#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SDF4	51150	hgsc.bcm.edu	37	1	1163850	1163850	+	Silent	SNP	G	G	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr1:1163850G>T	ENST00000360001.6	-	2	586	c.324C>A	c.(322-324)tcC>tcA	p.S108S	SDF4_ENST00000545427.1_Silent_p.S108S|SDF4_ENST00000459994.2_5'UTR|SDF4_ENST00000263741.7_Silent_p.S108S			Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4	108	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion-dependent exocytosis (GO:0017156)|cerebellum development (GO:0021549)|fat cell differentiation (GO:0045444)|response to ethanol (GO:0045471)|UV protection (GO:0009650)|zymogen granule exocytosis (GO:0070625)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|late endosome (GO:0005770)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		GCACCTACTTGGAAAAGATGA	0.667																																					p.S108S		Atlas-SNP	.											.	SDF4	50	.	0			c.C324A						PASS	.						27.0	32.0	31.0					1																	1163850		2201	4298	6499	SO:0001819	synonymous_variant	51150	exon2			CTACTTGGAAAAG		CCDS12.1, CCDS30553.1	1p36.33	2013-01-10			ENSG00000078808	ENSG00000078808		"""EF-hand domain containing"""	24188	protein-coding gene	gene with protein product	"""calcium binding protein"""	614282				9254016, 8609160	Standard	NM_016176		Approved	Cab45	uc001adh.4	Q9BRK5	OTTHUMG00000001812	ENST00000360001.6:c.324C>A	chr1.hg19:g.1163850G>T		49.0	0.0	.		48.0	14.0	.	NM_016547	B1AME5|B1AME6|B2RDF1|B4DSM1|Q53G52|Q53HQ9|Q8NBQ3|Q96AA1|Q9NZP7|Q9UN53	Silent	SNP	ENST00000360001.6	hg19	CCDS30553.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055142	0.36277	.	.	ENSG00000078808	ENST00000403997	.	.	.	3.86	1.73	0.24493	.	.	.	.	.	T	0.56016	0.1957	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50849	-0.8779	4	.	.	.	-24.5532	8.5179	0.33257	0.0957:0.0:0.7422:0.1621	.	.	.	.	K	43	.	.	Q	-	1	0	SDF4	1153713	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	2.612000	0.46343	0.828000	0.34709	0.511000	0.50034	CAA	.	.	.	none		0.667	SDF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005064.1	NM_016176	
KNCN	148930	hgsc.bcm.edu	37	1	47014904	47014905	+	Missense_Mutation	DNP	GG	GG	TC	rs191194559		TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr1:47014904_47014905GG>TC	ENST00000481882.2	-	3	566_567	c.255_256CC>GA	c.(253-258)gaCCac>gaGAac	p.85_86DH>EN	KNCN_ENST00000524908.1_5'UTR|KNCN_ENST00000396314.3_Missense_Mutation_p.62_63DH>EN|MKNK1-AS1_ENST00000602433.1_RNA			A6PVL3	KNCN_HUMAN	kinocilin	85						apical plasma membrane (GO:0016324)|ciliary basal body (GO:0036064)|cuticular plate (GO:0032437)|integral component of membrane (GO:0016021)|kinocilium (GO:0060091)|neuronal cell body (GO:0043025)				central_nervous_system(1)|endometrium(1)|lung(1)|ovary(1)	4	Acute lymphoblastic leukemia(166;0.155)					CCTTCCCCGTGGTCTGCCCCTG	0.5																																					p.H63N|p.D62E		Atlas-SNP	.											.	KNCN	7	.	0			c.C187A|c.C186G						PASS	.																																			SO:0001583	missense	148930	exon2			CCCCGTGGTCTGC|CCCGTGGTCTGCC	AK056573	CCDS44133.1	1p33	2014-02-12	2006-10-26		ENSG00000162456	ENSG00000162456			26488	protein-coding gene	gene with protein product		611455				15855039	Standard	NM_001097611		Approved	FLJ32011, KINO, L5	uc001cpy.2	A6PVL3	OTTHUMG00000007987	ENST00000481882.2:c.255_256delinsTC	chr1.hg19:g.47014904_47014905delinsTC	ENSP00000419705:p.D85_H86delinsEN	113.0	0.0	.		101.0	30.0	.	NM_001097611	A8MXE3	Missense_Mutation	SNP	ENST00000481882.2	hg19																																																																																				.	.|G|1.000;T|0.000	.	none|alt		0.500	KNCN-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000316334.2	NM_182516	
SLC44A3	126969	hgsc.bcm.edu	37	1	95323000	95323000	+	Silent	SNP	C	C	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr1:95323000C>A	ENST00000271227.6	+	10	1284	c.1182C>A	c.(1180-1182)atC>atA	p.I394I	SLC44A3_ENST00000532427.1_Silent_p.I314I|SLC44A3_ENST00000529450.1_Silent_p.I362I|SLC44A3_ENST00000467909.1_Silent_p.I346I|SLC44A3_ENST00000530397.1_3'UTR|RP11-465K1.2_ENST00000422162.1_RNA|SLC44A3_ENST00000527077.1_Silent_p.I326I|SLC44A3_ENST00000446120.2_Silent_p.I358I	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	394					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	GTGAATTCATCCTTGCGTGCC	0.443																																					p.I394I		Atlas-SNP	.											.	SLC44A3	109	.	0			c.C1182A						PASS	.						190.0	172.0	178.0					1																	95323000		2203	4300	6503	SO:0001819	synonymous_variant	126969	exon10			ATTCATCCTTGCG	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1182C>A	chr1.hg19:g.95323000C>A		121.0	0.0	.		114.0	32.0	.	NM_001114106	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Silent	SNP	ENST00000271227.6	hg19	CCDS44176.1																																																																																			.	.	.	none		0.443	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
VANGL1	81839	hgsc.bcm.edu	37	1	116206833	116206833	+	Silent	SNP	G	G	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr1:116206833G>T	ENST00000355485.2	+	4	1027	c.756G>T	c.(754-756)ctG>ctT	p.L252L	VANGL1_ENST00000310260.3_Silent_p.L252L|VANGL1_ENST00000369509.1_Silent_p.L252L|VANGL1_ENST00000369510.4_Silent_p.L250L	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	252					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TGTTCACGCTGCAGGTGGTCC	0.577																																					p.L252L		Atlas-SNP	.											.	VANGL1	65	.	0			c.G756T						PASS	.						60.0	57.0	58.0					1																	116206833		2203	4300	6503	SO:0001819	synonymous_variant	81839	exon4			CACGCTGCAGGTG	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.756G>T	chr1.hg19:g.116206833G>T		36.0	0.0	.		39.0	4.0	.	NM_138959	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Silent	SNP	ENST00000355485.2	hg19	CCDS883.1																																																																																			.	.	.	none		0.577	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033096.1		
LCE2B	26239	hgsc.bcm.edu	37	1	152659505	152659505	+	Silent	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr1:152659505C>T	ENST00000368780.3	+	2	240	c.186C>T	c.(184-186)ggC>ggT	p.G62G	LCE2B_ENST00000417924.2_Silent_p.G62G	NM_014357.4	NP_055172.1	O14633	LCE2B_HUMAN	late cornified envelope 2B	62	Cys-rich.				epidermis development (GO:0008544)|keratinization (GO:0031424)					endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	11	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCTGGGGGCTGCTGCAACT	0.662																																					p.G62G		Atlas-SNP	.											.	LCE2B	40	.	0			c.C186T						PASS	.						89.0	105.0	99.0					1																	152659505		2203	4300	6503	SO:0001819	synonymous_variant	26239	exon2			TGGGGGCTGCTGC	BI670514	CCDS1020.1	1q21	2008-02-05	2004-10-11	2004-10-15	ENSG00000159455	ENSG00000159455		"""Late cornified envelopes"""	16610	protein-coding gene	gene with protein product		612610	"""small proline rich-like (epidermal differentiation complex) 1B"""	SPRL1B		11698679, 9344646	Standard	NM_014357		Approved	LEP10, XP5	uc001fai.3	O14633	OTTHUMG00000012404	ENST00000368780.3:c.186C>T	chr1.hg19:g.152659505C>T		110.0	0.0	.		115.0	42.0	.	NM_014357	Q5TA80	Silent	SNP	ENST00000368780.3	hg19	CCDS1020.1																																																																																			.	.	.	none		0.662	LCE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034524.1	NM_014357	
ISG20L2	81875	hgsc.bcm.edu	37	1	156696838	156696838	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr1:156696838T>C	ENST00000313146.6	-	1	1389	c.607A>G	c.(607-609)Att>Gtt	p.I203V	ISG20L2_ENST00000472824.2_5'Flank|RRNAD1_ENST00000524343.1_5'Flank|ISG20L2_ENST00000368219.1_Missense_Mutation_p.I203V|RRNAD1_ENST00000368218.4_5'Flank|RRNAD1_ENST00000368216.4_5'Flank	NM_030980.1	NP_112242.1	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene 20kDa-like 2	203	Exonuclease.				ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TAGTTGACAATGCTACATCGA	0.527											OREG0013885	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I203V		Atlas-SNP	.											.	ISG20L2	43	.	0			c.A607G						PASS	.						187.0	148.0	161.0					1																	156696838		2203	4300	6503	SO:0001583	missense	81875	exon1			TGACAATGCTACA	AK095697	CCDS1153.1	1q23.1	2013-10-11			ENSG00000143319	ENSG00000143319			25745	protein-coding gene	gene with protein product		611930				18065403	Standard	NM_030980		Approved	FLJ12671	uc001fps.1	Q9H9L3	OTTHUMG00000041301	ENST00000313146.6:c.607A>G	chr1.hg19:g.156696838T>C	ENSP00000323424:p.Ile203Val	93.0	0.0	.	1780	91.0	27.0	.	NM_030980	D3DVC6|Q64KA2	Missense_Mutation	SNP	ENST00000313146.6	hg19	CCDS1153.1	.	.	.	.	.	.	.	.	.	.	T	12.19	1.864162	0.32977	.	.	ENSG00000143319	ENST00000313146;ENST00000368219	T;T	0.24538	1.85;1.85	5.17	5.17	0.71159	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.097133	0.50627	D	0.000111	T	0.13927	0.0337	N	0.16833	0.445	0.43494	D	0.995738	B	0.27910	0.193	B	0.42462	0.388	T	0.19289	-1.0310	10	0.38643	T	0.18	.	13.9797	0.64297	0.0:0.0:0.0:1.0	.	203	Q9H9L3	I20L2_HUMAN	V	203	ENSP00000323424:I203V;ENSP00000357202:I203V	ENSP00000323424:I203V	I	-	1	0	ISG20L2	154963462	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	1.502000	0.35704	2.175000	0.68902	0.533000	0.62120	ATT	.	.	.	none		0.527	ISG20L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098969.1	NM_030980	
SMG7	9887	hgsc.bcm.edu	37	1	183520232	183520232	+	Silent	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr1:183520232C>T	ENST00000347615.2	+	21	3326	c.3207C>T	c.(3205-3207)agC>agT	p.S1069S	SMG7_ENST00000367537.3_Silent_p.S1102S|SMG7_ENST00000515829.2_Silent_p.S1023S|SMG7_ENST00000507469.1_Silent_p.S1073S|SMG7_ENST00000456731.2_Silent_p.S981S|SMG7_ENST00000508461.1_Silent_p.S1077S	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	1069					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						CCTCTGAGAGCAGTTGGCATC	0.493																																					p.S1077S		Atlas-SNP	.											.	SMG7	165	.	0			c.C3231T						PASS	.						81.0	74.0	76.0					1																	183520232		2203	4300	6503	SO:0001819	synonymous_variant	9887	exon21			TGAGAGCAGTTGG	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.3207C>T	chr1.hg19:g.183520232C>T		154.0	0.0	.		112.0	28.0	.	NM_001174061	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Silent	SNP	ENST00000347615.2	hg19	CCDS1355.1																																																																																			.	.	.	none		0.493	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837	
DHX57	90957	hgsc.bcm.edu	37	2	39050399	39050399	+	Silent	SNP	T	T	C			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr2:39050399T>C	ENST00000295373.6	-	17	3153	c.3027A>G	c.(3025-3027)ttA>ttG	p.L1009L		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1009	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TAAACATCTCTAAAATTTTAA	0.343																																					p.L1009L	Melanoma(191;1090 2095 4375 23729 47341)	Atlas-SNP	.											.	DHX57	127	.	0			c.A3027G						PASS	.						40.0	43.0	42.0					2																	39050399		2203	4300	6503	SO:0001819	synonymous_variant	90957	exon17			CATCTCTAAAATT	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3027A>G	chr2.hg19:g.39050399T>C		81.0	0.0	.		74.0	27.0	.	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Silent	SNP	ENST00000295373.6	hg19	CCDS1800.1	.	.	.	.	.	.	.	.	.	.	T	3.584	-0.084978	0.07097	.	.	ENSG00000163214	ENST00000452978	.	.	.	5.62	-2.77	0.05877	.	.	.	.	.	T	0.63581	0.2523	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62530	-0.6835	4	.	.	.	.	13.7596	0.62956	0.0:0.7451:0.0:0.2549	.	.	.	.	G	333	.	.	R	-	1	2	DHX57	38903903	1.000000	0.71417	0.979000	0.43373	0.432000	0.31715	1.023000	0.30065	-0.415000	0.07484	-0.411000	0.06167	AGA	.	.	.	none		0.343	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
THADA	63892	hgsc.bcm.edu	37	2	43519255	43519255	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr2:43519255G>C	ENST00000405006.4	-	33	5276	c.4925C>G	c.(4924-4926)gCt>gGt	p.A1642G	THADA_ENST00000415080.2_Missense_Mutation_p.A1323G|THADA_ENST00000330266.7_Intron|THADA_ENST00000405975.2_Missense_Mutation_p.A1642G	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1642										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TTCATTGGAAGCAATATCCAT	0.488																																					p.A1642G		Atlas-SNP	.											.	THADA	131	.	0			c.C4925G						PASS	.						51.0	56.0	55.0					2																	43519255		1955	4146	6101	SO:0001583	missense	63892	exon33			TTGGAAGCAATAT	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.4925C>G	chr2.hg19:g.43519255G>C	ENSP00000385995:p.Ala1642Gly	90.0	0.0	.		84.0	28.0	.	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	hg19	CCDS46268.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.606563|4.606563	0.87157|0.87157	.|.	.|.	ENSG00000115970|ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006|ENST00000407351	T;T;T|.	0.18502|.	2.48;2.21;2.48|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.320498|.	0.28659|.	N|.	0.014574|.	T|T	0.56746|0.56746	0.2006|0.2006	L|L	0.34521|0.34521	1.04|1.04	0.36371|0.36371	D|D	0.86129|0.86129	D;D|.	0.69078|.	0.997;0.991|.	D;P|.	0.72338|.	0.977;0.793|.	T|T	0.60900|0.60900	-0.7171|-0.7171	10|5	0.35671|.	T|.	0.21|.	-12.1636|-12.1636	15.7003|15.7003	0.77536|0.77536	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1569;1642|.	B6ZDQ0;Q6YHU6|.	.;THADA_HUMAN|.	G|V	1642;1569;1323;1642|882	ENSP00000386088:A1642G;ENSP00000416048:A1323G;ENSP00000385995:A1642G|.	ENSP00000349464:A1569G|.	A|L	-|-	2|1	0|0	THADA|THADA	43372759|43372759	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	4.752000|4.752000	0.62176|0.62176	2.421000|2.421000	0.82119|0.82119	0.644000|0.644000	0.83932|0.83932	GCT|CTT	.	.	.	none		0.488	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
CWC22	57703	hgsc.bcm.edu	37	2	180842978	180842978	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr2:180842978T>G	ENST00000410053.3	-	6	819	c.520A>C	c.(520-522)Aac>Cac	p.N174H	CWC22_ENST00000295749.6_Missense_Mutation_p.N174H	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	174	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.				mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						TTGGAAATGTTGACTTTGTTG	0.308																																					p.N174H		Atlas-SNP	.											.	CWC22	62	.	0			c.A520C						PASS	.						69.0	66.0	67.0					2																	180842978		1799	4069	5868	SO:0001583	missense	57703	exon6			AAATGTTGACTTT		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.520A>C	chr2.hg19:g.180842978T>G	ENSP00000387006:p.Asn174His	115.0	0.0	.		171.0	63.0	.	NM_020943	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	ENST00000410053.3	hg19	CCDS46465.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.569299	0.86439	.	.	ENSG00000163510	ENST00000410053;ENST00000295749;ENST00000404136	T;T;T	0.22945	1.93;1.93;1.93	5.87	5.87	0.94306	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.63367	0.2505	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74680	-0.3584	10	0.87932	D	0	-26.3331	15.4442	0.75216	0.0:0.0:0.0:1.0	.	174	Q9HCG8	CWC22_HUMAN	H	174	ENSP00000387006:N174H;ENSP00000295749:N174H;ENSP00000384159:N174H	ENSP00000295749:N174H	N	-	1	0	CWC22	180551223	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.806000	0.86020	2.239000	0.73571	0.528000	0.53228	AAC	.	.	.	none		0.308	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334537.1	NM_020943	
GLS	2744	hgsc.bcm.edu	37	2	191797583	191797583	+	Intron	SNP	A	A	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr2:191797583A>G	ENST00000320717.3	+	14	1908				GLS_ENST00000338435.4_Missense_Mutation_p.S598G|GLS_ENST00000409215.1_Missense_Mutation_p.S103G|GLS_ENST00000409626.1_Missense_Mutation_p.S169G|GLS_ENST00000471443.1_3'UTR|GLS_ENST00000409428.1_Intron	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase						cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	GGGAGAGAAAAGCTAAAGAAA	0.308																																					p.S598G		Atlas-SNP	.											.	GLS	47	.	0			c.A1792G						PASS	.						45.0	45.0	45.0					2																	191797583		875	1991	2866	SO:0001627	intron_variant	2744	exon15			GAGAAAAGCTAAA	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1650+1220A>G	chr2.hg19:g.191797583A>G		51.0	0.0	.		66.0	27.0	.	NM_001256310	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	hg19	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	A	16.03	3.007644	0.54361	.	.	ENSG00000115419	ENST00000338435;ENST00000409626;ENST00000409215	T	0.49432	0.78	5.38	5.38	0.77491	.	.	.	.	.	T	0.43831	0.1265	.	.	.	0.24313	N	0.995077	B;B	0.33171	0.0;0.4	B;B	0.33960	0.004;0.173	T	0.44862	-0.9300	8	0.62326	D	0.03	.	15.3934	0.74767	1.0:0.0:0.0:0.0	.	252;598	Q68D38;O94925-3	.;.	G	598;169;103	ENSP00000340689:S598G	ENSP00000340689:S598G	S	+	1	0	GLS	191505828	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.434000	0.66526	2.021000	0.59480	0.533000	0.62120	AGC	.	.	.	none		0.308	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
IL17RC	84818	hgsc.bcm.edu	37	3	9974800	9974800	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr3:9974800G>C	ENST00000295981.3	+	19	2117	c.1899G>C	c.(1897-1899)tgG>tgC	p.W633C	IL17RC_ENST00000383812.4_Missense_Mutation_p.W547C|IL17RC_ENST00000416074.2_Missense_Mutation_p.W388C|IL17RC_ENST00000455057.1_Missense_Mutation_p.W530C|IL17RC_ENST00000403601.3_Missense_Mutation_p.W562C|IL17RC_ENST00000498214.1_3'UTR|RP11-1020A11.1_ENST00000602411.1_RNA|CRELD1_ENST00000452070.1_5'Flank|CRELD1_ENST00000326434.5_5'Flank|IL17RC_ENST00000413608.1_Missense_Mutation_p.W549C|CRELD1_ENST00000383811.3_5'Flank|CRELD1_ENST00000397170.3_5'Flank	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	633	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCGTGGCTTGGTTTCACGCGC	0.711											OREG0015383	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W633C		Atlas-SNP	.											.	IL17RC	55	.	0			c.G1899C						PASS	.						17.0	17.0	17.0					3																	9974800		2193	4286	6479	SO:0001583	missense	84818	exon19			GGCTTGGTTTCAC	BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.1899G>C	chr3.hg19:g.9974800G>C	ENSP00000295981:p.Trp633Cys	26.0	0.0	.	661	39.0	11.0	.	NM_153461	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	ENST00000295981.3	hg19	CCDS2590.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.834602	0.50951	.	.	ENSG00000163702	ENST00000383812;ENST00000295981;ENST00000403601;ENST00000416074;ENST00000455057;ENST00000413608	T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6	4.97	3.16	0.36331	SEFIR (1);	0.000000	0.64402	D	0.000001	T	0.64594	0.2612	M	0.62723	1.935	0.52099	D	0.999946	D;B;B;D;D;B;D;D	0.89917	1.0;0.129;0.129;1.0;1.0;0.105;1.0;1.0	D;B;B;D;D;B;D;D	0.97110	0.999;0.114;0.114;1.0;1.0;0.069;0.999;0.999	T	0.62992	-0.6736	10	0.72032	D	0.01	-12.9366	6.6131	0.22763	0.093:0.0:0.7317:0.1753	.	388;530;532;549;388;547;633;562	F5H4Z2;E9PHG1;A8BWD5;E9PHJ6;B4E008;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;I17RC_HUMAN;.	C	547;633;562;388;530;549	ENSP00000373323:W547C;ENSP00000295981:W633C;ENSP00000384969:W562C;ENSP00000395315:W388C;ENSP00000407894:W530C;ENSP00000396064:W549C	ENSP00000295981:W633C	W	+	3	0	IL17RC	9949800	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	5.080000	0.64437	0.496000	0.27904	-0.310000	0.09108	TGG	.	.	.	none		0.711	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732	
TIGIT	201633	hgsc.bcm.edu	37	3	114026767	114026767	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr3:114026767T>G	ENST00000486257.1	+	5	781	c.524T>G	c.(523-525)gTg>gGg	p.V175G	TIGIT_ENST00000383671.3_Missense_Mutation_p.V175G|TIGIT_ENST00000481065.1_Missense_Mutation_p.V242G|TIGIT_ENST00000496848.1_3'UTR			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	175					negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						ATCCATTCTGTGGAAGGTGAC	0.483																																					p.V175G		Atlas-SNP	.											.	TIGIT	42	.	0			c.T524G						PASS	.						76.0	80.0	79.0					3																	114026767		2203	4300	6503	SO:0001583	missense	201633	exon4			ATTCTGTGGAAGG	AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.524T>G	chr3.hg19:g.114026767T>G	ENSP00000419085:p.Val175Gly	172.0	0.0	.		137.0	36.0	.	NM_173799	Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	ENST00000486257.1	hg19	CCDS2980.1	.	.	.	.	.	.	.	.	.	.	T	3.429	-0.116496	0.06838	.	.	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	T;T;T;T;T	0.58210	0.35;0.36;0.42;0.42;0.35	4.21	-1.81	0.07882	.	0.851711	0.10155	N	0.709140	T	0.27832	0.0685	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.16129	-1.0413	10	0.22706	T	0.39	0.8948	4.6147	0.12420	0.0:0.3506:0.1677:0.4817	.	175	Q495A1	TIGIT_HUMAN	G	154;242;175;175;154	ENSP00000418917:V154G;ENSP00000420552:V242G;ENSP00000419085:V175G;ENSP00000373167:V175G;ENSP00000419706:V154G	ENSP00000373167:V175G	V	+	2	0	TIGIT	115509457	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.300000	0.08243	-0.325000	0.08577	0.533000	0.62120	GTG	.	.	.	none		0.483	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354690.1	NM_173799	
TIMMDC1	51300	hgsc.bcm.edu	37	3	119222809	119222809	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr3:119222809A>G	ENST00000494664.1	+	4	660	c.458A>G	c.(457-459)aAc>aGc	p.N153S	TIMMDC1_ENST00000493694.1_Intron	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	153						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						AGCACAGTGAACACTAGTCTG	0.323																																					p.N153S		Atlas-SNP	.											.	TIMMDC1	29	.	0			c.A458G						PASS	.						141.0	140.0	141.0					3																	119222809		2203	4300	6503	SO:0001583	missense	51300	exon4			CAGTGAACACTAG	AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.458A>G	chr3.hg19:g.119222809A>G	ENSP00000418803:p.Asn153Ser	44.0	0.0	.		55.0	13.0	.	NM_016589	D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Missense_Mutation	SNP	ENST00000494664.1	hg19	CCDS33831.1	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.808491	0.00606	.	.	ENSG00000113845	ENST00000494664;ENST00000466984	T;T	0.39229	1.56;1.09	4.74	0.905	0.19307	.	0.155895	0.56097	N	0.000037	T	0.15696	0.0378	N	0.11427	0.14	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.28106	-1.0054	10	0.02654	T	1	-8.7525	4.7175	0.12903	0.6328:0.1645:0.2027:0.0	.	153	Q9NPL8	TIDC1_HUMAN	S	153;68	ENSP00000418803:N153S;ENSP00000420122:N68S	ENSP00000264244:N153S	N	+	2	0	TIMMDC1	120705499	1.000000	0.71417	0.995000	0.50966	0.007000	0.05969	2.437000	0.44828	0.004000	0.14682	-1.447000	0.01057	AAC	.	.	.	none		0.323	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355077.3	NM_016589	
ALDH1L1	10840	hgsc.bcm.edu	37	3	125854448	125854448	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr3:125854448C>T	ENST00000393434.2	-	12	1751	c.1402G>A	c.(1402-1404)Gcc>Acc	p.A468T	ALDH1L1_ENST00000273450.3_Missense_Mutation_p.A478T|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.A468T|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.A367T|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.A468T	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	468	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GCATCCTTGGCTGCGGCCACT	0.602																																					p.A478T		Atlas-SNP	.											.	ALDH1L1	138	.	0			c.G1432A						PASS	.						143.0	111.0	122.0					3																	125854448		2203	4300	6503	SO:0001583	missense	10840	exon12			CCTTGGCTGCGGC	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1402G>A	chr3.hg19:g.125854448C>T	ENSP00000377083:p.Ala468Thr	26.0	0.0	.		38.0	12.0	.	NM_001270364	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	hg19	CCDS3034.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.431432	0.62844	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431	D;D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65;-2.65	4.16	4.16	0.48862	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.133532	0.47455	D	0.000221	D	0.96987	0.9016	H	0.97983	4.12	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.76575	0.969;0.988;0.955	D	0.98072	1.0399	10	0.87932	D	0	.	14.3504	0.66697	0.0:1.0:0.0:0.0	.	367;520;468	E9PBX3;Q59G10;O75891	.;.;AL1L1_HUMAN	T	478;468;367;468;468	ENSP00000273450:A478T;ENSP00000420293:A468T;ENSP00000395881:A367T;ENSP00000377083:A468T;ENSP00000377081:A468T	ENSP00000273450:A478T	A	-	1	0	ALDH1L1	127337138	1.000000	0.71417	0.054000	0.19295	0.003000	0.03518	6.729000	0.74775	2.331000	0.79229	0.460000	0.39030	GCC	.	.	.	none		0.602	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190	
ACKR4	51554	hgsc.bcm.edu	37	3	132319326	132319326	+	Silent	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr3:132319326C>T	ENST00000249887.2	+	2	181	c.85C>T	c.(85-87)Ctg>Ttg	p.L29L	ACAD11_ENST00000264990.6_Intron|ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000355458.3_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	29					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.L29L(1)									TCAATATGAACTGATCTGTAT	0.378																																					p.L29L		Atlas-SNP	.											CCRL1,NS,carcinoma,0,2	CCRL1	30	.	1	Substitution - coding silent(1)	endometrium(1)	c.C85T						PASS	.						58.0	58.0	58.0					3																	132319326		2203	4300	6503	SO:0001819	synonymous_variant	51554	exon1			TATGAACTGATCT	AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.85C>T	chr3.hg19:g.132319326C>T		240.0	1.0	.		231.0	11.0	.	NM_178445	B2R9U7	Silent	SNP	ENST00000249887.2	hg19	CCDS3075.1																																																																																			.	.	.	none		0.378	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357238.2	NM_016557	
RASSF6	166824	hgsc.bcm.edu	37	4	74459297	74459297	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr4:74459297T>A	ENST00000342081.3	-	4	384	c.254A>T	c.(253-255)aAa>aTa	p.K85I	RASSF6_ENST00000307439.5_Missense_Mutation_p.K53I|RASSF6_ENST00000335049.5_Missense_Mutation_p.K41I|RASSF6_ENST00000395777.2_Missense_Mutation_p.K53I	NM_201431.2	NP_958834.1	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family member 6	85					apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)					breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|pancreas(2)|skin(2)	17	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			AACAATTAGTTTGCCATCTTC	0.338																																					p.K85I		Atlas-SNP	.											.	RASSF6	68	.	0			c.A254T						PASS	.						102.0	103.0	103.0					4																	74459297		2203	4300	6503	SO:0001583	missense	166824	exon4			ATTAGTTTGCCAT	AY217664	CCDS3558.1, CCDS3559.1, CCDS58904.1, CCDS58905.1	4q21.1	2008-02-22	2008-02-22		ENSG00000169435	ENSG00000169435			20796	protein-coding gene	gene with protein product		612620					Standard	NM_177532		Approved		uc003hhd.2	Q6ZTQ3	OTTHUMG00000130007	ENST00000342081.3:c.254A>T	chr4.hg19:g.74459297T>A	ENSP00000340578:p.Lys85Ile	57.0	0.0	.		83.0	26.0	.	NM_201431	Q68DT2|Q6PDA6|Q86WG9|Q86WH0	Missense_Mutation	SNP	ENST00000342081.3	hg19	CCDS3558.1	.	.	.	.	.	.	.	.	.	.	T	13.64	2.297478	0.40694	.	.	ENSG00000169435	ENST00000307439;ENST00000342081;ENST00000395777;ENST00000335049	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.42	5.42	0.78866	.	0.814802	0.11816	N	0.526735	T	0.53738	0.1815	L	0.38175	1.15	0.09310	N	1	D;P;P	0.54397	0.966;0.797;0.943	P;B;B	0.50708	0.648;0.446;0.352	T	0.48647	-0.9017	10	0.62326	D	0.03	-0.7807	11.8484	0.52397	0.0:0.0:0.0:1.0	.	41;53;85	Q6ZTQ3-3;Q6ZTQ3-4;Q6ZTQ3	.;.;RASF6_HUMAN	I	53;85;53;41	ENSP00000303877:K53I;ENSP00000340578:K85I;ENSP00000379123:K53I;ENSP00000335582:K41I	ENSP00000303877:K53I	K	-	2	0	RASSF6	74678161	0.558000	0.26554	0.022000	0.16811	0.609000	0.37215	2.314000	0.43743	2.071000	0.62044	0.443000	0.29094	AAA	.	.	.	none		0.338	RASSF6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252279.1	NM_177532	
ICE1	23379	hgsc.bcm.edu	37	5	5469021	5469021	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr5:5469021A>G	ENST00000296564.7	+	15	6364	c.6142A>G	c.(6142-6144)Aaa>Gaa	p.K2048E		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		2048					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GGTGATTAATAAAGCAATGCA	0.353																																					p.K2048E		Atlas-SNP	.											.	KIAA0947	301	.	0			c.A6142G						PASS	.						124.0	120.0	121.0					5																	5469021		1853	4090	5943	SO:0001583	missense	23379	exon15			ATTAATAAAGCAA																												ENST00000296564.7:c.6142A>G	chr5.hg19:g.5469021A>G	ENSP00000296564:p.Lys2048Glu	99.0	0.0	.		87.0	27.0	.	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	hg19	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	A	13.20	2.165436	0.38217	.	.	ENSG00000164151	ENST00000296564	T	0.12039	2.72	5.86	3.45	0.39498	.	.	.	.	.	T	0.09949	0.0244	L	0.31926	0.97	0.21782	N	0.999541	B	0.25955	0.138	B	0.21151	0.033	T	0.32052	-0.9921	9	0.33940	T	0.23	3.9123	6.658	0.22998	0.7625:0.1549:0.0826:0.0	.	2048	Q9Y2F5	K0947_HUMAN	E	2048	ENSP00000296564:K2048E	ENSP00000296564:K2048E	K	+	1	0	KIAA0947	5522021	1.000000	0.71417	0.004000	0.12327	0.977000	0.68977	2.140000	0.42159	0.464000	0.27142	0.528000	0.53228	AAA	.	.	.	none		0.353	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
DNAH5	1767	hgsc.bcm.edu	37	5	13894791	13894791	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr5:13894791T>A	ENST00000265104.4	-	16	2503	c.2399A>T	c.(2398-2400)gAg>gTg	p.E800V	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	800	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TAAATAAGCCTCAATATTCAG	0.413									Kartagener syndrome																												p.E800V		Atlas-SNP	.											.	DNAH5	868	.	0			c.A2399T						PASS	.						129.0	122.0	125.0					5																	13894791		2203	4300	6503	SO:0001583	missense	1767	exon16	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TAAGCCTCAATAT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2399A>T	chr5.hg19:g.13894791T>A	ENSP00000265104:p.Glu800Val	103.0	0.0	.		66.0	16.0	.	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.301659	0.23736	.	.	ENSG00000039139	ENST00000265104	T	0.57752	0.38	5.23	4.07	0.47477	Dynein heavy chain, domain-1 (1);	0.151463	0.56097	D	0.000021	T	0.49881	0.1583	M	0.66939	2.045	0.36165	D	0.848377	B	0.14805	0.011	B	0.22386	0.039	T	0.53408	-0.8443	10	0.38643	T	0.18	.	10.1183	0.42605	0.0:0.0805:0.0:0.9194	.	800	Q8TE73	DYH5_HUMAN	V	800	ENSP00000265104:E800V	ENSP00000265104:E800V	E	-	2	0	DNAH5	13947791	0.998000	0.40836	0.685000	0.30070	0.043000	0.13939	2.905000	0.48727	0.843000	0.35070	0.402000	0.26972	GAG	.	.	.	none		0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
SPATS1	221409	hgsc.bcm.edu	37	6	44320474	44320474	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr6:44320474A>G	ENST00000288390.2	+	2	498	c.151A>G	c.(151-153)Agt>Ggt	p.S51G	RP11-444E17.6_ENST00000505802.1_3'UTR|SPATS1_ENST00000323108.8_Missense_Mutation_p.S51G			Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	51										NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(5)|skin(1)|urinary_tract(1)	14	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGCTAATTGCAGTGATTTTCT	0.358																																					p.S51G		Atlas-SNP	.											.	SPATS1	61	.	0			c.A151G						PASS	.						116.0	108.0	111.0					6																	44320474		2203	4300	6503	SO:0001583	missense	221409	exon3			AATTGCAGTGATT	AK058171	CCDS4911.1	6p21.1	2003-08-08			ENSG00000249481	ENSG00000249481			22957	protein-coding gene	gene with protein product							Standard	NM_145026		Approved	SPATA8, FLJ25442, SRSP1	uc021yzz.1	Q496A3	OTTHUMG00000014764	ENST00000288390.2:c.151A>G	chr6.hg19:g.44320474A>G	ENSP00000424400:p.Ser51Gly	46.0	0.0	.		99.0	32.0	.	NM_145026	Q496A2|Q496A5|Q96LJ0	Missense_Mutation	SNP	ENST00000288390.2	hg19	CCDS4911.1	.	.	.	.	.	.	.	.	.	.	A	6.330	0.428946	0.11987	.	.	ENSG00000249481	ENST00000323108;ENST00000288390	T;T	0.48836	0.8;0.8	3.92	-0.0235	0.13943	.	1.491510	0.04356	N	0.356554	T	0.12305	0.0299	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11842	-1.0571	10	0.12430	T	0.62	.	6.2149	0.20649	0.628:0.0:0.372:0.0	.	51	Q496A3	SPAS1_HUMAN	G	51	ENSP00000437552:S51G;ENSP00000424400:S51G	ENSP00000424400:S51G	S	+	1	0	SPATS1	44428452	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.147000	0.16202	0.003000	0.14656	-0.290000	0.09829	AGT	.	.	.	none		0.358	SPATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040738.2	NM_145026	
SLC35A1	10559	hgsc.bcm.edu	37	6	88187175	88187175	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr6:88187175G>T	ENST00000369552.4	+	2	139	c.112G>T	c.(112-114)Gac>Tac	p.D38Y	SLC35A1_ENST00000464978.1_3'UTR|C6orf165_ENST00000507897.1_3'UTR|C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000369557.5_Missense_Mutation_p.D38Y|SLC35A1_ENST00000544441.1_5'UTR|SLC35A1_ENST00000369556.3_Missense_Mutation_p.D38Y	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1	38					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)			breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		AAGGACATCAGACAAAGAACT	0.368																																					p.D38Y	NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)	Atlas-SNP	.											.	SLC35A1	29	.	0			c.G112T						PASS	.						109.0	103.0	105.0					6																	88187175		2203	4300	6503	SO:0001583	missense	10559	exon2			ACATCAGACAAAG	D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.112G>T	chr6.hg19:g.88187175G>T	ENSP00000358565:p.Asp38Tyr	79.0	0.0	.		88.0	41.0	.	NM_006416	Q5W1L8	Missense_Mutation	SNP	ENST00000369552.4	hg19	CCDS5010.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284666	0.40394	.	.	ENSG00000164414	ENST00000369556;ENST00000369552;ENST00000429605;ENST00000369557;ENST00000369544	T	0.47869	0.83	5.62	3.78	0.43462	.	0.437967	0.23010	U	0.052966	T	0.17280	0.0415	L	0.43923	1.385	0.18873	N	0.999986	P;P	0.39157	0.533;0.662	B;B	0.29942	0.109;0.109	T	0.04153	-1.0973	10	0.72032	D	0.01	-14.2719	8.7393	0.34547	0.2397:0.0:0.7603:0.0	.	38;38	P78382;Q5W1L8	S35A1_HUMAN;.	Y	38;38;38;38;19	ENSP00000358565:D38Y	ENSP00000358557:D19Y	D	+	1	0	SLC35A1	88243894	1.000000	0.71417	0.969000	0.41365	0.996000	0.88848	2.735000	0.47377	0.666000	0.31087	0.655000	0.94253	GAC	.	.	.	none		0.368	SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041446.1		
NRCAM	4897	hgsc.bcm.edu	37	7	107823350	107823350	+	Silent	SNP	G	G	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr7:107823350G>A	ENST00000425651.2	-	20	2318	c.2319C>T	c.(2317-2319)ttC>ttT	p.F773F	NRCAM_ENST00000413765.2_Silent_p.F754F|NRCAM_ENST00000379022.4_Silent_p.F773F|NRCAM_ENST00000379028.3_Silent_p.F773F|NRCAM_ENST00000379024.4_Silent_p.F754F|NRCAM_ENST00000351718.4_Silent_p.F757F	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	773	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CATTAGATTCGAAACCATTCA	0.418																																					p.F773F		Atlas-SNP	.											.	NRCAM	267	.	0			c.C2319T						PASS	.						60.0	57.0	58.0					7																	107823350		2203	4300	6503	SO:0001819	synonymous_variant	4897	exon20			AGATTCGAAACCA		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2319C>T	chr7.hg19:g.107823350G>A		94.0	0.0	.		120.0	31.0	.	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	hg19	CCDS47686.1																																																																																			.	.	.	none		0.418	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
FBXO16	157574	hgsc.bcm.edu	37	8	28331306	28331306	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr8:28331306C>T	ENST00000380254.2	-	3	266	c.118G>A	c.(118-120)Gcc>Acc	p.A40T	FBXO16_ENST00000519471.2_Missense_Mutation_p.A40T|FBXO16_ENST00000517436.1_5'UTR|FBXO16_ENST00000346498.2_Intron|FBXO16_ENST00000518734.1_Intron	NM_001258211.1|NM_172366.3	NP_001245140.1|NP_758954.1	Q8IX29	FBX16_HUMAN	F-box protein 16	40										large_intestine(2)|ovary(1)	3		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.121)|Kidney(114;0.144)|Colorectal(74;0.249)		CCAAGCAGGGCTCTTCTTTCT	0.303																																					p.A40T		Atlas-SNP	.											.	FBXO16	29	.	0			c.G118A						PASS	.						57.0	63.0	61.0					8																	28331306		2202	4297	6499	SO:0001583	missense	157574	exon3			GCAGGGCTCTTCT	AF453435	CCDS6068.1, CCDS59099.1	8p21.1	2008-02-05	2004-06-15		ENSG00000214050	ENSG00000214050		"""F-boxes /  ""other"""""	13618	protein-coding gene	gene with protein product		608519	"""F-box only protein 16"""			12243353	Standard	NM_172366		Approved	FBX16	uc003xgu.4	Q8IX29	OTTHUMG00000102147	ENST00000380254.2:c.118G>A	chr8.hg19:g.28331306C>T	ENSP00000369604:p.Ala40Thr	206.0	0.0	.		257.0	80.0	.	NM_172366	Q3T1B2|Q3T1B3|Q3T1B4	Missense_Mutation	SNP	ENST00000380254.2	hg19	CCDS6068.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.608040	0.66558	.	.	ENSG00000214050	ENST00000380254;ENST00000517673;ENST00000519471	T;T	0.43688	2.43;0.94	5.86	4.81	0.61882	.	0.593369	0.15469	U	0.260724	T	0.29093	0.0723	N	0.19112	0.55	0.26393	N	0.976548	B	0.23316	0.083	B	0.21360	0.034	T	0.06481	-1.0824	10	0.19590	T	0.45	-36.1552	14.9653	0.71188	0.0:0.9203:0.0:0.0797	.	40	Q8IX29	FBX16_HUMAN	T	40	ENSP00000369604:A40T;ENSP00000429390:A40T	ENSP00000369604:A40T	A	-	1	0	FBXO16	28387225	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	2.002000	0.40835	2.771000	0.95319	0.563000	0.77884	GCC	.	.	.	none		0.303	FBXO16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219988.2	NM_172366	
CCL27	10850	hgsc.bcm.edu	37	9	34662362	34662362	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr9:34662362G>A	ENST00000259631.4	-	2	180	c.122C>T	c.(121-123)cCa>cTa	p.P41L	CCL27_ENST00000557161.1_5'UTR|RP11-195F19.30_ENST00000564224.1_RNA	NM_006664.2	NP_006655.1	Q9Y4X3	CCL27_HUMAN	chemokine (C-C motif) ligand 27	41					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			kidney(1)|large_intestine(3)|ovary(1)	5	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		GTCTGAGAGTGGCTTTCGGTA	0.577																																					p.P41L		Atlas-SNP	.											.	CCL27	6	.	0			c.C122T						PASS	.						75.0	64.0	68.0					9																	34662362		2203	4300	6503	SO:0001583	missense	10850	exon2			GAGAGTGGCTTTC	AJ243542	CCDS6569.1	9p13	2014-05-16	2002-08-22	2002-08-23	ENSG00000213927	ENSG00000213927		"""Chemokine ligands"", ""Endogenous ligands"""	10626	protein-coding gene	gene with protein product	"""CC chemokine ILC"", ""IL-11 Ralpha-locus chemokine"", ""cutaneous T-cell attracting chemokine"""	604833	"""small inducible cytokine subfamily A (Cys-Cys), member 27"""	SCYA27		10556532, 10588729	Standard	NM_006664		Approved	ALP, ILC, CTACK, skinkine, ESkine, PESKY, CTAK	uc003zvm.1	Q9Y4X3	OTTHUMG00000019834	ENST00000259631.4:c.122C>T	chr9.hg19:g.34662362G>A	ENSP00000259631:p.Pro41Leu	60.0	0.0	.		62.0	20.0	.	NM_006664		Missense_Mutation	SNP	ENST00000259631.4	hg19	CCDS6569.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.314771	0.40996	.	.	ENSG00000213927	ENST00000259631	T	0.05139	3.49	5.37	3.42	0.39159	Chemokine interleukin-8-like domain (2);	0.241243	0.29676	N	0.011493	T	0.05273	0.0140	L	0.33485	1.01	0.40928	D	0.984365	P	0.37708	0.606	B	0.38985	0.287	T	0.29397	-1.0013	10	0.40728	T	0.16	-8.2034	5.6242	0.17473	0.0979:0.0:0.7064:0.1957	.	41	Q9Y4X3	CCL27_HUMAN	L	41	ENSP00000259631:P41L	ENSP00000259631:P41L	P	-	2	0	CCL27	34652362	0.989000	0.36119	1.000000	0.80357	0.842000	0.47809	1.349000	0.33998	2.673000	0.90976	0.557000	0.71058	CCA	.	.	.	none		0.577	CCL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052228.1	NM_006664	
ASAH2	56624	hgsc.bcm.edu	37	10	52003053	52003053	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr10:52003053C>T	ENST00000395526.4	-	3	418	c.419G>A	c.(418-420)cGt>cAt	p.R140H	ASAH2_ENST00000443575.1_5'Flank|ASAH2_ENST00000329428.6_Missense_Mutation_p.R121H|ASAH2_ENST00000447815.1_Missense_Mutation_p.R140H	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	140					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)			large_intestine(1)|lung(9)|urinary_tract(1)	11						GATGAAGGCACGACTGTATAG	0.507																																					p.R140H		Atlas-SNP	.											.	ASAH2	69	.	0			c.G419A						PASS	.						222.0	184.0	197.0					10																	52003053		2203	4300	6503	SO:0001583	missense	56624	exon3			AAGGCACGACTGT	AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.419G>A	chr10.hg19:g.52003053C>T	ENSP00000378897:p.Arg140His	94.0	0.0	.		62.0	22.0	.	NM_019893	Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	ENST00000395526.4	hg19	CCDS7239.2	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717778	0.89205	.	.	ENSG00000188611	ENST00000395526;ENST00000447815;ENST00000329428	T;T;T	0.59906	0.23;0.23;0.23	5.82	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.81484	0.4832	M	0.93720	3.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86317	0.1690	10	0.87932	D	0	.	13.911	0.63866	0.1533:0.8467:0.0:0.0	.	140;140	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	H	140;140;121	ENSP00000378897:R140H;ENSP00000388206:R140H;ENSP00000329886:R121H	ENSP00000329886:R121H	R	-	2	0	ASAH2	51673059	1.000000	0.71417	0.985000	0.45067	0.785000	0.44390	7.167000	0.77562	1.413000	0.46997	0.557000	0.71058	CGT	.	.	.	none		0.507	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048061.3	NM_019893	
LZTS2	84445	hgsc.bcm.edu	37	10	102770293	102770293	+	IGR	SNP	T	T	G	rs200896335|rs71013480	byFrequency	TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr10:102770293T>G	ENST00000370220.1	+	0	5741									leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		TGACCCCGgctgctgcggctg	0.697																																					p.S785R	Esophageal Squamous(8;38 437 13604 19902 37640)	Atlas-SNP	.											.	PDZD7	101	.	0			c.A2353C						PASS	.																																			SO:0001628	intergenic_variant	79955	exon15			CCCGGCTGCTGCG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914		chr10.hg19:g.102770293T>G		356.0	0.0	.		409.0	18.0	.	NM_001195263		Missense_Mutation	SNP	ENST00000370220.1	hg19	CCDS7507.1	.	.	.	.	.	.	.	.	.	.	T	2.648	-0.282573	0.05642	.	.	ENSG00000186862	ENST00000393462	.	.	.	3.99	2.83	0.33086	.	.	.	.	.	T	0.29716	0.0742	N	0.24115	0.695	0.28374	N	0.919888	.	.	.	.	.	.	T	0.21793	-1.0235	6	0.20046	T	0.44	.	9.5348	0.39216	0.0:0.0:0.1777:0.8222	.	.	.	.	R	785	.	ENSP00000377106:S785R	S	-	1	0	PDZD7	102760283	0.123000	0.22298	0.736000	0.30914	0.083000	0.17756	0.220000	0.17660	0.649000	0.30751	-0.680000	0.03767	AGC	.	.	.	none		0.697	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
PPRC1	23082	hgsc.bcm.edu	37	10	103900243	103900243	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr10:103900243C>T	ENST00000278070.2	+	5	2017	c.1978C>T	c.(1978-1980)Ccg>Tcg	p.P660S	PPRC1_ENST00000413464.2_Missense_Mutation_p.P660S|PPRC1_ENST00000370012.1_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	660					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TGATGCTGTCCCGTCTGGCCC	0.547																																					p.P660S		Atlas-SNP	.											.	PPRC1	151	.	0			c.C1978T						PASS	.						96.0	81.0	86.0					10																	103900243		2203	4300	6503	SO:0001583	missense	23082	exon5			GCTGTCCCGTCTG	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.1978C>T	chr10.hg19:g.103900243C>T	ENSP00000278070:p.Pro660Ser	47.0	0.0	.		64.0	27.0	.	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	hg19	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.489648	0.26686	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.20598	2.07;2.06	4.59	1.4	0.22301	.	1.584220	0.03763	N	0.258417	T	0.14570	0.0352	N	0.19112	0.55	0.09310	N	1	B;B;B	0.13594	0.008;0.005;0.008	B;B;B	0.10450	0.003;0.005;0.003	T	0.26677	-1.0096	10	0.44086	T	0.13	.	4.7029	0.12835	0.0:0.5724:0.1946:0.233	.	660;540;660	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	S	660	ENSP00000278070:P660S;ENSP00000399743:P660S	ENSP00000278070:P660S	P	+	1	0	PPRC1	103890233	0.024000	0.19004	0.001000	0.08648	0.096000	0.18686	0.673000	0.25203	0.161000	0.19458	-0.291000	0.09656	CCG	.	.	.	none		0.547	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
OR51B5	282763	hgsc.bcm.edu	37	11	5364556	5364556	+	Missense_Mutation	SNP	T	T	G	rs372207902|rs147062602	byFrequency	TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr11:5364556T>G	ENST00000300773.2	-	1	253	c.199A>C	c.(199-201)Aca>Cca	p.T67P	HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron	NM_001005567.2	NP_001005567.2	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B, member 5	67					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A66fs*48(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	28		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCAGGTCTGTGGCAGCCAGC	0.542																																					p.T67P		Atlas-SNP	.											.	OR51B5	60	.	1	Deletion - Frameshift(1)	upper_aerodigestive_tract(1)	c.A199C						PASS	.						44.0	50.0	48.0					11																	5364556		2191	4293	6484	SO:0001583	missense	282763	exon5			GGTCTGTGGCAGC	BK004430	CCDS31378.1	11p15.4	2012-08-09			ENSG00000242180	ENSG00000242180		"""GPCR / Class A : Olfactory receptors"""	19599	protein-coding gene	gene with protein product							Standard	NM_001005567		Approved		uc001maq.2	Q9H339	OTTHUMG00000066676	ENST00000300773.2:c.199A>C	chr11.hg19:g.5364556T>G	ENSP00000300773:p.Thr67Pro	41.0	0.0	.		54.0	7.0	.	NM_001005567	B2RN59	Missense_Mutation	SNP	ENST00000300773.2	hg19	CCDS31378.1	.	.	.	.	.	.	.	.	.	.	T	15.67	2.901629	0.52227	.	.	ENSG00000242180	ENST00000300773	T	0.03004	4.08	4.76	4.76	0.60689	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42420	D	0.000714	T	0.17874	0.0429	M	0.89414	3.03	0.19300	N	0.999978	D	0.67145	0.996	D	0.65874	0.939	T	0.09037	-1.0693	10	0.87932	D	0	.	8.6339	0.33936	0.0:0.0903:0.0:0.9097	.	67	Q9H339	O51B5_HUMAN	P	67	ENSP00000300773:T67P	ENSP00000300773:T67P	T	-	1	0	OR51B5	5321132	0.000000	0.05858	0.612000	0.29024	0.641000	0.38312	0.241000	0.18065	2.017000	0.59298	0.529000	0.55759	ACA	.	.	.	none		0.542	OR51B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142975.1	NM_001005567	
OR51B5	282763	hgsc.bcm.edu	37	11	5364558	5364558	+	Missense_Mutation	SNP	G	G	C	rs372207902|rs147062602	byFrequency	TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr11:5364558G>C	ENST00000300773.2	-	1	251	c.197C>G	c.(196-198)gCc>gGc	p.A66G	HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron	NM_001005567.2	NP_001005567.2	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B, member 5	66					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A66fs*48(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	28		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGGTCTGTGGCAGCCAGCAT	0.542																																					p.A66G		Atlas-SNP	.											.	OR51B5	60	.	1	Deletion - Frameshift(1)	upper_aerodigestive_tract(1)	c.C197G						PASS	.						45.0	51.0	49.0					11																	5364558		2191	4293	6484	SO:0001583	missense	282763	exon5			TCTGTGGCAGCCA	BK004430	CCDS31378.1	11p15.4	2012-08-09			ENSG00000242180	ENSG00000242180		"""GPCR / Class A : Olfactory receptors"""	19599	protein-coding gene	gene with protein product							Standard	NM_001005567		Approved		uc001maq.2	Q9H339	OTTHUMG00000066676	ENST00000300773.2:c.197C>G	chr11.hg19:g.5364558G>C	ENSP00000300773:p.Ala66Gly	41.0	0.0	.		57.0	8.0	.	NM_001005567	B2RN59	Missense_Mutation	SNP	ENST00000300773.2	hg19	CCDS31378.1	.	.	.	.	.	.	.	.	.	.	G	6.859	0.527720	0.13127	.	.	ENSG00000242180	ENST00000300773	T	0.00551	6.65	4.76	-1.03	0.10102	GPCR, rhodopsin-like superfamily (1);	0.790635	0.10593	N	0.656558	T	0.00440	0.0014	L	0.27975	0.815	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.37361	-0.9709	10	0.45353	T	0.12	.	7.7471	0.28875	0.2155:0.4492:0.3354:0.0	.	66	Q9H339	O51B5_HUMAN	G	66	ENSP00000300773:A66G	ENSP00000300773:A66G	A	-	2	0	OR51B5	5321134	0.000000	0.05858	0.203000	0.23512	0.619000	0.37552	-0.266000	0.08631	-0.037000	0.13646	-0.171000	0.13296	GCC	.	.	.	none		0.542	OR51B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142975.1	NM_001005567	
SPDYC	387778	hgsc.bcm.edu	37	11	64940189	64940189	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr11:64940189C>A	ENST00000377185.2	+	6	633	c.551C>A	c.(550-552)aCt>aAt	p.T184N	AP003068.18_ENST00000534819.1_RNA	NM_001008778.1	NP_001008778.1			speedy/RINGO cell cycle regulator family member C											breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)	16						TGGGCTTGGACTCGGGACCGG	0.667																																					p.T184N		Atlas-SNP	.											.	SPDYC	31	.	0			c.C551A						PASS	.						43.0	45.0	44.0					11																	64940189		2201	4297	6498	SO:0001583	missense	387778	exon6			CTTGGACTCGGGA	AY820305	CCDS31606.1	11q13.1	2013-05-08	2013-05-08		ENSG00000204710	ENSG00000204710		"""Speedy homologs"""	32681	protein-coding gene	gene with protein product		614030	"""speedy homolog C (Xenopus laevis)"""			15611625	Standard	NM_001008778		Approved	Ringo2	uc010rnz.2	Q5MJ68	OTTHUMG00000165611	ENST00000377185.2:c.551C>A	chr11.hg19:g.64940189C>A	ENSP00000366390:p.Thr184Asn	18.0	0.0	.		41.0	13.0	.	NM_001008778		Missense_Mutation	SNP	ENST00000377185.2	hg19	CCDS31606.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.865824	0.51588	.	.	ENSG00000204710	ENST00000377185	.	.	.	5.09	2.0	0.26442	.	0.251706	0.27289	N	0.020044	T	0.37237	0.0996	L	0.59436	1.845	0.09310	N	0.999995	P	0.48998	0.918	P	0.52386	0.697	T	0.17471	-1.0368	9	0.19590	T	0.45	.	4.07	0.09877	0.3344:0.4858:0.0:0.1798	.	184	Q5MJ68	SPDYC_HUMAN	N	184	.	ENSP00000366390:T184N	T	+	2	0	SPDYC	64696765	0.258000	0.24033	0.044000	0.18714	0.973000	0.67179	0.896000	0.28377	0.122000	0.18314	0.655000	0.94253	ACT	.	.	.	none		0.667	SPDYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385299.1	NM_001008778	
SPTBN2	6712	hgsc.bcm.edu	37	11	66472844	66472844	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr11:66472844C>T	ENST00000533211.1	-	15	2234	c.1903G>A	c.(1903-1905)Gcc>Acc	p.A635T	SPTBN2_ENST00000309996.2_Missense_Mutation_p.A635T|SPTBN2_ENST00000529997.1_Missense_Mutation_p.A635T			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	635					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.A635S(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TCCAGCCGGGCCCGCCGCGCC	0.672																																					p.A635T		Atlas-SNP	.											SPTBN2,NS,carcinoma,0,1	SPTBN2	188	.	1	Substitution - Missense(1)	lung(1)	c.G1903A						PASS	.						21.0	25.0	24.0					11																	66472844		2174	4255	6429	SO:0001583	missense	6712	exon14			GCCGGGCCCGCCG	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.1903G>A	chr11.hg19:g.66472844C>T	ENSP00000432568:p.Ala635Thr	92.0	0.0	.		84.0	31.0	.	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	hg19	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.579927	0.46006	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.52057	0.68;0.68;0.68	4.45	4.45	0.53987	.	0.395296	0.25277	N	0.031832	T	0.47801	0.1465	M	0.63843	1.955	0.31886	N	0.617861	P	0.47910	0.902	P	0.46208	0.507	T	0.54970	-0.8213	10	0.22706	T	0.39	.	11.2662	0.49112	0.1831:0.8169:0.0:0.0	.	635	O15020	SPTN2_HUMAN	T	635	ENSP00000432568:A635T;ENSP00000311489:A635T;ENSP00000433593:A635T	ENSP00000311489:A635T	A	-	1	0	SPTBN2	66229420	0.350000	0.24878	0.983000	0.44433	0.720000	0.41350	2.898000	0.48672	2.294000	0.77228	0.491000	0.48974	GCC	.	.	.	none		0.672	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
FKBP4	2288	hgsc.bcm.edu	37	12	2907930	2907930	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr12:2907930T>C	ENST00000001008.4	+	4	639	c.452T>C	c.(451-453)aTt>aCt	p.I151T	RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	151					androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			GGCGGAATCATTCGCAGAATA	0.488																																					p.I151T		Atlas-SNP	.											.	FKBP4	29	.	0			c.T452C						PASS	.						162.0	146.0	151.0					12																	2907930		2203	4300	6503	SO:0001583	missense	2288	exon4			GAATCATTCGCAG	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.452T>C	chr12.hg19:g.2907930T>C	ENSP00000001008:p.Ile151Thr	86.0	0.0	.		125.0	31.0	.	NM_002014	D3DUQ1|Q9UCP1|Q9UCV7	Missense_Mutation	SNP	ENST00000001008.4	hg19	CCDS8512.1	.	.	.	.	.	.	.	.	.	.	T	16.67	3.188948	0.57909	.	.	ENSG00000004478	ENST00000001008	D	0.82167	-1.58	4.87	4.87	0.63330	.	0.154283	0.56097	D	0.000027	T	0.80149	0.4570	L	0.41236	1.265	0.58432	D	0.999998	B	0.30634	0.288	B	0.39904	0.313	T	0.77324	-0.2630	10	0.33141	T	0.24	-16.3236	13.3003	0.60321	0.0:0.0:0.0:1.0	.	151	Q02790	FKBP4_HUMAN	T	151	ENSP00000001008:I151T	ENSP00000001008:I151T	I	+	2	0	FKBP4	2778191	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	5.868000	0.69605	1.819000	0.53055	0.460000	0.39030	ATT	.	.	.	none		0.488	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206861.1		
ITPR2	3709	hgsc.bcm.edu	37	12	26572030	26572030	+	Silent	SNP	C	C	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr12:26572030C>A	ENST00000381340.3	-	50	7478	c.7062G>T	c.(7060-7062)ctG>ctT	p.L2354L	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2354					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GCATGCAAACCAGGACATACG	0.468																																					p.L2354L		Atlas-SNP	.											.	ITPR2	270	.	0			c.G7062T						PASS	.						85.0	93.0	91.0					12																	26572030		2027	4191	6218	SO:0001819	synonymous_variant	3709	exon50			GCAAACCAGGACA	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7062G>T	chr12.hg19:g.26572030C>A		109.0	0.0	.		125.0	6.0	.	NM_002223	O94773	Silent	SNP	ENST00000381340.3	hg19	CCDS41764.1																																																																																			.	.	.	none		0.468	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
PCED1B	91523	hgsc.bcm.edu	37	12	47471993	47471993	+	5'Flank	SNP	C	C	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr12:47471993C>G	ENST00000546455.1	+	0	0				AMIGO2_ENST00000429635.1_Missense_Mutation_p.D265H|AMIGO2_ENST00000266581.4_Missense_Mutation_p.D265H|AMIGO2_ENST00000321382.3_Missense_Mutation_p.D265H|AMIGO2_ENST00000550413.1_Missense_Mutation_p.D265H			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B								hydrolase activity (GO:0016787)										TGCCTGGAGTCAGACCACAGG	0.478																																					p.D265H		Atlas-SNP	.											.	AMIGO2	50	.	0			c.G793C						PASS	.						78.0	75.0	76.0					12																	47471993		2203	4300	6503	SO:0001631	upstream_gene_variant	347902	exon2			TGGAGTCAGACCA	BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617		chr12.hg19:g.47471993C>G	Exception_encountered	135.0	0.0	.		125.0	34.0	.	NM_181847	Q96B20	Missense_Mutation	SNP	ENST00000546455.1	hg19	CCDS8752.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523963	0.27299	.	.	ENSG00000139211	ENST00000266581;ENST00000550413;ENST00000429635;ENST00000321382	T;T;T;T	0.02525	4.26;4.26;4.26;4.26	4.66	3.77	0.43336	Cysteine-rich flanking region, C-terminal (1);	0.521481	0.20836	N	0.084792	T	0.03827	0.0108	L	0.38175	1.15	0.45762	D	0.998651	B	0.22909	0.077	B	0.30782	0.12	T	0.49021	-0.8982	10	0.35671	T	0.21	-3.9557	12.6119	0.56556	0.0:0.9173:0.0:0.0827	.	265	Q86SJ2	AMGO2_HUMAN	H	265	ENSP00000266581:D265H;ENSP00000449034:D265H;ENSP00000406020:D265H;ENSP00000320848:D265H	ENSP00000266581:D265H	D	-	1	0	AMIGO2	45758260	0.975000	0.34042	0.044000	0.18714	0.955000	0.61496	2.630000	0.46494	1.272000	0.44329	0.555000	0.69702	GAC	.	.	.	none		0.478	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1	NM_138371	
KRT3	3850	hgsc.bcm.edu	37	12	53183951	53183951	+	Missense_Mutation	SNP	C	C	T	rs570613061|rs60125653	byFrequency	TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr12:53183951C>T	ENST00000417996.2	-	9	1836	c.1762G>A	c.(1762-1764)Ggc>Agc	p.G588S	KRT3_ENST00000309505.3_Missense_Mutation_p.G589S	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	588	Gly-rich.|Tail.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GAGCCAAAgccgctgccaccg	0.697																																					p.G588S		Atlas-SNP	.											KRT3,rectum,carcinoma,0,2	KRT3	65	.	0			c.G1762A						PASS	.						14.0	31.0	25.0					12																	53183951		1574	3123	4697	SO:0001583	missense	3850	exon9			CAAAGCCGCTGCC		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1762G>A	chr12.hg19:g.53183951C>T	ENSP00000413479:p.Gly588Ser	93.0	0.0	.		116.0	18.0	.	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	hg19	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307617	0.40795	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	D;D	0.91351	-2.83;-2.83	3.4	-1.34	0.09143	.	0.507655	0.14827	N	0.296110	T	0.80149	0.4570	N	0.22421	0.69	0.09310	N	1	B	0.18166	0.026	B	0.08055	0.003	T	0.65302	-0.6201	10	0.34782	T	0.22	.	7.4497	0.27231	0.0:0.4872:0.0:0.5128	.	588	P12035	K2C3_HUMAN	S	588;589	ENSP00000413479:G588S;ENSP00000312206:G589S	ENSP00000312206:G589S	G	-	1	0	KRT3	51470218	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-1.682000	0.01935	-0.284000	0.09102	-0.258000	0.10820	GGC	.	.	.	none		0.697	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
KRT3	3850	hgsc.bcm.edu	37	12	53183979	53183979	+	Silent	SNP	G	G	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr12:53183979G>A	ENST00000417996.2	-	9	1808	c.1734C>T	c.(1732-1734)ggC>ggT	p.G578G	KRT3_ENST00000309505.3_Silent_p.G579G	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	578	Gly-rich.|Tail.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						cgctgctgccgccgccaaatc	0.701																																					p.G578G		Atlas-SNP	.											.	KRT3	65	.	0			c.C1734T						PASS	.						12.0	28.0	22.0					12																	53183979		1691	3337	5028	SO:0001819	synonymous_variant	3850	exon9			GCTGCCGCCGCCA		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1734C>T	chr12.hg19:g.53183979G>A		106.0	0.0	.		123.0	15.0	.	NM_057088	A6NIS2|Q701L8	Silent	SNP	ENST00000417996.2	hg19	CCDS44895.1																																																																																			.	.	.	none		0.701	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
PPP1R12A	4659	hgsc.bcm.edu	37	12	80214604	80214604	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr12:80214604C>T	ENST00000450142.2	-	8	1330	c.1064G>A	c.(1063-1065)tGc>tAc	p.C355Y	PPP1R12A_ENST00000437004.2_Missense_Mutation_p.C355Y|RP11-530C5.2_ENST00000548469.1_RNA|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.C268Y|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.C355Y|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.C355Y	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	355					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						TTCACTAGAGCAGCTAGACTC	0.368																																					p.C355Y		Atlas-SNP	.											.	PPP1R12A	76	.	0			c.G1064A						PASS	.						200.0	195.0	196.0					12																	80214604		1899	4101	6000	SO:0001583	missense	4659	exon8			CTAGAGCAGCTAG	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.1064G>A	chr12.hg19:g.80214604C>T	ENSP00000389168:p.Cys355Tyr	36.0	0.0	.		48.0	12.0	.	NM_002480	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	hg19	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061280	0.76187	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000547131	T;T;T;T;T;T;T	0.46819	1.26;1.26;1.26;1.26;1.25;1.23;0.86	5.84	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.47248	0.1435	M	0.62723	1.935	0.80722	D	1	B;B;B;B	0.12630	0.003;0.006;0.003;0.004	B;B;B;B	0.10450	0.004;0.005;0.004;0.002	T	0.41378	-0.9512	10	0.42905	T	0.14	.	14.8529	0.70313	0.0:0.9312:0.0:0.0688	.	355;355;355;355	F8W8Q6;O14974-2;O14974-3;O14974	.;.;.;MYPT1_HUMAN	Y	355;355;355;355;355;355;355;268;355;355;50	ENSP00000261207:C355Y;ENSP00000389168:C355Y;ENSP00000416769:C355Y;ENSP00000449514:C268Y;ENSP00000446855:C355Y;ENSP00000446816:C355Y;ENSP00000450061:C50Y	ENSP00000261207:C355Y	C	-	2	0	PPP1R12A	78738735	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.247000	0.78257	1.471000	0.48121	-0.218000	0.12543	TGC	.	.	.	none		0.368	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
HECTD4	283450	hgsc.bcm.edu	37	12	112654883	112654883	+	Silent	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr12:112654883C>T	ENST00000430131.2	-	45	7070	c.5925G>A	c.(5923-5925)ctG>ctA	p.L1975L	HECTD4_ENST00000377560.5_Silent_p.L2225L|HECTD4_ENST00000550722.1_Silent_p.L2251L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1975					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TGCCCCGGGGCAGGCCTCCCC	0.547																																					p.L2263L		Atlas-SNP	.											.	.	.	.	0			c.G6789A						PASS	.						24.0	27.0	26.0					12																	112654883		1917	4130	6047	SO:0001819	synonymous_variant	283450	exon46			CCGGGGCAGGCCT	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.5925G>A	chr12.hg19:g.112654883C>T		250.0	1.0	.		345.0	144.0	.	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	C	9.259	1.042822	0.19748	.	.	ENSG00000173064	ENST00000550968	.	.	.	5.81	1.06	0.20224	.	.	.	.	.	T	0.60932	0.2307	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57142	-0.7862	4	.	.	.	.	12.0519	0.53511	0.5084:0.4018:0.0898:0.0	.	.	.	.	Y	142	.	.	C	-	2	0	C12orf51	111139266	0.864000	0.29904	1.000000	0.80357	0.996000	0.88848	-0.036000	0.12185	0.219000	0.20840	0.655000	0.94253	TGC	.	.	.	none		0.547	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
LPAR6	10161	hgsc.bcm.edu	37	13	48986185	48986185	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr13:48986185C>G	ENST00000378434.4	-	7	1999	c.375G>C	c.(373-375)aaG>aaC	p.K125N	RB1_ENST00000267163.4_Intron|LPAR6_ENST00000345941.2_Missense_Mutation_p.K125N	NM_005767.5	NP_005758.2	P43657	LPAR6_HUMAN	lysophosphatidic acid receptor 6	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.0?(15)|p.?(4)		NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	14						TTCTTAGAGTCTTTGACTTAA	0.418																																					p.K125N		Atlas-SNP	.											.	LPAR6	38	.	19	Whole gene deletion(15)|Unknown(4)	bone(10)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.G375C						PASS	.						38.0	38.0	38.0					13																	48986185		2203	4300	6503	SO:0001583	missense	10161	exon5			TAGAGTCTTTGAC	AF000546	CCDS9410.1	13q14	2012-08-08	2009-06-23	2009-06-23	ENSG00000139679	ENSG00000139679		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	15520	protein-coding gene	gene with protein product		609239	"""purinergic receptor P2Y, G-protein coupled, 5"""	P2RY5		11004484, 9755289, 19386608	Standard	NM_005767		Approved	P2Y5	uc010acu.3	P43657	OTTHUMG00000016895	ENST00000378434.4:c.375G>C	chr13.hg19:g.48986185C>G	ENSP00000367691:p.Lys125Asn	38.0	0.0	.		60.0	23.0	.	NM_001162497	A4FTW9|B3KVF2|F2YGU4|O15133|Q3KPF5|Q53FA0|Q5VW44|Q7Z3S0|Q7Z3S6	Missense_Mutation	SNP	ENST00000378434.4	hg19	CCDS9410.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097503	0.56075	.	.	ENSG00000139679	ENST00000378434;ENST00000345941	T;T	0.72167	-0.63;-0.63	6.06	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.051696	0.85682	D	0.000000	T	0.60483	0.2272	N	0.26042	0.785	0.38310	D	0.943225	P	0.37688	0.605	B	0.42959	0.403	T	0.58211	-0.7676	10	0.20046	T	0.44	.	11.8623	0.52474	0.0:0.8662:0.0:0.1338	.	125	P43657	LPAR6_HUMAN	N	125	ENSP00000367691:K125N;ENSP00000344353:K125N	ENSP00000344353:K125N	K	-	3	2	LPAR6	47884186	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.960000	0.40422	2.882000	0.98803	0.655000	0.94253	AAG	.	.	.	none		0.418	LPAR6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276280.2	NM_005767	
GALNT16	57452	hgsc.bcm.edu	37	14	69792741	69792741	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr14:69792741G>A	ENST00000337827.4	+	5	892	c.565G>A	c.(565-567)Gaa>Aaa	p.E189K	GALNT16_ENST00000553669.1_Missense_Mutation_p.E189K|GALNT16_ENST00000448469.3_Missense_Mutation_p.E189K	NM_001168368.1|NM_020692.2	NP_001161840.1|NP_065743.2	Q8N428	GLT16_HUMAN	polypeptide N-acetylgalactosaminyltransferase 16	189	Catalytic subdomain A.				protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										TGATCGGCGGGAAGGTGAGTC	0.572																																					p.E189K		Atlas-SNP	.											.	GALNT16	8	.	0			c.G565A						PASS	.						110.0	92.0	98.0					14																	69792741		2203	4300	6503	SO:0001583	missense	57452	exon5			CGGCGGGAAGGTG	AB032956	CCDS32107.1	14q24.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000100626	ENSG00000100626	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23233	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 16"""	615132	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16"""	GALNTL1		10574461, 22186971	Standard	NM_020692		Approved	KIAA1130, GalNAc-T16	uc010aqu.2	Q8N428	OTTHUMG00000171231	ENST00000337827.4:c.565G>A	chr14.hg19:g.69792741G>A	ENSP00000336729:p.Glu189Lys	64.0	0.0	.		54.0	15.0	.	NM_001168368	Q4KMG3|Q58A55|Q9ULT9	Missense_Mutation	SNP	ENST00000337827.4	hg19	CCDS32107.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524011	0.85600	.	.	ENSG00000100626	ENST00000337827;ENST00000448469;ENST00000553669	T;T;T	0.61040	0.14;0.14;0.14	5.66	5.66	0.87406	Glycosyl transferase, family 2 (1);	0.046825	0.85682	D	0.000000	T	0.76849	0.4045	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.78122	-0.2327	10	0.72032	D	0.01	.	19.3316	0.94293	0.0:0.0:1.0:0.0	.	189;189	Q8N428;Q58A55	GLTL1_HUMAN;.	K	189	ENSP00000336729:E189K;ENSP00000402970:E189K;ENSP00000451200:E189K	ENSP00000336729:E189K	E	+	1	0	GALNTL1	68862494	1.000000	0.71417	0.998000	0.56505	0.075000	0.17131	8.849000	0.92178	2.672000	0.90937	0.655000	0.94253	GAA	.	.	.	none		0.572	GALNT16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412434.1	NM_001168368	
RPS6KA5	9252	hgsc.bcm.edu	37	14	91389482	91389482	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr14:91389482C>T	ENST00000261991.3	-	6	850	c.677G>A	c.(676-678)aGa>aAa	p.R226K	RPS6KA5_ENST00000418736.2_Missense_Mutation_p.R226K|RPS6KA5_ENST00000536315.2_Missense_Mutation_p.R147K	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	226	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R226T(2)		endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		ATCTCCCCCTCTGACAATATC	0.333																																					p.R226K		Atlas-SNP	.											RPS6KA5_ENST00000261991,NS,carcinoma,0,1	RPS6KA5	135	.	2	Substitution - Missense(2)	lung(2)	c.G677A						PASS	.						146.0	127.0	133.0					14																	91389482		2203	4300	6503	SO:0001583	missense	9252	exon6			CCCCCTCTGACAA	AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.677G>A	chr14.hg19:g.91389482C>T	ENSP00000261991:p.Arg226Lys	78.0	0.0	.		69.0	22.0	.	NM_182398	O95316|Q96AF7	Missense_Mutation	SNP	ENST00000261991.3	hg19	CCDS9893.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.314437	0.23908	.	.	ENSG00000100784	ENST00000261991;ENST00000536315;ENST00000418736	T;T;T	0.64991	-0.13;-0.13;-0.13	5.51	3.56	0.40772	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.198563	0.56097	N	0.000040	T	0.41236	0.1150	N	0.17312	0.475	0.34057	D	0.656889	B;B	0.02656	0.0;0.0	B;B	0.12837	0.002;0.008	T	0.40346	-0.9568	10	0.23302	T	0.38	.	7.9107	0.29789	0.0:0.6634:0.0:0.3366	.	226;226	O75582-2;O75582	.;KS6A5_HUMAN	K	226;147;226	ENSP00000261991:R226K;ENSP00000442803:R147K;ENSP00000402787:R226K	ENSP00000261991:R226K	R	-	2	0	RPS6KA5	90459235	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	0.710000	0.25748	0.585000	0.29608	-0.136000	0.14681	AGA	.	.	.	none		0.333	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411442.2	NM_004755	
MTMR10	54893	hgsc.bcm.edu	37	15	31253167	31253167	+	Silent	SNP	C	C	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr15:31253167C>G	ENST00000435680.1	-	7	772	c.675G>C	c.(673-675)tcG>tcC	p.S225S	MTMR10_ENST00000314404.8_5'UTR|MTMR10_ENST00000563714.1_Silent_p.S143S|MTMR10_ENST00000425768.1_Missense_Mutation_p.R195P	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	225	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		TGTCCCAATCCGAGTAAGTTT	0.473																																					p.S225S		Atlas-SNP	.											.	MTMR10	74	.	0			c.G675C						PASS	.						79.0	78.0	78.0					15																	31253167		1916	4128	6044	SO:0001819	synonymous_variant	54893	exon7			CCAATCCGAGTAA	AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.675G>C	chr15.hg19:g.31253167C>G		32.0	0.0	.		21.0	5.0	.	NM_017762	Q6P4Q6	Silent	SNP	ENST00000435680.1	hg19	CCDS45204.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300096	0.40694	.	.	ENSG00000166912	ENST00000425768	T	0.54866	0.55	5.15	-10.3	0.00346	.	.	.	.	.	T	0.34513	0.0900	.	.	.	0.21579	N	0.999631	.	.	.	.	.	.	T	0.43814	-0.9368	6	0.52906	T	0.07	.	2.1171	0.03716	0.3931:0.1394:0.3328:0.1347	.	.	.	.	P	195	ENSP00000412314:R195P	ENSP00000412314:R195P	R	-	2	0	MTMR10	29040459	0.241000	0.23857	0.939000	0.37840	0.959000	0.62525	-0.487000	0.06505	-1.281000	0.02399	-0.440000	0.05779	CGG	.	.	.	none		0.473	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430747.1	NM_017762	
NEDD4	4734	hgsc.bcm.edu	37	15	56142779	56142779	+	Silent	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr15:56142779C>T	ENST00000508342.1	-	10	2864	c.2565G>A	c.(2563-2565)agG>agA	p.R855R	NEDD4_ENST00000506154.1_Silent_p.R839R|NEDD4_ENST00000338963.2_Silent_p.R783R|NEDD4_ENST00000435532.3_Silent_p.R436R	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	855	Mediates interaction with TNIK. {ECO:0000250}.|WW 3. {ECO:0000255|PROSITE- ProRule:PRU00224}.				adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TAAAGAAAGGCCTCCCATTTG	0.428																																					p.R783R		Atlas-SNP	.											.	NEDD4	167	.	0			c.G2349A						PASS	.						195.0	210.0	205.0					15																	56142779		2193	4292	6485	SO:0001819	synonymous_variant	4734	exon7			GAAAGGCCTCCCA	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.2565G>A	chr15.hg19:g.56142779C>T		110.0	0.0	.		137.0	55.0	.	NM_198400	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Silent	SNP	ENST00000508342.1	hg19		.	.	.	.	.	.	.	.	.	.	C	0.592	-0.832663	0.02713	.	.	ENSG00000069869	ENST00000508871	.	.	.	5.45	3.54	0.40534	.	.	.	.	.	T	0.59742	0.2216	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57289	-0.7837	4	.	.	.	.	9.8067	0.40797	0.0:0.7725:0.0:0.2275	.	.	.	.	D	446	.	.	G	-	2	0	NEDD4	53930071	0.985000	0.35326	1.000000	0.80357	0.048000	0.14542	0.200000	0.17257	1.438000	0.47492	-0.259000	0.10710	GGC	.	.	.	none		0.428	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400	
PARP6	56965	hgsc.bcm.edu	37	15	72533806	72533806	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr15:72533806T>G	ENST00000569795.1	-	24	2570	c.1883A>C	c.(1882-1884)tAc>tCc	p.Y628S	PARP6_ENST00000260376.7_3'UTR|PARP6_ENST00000413097.2_5'UTR|PARP6_ENST00000287196.9_Missense_Mutation_p.Y628S			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	628							NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						TCAGTTTGTGTAAACCTGAGT	0.527																																					p.Y628S		Atlas-SNP	.											.	PARP6	44	.	0			c.A1883C						PASS	.						90.0	86.0	87.0					15																	72533806		1931	4124	6055	SO:0001583	missense	56965	exon23			TTTGTGTAAACCT	AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.1883A>C	chr15.hg19:g.72533806T>G	ENSP00000456348:p.Tyr628Ser	60.0	0.0	.		45.0	14.0	.	NM_020214	Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Missense_Mutation	SNP	ENST00000569795.1	hg19	CCDS10241.2	.	.	.	.	.	.	.	.	.	.	T	17.27	3.348146	0.61183	.	.	ENSG00000137817	ENST00000287196	.	.	.	4.91	4.91	0.64330	.	9.159190	0.01062	N	0.004676	T	0.57961	0.2089	N	0.08118	0	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.70487	0.969;0.969	T	0.52909	-0.8512	9	0.23891	T	0.37	-0.7931	13.9137	0.63883	0.0:0.0:0.0:1.0	.	628;561	Q2NL67;A0PJ50	PARP6_HUMAN;.	S	628	.	ENSP00000287196:Y628S	Y	-	2	0	PARP6	70320860	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.927000	0.75840	2.061000	0.61500	0.528000	0.53228	TAC	.	.	.	none		0.527	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257315.2	NM_020214	
CACNA1H	8912	hgsc.bcm.edu	37	16	1268646	1268646	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr16:1268646C>T	ENST00000348261.5	+	33	6130	c.5882C>T	c.(5881-5883)cCc>cTc	p.P1961L	CACNA1H_ENST00000565831.1_Missense_Mutation_p.P1955L|CACNA1H_ENST00000358590.4_Missense_Mutation_p.P1955L	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1961					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GCCGGCACCCCCTTGGGTATG	0.672																																					p.P1961L		Atlas-SNP	.											.	CACNA1H	317	.	0			c.C5882T						PASS	.						8.0	9.0	9.0					16																	1268646		1934	4083	6017	SO:0001583	missense	8912	exon33			GCACCCCCTTGGG	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.5882C>T	chr16.hg19:g.1268646C>T	ENSP00000334198:p.Pro1961Leu	65.0	0.0	.		109.0	29.0	.	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	hg19	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.955207	0.34471	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96554	-4.05;-3.99	4.78	2.8	0.32819	.	1.245580	0.06297	U	0.700188	D	0.90563	0.7042	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.16802	0.0;0.019;0.0;0.0;0.0	B;B;B;B;B	0.20184	0.001;0.028;0.001;0.002;0.001	T	0.82121	-0.0614	10	0.31617	T	0.26	.	4.2002	0.10462	0.0:0.6028:0.2199:0.1773	.	707;696;702;1955;1961	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	L	1961;1955	ENSP00000334198:P1961L;ENSP00000351401:P1955L	ENSP00000334198:P1961L	P	+	2	0	CACNA1H	1208647	0.005000	0.15991	0.014000	0.15608	0.002000	0.02628	0.950000	0.29122	1.003000	0.39130	-0.257000	0.10917	CCC	.	.	.	none		0.672	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
SETD6	79918	hgsc.bcm.edu	37	16	58552019	58552019	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr16:58552019G>T	ENST00000219315.4	+	6	907	c.857G>T	c.(856-858)gGg>gTg	p.G286V	SETD6_ENST00000418480.1_Intron|SETD6_ENST00000310682.2_Missense_Mutation_p.G262V|SETD6_ENST00000394266.4_Missense_Mutation_p.G217V			Q8TBK2	SETD6_HUMAN	SET domain containing 6	286	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						AACACTTATGGGCAAATGGCT	0.463																																					p.G286V		Atlas-SNP	.											.	SETD6	27	.	0			c.G857T						PASS	.						150.0	121.0	131.0					16																	58552019		2198	4300	6498	SO:0001583	missense	79918	exon6			CTTATGGGCAAAT	AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.857G>T	chr16.hg19:g.58552019G>T	ENSP00000219315:p.Gly286Val	129.0	0.0	.		106.0	5.0	.	NM_001160305	A8K380|B5ME38|Q9H787	Missense_Mutation	SNP	ENST00000219315.4	hg19	CCDS54013.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618020	0.87359	.	.	ENSG00000103037	ENST00000310682;ENST00000394266;ENST00000219315	T;T;T	0.26660	1.72;1.72;1.72	5.72	5.72	0.89469	SET domain (2);	0.000000	0.85682	D	0.000000	T	0.64159	0.2573	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73569	-0.3941	10	0.87932	D	0	-19.1594	18.875	0.92331	0.0:0.0:1.0:0.0	.	286;262	Q8TBK2;Q8TBK2-2	SETD6_HUMAN;.	V	262;217;286	ENSP00000310082:G262V;ENSP00000377809:G217V;ENSP00000219315:G286V	ENSP00000219315:G286V	G	+	2	0	SETD6	57109520	1.000000	0.71417	0.979000	0.43373	0.993000	0.82548	9.219000	0.95173	2.689000	0.91719	0.650000	0.86243	GGG	.	.	.	none		0.463	SETD6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317274.2	NM_024860	
BCAR1	9564	hgsc.bcm.edu	37	16	75263502	75263502	+	Silent	SNP	A	A	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr16:75263502A>T	ENST00000162330.5	-	7	2646	c.2520T>A	c.(2518-2520)ccT>ccA	p.P840P	BCAR1_ENST00000393420.6_Silent_p.P858P|BCAR1_ENST00000535626.2_Silent_p.P692P|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000418647.3_Silent_p.P886P|BCAR1_ENST00000420641.3_Silent_p.P858P|BCAR1_ENST00000538440.2_Silent_p.P840P|BCAR1_ENST00000546196.1_Silent_p.P811P|BCAR1_ENST00000393422.2_Silent_p.P858P|RP11-331F4.4_ENST00000489723.1_RNA|BCAR1_ENST00000542031.2_Silent_p.P838P	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	840					actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GGGCCGCGGAAGGCGATGGGT	0.682																																					p.P886P		Atlas-SNP	.											.	BCAR1	184	.	0			c.T2658A						PASS	.						30.0	24.0	26.0					16																	75263502		2196	4299	6495	SO:0001819	synonymous_variant	9564	exon8			CGCGGAAGGCGAT	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.2520T>A	chr16.hg19:g.75263502A>T		74.0	0.0	.		69.0	28.0	.	NM_001170714	B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Silent	SNP	ENST00000162330.5	hg19	CCDS10915.1																																																																																			.	.	.	none		0.682	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269017.1	NM_014567	
PHF12	57649	hgsc.bcm.edu	37	17	27234650	27234650	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr17:27234650A>T	ENST00000332830.4	-	13	3309	c.2499T>A	c.(2497-2499)tgT>tgA	p.C833*	PHF12_ENST00000577226.1_3'UTR|PHF12_ENST00000582655.1_5'Flank	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			ACACGTAGTTACAGTGACCAT	0.537																																					p.C833X		Atlas-SNP	.											.	PHF12	69	.	0			c.T2499A						PASS	.						123.0	96.0	105.0					17																	27234650		2203	4300	6503	SO:0001587	stop_gained	57649	exon13			GTAGTTACAGTGA	AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.2499T>A	chr17.hg19:g.27234650A>T	ENSP00000329933:p.Cys833*	57.0	0.0	.		59.0	11.0	.	NM_001033561		Nonsense_Mutation	SNP	ENST00000332830.4	hg19	CCDS32598.1	.	.	.	.	.	.	.	.	.	.	A	46	12.355174	0.99660	.	.	ENSG00000109118	ENST00000332830	.	.	.	4.34	3.27	0.37495	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.8096	6.3665	0.21457	0.8029:0.0:0.1971:0.0	.	.	.	.	X	833	.	ENSP00000329933:C833X	C	-	3	2	PHF12	24258776	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.575000	0.53870	0.705000	0.31890	0.383000	0.25322	TGT	.	.	.	none		0.537	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255941.1	NM_020889	
CACNA1G	8913	hgsc.bcm.edu	37	17	48703733	48703733	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr17:48703733A>G	ENST00000359106.5	+	38	6755	c.6755A>G	c.(6754-6756)cAg>cGg	p.Q2252R	CACNA1G_ENST00000515411.1_Missense_Mutation_p.Q2189R|CACNA1G_ENST00000354983.4_Missense_Mutation_p.Q2218R|CACNA1G_ENST00000507510.2_Missense_Mutation_p.Q2207R|CACNA1G_ENST00000360761.4_Missense_Mutation_p.Q2136R|CACNA1G_ENST00000507896.1_Missense_Mutation_p.Q2069R|CACNA1G_ENST00000358244.5_Missense_Mutation_p.Q2046R|CACNA1G_ENST00000502264.1_Missense_Mutation_p.Q2181R|CACNA1G_ENST00000510366.1_Missense_Mutation_p.Q2107R|CACNA1G_ENST00000514717.1_Missense_Mutation_p.Q2102R|CACNA1G_ENST00000429973.2_Missense_Mutation_p.Q2141R|CACNA1G_ENST00000352832.5_Missense_Mutation_p.Q2125R|CTB-22K21.2_ENST00000502435.1_RNA|CACNA1G_ENST00000510115.1_Missense_Mutation_p.Q2173R|CACNA1G_ENST00000513964.1_Missense_Mutation_p.Q2114R|CACNA1G_ENST00000503485.1_Missense_Mutation_p.Q2125R|CACNA1G_ENST00000515165.1_Missense_Mutation_p.Q2159R|CACNA1G_ENST00000515765.1_Missense_Mutation_p.Q2196R|CACNA1G_ENST00000514181.1_Missense_Mutation_p.Q2134R|CACNA1G_ENST00000514079.1_Missense_Mutation_p.Q2166R|CACNA1G_ENST00000505165.1_Missense_Mutation_p.Q2080R|CACNA1G_ENST00000512389.1_Missense_Mutation_p.Q2148R|CACNA1G_ENST00000507609.1_Missense_Mutation_p.Q2152R|CACNA1G_ENST00000513689.2_Missense_Mutation_p.Q2162R|CACNA1G_ENST00000442258.2_Missense_Mutation_p.Q2118R|CACNA1G_ENST00000507336.1_Missense_Mutation_p.Q2241R	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	2252					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GTGGAGGCCCAGAGCTGCCAG	0.667											OREG0024569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q2252R		Atlas-SNP	.											.	CACNA1G	659	.	0			c.A6755G						PASS	.						17.0	23.0	21.0					17																	48703733		2033	4181	6214	SO:0001583	missense	8913	exon38			AGGCCCAGAGCTG	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.6755A>G	chr17.hg19:g.48703733A>G	ENSP00000352011:p.Gln2252Arg	71.0	0.0	.	956	129.0	31.0	.	NM_018896	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	hg19	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.143188	0.57044	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97752	-4.37;-4.35;-4.32;-4.37;-4.45;-4.38;-4.52;-4.48;-4.52;-4.51;-4.41;-4.35;-4.49;-4.36;-4.36;-4.4;-4.36;-4.4;-4.4;-4.4;-4.36;-4.4;-4.39;-4.44;-4.43	5.32	3.06	0.35304	.	1.379610	0.04274	N	0.342662	D	0.98340	0.9449	M	0.61703	1.905	0.42919	D	0.994288	D;B;B;D;D;P;D;P;D;B;B;P;B;P;P;D;D;P;P;B;D;B;P;P;P	0.67145	0.958;0.209;0.087;0.959;0.992;0.949;0.959;0.895;0.959;0.001;0.001;0.936;0.209;0.788;0.926;0.996;0.979;0.887;0.948;0.361;0.958;0.167;0.82;0.893;0.658	D;B;B;D;D;P;D;P;D;B;B;P;B;B;D;D;P;P;P;B;D;B;P;B;P	0.74348	0.943;0.038;0.08;0.956;0.983;0.599;0.935;0.573;0.956;0.001;0.001;0.669;0.056;0.304;0.956;0.936;0.69;0.604;0.7;0.077;0.943;0.04;0.504;0.4;0.645	D	0.91285	0.5054	10	0.51188	T	0.08	.	9.6137	0.39679	0.856:0.0:0.144:0.0	.	2102;2114;2107;2189;2162;2134;2166;2125;2152;2069;2080;2181;2148;2241;2141;2196;2159;2229;2207;2125;2118;2173;2136;2252;2046	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.	R	2136;2125;2218;2118;2181;2148;2114;2102;2107;2125;2207;2241;2162;2152;2173;2159;2134;2196;2166;2046;2252;2141;2189;2080;2069	ENSP00000353990:Q2136R;ENSP00000339302:Q2125R;ENSP00000347078:Q2218R;ENSP00000409759:Q2118R;ENSP00000425522:Q2181R;ENSP00000426261:Q2148R;ENSP00000425451:Q2114R;ENSP00000422407:Q2102R;ENSP00000426814:Q2107R;ENSP00000427238:Q2125R;ENSP00000423112:Q2207R;ENSP00000420918:Q2241R;ENSP00000426172:Q2162R;ENSP00000423045:Q2152R;ENSP00000427173:Q2173R;ENSP00000426098:Q2159R;ENSP00000425698:Q2134R;ENSP00000426232:Q2196R;ENSP00000423317:Q2166R;ENSP00000350979:Q2046R;ENSP00000352011:Q2252R;ENSP00000414388:Q2141R;ENSP00000423155:Q2189R;ENSP00000422268:Q2080R;ENSP00000421518:Q2069R	ENSP00000339302:Q2125R	Q	+	2	0	CACNA1G	46058732	1.000000	0.71417	0.341000	0.25589	0.972000	0.66771	3.389000	0.52516	0.324000	0.23333	0.379000	0.24179	CAG	.	.	.	none		0.667	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
CHMP1B	57132	hgsc.bcm.edu	37	18	11852058	11852058	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr18:11852058C>A	ENST00000526991.2	+	1	664	c.548C>A	c.(547-549)gCg>gAg	p.A183E	GNAL_ENST00000269162.5_Intron|GNAL_ENST00000423027.3_Intron|GNAL_ENST00000535121.1_Intron|GNAL_ENST00000334049.6_Intron|RP11-78A19.3_ENST00000586474.1_RNA	NM_020412.4	NP_065145.2	Q7LBR1	CHM1B_HUMAN	charged multivesicular body protein 1B	183	Interaction with SPAST.|Interaction with VPS4A, MITD1 and STAMBP.|Interaction with VPS4B.|Interaction with VTA1.				cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|protein transport (GO:0015031)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|lung(1)|urinary_tract(1)	3						GTGGCTTCGGCGGAGCAGGAT	0.617																																					p.A183E		Atlas-SNP	.											.	CHMP1B	16	.	0			c.C548A						PASS	.						19.0	24.0	22.0					18																	11852058		1963	4151	6114	SO:0001583	missense	57132	exon1			CTTCGGCGGAGCA	AF306520	CCDS54180.1	18p11.21	2011-09-21	2011-09-21		ENSG00000255112	ENSG00000255112		"""Charged multivesicular body proteins"""	24287	protein-coding gene	gene with protein product		606486	"""chromatin modifying protein 1B"""			15537668	Standard	NM_020412		Approved	CHMP1.5, C18orf2, Vps46B	uc002kqe.3	Q7LBR1	OTTHUMG00000165820	ENST00000526991.2:c.548C>A	chr18.hg19:g.11852058C>A	ENSP00000432279:p.Ala183Glu	43.0	0.0	.		33.0	10.0	.	NM_020412	Q96E89|Q9HD41	Missense_Mutation	SNP	ENST00000526991.2	hg19	CCDS54180.1	.	.	.	.	.	.	.	.	.	.	C	8.013	0.757866	0.15846	.	.	ENSG00000255112	ENST00000526991	D	0.85955	-2.05	5.21	4.34	0.51931	.	.	.	.	.	T	0.71005	0.3289	N	0.17564	0.495	0.36770	D	0.883757	B	0.02656	0.0	B	0.04013	0.001	T	0.65705	-0.6103	9	0.02654	T	1	.	13.9894	0.64357	0.0:0.8473:0.1526:0.0	.	183	Q7LBR1	CHM1B_HUMAN	E	183	ENSP00000432279:A183E	ENSP00000432279:A183E	A	+	2	0	CHMP1B	11842058	1.000000	0.71417	0.978000	0.43139	0.789000	0.44602	5.333000	0.65917	1.562000	0.49601	0.655000	0.94253	GCG	.	.	.	none		0.617	CHMP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386375.2	NM_020412	
TNPO2	30000	hgsc.bcm.edu	37	19	12816354	12816354	+	Silent	SNP	G	G	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr19:12816354G>T	ENST00000592287.1	-	16	1923	c.1815C>A	c.(1813-1815)gtC>gtA	p.V605V	TNPO2_ENST00000356861.5_Silent_p.V605V|TNPO2_ENST00000425528.1_Silent_p.V605V|TNPO2_ENST00000450764.2_Silent_p.V605V|TNPO2_ENST00000441499.1_Silent_p.V605V|SNORD41_ENST00000386967.1_RNA|TNPO2_ENST00000588216.1_Silent_p.V605V	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	605					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGCGCTGGTAGACGGGCTCAC	0.637																																					p.V605V		Atlas-SNP	.											.	TNPO2	108	.	0			c.C1815A						PASS	.						25.0	29.0	28.0					19																	12816354		2119	4218	6337	SO:0001819	synonymous_variant	30000	exon16			CTGGTAGACGGGC	AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.1815C>A	chr19.hg19:g.12816354G>T		99.0	0.0	.		128.0	45.0	.	NM_013433	O14655|Q6IN77	Silent	SNP	ENST00000592287.1	hg19	CCDS45991.1																																																																																			.	.	.	none		0.637	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433	
PAK4	10298	hgsc.bcm.edu	37	19	39663570	39663570	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr19:39663570G>C	ENST00000593690.1	+	5	644	c.217G>C	c.(217-219)Ggc>Cgc	p.G73R	PAK4_ENST00000599470.1_Intron|PAK4_ENST00000321944.4_Missense_Mutation_p.G73R|PAK4_ENST00000360442.3_Missense_Mutation_p.G73R|PAK4_ENST00000599386.1_Intron|PAK4_ENST00000358301.3_Missense_Mutation_p.G73R|PAK4_ENST00000435673.2_Missense_Mutation_p.G73R	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	73	Linker.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			CATCGTGCGGGGCAGCAAAGG	0.652																																					p.G73R		Atlas-SNP	.											.	PAK4	40	.	0			c.G217C						PASS	.						17.0	17.0	17.0					19																	39663570		2066	3994	6060	SO:0001583	missense	10298	exon3			GTGCGGGGCAGCA	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.217G>C	chr19.hg19:g.39663570G>C	ENSP00000469413:p.Gly73Arg	130.0	0.0	.		122.0	45.0	.	NM_001014832	B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Missense_Mutation	SNP	ENST00000593690.1	hg19	CCDS12528.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204131	0.79127	.	.	ENSG00000130669	ENST00000358301;ENST00000435673;ENST00000360442	T;T;T	0.51325	0.71;0.71;0.71	4.04	4.04	0.47022	.	0.122742	0.56097	D	0.000040	T	0.66655	0.2811	M	0.73598	2.24	0.50813	D	0.999891	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.974	T	0.68700	-0.5339	10	0.45353	T	0.12	.	13.7374	0.62827	0.0:0.0:1.0:0.0	.	73;73	O96013-4;O96013	.;PAK4_HUMAN	R	73	ENSP00000351049:G73R;ENSP00000392753:G73R;ENSP00000353625:G73R	ENSP00000351049:G73R	G	+	1	0	PAK4	44355410	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.256000	0.95535	2.085000	0.62840	0.555000	0.69702	GGC	.	.	.	none		0.652	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463823.1		
RABAC1	10567	hgsc.bcm.edu	37	19	42463044	42463044	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr19:42463044C>T	ENST00000222008.6	-	2	210	c.113G>A	c.(112-114)cGc>cAc	p.R38H	RABAC1_ENST00000601078.1_5'UTR|RABAC1_ENST00000601891.1_Missense_Mutation_p.R38H	NM_006423.2	NP_006414.2	Q9UI14	PRAF1_HUMAN	Rab acceptor 1 (prenylated)	38	Required for interaction with prenylated RAB3A and VAMP2. {ECO:0000250}.					cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	identical protein binding (GO:0042802)			central_nervous_system(1)|kidney(1)|prostate(1)	3						GGTCGCGCGGCGCCGCTCCAG	0.721																																					p.R38H		Atlas-SNP	.											.	RABAC1	6	.	0			c.G113A						PASS	.						20.0	19.0	19.0					19																	42463044		2187	4292	6479	SO:0001583	missense	10567	exon2			GCGCGGCGCCGCT	AJ133534	CCDS12593.1	19q13.2	2012-09-20			ENSG00000105404	ENSG00000105404			9794	protein-coding gene	gene with protein product	"""PRA1 domain family 1"", ""prenylated Rab acceptor 1"""	604925				10329441, 10751420	Standard	NM_006423		Approved	PRA1, PRAF1, YIP3	uc002osf.3	Q9UI14		ENST00000222008.6:c.113G>A	chr19.hg19:g.42463044C>T	ENSP00000222008:p.Arg38His	59.0	0.0	.		54.0	18.0	.	NM_006423	Q7Z4Y2|Q9Y3R1	Missense_Mutation	SNP	ENST00000222008.6	hg19	CCDS12593.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210649	0.79240	.	.	ENSG00000105404	ENST00000222008	T	0.46063	0.88	4.34	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.47600	0.1454	M	0.80847	2.515	0.80722	D	1	B	0.19073	0.033	B	0.19946	0.027	T	0.52442	-0.8575	10	0.51188	T	0.08	-7.2464	14.7269	0.69351	0.0:1.0:0.0:0.0	.	38	Q9UI14	PRAF1_HUMAN	H	38	ENSP00000222008:R38H	ENSP00000222008:R38H	R	-	2	0	RABAC1	47154884	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.894000	0.63206	2.413000	0.81919	0.561000	0.74099	CGC	.	.	.	none		0.721	RABAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463388.1	NM_006423	
CFAP61	26074	hgsc.bcm.edu	37	20	20243776	20243776	+	Splice_Site	SNP	T	T	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr20:20243776T>A	ENST00000245957.5	+	21	2579		c.e21+2		RP5-1096J16.1_ENST00000460400.1_RNA|C20orf26_ENST00000377293.1_Splice_Site|C20orf26_ENST00000389656.3_Splice_Site|C20orf26_ENST00000377309.2_Splice_Site	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN												NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		CCACAGAAGGTAAGGATGTCG	0.383																																					.		Atlas-SNP	.											.	C20orf26	188	.	0			c.2503+2T>A						PASS	.						97.0	93.0	94.0					20																	20243776		2203	4300	6503	SO:0001630	splice_region_variant	26074	exon21			AGAAGGTAAGGAT																												ENST00000245957.5:c.2503+2T>A	chr20.hg19:g.20243776T>A		95.0	0.0	.		125.0	22.0	.	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Splice_Site	SNP	ENST00000245957.5	hg19	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	T	16.98	3.271005	0.59540	.	.	ENSG00000089101	ENST00000343997;ENST00000377309;ENST00000389656;ENST00000389655;ENST00000245957;ENST00000377293	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4346	0.75137	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	C20orf26	20191776	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	5.997000	0.70646	2.223000	0.72356	0.533000	0.62120	.	.	.	.	none		0.383	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		Intron
SDC4	6385	hgsc.bcm.edu	37	20	43964542	43964542	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr20:43964542T>G	ENST00000372733.3	-	2	118	c.79A>C	c.(79-81)Atc>Ctc	p.I27L	SDC4_ENST00000537976.1_Intron	NM_002999.3	NP_002990.2	P31431	SDC4_HUMAN	syndecan 4	27					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stress fiber assembly (GO:0051496)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|costamere (GO:0043034)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)		SDC4/ROS1(7)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)	5		Myeloproliferative disorder(115;0.0122)				TGGGGGTCGATGACCTCAGTC	0.542			T	ROS1	NSCLC																																p.I27L		Atlas-SNP	.		Dom	yes		20	20q12	6385	syndecan 4		E	.	SDC4	16	.	0			c.A79C						PASS	.						58.0	54.0	55.0					20																	43964542		2203	4300	6503	SO:0001583	missense	6385	exon2			GGTCGATGACCTC	X67016, D13292	CCDS13350.1	20q12	2010-03-25	2007-02-15		ENSG00000124145	ENSG00000124145		"""Proteoglycans / Cell Surface : Syndecans"""	10661	protein-coding gene	gene with protein product	"""syndecan proteoglycan 4"""	600017	"""syndecan 4 (amphiglycan, ryudocan)"""			7916598, 1500433	Standard	NM_002999		Approved	SYND4, amphiglycan, ryudocan	uc002xnu.3	P31431	OTTHUMG00000033083	ENST00000372733.3:c.79A>C	chr20.hg19:g.43964542T>G	ENSP00000361818:p.Ile27Leu	4.0	0.0	.		39.0	26.0	.	NM_002999	O00773|Q16833|Q53FN9|Q6FGN3	Missense_Mutation	SNP	ENST00000372733.3	hg19	CCDS13350.1	.	.	.	.	.	.	.	.	.	.	T	8.734	0.917388	0.17982	.	.	ENSG00000124145	ENST00000372733	T	0.28069	1.63	4.79	3.69	0.42338	.	0.238198	0.44483	D	0.000451	T	0.22126	0.0533	M	0.63428	1.95	0.80722	D	1	B	0.27229	0.172	B	0.16289	0.015	T	0.09357	-1.0678	10	0.02654	T	1	-22.057	7.2188	0.25975	0.0:0.1034:0.0:0.8966	.	27	P31431	SDC4_HUMAN	L	27	ENSP00000361818:I27L	ENSP00000361818:I27L	I	-	1	0	SDC4	43397956	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	2.662000	0.46766	0.795000	0.33922	0.459000	0.35465	ATC	.	.	.	none		0.542	SDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080515.1	NM_002999	
ZNF335	63925	hgsc.bcm.edu	37	20	44588028	44588028	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr20:44588028G>T	ENST00000322927.2	-	15	2165	c.2065C>A	c.(2065-2067)Cac>Aac	p.H689N	ZNF335_ENST00000426788.1_Missense_Mutation_p.H534N	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	689					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				TTCTTCTTGTGCCGTGTGCTG	0.662																																					p.H689N		Atlas-SNP	.											.	ZNF335	115	.	0			c.C2065A						PASS	.						53.0	40.0	44.0					20																	44588028		2203	4300	6503	SO:0001583	missense	63925	exon15			TCTTGTGCCGTGT	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.2065C>A	chr20.hg19:g.44588028G>T	ENSP00000325326:p.His689Asn	86.0	0.0	.		76.0	23.0	.	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	hg19	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.809312	0.90707	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.01613	4.73;4.73	5.02	5.02	0.67125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.06508	0.0167	L	0.35644	1.08	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.78314	0.991;0.98	T	0.48896	-0.8994	10	0.44086	T	0.13	-29.7901	17.5159	0.87773	0.0:0.0:1.0:0.0	.	534;689	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	N	689;466;534	ENSP00000325326:H689N;ENSP00000397098:H534N	ENSP00000243961:H466N	H	-	1	0	ZNF335	44021435	1.000000	0.71417	0.969000	0.41365	0.943000	0.58893	9.113000	0.94321	2.607000	0.88179	0.561000	0.74099	CAC	.	.	.	none		0.662	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
ARFRP1	10139	hgsc.bcm.edu	37	20	62331971	62331971	+	Silent	SNP	G	G	C			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr20:62331971G>C	ENST00000359715.5	-	6	1067	c.501C>G	c.(499-501)gcC>gcG	p.A167A	ARFRP1_ENST00000324228.2_Silent_p.A167A|ARFRP1_ENST00000485858.1_5'UTR|ARFRP1_ENST00000609142.1_Silent_p.A167A|ARFRP1_ENST00000440854.1_Silent_p.A167A|ARFRP1_ENST00000607873.1_Silent_p.A120A			Q13795	ARFRP_HUMAN	ADP-ribosylation factor related protein 1	167					gastrulation (GO:0007369)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)			GGGCCGAGCAGGCCTGGGTCA	0.662																																					p.A167A		Atlas-SNP	.											.	ARFRP1	17	.	0			c.C501G						PASS	.						48.0	41.0	44.0					20																	62331971		2196	4290	6486	SO:0001819	synonymous_variant	10139	exon7			CGAGCAGGCCTGG	X91504	CCDS13533.1, CCDS46630.1, CCDS68172.1, CCDS68173.1	20q13.3	2014-05-09			ENSG00000101246	ENSG00000101246		"""ADP-ribosylation factors"""	662	protein-coding gene	gene with protein product		604699				8530503	Standard	NM_003224		Approved	ARP, Arp1, ARL18	uc031rup.1	Q13795	OTTHUMG00000032993	ENST00000359715.5:c.501C>G	chr20.hg19:g.62331971G>C		51.0	0.0	.		64.0	18.0	.	NM_001134758	B7ZKX7|E1P5J9|Q6IBQ0	Silent	SNP	ENST00000359715.5	hg19	CCDS13533.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400715	0.25291	.	.	ENSG00000101246	ENST00000217224	.	.	.	5.4	3.1	0.35709	.	.	.	.	.	T	0.62159	0.2405	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60475	-0.7256	4	.	.	.	-36.1778	11.6004	0.50999	0.2192:0.0:0.7808:0.0	.	.	.	.	V	95	.	.	L	-	1	2	ARFRP1	61802415	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	0.750000	0.26334	1.274000	0.44362	0.462000	0.41574	CTG	.	.	.	none		0.662	ARFRP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472024.1		
ZNRF3	84133	hgsc.bcm.edu	37	22	29445610	29445610	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr22:29445610G>A	ENST00000544604.2	+	8	1616	c.1441G>A	c.(1441-1443)Gag>Aag	p.E481K	ZNRF3_ENST00000332811.4_Missense_Mutation_p.E381K|ZNRF3_ENST00000402174.1_Missense_Mutation_p.E381K|ZNRF3_ENST00000406323.3_Missense_Mutation_p.E381K	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	481					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						CAGCTACCCGGAGCAGGAGGG	0.657																																					p.E481K		Atlas-SNP	.											.	ZNRF3	75	.	0			c.G1441A						PASS	.						31.0	35.0	33.0					22																	29445610		2098	4197	6295	SO:0001583	missense	84133	exon8			TACCCGGAGCAGG	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.1441G>A	chr22.hg19:g.29445610G>A	ENSP00000443824:p.Glu481Lys	48.0	0.0	.		40.0	10.0	.	NM_001206998	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Missense_Mutation	SNP	ENST00000544604.2	hg19	CCDS56225.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309517	0.81247	.	.	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000462485;ENST00000402174;ENST00000406323	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.53	5.53	0.82687	.	0.154870	0.64402	D	0.000019	T	0.78502	0.4293	L	0.56769	1.78	0.40137	D	0.976783	P	0.51057	0.941	B	0.43478	0.421	T	0.79152	-0.1921	10	0.36615	T	0.2	-10.7636	14.1104	0.65118	0.0:0.1501:0.8499:0.0	.	481	Q9ULT6	ZNRF3_HUMAN	K	481;381;188;381;381	ENSP00000443824:E481K;ENSP00000328614:E381K;ENSP00000384456:E381K;ENSP00000384553:E381K	ENSP00000328614:E381K	E	+	1	0	ZNRF3	27775610	1.000000	0.71417	0.986000	0.45419	0.898000	0.52572	6.564000	0.73969	2.593000	0.87608	0.655000	0.94253	GAG	.	.	.	none		0.657	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	
ZMYM3	9203	hgsc.bcm.edu	37	X	70472532	70472532	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chrX:70472532T>C	ENST00000353904.2	-	2	761	c.574A>G	c.(574-576)Agc>Ggc	p.S192G	ZMYM3_ENST00000373988.1_Missense_Mutation_p.S192G|ZMYM3_ENST00000373978.1_Missense_Mutation_p.S192G|ZMYM3_ENST00000373998.1_Missense_Mutation_p.S192G|ZMYM3_ENST00000373982.1_Missense_Mutation_p.S192G|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373984.3_Missense_Mutation_p.S192G|ZMYM3_ENST00000373981.1_Missense_Mutation_p.S192G|ZMYM3_ENST00000314425.5_Missense_Mutation_p.S192G	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	192					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					ACTGAAGGGCTAGGCGGGGCA	0.607																																					p.S192G		Atlas-SNP	.											.	ZMYM3	137	.	0			c.A574G						PASS	.						36.0	33.0	34.0					X																	70472532		2203	4300	6503	SO:0001583	missense	9203	exon2			AAGGGCTAGGCGG	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.574A>G	chrX.hg19:g.70472532T>C	ENSP00000343909:p.Ser192Gly	60.0	0.0	.		69.0	45.0	.	NM_005096	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	ENST00000353904.2	hg19	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	t	4.052	0.007331	0.07866	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981;ENST00000373978	T;T;T;T;T;T;T	0.47177	1.47;0.88;1.47;1.47;1.47;0.85;0.85	5.08	3.93	0.45458	.	1.057890	0.07351	N	0.882388	T	0.34048	0.0884	N	0.19112	0.55	0.23716	N	0.997031	B;B;B	0.31817	0.0;0.341;0.092	B;B;B	0.32980	0.001;0.156;0.074	T	0.23583	-1.0184	10	0.38643	T	0.18	-5.5579	7.0795	0.25223	0.0:0.1055:0.0:0.8945	.	192;192;192	Q96E26;Q14202-2;Q14202	.;.;ZMYM3_HUMAN	G	192	ENSP00000322845:S192G;ENSP00000363110:S192G;ENSP00000343909:S192G;ENSP00000363096:S192G;ENSP00000363100:S192G;ENSP00000363094:S192G;ENSP00000363093:S192G	ENSP00000322845:S192G	S	-	1	0	ZMYM3	70389257	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	1.530000	0.36007	1.681000	0.50988	0.352000	0.21897	AGC	.	.	.	none		0.607	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599	
HDAC8	55869	hgsc.bcm.edu	37	X	71792527	71792527	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chrX:71792527C>G	ENST00000373573.3	-	1	426	c.85G>C	c.(85-87)Gac>Cac	p.D29H	HDAC8_ENST00000429103.2_5'UTR|HDAC8_ENST00000373571.1_Missense_Mutation_p.D29H|HDAC8_ENST00000373556.3_Missense_Mutation_p.D29H|HDAC8_ENST00000373560.2_Missense_Mutation_p.D29H|HDAC8_ENST00000373554.1_Missense_Mutation_p.D29H|HDAC8_ENST00000439122.2_Missense_Mutation_p.D29H|HDAC8_ENST00000373559.4_Missense_Mutation_p.D29H|HDAC8_ENST00000373583.1_Missense_Mutation_p.D29H|HDAC8_ENST00000373589.4_Missense_Mutation_p.D29H|HDAC8_ENST00000478743.1_5'UTR|HDAC8_ENST00000373561.4_Missense_Mutation_p.D29H	NM_018486.2	NP_060956.1	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	29	Histone deacetylase.				chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cohesin localization to chromatin (GO:0071922)|sister chromatid cohesion (GO:0007062)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(3)|cervix(1)|endometrium(1)|lung(4)|prostate(1)	10	Renal(35;0.156)				Vorinostat(DB02546)	GCCAGGGAGTCACACATACTG	0.582																																					p.D29H		Atlas-SNP	.											.	HDAC8	18	.	0			c.G85C						PASS	.						86.0	79.0	81.0					X																	71792527		2203	4300	6503	SO:0001583	missense	55869	exon1			GGGAGTCACACAT	AF230097	CCDS14420.1, CCDS55448.1, CCDS55449.1, CCDS55450.1, CCDS55451.1, CCDS55452.1	Xq13	2014-01-29	2002-09-02	2002-09-06	ENSG00000147099	ENSG00000147099			13315	protein-coding gene	gene with protein product		300269	"""histone deacetylase-like 1"", ""Wilson-Turner X-linked mental retardation syndrome"""	HDACL1, WTS, MRXS6		10756090, 10922473, 22889856	Standard	NM_001166448		Approved	RPD3	uc004eau.3	Q9BY41	OTTHUMG00000021814	ENST00000373573.3:c.85G>C	chrX.hg19:g.71792527C>G	ENSP00000362674:p.Asp29His	93.0	0.0	.		40.0	23.0	.	NM_018486	A6ND12|A6ND61|A6NET3|A6NJR3|A8MQ62|B4DKN0|B4DV22|Q86VC8|Q9NP76|Q9NYH4	Missense_Mutation	SNP	ENST00000373573.3	hg19	CCDS14420.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.813872	0.70912	.	.	ENSG00000147099	ENST00000373573;ENST00000373583;ENST00000373589;ENST00000373568;ENST00000415409;ENST00000373571;ENST00000439122;ENST00000373560;ENST00000373559;ENST00000373561;ENST00000373556;ENST00000373554	T;T;T;T;T;T;T;T;T;T;T	0.74002	-0.55;-0.8;-0.8;-0.55;-0.55;-0.55;-0.55;-0.8;-0.55;-0.55;-0.55	4.77	4.77	0.60923	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.83188	0.5200	L	0.60957	1.885	0.54753	D	0.999988	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.971;0.971	D	0.83870	0.0273	10	0.51188	T	0.08	-14.3316	14.8087	0.69977	0.0:1.0:0.0:0.0	.	29;29;29;29	B4DH31;B4DKN0;B4DV22;Q9BY41	.;.;.;HDAC8_HUMAN	H	29	ENSP00000362674:D29H;ENSP00000362691:D29H;ENSP00000362669:D29H;ENSP00000396424:D29H;ENSP00000362672:D29H;ENSP00000414486:D29H;ENSP00000362661:D29H;ENSP00000362660:D29H;ENSP00000362662:D29H;ENSP00000362657:D29H;ENSP00000362655:D29H	ENSP00000362655:D29H	D	-	1	0	HDAC8	71709252	1.000000	0.71417	0.997000	0.53966	0.616000	0.37450	5.895000	0.69814	2.298000	0.77334	0.436000	0.28706	GAC	.	.	.	none		0.582	HDAC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057193.2	NM_018486	
MT-ND6	4541	hgsc.bcm.edu	37	M	14387	14387	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chrM:14387A>G	ENST00000361681.2	-	1	286	c.287T>C	c.(286-288)tTa>tCa	p.L96S	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	96					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CCTCCATCGCTAACCCCACTA	0.463																																					p.L96S		Atlas-SNP	.											.	.	.	.	0			c.T287C						PASS	.																																			SO:0001583	missense	0	exon1			ATCGCTAACCCCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.287T>C	chrM.hg19:g.14387A>G	ENSP00000354665:p.Leu96Ser	11.0	0.0	.		28.0	26.0	.	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.	.	none		0.463	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
CD109	135228	hgsc.bcm.edu	37	6	74502420	74502421	+	Frame_Shift_Ins	INS	-	-	AC			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr6:74502420_74502421insAC	ENST00000287097.5	+	23	2885_2886	c.2773_2774insAC	c.(2773-2775)aacfs	p.N925fs	CD109_ENST00000474094.1_3'UTR|CD109_ENST00000422508.2_Frame_Shift_Ins_p.N848fs|CD109_ENST00000437994.2_Frame_Shift_Ins_p.N925fs			Q6YHK3	CD109_HUMAN	CD109 molecule	925					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGGTGAACAGAACATGATAAAT	0.366																																					p.N925fs		Atlas-Indel,Pindel	.											.	CD109	170	.	0			c.2773_2774insAC						PASS	.																																			SO:0001589	frameshift_variant	135228	exon23			.	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2774_2775dupAC	chr6.hg19:g.74502421_74502422dupAC	ENSP00000287097:p.Asn925fs	70.0	0.0	0		40.0	14.0	0.35	NM_001159587	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Frame_Shift_Ins	INS	ENST00000287097.5	hg19	CCDS4982.1																																																																																			.	.	.	none		0.366	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
MUC5B	727897	hgsc.bcm.edu	37	11	1272670	1272678	+	In_Frame_Del	DEL	ATAGCCACC	ATAGCCACC	-	rs200249076|rs377533930|rs372504985		TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	ATAGCCACC	ATAGCCACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr11:1272670_1272678delATAGCCACC	ENST00000529681.1	+	31	14618_14626	c.14560_14568delATAGCCACC	c.(14560-14568)atagccaccdel	p.IAT4854del	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_In_Frame_Del_p.IAT4857del	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4854	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCGAGCACTATAGCCACCGTGATGGTGC	0.627																																					p.4853_4856del		Atlas-INDEL	.											.	MUC5B	473	.	0			c.14559_14567del						PASS	.																																			SO:0001651	inframe_deletion	727897	exon31			.	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14560_14568delATAGCCACC	chr11.hg19:g.1272670_1272678delATAGCCACC	ENSP00000436812:p.Ile4854_Thr4856del	130.0	0.0	0		96.0	14.0	0.145833	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	In_Frame_Del	DEL	ENST00000529681.1	hg19	CCDS44515.2																																																																																			.	.	.	none		0.627	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
BEST1	7439	hgsc.bcm.edu	37	11	61724395	61724396	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr11:61724395_61724396insT	ENST00000378043.4	+	5	1204_1205	c.561_562insT	c.(562-564)tttfs	p.F188fs	BEST1_ENST00000526988.1_Frame_Shift_Ins_p.F82fs|BEST1_ENST00000534553.1_Intron|BEST1_ENST00000435278.2_Frame_Shift_Ins_p.F188fs|BEST1_ENST00000301774.9_Intron|BEST1_ENST00000449131.2_Frame_Shift_Ins_p.F128fs|BEST1_ENST00000378042.3_Frame_Shift_Ins_p.F128fs	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	188					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						CCTGGGTGTGGTTTGCCAACCT	0.559																																					p.W187fs		Atlas-Indel,Pindel	.											.	BEST1	85	.	0			c.561_562insT						PASS	.																																			SO:0001589	frameshift_variant	7439	exon5			.	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.564dupT	chr11.hg19:g.61724398_61724398dupT	ENSP00000367282:p.Phe188fs	61.0	0.0	0		69.0	19.0	0.275362	NM_004183	A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Frame_Shift_Ins	INS	ENST00000378043.4	hg19	CCDS31580.1																																																																																			.	.	.	none		0.559	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	NM_004183	
ZNF225	7768	hgsc.bcm.edu	37	19	44635280	44635280	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr19:44635280delA	ENST00000262894.6	+	5	793	c.513delA	c.(511-513)tcafs	p.S171fs	ZNF225_ENST00000590612.1_Frame_Shift_Del_p.S171fs|ZNF225_ENST00000592780.1_3'UTR	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				AACTACAGTCAAGAGAGAAGT	0.398																																					p.S171X		Atlas-Indel,Pindel	.											.	ZNF225	41	.	0			c.512delC						PASS	.						88.0	91.0	90.0					19																	44635280		2074	4246	6320	SO:0001589	frameshift_variant	7768	exon5			.	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.513delA	chr19.hg19:g.44635280delA	ENSP00000262894:p.Ser171fs	75.0	0.0	0		89.0	11.0	0.123596	NM_013362	A8K8S2|Q53F12|Q9NS46|Q9UID8	Frame_Shift_Del	DEL	ENST00000262894.6	hg19	CCDS46100.1																																																																																			.	.	.	none		0.398	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
LPO	4025	hgsc.bcm.edu	37	17	56332255	56332255	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr17:56332255delC	ENST00000262290.4	+	9	1505	c.1189delC	c.(1189-1191)ctafs	p.L397fs	LPO_ENST00000543544.1_Frame_Shift_Del_p.L338fs|LPO_ENST00000421678.2_Frame_Shift_Del_p.L314fs|LPO_ENST00000582328.1_Frame_Shift_Del_p.L314fs	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	397					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						GGCCAGAGAACTAAAGAGACT	0.567																																					p.E396fs		Atlas-Indel,Pindel	.											.	LPO	73	.	0			c.1188delA						PASS	.						104.0	105.0	105.0					17																	56332255		2203	4300	6503	SO:0001589	frameshift_variant	4025	exon9			.	M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1189delC	chr17.hg19:g.56332255delC	ENSP00000262290:p.Leu397fs	107.0	0.0	0		81.0	38.0	0.469136	NM_006151	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Frame_Shift_Del	DEL	ENST00000262290.4	hg19	CCDS32689.1																																																																																			.	.	.	none		0.567	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1		
MUC5B	727897	hgsc.bcm.edu	37	11	1272664	1272668	+	Frame_Shift_Del	DEL	AGCAC	AGCAC	-	rs573266996		TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	AGCAC	AGCAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr11:1272664_1272668delAGCAC	ENST00000529681.1	+	31	14612_14616	c.14554_14558delAGCAC	c.(14554-14559)agcactfs	p.ST4852fs	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Frame_Shift_Del_p.ST4855fs	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4852	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CACAGAGCCGAGCACTATAGCCACC	0.624																																					p.4851_4853del		Atlas-INDEL	.											.	MUC5B	473	.	0			c.14553_14557del						PASS	.																																			SO:0001589	frameshift_variant	727897	exon31			.	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14554_14558delAGCAC	chr11.hg19:g.1272664_1272668delAGCAC	ENSP00000436812:p.Ser4852fs	129.0	0.0	0		93.0	14.0	0.150538	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Frame_Shift_Del	DEL	ENST00000529681.1	hg19	CCDS44515.2																																																																																			.	.	.	none		0.624	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
IGF1R	3480	hgsc.bcm.edu	37	15	99500486	99500513	+	Frame_Shift_Del	DEL	CCCTCGGCCTCCTCGTCCTCCCTGCCAC	CCCTCGGCCTCCTCGTCCTCCCTGCCAC	-	rs561256285|rs144738779|rs188857649|rs542567372|rs369254807	byFrequency	TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	CCCTCGGCCTCCTCGTCCTCCCTGCCAC	CCCTCGGCCTCCTCGTCCTCCCTGCCAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr15:99500486_99500513delCCCTCGGCCTCCTCGTCCTCCCTGCCAC	ENST00000268035.6	+	21	4530_4557	c.3919_3946delCCCTCGGCCTCCTCGTCCTCCCTGCCAC	c.(3919-3948)ccctcggcctcctcgtcctccctgccactgfs	p.PSASSSSLPL1307fs	RP11-654A16.3_ENST00000559468.1_RNA|IGF1R_ENST00000558762.1_Frame_Shift_Del_p.PSASSSSLPL1306fs	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	1307					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CCCCCTGGACCCCTCGGCCTCCTCGTCCTCCCTGCCACTGCCCGACAG	0.662																																					p.1306_1315del		Pindel	.											.	IGF1R	147	.	0			c.3918_3945del						PASS	.																																			SO:0001589	frameshift_variant	3480	exon21			.	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.3919_3946delCCCTCGGCCTCCTCGTCCTCCCTGCCAC	chr15.hg19:g.99500486_99500513delCCCTCGGCCTCCTCGTCCTCCCTGCCAC	ENSP00000268035:p.Pro1307fs	96.0	0.0	.		71.0	13.0	0.183	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Frame_Shift_Del	DEL	ENST00000268035.6	hg19	CCDS10378.1																																																																																			.	.	.	none		0.662	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
MUC5B	727897	hgsc.bcm.edu	37	11	1272661	1272678	+	In_Frame_Del	DEL	CCGAGCACTATAGCCACC	CCGAGCACTATAGCCACC	-	rs201730803|rs377533930|rs372504985|rs573266996|rs201218727|rs200249076		TCGA-2Z-A9JM-01A-12D-A42J-10	TCGA-2Z-A9JM-10A-01D-A42M-10	CCGAGCACTATAGCCACC	CCGAGCACTATAGCCACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5f432901-8404-4499-ac42-e4560804eee8	db9c908a-91c7-4c8f-b608-39bc3e98d82b	g.chr11:1272661_1272678delCCGAGCACTATAGCCACC	ENST00000529681.1	+	31	14609_14626	c.14551_14568delCCGAGCACTATAGCCACC	c.(14551-14568)ccgagcactatagccaccdel	p.PSTIAT4851del	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_In_Frame_Del_p.PSTIAT4854del	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4851	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTCACAGAGCCGAGCACTATAGCCACCGTGATGGTGC	0.624																																					p.4850_4856del		Pindel	.											.	MUC5B	473	.	0			c.14550_14567del						PASS	.																																			SO:0001651	inframe_deletion	727897	exon31			.	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14551_14568delCCGAGCACTATAGCCACC	chr11.hg19:g.1272661_1272678delCCGAGCACTATAGCCACC	ENSP00000436812:p.Pro4851_Thr4856del	136.0	0.0	.		96.0	15.0	0.156	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	In_Frame_Del	DEL	ENST00000529681.1	hg19	CCDS44515.2																																																																																			.	.	.	none		0.624	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
