#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PGD	5226	hgsc.bcm.edu	37	1	10473152	10473152	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr1:10473152T>C	ENST00000270776.8	+	8	726	c.688T>C	c.(688-690)Tca>Cca	p.S230P	PGD_ENST00000541529.1_Missense_Mutation_p.S208P|PGD_ENST00000538557.1_Missense_Mutation_p.S217P	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	230					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	AGAGCTAGACTCATTCCTGAT	0.507																																					p.S230P		Atlas-SNP	.											.	PGD	39	.	0			c.T688C						PASS	.						87.0	82.0	83.0					1																	10473152		2203	4300	6503	SO:0001583	missense	5226	exon8			CTAGACTCATTCC	BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.688T>C	chr1.hg19:g.10473152T>C	ENSP00000270776:p.Ser230Pro	56.0	0.0	.		49.0	12.0	.	NM_002631	A8K2Y9|B4DQJ8|Q9BWD8	Missense_Mutation	SNP	ENST00000270776.8	hg19	CCDS113.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.278245	0.80692	.	.	ENSG00000142657	ENST00000541529;ENST00000543846;ENST00000270776;ENST00000538557	T;T;T	0.60797	0.16;0.16;0.16	5.06	5.06	0.68205	6-phosphogluconate dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	D	0.86053	0.5841	H	0.99182	4.46	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.92004	0.5613	10	0.87932	D	0	-15.9984	15.1463	0.72653	0.0:0.0:0.0:1.0	.	208;230;230	F5H7U0;A8K2Y9;P52209	.;.;6PGD_HUMAN	P	208;176;230;217	ENSP00000442285:S208P;ENSP00000270776:S230P;ENSP00000437822:S217P	ENSP00000270776:S230P	S	+	1	0	PGD	10395739	1.000000	0.71417	0.995000	0.50966	0.903000	0.53119	6.048000	0.71046	2.043000	0.60533	0.519000	0.50382	TCA	.	.	.	none		0.507	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005398.1	NM_002631	
UBR4	23352	hgsc.bcm.edu	37	1	19491316	19491316	+	Silent	SNP	G	G	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr1:19491316G>A	ENST00000375254.3	-	32	4515	c.4488C>T	c.(4486-4488)acC>acT	p.T1496T	UBR4_ENST00000375217.2_Silent_p.T1496T|UBR4_ENST00000375226.2_Silent_p.T1496T|UBR4_ENST00000375267.2_Silent_p.T1496T	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1496					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T1496T(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CAATGTATGTGGTCAGTAACT	0.488																																					p.T1496T		Atlas-SNP	.											UBR4,NS,carcinoma,0,1	UBR4	415	.	1	Substitution - coding silent(1)	lung(1)	c.C4488T						PASS	.						115.0	113.0	114.0					1																	19491316		2203	4300	6503	SO:0001819	synonymous_variant	23352	exon32			GTATGTGGTCAGT	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.4488C>T	chr1.hg19:g.19491316G>A		54.0	0.0	.		64.0	19.0	.	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	hg19	CCDS189.1																																																																																			.	.	.	none		0.488	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
CDKN2C	1031	hgsc.bcm.edu	37	1	51439795	51439795	+	Silent	SNP	G	G	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr1:51439795G>A	ENST00000262662.1	+	4	2394	c.360G>A	c.(358-360)gaG>gaA	p.E120E	CDKN2C_ENST00000371761.3_Silent_p.E120E|CDKN2C_ENST00000396148.1_Silent_p.E120E			P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)	120					cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|oligodendrocyte differentiation (GO:0048709)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.0?(11)|p.?(1)		central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|thyroid(1)	23				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		GGGTGGTGGAGTTCCTGGTGA	0.542			D		"""glioma, MM"""																																p.E120E	Melanoma(47;50 1155 4767 22863 47597)	Atlas-SNP	.		Rec	yes		1	1p32	1031	"""cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)"""		"""O, L"""	.	CDKN2C	24	.	12	Whole gene deletion(11)|Unknown(1)	central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(5)|thyroid(1)	c.G360A						PASS	.						62.0	62.0	62.0					1																	51439795		2203	4300	6503	SO:0001819	synonymous_variant	1031	exon3			GGTGGAGTTCCTG	BC000598	CCDS555.1	1p32.3	2013-01-10			ENSG00000123080	ENSG00000123080		"""Ankyrin repeat domain containing"""	1789	protein-coding gene	gene with protein product		603369				8001816, 9636670	Standard	NM_001262		Approved	INK4C, p18	uc001csg.3	P42773	OTTHUMG00000008046	ENST00000262662.1:c.360G>A	chr1.hg19:g.51439795G>A		89.0	0.0	.		85.0	26.0	.	NM_001262	Q8TB83	Silent	SNP	ENST00000262662.1	hg19	CCDS555.1																																																																																			.	.	.	none		0.542	CDKN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022058.1	NM_001262	
RPRD2	23248	hgsc.bcm.edu	37	1	150390180	150390180	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr1:150390180C>T	ENST00000369068.4	+	2	318	c.314C>T	c.(313-315)cCt>cTt	p.P105L	RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000369067.3_Missense_Mutation_p.P105L|RPRD2_ENST00000401000.4_Missense_Mutation_p.P105L|RPRD2_ENST00000539519.1_Missense_Mutation_p.P105L	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	105	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						GATGTACTTCCTGAAGCAGCT	0.358																																					p.P105L		Atlas-SNP	.											.	RPRD2	189	.	0			c.C314T						PASS	.						138.0	128.0	131.0					1																	150390180		1853	4106	5959	SO:0001583	missense	23248	exon2			TACTTCCTGAAGC	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.314C>T	chr1.hg19:g.150390180C>T	ENSP00000358064:p.Pro105Leu	77.0	0.0	.		66.0	19.0	.	NM_015203	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	hg19	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026331	0.93518	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369067;ENST00000369068	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.52	5.52	0.82312	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);Domain of unknown function DUF618 (1);	0.051483	0.85682	N	0.000000	T	0.57844	0.2081	M	0.67517	2.055	0.80722	D	1	D;D;D	0.89917	0.99;0.997;1.0	D;D;D	0.87578	0.933;0.953;0.998	T	0.52071	-0.8624	10	0.39692	T	0.17	-10.8804	19.3847	0.94551	0.0:1.0:0.0:0.0	.	105;105;105	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	L	105	ENSP00000383785:P105L;ENSP00000445482:P105L;ENSP00000358063:P105L;ENSP00000358064:P105L	ENSP00000358063:P105L	P	+	2	0	RPRD2	148656804	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.530000	0.67141	2.753000	0.94483	0.650000	0.86243	CCT	.	.	.	none		0.358	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
NAV1	89796	hgsc.bcm.edu	37	1	201777104	201777104	+	Silent	SNP	G	G	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr1:201777104G>T	ENST00000367296.4	+	18	4092	c.3672G>T	c.(3670-3672)gcG>gcT	p.A1224A	IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367295.1_Silent_p.A830A|NAV1_ENST00000367300.3_Silent_p.A1164A|MIR1231_ENST00000408101.1_RNA|NAV1_ENST00000367302.1_Silent_p.A1177A|NAV1_ENST00000367297.4_Silent_p.A1216A|NAV1_ENST00000295624.6_Silent_p.A1221A	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1224					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TCAACAAAGCGTTCAGTATAA	0.493																																					p.A1224A		Atlas-SNP	.											.	NAV1	143	.	0			c.G3672T						PASS	.						130.0	137.0	135.0					1																	201777104		2203	4300	6503	SO:0001819	synonymous_variant	89796	exon18			CAAAGCGTTCAGT	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.3672G>T	chr1.hg19:g.201777104G>T		138.0	0.0	.		155.0	49.0	.	NM_020443	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Silent	SNP	ENST00000367296.4	hg19	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	g	9.718	1.158971	0.21454	.	.	ENSG00000134369	ENST00000438083	.	.	.	5.28	4.36	0.52297	.	.	.	.	.	T	0.54759	0.1878	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52388	-0.8582	4	.	.	.	-33.8304	5.3519	0.16040	0.1465:0.6295:0.1462:0.0778	.	.	.	.	L	204	.	.	R	+	2	0	NAV1	200043727	0.966000	0.33281	1.000000	0.80357	0.959000	0.62525	0.174000	0.16743	1.223000	0.43536	-0.590000	0.04114	CGT	.	.	.	none		0.493	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
CENPF	1063	hgsc.bcm.edu	37	1	214819961	214819961	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr1:214819961A>G	ENST00000366955.3	+	13	7216	c.7048A>G	c.(7048-7050)Aca>Gca	p.T2350A		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2446	2 X 177 AA tandem repeats.|Interaction with NDE1 and NDEL1.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GATAGCCAGGACAAACCAAGA	0.453																																					p.T2350A	Colon(80;575 1284 11000 14801 43496)	Atlas-SNP	.											.	CENPF	321	.	0			c.A7048G						PASS	.						48.0	49.0	49.0					1																	214819961		2203	4300	6503	SO:0001583	missense	1063	exon13			GCCAGGACAAACC	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.7048A>G	chr1.hg19:g.214819961A>G	ENSP00000355922:p.Thr2350Ala	164.0	0.0	.		224.0	78.0	.	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	hg19	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	2.753	-0.259660	0.05791	.	.	ENSG00000117724	ENST00000366955	T	0.39997	1.05	4.18	-2.26	0.06867	Centromere protein Cenp-F, leucine-rich repeat-containing domain (1);	0.797597	0.10598	N	0.656030	T	0.17789	0.0427	N	0.08118	0	0.09310	N	1	B	0.18863	0.031	B	0.14578	0.011	T	0.23261	-1.0193	10	0.21014	T	0.42	.	5.8248	0.18548	0.5509:0.1334:0.3157:0.0	.	2446	P49454	CENPF_HUMAN	A	2350	ENSP00000355922:T2350A	ENSP00000355922:T2350A	T	+	1	0	CENPF	212886584	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.036000	0.13819	-0.437000	0.07243	-0.315000	0.08773	ACA	.	.	.	none		0.453	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227216669	227216669	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr1:227216669T>C	ENST00000366769.3	-	29	5307	c.4016A>G	c.(4015-4017)aAa>aGa	p.K1339R	CDC42BPA_ENST00000334218.5_Missense_Mutation_p.K1339R|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.K1311R|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.K1352R|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.K1374R|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.K1319R|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.K1258R	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				TTCTTTAAATTTTCTGTGACG	0.448																																					p.K1339R		Atlas-SNP	.											.	CDC42BPA	528	.	0			c.A4016G						PASS	.						74.0	70.0	71.0					1																	227216669		2203	4300	6503	SO:0001583	missense	8476	exon29			TTAAATTTTCTGT	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.4016A>G	chr1.hg19:g.227216669T>C	ENSP00000355731:p.Lys1339Arg	33.0	0.0	.		35.0	13.0	.	NM_003607		Missense_Mutation	SNP	ENST00000366769.3	hg19	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	T	11.39	1.624802	0.28889	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.05447	3.44;3.44;3.44;3.44;3.44;3.44;3.44	5.32	5.32	0.75619	.	0.050462	0.85682	D	0.000000	T	0.06554	0.0168	N	0.21508	0.67	0.48901	D	0.999725	B;B;B;B;B;B;B;B	0.22541	0.027;0.012;0.071;0.009;0.018;0.033;0.058;0.041	B;B;B;B;B;B;B;B	0.33690	0.02;0.009;0.168;0.074;0.036;0.036;0.065;0.06	T	0.38045	-0.9679	10	0.10902	T	0.67	.	15.5875	0.76495	0.0:0.0:0.0:1.0	.	1319;1311;654;236;1258;1339;1374;541	F5H5N0;Q5VT25-4;E9PEF7;Q5T7A7;Q5VT25-3;Q5VT25-5;Q5VT25-2;Q5T799	.;.;.;.;.;.;.;.	R	1339;1258;1339;1374;1311;654;1319;1352	ENSP00000355731:K1339R;ENSP00000355729:K1258R;ENSP00000335341:K1339R;ENSP00000355728:K1374R;ENSP00000355726:K1311R;ENSP00000443275:K1319R;ENSP00000355727:K1352R	ENSP00000335341:K1339R	K	-	2	0	CDC42BPA	225283292	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.691000	0.47010	2.153000	0.67306	0.477000	0.44152	AAA	.	.	.	none		0.448	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
PEX13	5194	hgsc.bcm.edu	37	2	61258902	61258902	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr2:61258902G>T	ENST00000295030.5	+	2	479	c.441G>T	c.(439-441)atG>atT	p.M147I	PEX13_ENST00000472678.1_3'UTR	NM_002618.3	NP_002609.1	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	147	Targeting to peroxisomes.				cerebral cortex cell migration (GO:0021795)|fatty acid alpha-oxidation (GO:0001561)|locomotory behavior (GO:0007626)|microtubule-based peroxisome localization (GO:0060152)|neuron migration (GO:0001764)|protein import into peroxisome matrix, docking (GO:0016560)|suckling behavior (GO:0001967)	integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			GTATGATGATGGATGCTACCT	0.408																																					p.M147I		Atlas-SNP	.											.	PEX13	27	.	0			c.G441T						PASS	.						182.0	173.0	176.0					2																	61258902		2203	4300	6503	SO:0001583	missense	5194	exon2			GATGATGGATGCT	U71374	CCDS1866.1	2p16.1	2008-08-26	2008-08-26		ENSG00000162928	ENSG00000162928			8855	protein-coding gene	gene with protein product		601789	"""peroxisome biogenesis factor 13"""			9878256	Standard	NM_002618		Approved		uc002sau.4	Q92968	OTTHUMG00000129422	ENST00000295030.5:c.441G>T	chr2.hg19:g.61258902G>T	ENSP00000295030:p.Met147Ile	77.0	0.0	.		131.0	47.0	.	NM_002618	B2RCS1	Missense_Mutation	SNP	ENST00000295030.5	hg19	CCDS1866.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179723	0.78564	.	.	ENSG00000162928	ENST00000295030	T	0.77098	-1.07	5.85	4.96	0.65561	Peroxin 13, N-terminal (1);	0.037439	0.85682	D	0.000000	T	0.76335	0.3973	L	0.39898	1.24	0.80722	D	1	P	0.45348	0.856	P	0.46144	0.505	T	0.78352	-0.2237	10	0.56958	D	0.05	-7.6725	16.9567	0.86261	0.0:0.1277:0.8723:0.0	.	147	Q92968	PEX13_HUMAN	I	147	ENSP00000295030:M147I	ENSP00000295030:M147I	M	+	3	0	PEX13	61112406	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.712000	0.84684	1.443000	0.47586	0.655000	0.94253	ATG	.	.	.	none		0.408	PEX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251581.3	NM_002618	
RPIA	22934	hgsc.bcm.edu	37	2	89036089	89036089	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr2:89036089G>A	ENST00000283646.4	+	7	689	c.634G>A	c.(634-636)Gga>Aga	p.G212R		NM_144563.2	NP_653164.2	P49247	RPIA_HUMAN	ribose 5-phosphate isomerase A	212					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|ribose phosphate metabolic process (GO:0019693)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	monosaccharide binding (GO:0048029)|ribose-5-phosphate isomerase activity (GO:0004751)	p.G212R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)				GTGGCACAAGGGAATCCCCAT	0.488																																					p.G212R		Atlas-SNP	.											RPIA,face,carcinoma,0,1	RPIA	35	.	1	Substitution - Missense(1)	skin(1)	c.G634A						PASS	.						107.0	112.0	110.0					2																	89036089		1967	4158	6125	SO:0001583	missense	22934	exon7			CACAAGGGAATCC	L35035	CCDS2004.2	2p11.2	2008-07-31	2008-07-31		ENSG00000153574	ENSG00000153574	5.3.1.6		10297	protein-coding gene	gene with protein product	"""ribose 5-phosphate epimerase"""	180430				7758956	Standard	NM_144563		Approved		uc002ste.3	P49247	OTTHUMG00000130333	ENST00000283646.4:c.634G>A	chr2.hg19:g.89036089G>A	ENSP00000283646:p.Gly212Arg	49.0	0.0	.		65.0	22.0	.	NM_144563	Q541P9|Q96BJ6	Missense_Mutation	SNP	ENST00000283646.4	hg19	CCDS2004.2	.	.	.	.	.	.	.	.	.	.	G	33	5.268670	0.95429	.	.	ENSG00000153574	ENST00000283646;ENST00000543560	T	0.75938	-0.98	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.88175	0.6366	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89386	0.3685	10	0.66056	D	0.02	-10.5302	18.9716	0.92716	0.0:0.0:1.0:0.0	.	212	P49247	RPIA_HUMAN	R	212;78	ENSP00000283646:G212R	ENSP00000283646:G212R	G	+	1	0	RPIA	88817204	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.011000	0.93618	2.574000	0.86865	0.563000	0.77884	GGA	.	.	.	none		0.488	RPIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252683.2		
ZNF35	7584	hgsc.bcm.edu	37	3	44701072	44701072	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr3:44701072T>A	ENST00000396056.2	+	4	1452	c.1217T>A	c.(1216-1218)aTt>aAt	p.I406N	ZNF35_ENST00000296092.3_3'UTR|ZNF35_ENST00000542250.1_Missense_Mutation_p.I246N|RP11-944L7.4_ENST00000457331.1_RNA	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	406					cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		TCACACCTTATTGTGCACCAG	0.443																																					p.I406N		Atlas-SNP	.											.	ZNF35	34	.	0			c.T1217A						PASS	.						98.0	104.0	102.0					3																	44701072		2203	4300	6503	SO:0001583	missense	7584	exon4			ACCTTATTGTGCA	X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	ENST00000396056.2:c.1217T>A	chr3.hg19:g.44701072T>A	ENSP00000379368:p.Ile406Asn	80.0	0.0	.		120.0	43.0	.	NM_003420	B2RBU6|Q53Y54|Q96D01	Missense_Mutation	SNP	ENST00000396056.2	hg19	CCDS2718.2	.	.	.	.	.	.	.	.	.	.	T	14.13	2.443523	0.43429	.	.	ENSG00000169981	ENST00000396056;ENST00000542250	T;T	0.07114	3.22;3.22	5.29	4.13	0.48395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47093	D	0.000246	T	0.07143	0.0181	N	0.01473	-0.845	0.09310	N	1	D	0.67145	0.996	D	0.67900	0.954	T	0.24404	-1.0161	10	0.54805	T	0.06	-21.1804	7.2269	0.26020	0.134:0.0:0.1536:0.7124	.	406	P13682	ZNF35_HUMAN	N	406;246	ENSP00000379368:I406N;ENSP00000443714:I246N	ENSP00000379368:I406N	I	+	2	0	ZNF35	44676076	0.000000	0.05858	0.600000	0.28864	0.994000	0.84299	-0.001000	0.12947	2.225000	0.72522	0.459000	0.35465	ATT	.	.	.	none		0.443	ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256749.4	NM_003420	
FGF5	2250	hgsc.bcm.edu	37	4	81207513	81207513	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr4:81207513G>A	ENST00000312465.7	+	3	720	c.494G>A	c.(493-495)cGt>cAt	p.R165H	FGF5_ENST00000503413.1_3'UTR|FGF5_ENST00000456523.3_3'UTR	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	165					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						TTCAGGGAGCGTTTTCAAGAA	0.398																																					p.R165H		Atlas-SNP	.											.	FGF5	49	.	0			c.G494A						PASS	.						133.0	147.0	142.0					4																	81207513		2202	4300	6502	SO:0001583	missense	2250	exon3			GGGAGCGTTTTCA	M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.494G>A	chr4.hg19:g.81207513G>A	ENSP00000311697:p.Arg165His	196.0	0.0	.		262.0	18.0	.	NM_004464	B2R554|O75846|Q3Y8M3|Q8NF90	Missense_Mutation	SNP	ENST00000312465.7	hg19	CCDS34021.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269981	0.80469	.	.	ENSG00000138675	ENST00000312465	D	0.81908	-1.55	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.88078	0.6340	M	0.75777	2.31	0.80722	D	1	P	0.35844	0.524	P	0.44990	0.466	D	0.87668	0.2539	10	0.66056	D	0.02	.	20.0851	0.97797	0.0:0.0:1.0:0.0	.	165	P12034	FGF5_HUMAN	H	165	ENSP00000311697:R165H	ENSP00000311697:R165H	R	+	2	0	FGF5	81426537	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	7.810000	0.86072	2.758000	0.94735	0.650000	0.86243	CGT	.	.	.	none		0.398	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252627.2		
GSTCD	79807	hgsc.bcm.edu	37	4	106746923	106746923	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr4:106746923A>G	ENST00000515279.1	+	8	1716	c.1496A>G	c.(1495-1497)aAt>aGt	p.N499S	GSTCD_ENST00000360505.5_Missense_Mutation_p.N499S|RP11-45L9.1_ENST00000506527.1_RNA|GSTCD_ENST00000394730.3_Missense_Mutation_p.N412S|RP11-45L9.1_ENST00000504955.1_RNA|GSTCD_ENST00000394728.3_Missense_Mutation_p.N499S|GSTCD_ENST00000515255.1_3'UTR|RP11-45L9.1_ENST00000509003.1_RNA			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	499						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		ATTCAAGCAAATATGGAATAT	0.279																																					p.N499S		Atlas-SNP	.											.	GSTCD	69	.	0			c.A1496G						PASS	.						106.0	107.0	107.0					4																	106746923		1800	4058	5858	SO:0001583	missense	79807	exon8			AAGCAAATATGGA	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1496A>G	chr4.hg19:g.106746923A>G	ENSP00000422354:p.Asn499Ser	197.0	0.0	.		184.0	60.0	.	NM_001031720	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	ENST00000515279.1	hg19	CCDS43257.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.225240	0.79576	.	.	ENSG00000138780	ENST00000394730;ENST00000515279;ENST00000360505;ENST00000394728	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.61236	0.2331	L	0.58925	1.835	0.58432	D	0.999998	D;P	0.89917	1.0;0.943	D;P	0.91635	0.999;0.906	T	0.64588	-0.6372	10	0.72032	D	0.01	-2.438	15.2919	0.73872	1.0:0.0:0.0:0.0	.	499;122	Q8NEC7;B7Z8J7	GSTCD_HUMAN;.	S	412;499;499;499	ENSP00000378218:N412S;ENSP00000422354:N499S;ENSP00000353695:N499S;ENSP00000378216:N499S	ENSP00000353695:N499S	N	+	2	0	GSTCD	106966372	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.602000	0.90868	2.076000	0.62316	0.528000	0.53228	AAT	.	.	.	none		0.279	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
OTUD4	54726	hgsc.bcm.edu	37	4	146063415	146063415	+	Silent	SNP	A	A	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr4:146063415A>T	ENST00000447906.2	-	18	1942	c.1755T>A	c.(1753-1755)ccT>ccA	p.P585P	OTUD4_ENST00000454497.2_Silent_p.P520P|OTUD4_ENST00000455611.2_5'UTR			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	585					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					AAGGCACCGCAGGAGTTAGAT	0.498																																					p.P520P		Atlas-SNP	.											.	OTUD4	120	.	0			c.T1560A						PASS	.						123.0	130.0	127.0					4																	146063415		2203	4300	6503	SO:0001819	synonymous_variant	54726	exon18			CACCGCAGGAGTT		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.1755T>A	chr4.hg19:g.146063415A>T		74.0	0.0	.		98.0	32.0	.	NM_001102653	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Silent	SNP	ENST00000447906.2	hg19																																																																																				.	.	.	none		0.498	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493	
C5orf42	65250	hgsc.bcm.edu	37	5	37183541	37183541	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr5:37183541G>A	ENST00000508244.1	-	25	4835	c.4742C>T	c.(4741-4743)tCt>tTt	p.S1581F	C5orf42_ENST00000274258.7_Missense_Mutation_p.S462F|C5orf42_ENST00000425232.2_Missense_Mutation_p.S1581F			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1581						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AAGCTTTCCAGAAAAACTAGT	0.318																																					p.S1581F		Atlas-SNP	.											.	C5orf42	422	.	0			c.C4742T						PASS	.						81.0	81.0	81.0					5																	37183541		2202	4300	6502	SO:0001583	missense	65250	exon26			TTTCCAGAAAAAC		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.4742C>T	chr5.hg19:g.37183541G>A	ENSP00000421690:p.Ser1581Phe	190.0	0.0	.		167.0	62.0	.	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681656	0.88542	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.44	5.44	0.79542	.	0.000000	0.46758	D	0.000271	T	0.79953	0.4535	N	0.24115	0.695	0.50467	D	0.999871	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82776	-0.0290	10	0.87932	D	0	.	19.2648	0.93982	0.0:0.0:1.0:0.0	.	1581;462	E9PH94;Q9H799	.;CE042_HUMAN	F	1581;1581;462;629;462	ENSP00000421690:S1581F;ENSP00000389014:S1581F;ENSP00000274258:S462F;ENSP00000424223:S629F	ENSP00000274258:S462F	S	-	2	0	C5orf42	37219298	1.000000	0.71417	0.991000	0.47740	0.713000	0.41058	5.236000	0.65354	2.551000	0.86045	0.655000	0.94253	TCT	.	.	.	none		0.318	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
PDE8B	8622	hgsc.bcm.edu	37	5	76700575	76700575	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr5:76700575G>A	ENST00000264917.5	+	12	1286	c.1241G>A	c.(1240-1242)aGg>aAg	p.R414K	PDE8B_ENST00000342343.4_Missense_Mutation_p.R394K|PDE8B_ENST00000346042.3_Missense_Mutation_p.R317K|PDE8B_ENST00000333194.4_Missense_Mutation_p.R414K|PDE8B_ENST00000340978.3_Missense_Mutation_p.R367K	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	414					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	AAGAACAGGAGGAAAGAGTCC	0.368																																					p.R414K		Atlas-SNP	.											.	PDE8B	103	.	0			c.G1241A						PASS	.						95.0	93.0	94.0					5																	76700575		2203	4300	6503	SO:0001583	missense	8622	exon12			ACAGGAGGAAAGA	AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.1241G>A	chr5.hg19:g.76700575G>A	ENSP00000264917:p.Arg414Lys	65.0	0.0	.		77.0	24.0	.	NM_001029852	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Missense_Mutation	SNP	ENST00000264917.5	hg19	CCDS4037.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.030433	0.93575	.	.	ENSG00000113231	ENST00000340978;ENST00000346042;ENST00000264917;ENST00000342343;ENST00000333194	T;T;T;T;T	0.72051	-0.45;-0.61;-0.45;-0.45;-0.62	4.75	4.75	0.60458	.	0.763615	0.12696	N	0.446784	T	0.79257	0.4415	M	0.79123	2.44	0.80722	D	1	P;B;P;P;P	0.48911	0.887;0.2;0.917;0.735;0.616	P;B;P;B;B	0.48189	0.57;0.098;0.547;0.381;0.211	T	0.82118	-0.0615	10	0.66056	D	0.02	.	18.136	0.89619	0.0:0.0:1.0:0.0	.	317;367;414;394;414	O95263-2;O95263-6;O95263-3;O95263-4;O95263	.;.;.;.;PDE8B_HUMAN	K	367;317;414;394;414	ENSP00000345446:R367K;ENSP00000330428:R317K;ENSP00000264917:R414K;ENSP00000345646:R394K;ENSP00000331336:R414K	ENSP00000264917:R414K	R	+	2	0	PDE8B	76736331	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.313000	0.96297	2.341000	0.79615	0.563000	0.77884	AGG	.	.	.	none		0.368	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719	
APC	324	hgsc.bcm.edu	37	5	112154711	112154711	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr5:112154711G>T	ENST00000457016.1	+	10	1362	c.982G>T	c.(982-984)Gat>Tat	p.D328Y	APC_ENST00000257430.4_Missense_Mutation_p.D328Y|APC_ENST00000508376.2_Missense_Mutation_p.D328Y			P25054	APC_HUMAN	adenomatous polyposis coli	328	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)			NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCATGATAAGGATGATATGTC	0.413		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.D328Y	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	Atlas-SNP	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	4158	.	0			c.G982T						PASS	.						204.0	179.0	187.0					5																	112154711		2202	4300	6502	SO:0001583	missense	324	exon11	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	GATAAGGATGATA	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.982G>T	chr5.hg19:g.112154711G>T	ENSP00000413133:p.Asp328Tyr	41.0	0.0	.		94.0	22.0	.	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	hg19	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610052	0.87258	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.93953	-2.62;-3.32;-2.62;-2.62;-2.8	5.73	5.73	0.89815	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	D	0.96648	0.8906	M	0.74881	2.28	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.74674	0.982;0.984	D	0.96682	0.9504	10	0.87932	D	0	-20.9336	19.9616	0.97254	0.0:0.0:1.0:0.0	.	330;328	Q4LE70;P25054	.;APC_HUMAN	Y	328;310;328;328;328	ENSP00000413133:D328Y;ENSP00000423224:D310Y;ENSP00000257430:D328Y;ENSP00000427089:D328Y;ENSP00000423828:D328Y	ENSP00000257430:D328Y	D	+	1	0	APC	112182610	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.722000	0.93159	0.650000	0.86243	GAT	.	.	.	none		0.413	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
CDC25C	995	hgsc.bcm.edu	37	5	137626353	137626353	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr5:137626353C>T	ENST00000323760.6	-	9	1117	c.839G>A	c.(838-840)gGg>gAg	p.G280E	CDC25C_ENST00000356505.3_Missense_Mutation_p.G250E|CDC25C_ENST00000514555.1_Missense_Mutation_p.G250E|CDC25C_ENST00000415130.2_Missense_Mutation_p.G207E|CDC25C_ENST00000513970.1_Missense_Mutation_p.G280E|CDC25C_ENST00000357274.3_Missense_Mutation_p.G237E|CDC25C_ENST00000348983.3_Missense_Mutation_p.G207E	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	280					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			AATCAGGTGCCCCTGGTTAGA	0.443																																					p.G280E		Atlas-SNP	.											.	CDC25C	37	.	0			c.G839A						PASS	.						91.0	78.0	83.0					5																	137626353		2203	4300	6503	SO:0001583	missense	995	exon9			AGGTGCCCCTGGT	M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.839G>A	chr5.hg19:g.137626353C>T	ENSP00000321656:p.Gly280Glu	99.0	0.0	.		130.0	40.0	.	NM_001790	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	ENST00000323760.6	hg19	CCDS4202.1	.	.	.	.	.	.	.	.	.	.	C	7.187	0.590733	0.13812	.	.	ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555	T;T;T;T;T;T;T	0.20738	2.64;2.64;2.05;2.05;2.05;2.64;2.64	5.19	3.41	0.39046	Rhodanese-like (1);	0.381500	0.24332	N	0.039453	T	0.11495	0.0280	N	0.12182	0.205	0.09310	N	0.999993	B;B;B;B	0.28350	0.11;0.208;0.2;0.067	B;B;B;B	0.27796	0.046;0.063;0.083;0.021	T	0.22661	-1.0210	10	0.32370	T	0.25	-2.6834	10.4344	0.44426	0.0:0.8481:0.0:0.1519	.	297;250;207;280	G3V1P6;P30307-2;P30307-4;P30307	.;.;.;MPIP3_HUMAN	E	280;250;237;207;207;280;297;250	ENSP00000321656:G280E;ENSP00000348898:G250E;ENSP00000349821:G237E;ENSP00000345205:G207E;ENSP00000392631:G207E;ENSP00000424795:G280E;ENSP00000425470:G250E	ENSP00000321656:G280E	G	-	2	0	CDC25C	137654252	0.836000	0.29430	0.031000	0.17742	0.889000	0.51656	1.599000	0.36751	0.766000	0.33244	0.585000	0.79938	GGG	.	.	.	none		0.443	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251280.1		
PCDHB16	57717	hgsc.bcm.edu	37	5	140563836	140563836	+	Missense_Mutation	SNP	G	G	A	rs535302272	byFrequency	TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr5:140563836G>A	ENST00000361016.2	+	1	2857	c.1702G>A	c.(1702-1704)Ggc>Agc	p.G568S		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	568	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGCAGAACGGCTCCGCGCC	0.711													G|||	2	0.000399361	0.0008	0.0	5008	,	,		13663	0.0		0.0	False		,,,				2504	0.001				p.G568S		Atlas-SNP	.											PCDHB16,NS,carcinoma,0,1	PCDHB16	159	.	0			c.G1702A						PASS	.						14.0	17.0	16.0					5																	140563836		1969	3923	5892	SO:0001583	missense	57717	exon1			CAGAACGGCTCCG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1702G>A	chr5.hg19:g.140563836G>A	ENSP00000354293:p.Gly568Ser	45.0	1.0	.		33.0	3.0	.	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	g	12.66	2.005258	0.35415	.	.	ENSG00000196963	ENST00000361016	T	0.60797	0.16	4.12	2.28	0.28536	Cadherin (1);Cadherin-like (1);	1.832600	0.03875	N	0.276324	T	0.41719	0.1171	N	0.20807	0.61	0.09310	N	1	B	0.22003	0.063	B	0.17979	0.02	T	0.27123	-1.0083	10	0.45353	T	0.12	.	3.1416	0.06457	0.2646:0.0:0.4112:0.3242	.	568	Q9NRJ7	PCDBG_HUMAN	S	568	ENSP00000354293:G568S	ENSP00000354293:G568S	G	+	1	0	PCDHB16	140544020	0.000000	0.05858	0.984000	0.44739	0.978000	0.69477	0.941000	0.29005	0.212000	0.20703	0.479000	0.44913	GGC	.	.	.	none		0.711	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
ANKS1A	23294	hgsc.bcm.edu	37	6	34950966	34950966	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr6:34950966C>A	ENST00000360359.3	+	6	1023	c.885C>A	c.(883-885)agC>agA	p.S295R	ANKS1A_ENST00000535627.1_Missense_Mutation_p.S295R	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	295					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CTCAAAAGAGCCAGCAAATAG	0.478																																					p.S295R		Atlas-SNP	.											.	ANKS1A	123	.	0			c.C885A						PASS	.						165.0	166.0	166.0					6																	34950966		2203	4300	6503	SO:0001583	missense	23294	exon6			AAAGAGCCAGCAA	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.885C>A	chr6.hg19:g.34950966C>A	ENSP00000353518:p.Ser295Arg	91.0	0.0	.		68.0	24.0	.	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	hg19	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252437	0.39797	.	.	ENSG00000064999	ENST00000544150;ENST00000360359;ENST00000535627	T;T	0.61392	1.02;0.11	5.66	4.61	0.57282	Ankyrin repeat-containing domain (2);	0.000000	0.56097	D	0.000021	T	0.67599	0.2910	M	0.66378	2.025	0.42555	D	0.993121	D;D	0.71674	0.984;0.998	P;D	0.75484	0.642;0.986	T	0.70392	-0.4884	10	0.72032	D	0.01	-21.6177	13.7604	0.62961	0.0:0.9166:0.0:0.0834	.	295;295	B4DQW8;Q92625	.;ANS1A_HUMAN	R	295	ENSP00000353518:S295R;ENSP00000438752:S295R	ENSP00000353518:S295R	S	+	3	2	ANKS1A	35058944	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.009000	0.29886	2.656000	0.90262	0.655000	0.94253	AGC	.	.	.	none		0.478	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
IGF2R	3482	hgsc.bcm.edu	37	6	160461724	160461724	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr6:160461724G>C	ENST00000356956.1	+	11	1596	c.1448G>C	c.(1447-1449)cGc>cCc	p.R483P		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	483					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GGGAAGAAGCGCTATGACCTG	0.557																																					p.R483P		Atlas-SNP	.											.	IGF2R	251	.	0			c.G1448C						PASS	.						143.0	125.0	131.0					6																	160461724		2203	4300	6503	SO:0001583	missense	3482	exon11			AGAAGCGCTATGA	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1448G>C	chr6.hg19:g.160461724G>C	ENSP00000349437:p.Arg483Pro	90.0	0.0	.		48.0	15.0	.	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	hg19	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208615	0.58343	.	.	ENSG00000197081	ENST00000356956	T	0.02280	4.36	4.79	3.91	0.45181	Mannose-6-phosphate receptor, binding (1);	0.156802	0.47093	D	0.000244	T	0.05273	0.0140	M	0.73598	2.24	0.43874	D	0.996481	D	0.89917	1.0	D	0.75020	0.985	T	0.29731	-1.0002	10	0.36615	T	0.2	-13.4021	9.8517	0.41061	0.1604:0.0:0.8396:0.0	.	483	P11717	MPRI_HUMAN	P	483	ENSP00000349437:R483P	ENSP00000349437:R483P	R	+	2	0	IGF2R	160381714	0.937000	0.31787	0.893000	0.35052	0.604000	0.37047	1.559000	0.36320	2.210000	0.71456	0.655000	0.94253	CGC	.	.	.	none		0.557	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
KCNH2	3757	hgsc.bcm.edu	37	7	150655488	150655488	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr7:150655488C>A	ENST00000262186.5	-	4	976	c.575G>T	c.(574-576)gGg>gTg	p.G192V	KCNH2_ENST00000392968.2_Missense_Mutation_p.G96V|KCNH2_ENST00000430723.3_Missense_Mutation_p.G192V|KCNH2_ENST00000330883.4_5'Flank	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	192					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CACCAcggcccccggggcgcc	0.761																																					p.G192V	GBM(137;110 1844 13671 20123 45161)	Atlas-SNP	.											.	KCNH2	157	.	0			c.G575T						PASS	.						1.0	2.0	1.0					7																	150655488		1310	2720	4030	SO:0001583	missense	3757	exon4			ACGGCCCCCGGGG	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.575G>T	chr7.hg19:g.150655488C>A	ENSP00000262186:p.Gly192Val	436.0	0.0	.		187.0	23.0	.	NM_000238	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	hg19	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723869	0.30593	.	.	ENSG00000055118	ENST00000392968;ENST00000262186;ENST00000430723	D;D;D	0.99167	-4.82;-5.03;-5.51	3.64	3.64	0.41730	.	0.496899	0.15878	N	0.240203	D	0.97949	0.9325	N	0.19112	0.55	0.58432	D	0.999999	D;D;P	0.69078	0.997;0.982;0.613	D;P;B	0.63597	0.916;0.682;0.186	D	0.97044	0.9759	10	0.54805	T	0.06	.	11.0164	0.47691	0.0:1.0:0.0:0.0	.	96;192;192	C4PFH9;G5E9I0;Q12809	.;.;KCNH2_HUMAN	V	96;192;192	ENSP00000376695:G96V;ENSP00000262186:G192V;ENSP00000387657:G192V	ENSP00000262186:G192V	G	-	2	0	KCNH2	150286421	0.981000	0.34729	0.992000	0.48379	0.619000	0.37552	1.898000	0.39809	2.040000	0.60383	0.455000	0.32223	GGG	.	.	.	none		0.761	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
MATN2	4147	hgsc.bcm.edu	37	8	99015912	99015912	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr8:99015912A>T	ENST00000520016.1	+	7	1352	c.1228A>T	c.(1228-1230)Aaa>Taa	p.K410*	MATN2_ENST00000521689.1_Nonsense_Mutation_p.K410*|MATN2_ENST00000524308.1_Nonsense_Mutation_p.K369*|MATN2_ENST00000522025.2_Nonsense_Mutation_p.K126*|MATN2_ENST00000254898.5_Nonsense_Mutation_p.K410*			O00339	MATN2_HUMAN	matrilin 2	410	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TGCACTGAACAAACCGGGCTG	0.602																																					p.K410X		Atlas-SNP	.											.	MATN2	165	.	0			c.A1228T						PASS	.						88.0	95.0	93.0					8																	99015912		2147	4263	6410	SO:0001587	stop_gained	4147	exon8			CTGAACAAACCGG	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1228A>T	chr8.hg19:g.99015912A>T	ENSP00000430487:p.Lys410*	81.0	0.0	.		104.0	23.0	.	NM_002380	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Nonsense_Mutation	SNP	ENST00000520016.1	hg19	CCDS55264.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.92|13.92	2.380389|2.380389	0.42207|0.42207	.|.	.|.	ENSG00000132561|ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000522025;ENST00000520016;ENST00000522270|ENST00000518154;ENST00000521041	.|.	.|.	.|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.373442|.	0.26086|.	N|.	0.026440|.	.|T	.|0.62429	.|0.2427	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70561	.|-0.4838	.|3	0.02654|.	T|.	1|.	-23.8411|-23.8411	12.026|12.026	0.53371|0.53371	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	410;410;369;369;126;410;114|192;164	.|.	ENSP00000254898:K410X|.	K|Q	+|+	1|2	0|0	MATN2|MATN2	99085088|99085088	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.465000|0.465000	0.32709|0.32709	5.458000|5.458000	0.66679|0.66679	2.111000|2.111000	0.64477|0.64477	0.379000|0.379000	0.24179|0.24179	AAA|CAA	.	.	.	none		0.602	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
TG	7038	hgsc.bcm.edu	37	8	133895243	133895243	+	Splice_Site	SNP	T	T	C			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr8:133895243T>C	ENST00000220616.4	+	8	1114	c.1074T>C	c.(1072-1074)tgT>tgC	p.C358C	TG_ENST00000377869.1_Splice_Site_p.C358C	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	358	Thyroglobulin type-1 4. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CGCCATCTTGTGGTGGGTTTC	0.592																																					p.C358C		Atlas-SNP	.											.	TG	416	.	0			c.T1074C						PASS	.						24.0	24.0	24.0					8																	133895243		2203	4300	6503	SO:0001630	splice_region_variant	7038	exon8			ATCTTGTGGTGGG	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1075+1T>C	chr8.hg19:g.133895243T>C		65.0	0.0	.		81.0	28.0	.	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Silent	SNP	ENST00000220616.4	hg19	CCDS34944.1																																																																																			.	.	.	none		0.592	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	Silent
VPS13A	23230	hgsc.bcm.edu	37	9	79862227	79862227	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr9:79862227G>T	ENST00000360280.3	+	20	2213	c.1953G>T	c.(1951-1953)ttG>ttT	p.L651F	VPS13A_ENST00000376634.4_Missense_Mutation_p.L651F|VPS13A_ENST00000357409.5_Missense_Mutation_p.L651F|VPS13A_ENST00000376636.3_Missense_Mutation_p.L651F	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	651					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AAATTAATTTGAAGGCTTCAT	0.294																																					p.L651F		Atlas-SNP	.											.	VPS13A	735	.	0			c.G1953T						PASS	.						80.0	89.0	86.0					9																	79862227		2202	4287	6489	SO:0001583	missense	23230	exon20			TAATTTGAAGGCT	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.1953G>T	chr9.hg19:g.79862227G>T	ENSP00000353422:p.Leu651Phe	336.0	0.0	.		251.0	86.0	.	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	hg19	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.246346	0.59103	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.60040	0.22;0.22;0.22;0.22	5.52	4.61	0.57282	.	0.384693	0.22519	N	0.058988	T	0.66944	0.2841	L	0.61036	1.89	0.80722	D	1	P;P;D;D	0.55800	0.891;0.954;0.973;0.973	P;P;P;P	0.61533	0.603;0.721;0.89;0.89	T	0.67573	-0.5636	10	0.54805	T	0.06	.	7.5233	0.27641	0.1579:0.1492:0.6929:0.0	.	651;651;651;651	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	F	651	ENSP00000365821:L651F;ENSP00000365823:L651F;ENSP00000353422:L651F;ENSP00000349985:L651F	ENSP00000349985:L651F	L	+	3	2	VPS13A	79052047	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.532000	0.23067	1.428000	0.47296	0.563000	0.77884	TTG	.	.	.	none		0.294	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
DAB2IP	153090	hgsc.bcm.edu	37	9	124544633	124544633	+	Silent	SNP	T	T	C			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr9:124544633T>C	ENST00000408936.3	+	16	3608	c.3426T>C	c.(3424-3426)gaT>gaC	p.D1142D	DAB2IP_ENST00000309989.1_Silent_p.D1018D|DAB2IP_ENST00000259371.2_Silent_p.D1114D			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	1142					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						CCTCGTTGGATGCCGCCAATG	0.592																																					p.D1114D		Atlas-SNP	.											.	DAB2IP	150	.	0			c.T3342C						PASS	.						133.0	118.0	123.0					9																	124544633		2203	4300	6503	SO:0001819	synonymous_variant	153090	exon16			GTTGGATGCCGCC	AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.3426T>C	chr9.hg19:g.124544633T>C		147.0	0.0	.		105.0	48.0	.	NM_032552	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Silent	SNP	ENST00000408936.3	hg19																																																																																				.	.	.	none		0.592	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
DNAJB12	54788	hgsc.bcm.edu	37	10	74095644	74095644	+	Missense_Mutation	SNP	A	A	T	rs368163344		TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr10:74095644A>T	ENST00000444643.2	-	8	1384	c.1052T>A	c.(1051-1053)aTg>aAg	p.M351K	DNAJB12_ENST00000461919.1_Missense_Mutation_p.M146K|DNAJB12_ENST00000394903.2_Missense_Mutation_p.M385K|DNAJB12_ENST00000338820.3_Missense_Mutation_p.M385K			Q9NXW2	DJB12_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 12	351						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|skin(1)	4						TCTGTGGTACATATCTGTGTC	0.597																																					p.M385K		Atlas-SNP	.											.	DNAJB12	22	.	0			c.T1154A						PASS	.						149.0	120.0	130.0					10																	74095644		2203	4300	6503	SO:0001583	missense	54788	exon8			TGGTACATATCTG	AK000034	CCDS7316.2	10q22	2011-09-02			ENSG00000148719	ENSG00000148719		"""Heat shock proteins / DNAJ (HSP40)"""	14891	protein-coding gene	gene with protein product		608376				11147971	Standard	NM_001002762		Approved	DJ10, FLJ20027	uc001jta.2	Q9NXW2	OTTHUMG00000018436	ENST00000444643.2:c.1052T>A	chr10.hg19:g.74095644A>T	ENSP00000403313:p.Met351Lys	84.0	0.0	.		72.0	17.0	.	NM_017626	B7Z7I3|Q9H6H0	Missense_Mutation	SNP	ENST00000444643.2	hg19		.	.	.	.	.	.	.	.	.	.	A	22.4	4.283930	0.80803	.	.	ENSG00000148719	ENST00000338820;ENST00000394903;ENST00000444643	T;T;T	0.38560	1.13;1.13;1.13	5.82	5.82	0.92795	Domain of unknown function DUF1977, DnaJ-like (1);	0.052948	0.85682	D	0.000000	T	0.35008	0.0917	N	0.14661	0.345	0.54753	D	0.999988	P;P	0.36249	0.49;0.545	B;B	0.41646	0.247;0.362	T	0.35574	-0.9783	10	0.87932	D	0	-12.4345	16.17	0.81801	1.0:0.0:0.0:0.0	.	351;351	Q9NXW2-2;Q9NXW2	.;DJB12_HUMAN	K	385;385;351	ENSP00000345575:M385K;ENSP00000378363:M385K;ENSP00000403313:M351K	ENSP00000345575:M385K	M	-	2	0	DNAJB12	73765650	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.224000	0.72417	0.459000	0.35465	ATG	.	.	.	none		0.597	DNAJB12-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048581.2		
RAG2	5897	hgsc.bcm.edu	37	11	36615488	36615488	+	Silent	SNP	A	A	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr11:36615488A>T	ENST00000311485.3	-	2	392	c.231T>A	c.(229-231)acT>acA	p.T77T	C11orf74_ENST00000534635.1_5'Flank|C11orf74_ENST00000347206.4_5'Flank|C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000334307.5_5'Flank|RAG2_ENST00000528428.1_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	77			T -> N (in CHIDG; reduced recombination activity). {ECO:0000269|PubMed:18463379}.		B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				TGAATGTGCAAGTGGCTGGGT	0.423									Familial Hemophagocytic Lymphohistiocytosis																												p.T77T		Atlas-SNP	.											RAG2,NS,carcinoma,0,1	RAG2	92	.	0			c.T231A						PASS	.						131.0	137.0	135.0					11																	36615488		2202	4298	6500	SO:0001819	synonymous_variant	5897	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	TGTGCAAGTGGCT	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.231T>A	chr11.hg19:g.36615488A>T		89.0	0.0	.		132.0	39.0	.	NM_001243785	A8K9E9|Q8TBL4	Silent	SNP	ENST00000311485.3	hg19	CCDS7903.1																																																																																			.	.	.	none		0.423	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536	
ASRGL1	80150	hgsc.bcm.edu	37	11	62156671	62156671	+	Silent	SNP	A	A	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr11:62156671A>T	ENST00000415229.2	+	5	773	c.558A>T	c.(556-558)acA>acT	p.T186T	ASRGL1_ENST00000301776.5_Silent_p.T186T|ASRGL1_ENST00000535727.1_Silent_p.T58T|CTD-2531D15.5_ENST00000526045.1_RNA	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	186					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	CAACCTCCACAGGCGGTATCG	0.542																																					p.T186T		Atlas-SNP	.											.	ASRGL1	25	.	0			c.A558T						PASS	.						128.0	120.0	123.0					11																	62156671		2202	4299	6501	SO:0001819	synonymous_variant	80150	exon5			CTCCACAGGCGGT		CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.558A>T	chr11.hg19:g.62156671A>T		61.0	0.0	.		81.0	25.0	.	NM_001083926	B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Silent	SNP	ENST00000415229.2	hg19	CCDS8019.1																																																																																			.	.	.	none		0.542	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394865.1	NM_001083926	
PHLDB1	23187	hgsc.bcm.edu	37	11	118526375	118526375	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr11:118526375A>T	ENST00000361417.2	+	22	4346	c.3935A>T	c.(3934-3936)tAc>tTc	p.Y1312F	PHLDB1_ENST00000524713.1_Missense_Mutation_p.Y455F|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000527898.1_Missense_Mutation_p.Y363F|PHLDB1_ENST00000356063.5_Missense_Mutation_p.Y1265F	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1312	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GAAGTGTACTACGACCACCTG	0.607																																					p.Y1312F		Atlas-SNP	.											.	PHLDB1	103	.	0			c.A3935T						PASS	.						111.0	94.0	99.0					11																	118526375		2200	4295	6495	SO:0001583	missense	23187	exon21			TGTACTACGACCA		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3935A>T	chr11.hg19:g.118526375A>T	ENSP00000354498:p.Tyr1312Phe	22.0	0.0	.		42.0	15.0	.	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	hg19	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.918880	0.92249	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063;ENST00000541457;ENST00000527898;ENST00000524713	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	5.79	5.79	0.91817	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.79839	0.4515	L	0.42581	1.335	0.80722	D	1	B;D;B;B	0.71674	0.392;0.998;0.33;0.382	P;D;P;P	0.87578	0.47;0.998;0.687;0.598	T	0.81182	-0.1049	10	0.62326	D	0.03	-10.3043	16.1354	0.81481	1.0:0.0:0.0:0.0	.	676;1071;1265;1312	B0YJ65;Q5W9G0;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	F	1312;1086;676;1265;47;363;455	ENSP00000354498:Y1312F;ENSP00000348359:Y1265F;ENSP00000435388:Y363F;ENSP00000434905:Y455F	ENSP00000348359:Y1265F	Y	+	2	0	PHLDB1	118031585	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	8.842000	0.92136	2.207000	0.71202	0.533000	0.62120	TAC	.	.	.	none		0.607	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
H1FNT	341567	hgsc.bcm.edu	37	12	48723566	48723566	+	Silent	SNP	G	G	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr12:48723566G>A	ENST00000335017.1	+	1	804	c.492G>A	c.(490-492)gcG>gcA	p.A164A		NM_181788.1	NP_861453.1	Q75WM6	H1FNT_HUMAN	H1 histone family, member N, testis-specific	164	Arg-rich.				chromosome condensation (GO:0030261)|multicellular organismal development (GO:0007275)|sperm chromatin condensation (GO:0035092)|spermatid nucleus elongation (GO:0007290)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	13						TTCGCAAGGCGGCCAGGAAGG	0.726																																					p.A164A		Atlas-SNP	.											.	H1FNT	30	.	0			c.G492A						PASS	.						16.0	16.0	16.0					12																	48723566		2173	4250	6423	SO:0001819	synonymous_variant	341567	exon1			CAAGGCGGCCAGG	AY302593	CCDS8762.1	12q13.11	2011-01-27				ENSG00000187166		"""Histones / Replication-independent"""	24893	protein-coding gene	gene with protein product						15710904	Standard	NM_181788		Approved	HANP1, H1T2	uc001rrm.3	Q75WM6		ENST00000335017.1:c.492G>A	chr12.hg19:g.48723566G>A		152.0	0.0	.		93.0	28.0	.	NM_181788	Q147U8|Q5GKZ5|Q7Z694	Silent	SNP	ENST00000335017.1	hg19	CCDS8762.1																																																																																			.	.	.	none		0.726	H1FNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406516.1	NM_181788	
FBRSL1	57666	hgsc.bcm.edu	37	12	133158030	133158030	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr12:133158030G>A	ENST00000434748.2	+	14	2989	c.1969G>A	c.(1969-1971)Gcc>Acc	p.A657T	FBRSL1_ENST00000261673.6_Missense_Mutation_p.A584T	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	657							poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						CCCAGGTGCCGCCCATCCTGC	0.632																																					p.A657T		Atlas-SNP	.											.	FBRSL1	47	.	0			c.G1969A						PASS	.						26.0	32.0	30.0					12																	133158030		692	1590	2282	SO:0001583	missense	57666	exon14			GGTGCCGCCCATC		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.1969G>A	chr12.hg19:g.133158030G>A	ENSP00000396160:p.Ala657Thr	224.0	0.0	.		124.0	42.0	.	NM_001142641	Q86XQ1	Missense_Mutation	SNP	ENST00000434748.2	hg19	CCDS45010.1	.	.	.	.	.	.	.	.	.	.	G	7.201	0.593465	0.13875	.	.	ENSG00000112787	ENST00000434748;ENST00000261673	T;T	0.29655	1.56;1.56	4.94	-1.84	0.07809	.	0.302618	0.35870	N	0.002928	T	0.09113	0.0225	N	0.10972	0.075	0.09310	N	1	B	0.24618	0.107	B	0.18871	0.023	T	0.31223	-0.9951	10	0.02654	T	1	-6.3305	3.3439	0.07128	0.5152:0.1148:0.2531:0.1168	.	657	Q9HCM7	FBSL_HUMAN	T	657;584	ENSP00000396160:A657T;ENSP00000261673:A584T	ENSP00000261673:A584T	A	+	1	0	FBRSL1	131668103	0.001000	0.12720	0.000000	0.03702	0.706000	0.40770	0.327000	0.19663	-0.785000	0.04522	0.400000	0.26472	GCC	.	.	.	none		0.632	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		
GABPB1	2553	hgsc.bcm.edu	37	15	50593523	50593523	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr15:50593523C>G	ENST00000220429.8	-	5	682	c.514G>C	c.(514-516)Gac>Cac	p.D172H	GABPB1_ENST00000396464.3_Missense_Mutation_p.D172H|GABPB1_ENST00000543881.1_Missense_Mutation_p.D96H|GABPB1_ENST00000380877.3_Missense_Mutation_p.D172H|GABPB1_ENST00000359031.4_Missense_Mutation_p.D172H|GABPB1_ENST00000429662.2_Missense_Mutation_p.D172H|GABPB1_ENST00000560825.1_Missense_Mutation_p.D172H			Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta subunit 1	172					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(1)|large_intestine(7)|lung(5)	14						GTCACAGTGTCAGGACTCTCT	0.418																																					p.D172H		Atlas-SNP	.											.	GABPB1	33	.	0			c.G514C						PASS	.						261.0	219.0	233.0					15																	50593523		2196	4295	6491	SO:0001583	missense	2553	exon5			CAGTGTCAGGACT	D13316	CCDS10135.1, CCDS10136.1, CCDS32239.1, CCDS45258.1	15q21.2	2013-01-10	2008-02-25	2008-02-25	ENSG00000104064	ENSG00000104064		"""Ankyrin repeat domain containing"""	4074	protein-coding gene	gene with protein product		600610	"""GA binding protein transcription factor, beta subunit 2"""	GABPB2		7958862	Standard	NM_016655		Approved	E4TF1-47, GABPB	uc001zyb.3	Q06547	OTTHUMG00000131642	ENST00000220429.8:c.514G>C	chr15.hg19:g.50593523C>G	ENSP00000220429:p.Asp172His	90.0	0.0	.		87.0	33.0	.	NM_016654	A8IE52|Q06545|Q12940|Q12941|Q12942|Q8IYD0	Missense_Mutation	SNP	ENST00000220429.8	hg19	CCDS32239.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113480	0.77210	.	.	ENSG00000104064	ENST00000220429;ENST00000380877;ENST00000543881;ENST00000396464;ENST00000429662;ENST00000359031	T;T;T;T;T;T	0.72167	-0.63;-0.28;0.66;-0.3;-0.3;-0.3	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.77745	0.4176	L	0.29908	0.895	0.58432	D	0.999997	D;D;D;D;D	0.76494	0.999;0.979;0.987;0.999;0.994	P;P;P;D;P	0.80764	0.908;0.865;0.775;0.994;0.896	T	0.75252	-0.3383	10	0.36615	T	0.2	-11.8081	20.024	0.97514	0.0:1.0:0.0:0.0	.	172;172;172;172;172	B7Z726;Q06547-3;Q06547-4;Q06547;Q06547-2	.;.;.;GABP1_HUMAN;.	H	172;172;96;172;172;172	ENSP00000220429:D172H;ENSP00000370259:D172H;ENSP00000442500:D96H;ENSP00000379728:D172H;ENSP00000395771:D172H;ENSP00000351923:D172H	ENSP00000220429:D172H	D	-	1	0	GABPB1	48380815	1.000000	0.71417	0.994000	0.49952	0.999000	0.98932	5.062000	0.64326	2.809000	0.96659	0.655000	0.94253	GAC	.	.	.	none		0.418	GABPB1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000418294.1		
KIAA0101	9768	hgsc.bcm.edu	37	15	64668943	64668943	+	Splice_Site	SNP	T	T	A			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr15:64668943T>A	ENST00000300035.4	-	3	427	c.289A>T	c.(289-291)Aaa>Taa	p.K97*	KIAA0101_ENST00000380258.2_Intron|CTD-2116N17.1_ENST00000558783.1_5'Flank|KIAA0101_ENST00000559519.1_Splice_Site_p.K70*|KIAA0101_ENST00000558008.1_Splice_Site_p.N97Y	NM_014736.4	NP_055551.1	Q15004	PAF15_HUMAN	KIAA0101	97					cellular response to DNA damage stimulus (GO:0006974)|centrosome organization (GO:0051297)|DNA replication (GO:0006260)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin binding (GO:0003682)			central_nervous_system(1)|lung(1)|upper_aerodigestive_tract(1)	3						AAAACTTACTTTCTCTTTGCT	0.423																																					p.K97X		Atlas-SNP	.											.	KIAA0101	8	.	0			c.A289T						PASS	.						36.0	38.0	37.0					15																	64668943		2202	4300	6502	SO:0001630	splice_region_variant	9768	exon3			CTTACTTTCTCTT	D14657	CCDS10193.1, CCDS32269.1	15q22	2006-06-22			ENSG00000166803	ENSG00000166803			28961	protein-coding gene	gene with protein product		610696				11313979, 16288740	Standard	NM_001029989		Approved	NS5ATP9, OEATC-1, p15(PAF)	uc002ank.3	Q15004	OTTHUMG00000133017	ENST00000300035.4:c.290+1A>T	chr15.hg19:g.64668943T>A		110.0	0.0	.		112.0	28.0	.	NM_014736	A6NNU5|A8K3Y3|G9G694|G9G696	Nonsense_Mutation	SNP	ENST00000300035.4	hg19	CCDS10193.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.479203	0.84747	.	.	ENSG00000166803	ENST00000300035	.	.	.	5.81	5.81	0.92471	.	0.048857	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.3444	15.1475	0.72667	0.0:0.0:0.0:1.0	.	.	.	.	X	97	.	ENSP00000300035:K97X	K	-	1	0	KIAA0101	62455996	1.000000	0.71417	1.000000	0.80357	0.583000	0.36354	7.006000	0.76329	2.222000	0.72286	0.482000	0.46254	AAA	.	.	.	none		0.423	KIAA0101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256603.1	NM_014736	Nonsense_Mutation
ABCA3	21	hgsc.bcm.edu	37	16	2329051	2329051	+	Silent	SNP	G	G	A	rs367951064		TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr16:2329051G>A	ENST00000301732.5	-	29	5140	c.4440C>T	c.(4438-4440)taC>taT	p.Y1480Y	ABCA3_ENST00000382381.3_Silent_p.Y1422Y	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1480	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GGAGCCGAGCGTACATGACCA	0.657																																					p.Y1480Y		Atlas-SNP	.											.	ABCA3	176	.	0			c.C4440T						PASS	.						61.0	63.0	62.0					16																	2329051		2198	4299	6497	SO:0001819	synonymous_variant	21	exon29			CCGAGCGTACATG	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.4440C>T	chr16.hg19:g.2329051G>A		102.0	0.0	.		89.0	26.0	.	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	hg19	CCDS10466.1																																																																																			.	.	.	alt		0.657	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
SRCAP	10847	hgsc.bcm.edu	37	16	30732250	30732250	+	Silent	SNP	C	C	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr16:30732250C>T	ENST00000262518.4	+	20	3589	c.3204C>T	c.(3202-3204)ggC>ggT	p.G1068G	SRCAP_ENST00000395059.2_Silent_p.G1068G|SRCAP_ENST00000344771.4_Silent_p.G1068G	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1068	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGCCTCCTGGCCCTGTCCTCT	0.612																																					p.G1068G		Atlas-SNP	.											.	SRCAP	298	.	0			c.C3204T						PASS	.						57.0	54.0	55.0					16																	30732250		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon20			TCCTGGCCCTGTC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3204C>T	chr16.hg19:g.30732250C>T		52.0	0.0	.		50.0	6.0	.	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	hg19	CCDS10689.2																																																																																			.	.	.	none		0.612	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
NFAT5	10725	hgsc.bcm.edu	37	16	69724916	69724916	+	Silent	SNP	A	A	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr16:69724916A>T	ENST00000354436.2	+	11	2112	c.1794A>T	c.(1792-1794)ccA>ccT	p.P598P	NFAT5_ENST00000432919.1_Silent_p.P616P|NFAT5_ENST00000566899.1_Silent_p.P522P|NFAT5_ENST00000567239.1_Silent_p.P615P|NFAT5_ENST00000349945.1_Silent_p.P522P|NFAT5_ENST00000393742.2_Silent_p.P522P	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	598					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CACTCATACCAAGCAGTATGA	0.348																																					p.P616P		Atlas-SNP	.											.	NFAT5	184	.	0			c.A1848T						PASS	.						108.0	107.0	107.0					16																	69724916		2198	4298	6496	SO:0001819	synonymous_variant	10725	exon12			CATACCAAGCAGT	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1794A>T	chr16.hg19:g.69724916A>T		183.0	0.0	.		227.0	122.0	.	NM_138713	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Silent	SNP	ENST00000354436.2	hg19	CCDS10881.1																																																																																			.	.	.	none		0.348	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
KRT25	147183	hgsc.bcm.edu	37	17	38907279	38907279	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr17:38907279G>T	ENST00000312150.4	-	5	944	c.884C>A	c.(883-885)gCc>gAc	p.A295D		NM_181534.3	NP_853512.1			keratin 25											endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				CTCATTCCGGGCTGAGGTTGT	0.463																																					p.A295D		Atlas-SNP	.											.	KRT25	63	.	0			c.C884A						PASS	.						104.0	101.0	102.0					17																	38907279		2203	4300	6503	SO:0001583	missense	147183	exon5			TTCCGGGCTGAGG	AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.884C>A	chr17.hg19:g.38907279G>T	ENSP00000310573:p.Ala295Asp	83.0	0.0	.		121.0	28.0	.	NM_181534		Missense_Mutation	SNP	ENST00000312150.4	hg19	CCDS11373.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348552	0.82132	.	.	ENSG00000204897	ENST00000312150	D	0.90004	-2.6	5.84	5.84	0.93424	Filament (1);	0.000000	0.64402	D	0.000007	D	0.93259	0.7852	M	0.89287	3.02	0.36483	D	0.867994	P	0.51147	0.942	P	0.57620	0.824	D	0.95013	0.8153	9	.	.	.	.	8.1242	0.30988	0.0781:0.0:0.7228:0.1991	.	295	Q7Z3Z0	K1C25_HUMAN	D	295	ENSP00000310573:A295D	.	A	-	2	0	KRT25	36160805	0.072000	0.21174	0.500000	0.27589	0.980000	0.70556	1.074000	0.30703	2.758000	0.94735	0.655000	0.94253	GCC	.	.	.	none		0.463	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257218.1	NM_181534	
KCNH6	81033	hgsc.bcm.edu	37	17	61607776	61607776	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr17:61607776A>G	ENST00000583023.1	+	4	559	c.548A>G	c.(547-549)cAg>cGg	p.Q183R	KCNH6_ENST00000314672.5_Missense_Mutation_p.Q183R|KCNH6_ENST00000580652.1_Missense_Mutation_p.Q183R|KCNH6_ENST00000581784.1_Missense_Mutation_p.Q183R|KCNH6_ENST00000456941.2_Missense_Mutation_p.Q183R	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	183					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CAGATCCCACAGTTCACGCTC	0.607																																					p.Q183R		Atlas-SNP	.											.	KCNH6	122	.	0			c.A548G						PASS	.						199.0	145.0	163.0					17																	61607776		2203	4300	6503	SO:0001583	missense	81033	exon4			TCCCACAGTTCAC	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.548A>G	chr17.hg19:g.61607776A>G	ENSP00000463533:p.Gln183Arg	291.0	0.0	.		230.0	34.0	.	NM_030779	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	hg19	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	A	10.92	1.487431	0.26686	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.92805	-3.11;-3.11	4.69	3.61	0.41365	.	0.181186	0.37761	N	0.001951	D	0.92782	0.7705	L	0.42245	1.32	0.46874	D	0.999236	D;B;B;D;D	0.69078	0.969;0.188;0.002;0.997;0.987	P;B;B;D;P	0.66196	0.805;0.062;0.012;0.942;0.886	D	0.91773	0.5429	10	0.56958	D	0.05	.	10.127	0.42656	0.9209:0.0:0.0791:0.0	.	60;183;183;183;183	B4DPJ3;B4DKC0;Q9H252-2;Q9H252;Q9H252-3	.;.;.;KCNH6_HUMAN;.	R	183	ENSP00000318212:Q183R;ENSP00000396900:Q183R	ENSP00000318212:Q183R	Q	+	2	0	KCNH6	58961508	1.000000	0.71417	0.999000	0.59377	0.811000	0.45836	4.897000	0.63231	0.832000	0.34804	0.379000	0.24179	CAG	.	.	.	none		0.607	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
SAP30BP	29115	hgsc.bcm.edu	37	17	73700857	73700857	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr17:73700857T>G	ENST00000584667.1	+	9	880	c.623T>G	c.(622-624)aTg>aGg	p.M208R	SAP30BP_ENST00000355423.3_Missense_Mutation_p.M192R	NM_013260.6	NP_037392.1			SAP30 binding protein											kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)	17	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			AAAATTGAGATGGACAAATTG	0.512																																					p.M208R		Atlas-SNP	.											.	SAP30BP	30	.	0			c.T623G						PASS	.						120.0	111.0	114.0					17																	73700857		2203	4300	6503	SO:0001583	missense	29115	exon9			TTGAGATGGACAA	AY082382	CCDS11726.1	17q25.1	2006-01-05				ENSG00000161526			30785	protein-coding gene	gene with protein product		610218				15496587	Standard	NM_013260		Approved	HCNGP, HTRG, HTRP	uc002jpe.3	Q9UHR5		ENST00000584667.1:c.623T>G	chr17.hg19:g.73700857T>G	ENSP00000462116:p.Met208Arg	111.0	0.0	.		122.0	16.0	.	NM_013260		Missense_Mutation	SNP	ENST00000584667.1	hg19	CCDS11726.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.447631	0.84101	.	.	ENSG00000161526	ENST00000355423;ENST00000293208	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.72510	0.3469	L	0.56199	1.76	0.80722	D	1	D;D	0.65815	0.994;0.995	D;D	0.70227	0.952;0.968	T	0.67518	-0.5650	9	0.13108	T	0.6	-29.2385	15.8909	0.79296	0.0:0.0:0.0:1.0	.	192;208	Q9UHR5-2;Q9UHR5	.;S30BP_HUMAN	R	208;192	.	ENSP00000293208:M192R	M	+	2	0	SAP30BP	71212452	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.092000	0.76930	2.146000	0.66826	0.533000	0.62120	ATG	.	.	.	none		0.512	SAP30BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448227.1	NM_013260	
ZNF91	7644	hgsc.bcm.edu	37	19	23545348	23545348	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr19:23545348A>G	ENST00000300619.7	-	4	638	c.433T>C	c.(433-435)Tgt>Cgt	p.C145R	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.C113R	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	145					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GTTGTGAGACACTGGTTAAGT	0.323																																					p.C145R		Atlas-SNP	.											.	ZNF91	349	.	0			c.T433C						PASS	.						80.0	85.0	83.0					19																	23545348		2159	4277	6436	SO:0001583	missense	7644	exon4			TGAGACACTGGTT	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.433T>C	chr19.hg19:g.23545348A>G	ENSP00000300619:p.Cys145Arg	129.0	0.0	.		105.0	39.0	.	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	hg19	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.778055	0.00634	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.05717	3.43;3.4	0.428	0.428	0.16499	.	.	.	.	.	T	0.15652	0.0377	M	0.75264	2.295	0.09310	N	1	B;D	0.54964	0.04;0.969	B;P	0.59643	0.034;0.861	T	0.18493	-1.0335	8	0.21014	T	0.42	.	.	.	.	.	113;145	Q05481-2;Q05481	.;ZNF91_HUMAN	R	145;113	ENSP00000300619:C145R;ENSP00000380272:C113R	ENSP00000300619:C145R	C	-	1	0	ZNF91	23337188	0.005000	0.15991	0.003000	0.11579	0.118000	0.20060	0.756000	0.26419	0.368000	0.24481	0.147000	0.16070	TGT	.	.	.	none		0.323	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
PPFIA3	8541	hgsc.bcm.edu	37	19	49631270	49631271	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr19:49631270_49631271GC>TT	ENST00000334186.4	+	2	489_490	c.140_141GC>TT	c.(139-141)cGC>cTT	p.R47L	PPFIA3_ENST00000602351.1_Missense_Mutation_p.R47L	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	47					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		GAGACGCTGCGCGAGGCACAGG	0.743																																					p.R47L|p.R47R		Atlas-SNP	.											.	PPFIA3	71	.	0			c.G140T|c.C141T						PASS	.																																			SO:0001583	missense	8541	exon2			CGCTGCGCGAGGC|GCTGCGCGAGGCA	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	Exception_encountered	chr19.hg19:g.49631270_49631271delinsTT	ENSP00000335614:p.Arg47Leu	7.0|8.0	0.0	.		8.0	5.0	.	NM_003660	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation|Silent	SNP	ENST00000334186.4	hg19	CCDS12758.1																																																																																			.	.	.	none		0.743	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
CTSA	5476	hgsc.bcm.edu	37	20	44520635	44520635	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr20:44520635A>T	ENST00000372459.2	+	2	468	c.275A>T	c.(274-276)gAt>gTt	p.D92V	NEURL2_ENST00000372518.4_5'Flank|CTSA_ENST00000191018.5_Missense_Mutation_p.D92V|CTSA_ENST00000354880.5_Missense_Mutation_p.D110V|RP3-337O18.9_ENST00000607703.1_RNA|CTSA_ENST00000372484.3_Missense_Mutation_p.D110V			P10619	PPGB_HUMAN	cathepsin A	92					glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				AGCTCACTAGATGGGCTCCTC	0.602											OREG0025986	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D110V		Atlas-SNP	.											.	CTSA	52	.	0			c.A329T						PASS	.						38.0	43.0	41.0					20																	44520635		2203	4300	6503	SO:0001583	missense	5476	exon3			CACTAGATGGGCT	M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.275A>T	chr20.hg19:g.44520635A>T	ENSP00000361537:p.Asp92Val	84.0	0.0	.	924	30.0	11.0	.	NM_000308	B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Missense_Mutation	SNP	ENST00000372459.2	hg19	CCDS46609.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.931780	0.92389	.	.	ENSG00000064601	ENST00000354880;ENST00000372484;ENST00000191018;ENST00000419493;ENST00000372459	D;D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02;-3.02	5.51	5.51	0.81932	.	0.086182	0.85682	D	0.000000	D	0.93383	0.7890	L	0.59436	1.845	0.80722	D	1	D;P;P	0.54601	0.967;0.744;0.744	P;P;P	0.57548	0.823;0.687;0.592	D	0.91572	0.5272	10	0.20046	T	0.44	.	15.2903	0.73862	1.0:0.0:0.0:0.0	.	109;92;109	B4E324;P10619;Q59EV6	.;PPGB_HUMAN;.	V	110;110;92;92;92	ENSP00000346952:D110V;ENSP00000361562:D110V;ENSP00000191018:D92V;ENSP00000408533:D92V;ENSP00000361537:D92V	ENSP00000191018:D92V	D	+	2	0	CTSA	43954042	1.000000	0.71417	0.729000	0.30791	0.899000	0.52679	5.173000	0.65010	2.088000	0.63022	0.454000	0.30748	GAT	.	.	.	none		0.602	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308	
KCNQ2	3785	hgsc.bcm.edu	37	20	62044846	62044846	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr20:62044846C>T	ENST00000359125.2	-	15	1894	c.1720G>A	c.(1720-1722)Ggc>Agc	p.G574S	KCNQ2_ENST00000354587.3_Missense_Mutation_p.G546S|KCNQ2_ENST00000359689.1_Missense_Mutation_p.G574S|KCNQ2_ENST00000357249.2_Missense_Mutation_p.G556S|KCNQ2_ENST00000360480.3_Missense_Mutation_p.G546S|KCNQ2_ENST00000344462.4_Missense_Mutation_p.G543S|KCNQ2_ENST00000370224.1_Missense_Mutation_p.G546S	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	574					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.G574S(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCCAGGTGGCCGGCTGAGTAC	0.627																																					p.G574S		Atlas-SNP	.											KCNQ2,NS,carcinoma,0,1	KCNQ2	201	.	1	Substitution - Missense(1)	prostate(1)	c.G1720A						PASS	.						98.0	85.0	89.0					20																	62044846		2203	4300	6503	SO:0001583	missense	3785	exon15			GGTGGCCGGCTGA	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1720G>A	chr20.hg19:g.62044846C>T	ENSP00000352035:p.Gly574Ser	350.0	0.0	.		192.0	70.0	.	NM_172107	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	hg19	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	c	35	5.507931	0.96386	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222	D;D;D;D;D;D;D;D;D;D	0.99923	-8.01;-8.01;-8.01;-8.01;-8.01;-8.01;-8.01;-8.01;-8.01;-8.01	4.99	4.99	0.66335	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.138723	0.49916	D	0.000125	D	0.99924	0.9965	M	0.87547	2.89	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95748	0.8789	10	0.62326	D	0.03	-37.6648	18.2551	0.90017	0.0:1.0:0.0:0.0	.	546;556;543;574	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	S	556;574;544;546;574;543;546;534;546;546	ENSP00000349789:G556S;ENSP00000352035:G574S;ENSP00000359246:G544S;ENSP00000346601:G546S;ENSP00000352718:G574S;ENSP00000399612:G543S;ENSP00000353668:G546S;ENSP00000339611:G534S;ENSP00000359244:G546S;ENSP00000359242:G546S	ENSP00000339611:G534S	G	-	1	0	KCNQ2	61515290	1.000000	0.71417	0.937000	0.37676	0.905000	0.53344	7.660000	0.83776	2.323000	0.78572	0.556000	0.70494	GGC	.	.	.	none		0.627	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
STIM1	6786	hgsc.bcm.edu	37	11	4095775	4095788	+	Frame_Shift_Del	DEL	AAGGTCCATCTGGA	AAGGTCCATCTGGA	-	rs199510481|rs200324686		TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	AAGGTCCATCTGGA	AAGGTCCATCTGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr11:4095775_4095788delAAGGTCCATCTGGA	ENST00000300737.4	+	7	1404_1417	c.835_848delAAGGTCCATCTGGA	c.(835-849)aaggtccatctggaafs	p.KVHLE279fs	STIM1_ENST00000533977.1_Frame_Shift_Del_p.KVHLE106fs|STIM1_ENST00000527651.1_Frame_Shift_Del_p.KVHLE279fs	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	279	Glu-rich.				activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		GGAGGTGGAGAAGGTCCATCTGGAAAAGAAGCTG	0.607																																					p.278_283del		Atlas-Indel,Pindel	.											.	STIM1	55	.	0			c.834_847del						PASS	.																																			SO:0001589	frameshift_variant	6786	exon7			.	BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.835_848delAAGGTCCATCTGGA	chr11.hg19:g.4095775_4095788delAAGGTCCATCTGGA	ENSP00000300737:p.Lys279fs	56.0	0.0	0		59.0	15.0	0.254237	NM_003156	E9PQJ4|Q8N382	Frame_Shift_Del	DEL	ENST00000300737.4	hg19	CCDS7749.1																																																																																			.	.	.	none		0.607	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257196.1	NM_003156	
C10orf76	79591	hgsc.bcm.edu	37	10	103717456	103717456	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr10:103717456delT	ENST00000370033.4	-	21	1648	c.1529delA	c.(1528-1530)aatfs	p.N510fs		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	510						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		TACAGTCTCATTTGACATAAG	0.299																																					p.N510fs		Atlas-Indel,Pindel	.											.	C10orf76	48	.	0			c.1530delT						PASS	.						82.0	75.0	77.0					10																	103717456		1817	4080	5897	SO:0001589	frameshift_variant	79591	exon21			.	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.1529delA	chr10.hg19:g.103717456delT	ENSP00000359050:p.Asn510fs	44.0	0.0	0		52.0	16.0	0.307692	NM_024541	Q2TB87|Q9H8Z9	Frame_Shift_Del	DEL	ENST00000370033.4	hg19	CCDS41563.1																																																																																			.	.	.	none		0.299	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	NM_024541	
CCDC146	57639	hgsc.bcm.edu	37	7	76883839	76883844	+	In_Frame_Del	DEL	ATCATC	ATCATC	-			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	ATCATC	ATCATC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr7:76883839_76883844delATCATC	ENST00000285871.4	+	5	593_598	c.466_471delATCATC	c.(466-471)atcatcdel	p.II156del	CCDC146_ENST00000431197.1_5'UTR|AC073635.5_ENST00000476561.2_RNA	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	156										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GGAAGAAAAAATCATCATAGTAAAAG	0.286																																					p.155_157del		Atlas-Indel,Pindel	.											.	CCDC146	87	.	0			c.465_470del						PASS	.																																			SO:0001651	inframe_deletion	57639	exon5			.	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.466_471delATCATC	chr7.hg19:g.76883839_76883844delATCATC	ENSP00000285871:p.Ile156_Ile157del	43.0	0.0	0		75.0	19.0	0.253333	NM_020879	A8K8X6|Q9P223	In_Frame_Del	DEL	ENST00000285871.4	hg19	CCDS34671.1																																																																																			.	.	.	none		0.286	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879	
ANKRD30A	91074	hgsc.bcm.edu	37	10	37478466	37478468	+	In_Frame_Del	DEL	AAT	AAT	-			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	AAT	AAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr10:37478466_37478468delAAT	ENST00000602533.1	+	25	2424_2426	c.2325_2327delAAT	c.(2323-2328)aaaata>aaa	p.I776del	ANKRD30A_ENST00000361713.1_In_Frame_Del_p.I776del|ANKRD30A_ENST00000475522.1_3'UTR|ANKRD30A_ENST00000374660.1_In_Frame_Del_p.I895del			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	832					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AAATAGATAAAATAAATGGAAAA	0.305																																					p.775_776del		Atlas-Indel,Pindel	.											ANKRD30A,NS,carcinoma,0,1	ANKRD30A	448	.	0			c.2324_2326del						PASS	.																																			SO:0001651	inframe_deletion	91074	exon25			.	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2325_2327delAAT	chr10.hg19:g.37478466_37478468delAAT	ENSP00000473551:p.Ile776del	350.0	0.0	0		309.0	43.0	0.139159	NM_052997	Q5W025	In_Frame_Del	DEL	ENST00000602533.1	hg19																																																																																				.	.	.	none		0.305	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
KMT2E	55904	hgsc.bcm.edu	37	7	104742528	104742541	+	Frame_Shift_Del	DEL	AATACTGTACTTAC	AATACTGTACTTAC	-			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	AATACTGTACTTAC	AATACTGTACTTAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr7:104742528_104742541delAATACTGTACTTAC	ENST00000311117.3	+	17	2628_2641	c.2083_2096delAATACTGTACTTAC	c.(2083-2097)aatactgtacttacafs	p.NTVLT695fs	KMT2E_ENST00000334877.4_Frame_Shift_Del_p.NTVLT695fs|KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_Frame_Shift_Del_p.NTVLT695fs|CTB-152G17.6_ENST00000607968.1_RNA	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	695					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TGATATTGAAAATACTGTACTTACAATAGAACCA	0.383																																					p.694_699del		Atlas-Indel,Pindel	.											.	MLL5	173	.	0			c.2082_2095del						PASS	.																																			SO:0001589	frameshift_variant	55904	exon17			.	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2083_2096delAATACTGTACTTAC	chr7.hg19:g.104742528_104742541delAATACTGTACTTAC	ENSP00000312379:p.Asn695fs	211.0	0.0	0		379.0	92.0	0.242744	NM_182931	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Frame_Shift_Del	DEL	ENST00000311117.3	hg19	CCDS34723.1																																																																																			.	.	.	none		0.383	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643025	1643025	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr11:1643025delC	ENST00000399682.1	-	1	343	c.299delG	c.(298-300)ggcfs	p.G100fs		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GGAGCCACAGCCCCCCTTGGA	0.682																																					p.G100fs		Atlas-INDEL	.											.	KRTAP5-4	78	.	0			c.300delC						PASS	.						6.0	12.0	10.0					11																	1643025		640	1507	2147	SO:0001589	frameshift_variant	387267	exon1			.	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.299delG	chr11.hg19:g.1643025delC	ENSP00000382590:p.Gly100fs	260.0	0.0	0		189.0	19.0	0.100529	NM_001012709		Frame_Shift_Del	DEL	ENST00000399682.1	hg19																																																																																				.	.	.	none		0.682	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
ATP5H	10476	hgsc.bcm.edu	37	17	73038343	73038343	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr17:73038343delG	ENST00000301587.4	-	3	199	c.152delC	c.(151-153)gctfs	p.A51fs	KCTD2_ENST00000581589.1_Intron|ATP5H_ENST00000344546.4_Frame_Shift_Del_p.A51fs|RN7SL573P_ENST00000485340.2_RNA|KCTD2_ENST00000584767.1_Intron	NM_006356.2	NP_006347.1	O75947	ATP5H_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d	51					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			lung(1)|skin(1)	2	all_lung(278;0.226)					CCAGTCGATAGCTGGTGGATT	0.458																																					p.A51fs		Atlas-Indel,Pindel	.											.	ATP5H	5	.	0			c.153delT						PASS	.						73.0	61.0	65.0					17																	73038343		2203	4300	6503	SO:0001589	frameshift_variant	10476	exon3			.	AF087135	CCDS11712.1, CCDS32727.1	17q25	2014-01-24	2010-06-11		ENSG00000167863	ENSG00000167863		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	845	protein-coding gene	gene with protein product			"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d"""			11042152	Standard	NM_006356		Approved	ATPQ, ATP5JD	uc002jmn.1	O75947	OTTHUMG00000179219	ENST00000301587.4:c.152delC	chr17.hg19:g.73038343delG	ENSP00000301587:p.Ala51fs	87.0	0.0	0		98.0	50.0	0.510204	NM_006356	B2R5L6|Q9H3J4	Frame_Shift_Del	DEL	ENST00000301587.4	hg19	CCDS11712.1																																																																																			.	.	.	none		0.458	ATP5H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445318.1	NM_006356	
APC2	10297	hgsc.bcm.edu	37	19	1465652	1465652	+	Frame_Shift_Del	DEL	G	G	-	rs61757708		TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr19:1465652delG	ENST00000535453.1	+	14	4065	c.2352delG	c.(2350-2352)ccgfs	p.P784fs	CTB-25B13.12_ENST00000588225.1_RNA|APC2_ENST00000233607.2_Frame_Shift_Del_p.P784fs|C19orf25_ENST00000588427.1_Intron|APC2_ENST00000238483.4_Frame_Shift_Del_p.P510fs			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGATGCACCGTCATCCCTGG	0.706																																					p.P784fs		Atlas-Indel,Pindel	.											.	APC2	50	.	0			c.2351delC						PASS	.						8.0	11.0	10.0					19																	1465652		2061	4181	6242	SO:0001589	frameshift_variant	10297	exon15			.		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.2352delG	chr19.hg19:g.1465652delG	ENSP00000442954:p.Pro784fs	160.0	0.0	0		102.0	28.0	0.27451	NM_005883	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Frame_Shift_Del	DEL	ENST00000535453.1	hg19	CCDS12068.1																																																																																			.	.	.	none		0.706	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	
VCPIP1	80124	hgsc.bcm.edu	37	8	67577722	67577722	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr8:67577722delA	ENST00000310421.4	-	1	1730	c.1472delT	c.(1471-1473)ttgfs	p.L491fs	C8orf44_ENST00000521889.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank|C8orf44-SGK3_ENST00000519289.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	491					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CAGGTTATACAATTTCCCTCC	0.413																																					p.L491fs	NSCLC(179;265 2915 6144 43644)	Atlas-Indel,Pindel	.											.	VCPIP1	110	.	0			c.1473delG						PASS	.						140.0	147.0	144.0					8																	67577722		2203	4300	6503	SO:0001589	frameshift_variant	80124	exon1			.	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.1472delT	chr8.hg19:g.67577722delA	ENSP00000309031:p.Leu491fs	92.0	0.0	0		87.0	34.0	0.390805	NM_025054	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Frame_Shift_Del	DEL	ENST00000310421.4	hg19	CCDS6192.1																																																																																			.	.	.	none		0.413	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1		
HERC3	8916	hgsc.bcm.edu	37	4	89583701	89583701	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr4:89583701delA	ENST00000402738.1	+	11	1505	c.1266delA	c.(1264-1266)acafs	p.T422fs	HERC3_ENST00000543130.1_Intron|HERC3_ENST00000264345.3_Frame_Shift_Del_p.T422fs	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	422					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		ATGCAAATACAATCAAGTATG	0.338																																					p.T422fs		Atlas-Indel,Pindel	.											.	HERC3	82	.	0			c.1265delC						PASS	.						92.0	87.0	89.0					4																	89583701		2203	4300	6503	SO:0001589	frameshift_variant	8916	exon11			.	D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.1266delA	chr4.hg19:g.89583701delA	ENSP00000385684:p.Thr422fs	125.0	0.0	0		149.0	46.0	0.308725	NM_014606	A8K1S5|Q8IXX3	Frame_Shift_Del	DEL	ENST00000402738.1	hg19	CCDS34028.1																																																																																			.	.	.	none		0.338	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606	
ANKRD30A	91074	hgsc.bcm.edu	37	10	37442571	37442573	+	In_Frame_Del	DEL	AAT	AAT	-	rs376853184		TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	AAT	AAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr10:37442571_37442573delAAT	ENST00000602533.1	+	13	1710_1712	c.1611_1613delAAT	c.(1609-1614)aaaata>aaa	p.I538del	ANKRD30A_ENST00000361713.1_In_Frame_Del_p.I538del|ANKRD30A_ENST00000374660.1_In_Frame_Del_p.I538del			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	594					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AAATAGATAAAATAAATGGAAAA	0.32																																					p.537_538del		Atlas-INDEL	.											ANKRD30A,colon,carcinoma,0,1	ANKRD30A	448	.	0			c.1610_1612del						PASS	.																																			SO:0001651	inframe_deletion	91074	exon13			.	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1611_1613delAAT	chr10.hg19:g.37442571_37442573delAAT	ENSP00000473551:p.Ile538del	619.0	0.0	0		675.0	52.0	0.077037	NM_052997	Q5W025	In_Frame_Del	DEL	ENST00000602533.1	hg19																																																																																				.	.	.	none		0.320	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
MSH4	4438	hgsc.bcm.edu	37	1	76282215	76282218	+	Frame_Shift_Del	DEL	AATA	AATA	-	rs139179365		TCGA-2Z-A9JR-01A-12D-A42J-10	TCGA-2Z-A9JR-10A-01D-A42M-10	AATA	AATA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9a5edc5e-790b-41c7-b1c1-49106b297a3d	dea33a63-ced9-4e0a-a451-ffb60520dc94	g.chr1:76282215_76282218delAATA	ENST00000263187.3	+	6	1077_1080	c.973_976delAATA	c.(973-978)aataatfs	p.NN325fs		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	325					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						ATTGTTAATTAATAATCAAGACTA	0.279								Mismatch excision repair (MMR)																													p.324_325del		Pindel	.											.	MSH4	147	.	0			c.972_975del						PASS	.																																			SO:0001589	frameshift_variant	4438	exon6			.	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.973_976delAATA	chr1.hg19:g.76282215_76282218delAATA	ENSP00000263187:p.Asn325fs	254.0	0.0	.		320.0	66.0	0.206	NM_002440	Q5T4U6|Q8NEB3|Q9UNP8	Frame_Shift_Del	DEL	ENST00000263187.3	hg19	CCDS670.1																																																																																			.	.	.	none		0.279	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	
