2_Splice_Site_p.V480fs|PDE4A_ENST00000592685.1_Splice_Site_p.V519fs|PDE4A_ENST00000380702.2_Splice_Site_p.V519fs|PDE4A_ENST00000344979.3_Splice_Site_p.V302fs|PDE4A_ENST00000293683.5_Splice_Site_p.V515fs	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	541	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	TGCCCGCAGGTGCTGGCCACG	0.637																																					p.V541fs		Atlas-Indel,Pindel	.											.	PDE4A	236	.	0			c.1621delG						PASS	.						70.0	64.0	66.0					19																	10572554		2203	4300	6503	SO:0001630	splice_region_variant	5141	exon13			.		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1621-1T>-	chr19.hg19:g.10572554delT		33.0	0.0	0		57.0	21.0	0.368421	NM_001111307	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Frame_Shift_Del	DEL	ENST00000352831.6	hg19	CCDS45961.1																																																																																			.	.	.	none		0.637	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		Frame_Shift_Del
INPP5F	22876	hgsc.bcm.edu	37	10	121567442	121567445	+	Splice_Site	DEL	TAGC	TAGC	-			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	TAGC	TAGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr10:121567442_121567445delTAGC	ENST00000361976.2	+	13	1606_1608	c.1440_1442delTAGC	c.(1438-1443)catagc>cac	p.S481fs		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	792	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		TGTTCATTTTAGCTGAAAAAATTA	0.387																																					.		Atlas-INDEL	.											.	INPP5F	112	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	22876	.			.	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1441-1TAGC>-	chr10.hg19:g.121567442_121567445delTAGC		91.0	0.0	0		53.0	17.0	0.320755	.	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Splice_Site	DEL	ENST00000361976.2	hg19	CCDS7616.1																																																																																			.	.	.	none		0.387	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	NM_014937	Frame_Shift_Del
WDR91	29062	hgsc.bcm.edu	37	7	134890789	134890789	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr7:134890789delT	ENST00000354475.4	-	5	647	c.616delA	c.(616-618)atcfs	p.I206fs	WDR91_ENST00000344400.5_Frame_Shift_Del_p.I206fs|WDR91_ENST00000485942.1_5'UTR|WDR91_ENST00000423565.1_Frame_Shift_Del_p.I171fs	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	206										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						AGTCGGTGGATTTCAGCTTGC	0.507																																					p.I206fs		Pindel	.											.	WDR91	82	.	0			c.617delT						PASS	.						270.0	237.0	248.0					7																	134890789		2203	4300	6503	SO:0001589	frameshift_variant	29062	exon5			.	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.616delA	chr7.hg19:g.134890789delT	ENSP00000346466:p.Ile206fs	147.0	0.0	.		140.0	59.0	0.421	NM_014149	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Frame_Shift_Del	DEL	ENST00000354475.4	hg19	CCDS34758.1																																																																																			.	.	.	none		0.507	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
FRMPD2	143162	hgsc.bcm.edu	37	10	49380990	49380999	+	Splice_Site	DEL	ATCTGTCACT	ATCTGTCACT	-	rs367862519|rs138229835	byFrequency	TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	ATCTGTCACT	ATCTGTCACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr10:49380990_49380999delATCTGTCACT	ENST00000374201.3	-	25	3515_3524	c.3213_3222delAGTGACAGAT	c.(3211-3222)tcagtgacagat>tc	p.SVTD1071fs	FRMPD2_ENST00000305531.3_Splice_Site_p.SVTD1046fs|FRMPD2_ENST00000474573.1_Splice_Site_p.SVTD23fs|FRMPD2_ENST00000463706.1_5'UTR|FRMPD2_ENST00000407470.4_Splice_Site_p.SVTD1039fs	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	1071					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CCCTCTCACCATCTGTCACTGAGACACAGC	0.5																																					p.1072_1075del		Pindel	.											.	FRMPD2	157	.	0			c.3214_3223del						PASS	.																																			SO:0001630	splice_region_variant	143162	exon25			.	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.3223+1AGTGACAGAT>-	chr10.hg19:g.49380990_49380999delATCTGTCACT		589.0	0.0	.		493.0	23.0	0.047	NM_001018071	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Frame_Shift_Del	DEL	ENST00000374201.3	hg19	CCDS31195.1																																																																																			.	.	.	none		0.500	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	Frame_Shift_Del
INPP5F	22876	hgsc.bcm.edu	37	10	121567442	121567447	+	Splice_Site	DEL	TTTAGC	TTTAGC	-			TCGA-2Z-A9JL-01A-11D-A42J-10	TCGA-2Z-A9JL-10A-01D-A42M-10	TTTAGC	TTTAGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d76bb38d-3ef3-4a37-bc21-5b7bc290d112	27a1d440-82fb-44f6-b007-5ad71c7b4cc1	g.chr10:121567442_121567447delTTTAGC	ENST00000361976.2	+	13	1606_1610	c.1440_1444delTTTAGC	c.(1438-1446)catttagca>caca	p.LA481del		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	792	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		TGTTCATTTTAGCTGAAAAAATTAGG	0.388																																					.		Pindel	.											.	INPP5F	112	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	22876	.			.	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1441-1TTTAGC>-	chr10.hg19:g.121567442_121567447delTTTAGC		94.0	0.0	.		54.0	12.0	0.222	.	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Splice_Site	DEL	ENST00000361976.2	hg19	CCDS7616.1																																																																																			.	.	.	none		0.388	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	NM_014937	In_Frame_Del
