#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
INADL	10207	hgsc.bcm.edu	37	1	62288639	62288639	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr1:62288639G>C	ENST00000371158.2	+	15	1820	c.1706G>C	c.(1705-1707)aGg>aCg	p.R569T	INADL_ENST00000316485.6_Missense_Mutation_p.R569T	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	569	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.R569M(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						CACACTCTGAGGCTTGGTGTG	0.438																																					p.R569T		Atlas-SNP	.											INADL,NS,carcinoma,0,1	INADL	179	.	1	Substitution - Missense(1)	lung(1)	c.G1706C						PASS	.						229.0	208.0	215.0					1																	62288639		2203	4300	6503	SO:0001583	missense	10207	exon15			CTCTGAGGCTTGG	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.1706G>C	chr1.hg19:g.62288639G>C	ENSP00000360200:p.Arg569Thr	89.0	0.0	.		92.0	51.0	.	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	hg19	CCDS617.2	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987438	0.74589	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.38560	1.13;1.13	4.99	4.99	0.66335	PDZ/DHR/GLGF (3);	0.000000	0.64402	D	0.000002	T	0.55593	0.1930	L	0.35723	1.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.998;0.962	T	0.53085	-0.8488	10	0.37606	T	0.19	.	17.8838	0.88849	0.0:0.0:1.0:0.0	.	569;569;569	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	T	569	ENSP00000360200:R569T;ENSP00000326199:R569T	ENSP00000255202:R569T	R	+	2	0	INADL	62061227	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.336000	0.90033	2.322000	0.78497	0.561000	0.74099	AGG	.	.	.	none		0.438	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
NOTCH2	4853	hgsc.bcm.edu	37	1	120464974	120464975	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr1:120464974_120464975CC>AT	ENST00000256646.2	-	28	5316_5317	c.5097_5098GG>AT	c.(5095-5100)atGGca>atATca	p.1699_1700MA>IS	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1699					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTCGTTTTGCCATGATTACCC	0.5			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.A1700S|p.M1699I		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348	.	0			c.G5098T|c.G5097A						PASS	.																																			SO:0001583	missense	4853	exon28	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GTTTTGCCATGAT|TTTTGCCATGATT	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.5097_5098delinsAT	chr1.hg19:g.120464974_120464975delinsAT	ENSP00000256646:p.M1699_A1700delinsIS	89.0|90.0	0.0	.		84.0|83.0	23.0	.	NM_024408	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	hg19	CCDS908.1																																																																																			.	.	.	none		0.500	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
ILF2	3608	hgsc.bcm.edu	37	1	153636583	153636584	+	Missense_Mutation	DNP	AG	AG	GA			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr1:153636583_153636584AG>GA	ENST00000361891.4	-	10	804_805	c.679_680CT>TC	c.(679-681)CTg>TCg	p.L227S	ILF2_ENST00000480213.1_5'UTR	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	227	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAAGTCCTTCAGTAGTCTGATG	0.411																																					p.L227P|p.L227L		Atlas-SNP	.											.	ILF2	25	.	0			c.T680C|c.C679T						PASS	.																																			SO:0001583	missense	3608	exon10			TCCTTCAGTAGTC|CCTTCAGTAGTCT	U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.679_680delinsGA	chr1.hg19:g.153636583_153636584delinsGA	ENSP00000355011:p.Leu227Ser	240.0|239.0	0.0	.		203.0|206.0	72.0|74.0	.	NM_004515	A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	Missense_Mutation|Silent	SNP	ENST00000361891.4	hg19	CCDS1050.1																																																																																			.	.	.	none		0.411	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090040.1	NM_004515	
PEAR1	375033	hgsc.bcm.edu	37	1	156876627	156876627	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr1:156876627C>T	ENST00000338302.3	+	7	824	c.599C>T	c.(598-600)cCc>cTc	p.P200L	PEAR1_ENST00000292357.7_Missense_Mutation_p.P200L			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	200					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCCTGCGATCCCCAGACTGGA	0.617																																					p.P200L		Atlas-SNP	.											.	PEAR1	118	.	0			c.C599T						PASS	.						49.0	49.0	49.0					1																	156876627		2203	4300	6503	SO:0001583	missense	375033	exon6			GCGATCCCCAGAC	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.599C>T	chr1.hg19:g.156876627C>T	ENSP00000344465:p.Pro200Leu	87.0	0.0	.		45.0	16.0	.	NM_001080471	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	hg19	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.549844	0.45383	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.58797	0.31;0.31	4.81	2.88	0.33553	.	0.135547	0.34245	N	0.004132	T	0.32071	0.0817	L	0.56769	1.78	0.47994	D	0.999563	B	0.31435	0.323	B	0.27380	0.079	T	0.18116	-1.0347	9	.	.	.	.	9.3744	0.38275	0.0:0.8172:0.0:0.1828	.	200	Q5VY43	PEAR1_HUMAN	L	200	ENSP00000344465:P200L;ENSP00000292357:P200L	.	P	+	2	0	PEAR1	155143251	0.002000	0.14202	1.000000	0.80357	0.985000	0.73830	0.782000	0.26788	1.238000	0.43771	0.561000	0.74099	CCC	.	.	.	none		0.617	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
C1orf106	55765	hgsc.bcm.edu	37	1	200869255	200869255	+	Silent	SNP	G	G	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr1:200869255G>A	ENST00000367342.4	+	4	659	c.459G>A	c.(457-459)gcG>gcA	p.A153A	C1orf106_ENST00000413687.2_Silent_p.A68A	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	153										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						CCTTGCCAGCGGAGTATCCCC	0.627																																					p.A167A		Atlas-SNP	.											.	C1orf106	59	.	0			c.G501A						PASS	.						47.0	42.0	44.0					1																	200869255		2202	4300	6502	SO:0001819	synonymous_variant	55765	exon4			GCCAGCGGAGTAT	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.459G>A	chr1.hg19:g.200869255G>A		239.0	0.0	.		137.0	61.0	.	NM_018265	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Silent	SNP	ENST00000367342.4	hg19																																																																																				.	.	.	none		0.627	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
ZFP36L2	678	hgsc.bcm.edu	37	2	43452438	43452438	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr2:43452438T>C	ENST00000282388.3	-	2	798	c.505A>G	c.(505-507)Aag>Gag	p.K169E	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	169					cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				TCGCCGTACTTGCACGTGCCG	0.637																																					p.K169E		Atlas-SNP	.											.	ZFP36L2	56	.	0			c.A505G						PASS	.						47.0	44.0	45.0					2																	43452438		2203	4300	6503	SO:0001583	missense	678	exon2			CGTACTTGCACGT	X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.505A>G	chr2.hg19:g.43452438T>C	ENSP00000282388:p.Lys169Glu	56.0	0.0	.		26.0	16.0	.	NM_006887	Q53TB4|Q9BSJ3	Missense_Mutation	SNP	ENST00000282388.3	hg19	CCDS1811.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.435753	0.83885	.	.	ENSG00000152518	ENST00000282388	T	0.52754	0.65	4.65	4.65	0.58169	Zinc finger, CCCH-type (3);	0.477019	0.21330	N	0.076316	T	0.73567	0.3603	M	0.91818	3.245	0.80722	D	1	D	0.71674	0.998	D	0.72338	0.977	T	0.79997	-0.1567	10	0.87932	D	0	-21.6188	13.1367	0.59413	0.0:0.0:0.0:1.0	.	169	P47974	TISD_HUMAN	E	169	ENSP00000282388:K169E	ENSP00000282388:K169E	K	-	1	0	ZFP36L2	43305942	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.528000	0.81941	1.742000	0.51746	0.454000	0.30748	AAG	.	.	.	none		0.637	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250513.2	NM_006887	
SOCS5	9655	hgsc.bcm.edu	37	2	46986775	46986775	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr2:46986775T>C	ENST00000306503.5	+	2	1278	c.1106T>C	c.(1105-1107)cTc>cCc	p.L369P	SOCS5_ENST00000394861.2_Missense_Mutation_p.L369P	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	369					cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			ATACACTGCCTCGTGCCTGAT	0.507																																					p.L369P		Atlas-SNP	.											.	SOCS5	62	.	0			c.T1106C						PASS	.						58.0	56.0	57.0					2																	46986775		2203	4300	6503	SO:0001583	missense	9655	exon2			ACTGCCTCGTGCC	AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.1106T>C	chr2.hg19:g.46986775T>C	ENSP00000305133:p.Leu369Pro	128.0	0.0	.		132.0	65.0	.	NM_144949	Q53SD4|Q8IYZ4	Missense_Mutation	SNP	ENST00000306503.5	hg19	CCDS1830.1	.	.	.	.	.	.	.	.	.	.	T	17.31	3.356193	0.61293	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	T;T	0.40476	1.03;1.03	5.43	5.43	0.79202	SH2 motif (1);	0.064994	0.64402	D	0.000007	T	0.59500	0.2198	L	0.52011	1.625	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62191	-0.6906	10	0.87932	D	0	-16.2224	15.3001	0.73940	0.0:0.0:0.0:1.0	.	369	O75159	SOCS5_HUMAN	P	369	ENSP00000305133:L369P;ENSP00000378330:L369P	ENSP00000305133:L369P	L	+	2	0	SOCS5	46840279	1.000000	0.71417	0.944000	0.38274	0.989000	0.77384	7.868000	0.87116	2.279000	0.76181	0.533000	0.62120	CTC	.	.	.	none		0.507	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250791.2		
DCTN1	1639	hgsc.bcm.edu	37	2	74597421	74597421	+	Silent	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr2:74597421C>T	ENST00000361874.3	-	12	1496	c.1179G>A	c.(1177-1179)aaG>aaA	p.K393K	DCTN1_ENST00000409868.1_Silent_p.K376K|DCTN1_ENST00000409438.1_Silent_p.K259K|DCTN1_ENST00000394003.3_Silent_p.K386K|DCTN1_ENST00000409567.3_Silent_p.K373K|DCTN1_ENST00000407639.2_Silent_p.K259K|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409240.1_Silent_p.K356K	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	393					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						TTTCCATGAGCTTCTGGAGCT	0.537																																					p.K393K		Atlas-SNP	.											.	DCTN1	110	.	0			c.G1179A						PASS	.						72.0	66.0	68.0					2																	74597421		2203	4300	6503	SO:0001819	synonymous_variant	1639	exon12			CATGAGCTTCTGG		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.1179G>A	chr2.hg19:g.74597421C>T		59.0	0.0	.		39.0	21.0	.	NM_004082	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Silent	SNP	ENST00000361874.3	hg19	CCDS1939.1																																																																																			.	.	.	none		0.537	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	
VWA3B	200403	hgsc.bcm.edu	37	2	98844793	98844793	+	Silent	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr2:98844793C>T	ENST00000477737.1	+	15	2352	c.2148C>T	c.(2146-2148)agC>agT	p.S716S		NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	716										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						ATGGAGACAGCAAGTGAGCAC	0.522																																					p.S716S		Atlas-SNP	.											.	VWA3B	138	.	0			c.C2148T						PASS	.						73.0	74.0	73.0					2																	98844793		2048	4198	6246	SO:0001819	synonymous_variant	200403	exon15			AGACAGCAAGTGA	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.2148C>T	chr2.hg19:g.98844793C>T		50.0	0.0	.		40.0	12.0	.	NM_144992	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Silent	SNP	ENST00000477737.1	hg19	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	C	4.479	0.088881	0.08583	.	.	ENSG00000168658	ENST00000473149	.	.	.	5.18	-1.5	0.08691	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.0944	0.03664	0.1619:0.4501:0.1904:0.1976	.	.	.	.	X	127	.	.	Q	+	1	0	VWA3B	98211225	0.003000	0.15002	0.052000	0.19188	0.496000	0.33645	-0.656000	0.05342	-0.261000	0.09405	0.467000	0.42956	CAA	.	.	.	none		0.522	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
MAP3K19	80122	hgsc.bcm.edu	37	2	135779307	135779307	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr2:135779307A>T	ENST00000375845.3	-	2	146	c.116T>A	c.(115-117)tTg>tAg	p.L39*	MAP3K19_ENST00000392918.3_Nonsense_Mutation_p.L39*|MAP3K19_ENST00000392915.1_Nonsense_Mutation_p.L56*|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Nonsense_Mutation_p.L39*|MAP3K19_ENST00000392917.3_Nonsense_Mutation_p.L39*|MAP3K19_ENST00000358371.4_Nonsense_Mutation_p.L39*	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	39							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										GATGCTTTGCAAGATGATGTT	0.373																																					p.L39X		Atlas-SNP	.											.	.	.	.	0			c.T116A						PASS	.						153.0	137.0	142.0					2																	135779307		2203	4300	6503	SO:0001587	stop_gained	80122	exon2			CTTTGCAAGATGA	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.116T>A	chr2.hg19:g.135779307A>T	ENSP00000365005:p.Leu39*	67.0	0.0	.		64.0	25.0	.	NM_025052	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Nonsense_Mutation	SNP	ENST00000375845.3	hg19	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	A	24.6	4.554596	0.86231	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915;ENST00000425952;ENST00000414343	.	.	.	4.44	4.44	0.53790	.	0.000000	0.31010	N	0.008422	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0351	0.42125	1.0:0.0:0.0:0.0	.	.	.	.	X	39;39;39;39;39;56;11;11	.	ENSP00000351140:L39X	L	-	2	0	YSK4	135495777	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.668000	0.46816	1.877000	0.54381	0.477000	0.44152	TTG	.	.	.	none		0.373	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
TTN	7273	hgsc.bcm.edu	37	2	179435106	179435106	+	Silent	SNP	A	A	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr2:179435106A>T	ENST00000591111.1	-	276	71054	c.70830T>A	c.(70828-70830)gtT>gtA	p.V23610V	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.V22683V|TTN_ENST00000589042.1_Silent_p.V25251V|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.V16378V|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Silent_p.V16311V|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Silent_p.V16186V|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23610	Fibronectin type-III 71. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCACAGTCCAAACTAAGCGGC	0.428																																					p.V25251V		Atlas-SNP	.											.	TTN	18412	.	0			c.T75753A						PASS	.						55.0	53.0	54.0					2																	179435106		1921	4128	6049	SO:0001819	synonymous_variant	7273	exon326			AGTCCAAACTAAG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70830T>A	chr2.hg19:g.179435106A>T		31.0	0.0	.		79.0	35.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CUL3	8452	hgsc.bcm.edu	37	2	225378264	225378264	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr2:225378264C>A	ENST00000264414.4	-	5	969	c.631G>T	c.(631-633)Gaa>Taa	p.E211*	CUL3_ENST00000344951.4_Nonsense_Mutation_p.E145*|CUL3_ENST00000432260.2_5'Flank|CUL3_ENST00000409777.1_Nonsense_Mutation_p.E187*|CUL3_ENST00000409096.1_Nonsense_Mutation_p.E187*	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	211					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GCAGACATTTCCAAAAAAGGA	0.303																																					p.E217X		Atlas-SNP	.											.	CUL3	96	.	0			c.G649T						PASS	.						57.0	60.0	59.0					2																	225378264		2202	4300	6502	SO:0001587	stop_gained	8452	exon5			ACATTTCCAAAAA	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.631G>T	chr2.hg19:g.225378264C>A	ENSP00000264414:p.Glu211*	190.0	0.0	.		148.0	54.0	.	NM_001257198	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Nonsense_Mutation	SNP	ENST00000264414.4	hg19	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	C	38	6.790642	0.97841	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	.	.	.	5.77	5.77	0.91146	.	0.095159	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	20.0562	0.97651	0.0:1.0:0.0:0.0	.	.	.	.	X	211;145;187;187	.	ENSP00000264414:E211X	E	-	1	0	CUL3	225086508	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.738000	0.68613	2.758000	0.94735	0.644000	0.83932	GAA	.	.	.	none		0.303	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
AQP12B	653437	hgsc.bcm.edu	37	2	241622010	241622010	+	Missense_Mutation	SNP	G	G	A	rs374703341		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr2:241622010G>A	ENST00000407834.3	-	1	307	c.245C>T	c.(244-246)gCg>gTg	p.A82V		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	70						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GACCCCGTGCGCCAGGAAGAG	0.672																																					p.A82V		Atlas-SNP	.											.	AQP12B	33	.	0			c.C245T						PASS	.		VAL/ALA	0,4406		0,0,2203	50.0	51.0	51.0		245	-2.4	0.1	2		51	1,8597		0,1,4298	no	missense	AQP12B	NM_001102467.1	64	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	82/308	241622010	1,13003	2203	4299	6502	SO:0001583	missense	653437	exon1			CCGTGCGCCAGGA	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.245C>T	chr2.hg19:g.241622010G>A	ENSP00000384894:p.Ala82Val	155.0	0.0	.		89.0	4.0	.	NM_001102467	A4QPB9	Missense_Mutation	SNP	ENST00000407834.3	hg19	CCDS46560.1	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.119709	0.00346	0.0	1.16E-4	ENSG00000185176	ENST00000407834	T	0.06371	3.31	2.53	-2.36	0.06663	.	0.576494	0.18143	N	0.150341	T	0.02047	0.0064	N	0.03224	-0.385	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.44726	-0.9309	9	.	.	.	-0.5459	5.1467	0.14989	0.2663:0.2058:0.5279:0.0	.	82	A6NM10-2	.	V	82	ENSP00000384894:A82V	.	A	-	2	0	AQP12B	241270683	0.001000	0.12720	0.053000	0.19242	0.111000	0.19643	0.052000	0.14163	-0.484000	0.06763	-0.359000	0.07587	GCG	.	.	.	weak		0.672	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325625.1		
SCN11A	11280	hgsc.bcm.edu	37	3	38892111	38892111	+	Silent	SNP	G	G	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr3:38892111G>A	ENST00000302328.3	-	25	4386	c.4188C>T	c.(4186-4188)tcC>tcT	p.S1396S	SCN11A_ENST00000450244.1_Silent_p.S1396S|SCN11A_ENST00000456224.3_Silent_p.S1358S|SCN11A_ENST00000444237.2_Silent_p.S1396S	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1396					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGTCAAGGATGGATTTCATGG	0.398																																					p.S1396S		Atlas-SNP	.											.	SCN11A	296	.	0			c.C4188T						PASS	.						190.0	171.0	177.0					3																	38892111		2203	4300	6503	SO:0001819	synonymous_variant	11280	exon25			AAGGATGGATTTC	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4188C>T	chr3.hg19:g.38892111G>A		35.0	0.0	.		86.0	34.0	.	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	hg19	CCDS33737.1																																																																																			.	.	.	none		0.398	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
QARS	5859	hgsc.bcm.edu	37	3	49136634	49136634	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr3:49136634C>A	ENST00000306125.6	-	18	2004	c.1667G>T	c.(1666-1668)tGt>tTt	p.C556F	QARS_ENST00000414533.1_Missense_Mutation_p.C545F|QARS_ENST00000470225.1_5'Flank			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	556					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	ATCACGCACACAGGCTTCTAG	0.542																																					p.C556F		Atlas-SNP	.											.	QARS	55	.	0			c.G1667T						PASS	.						105.0	102.0	103.0					3																	49136634		2203	4300	6503	SO:0001583	missense	5859	exon18			CGCACACAGGCTT	X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1667G>T	chr3.hg19:g.49136634C>A	ENSP00000307567:p.Cys556Phe	77.0	0.0	.		70.0	24.0	.	NM_005051	B4DWJ2	Missense_Mutation	SNP	ENST00000306125.6	hg19	CCDS2788.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.801459	0.90538	.	.	ENSG00000172053	ENST00000453392;ENST00000306125;ENST00000414533	T;T;T	0.17370	2.28;2.28;2.28	6.02	6.02	0.97574	Glutamyl/glutaminyl-tRNA synthetase, class Ib, alpha-bundle domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.40670	0.1126	L	0.55017	1.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00766	-1.1575	10	0.38643	T	0.18	-17.8032	20.5407	0.99260	0.0:1.0:0.0:0.0	.	545;556	B4DWJ2;P47897	.;SYQ_HUMAN	F	76;556;545	ENSP00000396326:C76F;ENSP00000307567:C556F;ENSP00000390015:C545F	ENSP00000307567:C556F	C	-	2	0	QARS	49111638	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.579000	0.67457	2.865000	0.98341	0.655000	0.94253	TGT	.	.	.	none		0.542	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051	
CACNA1D	776	hgsc.bcm.edu	37	3	53699775	53699775	+	Nonsense_Mutation	SNP	T	T	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr3:53699775T>G	ENST00000350061.5	+	6	1366	c.855T>G	c.(853-855)taT>taG	p.Y285*	CACNA1D_ENST00000288139.4_Nonsense_Mutation_p.Y285*|CACNA1D_ENST00000422281.2_Nonsense_Mutation_p.Y285*	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	285					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TCATAATCTATGCTATTATAG	0.333																																					p.Y285X		Atlas-SNP	.											.	CACNA1D	324	.	0			c.T855G						PASS	.						115.0	116.0	116.0					3																	53699775		2203	4300	6503	SO:0001587	stop_gained	776	exon6			AATCTATGCTATT	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.855T>G	chr3.hg19:g.53699775T>G	ENSP00000288133:p.Tyr285*	82.0	0.0	.		94.0	36.0	.	NM_001128840	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Nonsense_Mutation	SNP	ENST00000350061.5	hg19	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	T	38	6.984700	0.97983	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281	.	.	.	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0112	0.71552	0.0:0.0:0.0:1.0	.	.	.	.	X	285	.	ENSP00000288139:Y285X	Y	+	3	2	CACNA1D	53674815	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.575000	0.46025	2.125000	0.65367	0.533000	0.62120	TAT	.	.	.	none		0.333	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
ARHGAP31	57514	hgsc.bcm.edu	37	3	119133437	119133437	+	Silent	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr3:119133437C>T	ENST00000264245.4	+	12	3193	c.2661C>T	c.(2659-2661)gaC>gaT	p.D887D		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	887					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						AGCCTTCAGACTGTGACGAAG	0.557																																					p.D887D	Pancreas(7;176 297 5394 51128 51241)	Atlas-SNP	.											.	ARHGAP31	175	.	0			c.C2661T						PASS	.						108.0	111.0	110.0					3																	119133437		2075	4217	6292	SO:0001819	synonymous_variant	57514	exon12			TTCAGACTGTGAC		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2661C>T	chr3.hg19:g.119133437C>T		91.0	0.0	.		112.0	50.0	.	NM_020754	Q9ULL6	Silent	SNP	ENST00000264245.4	hg19	CCDS43135.1																																																																																			.	.	.	none		0.557	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
PLS1	5357	hgsc.bcm.edu	37	3	142383090	142383090	+	Missense_Mutation	SNP	G	G	T	rs373717334		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr3:142383090G>T	ENST00000337777.3	+	2	224	c.11G>T	c.(10-12)aGt>aTt	p.S4I	PLS1_ENST00000457734.2_Missense_Mutation_p.S4I|PLS1_ENST00000497002.1_Missense_Mutation_p.S4I	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	4						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.S4N(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						ATGGAAAACAGTACTACTACC	0.323																																					p.S4I		Atlas-SNP	.											PLS1,NS,carcinoma,0,2	PLS1	71	.	1	Substitution - Missense(1)	pancreas(1)	c.G11T						PASS	.						84.0	85.0	85.0					3																	142383090		2203	4300	6503	SO:0001583	missense	5357	exon2			AAAACAGTACTAC	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.11G>T	chr3.hg19:g.142383090G>T	ENSP00000336831:p.Ser4Ile	165.0	0.0	.		192.0	81.0	.	NM_001172312	A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	ENST00000337777.3	hg19	CCDS3125.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.581186	0.46006	.	.	ENSG00000120756	ENST00000457734;ENST00000483373;ENST00000475296;ENST00000495744;ENST00000461644;ENST00000464320;ENST00000337777;ENST00000497199;ENST00000497002	T;T;T;T;T;T;T;T;T	0.60040	0.8;0.82;0.22;0.56;0.53;0.33;0.8;0.52;0.8	5.44	3.28	0.37604	.	0.174974	0.64402	D	0.000011	T	0.19366	0.0465	N	0.00347	-1.61	0.28604	N	0.909025	B	0.15141	0.012	B	0.16722	0.016	T	0.10428	-1.0630	10	0.49607	T	0.09	-15.4577	4.5182	0.11947	0.4314:0.0:0.5686:0.0	.	4	Q14651	PLSI_HUMAN	I	4	ENSP00000387890:S4I;ENSP00000419893:S4I;ENSP00000417311:S4I;ENSP00000419531:S4I;ENSP00000419271:S4I;ENSP00000418880:S4I;ENSP00000336831:S4I;ENSP00000417491:S4I;ENSP00000418700:S4I	ENSP00000336831:S4I	S	+	2	0	PLS1	143865780	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	2.794000	0.47853	1.466000	0.48025	0.580000	0.79431	AGT	.	.	.	alt		0.323	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
TACC3	10460	hgsc.bcm.edu	37	4	1729484	1729485	+	Missense_Mutation	DNP	CA	CA	GT			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr4:1729484_1729485CA>GT	ENST00000313288.4	+	4	461_462	c.355_356CA>GT	c.(355-357)CAg>GTg	p.Q119V		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	119					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			TGGAATTCTACAGAAACCAGTG	0.54																																					p.Q119E|p.Q119L	Ovarian(120;482 2294 11894 35824)	Atlas-SNP	.											.	TACC3	69	.	0			c.C355G|c.A356T						PASS	.																																			SO:0001583	missense	10460	exon4			ATTCTACAGAAAC|TTCTACAGAAACC	AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	Exception_encountered	chr4.hg19:g.1729484_1729485delinsGT	ENSP00000326550:p.Gln119Val	178.0|181.0	0.0	.		115.0|117.0	63.0	.	NM_006342	Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	ENST00000313288.4	hg19	CCDS3352.1																																																																																			.	.	.	none		0.540	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2		
ATP10D	57205	hgsc.bcm.edu	37	4	47574963	47574963	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr4:47574963G>T	ENST00000273859.3	+	18	3584	c.3315G>T	c.(3313-3315)tgG>tgT	p.W1105C		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1105					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						ATGGACACTGGTGTTATACAC	0.448																																					p.W1105C		Atlas-SNP	.											.	ATP10D	168	.	0			c.G3315T						PASS	.						279.0	263.0	268.0					4																	47574963		2203	4300	6503	SO:0001583	missense	57205	exon18			ACACTGGTGTTAT	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.3315G>T	chr4.hg19:g.47574963G>T	ENSP00000273859:p.Trp1105Cys	42.0	0.0	.		55.0	18.0	.	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	hg19	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704143	0.88924	.	.	ENSG00000145246	ENST00000273859	T	0.72167	-0.63	6.06	6.06	0.98353	HAD-like domain (1);	0.000000	0.85682	D	0.000000	D	0.89553	0.6748	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91174	0.4971	10	0.87932	D	0	-11.8389	20.6397	0.99537	0.0:0.0:1.0:0.0	.	1105	Q9P241	AT10D_HUMAN	C	1105	ENSP00000273859:W1105C	ENSP00000273859:W1105C	W	+	3	0	ATP10D	47269720	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.020000	0.88740	2.880000	0.98712	0.650000	0.86243	TGG	.	.	.	none		0.448	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
ANKRD17	26057	hgsc.bcm.edu	37	4	74027050	74027050	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr4:74027050G>T	ENST00000358602.4	-	3	679	c.563C>A	c.(562-564)tCc>tAc	p.S188Y	ANKRD17_ENST00000330838.6_Missense_Mutation_p.S188Y|ANKRD17_ENST00000509867.2_Missense_Mutation_p.S75Y	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	188					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATCAGCCGTGGACAATTTTCC	0.408																																					p.S188Y		Atlas-SNP	.											ANKRD17,NS,carcinoma,0,1	ANKRD17	214	.	0			c.C563A						PASS	.						102.0	95.0	97.0					4																	74027050		2203	4300	6503	SO:0001583	missense	26057	exon3			GCCGTGGACAATT	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.563C>A	chr4.hg19:g.74027050G>T	ENSP00000351416:p.Ser188Tyr	61.0	0.0	.		82.0	37.0	.	NM_198889	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	hg19	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	G	31	5.096994	0.94197	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.71461	-0.4;-0.27;-0.57	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000005	T	0.81192	0.4771	L	0.50333	1.59	0.40447	D	0.980101	P;D;D;D	0.64830	0.894;0.994;0.981;0.989	P;D;P;P	0.66716	0.706;0.946;0.825;0.706	T	0.82647	-0.0354	10	0.72032	D	0.01	.	19.4722	0.94967	0.0:0.0:1.0:0.0	.	188;188;188;75	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	Y	188;188;188;75;188	ENSP00000351416:S188Y;ENSP00000332265:S188Y;ENSP00000427151:S75Y	ENSP00000332265:S188Y	S	-	2	0	ANKRD17	74245914	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.848000	0.99507	2.614000	0.88457	0.591000	0.81541	TCC	.	.	.	none		0.408	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
FRAS1	80144	hgsc.bcm.edu	37	4	79387543	79387543	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr4:79387543C>T	ENST00000264895.6	+	50	7651	c.7211C>T	c.(7210-7212)tCt>tTt	p.S2404F		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2404					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TTCACTGTTTCTGATGGGACA	0.532																																					p.S2404F		Atlas-SNP	.											.	FRAS1	779	.	0			c.C7211T						PASS	.						64.0	64.0	64.0					4																	79387543		2033	4197	6230	SO:0001583	missense	80144	exon50			CTGTTTCTGATGG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7211C>T	chr4.hg19:g.79387543C>T	ENSP00000264895:p.Ser2404Phe	124.0	0.0	.		195.0	78.0	.	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	hg19	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	C	13.07	2.127811	0.37533	.	.	ENSG00000138759	ENST00000264895	T	0.25250	1.81	4.86	4.01	0.46588	.	0.622123	0.16858	N	0.196636	T	0.41719	0.1171	M	0.69823	2.125	0.80722	D	1	P	0.48998	0.918	P	0.50896	0.653	T	0.48479	-0.9032	10	0.87932	D	0	.	15.6258	0.76855	0.0:0.8621:0.1379:0.0	.	2404	E9PHH6	.	F	2404	ENSP00000264895:S2404F	ENSP00000264895:S2404F	S	+	2	0	FRAS1	79606567	0.029000	0.19370	0.707000	0.30419	0.840000	0.47671	2.800000	0.47900	1.398000	0.46701	0.585000	0.79938	TCT	.	.	.	none		0.532	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
POU4F2	5458	hgsc.bcm.edu	37	4	147560484	147560484	+	Silent	SNP	C	C	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr4:147560484C>A	ENST00000281321.3	+	1	440	c.192C>A	c.(190-192)ggC>ggA	p.G64G	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	64	Poly-Gly.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					gcggcggcggcggcggcggag	0.771																																					p.G64G		Atlas-SNP	.											.	POU4F2	83	.	0			c.C192A						PASS	.						3.0	5.0	5.0					4																	147560484		1329	2897	4226	SO:0001819	synonymous_variant	5458	exon1			CGGCGGCGGCGGC	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.192C>A	chr4.hg19:g.147560484C>A		117.0	0.0	.		70.0	5.0	.	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	ENST00000281321.3	hg19	CCDS34074.1																																																																																			.	.	.	none		0.771	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
TERT	7015	hgsc.bcm.edu	37	5	1258735	1258736	+	Missense_Mutation	DNP	TC	TC	CG			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr5:1258735_1258736TC>CG	ENST00000310581.5	-	13	3066_3067	c.3009_3010GA>CG	c.(3007-3012)aaGAtc>aaCGtc	p.1003_1004KI>NV	TERT_ENST00000334602.6_Missense_Mutation_p.940_941KI>NV|TERT_ENST00000296820.5_3'UTR	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	1003	CTE.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	AGCAGGAGGATCTTGTAGATGT	0.574									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																												p.I1004V|p.K1003N		Atlas-SNP	.											.	TERT	2594	.	0			c.A3010G|c.G3009C						PASS	.																																			SO:0001583	missense	7015	exon13	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	GGAGGATCTTGTA|GAGGATCTTGTAG	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.3009_3010delinsCG	chr5.hg19:g.1258735_1258736delinsCG	ENSP00000309572:p.K1003_I1004delinsNV	66.0	0.0	.		43.0|44.0	14.0	.	NM_198253	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	ENST00000310581.5	hg19	CCDS3861.2																																																																																			.	.	.	none		0.574	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2		
SLC45A2	51151	hgsc.bcm.edu	37	5	33984582	33984582	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr5:33984582A>G	ENST00000296589.4	-	1	253	c.107T>C	c.(106-108)aTc>aCc	p.I36T	SLC45A2_ENST00000509381.1_Missense_Mutation_p.I36T|SLC45A2_ENST00000342059.3_Missense_Mutation_p.I36T|SLC45A2_ENST00000345083.5_Missense_Mutation_p.I36T|SLC45A2_ENST00000382102.3_Missense_Mutation_p.I36T	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	36					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						GCTGTGCATGATGAGTCTGCT	0.582																																					p.I36T	Ovarian(31;380 859 8490 22203 49048)	Atlas-SNP	.											.	SLC45A2	100	.	0			c.T107C						PASS	.						53.0	51.0	52.0					5																	33984582		2203	4300	6503	SO:0001583	missense	51151	exon1			TGCATGATGAGTC	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.107T>C	chr5.hg19:g.33984582A>G	ENSP00000296589:p.Ile36Thr	18.0	0.0	.		22.0	9.0	.	NM_016180	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	hg19	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.956505	0.53293	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000509381;ENST00000345083	D;D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06;-3.06	5.41	5.41	0.78517	Major facilitator superfamily domain, general substrate transporter (1);	0.360446	0.32386	N	0.006168	D	0.94689	0.8287	M	0.82323	2.585	0.58432	D	0.999993	P;B;P	0.51653	0.947;0.427;0.766	P;P;P	0.52823	0.659;0.462;0.71	D	0.94810	0.7978	10	0.51188	T	0.08	-13.8858	15.4467	0.75235	1.0:0.0:0.0:0.0	.	36;36;36	D6RGY6;Q9UMX9-4;Q9UMX9	.;.;S45A2_HUMAN	T	36	ENSP00000296589:I36T;ENSP00000341014:I36T;ENSP00000371534:I36T;ENSP00000421100:I36T;ENSP00000340444:I36T	ENSP00000296589:I36T	I	-	2	0	SLC45A2	34020339	1.000000	0.71417	0.786000	0.31890	0.432000	0.31715	8.996000	0.93539	2.050000	0.60909	0.450000	0.29827	ATC	.	.	.	none		0.582	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
LOX	4015	hgsc.bcm.edu	37	5	121413349	121413349	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr5:121413349C>G	ENST00000231004.4	-	1	631	c.332G>C	c.(331-333)gGa>gCa	p.G111A	LOX_ENST00000513319.1_5'Flank	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	111					blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		AGCGGTGACTCCAGATGAGCC	0.721																																					p.G111A		Atlas-SNP	.											.	LOX	29	.	0			c.G332C						PASS	.						7.0	9.0	8.0					5																	121413349		2060	4113	6173	SO:0001583	missense	4015	exon1			GTGACTCCAGATG		CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.332G>C	chr5.hg19:g.121413349C>G	ENSP00000231004:p.Gly111Ala	94.0	0.0	.		79.0	33.0	.	NM_002317	B2R5Q3|Q5FWF0	Missense_Mutation	SNP	ENST00000231004.4	hg19	CCDS4129.1	.	.	.	.	.	.	.	.	.	.	C	0.254	-1.004655	0.02112	.	.	ENSG00000113083	ENST00000231004;ENST00000543620	T	0.21734	1.99	4.35	3.47	0.39725	.	0.917794	0.09424	N	0.804091	T	0.13157	0.0319	N	0.19112	0.55	0.31202	N	0.699664	B	0.13145	0.007	B	0.12837	0.008	T	0.19484	-1.0304	10	0.05620	T	0.96	.	12.4631	0.55743	0.0:0.6775:0.3225:0.0	.	111	P28300	LYOX_HUMAN	A	111;71	ENSP00000231004:G111A	ENSP00000231004:G111A	G	-	2	0	LOX	121441248	0.002000	0.14202	0.020000	0.16555	0.036000	0.12997	1.657000	0.37366	0.779000	0.33543	0.455000	0.32223	GGA	.	.	.	none		0.721	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250887.2		
PCDHA2	56146	hgsc.bcm.edu	37	5	140176343	140176343	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr5:140176343C>G	ENST00000526136.1	+	1	1794	c.1794C>G	c.(1792-1794)gaC>gaG	p.D598E	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.D598E|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.D598E	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	598	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCAGTGGACGCTGACTCAG	0.657																																					p.D598E		Atlas-SNP	.											.	PCDHA2	404	.	0			c.C1794G						PASS	.						160.0	144.0	149.0					5																	140176343		2203	4300	6503	SO:0001583	missense	56146	exon1			AGTGGACGCTGAC	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1794C>G	chr5.hg19:g.140176343C>G	ENSP00000431748:p.Asp598Glu	142.0	0.0	.		84.0	33.0	.	NM_031495	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	hg19	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	11.04	1.520898	0.27211	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.61392	0.11;0.11;0.11	3.91	-0.181	0.13291	Cadherin (4);Cadherin-like (1);	0.000000	0.41194	U	0.000923	D	0.82572	0.5066	H	0.99261	4.49	0.27054	N	0.963715	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	T	0.73940	-0.3824	10	0.87932	D	0	.	8.5891	0.33677	0.0:0.3705:0.0:0.6295	.	598;598;598	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	E	598	ENSP00000430584:D598E;ENSP00000367372:D598E;ENSP00000431748:D598E	ENSP00000367372:D598E	D	+	3	2	PCDHA2	140156527	0.000000	0.05858	0.783000	0.31826	0.107000	0.19398	-0.793000	0.04589	-0.027000	0.13873	-1.080000	0.02220	GAC	.	.	.	none		0.657	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
IRF4	3662	hgsc.bcm.edu	37	6	401489	401489	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr6:401489C>T	ENST00000380956.4	+	7	937	c.811C>T	c.(811-813)Ccc>Tcc	p.P271S		NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	271					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		CACGTCCAGCCCCGAGGGCTG	0.597			T	IGH@	MM																																p.P271S		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.C811T						PASS	.						61.0	50.0	54.0					6																	401489		2203	4300	6503	SO:0001583	missense	3662	exon7			TCCAGCCCCGAGG	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.811C>T	chr6.hg19:g.401489C>T	ENSP00000370343:p.Pro271Ser	106.0	0.0	.		85.0	30.0	.	NM_002460	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	hg19	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	C	31	5.095778	0.94197	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.95690	-3.78	5.76	5.76	0.90799	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.000000	0.85682	D	0.000000	D	0.96030	0.8707	M	0.62209	1.925	0.80722	D	1	B;P;B;P	0.44429	0.389;0.645;0.088;0.835	P;P;B;P	0.53518	0.507;0.588;0.127;0.728	D	0.94968	0.8114	10	0.41790	T	0.15	-14.7588	19.9857	0.97347	0.0:1.0:0.0:0.0	.	271;301;270;271	F2Z3D5;Q99419;Q15306-2;Q15306	.;.;.;IRF4_HUMAN	S	271;300	ENSP00000370343:P271S	ENSP00000370343:P271S	P	+	1	0	IRF4	346489	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	7.440000	0.80464	2.706000	0.92434	0.655000	0.94253	CCC	.	.	.	none		0.597	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
IBTK	25998	hgsc.bcm.edu	37	6	82906099	82906099	+	Silent	SNP	A	A	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr6:82906099A>T	ENST00000306270.7	-	22	3639	c.3090T>A	c.(3088-3090)tcT>tcA	p.S1030S	IBTK_ENST00000503631.1_Silent_p.S829S|IBTK_ENST00000510291.1_Silent_p.S1015S	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	1030					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		AGCTTCCTTCAGAGTCTGATG	0.358																																					p.S1030S		Atlas-SNP	.											.	IBTK	128	.	0			c.T3090A						PASS	.						86.0	85.0	85.0					6																	82906099		2203	4300	6503	SO:0001819	synonymous_variant	25998	exon22			TCCTTCAGAGTCT	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.3090T>A	chr6.hg19:g.82906099A>T		42.0	0.0	.		70.0	24.0	.	NM_015525	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Silent	SNP	ENST00000306270.7	hg19	CCDS34490.1																																																																																			.	.	.	none		0.358	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
MDN1	23195	hgsc.bcm.edu	37	6	90491213	90491213	+	Silent	SNP	A	A	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr6:90491213A>G	ENST00000369393.3	-	10	1663	c.1548T>C	c.(1546-1548)gaT>gaC	p.D516D	MDN1_ENST00000428876.1_Silent_p.D516D			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	516					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CAACAGAACTATCACTCCAAG	0.423																																					p.D516D		Atlas-SNP	.											.	MDN1	478	.	0			c.T1548C						PASS	.						139.0	135.0	136.0					6																	90491213		2203	4300	6503	SO:0001819	synonymous_variant	23195	exon10			AGAACTATCACTC	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.1548T>C	chr6.hg19:g.90491213A>G		183.0	0.0	.		158.0	62.0	.	NM_014611	O15019|Q5T794	Silent	SNP	ENST00000369393.3	hg19	CCDS5024.1																																																																																			.	.	.	none		0.423	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
PSMB1	5689	hgsc.bcm.edu	37	6	170862258	170862258	+	Missense_Mutation	SNP	G	G	T	rs60257797	byFrequency	TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr6:170862258G>T	ENST00000262193.6	-	1	171	c.73C>A	c.(73-75)Cct>Act	p.P25T	TBP_ENST00000540980.1_5'Flank|TBP_ENST00000392092.2_5'Flank|PSMB1_ENST00000462957.1_5'Flank|TBP_ENST00000230354.6_5'Flank	NM_002793.3	NP_002784.1	P20618	PSB1_HUMAN	proteasome (prosome, macropain) subunit, beta type, 1	25					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)|Carfilzomib(DB08889)	AGCTGCAAAGGGCCCGCGGCT	0.592																																					p.P25T		Atlas-SNP	.											.	PSMB1	12	.	0			c.C73A						PASS	.						39.0	38.0	38.0					6																	170862258		2203	4299	6502	SO:0001583	missense	5689	exon1			GCAAAGGGCCCGC	D00761	CCDS34577.1	6q27	2008-02-05			ENSG00000008018	ENSG00000008018		"""Proteasome (prosome, macropain) subunits"""	9537	protein-coding gene	gene with protein product		602017				2025653	Standard	NM_002793		Approved	PMSB1, HC5	uc011ehe.2	P20618	OTTHUMG00000016087	ENST00000262193.6:c.73C>A	chr6.hg19:g.170862258G>T	ENSP00000262193:p.Pro25Thr	82.0	0.0	.		63.0	8.0	.	NM_002793	B5BU76|Q9BWA8	Missense_Mutation	SNP	ENST00000262193.6	hg19	CCDS34577.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.487058	0.44249	.	.	ENSG00000008018	ENST00000262193;ENST00000392093	T	0.25085	1.82	4.37	3.5	0.40072	.	0.244443	0.41605	D	0.000845	T	0.06508	0.0167	N	0.19112	0.55	0.54753	D	0.999988	P	0.45348	0.856	B	0.38803	0.282	T	0.17561	-1.0365	10	0.35671	T	0.21	-6.038	8.6868	0.34243	0.0863:0.1526:0.761:0.0	.	25	P20618	PSB1_HUMAN	T	25;30	ENSP00000262193:P25T	ENSP00000262193:P25T	P	-	1	0	PSMB1	170704183	1.000000	0.71417	0.769000	0.31535	0.030000	0.12068	4.424000	0.59868	1.054000	0.40438	-0.253000	0.11424	CCT	.	G|0.998;A|0.002	.	alt		0.592	PSMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043278.2	NM_002793	
COL28A1	340267	hgsc.bcm.edu	37	7	7557428	7557428	+	Splice_Site	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr7:7557428C>T	ENST00000399429.3	-	7	994	c.854G>A	c.(853-855)gGg>gAg	p.G285E		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	285					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TGTACATACCCCTGGACCTCT	0.433																																					p.G285E		Atlas-SNP	.											.	COL28A1	113	.	0			c.G854A						PASS	.						201.0	194.0	196.0					7																	7557428		1875	4116	5991	SO:0001630	splice_region_variant	340267	exon7			CATACCCCTGGAC	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.855+1G>A	chr7.hg19:g.7557428C>T		90.0	0.0	.		246.0	110.0	.	NM_001037763	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	hg19	CCDS43553.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.496886	0.01001	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	D	0.91577	-2.87	3.8	-0.292	0.12839	.	1.902390	0.03505	U	0.218727	T	0.67306	0.2879	N	0.00729	-1.24	0.20764	N	0.999859	P	0.35468	0.503	B	0.33521	0.165	T	0.69018	-0.5256	10	0.06891	T	0.86	2.2101	3.0593	0.06195	0.3875:0.3932:0.0:0.2193	.	285	Q2UY09	COSA1_HUMAN	E	285	ENSP00000382356:G285E	ENSP00000382347:G285E	G	-	2	0	COL28A1	7523953	0.996000	0.38824	0.410000	0.26471	0.493000	0.33554	0.295000	0.19065	-0.057000	0.13199	0.655000	0.94253	GGG	.	.	.	none		0.433	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763	Missense_Mutation
MOSPD3	64598	hgsc.bcm.edu	37	7	100210558	100210558	+	Silent	SNP	G	G	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr7:100210558G>T	ENST00000393950.2	+	1	426	c.144G>T	c.(142-144)cgG>cgT	p.R48R	MOSPD3_ENST00000424091.2_Silent_p.R48R|MOSPD3_ENST00000223054.4_Silent_p.R48R|MOSPD3_ENST00000379527.2_Silent_p.R48R	NM_023948.4	NP_076438.1	O75425	MSPD3_HUMAN	motile sperm domain containing 3	48	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.				heart development (GO:0007507)	integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CGGACCAGCGGAGCGGACCCC	0.697																																					p.R48R		Atlas-SNP	.											.	MOSPD3	29	.	0			c.G144T						PASS	.						53.0	61.0	58.0					7																	100210558		2203	4296	6499	SO:0001819	synonymous_variant	64598	exon2			CCAGCGGAGCGGA	BC011653	CCDS5701.1, CCDS47662.1	7q22	2009-11-06			ENSG00000106330	ENSG00000106330			25078	protein-coding gene	gene with protein product		609125				15533722	Standard	XM_005250531		Approved	CDS3, NET30	uc003uvs.3	O75425	OTTHUMG00000159599	ENST00000393950.2:c.144G>T	chr7.hg19:g.100210558G>T		382.0	0.0	.		463.0	213.0	.	NM_001040098	A4D2D1|A6NG17|C9JE89|D6W5W1|O75423|O75424	Silent	SNP	ENST00000393950.2	hg19	CCDS5701.1																																																																																			.	.	.	none		0.697	MOSPD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356395.1	NM_023948	
MTUS1	57509	hgsc.bcm.edu	37	8	17503480	17503480	+	Silent	SNP	T	T	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr8:17503480T>A	ENST00000262102.6	-	15	3992	c.3768A>T	c.(3766-3768)ccA>ccT	p.P1256P	MTUS1_ENST00000400046.1_Silent_p.P328P|MTUS1_ENST00000519263.1_Silent_p.P1202P|MTUS1_ENST00000544260.1_Silent_p.P401P|MTUS1_ENST00000381869.3_Silent_p.P1202P|MTUS1_ENST00000381861.3_Silent_p.P503P|MTUS1_ENST00000297488.6_Silent_p.P422P	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	1256					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		CCGAATTCCTTGGTGACTGCA	0.537																																					p.P1256P		Atlas-SNP	.											.	MTUS1	144	.	0			c.A3768T						PASS	.						61.0	64.0	63.0					8																	17503480		1923	4140	6063	SO:0001819	synonymous_variant	57509	exon15			ATTCCTTGGTGAC	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.3768A>T	chr8.hg19:g.17503480T>A		95.0	0.0	.		105.0	45.0	.	NM_001001924	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Silent	SNP	ENST00000262102.6	hg19	CCDS43717.1																																																																																			.	.	.	none		0.537	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
STC1	6781	hgsc.bcm.edu	37	8	23702289	23702289	+	Silent	SNP	A	A	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr8:23702289A>G	ENST00000290271.2	-	4	1021	c.738T>C	c.(736-738)agT>agC	p.S246S	STC1_ENST00000524323.1_Silent_p.S177S	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	246					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		CTGGTTATGCACTCTCATGGG	0.498																																					p.S246S		Atlas-SNP	.											.	STC1	49	.	0			c.T738C						PASS	.						95.0	81.0	86.0					8																	23702289		2203	4300	6503	SO:0001819	synonymous_variant	6781	exon4			TTATGCACTCTCA		CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.738T>C	chr8.hg19:g.23702289A>G		19.0	0.0	.		58.0	32.0	.	NM_003155	B4DN22|Q71UE5	Silent	SNP	ENST00000290271.2	hg19	CCDS6043.1																																																																																			.	.	.	none		0.498	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215143.1		
POLR1E	64425	hgsc.bcm.edu	37	9	37500883	37500883	+	Silent	SNP	G	G	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr9:37500883G>T	ENST00000377798.4	+	10	1046	c.933G>T	c.(931-933)ctG>ctT	p.L311L	POLR1E_ENST00000377792.3_Silent_p.L373L|POLR1E_ENST00000442009.2_Silent_p.L241L	NM_022490.1	NP_071935.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide E, 53kDa	0					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	12				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		CCAAACTGCTGAAGCACTTTA	0.498																																					p.L311L	Ovarian(116;843 1620 18506 32459 34463)	Atlas-SNP	.											.	POLR1E	28	.	0			c.G933T						PASS	.						138.0	116.0	123.0					9																	37500883		2203	4300	6503	SO:0001819	synonymous_variant	64425	exon10			ACTGCTGAAGCAC	AK091294	CCDS6611.1	9p13.1	2013-01-21	2006-03-09	2006-03-09	ENSG00000137054	ENSG00000137054		"""RNA polymerase subunits"""	17631	protein-coding gene	gene with protein product	"""RNA polymerase I associated factor 53"""		"""polymerase (RNA) I associated factor 1"""	PRAF1		8641287	Standard	XM_005251547		Approved	FLJ13390, PAF53, FLJ13970	uc003zzy.1	Q9GZS1	OTTHUMG00000019920	ENST00000377798.4:c.933G>T	chr9.hg19:g.37500883G>T		108.0	0.0	.		73.0	5.0	.	NM_022490	O75395|Q5JTE3	Silent	SNP	ENST00000377798.4	hg19	CCDS6611.1																																																																																			.	.	.	none		0.498	POLR1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052464.1	NM_022490	
OBP2B	29989	hgsc.bcm.edu	37	9	136082700	136082700	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr9:136082700G>C	ENST00000372034.3	-	4	342	c.301C>G	c.(301-303)Ctg>Gtg	p.L101V	OBP2B_ENST00000372032.2_Missense_Mutation_p.P56R|OBP2B_ENST00000461961.1_5'UTR	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	101					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)			central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		AGCTCCTGCAGGTACATGAGC	0.547																																					p.L101V		Atlas-SNP	.											.	OBP2B	20	.	0			c.C301G						PASS	.						110.0	83.0	92.0					9																	136082700		2203	4300	6503	SO:0001583	missense	29989	exon4			CCTGCAGGTACAT	AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.301C>G	chr9.hg19:g.136082700G>C	ENSP00000361104:p.Leu101Val	113.0	0.0	.		50.0	20.0	.	NM_014581	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	hg19	CCDS6961.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.604|0.604	-0.827969|-0.827969	0.02734|0.02734	.|.	.|.	ENSG00000171102|ENSG00000171102	ENST00000372034|ENST00000372032	T|T	0.05025|0.08102	3.51|3.13	1.91|1.91	-3.82|-3.82	0.04281|0.04281	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);|.	1.036800|.	0.07743|.	N|.	0.947204|.	T|T	0.02727|0.02727	0.0082|0.0082	N|N	0.03194|0.03194	-0.395|-0.395	0.09310|0.09310	N|N	1|1	B|.	0.06786|.	0.001|.	B|.	0.15052|.	0.012|.	T|T	0.36504|0.36504	-0.9745|-0.9745	10|7	0.02654|0.87932	T|D	1|0	-15.1887|-15.1887	0.9011|0.9011	0.01274|0.01274	0.1534:0.1911:0.3106:0.3449|0.1534:0.1911:0.3106:0.3449	.|.	101|.	Q9NPH6|.	OBP2B_HUMAN|.	V|R	101|56	ENSP00000361104:L101V|ENSP00000361102:P56R	ENSP00000361104:L101V|ENSP00000361102:P56R	L|P	-|-	1|2	2|0	OBP2B|OBP2B	135072521|135072521	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-2.234000|-2.234000	0.01203|0.01203	-2.668000|-2.668000	0.00415|0.00415	-2.408000|-2.408000	0.00222|0.00222	CTG|CCT	.	.	.	none		0.547	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
MTPAP	55149	hgsc.bcm.edu	37	10	30615418	30615418	+	Silent	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr10:30615418C>T	ENST00000263063.4	-	5	970	c.927G>A	c.(925-927)cgG>cgA	p.R309R	MTPAP_ENST00000358107.4_Silent_p.R439R|MTPAP_ENST00000488290.1_5'UTR	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	309					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CGAGCGGACACCGGGCATTTA	0.443																																					p.R309R		Atlas-SNP	.											MTPAP_ENST00000358107,right_upper_lobe,carcinoma,0,2	MTPAP	113	.	0			c.G927A						PASS	.						107.0	115.0	112.0					10																	30615418		2203	4300	6503	SO:0001819	synonymous_variant	55149	exon5			CGGACACCGGGCA	AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.927G>A	chr10.hg19:g.30615418C>T		343.0	0.0	.		306.0	135.0	.	NM_018109	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Silent	SNP	ENST00000263063.4	hg19	CCDS7165.1																																																																																			.	.	.	none		0.443	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047426.2	NM_018109	
ANKRD2	26287	hgsc.bcm.edu	37	10	99343384	99343384	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr10:99343384C>T	ENST00000307518.5	+	9	1252	c.985C>T	c.(985-987)Cac>Tac	p.H329Y	PI4K2A_ENST00000370649.3_5'Flank|HOGA1_ENST00000370646.4_5'Flank|ANKRD2_ENST00000455090.1_Missense_Mutation_p.H269Y|ANKRD2_ENST00000298808.5_Missense_Mutation_p.H296Y|HOGA1_ENST00000370647.4_5'Flank|ANKRD2_ENST00000370655.1_Missense_Mutation_p.H302Y|PI4K2A_ENST00000555577.1_5'Flank			Q9GZV1	ANKR2_HUMAN	ankyrin repeat domain 2 (stretch responsive muscle)	329					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|euchromatin (GO:0000791)|I band (GO:0031674)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	protein kinase B binding (GO:0043422)|structural constituent of muscle (GO:0008307)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)		TGATACCCGGCACGCCCTGGA	0.647																																					p.H329Y		Atlas-SNP	.											.	ANKRD2	27	.	0			c.C985T						PASS	.						18.0	18.0	18.0					10																	99343384		2200	4298	6498	SO:0001583	missense	26287	exon9			ACCCGGCACGCCC	AJ304805	CCDS7466.1, CCDS44468.1	10q23	2013-01-10			ENSG00000165887	ENSG00000165887		"""Ankyrin repeat domain containing"""	495	protein-coding gene	gene with protein product		610734				10873377, 15136035, 15677738	Standard	NM_001129981		Approved	ARPP	uc001knw.3	Q9GZV1	OTTHUMG00000018860	ENST00000307518.5:c.985C>T	chr10.hg19:g.99343384C>T	ENSP00000306163:p.His329Tyr	367.0	0.0	.		220.0	90.0	.	NM_020349	Q3B778|Q5T456|Q70EZ9|Q8WUD7|Q96MG0|Q9NQC9	Missense_Mutation	SNP	ENST00000307518.5	hg19	CCDS7466.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437522	0.43224	.	.	ENSG00000165887	ENST00000307518;ENST00000298808;ENST00000370655;ENST00000455090	T;T;T;T	0.67171	0.93;-0.25;0.88;-0.25	5.6	2.43	0.29744	.	0.449475	0.21686	N	0.070642	T	0.49813	0.1579	N	0.24115	0.695	0.23950	N	0.996373	B;B	0.27117	0.168;0.072	B;B	0.28139	0.086;0.059	T	0.46470	-0.9189	10	0.59425	D	0.04	-0.4987	8.5035	0.33173	0.5059:0.3605:0.1336:0.0	.	296;329	Q9GZV1-2;Q9GZV1	.;ANKR2_HUMAN	Y	329;296;302;269	ENSP00000306163:H329Y;ENSP00000298808:H296Y;ENSP00000359689:H302Y;ENSP00000403114:H269Y	ENSP00000298808:H296Y	H	+	1	0	ANKRD2	99333374	0.396000	0.25262	0.978000	0.43139	0.887000	0.51463	0.858000	0.27845	0.635000	0.30488	0.561000	0.74099	CAC	.	.	.	none		0.647	ANKRD2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
NRAP	4892	hgsc.bcm.edu	37	10	115401186	115401186	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr10:115401186C>T	ENST00000359988.3	-	13	1505	c.1261G>A	c.(1261-1263)Gaa>Aaa	p.E421K	NRAP_ENST00000369360.3_Missense_Mutation_p.E386K|NRAP_ENST00000360478.3_Missense_Mutation_p.E386K|NRAP_ENST00000369358.4_Missense_Mutation_p.E421K	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CCAACTCCTTCATAGCGGCCT	0.453																																					p.E421K		Atlas-SNP	.											NRAP,NS,carcinoma,0,1	NRAP	208	.	0			c.G1261A						PASS	.						178.0	159.0	165.0					10																	115401186		2203	4300	6503	SO:0001583	missense	4892	exon13			CTCCTTCATAGCG		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.1261G>A	chr10.hg19:g.115401186C>T	ENSP00000353078:p.Glu421Lys	50.0	0.0	.		42.0	21.0	.	NM_001261463		Missense_Mutation	SNP	ENST00000359988.3	hg19	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983267	0.53827	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350;ENST00000369343	T;T;T;T	0.31510	1.49;2.55;1.49;2.37	5.49	4.57	0.56435	.	0.215254	0.47852	D	0.000220	T	0.22666	0.0547	L	0.45137	1.4	0.31944	N	0.61052	P;P;P	0.35527	0.507;0.454;0.474	B;B;B	0.35182	0.184;0.197;0.097	T	0.13953	-1.0490	10	0.06757	T	0.87	.	11.3728	0.49711	0.0:0.8029:0.1271:0.0701	.	421;386;421	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	K	421;386;421;386;150;150	ENSP00000358365:E421K;ENSP00000358367:E386K;ENSP00000353078:E421K;ENSP00000353666:E386K	ENSP00000353078:E421K	E	-	1	0	NRAP	115391176	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.648000	0.46647	1.280000	0.44463	0.561000	0.74099	GAA	.	.	.	none		0.453	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
MAP4K2	5871	hgsc.bcm.edu	37	11	64557720	64557720	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr11:64557720C>T	ENST00000294066.2	-	29	2279	c.2188G>A	c.(2188-2190)Ggc>Agc	p.G730S	MAP4K2_ENST00000377350.3_Missense_Mutation_p.G722S	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	730	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						GTGGGCTCGCCCTGCATGTTG	0.622																																					p.G730S		Atlas-SNP	.											.	MAP4K2	83	.	0			c.G2188A						PASS	.						127.0	113.0	118.0					11																	64557720		2201	4297	6498	SO:0001583	missense	5871	exon29			GCTCGCCCTGCAT	BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.2188G>A	chr11.hg19:g.64557720C>T	ENSP00000294066:p.Gly730Ser	79.0	0.0	.		64.0	33.0	.	NM_004579	Q86VU3	Missense_Mutation	SNP	ENST00000294066.2	hg19	CCDS8082.1	.	.	.	.	.	.	.	.	.	.	C	34	5.409908	0.96072	.	.	ENSG00000168067	ENST00000294066;ENST00000377350	T;T	0.36340	1.26;1.26	5.28	5.28	0.74379	Citron-like (3);	0.000000	0.85682	D	0.000000	T	0.61274	0.2334	M	0.76938	2.355	0.53005	D	0.999966	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.65582	-0.6133	10	0.87932	D	0	.	14.4958	0.67685	0.0:1.0:0.0:0.0	.	722;730	Q86VU3;Q12851	.;M4K2_HUMAN	S	730;722	ENSP00000294066:G730S;ENSP00000366567:G722S	ENSP00000294066:G730S	G	-	1	0	MAP4K2	64314296	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	6.468000	0.73551	2.494000	0.84150	0.555000	0.69702	GGC	.	.	.	none		0.622	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579	
CNTN5	53942	hgsc.bcm.edu	37	11	99690335	99690335	+	Missense_Mutation	SNP	A	A	T	rs199945392		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr11:99690335A>T	ENST00000524871.1	+	4	406	c.116A>T	c.(115-117)aAg>aTg	p.K39M	CNTN5_ENST00000527185.1_Missense_Mutation_p.K39M|CNTN5_ENST00000418526.2_Intron|CNTN5_ENST00000279463.3_Missense_Mutation_p.K39M|CNTN5_ENST00000528682.1_Missense_Mutation_p.K39M	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	39					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AGAATTAAGAAGAGTTCATCT	0.398																																					p.K39M		Atlas-SNP	.											.	CNTN5	324	.	0			c.A116T						PASS	.						125.0	126.0	125.0					11																	99690335		1887	4119	6006	SO:0001583	missense	53942	exon3			TTAAGAAGAGTTC	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.116A>T	chr11.hg19:g.99690335A>T	ENSP00000435637:p.Lys39Met	66.0	0.0	.		88.0	14.0	.	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	hg19	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	A	14.84	2.654223	0.47467	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000279463	T;T;T;T	0.57595	0.39;0.46;0.46;0.46	5.06	3.95	0.45737	.	0.313869	0.30547	N	0.009393	T	0.37999	0.1024	N	0.19112	0.55	0.31267	N	0.692233	P;P	0.39576	0.679;0.679	B;B	0.43916	0.436;0.319	T	0.47249	-0.9132	10	0.72032	D	0.01	.	4.34	0.11105	0.7511:0.0:0.2489:0.0	.	39;39	E9PKE8;O94779	.;CNTN5_HUMAN	M	39	ENSP00000433575:K39M;ENSP00000436185:K39M;ENSP00000435637:K39M;ENSP00000279463:K39M	ENSP00000279463:K39M	K	+	2	0	CNTN5	99195545	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.718000	0.38001	2.208000	0.71279	0.528000	0.53228	AAG	.	.	.	alt		0.398	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
SLC37A4	2542	hgsc.bcm.edu	37	11	118898353	118898353	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr11:118898353A>G	ENST00000545985.1	-	6	1366	c.610T>C	c.(610-612)Tct>Cct	p.S204P	SLC37A4_ENST00000330775.7_Missense_Mutation_p.S203P|SLC37A4_ENST00000538950.1_Missense_Mutation_p.S131P|SLC37A4_ENST00000357590.5_Missense_Mutation_p.S204P|SLC37A4_ENST00000525102.1_5'UTR	NM_001164277.1|NM_001467.5	NP_001157749.1|NP_001458.1	O43826	G6PT1_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 4	204					carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphate transmembrane transporter activity (GO:0015152)|transporter activity (GO:0005215)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|prostate(1)	6	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		TTGCCCTCAGAGGGCATGGGG	0.577																																					p.S204P		Atlas-SNP	.											.	SLC37A4	19	.	0			c.T610C						PASS	.						51.0	56.0	54.0					11																	118898353		2060	4197	6257	SO:0001583	missense	2542	exon5			CCTCAGAGGGCAT	Y15409		11q23.3	2014-09-17	2007-03-28	2003-09-10		ENSG00000137700		"""Solute carriers"""	4061	protein-coding gene	gene with protein product		602671	"""glucose-6-phosphatase, transport (glucose-6-phosphate) protein 1"""	G6PT1, G6PT2, G6PT3		9428641, 9463334	Standard	NM_001164277		Approved	GSD1b, GSD1c, GSD1d	uc010ryt.1	O43826		ENST00000545985.1:c.610T>C	chr11.hg19:g.118898353A>G	ENSP00000475241:p.Ser204Pro	119.0	0.0	.		89.0	36.0	.	NM_001467	O96016|Q5J7V4|Q9UI19|Q9UNS4	Missense_Mutation	SNP	ENST00000545985.1	hg19																																																																																				.	.	.	none		0.577	SLC37A4-204	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001467	
PRDM10	56980	hgsc.bcm.edu	37	11	129795021	129795021	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr11:129795021A>G	ENST00000360871.3	-	12	1865	c.1634T>C	c.(1633-1635)tTa>tCa	p.L545S	PRDM10_ENST00000526082.1_Missense_Mutation_p.L463S|PRDM10_ENST00000423662.2_Missense_Mutation_p.L463S|PRDM10_ENST00000528746.1_Missense_Mutation_p.L519S|PRDM10_ENST00000304538.6_Missense_Mutation_p.L459S|PRDM10_ENST00000358825.5_Missense_Mutation_p.L549S	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	549					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		ATGGAAGCGTAAGTGCTGGTC	0.537																																					p.L549S		Atlas-SNP	.											.	PRDM10	120	.	0			c.T1646C						PASS	.						184.0	181.0	182.0					11																	129795021		2201	4297	6498	SO:0001583	missense	56980	exon13			AAGCGTAAGTGCT	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1634T>C	chr11.hg19:g.129795021A>G	ENSP00000354118:p.Leu545Ser	109.0	0.0	.		127.0	48.0	.	NM_020228	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	hg19	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.172096	0.78452	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.09350	2.99;2.99;2.99;2.99;2.99;2.99;2.99	5.41	5.41	0.78517	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.232278	0.37178	N	0.002217	T	0.15739	0.0379	L	0.29908	0.895	0.52501	D	0.999951	P;P;P;P;P;P	0.52692	0.638;0.585;0.638;0.585;0.955;0.585	P;P;P;P;P;P	0.53102	0.61;0.475;0.61;0.475;0.718;0.475	T	0.04737	-1.0930	10	0.28530	T	0.3	-6.6276	15.7411	0.77899	1.0:0.0:0.0:0.0	.	459;545;549;463;459;463	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	S	549;459;545;463;519;463;262	ENSP00000351686:L549S;ENSP00000302669:L459S;ENSP00000354118:L545S;ENSP00000398431:L463S;ENSP00000431262:L519S;ENSP00000432237:L463S;ENSP00000435940:L262S	ENSP00000302669:L459S	L	-	2	0	PRDM10	129300231	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.910000	0.92685	2.171000	0.68590	0.533000	0.62120	TTA	.	.	.	none		0.537	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
KRT6A	3853	hgsc.bcm.edu	37	12	52882218	52882218	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr12:52882218C>G	ENST00000330722.6	-	7	1386	c.1318G>C	c.(1318-1320)Gac>Cac	p.D440H		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	440	Coil 2.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		CGGGCCAGGTCCTGCTTGGCC	0.622																																					p.D440H		Atlas-SNP	.											.	KRT6A	89	.	0			c.G1318C						PASS	.						101.0	91.0	95.0					12																	52882218		2203	4298	6501	SO:0001583	missense	3853	exon7			CCAGGTCCTGCTT	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1318G>C	chr12.hg19:g.52882218C>G	ENSP00000369317:p.Asp440His	162.0	0.0	.		101.0	51.0	.	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	hg19	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	c	22.1	4.247317	0.80024	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.89681	-2.55	5.06	5.06	0.68205	Filament (1);	0.000000	0.64402	D	0.000007	D	0.97096	0.9051	H	0.98701	4.305	0.53005	D	0.999968	D	0.89917	1.0	D	0.79108	0.992	D	0.98900	1.0776	10	0.87932	D	0	.	18.799	0.92008	0.0:1.0:0.0:0.0	.	440	P02538	K2C6A_HUMAN	H	440;396	ENSP00000369317:D440H	ENSP00000369317:D440H	D	-	1	0	KRT6A	51168485	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.722000	0.61958	2.501000	0.84356	0.591000	0.81541	GAC	.	.	.	none		0.622	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
KRT72	140807	hgsc.bcm.edu	37	12	52985268	52985268	+	Nonsense_Mutation	SNP	C	C	A	rs145259719	byFrequency	TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr12:52985268C>A	ENST00000537672.2	-	5	953	c.943G>T	c.(943-945)Gag>Tag	p.E315*	KRT72_ENST00000354310.4_Nonsense_Mutation_p.E315*|KRT72_ENST00000293745.2_Nonsense_Mutation_p.E315*|KRT72_ENST00000398066.3_Nonsense_Mutation_p.E127*	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	315	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		TACAGGGTCTCAGCCTCGGCC	0.577																																					p.E315X		Atlas-SNP	.											.	KRT72	70	.	0			c.G943T						PASS	.						128.0	94.0	106.0					12																	52985268		2203	4300	6503	SO:0001587	stop_gained	140807	exon5			GGGTCTCAGCCTC	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.943G>T	chr12.hg19:g.52985268C>A	ENSP00000441160:p.Glu315*	72.0	0.0	.		46.0	17.0	.	NM_001146225	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Nonsense_Mutation	SNP	ENST00000537672.2	hg19	CCDS8833.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.865439	0.51588	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	.	.	.	4.33	4.33	0.51752	.	0.000000	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.6339	0.62210	0.0:0.9208:0.0:0.0792	.	.	.	.	X	315;315;315;127	.	ENSP00000293745:E315X	E	-	1	0	KRT72	51271535	1.000000	0.71417	0.230000	0.23976	0.014000	0.08584	7.561000	0.82288	2.715000	0.92844	0.655000	0.94253	GAG	.	C|1.000;T|0.000	.	alt		0.577	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
APPL2	55198	hgsc.bcm.edu	37	12	105582221	105582221	+	Silent	SNP	A	A	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr12:105582221A>G	ENST00000258530.3	-	17	1689	c.1464T>C	c.(1462-1464)tcT>tcC	p.S488S	APPL2_ENST00000539978.2_Silent_p.S445S|APPL2_ENST00000551662.1_Silent_p.S494S	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						GCTGCAAAAGAGAATCTGGAA	0.423																																					p.S494S		Atlas-SNP	.											.	APPL2	69	.	0			c.T1482C						PASS	.						74.0	74.0	74.0					12																	105582221		2203	4300	6503	SO:0001819	synonymous_variant	55198	exon17			CAAAAGAGAATCT	AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.1464T>C	chr12.hg19:g.105582221A>G		50.0	0.0	.		73.0	31.0	.	NM_001251904	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Silent	SNP	ENST00000258530.3	hg19	CCDS9101.1																																																																																			.	.	.	none		0.423	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406238.3	NM_018171	
PLCB2	5330	hgsc.bcm.edu	37	15	40594770	40594770	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr15:40594770T>C	ENST00000260402.3	-	4	521	c.272A>G	c.(271-273)gAt>gGt	p.D91G	PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000543785.2_Missense_Mutation_p.D91G|PLCB2_ENST00000557821.1_Missense_Mutation_p.D91G|PLCB2_ENST00000456256.2_Missense_Mutation_p.D91G	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	91					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GAAACTGTTATCAGGAAAGTC	0.572																																					p.D91G		Atlas-SNP	.											.	PLCB2	177	.	0			c.A272G						PASS	.						93.0	98.0	96.0					15																	40594770		2035	4190	6225	SO:0001583	missense	5330	exon4			CTGTTATCAGGAA		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.272A>G	chr15.hg19:g.40594770T>C	ENSP00000260402:p.Asp91Gly	127.0	0.0	.		59.0	16.0	.	NM_004573	A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	hg19	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	T	14.98	2.697454	0.48202	.	.	ENSG00000137841	ENST00000260402;ENST00000456256;ENST00000543785	T;T;T	0.45276	0.9;0.9;0.9	4.87	3.75	0.43078	.	0.342197	0.32836	N	0.005590	T	0.34483	0.0899	L	0.54323	1.7	0.41896	D	0.990392	P;B;B;B	0.44195	0.828;0.002;0.329;0.002	B;B;B;B	0.39119	0.291;0.008;0.165;0.005	T	0.10245	-1.0638	10	0.20046	T	0.44	.	10.737	0.46130	0.0:0.075:0.0:0.925	.	91;91;91;91	B9EGH5;Q00722-2;Q9BVT6;Q00722	.;.;.;PLCB2_HUMAN	G	91	ENSP00000260402:D91G;ENSP00000411991:D91G;ENSP00000444652:D91G	ENSP00000260402:D91G	D	-	2	0	PLCB2	38382062	1.000000	0.71417	0.999000	0.59377	0.701000	0.40568	4.261000	0.58841	1.008000	0.39264	0.459000	0.35465	GAT	.	.	.	none		0.572	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
MAP1A	4130	hgsc.bcm.edu	37	15	43818453	43818453	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr15:43818453G>T	ENST00000300231.5	+	4	5232	c.4782G>T	c.(4780-4782)aaG>aaT	p.K1594N	MAP1A_ENST00000399453.1_Missense_Mutation_p.K1594N|MAP1A_ENST00000382031.1_Missense_Mutation_p.K1832N			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1594					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GGAAACCAAAGATGCTAGAGG	0.493																																					p.K1594N		Atlas-SNP	.											.	MAP1A	189	.	0			c.G4782T						PASS	.						56.0	58.0	58.0					15																	43818453		1879	4101	5980	SO:0001583	missense	4130	exon4			ACCAAAGATGCTA	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.4782G>T	chr15.hg19:g.43818453G>T	ENSP00000300231:p.Lys1594Asn	142.0	0.0	.		142.0	61.0	.	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	hg19	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	G	2.879	-0.232235	0.05983	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.64803	-0.12;-0.12;-0.12	1.46	-2.47	0.06442	.	.	.	.	.	T	0.48732	0.1516	L	0.32530	0.975	0.09310	N	1	P	0.37330	0.59	B	0.43728	0.429	T	0.42241	-0.9463	9	0.34782	T	0.22	-9.6264	3.4489	0.07491	0.5006:0.2186:0.2808:0.0	.	1594	P78559	MAP1A_HUMAN	N	1832;1594;1594	ENSP00000371462:K1832N;ENSP00000382380:K1594N;ENSP00000300231:K1594N	ENSP00000300231:K1594N	K	+	3	2	MAP1A	41605745	0.000000	0.05858	0.000000	0.03702	0.397000	0.30659	-0.481000	0.06552	-0.776000	0.04578	-0.251000	0.11542	AAG	.	.	.	none		0.493	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
HERC1	8925	hgsc.bcm.edu	37	15	63918321	63918321	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr15:63918321C>G	ENST00000443617.2	-	71	13225	c.13138G>C	c.(13138-13140)Gac>Cac	p.D4380H		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4380					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GGCACTGTGTCAGGCAGGCCC	0.532																																					p.D4380H		Atlas-SNP	.											.	HERC1	624	.	0			c.G13138C						PASS	.						36.0	38.0	38.0					15																	63918321		1985	4153	6138	SO:0001583	missense	8925	exon71			CTGTGTCAGGCAG	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.13138G>C	chr15.hg19:g.63918321C>G	ENSP00000390158:p.Asp4380His	58.0	0.0	.		48.0	16.0	.	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.266711	0.59540	.	.	ENSG00000103657	ENST00000443617	T	0.25250	1.81	5.23	4.31	0.51392	.	0.138683	0.46442	U	0.000293	T	0.19446	0.0467	N	0.24115	0.695	0.45747	D	0.998648	B	0.32653	0.379	B	0.30782	0.12	T	0.04961	-1.0915	10	0.59425	D	0.04	.	15.57	0.76326	0.1389:0.8611:0.0:0.0	.	4380	Q15751	HERC1_HUMAN	H	4380	ENSP00000390158:D4380H	ENSP00000390158:D4380H	D	-	1	0	HERC1	61705374	0.980000	0.34600	0.198000	0.23420	0.897000	0.52465	4.826000	0.62715	1.321000	0.45227	0.491000	0.48974	GAC	.	.	.	none		0.532	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
ST8SIA2	8128	hgsc.bcm.edu	37	15	92987897	92987897	+	Silent	SNP	C	C	A	rs146396658		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr15:92987897C>A	ENST00000268164.3	+	5	817	c.580C>A	c.(580-582)Cgg>Agg	p.R194R	ST8SIA2_ENST00000539113.1_Silent_p.R173R	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	194					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.R194R(1)		endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			GGAGTATGCCCGGGATGTGGG	0.567																																					p.R194R		Atlas-SNP	.											.	ST8SIA2	41	.	1	Substitution - coding silent(1)	lung(1)	c.C580A						PASS	.						65.0	69.0	67.0					15																	92987897		2198	4298	6496	SO:0001819	synonymous_variant	8128	exon5			TATGCCCGGGATG	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.580C>A	chr15.hg19:g.92987897C>A		142.0	0.0	.		110.0	56.0	.	NM_006011	Q4VAZ0|Q92470|Q92746	Silent	SNP	ENST00000268164.3	hg19	CCDS10372.1																																																																																			.	C|1.000;T|0.000	.	alt		0.567	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011	
MCTP2	55784	hgsc.bcm.edu	37	15	94841631	94841631	+	Missense_Mutation	SNP	G	G	A	rs61735139	byFrequency	TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr15:94841631G>A	ENST00000357742.4	+	1	137	c.137G>A	c.(136-138)cGc>cAc	p.R46H	MCTP2_ENST00000451018.3_Missense_Mutation_p.R46H|MCTP2_ENST00000543482.1_Missense_Mutation_p.R46H|MCTP2_ENST00000331706.4_5'UTR	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	46					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.R46H(2)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CACTTGGACCGCCGTCTCAGC	0.587													G|||	6	0.00119808	0.0038	0.0014	5008	,	,		15580	0.0		0.0	False		,,,				2504	0.0				p.R46H		Atlas-SNP	.											MCTP2,caecum,carcinoma,0,2	MCTP2	122	.	2	Substitution - Missense(2)	large_intestine(2)	c.G137A						PASS	.						62.0	65.0	64.0					15																	94841631		2197	4298	6495	SO:0001583	missense	55784	exon1			TGGACCGCCGTCT	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.137G>A	chr15.hg19:g.94841631G>A	ENSP00000350377:p.Arg46His	69.0	0.0	.		74.0	24.0	.	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	hg19	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971150	0.53614	.	.	ENSG00000140563	ENST00000543482;ENST00000556363;ENST00000451018;ENST00000357742	T;T;T	0.74632	-0.86;-0.59;-0.43	5.17	5.17	0.71159	.	0.000000	0.50627	D	0.000104	T	0.56572	0.1994	N	0.19112	0.55	0.80722	D	1	P;B;B;P;P	0.49559	0.765;0.257;0.167;0.877;0.925	B;B;B;B;B	0.38327	0.125;0.039;0.018;0.139;0.271	T	0.59332	-0.7474	10	0.33940	T	0.23	.	11.7616	0.51908	0.0816:0.0:0.9184:0.0	rs61735139	46;46;46;46;46	F5H415;Q6DN12-2;Q6DN12;B7Z6H2;G3V2J2	.;.;MCTP2_HUMAN;.;.	H	46	ENSP00000438521:R46H;ENSP00000395109:R46H;ENSP00000350377:R46H	ENSP00000350377:R46H	R	+	2	0	MCTP2	92642635	1.000000	0.71417	0.984000	0.44739	0.398000	0.30690	4.789000	0.62446	2.421000	0.82119	0.655000	0.94253	CGC	.	G|0.986;A|0.014	0.014	weak		0.587	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
KLHL36	79786	hgsc.bcm.edu	37	16	84690911	84690911	+	Silent	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr16:84690911C>T	ENST00000564996.1	+	3	639	c.498C>T	c.(496-498)ttC>ttT	p.F166F	KLHL36_ENST00000258157.5_Silent_p.F166F	NM_024731.2	NP_079007.2	Q8N4N3	KLH36_HUMAN	kelch-like family member 36	166	BACK.				protein ubiquitination (GO:0016567)					endometrium(3)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TTGATGCCTTCATCGATGGCT	0.562																																					p.F166F		Atlas-SNP	.											.	KLHL36	51	.	0			c.C498T						PASS	.						94.0	77.0	83.0					16																	84690911		2199	4300	6499	SO:0001819	synonymous_variant	79786	exon3			TGCCTTCATCGAT	AK022605	CCDS10948.1	16q24.1	2013-02-22	2013-02-22	2008-07-07	ENSG00000135686	ENSG00000135686		"""Kelch-like"", ""BTB/POZ domain containing"""	17844	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 44"", ""kelch-like 36 (Drosophila)"""	C16orf44			Standard	NM_024731		Approved	FLJ12543	uc002fig.3	Q8N4N3	OTTHUMG00000137642	ENST00000564996.1:c.498C>T	chr16.hg19:g.84690911C>T		56.0	0.0	.		65.0	34.0	.	NM_024731	Q8N5G6|Q9H9U6	Silent	SNP	ENST00000564996.1	hg19	CCDS10948.1																																																																																			.	.	.	none		0.562	KLHL36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269084.2		
FANCA	2175	hgsc.bcm.edu	37	16	89809242	89809242	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr16:89809242T>A	ENST00000389301.3	-	37	3761	c.3731A>T	c.(3730-3732)aAg>aTg	p.K1244M	FANCA_ENST00000568369.1_Missense_Mutation_p.K1244M	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1244					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CTTTAGCTGCTTCCTGATGTT	0.493			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.K1244M		Atlas-SNP	.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	99	.	0			c.A3731T						PASS	.						114.0	100.0	105.0					16																	89809242		2198	4300	6498	SO:0001583	missense	2175	exon37	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AGCTGCTTCCTGA	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3731A>T	chr16.hg19:g.89809242T>A	ENSP00000373952:p.Lys1244Met	50.0	0.0	.		62.0	14.0	.	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	hg19	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	T	11.12	1.544860	0.27563	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	D	0.84873	-1.91	4.85	-9.7	0.00521	.	1.958180	0.02194	N	0.061614	T	0.63331	0.2502	N	0.08118	0	0.09310	N	1	B;P;P	0.35600	0.42;0.511;0.511	B;B;B	0.31751	0.096;0.135;0.135	T	0.62110	-0.6923	10	0.51188	T	0.08	4.2992	3.4872	0.07624	0.0912:0.185:0.3755:0.3483	.	221;1244;1244	B7Z6Y4;B4DRI7;O15360	.;.;FANCA_HUMAN	M	1244;221	ENSP00000373952:K1244M	ENSP00000306281:K221M	K	-	2	0	FANCA	88336743	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.517000	0.02248	-1.568000	0.01670	-1.223000	0.01593	AAG	.	.	.	none		0.493	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
HEATR9	256957	hgsc.bcm.edu	37	17	34185488	34185488	+	Silent	SNP	G	G	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr17:34185488G>T	ENST00000311880.2	-	10	1129	c.981C>A	c.(979-981)gcC>gcA	p.A327A	C17orf66_ENST00000592980.1_Silent_p.A287A	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		327					hematopoietic progenitor cell differentiation (GO:0002244)					breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		TGATGACTGGGGCTGAGTGCA	0.582																																					p.A327A		Atlas-SNP	.											.	C17orf66	57	.	0			c.C981A						PASS	.						123.0	83.0	96.0					17																	34185488		2203	4300	6503	SO:0001819	synonymous_variant	256957	exon10			GACTGGGGCTGAG																												ENST00000311880.2:c.981C>A	chr17.hg19:g.34185488G>T		127.0	0.0	.		125.0	23.0	.	NM_152781	B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Silent	SNP	ENST00000311880.2	hg19	CCDS11299.1																																																																																			.	.	.	none		0.582	C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256487.1		
FDXR	2232	hgsc.bcm.edu	37	17	72859031	72859031	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr17:72859031C>T	ENST00000293195.5	-	12	1462	c.1384G>A	c.(1384-1386)Gat>Aat	p.D462N	FDXR_ENST00000413947.2_Missense_Mutation_p.D493N|FDXR_ENST00000581530.1_Missense_Mutation_p.D468N|GRIN2C_ENST00000578159.1_5'Flank|FDXR_ENST00000582944.1_Missense_Mutation_p.D454N|FDXR_ENST00000583917.1_Missense_Mutation_p.D434N|FDXR_ENST00000420580.2_Missense_Mutation_p.D422N|FDXR_ENST00000442102.2_Missense_Mutation_p.D505N|FDXR_ENST00000544854.1_Missense_Mutation_p.D410N|FDXR_ENST00000455107.2_3'UTR|GRIN2C_ENST00000347612.4_5'Flank	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	462					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	TCCTCGGCATCCAGCTTCTCC	0.657																																					p.D505N		Atlas-SNP	.											.	FDXR	68	.	0			c.G1513A						PASS	.						42.0	52.0	49.0					17																	72859031		2203	4300	6503	SO:0001583	missense	2232	exon12			CGGCATCCAGCTT	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.1384G>A	chr17.hg19:g.72859031C>T	ENSP00000293195:p.Asp462Asn	80.0	0.0	.		48.0	34.0	.	NM_001258012	B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	ENST00000293195.5	hg19	CCDS58593.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253053	0.59212	.	.	ENSG00000161513	ENST00000420580;ENST00000544854;ENST00000293195;ENST00000442102;ENST00000413947	T;T;T;T	0.23552	2.6;2.64;1.9;1.9	5.05	5.05	0.67936	NAD(P)-binding domain (1);	0.097389	0.64402	D	0.000001	T	0.54271	0.1848	M	0.82323	2.585	0.80722	D	1	D;D;D;D;P;P;P;D;P;D	0.62365	0.984;0.991;0.99;0.979;0.793;0.801;0.665;0.979;0.665;0.988	P;D;P;P;P;B;B;P;B;P	0.65684	0.669;0.937;0.755;0.556;0.689;0.425;0.224;0.556;0.224;0.791	T	0.59768	-0.7392	10	0.52906	T	0.07	-13.8242	17.9977	0.89189	0.0:1.0:0.0:0.0	.	422;505;493;460;410;493;462;454;462;468	B4DQQ4;B4DHX5;E7EQC1;B4DDI9;B7Z7G2;B4DDI7;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;.;.;.;ADRO_HUMAN;.	N	422;410;468;505;493	ENSP00000414172:D422N;ENSP00000445432:D410N;ENSP00000416515:D505N;ENSP00000408595:D493N	ENSP00000293195:D468N	D	-	1	0	FDXR	70370626	1.000000	0.71417	1.000000	0.80357	0.079000	0.17450	4.096000	0.57734	2.337000	0.79520	0.407000	0.27541	GAT	.	.	.	none		0.657	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110	
UNK	85451	hgsc.bcm.edu	37	17	73818652	73818652	+	Silent	SNP	T	T	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr17:73818652T>A	ENST00000589666.1	+	14	2042	c.1932T>A	c.(1930-1932)gcT>gcA	p.A644A	UNK_ENST00000293218.3_Silent_p.A720A|RP11-552F3.4_ENST00000586808.1_RNA	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	644							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGCCAGGGGCTGCCGAGCTGG	0.627																																					p.A644A		Atlas-SNP	.											.	UNK	87	.	0			c.T1932A						PASS	.						57.0	66.0	63.0					17																	73818652		1970	4147	6117	SO:0001819	synonymous_variant	85451	exon14			AGGGGCTGCCGAG	AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.1932T>A	chr17.hg19:g.73818652T>A		82.0	0.0	.		83.0	54.0	.	NM_001080419		Silent	SNP	ENST00000589666.1	hg19	CCDS45778.2																																																																																			.	.	.	none		0.627	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448835.1	NM_001080419	
TIMP2	7077	hgsc.bcm.edu	37	17	76869985	76869985	+	Silent	SNP	C	C	A	rs146970059		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr17:76869985C>A	ENST00000262768.7	-	2	445	c.147G>T	c.(145-147)gcG>gcT	p.A49A	TIMP2_ENST00000536189.2_5'UTR|TIMP2_ENST00000585421.1_5'UTR|TIMP2_ENST00000586057.1_5'UTR	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2	49	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.			VIRAKAV -> GKESGDP (in Ref. 10). {ECO:0000305}.	aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			TCTCACTGACCGCTTTGGCCC	0.507																																					p.A49A		Atlas-SNP	.											.	TIMP2	27	.	0			c.G147T						PASS	.						144.0	127.0	133.0					17																	76869985		2203	4300	6503	SO:0001819	synonymous_variant	7077	exon2			ACTGACCGCTTTG		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.147G>T	chr17.hg19:g.76869985C>A		68.0	0.0	.		81.0	46.0	.	NM_003255	Q16121|Q93006|Q9UDF7	Silent	SNP	ENST00000262768.7	hg19	CCDS11758.1																																																																																			.	C|1.000;T|0.000	.	alt		0.507	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
KIAA1683	80726	hgsc.bcm.edu	37	19	18378080	18378080	+	Silent	SNP	G	G	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr19:18378080G>A	ENST00000600328.3	-	3	463	c.270C>T	c.(268-270)gcC>gcT	p.A90A	KIAA1683_ENST00000600359.3_Silent_p.A44A|KIAA1683_ENST00000392413.4_Silent_p.A90A			Q9H0B3	K1683_HUMAN	KIAA1683	90						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TGTTCTTGAAGGCCTGGCTCT	0.632																																					p.A90A		Atlas-SNP	.											.	KIAA1683	190	.	0			c.C270T						PASS	.						81.0	79.0	80.0					19																	18378080		2203	4300	6503	SO:0001819	synonymous_variant	80726	exon3			CTTGAAGGCCTGG	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.270C>T	chr19.hg19:g.18378080G>A		101.0	0.0	.		91.0	43.0	.	NM_001145304	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Silent	SNP	ENST00000600328.3	hg19	CCDS32958.1																																																																																			.	.	.	none		0.632	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3		
PSG8	440533	hgsc.bcm.edu	37	19	43258514	43258514	+	Missense_Mutation	SNP	C	C	T	rs200488282	byFrequency	TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr19:43258514C>T	ENST00000306511.4	-	5	1311	c.1214G>A	c.(1213-1215)aGc>aAc	p.S405N	PSG8_ENST00000401467.2_Missense_Mutation_p.S312N|PSG8_ENST00000406636.3_Missense_Mutation_p.S283N|PSG8_ENST00000404209.4_Missense_Mutation_p.S405N|PSG8_ENST00000600709.1_5'UTR	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	405	Ig-like C2-type 3.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GGATTTGGAGCTTTCCTTGCC	0.468																																					p.S405N		Atlas-SNP	.											.	PSG8	101	.	0			c.G1214A						PASS	.						198.0	211.0	207.0					19																	43258514		2203	4299	6502	SO:0001583	missense	440533	exon5			TTGGAGCTTTCCT	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.1214G>A	chr19.hg19:g.43258514C>T	ENSP00000305005:p.Ser405Asn	64.0	0.0	.		90.0	38.0	.	NM_001130167	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	hg19	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	N	3.401	-0.122166	0.06795	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000406636;ENST00000401467;ENST00000426252;ENST00000407488;ENST00000306511	T;T;T;T	0.12361	2.69;2.69;2.69;2.69	1.62	-1.25	0.09405	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.09202	0.0227	L	0.41961	1.31	0.09310	N	1	B;B;B;B;B;B	0.19583	0.004;0.037;0.003;0.011;0.001;0.001	B;B;B;B;B;B	0.21360	0.018;0.034;0.012;0.023;0.005;0.008	T	0.41502	-0.9505	9	0.20519	T	0.43	.	2.8307	0.05499	0.2599:0.5561:0.0:0.1841	.	283;312;405;312;405;405	Q9UQ74-2;B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;.;PSG8_HUMAN;.;.;.	N	405;187;283;312;217;312;405	ENSP00000385869:S405N;ENSP00000385081:S283N;ENSP00000386090:S312N;ENSP00000305005:S405N	ENSP00000292109:S187N	S	-	2	0	PSG8	47950354	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.061000	0.01391	-0.535000	0.06307	-2.322000	0.00252	AGC	.	C|0.999;A|0.001	.	alt		0.468	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
RTN2	6253	hgsc.bcm.edu	37	19	46000066	46000066	+	Silent	SNP	C	C	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr19:46000066C>A	ENST00000245923.4	-	1	253	c.18G>T	c.(16-18)ccG>ccT	p.P6P	RTN2_ENST00000344680.4_Silent_p.P6P|PPM1N_ENST00000396737.2_5'Flank|PPM1N_ENST00000324688.4_5'Flank|PPM1N_ENST00000396735.2_5'Flank|PPM1N_ENST00000456399.2_5'Flank|RTN2_ENST00000589384.1_5'Flank|RTN2_ENST00000590526.1_5'UTR|PPM1N_ENST00000401705.1_Intron|PPM1N_ENST00000451287.2_5'Flank	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	6					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GGGCGAAGACCGGCAGGACCT	0.741																																					p.P6P		Atlas-SNP	.											.	RTN2	45	.	0			c.G18T						PASS	.						8.0	10.0	10.0					19																	46000066		2184	4277	6461	SO:0001819	synonymous_variant	6253	exon1			GAAGACCGGCAGG	AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.18G>T	chr19.hg19:g.46000066C>A		181.0	0.0	.		148.0	62.0	.	NM_206900	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Silent	SNP	ENST00000245923.4	hg19	CCDS12665.1																																																																																			.	.	.	none		0.741	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48205073	48205073	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr19:48205073A>G	ENST00000396720.3	+	15	4278	c.4084A>G	c.(4084-4086)Acg>Gcg	p.T1362A	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1362										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GATGAACGGCACGGTGGACCA	0.776																																					p.T1362A		Atlas-SNP	.											.	GLTSCR1	79	.	0			c.A4084G						PASS	.						1.0	1.0	1.0					19																	48205073		728	2032	2760	SO:0001583	missense	29998	exon15			AACGGCACGGTGG	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.4084A>G	chr19.hg19:g.48205073A>G	ENSP00000379946:p.Thr1362Ala	60.0	0.0	.		44.0	16.0	.	NM_015711	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	hg19	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	A	9.937	1.216338	0.22373	.	.	ENSG00000063169	ENST00000396720	T	0.48522	0.81	2.94	1.86	0.25419	.	.	.	.	.	T	0.45915	0.1366	L	0.32530	0.975	0.30752	N	0.744981	D	0.54964	0.969	P	0.53593	0.73	T	0.49661	-0.8916	9	0.87932	D	0	.	7.9097	0.29782	0.7901:0.2099:0.0:0.0	.	1362	Q9NZM4	GSCR1_HUMAN	A	1362	ENSP00000379946:T1362A	ENSP00000379946:T1362A	T	+	1	0	GLTSCR1	52896885	0.043000	0.20138	0.165000	0.22776	0.352000	0.29268	0.917000	0.28665	0.209000	0.20645	0.260000	0.18958	ACG	.	.	.	none		0.776	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
NUCB1	4924	hgsc.bcm.edu	37	19	49404086	49404086	+	Silent	SNP	T	T	C			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr19:49404086T>C	ENST00000405315.4	+	2	367	c.33T>C	c.(31-33)ctT>ctC	p.L11L	NUCB1_ENST00000407032.1_Silent_p.L11L|NUCB1_ENST00000263273.5_Silent_p.L11L|TULP2_ENST00000221399.3_5'Flank|NUCB1_ENST00000485798.1_Intron	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	11						endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		GAACCCTCCTTctgttgccgc	0.647																																					p.L11L		Atlas-SNP	.											.	NUCB1	44	.	0			c.T33C						PASS	.						64.0	49.0	54.0					19																	49404086		2203	4300	6503	SO:0001819	synonymous_variant	4924	exon2			CCTCCTTCTGTTG	BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.33T>C	chr19.hg19:g.49404086T>C		68.0	0.0	.		42.0	14.0	.	NM_006184	B2RD64|Q15838|Q7Z4J7|Q9BUR1	Silent	SNP	ENST00000405315.4	hg19	CCDS12740.1	.	.	.	.	.	.	.	.	.	.	T	2.581	-0.297309	0.05532	.	.	ENSG00000104805	ENST00000424608	.	.	.	3.96	-7.43	0.01383	.	.	.	.	.	T	0.25568	0.0622	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.31752	-0.9932	4	.	.	.	.	7.9811	0.30183	0.0:0.2298:0.1296:0.6406	.	.	.	.	S	11	.	.	F	+	2	0	NUCB1	54095898	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-1.333000	0.02667	-1.430000	0.01985	-0.463000	0.05309	TTC	.	.	.	none		0.647	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326545.2	NM_006184	
ZIM3	114026	hgsc.bcm.edu	37	19	57647015	57647015	+	Missense_Mutation	SNP	A	A	T	rs7251328	byFrequency	TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr19:57647015A>T	ENST00000269834.1	-	5	1075	c.690T>A	c.(688-690)aaT>aaA	p.N230K	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GCTTGTAGGCATTTCCACAGT	0.413																																					p.N230K		Atlas-SNP	.											.	ZIM3	107	.	0			c.T690A						PASS	.						142.0	139.0	140.0					19																	57647015		2203	4300	6503	SO:0001583	missense	114026	exon5			GTAGGCATTTCCA	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.690T>A	chr19.hg19:g.57647015A>T	ENSP00000269834:p.Asn230Lys	79.0	0.0	.		51.0	29.0	.	NM_052882	Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	hg19	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	G	0.129	-1.116394	0.01799	.	.	ENSG00000141946	ENST00000269834	T	0.07021	3.23	1.97	-0.339	0.12647	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00845	0.0028	N	0.00014	-2.91	0.46078	P	0.0011440000000000339	B	0.12630	0.006	B	0.18871	0.023	T	0.42515	-0.9447	8	0.02654	T	1	.	0.6984	0.00903	0.1873:0.141:0.2128:0.4589	.	230	Q96PE6	ZIM3_HUMAN	K	230	ENSP00000269834:N230K	ENSP00000269834:N230K	N	-	3	2	ZIM3	62338827	0.000000	0.05858	0.293000	0.24932	0.329000	0.28539	-1.080000	0.03407	-0.562000	0.06086	-0.642000	0.03964	AAT	.	A|0.387;G|0.613	.	alt		0.413	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
ZNF343	79175	hgsc.bcm.edu	37	20	2473416	2473416	+	Missense_Mutation	SNP	C	C	T	rs145750724		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr20:2473416C>T	ENST00000278772.4	-	5	720	c.233G>A	c.(232-234)aGa>aAa	p.R78K	RP4-734P14.4_ENST00000461548.1_Missense_Mutation_p.R78K|ZNF343_ENST00000381253.1_Missense_Mutation_p.R78K|ZNF343_ENST00000358413.2_Missense_Mutation_p.R78K	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	78	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						TGGACTCAGTCTCTTCCATTC	0.413																																					p.R78K		Atlas-SNP	.											.	ZNF343	47	.	0			c.G233A						PASS	.						224.0	207.0	213.0					20																	2473416		2203	4300	6503	SO:0001583	missense	79175	exon5			CTCAGTCTCTTCC	AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.233G>A	chr20.hg19:g.2473416C>T	ENSP00000278772:p.Arg78Lys	39.0	0.0	.		38.0	17.0	.	NM_024325	Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Missense_Mutation	SNP	ENST00000278772.4	hg19	CCDS13028.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658284	0.47467	.	.	ENSG00000088876	ENST00000278772;ENST00000445484;ENST00000381253;ENST00000358413;ENST00000421216	T;T;T;T;T	0.01725	4.67;4.67;4.67;4.67;4.67	3.96	-0.545	0.11843	Krueppel-associated box (4);	.	.	.	.	T	0.01387	0.0045	L	0.39020	1.185	0.09310	N	1	P	0.42785	0.79	B	0.36335	0.222	T	0.49370	-0.8947	9	0.23891	T	0.37	.	4.6349	0.12520	0.3084:0.5313:0.0:0.1602	.	78	Q6P1L6	ZN343_HUMAN	K	78	ENSP00000278772:R78K;ENSP00000399682:R78K;ENSP00000370652:R78K;ENSP00000351188:R78K;ENSP00000416488:R78K	ENSP00000443337:R78K	R	-	2	0	ZNF343	2421416	0.000000	0.05858	0.000000	0.03702	0.923000	0.55619	-0.408000	0.07169	-0.156000	0.11079	0.585000	0.79938	AGA	.	C|1.000;G|0.000	.	alt		0.413	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077617.1	NM_024325	
DHX35	60625	hgsc.bcm.edu	37	20	37653904	37653904	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr20:37653904A>G	ENST00000252011.3	+	18	1736	c.1703A>G	c.(1702-1704)cAt>cGt	p.H568R	DHX35_ENST00000373325.2_Missense_Mutation_p.H568R|DHX35_ENST00000373323.4_Missense_Mutation_p.H537R	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	568					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TGTCAGGAACATTTCCTGAAT	0.413																																					p.H568R		Atlas-SNP	.											.	DHX35	82	.	0			c.A1703G						PASS	.						209.0	210.0	209.0					20																	37653904		2203	4300	6503	SO:0001583	missense	60625	exon18			AGGAACATTTCCT	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.1703A>G	chr20.hg19:g.37653904A>G	ENSP00000252011:p.His568Arg	76.0	0.0	.		90.0	37.0	.	NM_021931	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Missense_Mutation	SNP	ENST00000252011.3	hg19	CCDS13310.1	.	.	.	.	.	.	.	.	.	.	A	12.93	2.086830	0.36855	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000373321;ENST00000449559	T;T;T;T	0.32023	4.28;4.28;4.28;1.47	5.41	5.41	0.78517	.	0.046837	0.85682	D	0.000000	T	0.28962	0.0719	L	0.55990	1.75	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.09377	0.004;0.003	T	0.11767	-1.0574	10	0.72032	D	0.01	.	9.025	0.36224	0.9159:0.0:0.0841:0.0	.	537;568	F5GXM6;Q9H5Z1	.;DHX35_HUMAN	R	568;568;537;48;32	ENSP00000362422:H568R;ENSP00000252011:H568R;ENSP00000362420:H537R;ENSP00000397997:H32R	ENSP00000252011:H568R	H	+	2	0	DHX35	37087318	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.050000	0.76620	2.045000	0.60652	0.533000	0.62120	CAT	.	.	.	none		0.413	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
CDH4	1002	hgsc.bcm.edu	37	20	60508065	60508065	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr20:60508065G>A	ENST00000360469.5	+	14	2350	c.2262G>A	c.(2260-2262)atG>atA	p.M754I	CDH4_ENST00000543233.1_Missense_Mutation_p.M680I	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	754					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TGTTTGTCATGTGGATGAAGC	0.602																																					p.M754I		Atlas-SNP	.											.	CDH4	172	.	0			c.G2262A						PASS	.						89.0	62.0	71.0					20																	60508065		2203	4300	6503	SO:0001583	missense	1002	exon14			TGTCATGTGGATG	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.2262G>A	chr20.hg19:g.60508065G>A	ENSP00000353656:p.Met754Ile	151.0	0.0	.		108.0	42.0	.	NM_001794	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	hg19	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972864	0.53614	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.54071	0.59;0.6	4.18	3.2	0.36748	.	0.300446	0.31233	N	0.008008	T	0.40619	0.1124	L	0.47716	1.5	0.30164	N	0.801882	B	0.06786	0.001	B	0.04013	0.001	T	0.28004	-1.0057	9	.	.	.	.	8.2275	0.31577	0.2526:0.0:0.7474:0.0	.	754	P55283	CADH4_HUMAN	I	754;662;680	ENSP00000353656:M754I;ENSP00000443301:M680I	.	M	+	3	0	CDH4	59941460	1.000000	0.71417	0.986000	0.45419	0.929000	0.56500	2.612000	0.46343	2.027000	0.59764	0.563000	0.77884	ATG	.	.	.	none		0.602	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
TPTE	7179	hgsc.bcm.edu	37	21	10959746	10959746	+	Silent	SNP	T	T	C	rs369891740		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr21:10959746T>C	ENST00000361285.4	-	8	557	c.228A>G	c.(226-228)tcA>tcG	p.S76S	TPTE_ENST00000342420.5_Intron|TPTE_ENST00000298232.7_Silent_p.S58S|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	76					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTTACTCATATGAAGCAACAT	0.373																																					p.S76S		Atlas-SNP	.											.	TPTE	513	.	0			c.A228G						PASS	.	T	,,	3,4403	4.2+/-10.8	0,3,2200	70.0	71.0	71.0		174,,228	0.2	0.0	21		71	0,8590		0,0,4295	no	coding-synonymous,intron,coding-synonymous	TPTE	NM_199259.2,NM_199260.2,NM_199261.2	,,	0,3,6495	CC,CT,TT		0.0,0.0681,0.0231	,,	58/534,,76/552	10959746	3,12993	2203	4295	6498	SO:0001819	synonymous_variant	7179	exon8			CTCATATGAAGCA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.228A>G	chr21.hg19:g.10959746T>C		510.0	0.0	.		610.0	151.0	.	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	ENST00000361285.4	hg19	CCDS13560.2																																																																																			.	.	.	weak		0.373	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
DSCAM	1826	hgsc.bcm.edu	37	21	41725475	41725475	+	Missense_Mutation	SNP	C	C	A	rs140655651	byFrequency	TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr21:41725475C>A	ENST00000400454.1	-	5	1328	c.851G>T	c.(850-852)cGc>cTc	p.R284L		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	284	Ig-like C2-type 3.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GTCCGAGGGGCGAATGTTCTC	0.542																																					p.R284L	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.G851T						PASS	.						81.0	79.0	80.0					21																	41725475		1967	4152	6119	SO:0001583	missense	1826	exon5			GAGGGGCGAATGT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.851G>T	chr21.hg19:g.41725475C>A	ENSP00000383303:p.Arg284Leu	63.0	0.0	.		67.0	27.0	.	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	hg19	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.493198	0.84962	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.67523	1.59;-0.27	5.53	5.53	0.82687	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.062950	0.64402	D	0.000002	T	0.57344	0.2047	L	0.34521	1.04	0.53005	D	0.999968	P	0.44946	0.846	B	0.36666	0.23	T	0.62201	-0.6904	10	0.49607	T	0.09	.	19.7967	0.96487	0.0:1.0:0.0:0.0	.	284	O60469	DSCAM_HUMAN	L	284;36	ENSP00000383303:R284L;ENSP00000385342:R36L	ENSP00000383303:R284L	R	-	2	0	DSCAM	40647345	1.000000	0.71417	0.691000	0.30163	0.995000	0.86356	4.422000	0.59854	2.744000	0.94065	0.655000	0.94253	CGC	.	C|0.999;T|0.001	.	alt		0.542	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
TTC28	23331	hgsc.bcm.edu	37	22	28379354	28379354	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr22:28379354C>A	ENST00000397906.2	-	23	6442	c.6301G>T	c.(6301-6303)Ggg>Tgg	p.G2101W	TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000425112.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	2101					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CTGATGCTCCCTTTGGAGCTC	0.522																																					p.G2101W		Atlas-SNP	.											.	TTC28	84	.	0			c.G6301T						PASS	.						86.0	67.0	73.0					22																	28379354		692	1591	2283	SO:0001583	missense	23331	exon23			TGCTCCCTTTGGA	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.6301G>T	chr22.hg19:g.28379354C>A	ENSP00000381003:p.Gly2101Trp	75.0	0.0	.		58.0	26.0	.	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	hg19	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.128975	0.56721	.	.	ENSG00000100154	ENST00000397906	D	0.95171	-3.63	4.66	4.66	0.58398	.	0.062590	0.64402	D	0.000006	D	0.95564	0.8558	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96396	0.9293	10	0.87932	D	0	-22.9445	16.9241	0.86170	0.0:1.0:0.0:0.0	.	2101	Q96AY4	TTC28_HUMAN	W	2101	ENSP00000381003:G2101W	ENSP00000381003:G2101W	G	-	1	0	TTC28	26709354	1.000000	0.71417	0.991000	0.47740	0.238000	0.25445	7.236000	0.78154	2.318000	0.78349	0.655000	0.94253	GGG	.	.	.	none		0.522	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
EGFL6	25975	hgsc.bcm.edu	37	X	13588004	13588004	+	Silent	SNP	G	G	T			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chrX:13588004G>T	ENST00000361306.1	+	1	281	c.24G>T	c.(22-24)gcG>gcT	p.A8A	EGFL6_ENST00000380602.3_Silent_p.A8A	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	8					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						GGAGCCTTGCGCTCCCGCTGC	0.706																																					p.A8A		Atlas-SNP	.											.	EGFL6	111	.	0			c.G24T						PASS	.						77.0	60.0	66.0					X																	13588004		2203	4300	6503	SO:0001819	synonymous_variant	25975	exon1			CCTTGCGCTCCCG	AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.24G>T	chrX.hg19:g.13588004G>T		116.0	0.0	.		87.0	4.0	.	NM_001167890	B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Silent	SNP	ENST00000361306.1	hg19	CCDS14155.1																																																																																			.	.	.	none		0.706	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055800.1	NM_015507	
FAM122B	159090	hgsc.bcm.edu	37	X	133906199	133906199	+	Silent	SNP	G	G	A			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chrX:133906199G>A	ENST00000370790.1	-	9	1642	c.714C>T	c.(712-714)ttC>ttT	p.F238F	FAM122B_ENST00000493333.1_5'UTR|FAM122B_ENST00000486347.1_Silent_p.F239F|FAM122B_ENST00000298090.6_Intron|FAM122B_ENST00000343004.5_Silent_p.F257F	NM_001166599.2|NM_145284.5	NP_001160071.1|NP_660327.2	Q7Z309	F122B_HUMAN	family with sequence similarity 122B	238										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|skin(1)	6	Acute lymphoblastic leukemia(192;0.000127)					CCATCAAGATGAACGAAGAGC	0.468																																					p.F257F		Atlas-SNP	.											.	FAM122B	20	.	0			c.C771T						PASS	.						128.0	98.0	109.0					X																	133906199		2203	4300	6503	SO:0001819	synonymous_variant	159090	exon10			CAAGATGAACGAA	BX538218	CCDS14643.1, CCDS55497.1, CCDS55498.1	Xq26.3	2008-02-05			ENSG00000156504	ENSG00000156504			30490	protein-coding gene	gene with protein product						12477932	Standard	NM_145284		Approved	DKFZp686L20116, RP11-308B5.5	uc004exq.3	Q7Z309	OTTHUMG00000022461	ENST00000370790.1:c.714C>T	chrX.hg19:g.133906199G>A		87.0	0.0	.		77.0	61.0	.	NM_001170756	A8K902|Q6PIM2|Q6ZU47|Q6ZV64|Q6ZVE4|Q8TB75	Silent	SNP	ENST00000370790.1	hg19	CCDS55497.1																																																																																			.	.	.	none		0.468	FAM122B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058382.1	NM_145284	
FRAS1	80144	hgsc.bcm.edu	37	4	79229272	79229272	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr4:79229272delG	ENST00000325942.6	+	15	2027	c.1587delG	c.(1585-1587)ttgfs	p.L529fs	FRAS1_ENST00000264895.6_Frame_Shift_Del_p.L529fs|FRAS1_ENST00000264899.6_Frame_Shift_Del_p.L529fs	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	529					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGCACTGCTTGGCCTGCAGAG	0.562																																					p.L529fs		Atlas-Indel,Pindel	.											.	FRAS1	779	.	0			c.1586delT						PASS	.						73.0	79.0	77.0					4																	79229272		2133	4246	6379	SO:0001589	frameshift_variant	80144	exon15			.	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.1587delG	chr4.hg19:g.79229272delG	ENSP00000326330:p.Leu529fs	111.0	0.0	0		107.0	41.0	0.383178	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Frame_Shift_Del	DEL	ENST00000325942.6	hg19	CCDS54772.1																																																																																			.	.	.	none		0.562	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
PLS1	5357	hgsc.bcm.edu	37	3	142383093	142383093	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr3:142383093delC	ENST00000337777.3	+	2	227	c.14delC	c.(13-15)actfs	p.T7fs	PLS1_ENST00000457734.2_Frame_Shift_Del_p.T7fs|PLS1_ENST00000497002.1_Frame_Shift_Del_p.T7fs	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	7						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						GAAAACAGTACTACTACCATT	0.323																																					p.T5fs		Atlas-INDEL	.											.	PLS1	71	.	0			c.13delA						PASS	.						84.0	85.0	85.0					3																	142383093		2203	4300	6503	SO:0001589	frameshift_variant	5357	exon2			.	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.14delC	chr3.hg19:g.142383093delC	ENSP00000336831:p.Thr7fs	166.0	0.0	0		193.0	80.0	0.414508	NM_001172312	A8K2Q1|D3DNG3|Q8NEG6	Frame_Shift_Del	DEL	ENST00000337777.3	hg19	CCDS3125.1																																																																																			.	.	.	none		0.323	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
GPR123	84435	hgsc.bcm.edu	37	10	134916320	134916320	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr10:134916320delA	ENST00000392607.3	+	5	811	c.375delA	c.(373-375)ccafs	p.P126fs	GPR123_ENST00000607359.1_Frame_Shift_Del_p.P846fs|GPR123_ENST00000392606.2_Frame_Shift_Del_p.P29fs	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	126					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CAGACCAGCCACCGTACCCCA	0.622																																					p.P125fs		Atlas-Indel,Pindel	.											.	GPR123	118	.	0			c.374delC						PASS	.						64.0	48.0	53.0					10																	134916320		2203	4300	6503	SO:0001589	frameshift_variant	84435	exon5			.	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.375delA	chr10.hg19:g.134916320delA	ENSP00000376384:p.Pro126fs	58.0	0.0	0		41.0	19.0	0.463415	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Frame_Shift_Del	DEL	ENST00000392607.3	hg19	CCDS41580.1																																																																																			.	.	.	none		0.622	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
CBLL1	79872	hgsc.bcm.edu	37	7	107389353	107389354	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr7:107389353_107389354delTG	ENST00000440859.3	+	2	509_510	c.42_43delTG	c.(40-45)tctggafs	p.G15fs	CBLL1_ENST00000222597.2_Frame_Shift_Del_p.G15fs|CBLL1_ENST00000415884.2_Frame_Shift_Del_p.G15fs	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	15					negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						CTAATAGTTCTGGATCCTTGGG	0.366																																					p.14_14del		Atlas-INDEL	.											.	CBLL1	54	.	0			c.41_42del						PASS	.																																			SO:0001589	frameshift_variant	79872	exon2			.	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.42_43delTG	chr7.hg19:g.107389353_107389354delTG	ENSP00000401277:p.Gly15fs	169.0	0.0	0		291.0	96.0	0.329897	NM_024814	B7ZM03|Q8TAJ4|Q9H5S6	Frame_Shift_Del	DEL	ENST00000440859.3	hg19	CCDS5747.1																																																																																			.	.	.	none		0.366	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814	
OAS3	4940	hgsc.bcm.edu	37	12	113386980	113386982	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr12:113386980_113386982delCTG	ENST00000228928.7	+	6	1523_1525	c.1344_1346delCTG	c.(1342-1347)aactgt>aat	p.C449del	RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	449	OAS domain 2.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						TCCATGAGAACTGTGTTCACAAG	0.567																																					p.448_449del		Atlas-INDEL	.											.	OAS3	63	.	0			c.1343_1345del						PASS	.																																			SO:0001651	inframe_deletion	4940	exon6			.	AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.1344_1346delCTG	chr12.hg19:g.113386980_113386982delCTG	ENSP00000228928:p.Cys449del	41.0	0.0	0		30.0	11.0	0.366667	NM_006187	Q2HJ14|Q9H3P5	In_Frame_Del	DEL	ENST00000228928.7	hg19	CCDS44981.1																																																																																			.	.	.	none		0.567	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405920.1		
ELANE	1991	hgsc.bcm.edu	37	19	856058	856058	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr19:856058delC	ENST00000590230.1	+	6	839	c.698delC	c.(697-699)gccfs	p.A233fs	ELANE_ENST00000263621.1_Frame_Shift_Del_p.A233fs			P08246	ELNE_HUMAN	elastase, neutrophil expressed	233	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		A -> P (in SCN1). {ECO:0000269|PubMed:23463630}.		acute inflammatory response to antigenic stimulus (GO:0002438)|cellular calcium ion homeostasis (GO:0006874)|collagen catabolic process (GO:0030574)|defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of chemotaxis (GO:0050922)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil mediated killing of fungus (GO:0070947)|phagocytosis (GO:0006909)|positive regulation of immune response (GO:0050778)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)|response to UV (GO:0009411)|response to yeast (GO:0001878)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|transcriptional repressor complex (GO:0017053)	cytokine binding (GO:0019955)|endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|RNA polymerase II transcription corepressor activity (GO:0001106)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(1)|lung(4)|pancreas(1)	13					Alpha-1-proteinase inhibitor(DB00058)|Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GATGCCTTTGCCCCGGTGGCA	0.657																																					p.A233fs		Atlas-Indel,Pindel	.											ELANE,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	ELANE	27	.	0			c.697delG						PASS	.						86.0	96.0	93.0					19																	856058		2203	4300	6503	SO:0001589	frameshift_variant	1991	exon5			.		CCDS12045.1	19p13.3	2014-09-17	2009-05-05	2009-05-05	ENSG00000197561	ENSG00000197561	3.4.21.37		3309	protein-coding gene	gene with protein product	"""neutrophil elastase"", ""leukocyte elastase"", ""medullasin"""	130130	"""elastase 2, neutrophil"""	ELA2		2902087	Standard	XM_005259517		Approved	NE, HNE, HLE	uc002lqb.3	P08246		ENST00000590230.1:c.698delC	chr19.hg19:g.856058delC	ENSP00000466090:p.Ala233fs	207.0	0.0	0		129.0	70.0	0.542636	NM_001972	P09649|Q6B0D9|Q6LDP5	Frame_Shift_Del	DEL	ENST00000590230.1	hg19	CCDS12045.1																																																																																			.	.	.	none		0.657	ELANE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457890.2	NM_001972	
FKBP10	60681	hgsc.bcm.edu	37	17	39975893	39975893	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr17:39975893delC	ENST00000321562.4	+	6	1133	c.1029delC	c.(1027-1029)atcfs	p.I343fs	FKBP10_ENST00000544340.1_Frame_Shift_Del_p.I55fs	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	343	PPIase FKBP-type 3. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		GAATTACCATCCCCCCGCACC	0.617																																					p.I343fs		Atlas-Indel,Pindel	.											.	FKBP10	57	.	0			c.1028delT						PASS	.																																			SO:0001589	frameshift_variant	60681	exon6			.	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.1029delC	chr17.hg19:g.39975893delC	ENSP00000317232:p.Ile343fs	82.0	0.0	0		88.0	24.0	0.272727	NM_021939	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Frame_Shift_Del	DEL	ENST00000321562.4	hg19	CCDS11409.1																																																																																			.	.	.	none		0.617	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257410.2	NM_021939	
ZNF479	90827	hgsc.bcm.edu	37	7	57188741	57188741	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr7:57188741delT	ENST00000331162.4	-	5	651	c.381delA	c.(379-381)aaafs	p.K127fs		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	127					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TTTTACAGCATTTTTTAAATT	0.368																																					p.C128fs		Atlas-Indel,Pindel	.											.	ZNF479	193	.	0			c.382delT						PASS	.						90.0	83.0	85.0					7																	57188741		1850	4101	5951	SO:0001589	frameshift_variant	90827	exon5			.	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.381delA	chr7.hg19:g.57188741delT	ENSP00000333776:p.Lys127fs	141.0	0.0	0		376.0	151.0	0.401596	NM_033273		Frame_Shift_Del	DEL	ENST00000331162.4	hg19	CCDS43590.1																																																																																			.	.	.	none		0.368	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
TXNDC2	84203	hgsc.bcm.edu	37	18	9886730	9886730	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr18:9886730delA	ENST00000306084.6	+	2	453	c.254delA	c.(253-255)gagfs	p.E85fs	TXNDC2_ENST00000426718.3_3'UTR|TXNDC2_ENST00000536353.2_Frame_Shift_Del_p.E18fs|TXNDC2_ENST00000357775.5_Frame_Shift_Del_p.E18fs	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	85					cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						GCCTCACAGGAGGGCGATGAC	0.562																																					p.E85fs		Atlas-Indel,Pindel	.											.	TXNDC2	168	.	0			c.253delG						PASS	.						154.0	101.0	119.0					18																	9886730		2203	4300	6503	SO:0001589	frameshift_variant	84203	exon2			.	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.254delA	chr18.hg19:g.9886730delA	ENSP00000304908:p.Glu85fs	114.0	0.0	0		73.0	34.0	0.465753	NM_001098529	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Frame_Shift_Del	DEL	ENST00000306084.6	hg19	CCDS42414.1																																																																																			.	.	.	none		0.562	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
CBLL1	79872	hgsc.bcm.edu	37	7	107389358	107389358	+	Frame_Shift_Del	DEL	C	C	-	rs267601227		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr7:107389358delC	ENST00000440859.3	+	2	514	c.47delC	c.(46-48)tccfs	p.S16fs	CBLL1_ENST00000222597.2_Frame_Shift_Del_p.S16fs|CBLL1_ENST00000415884.2_Frame_Shift_Del_p.S16fs	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	16					negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						AGTTCTGGATCCTTGGGTGGT	0.373																																					p.S16fs		Atlas-INDEL	.											.	CBLL1	54	.	0			c.46delT						PASS	.						146.0	149.0	148.0					7																	107389358		2203	4300	6503	SO:0001589	frameshift_variant	79872	exon2			.	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.47delC	chr7.hg19:g.107389358delC	ENSP00000401277:p.Ser16fs	169.0	0.0	0		293.0	102.0	0.348123	NM_024814	B7ZM03|Q8TAJ4|Q9H5S6	Frame_Shift_Del	DEL	ENST00000440859.3	hg19	CCDS5747.1																																																																																			.	.	.	none		0.373	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814	
ALOX12B	242	hgsc.bcm.edu	37	17	7976157	7976158	+	Frame_Shift_Ins	INS	-	-	G			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr17:7976157_7976158insG	ENST00000319144.4	-	15	2297_2298	c.2037_2038insC	c.(2035-2040)cgcaacfs	p.N680fs	ALOX12B_ENST00000577351.1_5'Flank	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	680	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						AGGCACTTGTTGCGCTGGCGGA	0.589										Multiple Myeloma(8;0.094)																											p.N680fs		Atlas-Indel,Pindel	.											.	ALOX12B	61	.	0			c.2038_2039insC						PASS	.																																			SO:0001589	frameshift_variant	242	exon15			.	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.2038dupC	chr17.hg19:g.7976158_7976158dupG	ENSP00000315167:p.Asn680fs	162.0	0.0	0		161.0	104.0	0.645963	NM_001139		Frame_Shift_Ins	INS	ENST00000319144.4	hg19	CCDS11129.1																																																																																			.	.	.	none		0.589	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226984.3		
KDM6B	23135	hgsc.bcm.edu	37	17	7749761	7749761	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr17:7749761delC	ENST00000448097.2	+	7	831	c.500delC	c.(499-501)gccfs	p.A167fs	KDM6B_ENST00000254846.5_Frame_Shift_Del_p.A167fs			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	167					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CAGCACCGAGCCAAGGTCCTG	0.642																																					p.A167fs		Atlas-Indel,Pindel	.											.	KDM6B	95	.	0			c.499delG						PASS	.						27.0	28.0	28.0					17																	7749761		2202	4300	6502	SO:0001589	frameshift_variant	23135	exon7			.	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.500delC	chr17.hg19:g.7749761delC	ENSP00000412513:p.Ala167fs	135.0	0.0	0		115.0	30.0	0.26087	NM_001080424	C9IZ40|Q96G33	Frame_Shift_Del	DEL	ENST00000448097.2	hg19																																																																																				.	.	.	none		0.642	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
SFTPD	6441	hgsc.bcm.edu	37	10	81702210	81702210	+	Frame_Shift_Del	DEL	G	G	-	rs17878336	byFrequency	TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr10:81702210delG	ENST00000372292.3	-	4	407	c.367delC	c.(367-369)ctgfs	p.L123fs		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	123	Collagen-like.		L -> V (in dbSNP:rs17878336). {ECO:0000269|PubMed:19100526, ECO:0000269|Ref.4}.		defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			TGCTTCCCCAGGGGACCTTCT	0.602																																					p.L123fs		Atlas-Indel,Pindel	.											.	SFTPD	43	.	0			c.368delT						PASS	.						77.0	71.0	73.0					10																	81702210		2203	4300	6503	SO:0001589	frameshift_variant	6441	exon4			.	L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.367delC	chr10.hg19:g.81702210delG	ENSP00000361366:p.Leu123fs	69.0	0.0	0		47.0	21.0	0.446809	NM_003019	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Frame_Shift_Del	DEL	ENST00000372292.3	hg19	CCDS7362.1																																																																																			.	.	.	none		0.602	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		
PLXNB1	5364	hgsc.bcm.edu	37	3	48457576	48457576	+	Splice_Site	DEL	C	C	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr3:48457576delC	ENST00000358536.4	-	18	3750	c.3481delG	c.(3481-3483)gat>at	p.D1161fs	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000296440.6_Splice_Site_p.D1161fs|PLXNB1_ENST00000358459.4_Splice_Site_p.D978fs|PLXNB1_ENST00000456774.1_Splice_Site_p.D978fs|PLXNB1_ENST00000465117.1_5'Flank	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1161					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ACCTTCGGATCCTGTGGGACA	0.647																																					p.D1161fs		Atlas-Indel,Pindel	.											.	PLXNB1	150	.	0			c.3482delA						PASS	.						20.0	21.0	21.0					3																	48457576		2197	4296	6493	SO:0001630	splice_region_variant	5364	exon18			.	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.3481-1G>-	chr3.hg19:g.48457576delC		120.0	0.0	0		109.0	37.0	0.33945	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Frame_Shift_Del	DEL	ENST00000358536.4	hg19	CCDS2765.1																																																																																			.	.	.	none		0.647	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	Frame_Shift_Del
LINC00482	284185	hgsc.bcm.edu	37	17	79278931	79278931	+	lincRNA	DEL	G	G	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr17:79278931delG	ENST00000332012.5	-	0	662					NR_038080.1		Q8N8I6	CQ055_HUMAN	long intergenic non-protein coding RNA 482																		GTGCCTTCGAGGGCCTGGTTG	0.667																																					.		Atlas-Indel,Pindel	.											.	.	.	.	0			.						PASS	.						15.0	16.0	15.0					17																	79278931		2026	4186	6212			284185	.			.	AK096740		17q25.3	2012-10-12	2011-09-01	2011-09-01	ENSG00000185168	ENSG00000185168		"""Long non-coding RNAs"""	26816	non-coding RNA	RNA, long non-coding			"""chromosome 17 open reading frame 55"""	C17orf55			Standard	NR_038080		Approved	FLJ39421	uc002kac.1	Q8N8I6			chr17.hg19:g.79278931delG		49.0	0.0	0		55.0	27.0	0.490909	.		RNA	DEL	ENST00000332012.5	hg19																																																																																				.	.	.	none		0.667	LINC00482-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000439605.1	NM_178519	
GCC2	9648	hgsc.bcm.edu	37	2	109102163	109102164	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr2:109102163_109102164delAA	ENST00000309863.6	+	14	4399_4400	c.3685_3686delAA	c.(3685-3687)aaafs	p.K1230fs		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1230					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						TGTGAAAACCAAAAAGGAACTG	0.272																																					p.1228_1229del		Atlas-Indel,Pindel	.											.	GCC2	129	.	0			c.3684_3685del						PASS	.																																			SO:0001589	frameshift_variant	9648	exon14			.	BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.3685_3686delAA	chr2.hg19:g.109102165_109102166delAA	ENSP00000307939:p.Lys1230fs	545.0	0.0	0		608.0	237.0	0.389803	NM_181453	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Frame_Shift_Del	DEL	ENST00000309863.6	hg19	CCDS33268.1																																																																																			.	.	.	none		0.272	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	NM_014635	
CEMIP	57214	hgsc.bcm.edu	37	15	81134366	81134386	+	Intron	DEL	CAGTGACAACTATGGATGAGC	CAGTGACAACTATGGATGAGC	-	rs372055177|rs372090446		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	CAGTGACAACTATGGATGAGC	CAGTGACAACTATGGATGAGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr15:81134366_81134386delCAGTGACAACTATGGATGAGC	ENST00000394685.3	+	2	244				MIR549_ENST00000385268.1_RNA|KIAA1199_ENST00000356249.5_Intron|KIAA1199_ENST00000220244.3_Intron			Q8WUJ3	CEMIP_HUMAN							hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TGATTTGAGACAGTGACAACTATGGATGAGCTCTCAATATA	0.412																																					.		Atlas-Indel,Pindel	.											.	.	.	.	0			.						PASS	.																																			SO:0001627	intron_variant	693132	.			.																												ENST00000394685.3:c.-175-31493CAGTGACAACTATGGATGAGC>-	chr15.hg19:g.81134366_81134386delCAGTGACAACTATGGATGAGC		193.0	0.0	0		145.0	63.0	0.434483	.	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	RNA	DEL	ENST00000394685.3	hg19	CCDS10315.1																																																																																			.	.	.	none		0.412	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
CNTN5	53942	hgsc.bcm.edu	37	11	99690335	99690336	+	In_Frame_Ins	INS	-	-	GAGTTGAGTTGAGTT	rs199945392		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr11:99690335_99690336insGAGTTGAGTTGAGTT	ENST00000524871.1	+	4	406_407	c.116_117insGAGTTGAGTTGAGTT	c.(115-120)aagagt>aaGAGTTGAGTTGAGTTgagt	p.40_41ins*VELS	CNTN5_ENST00000527185.1_In_Frame_Ins_p.40_41ins*VELS|CNTN5_ENST00000418526.2_Intron|CNTN5_ENST00000279463.3_In_Frame_Ins_p.40_41ins*VELS|CNTN5_ENST00000528682.1_In_Frame_Ins_p.40_41ins*VELS	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	40					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AGAATTAAGAAGAGTTCATCTT	0.401																																					p.K39delinsKSX		Pindel	.											.	CNTN5	324	.	0			c.116_117insGAGTTGAGTTGAGTT						PASS	.																																			SO:0001652	inframe_insertion	53942	exon4			.	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	Exception_encountered	chr11.hg19:g.99690335_99690336insGAGTTGAGTTGAGTT	ENSP00000435637:p.Ser40_Ser41ins*ValGluLeuSer	66.0	0.0	.		90.0	12.0	0.133	NM_001243271	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	In_Frame_Ins	INS	ENST00000524871.1	hg19	CCDS53696.1																																																																																			.	.	.	none		0.401	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
PLS1	5357	hgsc.bcm.edu	37	3	142383090	142383093	+	Frame_Shift_Del	DEL	GTAC	GTAC	-	rs373717334		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	GTAC	GTAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr3:142383090_142383093delGTAC	ENST00000337777.3	+	2	224_227	c.11_14delGTAC	c.(10-15)agtactfs	p.ST4fs	PLS1_ENST00000457734.2_Frame_Shift_Del_p.ST4fs|PLS1_ENST00000497002.1_Frame_Shift_Del_p.ST4fs	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	4						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.S4N(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						ATGGAAAACAGTACTACTACCATT	0.324																																					p.4_5del		Pindel	.											.	PLS1	71	.	1	Substitution - Missense(1)	pancreas(1)	c.10_13del						PASS	.																																			SO:0001589	frameshift_variant	5357	exon2			.	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.11_14delGTAC	chr3.hg19:g.142383090_142383093delGTAC	ENSP00000336831:p.Ser4fs	167.0	0.0	.		194.0	52.0	0.268	NM_001172312	A8K2Q1|D3DNG3|Q8NEG6	Frame_Shift_Del	DEL	ENST00000337777.3	hg19	CCDS3125.1																																																																																			.	.	.	none		0.324	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
CBLL1	79872	hgsc.bcm.edu	37	7	107389353	107389358	+	In_Frame_Del	DEL	TGGATC	TGGATC	-	rs267601227		TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	TGGATC	TGGATC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr7:107389353_107389358delTGGATC	ENST00000440859.3	+	2	509_514	c.42_47delTGGATC	c.(40-48)tctggatcc>tcc	p.14_16SGS>S	CBLL1_ENST00000222597.2_In_Frame_Del_p.14_16SGS>S|CBLL1_ENST00000415884.2_In_Frame_Del_p.14_16SGS>S	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	14					negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						CTAATAGTTCTGGATCCTTGGGTGGT	0.364																																					p.14_16del		Pindel	.											.	CBLL1	54	.	0			c.41_46del						PASS	.																																			SO:0001651	inframe_deletion	79872	exon2			.	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.42_47delTGGATC	chr7.hg19:g.107389353_107389358delTGGATC	ENSP00000401277:p.Ser14_Gly15del	173.0	0.0	.		299.0	74.0	0.247	NM_024814	B7ZM03|Q8TAJ4|Q9H5S6	In_Frame_Del	DEL	ENST00000440859.3	hg19	CCDS5747.1																																																																																			.	.	.	none		0.364	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814	
NAV2	89797	hgsc.bcm.edu	37	11	19901514	19901521	+	Frame_Shift_Del	DEL	CACCTCTG	CACCTCTG	-			TCGA-2Z-A9JQ-01A-11D-A42J-10	TCGA-2Z-A9JQ-10A-01D-A42M-10	CACCTCTG	CACCTCTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c0bed76f-49c1-44d5-b9eb-c8ef1b6c63bc	72b21503-f17e-4728-8b9c-d0b550371302	g.chr11:19901514_19901521delCACCTCTG	ENST00000396087.3	+	5	710_717	c.611_618delCACCTCTG	c.(610-618)tcacctctgfs	p.SPL204fs	NAV2_ENST00000360655.4_Frame_Shift_Del_p.SPL140fs|NAV2_ENST00000349880.4_Frame_Shift_Del_p.SPL204fs|NAV2_ENST00000540292.1_Frame_Shift_Del_p.SPL135fs|NAV2_ENST00000396085.1_Frame_Shift_Del_p.SPL204fs|NAV2_ENST00000534229.1_3'UTR|NAV2_ENST00000527559.2_Frame_Shift_Del_p.SPL133fs	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	204	Gln-rich.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						caCCTCTCCTCACCTCTGCCGCCCGCCG	0.654																																					p.204_206del		Pindel	.											.	NAV2	255	.	0			c.610_617del						PASS	.																																			SO:0001589	frameshift_variant	89797	exon5			.	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.611_618delCACCTCTG	chr11.hg19:g.19901514_19901521delCACCTCTG	ENSP00000379396:p.Ser204fs	63.0	0.0	.		50.0	12.0	0.240	NM_145117	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Frame_Shift_Del	DEL	ENST00000396087.3	hg19	CCDS58126.1																																																																																			.	.	.	none		0.654	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
