#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OTUD3	23252	hgsc.bcm.edu	37	1	20233044	20233044	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr1:20233044G>A	ENST00000375120.3	+	7	956	c.955G>A	c.(955-957)Gaa>Aaa	p.E319K		NM_015207.1	NP_056022.1	Q5T2D3	OTUD3_HUMAN	OTU deubiquitinase 3	319					protein K11-linked deubiquitination (GO:0035871)|protein K6-linked deubiquitination (GO:0044313)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|kidney(2)|large_intestine(4)|lung(1)|skin(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCAGGACCGAAAACAATAA	0.517																																					p.E319K		Atlas-SNP	.											.	OTUD3	25	.	0			c.G955A						PASS	.						103.0	105.0	104.0					1																	20233044		1965	4159	6124	SO:0001583	missense	23252	exon7			AGGACCGAAAACA	AB007928	CCDS41279.1	1p36.13	2014-02-24	2014-02-24		ENSG00000169914	ENSG00000169914		"""OTU domain containing"""	29038	protein-coding gene	gene with protein product		611758	"""OTU domain containing 3"""			9455484, 23827681	Standard	NM_015207		Approved	KIAA0459, DUBA4	uc001bcs.4	Q5T2D3	OTTHUMG00000002696	ENST00000375120.3:c.955G>A	chr1.hg19:g.20233044G>A	ENSP00000364261:p.Glu319Lys	151.0	0.0	.		126.0	10.0	.	NM_015207	O75047	Missense_Mutation	SNP	ENST00000375120.3	hg19	CCDS41279.1	.	.	.	.	.	.	.	.	.	.	G	6.303	0.424020	0.11928	.	.	ENSG00000169914	ENST00000375120	T	0.22945	1.93	5.88	5.88	0.94601	.	0.213831	0.47852	D	0.000207	T	0.21841	0.0526	L	0.47716	1.5	0.51012	D	0.999906	B	0.28880	0.226	B	0.20184	0.028	T	0.04796	-1.0926	10	0.07990	T	0.79	.	16.9476	0.86233	0.0:0.0:1.0:0.0	.	319	Q5T2D3	OTUD3_HUMAN	K	319	ENSP00000364261:E319K	ENSP00000364261:E319K	E	+	1	0	OTUD3	20105631	0.995000	0.38212	0.187000	0.23214	0.047000	0.14425	4.223000	0.58587	2.785000	0.95823	0.650000	0.86243	GAA	.	.	.	none		0.517	OTUD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007655.1		
INADL	10207	hgsc.bcm.edu	37	1	62253584	62253584	+	Silent	SNP	C	C	G			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr1:62253584C>G	ENST00000371158.2	+	8	1122	c.1008C>G	c.(1006-1008)ccC>ccG	p.P336P	INADL_ENST00000316485.6_Silent_p.P336P	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	336					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						CAGTCACCCCCCCTGCCCCTG	0.502																																					p.P336P		Atlas-SNP	.											.	INADL	179	.	0			c.C1008G						PASS	.						88.0	80.0	83.0					1																	62253584		2203	4300	6503	SO:0001819	synonymous_variant	10207	exon8			CACCCCCCCTGCC	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.1008C>G	chr1.hg19:g.62253584C>G		44.0	0.0	.		46.0	13.0	.	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Silent	SNP	ENST00000371158.2	hg19	CCDS617.2																																																																																			.	.	.	none		0.502	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
ATG4C	84938	hgsc.bcm.edu	37	1	63294738	63294738	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr1:63294738A>G	ENST00000317868.4	+	7	1031	c.824A>G	c.(823-825)cAg>cGg	p.Q275R	ATG4C_ENST00000371120.3_Missense_Mutation_p.Q275R	NM_032852.3	NP_116241.2	Q96DT6	ATG4C_HUMAN	autophagy related 4C, cysteine peptidase	275					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|protein targeting to membrane (GO:0006612)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)		ATG4C/FBXO38(2)	NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(3)|ovary(1)|prostate(2)	19						ATTGATAAACAGAGTGCTTCC	0.299																																					p.Q275R		Atlas-SNP	.											.	ATG4C	96	.	0			c.A824G						PASS	.						66.0	69.0	68.0					1																	63294738		2203	4300	6503	SO:0001583	missense	84938	exon7			ATAAACAGAGTGC	AK027773	CCDS623.1	1p31.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000125703	ENSG00000125703			16040	protein-coding gene	gene with protein product		611339	"""AUT (S. cerevisiae)-like 1, cysteine endopeptidase; AUT-like 1, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog C (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog C (S. cerevisiae)"""	AUTL1, APG4C		12446702	Standard	NM_032852		Approved	FLJ14867, AUTL3	uc001dau.3	Q96DT6	OTTHUMG00000009142	ENST00000317868.4:c.824A>G	chr1.hg19:g.63294738A>G	ENSP00000322159:p.Gln275Arg	133.0	0.0	.		133.0	37.0	.	NM_178221	A6NLR8|D3DQ58|Q96K04	Missense_Mutation	SNP	ENST00000317868.4	hg19	CCDS623.1	.	.	.	.	.	.	.	.	.	.	A	9.217	1.032295	0.19590	.	.	ENSG00000125703	ENST00000317868;ENST00000371120;ENST00000540025;ENST00000414558	T;T	0.40756	1.02;1.02	5.69	4.49	0.54785	.	0.258613	0.39615	N	0.001310	T	0.26376	0.0644	L	0.54323	1.7	0.38573	D	0.949985	B	0.23650	0.089	B	0.38156	0.266	T	0.09314	-1.0680	10	0.11794	T	0.64	-11.6012	11.6985	0.51556	0.8677:0.0:0.0:0.1323	.	275	Q96DT6	ATG4C_HUMAN	R	275;275;275;19	ENSP00000322159:Q275R;ENSP00000360161:Q275R	ENSP00000322159:Q275R	Q	+	2	0	ATG4C	63067326	1.000000	0.71417	0.934000	0.37439	0.772000	0.43724	5.596000	0.67570	2.162000	0.67917	0.533000	0.62120	CAG	.	.	.	none		0.299	ATG4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025332.2	NM_032852	
FMO2	2327	hgsc.bcm.edu	37	1	171162500	171162500	+	Silent	SNP	T	T	C			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr1:171162500T>C	ENST00000209929.7	+	3	317	c.159T>C	c.(157-159)agT>agC	p.S53S	FMO2_ENST00000441535.1_Silent_p.S53S|FMO2_ENST00000529935.1_3'UTR			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	53					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GCCGAGCAAGTATCTATCAAT	0.348																																					p.S53S		Atlas-SNP	.											.	FMO2	66	.	0			c.T159C						PASS	.						111.0	111.0	111.0					1																	171162500		2203	4300	6503	SO:0001819	synonymous_variant	2327	exon3			AGCAAGTATCTAT	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.159T>C	chr1.hg19:g.171162500T>C		89.0	0.0	.		53.0	21.0	.	NM_001460	Q53XR0	Silent	SNP	ENST00000209929.7	hg19	CCDS1293.1																																																																																			.	.	.	none		0.348	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086216.2	NM_001460	
ZAP70	7535	hgsc.bcm.edu	37	2	98354318	98354318	+	Silent	SNP	C	C	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr2:98354318C>T	ENST00000264972.5	+	12	1796	c.1581C>T	c.(1579-1581)gtC>gtT	p.V527V	ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Silent_p.V401V|ZAP70_ENST00000451498.2_Silent_p.V220V	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	527	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						GCTATGGGGTCACCATGTGGG	0.647																																					p.V527V		Atlas-SNP	.											.	ZAP70	77	.	0			c.C1581T						PASS	.						121.0	129.0	127.0					2																	98354318		2203	4300	6503	SO:0001819	synonymous_variant	7535	exon12			TGGGGTCACCATG	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.1581C>T	chr2.hg19:g.98354318C>T		73.0	0.0	.		60.0	22.0	.	NM_001079	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Silent	SNP	ENST00000264972.5	hg19	CCDS33254.1																																																																																			.	.	.	none		0.647	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1		
NEB	4703	hgsc.bcm.edu	37	2	152410531	152410531	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr2:152410531G>T	ENST00000172853.10	-	98	14481	c.14334C>A	c.(14332-14334)taC>taA	p.Y4778*	NEB_ENST00000427231.2_Nonsense_Mutation_p.Y6479*|NEB_ENST00000604864.1_Nonsense_Mutation_p.Y6479*|NEB_ENST00000603639.1_Nonsense_Mutation_p.Y6479*|NEB_ENST00000409198.1_Nonsense_Mutation_p.Y4778*|NEB_ENST00000397345.3_Nonsense_Mutation_p.Y6479*			P20929	NEBU_HUMAN	nebulin	4778					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AAACTGATCTGTACAGGCGCT	0.438																																					p.Y6479X		Atlas-SNP	.											.	NEB	1697	.	0			c.C19437A						PASS	.						140.0	133.0	135.0					2																	152410531		1915	4127	6042	SO:0001587	stop_gained	4703	exon126			TGATCTGTACAGG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.14334C>A	chr2.hg19:g.152410531G>T	ENSP00000172853:p.Tyr4778*	90.0	0.0	.		74.0	4.0	.	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Nonsense_Mutation	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	G	55	24.727022	0.99962	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	.	.	.	5.48	4.6	0.57074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1907	0.65637	0.0716:0.0:0.9284:0.0	.	.	.	.	X	4778;6479;6479;827;1209;4778	.	ENSP00000172853:Y4778X	Y	-	3	2	NEB	152118777	1.000000	0.71417	0.999000	0.59377	0.573000	0.36030	5.221000	0.65272	1.307000	0.44944	0.655000	0.94253	TAC	.	.	.	none		0.438	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
PROM1	8842	hgsc.bcm.edu	37	4	16002183	16002183	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr4:16002183A>T	ENST00000510224.1	-	14	1762	c.1514T>A	c.(1513-1515)tTt>tAt	p.F505Y	PROM1_ENST00000539194.1_Missense_Mutation_p.F505Y|PROM1_ENST00000508167.1_Missense_Mutation_p.F496Y|PROM1_ENST00000505450.1_Missense_Mutation_p.F496Y|PROM1_ENST00000540805.1_Missense_Mutation_p.F505Y|PROM1_ENST00000543373.1_Missense_Mutation_p.F496Y|PROM1_ENST00000447510.2_Missense_Mutation_p.F505Y			O43490	PROM1_HUMAN	prominin 1	505					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						ACCAAAGACAAAGGTAAGAAC	0.343																																					p.F505Y		Atlas-SNP	.											.	PROM1	91	.	0			c.T1514A						PASS	.						76.0	70.0	72.0					4																	16002183		1837	4094	5931	SO:0001583	missense	8842	exon13			AAGACAAAGGTAA	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.1514T>A	chr4.hg19:g.16002183A>T	ENSP00000426809:p.Phe505Tyr	34.0	0.0	.		41.0	15.0	.	NM_006017	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	ENST00000510224.1	hg19	CCDS47029.1	.	.	.	.	.	.	.	.	.	.	A	17.22	3.335153	0.60853	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.80232	0.4585	M	0.83603	2.65	0.54753	D	0.999987	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;0.995;1.0	T	0.83241	-0.0058	10	0.66056	D	0.02	-26.3108	14.25	0.66013	1.0:0.0:0.0:0.0	.	496;505;496;505;496;505	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	Y	505;505;505;496;496;505;496	ENSP00000415481:F505Y;ENSP00000438045:F505Y;ENSP00000443620:F505Y;ENSP00000426090:F496Y;ENSP00000427346:F496Y;ENSP00000426809:F505Y;ENSP00000445526:F496Y	ENSP00000415481:F505Y	F	-	2	0	PROM1	15611281	1.000000	0.71417	0.152000	0.22495	0.088000	0.18126	8.629000	0.90983	1.994000	0.58287	0.528000	0.53228	TTT	.	.	.	none		0.343	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	
MANBA	4126	hgsc.bcm.edu	37	4	103560989	103560989	+	Missense_Mutation	SNP	G	G	T	rs142814374		TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr4:103560989G>T	ENST00000226578.4	-	14	1994	c.1895C>A	c.(1894-1896)aCa>aAa	p.T632K	MANBA_ENST00000505239.1_Missense_Mutation_p.T575K	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	632					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		TTCAGTTTCTGTTTTGACACA	0.463																																					p.T632K		Atlas-SNP	.											.	MANBA	78	.	0			c.C1895A						PASS	.						119.0	102.0	107.0					4																	103560989		2203	4300	6503	SO:0001583	missense	4126	exon14			GTTTCTGTTTTGA		CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1895C>A	chr4.hg19:g.103560989G>T	ENSP00000226578:p.Thr632Lys	87.0	0.0	.		82.0	4.0	.	NM_005908	Q96BC3|Q9NYX9	Missense_Mutation	SNP	ENST00000226578.4	hg19	CCDS3658.1	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791881	0.70452	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	T;T	0.55588	0.51;0.51	5.7	2.08	0.27032	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.570170	0.20271	N	0.095654	T	0.64659	0.2618	M	0.90483	3.12	0.34404	D	0.695608	D;P	0.56035	0.974;0.955	P;P	0.50537	0.556;0.643	T	0.74253	-0.3725	10	0.49607	T	0.09	-11.3782	9.088	0.36592	0.3294:0.0:0.6706:0.0	.	575;632	E9PFW2;O00462	.;MANBA_HUMAN	K	632;575	ENSP00000226578:T632K;ENSP00000427322:T575K	ENSP00000226578:T632K	T	-	2	0	MANBA	103780037	0.996000	0.38824	0.996000	0.52242	0.991000	0.79684	0.723000	0.25939	0.363000	0.24346	0.650000	0.86243	ACA	.	.	.	none		0.463	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
C5orf42	65250	hgsc.bcm.edu	37	5	37170251	37170251	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr5:37170251A>C	ENST00000508244.1	-	32	6447	c.6354T>G	c.(6352-6354)ttT>ttG	p.F2118L	C5orf42_ENST00000274258.7_Missense_Mutation_p.F998L|C5orf42_ENST00000425232.2_Missense_Mutation_p.F2118L			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2118						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GTGGTTTAATAAAAAATCTCT	0.438																																					p.F2118L		Atlas-SNP	.											.	C5orf42	422	.	0			c.T6354G						PASS	.						165.0	168.0	167.0					5																	37170251		2203	4300	6503	SO:0001583	missense	65250	exon33			TTTAATAAAAAAT		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.6354T>G	chr5.hg19:g.37170251A>C	ENSP00000421690:p.Phe2118Leu	108.0	0.0	.		132.0	41.0	.	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	A	12.09	1.833277	0.32421	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.21543	2.01;2.01;2.0;2.01	5.12	-6.03	0.02185	.	1.591830	0.03542	N	0.224092	T	0.12646	0.0307	L	0.38838	1.175	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.24548	-1.0157	10	0.11485	T	0.65	.	4.8926	0.13735	0.4906:0.0:0.278:0.2315	.	2118;998	E9PH94;Q9H799	.;CE042_HUMAN	L	2118;2118;998;1166;998	ENSP00000421690:F2118L;ENSP00000389014:F2118L;ENSP00000274258:F998L;ENSP00000424223:F1166L	ENSP00000274258:F998L	F	-	3	2	C5orf42	37206008	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-1.670000	0.01956	-1.006000	0.03412	-0.375000	0.07067	TTT	.	.	.	none		0.438	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
LRRC1	55227	hgsc.bcm.edu	37	6	53784349	53784349	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr6:53784349T>A	ENST00000370888.1	+	12	1437	c.1160T>A	c.(1159-1161)cTa>cAa	p.L387Q	RP3-523E19.2_ENST00000474641.2_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	387						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		GCTCTGTGGCTATCTGACAAC	0.428																																					p.L387Q		Atlas-SNP	.											.	LRRC1	59	.	0			c.T1160A						PASS	.						87.0	82.0	83.0					6																	53784349		1935	4146	6081	SO:0001583	missense	55227	exon12			TGTGGCTATCTGA	AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.1160T>A	chr6.hg19:g.53784349T>A	ENSP00000359925:p.Leu387Gln	105.0	0.0	.		91.0	28.0	.	NM_018214	Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	hg19	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	T	23.9	4.471168	0.84533	.	.	ENSG00000137269	ENST00000370888	D	0.91068	-2.78	5.69	5.69	0.88448	.	0.177730	0.37761	N	0.001948	D	0.96445	0.8840	H	0.95365	3.66	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.97646	1.0151	10	0.87932	D	0	.	15.135	0.72558	0.0:0.0:0.0:1.0	.	387	Q9BTT6	LRRC1_HUMAN	Q	387	ENSP00000359925:L387Q	ENSP00000359925:L387Q	L	+	2	0	LRRC1	53892308	1.000000	0.71417	0.648000	0.29521	0.953000	0.61014	7.698000	0.84413	2.163000	0.67991	0.533000	0.62120	CTA	.	.	.	none		0.428	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168	
MPP6	51678	hgsc.bcm.edu	37	7	24690128	24690128	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr7:24690128A>G	ENST00000222644.5	+	5	698	c.448A>G	c.(448-450)Aat>Gat	p.N150D	MPP6_ENST00000409761.1_Missense_Mutation_p.N38D|MPP6_ENST00000396475.2_Missense_Mutation_p.N150D			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						GGTTGAAAATAATGATCTGGT	0.353																																					p.N150D		Atlas-SNP	.											.	MPP6	62	.	0			c.A448G						PASS	.						69.0	72.0	71.0					7																	24690128		2203	4300	6503	SO:0001583	missense	51678	exon6			GAAAATAATGATC	AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.448A>G	chr7.hg19:g.24690128A>G	ENSP00000222644:p.Asn150Asp	77.0	0.0	.		81.0	31.0	.	NM_016447	B2RAF0	Missense_Mutation	SNP	ENST00000222644.5	hg19	CCDS5388.1	.	.	.	.	.	.	.	.	.	.	A	15.88	2.962360	0.53400	.	.	ENSG00000105926	ENST00000432190;ENST00000222644;ENST00000409761;ENST00000396475;ENST00000430180	T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82	6.06	6.06	0.98353	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000009	T	0.14270	0.0345	N	0.04132	-0.27	0.41810	D	0.989969	B	0.09022	0.002	B	0.15484	0.013	T	0.12502	-1.0545	10	0.32370	T	0.25	.	15.1804	0.72952	1.0:0.0:0.0:0.0	.	150	Q9NZW5	MPP6_HUMAN	D	150;150;38;150;150	ENSP00000395859:N150D;ENSP00000222644:N150D;ENSP00000386262:N38D;ENSP00000379737:N150D;ENSP00000391020:N150D	ENSP00000222644:N150D	N	+	1	0	MPP6	24656653	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.920000	0.75799	2.324000	0.78689	0.533000	0.62120	AAT	.	.	.	none		0.353	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250272.4		
TBRG4	9238	hgsc.bcm.edu	37	7	45148711	45148711	+	Silent	SNP	T	T	C			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr7:45148711T>C	ENST00000258770.3	-	2	247	c.126A>G	c.(124-126)tcA>tcG	p.S42S	TBRG4_ENST00000471142.1_5'UTR|TBRG4_ENST00000361278.3_Silent_p.S42S|TBRG4_ENST00000395655.4_Silent_p.S42S|TBRG4_ENST00000494076.1_Silent_p.S42S	NM_004749.3	NP_004740.2	Q969Z0	TBRG4_HUMAN	transforming growth factor beta regulator 4	42					cell cycle arrest (GO:0007050)|cellular respiration (GO:0045333)|positive regulation of cell proliferation (GO:0008284)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(2)	17						GTGAGGTGGCTGAGGAAGTCA	0.587																																					p.S53S		Atlas-SNP	.											.	TBRG4	52	.	0			c.A159G						PASS	.						99.0	90.0	93.0					7																	45148711		2203	4300	6503	SO:0001819	synonymous_variant	9238	exon2			GGTGGCTGAGGAA	AB023165	CCDS5501.1, CCDS5502.1	7p13	2006-07-07			ENSG00000136270	ENSG00000136270			17443	protein-coding gene	gene with protein product	"""FAST kinase domains 4"", ""cell cycle progression 2 protein"""	611325				9383053	Standard	NM_004749		Approved	Cpr2, KIAA0948, H_TD2522F11.8, FASTKD4	uc011kcd.3	Q969Z0	OTTHUMG00000129247	ENST00000258770.3:c.126A>G	chr7.hg19:g.45148711T>C		87.0	0.0	.		95.0	21.0	.	NM_001261834	A4D2L2|A4D2L3|D3DVL5|D3DVL6|O14710|Q53GI8|Q8NDM4|Q9BUC6|Q9Y2F6	Silent	SNP	ENST00000258770.3	hg19	CCDS5501.1																																																																																			.	.	.	none		0.587	TBRG4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251351.1	NM_030900	
MTUS1	57509	hgsc.bcm.edu	37	8	17611702	17611702	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr8:17611702C>T	ENST00000262102.6	-	2	1839	c.1615G>A	c.(1615-1617)Gcc>Acc	p.A539T	MTUS1_ENST00000381862.3_Missense_Mutation_p.A539T|MTUS1_ENST00000519263.1_Missense_Mutation_p.A539T|MTUS1_ENST00000381869.3_Missense_Mutation_p.A539T	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	539					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		GGTGATGAGGCACTGGTCTGC	0.423																																					p.A539T		Atlas-SNP	.											.	MTUS1	144	.	0			c.G1615A						PASS	.						219.0	211.0	214.0					8																	17611702		2079	4207	6286	SO:0001583	missense	57509	exon2			ATGAGGCACTGGT	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.1615G>A	chr8.hg19:g.17611702C>T	ENSP00000262102:p.Ala539Thr	44.0	0.0	.		60.0	26.0	.	NM_001001924	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	hg19	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.378332	0.24944	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.35973	3.03;1.28;3.03;2.05	5.1	3.26	0.37387	.	0.753950	0.11344	N	0.573725	T	0.22666	0.0547	N	0.19112	0.55	0.09310	N	1	P;B;B	0.35872	0.525;0.102;0.102	B;B;B	0.36092	0.217;0.08;0.08	T	0.12837	-1.0532	10	0.30854	T	0.27	.	6.8492	0.24005	0.0:0.6996:0.1463:0.1542	.	539;539;539	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	T	539	ENSP00000371293:A539T;ENSP00000262102:A539T;ENSP00000430167:A539T;ENSP00000371286:A539T	ENSP00000262102:A539T	A	-	1	0	MTUS1	17655982	0.000000	0.05858	0.003000	0.11579	0.752000	0.42762	-0.236000	0.09003	0.824000	0.34613	0.650000	0.86243	GCC	.	.	.	none		0.423	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
ANK1	286	hgsc.bcm.edu	37	8	41583374	41583374	+	Missense_Mutation	SNP	G	G	A	rs368414600		TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr8:41583374G>A	ENST00000347528.4	-	6	600	c.517C>T	c.(517-519)Cgc>Tgc	p.R173C	ANK1_ENST00000396942.1_Missense_Mutation_p.R173C|ANK1_ENST00000396945.1_Missense_Mutation_p.R173C|ANK1_ENST00000265709.8_Missense_Mutation_p.R206C|ANK1_ENST00000379758.2_Missense_Mutation_p.R173C|ANK1_ENST00000289734.7_Missense_Mutation_p.R173C|ANK1_ENST00000352337.4_Missense_Mutation_p.R173C	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	173	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GCCGGGAGGCGCACCTTCCCC	0.677																																					p.R206C		Atlas-SNP	.											.	ANK1	497	.	0			c.C616T						PASS	.	G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	85.0	54.0	64.0		517,616,517,517,517	5.0	1.0	8		64	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	ANK1	NM_000037.3,NM_001142446.1,NM_020475.2,NM_020476.2,NM_020477.2	180,180,180,180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	173/1881,206/1898,173/1857,173/1882,173/1720	41583374	1,13005	2203	4300	6503	SO:0001583	missense	286	exon6			GGAGGCGCACCTT	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.517C>T	chr8.hg19:g.41583374G>A	ENSP00000339620:p.Arg173Cys	81.0	0.0	.		76.0	28.0	.	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	hg19	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	G	32	5.116615	0.94385	0.0	1.16E-4	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37;2.37;2.37	5.84	4.96	0.65561	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.35624	0.0938	L	0.45137	1.4	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.993;0.98;1.0	T	0.11567	-1.0582	10	0.72032	D	0.01	.	16.3792	0.83439	0.0:0.0:0.8671:0.1329	.	206;173;173;173;173	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	C	173;173;173;173;173;173;206;173	ENSP00000339620:R173C;ENSP00000289734:R173C;ENSP00000369082:R173C;ENSP00000380149:R173C;ENSP00000380147:R173C;ENSP00000309131:R173C;ENSP00000265709:R206C	ENSP00000265709:R206C	R	-	1	0	ANK1	41702531	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.997000	0.88414	1.460000	0.47911	0.551000	0.68910	CGC	.	.	.	weak		0.677	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
CACNB2	783	hgsc.bcm.edu	37	10	18550223	18550223	+	Intron	SNP	C	C	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr10:18550223C>T	ENST00000324631.7	+	2	273				CACNB2_ENST00000282343.8_Intron|CACNB2_ENST00000377328.1_Intron|CACNB2_ENST00000377319.3_Missense_Mutation_p.R9C|CACNB2_ENST00000396576.2_Missense_Mutation_p.R9C|CACNB2_ENST00000377331.2_Intron|RP11-109I13.2_ENST00000457058.1_RNA|CACNB2_ENST00000352115.6_Intron	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit						axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCTGGTGCATCGCCGGCGAGT	0.547																																					p.R9C		Atlas-SNP	.											.	CACNB2	220	.	0			c.C25T						PASS	.						129.0	117.0	121.0					10																	18550223		1994	3661	5655	SO:0001627	intron_variant	783	exon1			GTGCATCGCCGGC	U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.213+110319C>T	chr10.hg19:g.18550223C>T		84.0	0.0	.		56.0	13.0	.	NM_000724	A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Missense_Mutation	SNP	ENST00000324631.7	hg19	CCDS7125.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344707	0.61073	.	.	ENSG00000165995	ENST00000396576;ENST00000377319	D;D	0.83591	-1.74;-1.73	5.29	5.29	0.74685	.	.	.	.	.	D	0.88544	0.6465	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.973;0.988	D	0.89081	0.3476	9	0.72032	D	0.01	.	19.1238	0.93374	0.0:1.0:0.0:0.0	.	20;9	Q59H42;Q08289-6	.;.	C	9	ENSP00000379821:R9C;ENSP00000366536:R9C	ENSP00000366536:R9C	R	+	1	0	CACNB2	18590229	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.481000	0.66826	2.752000	0.94435	0.557000	0.71058	CGC	.	.	.	none		0.547	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724	
CCDC186	55088	hgsc.bcm.edu	37	10	115922396	115922396	+	Splice_Site	SNP	T	T	C			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr10:115922396T>C	ENST00000369287.3	-	2	898	c.632A>G	c.(631-633)aAg>aGg	p.K211R	C10orf118_ENST00000369286.1_Missense_Mutation_p.K211R|C10orf118_ENST00000369285.3_Missense_Mutation_p.K211R	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		211										NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		AAAAACTTACTTTTTTATGAT	0.313																																					p.K211R		Atlas-SNP	.											.	C10orf118	70	.	0			c.A632G						PASS	.						27.0	27.0	27.0					10																	115922396		2200	4298	6498	SO:0001630	splice_region_variant	55088	exon2			ACTTACTTTTTTA																												ENST00000369287.3:c.632+1A>G	chr10.hg19:g.115922396T>C		67.0	0.0	.		67.0	25.0	.	NM_018017	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Missense_Mutation	SNP	ENST00000369287.3	hg19	CCDS7587.1	.	.	.	.	.	.	.	.	.	.	T	11.50	1.656651	0.29425	.	.	ENSG00000165813	ENST00000369287;ENST00000430353;ENST00000369286;ENST00000369285	T;T;T	0.33216	1.42;1.42;1.42	5.48	1.79	0.24919	.	0.377613	0.32624	N	0.005859	T	0.16342	0.0393	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.08848	-1.0702	10	0.30078	T	0.28	.	5.0037	0.14277	0.1337:0.146:0.0:0.7202	.	211	Q7Z3E2	CJ118_HUMAN	R	211;317;211;211	ENSP00000358293:K211R;ENSP00000358292:K211R;ENSP00000358291:K211R	ENSP00000358291:K211R	K	-	2	0	C10orf118	115912386	1.000000	0.71417	0.999000	0.59377	0.879000	0.50718	1.291000	0.33330	0.053000	0.16036	-0.343000	0.07986	AAG	.	.	.	none		0.313	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1		Missense_Mutation
FAM160A2	84067	hgsc.bcm.edu	37	11	6236092	6236092	+	Silent	SNP	G	G	A			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr11:6236092G>A	ENST00000449352.2	-	10	2528	c.2265C>T	c.(2263-2265)aaC>aaT	p.N755N	FAM160A2_ENST00000265978.4_Silent_p.N769N|FAM160A2_ENST00000529360.1_5'UTR			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	755					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CATAGACGGAGTTCTGCAGCA	0.587																																					p.N769N		Atlas-SNP	.											.	FAM160A2	100	.	0			c.C2307T						PASS	.						56.0	45.0	49.0					11																	6236092		2201	4296	6497	SO:0001819	synonymous_variant	84067	exon10			GACGGAGTTCTGC		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.2265C>T	chr11.hg19:g.6236092G>A		59.0	0.0	.		44.0	14.0	.	NM_032127	Q9C0A4|Q9H0N3|Q9H624	Silent	SNP	ENST00000449352.2	hg19	CCDS44530.1																																																																																			.	.	.	none		0.587	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	NM_032127	
NPAT	4863	hgsc.bcm.edu	37	11	108043763	108043763	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr11:108043763C>T	ENST00000278612.8	-	13	2053	c.1948G>A	c.(1948-1950)Gaa>Aaa	p.E650K	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	650	Required for acceleration of G1 phase.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		GCCTGAGCTTCATTTTCTGTA	0.368																																					p.E650K		Atlas-SNP	.											.	NPAT	124	.	0			c.G1948A						PASS	.						53.0	50.0	51.0					11																	108043763		1833	4078	5911	SO:0001583	missense	4863	exon13			GAGCTTCATTTTC	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.1948G>A	chr11.hg19:g.108043763C>T	ENSP00000278612:p.Glu650Lys	53.0	0.0	.		55.0	15.0	.	NM_002519	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	hg19	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	C	7.695	0.691773	0.15039	.	.	ENSG00000149308	ENST00000278612	T	0.04083	3.71	6.08	3.87	0.44632	.	0.657735	0.15963	N	0.236168	T	0.02929	0.0087	N	0.19112	0.55	0.09310	N	1	B;B	0.17268	0.021;0.01	B;B	0.18561	0.022;0.009	T	0.46091	-0.9216	10	0.08179	T	0.78	-15.3657	6.6244	0.22820	0.1802:0.6533:0.0:0.1665	.	650;650	B9EG70;Q14207	.;NPAT_HUMAN	K	650	ENSP00000278612:E650K	ENSP00000278612:E650K	E	-	1	0	NPAT	107548973	0.118000	0.22208	0.385000	0.26158	0.799000	0.45148	0.125000	0.15749	1.555000	0.49500	0.655000	0.94253	GAA	.	.	.	none		0.368	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
PCED1B	91523	hgsc.bcm.edu	37	12	47629401	47629401	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr12:47629401G>T	ENST00000546455.1	+	4	1286	c.555G>T	c.(553-555)aaG>aaT	p.K185N	RP11-493L12.3_ENST00000547748.1_RNA|PCED1B_ENST00000432328.1_Missense_Mutation_p.K185N			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	185							hydrolase activity (GO:0016787)										GGCGGCAGAAGGCCACCTTCC	0.577																																					p.K185N		Atlas-SNP	.											.	.	.	.	0			c.G555T						PASS	.						32.0	27.0	29.0					12																	47629401		2203	4300	6503	SO:0001583	missense	91523	exon2			GCAGAAGGCCACC	BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.555G>T	chr12.hg19:g.47629401G>T	ENSP00000446688:p.Lys185Asn	29.0	0.0	.		45.0	17.0	.	NM_138371	Q96B20	Missense_Mutation	SNP	ENST00000546455.1	hg19	CCDS8752.1	.	.	.	.	.	.	.	.	.	.	G	0.690	-0.794903	0.02862	.	.	ENSG00000179715	ENST00000546455;ENST00000432328;ENST00000548348;ENST00000330951	T;T;T	0.17054	2.3;2.3;2.3	0.427	-0.581	0.11713	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	4.839840	0.00674	N	0.000658	T	0.10035	0.0246	N	0.08118	0	0.09310	N	1	B	0.31503	0.326	B	0.36845	0.234	T	0.14811	-1.0459	9	0.23891	T	0.37	12.6003	.	.	.	.	185	Q96HM7	F113B_HUMAN	N	185;185;65;65	ENSP00000446688:K185N;ENSP00000396040:K185N;ENSP00000448693:K65N	ENSP00000328560:K65N	K	+	3	2	FAM113B	45915668	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.398000	0.02509	-0.370000	0.08016	-0.363000	0.07495	AAG	.	.	.	none		0.577	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1	NM_138371	
EEA1	8411	hgsc.bcm.edu	37	12	93171433	93171433	+	Silent	SNP	A	A	G			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr12:93171433A>G	ENST00000322349.8	-	27	4164	c.3900T>C	c.(3898-3900)ctT>ctC	p.L1300L		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	1300					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						CTTCTCCTTTAAGACATCTGG	0.333																																					p.L1300L		Atlas-SNP	.											.	EEA1	104	.	0			c.T3900C						PASS	.						82.0	70.0	74.0					12																	93171433		2203	4300	6503	SO:0001819	synonymous_variant	8411	exon27			TCCTTTAAGACAT	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.3900T>C	chr12.hg19:g.93171433A>G		58.0	0.0	.		69.0	17.0	.	NM_003566	Q14221	Silent	SNP	ENST00000322349.8	hg19	CCDS31874.1																																																																																			.	.	.	none		0.333	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
PPP2R5E	5529	hgsc.bcm.edu	37	14	63842804	63842804	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr14:63842804G>A	ENST00000337537.3	-	14	1929	c.1327C>T	c.(1327-1329)Cgt>Tgt	p.R443C	PPP2R5E_ENST00000422769.2_Missense_Mutation_p.R367C|PPP2R5E_ENST00000555899.1_Missense_Mutation_p.R438C	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform	443					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		AATTCTTCACGCTCCTTTTCT	0.328																																					p.R443C		Atlas-SNP	.											.	PPP2R5E	43	.	0			c.C1327T						PASS	.						166.0	145.0	152.0					14																	63842804		2203	4298	6501	SO:0001583	missense	5529	exon14			CTTCACGCTCCTT	L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.1327C>T	chr14.hg19:g.63842804G>A	ENSP00000337641:p.Arg443Cys	55.0	0.0	.		45.0	13.0	.	NM_006246	A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	Missense_Mutation	SNP	ENST00000337537.3	hg19	CCDS9758.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.413814	0.42817	.	.	ENSG00000154001	ENST00000337537;ENST00000555899;ENST00000422769	.	.	.	5.86	5.86	0.93980	Armadillo-type fold (1);	0.111045	0.56097	D	0.000022	D	0.84633	0.5515	M	0.90019	3.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.87143	0.2204	9	0.87932	D	0	-5.744	14.9745	0.71261	0.0:0.0:0.8574:0.1426	.	438;443	B7ZKK9;Q16537	.;2A5E_HUMAN	C	443;438;367	.	ENSP00000337641:R443C	R	-	1	0	PPP2R5E	62912557	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	4.260000	0.58835	2.776000	0.95493	0.650000	0.86243	CGT	.	.	.	none		0.328	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276973.1	NM_006246	
RCCD1	91433	hgsc.bcm.edu	37	15	91500569	91500569	+	Silent	SNP	T	T	A			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr15:91500569T>A	ENST00000394258.2	+	3	595	c.393T>A	c.(391-393)gcT>gcA	p.A131A	RCCD1_ENST00000556774.1_Intron|RCCD1_ENST00000556618.1_Silent_p.A131A|AC068831.6_ENST00000553321.1_RNA|RCCD1_ENST00000555155.1_Silent_p.A131A	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	131						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			AGGCCCAGGCTGGGAGGCTAC	0.731																																					p.A131A		Atlas-SNP	.											.	RCCD1	9	.	0			c.T393A						PASS	.						10.0	9.0	10.0					15																	91500569		1982	3924	5906	SO:0001819	synonymous_variant	91433	exon3			CCAGGCTGGGAGG		CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.393T>A	chr15.hg19:g.91500569T>A		58.0	0.0	.		63.0	22.0	.	NM_001017919	B2RTP9|Q29RX6	Silent	SNP	ENST00000394258.2	hg19	CCDS32333.1																																																																																			.	.	.	none		0.731	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1	NM_033544	
PDILT	204474	hgsc.bcm.edu	37	16	20371931	20371931	+	Silent	SNP	G	G	A			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr16:20371931G>A	ENST00000302451.4	-	11	1713	c.1465C>T	c.(1465-1467)Ctg>Ttg	p.L489L		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	489					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						TGGCTTTCCAGGAAGTCAGAG	0.473																																					p.L489L		Atlas-SNP	.											.	PDILT	120	.	0			c.C1465T						PASS	.						218.0	198.0	205.0					16																	20371931		2203	4300	6503	SO:0001819	synonymous_variant	204474	exon11			TTTCCAGGAAGTC		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.1465C>T	chr16.hg19:g.20371931G>A		84.0	0.0	.		81.0	17.0	.	NM_174924	Q8IVQ5	Silent	SNP	ENST00000302451.4	hg19	CCDS10584.1																																																																																			.	.	.	none		0.473	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
TK2	7084	hgsc.bcm.edu	37	16	66547633	66547633	+	Splice_Site	SNP	C	C	G			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr16:66547633C>G	ENST00000451102.2	-	9	1050		c.e9+1		TK2_ENST00000563369.2_Splice_Site|TK2_ENST00000568170.1_5'Flank|TK2_ENST00000527284.1_Splice_Site|TK2_ENST00000299697.7_Splice_Site|TK2_ENST00000544898.1_Splice_Site|TK2_ENST00000525974.1_Splice_Site|TK2_ENST00000417693.3_Splice_Site|RP11-403P17.5_ENST00000561728.1_Splice_Site|TK2_ENST00000545043.2_Splice_Site|TK2_ENST00000564917.1_Splice_Site|TK2_ENST00000527800.1_Splice_Site			O00142	KITM_HUMAN	thymidine kinase 2, mitochondrial						deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|DNA replication (GO:0006260)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|thymidine kinase activity (GO:0004797)			large_intestine(1)|lung(2)|urinary_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0736)|Epithelial(162;0.237)		GTCTTACTTACCAGAACAGGG	0.537																																					.		Atlas-SNP	.											.	TK2	17	.	0			c.408+1G>C						PASS	.						70.0	61.0	64.0					16																	66547633		2201	4300	6501	SO:0001630	splice_region_variant	7084	exon10			TACTTACCAGAAC		CCDS10805.1, CCDS10805.2, CCDS54016.1, CCDS54017.1, CCDS54018.1, CCDS61955.1	16q22-q23.1	2012-10-02			ENSG00000166548	ENSG00000166548	2.7.1.21		11831	protein-coding gene	gene with protein product		188250					Standard	NM_004614		Approved		uc002eos.3	O00142	OTTHUMG00000137499	ENST00000451102.2:c.699+1G>C	chr16.hg19:g.66547633C>G		57.0	0.0	.		56.0	19.0	.	NM_001272050	B4DGJ7|B4DZK7|B7ZAB1|E9PH08|O15238	Splice_Site	SNP	ENST00000451102.2	hg19	CCDS10805.2	.	.	.	.	.	.	.	.	.	.	C	19.00	3.741035	0.69304	.	.	ENSG00000166548	ENST00000299697;ENST00000417693;ENST00000545043;ENST00000451102;ENST00000527800;ENST00000527284;ENST00000544898;ENST00000525974	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6218	0.76813	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TK2	65105134	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.457000	0.66672	2.543000	0.85770	0.650000	0.86243	.	.	.	.	none		0.537	TK2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268806.4		Intron
TANGO6	79613	hgsc.bcm.edu	37	16	69117519	69117519	+	Silent	SNP	G	G	A	rs376805485		TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr16:69117519G>A	ENST00000261778.1	+	18	3252	c.3240G>A	c.(3238-3240)ctG>ctA	p.L1080L	TANGO6_ENST00000561931.1_3'UTR	NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	1080						integral component of membrane (GO:0016021)											AAAACTTCCTGTTCCCTCCAC	0.587																																					p.L1080L		Atlas-SNP	.											.	.	.	.	0			c.G3240A						PASS	.						44.0	46.0	45.0					16																	69117519		2029	4182	6211	SO:0001819	synonymous_variant	79613	exon18			CTTCCTGTTCCCT		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.3240G>A	chr16.hg19:g.69117519G>A		84.0	0.0	.		69.0	4.0	.	NM_024562	Q569F9|Q9H9K1	Silent	SNP	ENST00000261778.1	hg19	CCDS45516.1																																																																																			.	.	.	alt		0.587	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2	
SUPT6H	6830	hgsc.bcm.edu	37	17	27005195	27005195	+	Silent	SNP	A	A	C			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr17:27005195A>C	ENST00000314616.6	+	9	1384	c.1101A>C	c.(1099-1101)cgA>cgC	p.R367R	SUPT6H_ENST00000347486.4_Silent_p.R367R	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	367	Interaction with IWS1. {ECO:0000250}.|Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GCTTCATGCGAAATCAGCATT	0.493																																					p.R367R		Atlas-SNP	.											.	SUPT6H	165	.	0			c.A1101C						PASS	.						68.0	67.0	67.0					17																	27005195		2203	4300	6503	SO:0001819	synonymous_variant	6830	exon9			CATGCGAAATCAG	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.1101A>C	chr17.hg19:g.27005195A>C		85.0	0.0	.		112.0	35.0	.	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	hg19	CCDS32596.1																																																																																			.	.	.	none		0.493	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
AKAP1	8165	hgsc.bcm.edu	37	17	55183561	55183561	+	Missense_Mutation	SNP	G	G	C	rs145117487		TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr17:55183561G>C	ENST00000337714.3	+	2	969	c.736G>C	c.(736-738)Ggg>Cgg	p.G246R	AKAP1_ENST00000539273.1_Missense_Mutation_p.G246R|AKAP1_ENST00000314126.3_Missense_Mutation_p.G246R|AKAP1_ENST00000571629.1_Missense_Mutation_p.G246R|AKAP1_ENST00000572557.1_Missense_Mutation_p.G246R	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	246					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					AGAAGATAAGGGGAAGAGCAG	0.542																																					p.G246R		Atlas-SNP	.											.	AKAP1	73	.	0			c.G736C						PASS	.						104.0	111.0	109.0					17																	55183561		2203	4300	6503	SO:0001583	missense	8165	exon3			GATAAGGGGAAGA	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.736G>C	chr17.hg19:g.55183561G>C	ENSP00000337736:p.Gly246Arg	104.0	0.0	.		98.0	30.0	.	NM_001242902	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	ENST00000337714.3	hg19	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609976	0.28712	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.18016	2.5;2.24;2.5	6.05	3.76	0.43208	.	0.785841	0.12432	N	0.469465	T	0.16128	0.0388	L	0.60455	1.87	0.09310	N	1	B	0.15473	0.013	B	0.10450	0.005	T	0.20240	-1.0281	10	0.51188	T	0.08	-8.8734	3.4974	0.07659	0.1622:0.1351:0.5635:0.1392	.	246	Q92667	AKAP1_HUMAN	R	246;246;288;246	ENSP00000337736:G246R;ENSP00000314075:G246R;ENSP00000443139:G246R	ENSP00000314075:G246R	G	+	1	0	AKAP1	52538560	0.001000	0.12720	0.006000	0.13384	0.048000	0.14542	0.325000	0.19628	1.575000	0.49775	0.655000	0.94253	GGG	.	G|1.000;A|0.000	.	alt		0.542	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1		
SOX9	6662	hgsc.bcm.edu	37	17	70117912	70117912	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr17:70117912A>G	ENST00000245479.2	+	1	752	c.380A>G	c.(379-381)tAc>tGc	p.Y127C		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	127					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			GCGGACCAGTACCCGCACTTG	0.701																																					p.Y127C	Pancreas(42;83 1041 2320 35205 39456)	Atlas-SNP	.											.	SOX9	91	.	0			c.A380G						PASS	.						21.0	18.0	19.0					17																	70117912		2200	4297	6497	SO:0001583	missense	6662	exon1			ACCAGTACCCGCA	S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.380A>G	chr17.hg19:g.70117912A>G	ENSP00000245479:p.Tyr127Cys	242.0	0.0	.		168.0	59.0	.	NM_000346	Q53Y80	Missense_Mutation	SNP	ENST00000245479.2	hg19	CCDS11689.1	.	.	.	.	.	.	.	.	.	.	A	19.61	3.859113	0.71834	.	.	ENSG00000125398	ENST00000245479;ENST00000455872	D	0.97870	-4.58	3.97	2.89	0.33648	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	U	0.000000	D	0.96546	0.8873	N	0.21545	0.675	0.80722	D	1	D	0.69078	0.997	D	0.66847	0.947	D	0.95255	0.8363	10	0.87932	D	0	.	8.8963	0.35467	0.9088:0.0:0.0912:0.0	.	127	P48436	SOX9_HUMAN	C	127	ENSP00000245479:Y127C	ENSP00000245479:Y127C	Y	+	2	0	SOX9	67629507	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.049000	0.93837	0.430000	0.26230	0.358000	0.22013	TAC	.	.	.	none		0.701	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
FXYD1	5348	hgsc.bcm.edu	37	19	35631004	35631004	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr19:35631004C>G	ENST00000588081.1	+	1	79	c.21C>G	c.(19-21)atC>atG	p.I7M	FXYD1_ENST00000455515.2_Missense_Mutation_p.I7M|FXYD1_ENST00000588715.1_Missense_Mutation_p.I7M|LGI4_ENST00000493050.1_Intron|CTD-2527I21.4_ENST00000592174.1_RNA|FXYD1_ENST00000351325.4_Missense_Mutation_p.I7M|FXYD1_ENST00000589209.1_Missense_Mutation_p.I7M|FXYD1_ENST00000588607.1_Missense_Mutation_p.I7M			O00168	PLM_HUMAN	FXYD domain containing ion transport regulator 1	7					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|positive regulation of sodium ion export from cell (GO:1903278)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of heart contraction (GO:0008016)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)	chloride channel activity (GO:0005254)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)			lung(3)	3	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;2.32e-21)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;2.43e-18)|LUSC - Lung squamous cell carcinoma(66;0.0849)			TTGGCCACATCTTGGTTTTCT	0.622																																					p.I7M		Atlas-SNP	.											.	FXYD1	6	.	0			c.C21G						PASS	.						161.0	115.0	131.0					19																	35631004		2203	4300	6503	SO:0001583	missense	5348	exon2			CCACATCTTGGTT		CCDS12445.1	19q13.1	2008-08-01	2008-08-01			ENSG00000266964			4025	protein-coding gene	gene with protein product		602359	"""phospholemman"""	PLM		9169143	Standard	NM_005031		Approved		uc002nyc.3	O00168		ENST00000588081.1:c.21C>G	chr19.hg19:g.35631004C>G	ENSP00000467727:p.Ile7Met	23.0	0.0	.		17.0	6.0	.	NM_005031	A8K196	Missense_Mutation	SNP	ENST00000588081.1	hg19	CCDS12445.1	.	.	.	.	.	.	.	.	.	.	C	12.93	2.085201	0.36758	.	.	ENSG00000221857	ENST00000351325;ENST00000455515	T;T	0.67865	-0.29;-0.29	4.13	3.08	0.35506	.	0.567371	0.14534	N	0.313662	T	0.54498	0.1862	.	.	.	0.80722	D	1	B	0.25169	0.119	B	0.19391	0.025	T	0.54384	-0.8302	9	0.56958	D	0.05	-1.9404	7.9651	0.30094	0.0:0.8864:0.0:0.1136	.	7	O00168	PLM_HUMAN	M	7	ENSP00000343314:I7M;ENSP00000393611:I7M	ENSP00000343314:I7M	I	+	3	3	FXYD1	40322844	0.927000	0.31430	0.815000	0.32552	0.900000	0.52787	3.568000	0.53820	1.096000	0.41439	0.579000	0.79373	ATC	.	.	.	none		0.622	FXYD1-007	KNOWN	alternative_3_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460761.1	NM_021902	
ZIM3	114026	hgsc.bcm.edu	37	19	57646984	57646984	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr19:57646984G>T	ENST00000269834.1	-	5	1106	c.721C>A	c.(721-723)Cat>Aat	p.H241N	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	241					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATTTTCTGATGTTGAAAGAGA	0.378																																					p.H241N		Atlas-SNP	.											.	ZIM3	107	.	0			c.C721A						PASS	.						128.0	126.0	127.0					19																	57646984		2203	4300	6503	SO:0001583	missense	114026	exon5			TCTGATGTTGAAA	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.721C>A	chr19.hg19:g.57646984G>T	ENSP00000269834:p.His241Asn	51.0	0.0	.		31.0	11.0	.	NM_052882	Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	hg19	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.347746	0.24426	.	.	ENSG00000141946	ENST00000269834	D	0.86865	-2.18	2.53	1.45	0.22620	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94301	0.8169	H	0.95780	3.72	0.25361	N	0.988781	D	0.71674	0.998	D	0.91635	0.999	D	0.85217	0.1024	9	0.87932	D	0	.	7.1216	0.25448	0.1503:0.0:0.8497:0.0	.	241	Q96PE6	ZIM3_HUMAN	N	241	ENSP00000269834:H241N	ENSP00000269834:H241N	H	-	1	0	ZIM3	62338796	0.986000	0.35501	0.564000	0.28396	0.058000	0.15608	2.728000	0.47319	0.373000	0.24621	0.313000	0.20887	CAT	.	.	.	none		0.378	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
GUCD1	83606	hgsc.bcm.edu	37	22	24942883	24942883	+	Splice_Site	SNP	A	A	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr22:24942883A>T	ENST00000407471.3	-	4	575	c.385T>A	c.(385-387)Tgc>Agc	p.C129S	GUCD1_ENST00000490922.1_Intron|GUCD1_ENST00000402766.1_Splice_Site_p.C129S|GUCD1_ENST00000435822.1_Splice_Site_p.C129S|GUCD1_ENST00000447813.2_Splice_Site_p.W129R|GUCD1_ENST00000404664.3_Splice_Site_p.C185S	NM_001284251.1	NP_001271180.1	Q96NT3	GUCD1_HUMAN	guanylyl cyclase domain containing 1	129																	GGGGCTCACCATTTCTCCACC	0.557																																					p.C129S		Atlas-SNP	.											.	.	.	.	0			c.T385A						PASS	.						98.0	98.0	98.0					22																	24942883		2203	4300	6503	SO:0001630	splice_region_variant	83606	exon4			CTCACCATTTCTC	AK054681	CCDS33621.1, CCDS63426.1, CCDS63427.1, CCDS74831.1, CCDS74832.1, CCDS74833.1	22q11.2	2012-11-13	2012-11-13	2012-11-13	ENSG00000138867	ENSG00000138867			14237	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 13"""	C22orf13		12477932	Standard	XM_005261761		Approved	MGC1842, LLN4	uc003aah.2	Q96NT3	OTTHUMG00000150728	ENST00000407471.3:c.386+1T>A	chr22.hg19:g.24942883A>T		79.0	0.0	.		55.0	12.0	.	NM_031444	B5MCB8|B5MCL7|Q96Q79|Q9BU32	Missense_Mutation	SNP	ENST00000407471.3	hg19	CCDS33621.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.96|16.96	3.266439|3.266439	0.59540|0.59540	.|.	.|.	ENSG00000138867|ENSG00000138867	ENST00000407471;ENST00000435822;ENST00000404664;ENST00000402766|ENST00000447813	.|.	.|.	.|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.048451|.	0.85682|.	D|.	0.000000|.	T|T	0.55033|0.55033	0.1895|0.1895	L|L	0.60455|0.60455	1.87|1.87	0.58432|0.58432	D|D	0.999999|0.999999	D;P;P;P;B|.	0.61697|.	0.99;0.917;0.695;0.611;0.07|.	P;B;B;P;B|.	0.61800|.	0.894;0.425;0.236;0.502;0.051|.	T|T	0.51702|0.51702	-0.8672|-0.8672	9|6	0.30078|0.06494	T|T	0.28|0.89	-25.3709|-25.3709	9.7612|9.7612	0.40532|0.40532	0.9234:0.0:0.0766:0.0|0.9234:0.0:0.0766:0.0	.|.	129;185;193;129;129|.	E9PGZ7;B5MCL7;B4DH83;B4DL90;Q96NT3|.	.;.;.;.;CV013_HUMAN|.	S|R	129;129;185;129|129	.|.	ENSP00000381297:C129S|ENSP00000387867:W129R	C|W	-|-	1|1	0|0	C22orf13|C22orf13	23272883|23272883	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	4.659000|4.659000	0.61504|0.61504	2.212000|2.212000	0.71576|0.71576	0.533000|0.533000	0.62120|0.62120	TGC|TGG	.	.	.	none		0.557	GUCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319819.1	NM_031444	Missense_Mutation
ACE2	59272	hgsc.bcm.edu	37	X	15596288	15596288	+	Silent	SNP	G	G	A			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chrX:15596288G>A	ENST00000252519.3	-	9	1323	c.1221C>T	c.(1219-1221)atC>atT	p.I407I	ACE2_ENST00000427411.1_Silent_p.I407I			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	407					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	AAAGTGACATGATTTCCCCAA	0.418																																					p.I407I		Atlas-SNP	.											.	ACE2	87	.	0			c.C1221T						PASS	.						126.0	106.0	113.0					X																	15596288		2203	4300	6503	SO:0001819	synonymous_variant	59272	exon10			TGACATGATTTCC	AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.1221C>T	chrX.hg19:g.15596288G>A		154.0	0.0	.		129.0	44.0	.	NM_021804	C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Silent	SNP	ENST00000252519.3	hg19	CCDS14169.1																																																																																			.	.	.	none		0.418	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1		
LANCL3	347404	hgsc.bcm.edu	37	X	37431495	37431495	+	Silent	SNP	C	C	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chrX:37431495C>T	ENST00000378619.3	+	1	591	c.372C>T	c.(370-372)ggC>ggT	p.G124G	TM4SF2_ENST00000465127.1_Intron|LANCL3_ENST00000378621.3_Silent_p.G124G	NM_001170331.1	NP_001163802.1	Q6ZV70	LANC3_HUMAN	LanC lantibiotic synthetase component C-like 3 (bacterial)	124							catalytic activity (GO:0003824)			lung(4)|pancreas(1)	5						TGCTCGGGGGCGCGGGCGTGT	0.731																																					p.G124G		Atlas-SNP	.											.	LANCL3	42	.	0			c.C372T						PASS	.						2.0	3.0	2.0					X																	37431495		1288	2580	3868	SO:0001819	synonymous_variant	347404	exon1			CGGGGGCGCGGGC	AK124915	CCDS14240.1, CCDS55398.1	Xp21.1	2008-02-05			ENSG00000147036	ENSG00000147036			24767	protein-coding gene	gene with protein product							Standard	NM_198511		Approved	FLJ42925	uc011mkd.2	Q6ZV70	OTTHUMG00000033177	ENST00000378619.3:c.372C>T	chrX.hg19:g.37431495C>T		63.0	0.0	.		57.0	16.0	.	NM_001170331	A6NHE3	Silent	SNP	ENST00000378619.3	hg19	CCDS55398.1																																																																																			.	.	.	none		0.731	LANCL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080885.1	NM_198511	
FAM104B	90736	hgsc.bcm.edu	37	X	55172645	55172645	+	Missense_Mutation	SNP	C	C	G	rs1047042	byFrequency	TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chrX:55172645C>G	ENST00000358460.4	-	3	373	c.220G>C	c.(220-222)Gat>Cat	p.D74H	FAM104B_ENST00000489298.1_Missense_Mutation_p.D73H|FAM104B_ENST00000425133.2_Missense_Mutation_p.D75H|FAM104B_ENST00000478918.1_5'Flank|FAM104B_ENST00000477847.2_Missense_Mutation_p.D71H|FAM104B_ENST00000472571.2_3'UTR|FAM104B_ENST00000332132.4_Missense_Mutation_p.D75H			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	74				D -> V (in Ref. 1; BAG61768). {ECO:0000305}.						endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						AAGTTTGCATCGGGTTCAGTA	0.468													C|||	5	0.0013245	0.0023	0.0	3775	,	,		14416	0.0		0.0	False		,,,				2504	0.002				p.D75H		Atlas-SNP	.											.	FAM104B	28	.	0			c.G223C						PASS	.						136.0	110.0	119.0					X																	55172645		2203	4300	6503	SO:0001583	missense	90736	exon3			TTGCATCGGGTTC	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.220G>C	chrX.hg19:g.55172645C>G	ENSP00000364101:p.Asp74His	52.0	0.0	.		54.0	4.0	.	NM_001166699	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Missense_Mutation	SNP	ENST00000358460.4	hg19	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	c	3.193	-0.165363	0.06461	.	.	ENSG00000182518	ENST00000358460;ENST00000332132;ENST00000425133;ENST00000477847;ENST00000489298	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	1.59	-1.04	0.10068	.	0.505297	0.17523	U	0.171170	T	0.25044	0.0608	N	0.14661	0.345	0.09310	N	1	B;P;P	0.46859	0.002;0.774;0.885	B;P;B	0.46479	0.001;0.518;0.241	T	0.15065	-1.0450	10	0.56958	D	0.05	-1.547	4.2247	0.10575	0.0:0.4679:0.0:0.5321	.	75;74;75	Q5XKR9-3;Q5XKR9;Q5XKR9-2	.;F104B_HUMAN;.	H	74;75;75;71;73	ENSP00000364101:D74H;ENSP00000333394:D75H;ENSP00000397188:D75H;ENSP00000421161:D71H;ENSP00000423164:D73H	ENSP00000333394:D75H	D	-	1	0	FAM104B	55189370	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.019000	0.12546	-0.355000	0.08199	-0.556000	0.04195	GAT	.	C|0.600;T|0.400	.	alt		0.468	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056851.1	NM_138362	
AR	367	hgsc.bcm.edu	37	X	66765176	66765176	+	Missense_Mutation	SNP	A	A	T	rs62636527		TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chrX:66765176A>T	ENST00000374690.3	+	1	712	c.188A>T	c.(187-189)cAg>cTg	p.Q63L	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q63L|AR_ENST00000504326.1_Missense_Mutation_p.Q63L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	63	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	cagcagcagcagcagcagcag	0.672									Androgen Insensitivity Syndrome																												p.Q63L		Atlas-SNP	.											.	AR	249	.	0			c.A188T						PASS	.						5.0	8.0	7.0					X																	66765176		1640	3236	4876	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.188A>T	chrX.hg19:g.66765176A>T	ENSP00000363822:p.Gln63Leu	148.0	0.0	.		137.0	18.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.08	1.532203	0.27387	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.78246	-1.16;-1.16;-1.16	.	.	.	.	0.479323	0.15343	U	0.267412	T	0.62624	0.2443	N	0.19112	0.55	0.09310	N	0.999992	P;D;.	0.58268	0.755;0.982;.	B;P;.	0.48627	0.089;0.584;.	T	0.56408	-0.7984	8	0.17832	T	0.49	.	.	.	.	rs62636527	63;63;61	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	63	ENSP00000363822:Q63L;ENSP00000421155:Q63L;ENSP00000379359:Q63L	ENSP00000363822:Q63L	Q	+	2	0	AR	66681901	0.810000	0.29049	0.871000	0.34182	0.555000	0.35460	1.078000	0.30754	0.000000	0.14550	0.000000	0.15137	CAG	.	A|0.982;T|0.018	0.018	weak		0.672	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
AR	367	hgsc.bcm.edu	37	X	66765179	66765179	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chrX:66765179A>T	ENST00000374690.3	+	1	715	c.191A>T	c.(190-192)cAg>cTg	p.Q64L	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q64L|AR_ENST00000504326.1_Missense_Mutation_p.Q64L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	64	Gln-rich.|Modulating.|Poly-Gln.		Q -> R (in prostate cancer).		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	cagcagcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q64L		Atlas-SNP	.											.	AR	249	.	0			c.A191T						PASS	.						4.0	8.0	7.0					X																	66765179		1590	3143	4733	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.191A>T	chrX.hg19:g.66765179A>T	ENSP00000363822:p.Gln64Leu	145.0	0.0	.		134.0	19.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.28	1.591655	0.28357	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.67865	-0.29;-0.29;-0.29	.	.	.	.	1.847110	0.03494	N	0.217131	T	0.56124	0.1964	N	0.19112	0.55	0.09310	N	0.999991	P;D;.	0.58268	0.755;0.982;.	B;P;.	0.48627	0.089;0.584;.	T	0.50381	-0.8835	8	0.38643	T	0.18	.	.	.	.	.	64;64;62	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	64	ENSP00000363822:Q64L;ENSP00000421155:Q64L;ENSP00000379359:Q64L	ENSP00000363822:Q64L	Q	+	2	0	AR	66681904	0.024000	0.19004	0.883000	0.34634	0.574000	0.36063	-0.145000	0.10265	0.000000	0.14550	0.000000	0.15137	CAG	.	.	.	none		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
MAPRE3	22924	hgsc.bcm.edu	37	2	27247068	27247072	+	Frame_Shift_Del	DEL	CAACC	CAACC	-			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	CAACC	CAACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr2:27247068_27247072delCAACC	ENST00000233121.2	+	4	570_574	c.372_376delCAACC	c.(370-378)tacaaccctfs	p.NP125fs	MAPRE3_ENST00000402218.1_Frame_Shift_Del_p.NP125fs|MAPRE3_ENST00000405074.3_Frame_Shift_Del_p.NP125fs			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	125					mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAAGGATTACAACCCTCTGCTGGC	0.434																																					p.124_125del		Atlas-Indel,Pindel	.											MAPRE3,lymph_node,lymphoid_neoplasm,0,1	MAPRE3	40	.	0			c.371_375del						PASS	.																																			SO:0001589	frameshift_variant	22924	exon4			.	Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.372_376delCAACC	chr2.hg19:g.27247068_27247072delCAACC	ENSP00000233121:p.Asn125fs	123.0	0.0	0		111.0	35.0	0.315315	NM_012326	B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Frame_Shift_Del	DEL	ENST00000233121.2	hg19	CCDS1731.1																																																																																			.	.	.	none		0.434	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214183.1	NM_012326	
ATP6V1E2	90423	hgsc.bcm.edu	37	2	46739168	46739179	+	Stop_Codon_Del	DEL	AGGCTTATATAA	AGGCTTATATAA	-			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	AGGCTTATATAA	AGGCTTATATAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr2:46739168_46739179delAGGCTTATATAA	ENST00000306448.4	-	0	1785_1796				ATP6V1E2_ENST00000522587.1_Stop_Codon_Del	NM_080653.3	NP_542384.1	Q96A05	VATE2_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2						ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.151)			CTTCCCAGAGGCTTATATAAAGAACTTTCTGT	0.406																																					p.225_227del		Atlas-INDEL	.											.	ATP6V1E2	25	.	0			c.675_1795del						PASS	.																																			SO:0001567	stop_retained_variant	90423	exon2			.	BC008981	CCDS1826.1	2p21	2011-02-10	2006-01-13	2002-06-21	ENSG00000250565	ENSG00000250565		"""ATPases / V-type"""	18125	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD-like 2"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 2"""	ATP6EL2, ATP6V1EL2		12036578	Standard	NM_080653		Approved	MGC9341, VMA4, ATP6E1	uc002ruy.3	Q96A05	OTTHUMG00000128819	Exception_encountered	chr2.hg19:g.46739168_46739179delAGGCTTATATAA	Exception_encountered	30.0	0.0	0		42.0	10.0	0.238095	NM_080653		Frame_Shift_Del	DEL	ENST00000306448.4	hg19	CCDS1826.1																																																																																			.	.	.	none		0.406	ATP6V1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250753.1	NM_080653	
MYO7B	4648	hgsc.bcm.edu	37	2	128390900	128390900	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr2:128390900delA	ENST00000409816.2	+	38	5427	c.5395delA	c.(5395-5397)atcfs	p.I1799fs	MYO7B_ENST00000428314.1_Frame_Shift_Del_p.I1799fs|MYO7B_ENST00000389524.4_Frame_Shift_Del_p.I1800fs|MYO7B_ENST00000409090.1_Frame_Shift_Del_p.I652fs			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1799	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.|MyTH4 3. {ECO:0000255|PROSITE- ProRule:PRU00359}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CGTCTCCCGCATCTGCCACAA	0.662																																					p.R1798fs		Atlas-Indel,Pindel	.											.	MYO7B	359	.	0			c.5394delC						PASS	.						49.0	56.0	53.0					2																	128390900		2095	4212	6307	SO:0001589	frameshift_variant	4648	exon39			.		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.5395delA	chr2.hg19:g.128390900delA	ENSP00000386461:p.Ile1799fs	155.0	0.0	0		161.0	41.0	0.254658	NM_001080527	Q14786|Q8TEE1	Frame_Shift_Del	DEL	ENST00000409816.2	hg19	CCDS46405.1																																																																																			.	.	.	none		0.662	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
ALS2CR11	151254	hgsc.bcm.edu	37	2	202483729	202483729	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr2:202483729delT	ENST00000286195.3	-	1	169	c.125delA	c.(124-126)cacfs	p.H42fs	ALS2CR11_ENST00000439140.1_Frame_Shift_Del_p.H42fs|ALS2CR11_ENST00000450242.1_Frame_Shift_Del_p.H42fs|ALS2CR11_ENST00000439802.1_Frame_Shift_Del_p.H42fs	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	42										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						CCCTTTAATGTGCATGATATC	0.607																																					p.H42fs		Atlas-Indel,Pindel	.											.	ALS2CR11	194	.	0			c.126delC						PASS	.						94.0	90.0	91.0					2																	202483729		2203	4300	6503	SO:0001589	frameshift_variant	151254	exon1			.	AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.125delA	chr2.hg19:g.202483729delT	ENSP00000286195:p.His42fs	107.0	0.0	0		138.0	43.0	0.311594	NM_001168217	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Frame_Shift_Del	DEL	ENST00000286195.3	hg19	CCDS2349.1																																																																																			.	.	.	none		0.607	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	NM_152525	
ZNF233	353355	hgsc.bcm.edu	37	19	44778797	44778797	+	Frame_Shift_Del	DEL	T	T	-	rs386809644|rs386809645|rs2884015	byFrequency	TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr19:44778797delT	ENST00000391958.2	+	5	2111	c.1984delT	c.(1984-1986)ttgfs	p.L662fs	ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000592581.1_3'UTR|ZNF233_ENST00000334152.1_Frame_Shift_Del_p.L644fs	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	662					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				TAAGAGTTCGTTGTCTTCAGA	0.413																																					p.S661fs		Atlas-INDEL	.											.,8	ZNF233	73	.	0			c.1983delG						PASS	.		,	2463,1797		712,1039,379	70.0	79.0	75.0		,	-8.4	0.0	19	dbSNP_129	61	1034,7216		69,896,3160	no	frameshift,frameshift	ZNF233	NM_181756.2,NM_001207005.1	,	781,1935,3539	A1A1,A1R,RR		12.5333,42.1831,27.9536	,	,	44778797	3497,9013	2201	4300	6501	SO:0001589	frameshift_variant	353355	exon5			.	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1984delT	chr19.hg19:g.44778797delT	ENSP00000375820:p.Leu662fs	59.0	0.0	0		53.0	53.0	1	NM_001207005	B2RN78|B2RN79|Q86WL8	Frame_Shift_Del	DEL	ENST00000391958.2	hg19	CCDS33047.1																																																																																			.	.	.	none		0.413	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
RIMBP3B	440804	hgsc.bcm.edu	37	22	21741340	21741341	+	In_Frame_Ins	INS	-	-	TGCAGG	rs555102406	byFrequency	TCGA-2Z-A9JO-01A-11D-A42J-10	TCGA-2Z-A9JO-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be2d72cb-f80c-4e4e-898b-bcb53f6fbee6	c3d84203-c64e-4591-bf15-d40efc7076fd	g.chr22:21741340_21741341insTGCAGG	ENST00000434111.1	+	1	3678_3679	c.3193_3194insTGCAGG	c.(3193-3195)ctg>cTGCAGGtg	p.1067_1068insQV	SCARNA18_ENST00000516505.1_RNA|SCARNA17_ENST00000516211.1_RNA|RN7SKP63_ENST00000363187.1_RNA	NM_001128635.1	NP_001122107.1	A6NNM3	RIM3B_HUMAN	RIMS binding protein 3B	1067	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.																ATGGGACTTGCTGCAGGTGTAT	0.663																																					p.L1065delinsLQV		Pindel	.											.	RIMBP3C	6	.	0			c.3193_3194insTGCAGG						PASS	.			6,24		3,0,12						-2.0	0.0			1	7,131		3,1,65	no	coding	RIMBP3B	NM_001128635.1		6,1,77	A1A1,A1R,RR		5.0725,20.0,7.7381				13,155				SO:0001652	inframe_insertion	150221	exon1			.		CCDS46668.1	22q11.21	2008-10-23			ENSG00000196934	ENSG00000274600			33891	protein-coding gene	gene with protein product		612700				17855024	Standard	NM_001128635		Approved			A6NNM3	OTTHUMG00000150819	ENST00000434111.1:c.3194_3199dupTGCAGG	chr22.hg19:g.21741341_21741346dupTGCAGG	ENSP00000407925:p.Gln1066_Val1067dup	1.0	0.0	.		26.0	26.0	1.000	NM_001128633		In_Frame_Ins	INS	ENST00000434111.1	hg19	CCDS46668.1																																																																																			.	.	.	none		0.663	RIMBP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320196.2	XM_036936	
