#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TESK2	10420	hgsc.bcm.edu	37	1	45811638	45811638	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr1:45811638A>C	ENST00000372086.3	-	10	1308	c.908T>G	c.(907-909)gTg>gGg	p.V303G	TESK2_ENST00000341771.6_Missense_Mutation_p.V274G|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_Missense_Mutation_p.V274G|TESK2_ENST00000538496.1_Missense_Mutation_p.V220G	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	303	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					CCCAATCTCCACAAAAGATGG	0.522																																					p.V303G		Atlas-SNP	.											.	TESK2	60	.	0			c.T908G						PASS	.						74.0	72.0	73.0					1																	45811638		1899	4113	6012	SO:0001583	missense	10420	exon10			ATCTCCACAAAAG	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.908T>G	chr1.hg19:g.45811638A>C	ENSP00000361158:p.Val303Gly	73.0	0.0	.		65.0	15.0	.	NM_007170	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Missense_Mutation	SNP	ENST00000372086.3	hg19	CCDS41323.1	.	.	.	.	.	.	.	.	.	.	A	11.87	1.766844	0.31320	.	.	ENSG00000070759	ENST00000372084;ENST00000372086;ENST00000372083;ENST00000341771;ENST00000538496	T;D;T;D	0.82526	-0.19;-1.62;-0.19;-1.62	5.54	-0.102	0.13613	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.750938	0.12432	N	0.469475	T	0.64450	0.2599	N	0.13272	0.32	0.80722	D	1	B;B	0.14012	0.009;0.002	B;B	0.22152	0.038;0.027	T	0.46610	-0.9179	10	0.20519	T	0.43	-0.5571	4.8888	0.13717	0.4968:0.0:0.3572:0.146	.	274;303	Q96S53-3;Q96S53	.;TESK2_HUMAN	G	274;303;287;274;220	ENSP00000361156:V274G;ENSP00000361158:V303G;ENSP00000343940:V274G;ENSP00000441746:V220G	ENSP00000343940:V274G	V	-	2	0	TESK2	45584225	0.438000	0.25602	1.000000	0.80357	0.997000	0.91878	0.273000	0.18662	0.055000	0.16094	0.456000	0.33151	GTG	.	.	.	none		0.522	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020523.1	NM_007170	
AMPD2	271	hgsc.bcm.edu	37	1	110168296	110168296	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr1:110168296C>T	ENST00000256578.3	+	3	757	c.397C>T	c.(397-399)Cgc>Tgc	p.R133C	AMPD2_ENST00000528667.1_Missense_Mutation_p.R133C|AMPD2_ENST00000393688.3_Missense_Mutation_p.R14C|AMPD2_ENST00000528454.1_Missense_Mutation_p.R15C|AMPD2_ENST00000526301.1_3'UTR|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000358729.4_Missense_Mutation_p.R58C|AMPD2_ENST00000342115.4_Missense_Mutation_p.R52C	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	133					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		GCTGTTCACCCGCTCACTGGC	0.672																																					p.R133C		Atlas-SNP	.											AMPD2_ENST00000393689,NS,carcinoma,0,1	AMPD2	75	.	0			c.C397T						PASS	.						49.0	56.0	54.0					1																	110168296		2203	4300	6503	SO:0001583	missense	271	exon3			TTCACCCGCTCAC	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.397C>T	chr1.hg19:g.110168296C>T	ENSP00000256578:p.Arg133Cys	151.0	0.0	.		118.0	7.0	.	NM_004037	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	hg19	CCDS805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.8|27.8	4.865184|4.865184	0.91511|0.91511	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000369840|ENST00000531734;ENST00000342115;ENST00000528667;ENST00000531203;ENST00000256578;ENST00000358729;ENST00000527846;ENST00000528454;ENST00000393688	.|T;T;T;T;T;T;T;D	.|0.87809	.|1.12;1.12;1.12;1.12;1.18;1.12;1.18;-2.3	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|0.164918	.|0.56097	.|D	.|0.000040	D|D	0.90851|0.90851	0.7126|0.7126	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;0.999;0.999	.|D;D;P;P	.|0.80764	.|0.994;0.911;0.858;0.881	D|D	0.91649|0.91649	0.5333|0.5333	5|10	.|0.72032	.|D	.|0.01	-29.6856|-29.6856	16.8712|16.8712	0.86041|0.86041	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|58;14;133;52	.|Q01433-4;Q01433-3;Q01433;Q01433-2	.|.;.;AMPD2_HUMAN;.	L|C	103|52;52;133;15;133;58;100;15;14	.|ENSP00000433739:R52C;ENSP00000345498:R52C;ENSP00000436541:R133C;ENSP00000256578:R133C;ENSP00000351573:R58C;ENSP00000431904:R100C;ENSP00000437164:R15C;ENSP00000377292:R14C	.|ENSP00000256578:R133C	P|R	+|+	2|1	0|0	AMPD2|AMPD2	109969819|109969819	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.918000|0.918000	0.54935|0.54935	7.353000|7.353000	0.79414|0.79414	2.506000|2.506000	0.84524|0.84524	0.462000|0.462000	0.41574|0.41574	CCG|CGC	.	.	.	none		0.672	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1		
ITGA10	8515	hgsc.bcm.edu	37	1	145536864	145536864	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr1:145536864T>G	ENST00000369304.3	+	18	2419	c.2244T>G	c.(2242-2244)gaT>gaG	p.D748E	ITGA10_ENST00000539363.1_Missense_Mutation_p.D605E|ITGA10_ENST00000538811.1_Missense_Mutation_p.D617E	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	748					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ATACATCAGATTACCTCCGGC	0.468																																					p.D748E		Atlas-SNP	.											.	ITGA10	131	.	0			c.T2244G						PASS	.						190.0	175.0	180.0					1																	145536864		2203	4300	6503	SO:0001583	missense	8515	exon18			ATCAGATTACCTC	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.2244T>G	chr1.hg19:g.145536864T>G	ENSP00000358310:p.Asp748Glu	78.0	0.0	.		86.0	24.0	.	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	hg19	CCDS918.1	.	.	.	.	.	.	.	.	.	.	T	17.52	3.409932	0.62399	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.78481	-1.18;-1.18;-1.18	5.16	1.57	0.23409	Integrin alpha-2 (1);	0.000000	0.85682	D	0.000000	T	0.75428	0.3848	L	0.55213	1.73	0.41709	D	0.989441	D;D;D;D	0.89917	1.0;0.985;0.991;1.0	D;D;P;D	0.81914	0.987;0.918;0.901;0.995	T	0.75714	-0.3221	10	0.87932	D	0	.	5.9093	0.19018	0.0:0.3292:0.0:0.6708	.	714;617;605;748	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	E	748;714;605;617	ENSP00000358310:D748E;ENSP00000439894:D605E;ENSP00000440011:D617E	ENSP00000358310:D748E	D	+	3	2	ITGA10	144248221	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	0.925000	0.28791	0.446000	0.26666	0.374000	0.22700	GAT	.	.	.	none		0.468	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
TOR1AIP2	163590	hgsc.bcm.edu	37	1	179834169	179834169	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr1:179834169T>C	ENST00000553856.1	-	1	142	c.143A>G	c.(142-144)tAt>tGt	p.Y48C	TOR1AIP2_ENST00000367612.3_Intron|TOR1AIP2_ENST00000609928.1_Intron|TOR1AIP2_ENST00000482587.1_5'UTR	NM_022347.3	NP_071742.1	Q9H496	IFG15_HUMAN		48																	CTCAGGACAATAATCAGCTCT	0.433																																					p.Y48C		Atlas-SNP	.											.	TOR1AIP2	38	.	0			c.A143G						PASS	.						174.0	171.0	172.0					1																	179834169		1888	4104	5992	SO:0001583	missense	163590	exon3			GGACAATAATCAG																												ENST00000553856.1:c.143A>G	chr1.hg19:g.179834169T>C	ENSP00000452581:p.Tyr48Cys	391.0	0.0	.		356.0	108.0	.	NM_022347	Q05BU2	Missense_Mutation	SNP	ENST00000553856.1	hg19	CCDS53439.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.984540	0.35036	.	.	ENSG00000258664	ENST00000553856	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	T	0.48572	0.1507	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.46303	-0.9201	7	.	.	.	.	11.0179	0.47701	0.0:0.0:0.0:1.0	.	48	Q9H496	.	C	48	.	.	Y	-	2	0	AL359853.3	178100792	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	2.978000	0.49305	2.371000	0.80710	0.533000	0.62120	TAT	.	.	.	none		0.433	IFRG15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
MR1	3140	hgsc.bcm.edu	37	1	181021439	181021439	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr1:181021439C>T	ENST00000367580.5	+	4	678	c.673C>T	c.(673-675)Cat>Tat	p.H225Y	MR1_ENST00000282990.6_Intron|MR1_ENST00000434571.2_Intron|MR1_ENST00000438435.2_Intron|MR1_ENST00000367579.3_Missense_Mutation_p.H180Y	NM_001531.2	NP_001522.1	Q95460	HMR1_HUMAN	major histocompatibility complex, class I-related	225	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	MHC class I receptor activity (GO:0032393)|peptide antigen binding (GO:0042605)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	18					Antithymocyte globulin(DB00098)	CTGCAAAGCTCATGGCTTTTA	0.428																																					p.H225Y	Colon(174;1412 1962 45296 46549 47110)	Atlas-SNP	.											.	MR1	46	.	0			c.C673T						PASS	.						55.0	56.0	56.0					1																	181021439		2203	4300	6503	SO:0001583	missense	3140	exon5			AAAGCTCATGGCT	AF010446	CCDS1342.1, CCDS53440.1, CCDS53441.1, CCDS53442.1	1q25.3	2013-01-11	2003-03-05	2003-03-07	ENSG00000153029	ENSG00000153029		"""Immunoglobulin superfamily / C1-set domain containing"""	4975	protein-coding gene	gene with protein product		600764	"""major histocompatibility complex, class I-like sequence"""	HLALS		7624800, 9784382	Standard	NM_001194999		Approved		uc001goq.2	Q95460	OTTHUMG00000035175	ENST00000367580.5:c.673C>T	chr1.hg19:g.181021439C>T	ENSP00000356552:p.His225Tyr	114.0	0.0	.		87.0	23.0	.	NM_001531	A8K2V9|B4E3B1|O97985|O97986|Q53GM1|Q95HB8|Q9MY23|Q9NPL2|Q9TQB3|Q9TQB9|Q9TQK3	Missense_Mutation	SNP	ENST00000367580.5	hg19	CCDS1342.1	.	.	.	.	.	.	.	.	.	.	C	8.090	0.774344	0.16051	.	.	ENSG00000153029	ENST00000367580;ENST00000367579	T;T	0.02737	4.18;4.18	4.52	-2.19	0.07015	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.629307	0.14989	N	0.286793	T	0.01454	0.0047	N	0.03029	-0.43	0.47476	D	0.999438	B;B	0.02656	0.0;0.0	B;B	0.08055	0.002;0.003	T	0.51004	-0.8760	10	0.87932	D	0	.	10.6879	0.45854	0.0:0.3901:0.0:0.6099	.	180;225	Q95460-2;Q95460	.;HMR1_HUMAN	Y	225;180	ENSP00000356552:H225Y;ENSP00000356551:H180Y	ENSP00000356551:H180Y	H	+	1	0	MR1	179288062	0.021000	0.18746	0.881000	0.34555	0.754000	0.42855	-0.563000	0.05943	-0.583000	0.05921	-1.731000	0.00696	CAT	.	.	.	none		0.428	MR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085134.2	NM_001531	
PRKD3	23683	hgsc.bcm.edu	37	2	37501808	37501808	+	Silent	SNP	A	A	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr2:37501808A>T	ENST00000379066.1	-	11	2169	c.1407T>A	c.(1405-1407)tcT>tcA	p.S469S	PRKD3_ENST00000234179.2_Silent_p.S469S			O94806	KPCD3_HUMAN	protein kinase D3	469	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				CTCGTGGTGAAGATATGCGGA	0.323																																					p.S469S	Melanoma(80;621 1355 8613 11814 51767)	Atlas-SNP	.											.	PRKD3	170	.	0			c.T1407A						PASS	.						59.0	56.0	57.0					2																	37501808		2203	4300	6503	SO:0001819	synonymous_variant	23683	exon10			TGGTGAAGATATG	AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.1407T>A	chr2.hg19:g.37501808A>T		101.0	0.0	.		93.0	26.0	.	NM_005813	D6W587|Q53TR7|Q8NEL8	Silent	SNP	ENST00000379066.1	hg19	CCDS1789.1																																																																																			.	.	.	none		0.323	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813	
ADD2	119	hgsc.bcm.edu	37	2	70931469	70931469	+	Silent	SNP	G	G	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr2:70931469G>A	ENST00000264436.4	-	4	750	c.306C>T	c.(304-306)ttC>ttT	p.F102F	ADD2_ENST00000413157.2_Silent_p.F102F|ADD2_ENST00000407644.2_Silent_p.F102F|ADD2_ENST00000355733.3_Silent_p.F102F|ADD2_ENST00000473232.1_5'Flank|ADD2_ENST00000430656.1_Silent_p.F118F	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	102					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						AAGATGTCGGGAAGACTGCGT	0.602																																					p.F118F		Atlas-SNP	.											.	ADD2	261	.	0			c.C354T						PASS	.						131.0	113.0	119.0					2																	70931469		2203	4300	6503	SO:0001819	synonymous_variant	119	exon3			TGTCGGGAAGACT	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.306C>T	chr2.hg19:g.70931469G>A		55.0	0.0	.		50.0	12.0	.	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	ENST00000264436.4	hg19	CCDS1906.1																																																																																			.	.	.	none		0.602	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
CNNM4	26504	hgsc.bcm.edu	37	2	97428100	97428100	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr2:97428100A>G	ENST00000377075.2	+	1	1462	c.1364A>G	c.(1363-1365)gAc>gGc	p.D455G		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	455	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						GTCTTCCATGACACCAAGTTG	0.527																																					p.D455G		Atlas-SNP	.											.	CNNM4	48	.	0			c.A1364G						PASS	.						103.0	98.0	100.0					2																	97428100		2203	4300	6503	SO:0001583	missense	26504	exon1			TCCATGACACCAA	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.1364A>G	chr2.hg19:g.97428100A>G	ENSP00000366275:p.Asp455Gly	188.0	0.0	.		161.0	48.0	.	NM_020184	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	hg19	CCDS2024.2	.	.	.	.	.	.	.	.	.	.	A	16.78	3.216564	0.58452	.	.	ENSG00000158158	ENST00000377075	D	0.95137	-3.62	5.26	5.26	0.73747	Cystathionine beta-synthase, core (2);	0.000000	0.85682	D	0.000000	D	0.95705	0.8603	L	0.42529	1.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96259	0.9189	10	0.87932	D	0	-14.3599	14.1805	0.65572	1.0:0.0:0.0:0.0	.	455	Q6P4Q7	CNNM4_HUMAN	G	455	ENSP00000366275:D455G	ENSP00000366275:D455G	D	+	2	0	CNNM4	96791827	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.281000	0.95811	1.996000	0.58369	0.533000	0.62120	GAC	.	.	.	none		0.527	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	NM_020184	
MRPS9	64965	hgsc.bcm.edu	37	2	105654555	105654555	+	Missense_Mutation	SNP	C	C	T	rs149402894	byFrequency	TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr2:105654555C>T	ENST00000258455.3	+	1	115	c.5C>T	c.(4-6)gCg>gTg	p.A2V	AC010884.1_ENST00000456519.1_RNA	NM_182640.2	NP_872578.1	P82933	RT09_HUMAN	mitochondrial ribosomal protein S9	2					DNA damage response, detection of DNA damage (GO:0042769)|peptide biosynthetic process (GO:0043043)|translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						GCTAACATGGCGGCGCCCTGT	0.677													C|||	3	0.000599042	0.0	0.0014	5008	,	,		14716	0.0		0.0	False		,,,				2504	0.002				p.A2V		Atlas-SNP	.											.	MRPS9	32	.	0			c.C5T						PASS	.	C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	30.0	30.0	30.0		5	3.9	1.0	2	dbSNP_134	30	4,8596	3.7+/-12.6	0,4,4296	yes	missense	MRPS9	NM_182640.2	64	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	probably-damaging	2/397	105654555	5,13001	2203	4300	6503	SO:0001583	missense	64965	exon1			ACATGGCGGCGCC		CCDS2065.1	2q12.1	2012-09-13			ENSG00000135972	ENSG00000135972		"""Mitochondrial ribosomal proteins / small subunits"""	14501	protein-coding gene	gene with protein product	"""28S ribosomal protein S9, mitochondrial"""	611975				11279123	Standard	NM_182640		Approved	RPMS9, MRP-S9, S9mt	uc002tcn.4	P82933	OTTHUMG00000130807	ENST00000258455.3:c.5C>T	chr2.hg19:g.105654555C>T	ENSP00000258455:p.Ala2Val	122.0	0.0	.		105.0	30.0	.	NM_182640	Q6PG40	Missense_Mutation	SNP	ENST00000258455.3	hg19	CCDS2065.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.203247	0.38905	2.27E-4	4.65E-4	ENSG00000135972	ENST00000258455	T	0.52754	0.65	4.82	3.94	0.45596	.	0.062495	0.64402	N	0.000007	T	0.45597	0.1350	M	0.79475	2.455	0.41050	D	0.985296	B	0.29232	0.238	B	0.17979	0.02	T	0.52208	-0.8606	10	0.72032	D	0.01	-16.2181	9.4342	0.38628	0.0:0.9023:0.0:0.0977	.	2	P82933	RT09_HUMAN	V	2	ENSP00000258455:A2V	ENSP00000258455:A2V	A	+	2	0	MRPS9	105020987	1.000000	0.71417	0.998000	0.56505	0.265000	0.26407	1.884000	0.39668	1.376000	0.46267	0.655000	0.94253	GCG	.	C|1.000;T|0.000	0.000	weak		0.677	MRPS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253352.1	NM_182640	
SAP130	79595	hgsc.bcm.edu	37	2	128774008	128774008	+	Silent	SNP	G	G	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr2:128774008G>T	ENST00000259235.3	-	4	669	c.540C>A	c.(538-540)atC>atA	p.I180I	SAP130_ENST00000357702.5_Silent_p.I180I|SAP130_ENST00000259234.6_Silent_p.I154I	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	180					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		AAGCTTGAGGGATGCTACTCT	0.493																																					p.I180I		Atlas-SNP	.											.	SAP130	169	.	0			c.C540A						PASS	.						128.0	120.0	123.0					2																	128774008		2203	4300	6503	SO:0001819	synonymous_variant	79595	exon4			TTGAGGGATGCTA	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.540C>A	chr2.hg19:g.128774008G>T		146.0	0.0	.		132.0	32.0	.	NM_001145928	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Silent	SNP	ENST00000259235.3	hg19	CCDS2153.1																																																																																			.	.	.	none		0.493	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	
APEH	327	hgsc.bcm.edu	37	3	49723551	49723551	+	IGR	SNP	A	A	G	rs199957562		TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr3:49723551A>G	ENST00000296456.5	+	0	3220				MST1_ENST00000449682.2_Missense_Mutation_p.M364T|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'Flank|MST1_ENST00000383728.3_3'UTR	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.M350T(3)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGCCGCGCGCATGCCGGGCCG	0.667																																					p.M364T		Atlas-SNP	.											MST1,cerebellum,glioma,0,4	MST1	84	.	3	Substitution - Missense(3)	NS(2)|skin(1)	c.T1091C						PASS	.						13.0	16.0	15.0					3																	49723551		2196	4289	6485	SO:0001628	intergenic_variant	4485	exon9			GCGCGCATGCCGG	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		chr3.hg19:g.49723551A>G		91.0	0.0	.		67.0	4.0	.	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	hg19	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	A	15.79	2.937159	0.52972	.	.	ENSG00000173531	ENST00000449682	T	0.61510	0.1	5.4	4.17	0.49024	.	0.132069	0.34338	N	0.004055	T	0.35508	0.0934	N	0.04805	-0.155	0.80722	D	1	B	0.09022	0.002	B	0.17979	0.02	T	0.24083	-1.0170	10	0.51188	T	0.08	.	10.9733	0.47450	0.86:0.0:0.0:0.14	.	364	G3XAK1	.	T	364	ENSP00000414287:M364T	ENSP00000414287:M364T	M	-	2	0	MST1	49698555	1.000000	0.71417	0.995000	0.50966	0.875000	0.50365	7.395000	0.79876	2.042000	0.60477	0.533000	0.62120	ATG	.	.	.	weak		0.667	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
SKIL	6498	hgsc.bcm.edu	37	3	170079027	170079027	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr3:170079027T>C	ENST00000458537.3	+	1	1617	c.908T>C	c.(907-909)tTt>tCt	p.F303S	SKIL_ENST00000426052.2_Missense_Mutation_p.F283S|SKIL_ENST00000413427.2_Missense_Mutation_p.F303S|SKIL_ENST00000259119.4_Missense_Mutation_p.F303S	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	303					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			CCCCAGACGTTTGTGATGCAT	0.433																																					p.F303S		Atlas-SNP	.											.	SKIL	67	.	0			c.T908C						PASS	.						137.0	131.0	133.0					3																	170079027		2203	4300	6503	SO:0001583	missense	6498	exon1			AGACGTTTGTGAT	X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.908T>C	chr3.hg19:g.170079027T>C	ENSP00000415243:p.Phe303Ser	105.0	0.0	.		113.0	35.0	.	NM_001248008	A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	ENST00000458537.3	hg19	CCDS33890.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.544136	0.86022	.	.	ENSG00000136603	ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	D;D;D;D	0.97994	-4.65;-4.64;-4.58;-4.65	5.83	5.83	0.93111	SAND domain-like (2);c-SKI Smad4-binding (1);	0.045464	0.85682	D	0.000000	D	0.98773	0.9587	M	0.85197	2.74	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99826	1.1050	10	0.87932	D	0	-22.9726	16.2481	0.82460	0.0:0.0:0.0:1.0	.	303;303	P12757-3;P12757	.;SKIL_HUMAN	S	303;283;303;303	ENSP00000259119:F303S;ENSP00000406520:F283S;ENSP00000400193:F303S;ENSP00000415243:F303S	ENSP00000259119:F303S	F	+	2	0	SKIL	171561721	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	7.698000	0.84413	2.241000	0.73720	0.524000	0.50904	TTT	.	.	.	none		0.433	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352351.4	NM_005414	
FAM131A	131408	hgsc.bcm.edu	37	3	184062561	184062561	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr3:184062561C>G	ENST00000310585.4	+	3	2175	c.811C>G	c.(811-813)Cag>Gag	p.Q271E	FAM131A_ENST00000418281.1_Missense_Mutation_p.Q179E|FAM131A_ENST00000340957.5_Missense_Mutation_p.Q217E|FAM131A_ENST00000453072.1_Missense_Mutation_p.Q217E|FAM131A_ENST00000450976.1_Missense_Mutation_p.Q217E|FAM131A_ENST00000383847.2_Missense_Mutation_p.Q302E|EIF2B5_ENST00000444495.1_Intron			Q6UXB0	F131A_HUMAN	family with sequence similarity 131, member A	271						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(9)|skin(1)	14	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ACTGGAGGCCCAGGACTCACT	0.687																																					p.Q302E		Atlas-SNP	.											.	FAM131A	37	.	0			c.C904G						PASS	.						43.0	53.0	49.0					3																	184062561		2202	4299	6501	SO:0001583	missense	131408	exon6			GAGGCCCAGGACT	BC026221	CCDS3262.1, CCDS3262.2, CCDS54689.1	3q27.1	2007-03-20	2007-03-20	2007-03-20	ENSG00000175182	ENSG00000175182			28308	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 40"""	C3orf40		12975309	Standard	NM_144635		Approved	MGC21688	uc003foe.3	Q6UXB0	OTTHUMG00000156206	ENST00000310585.4:c.811C>G	chr3.hg19:g.184062561C>G	ENSP00000310135:p.Gln271Glu	71.0	0.0	.		74.0	19.0	.	NM_144635	D3DNT6|G5E9B1|Q8TA84	Missense_Mutation	SNP	ENST00000310585.4	hg19		.	.	.	.	.	.	.	.	.	.	c	4.836	0.155381	0.09236	.	.	ENSG00000175182	ENST00000450976;ENST00000418281;ENST00000340957;ENST00000418768;ENST00000383847;ENST00000453072;ENST00000310585	T;T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07;2.07	4.73	4.73	0.59995	.	0.719434	0.14165	N	0.337106	T	0.12347	0.0300	N	0.22421	0.69	0.34151	D	0.667488	B;B;P	0.38250	0.017;0.035;0.624	B;B;B	0.33960	0.013;0.027;0.173	T	0.03619	-1.1019	10	0.06494	T	0.89	-22.0175	13.4502	0.61167	0.0:0.8428:0.1572:0.0	.	271;302;179	Q6UXB0;G5E9B1;C9JPT9	F131A_HUMAN;.;.	E	217;179;217;217;302;217;271	ENSP00000388551:Q217E;ENSP00000414050:Q179E;ENSP00000340974:Q217E;ENSP00000414913:Q217E;ENSP00000373360:Q302E;ENSP00000390588:Q217E;ENSP00000310135:Q271E	ENSP00000310135:Q271E	Q	+	1	0	FAM131A	185545255	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.805000	0.55575	2.170000	0.68504	0.655000	0.94253	CAG	.	.	.	none		0.687	FAM131A-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000343462.1	NM_144635	
HGFAC	3083	hgsc.bcm.edu	37	4	3446365	3446365	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr4:3446365C>A	ENST00000382774.3	+	7	861	c.746C>A	c.(745-747)cCt>cAt	p.P249H	HGFAC_ENST00000511533.1_Missense_Mutation_p.P249H	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	249	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CTGAGCAGCCCTTGCCTGAAC	0.716																																					p.P249H		Atlas-SNP	.											.	HGFAC	69	.	0			c.C746A						PASS	.						14.0	16.0	15.0					4																	3446365		2187	4281	6468	SO:0001583	missense	3083	exon7			GCAGCCCTTGCCT	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.746C>A	chr4.hg19:g.3446365C>A	ENSP00000372224:p.Pro249His	85.0	0.0	.		61.0	11.0	.	NM_001528	Q14726|Q2M1W7|Q53X47	Missense_Mutation	SNP	ENST00000382774.3	hg19	CCDS3369.1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258728	0.59321	.	.	ENSG00000109758	ENST00000382774;ENST00000511533	D;D	0.95171	-3.63;-3.63	3.44	2.59	0.31030	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.96744	0.8937	M	0.89478	3.035	0.43617	D	0.995997	D;D	0.89917	1.0;0.959	D;P	0.79784	0.993;0.772	D	0.95496	0.8573	10	0.87932	D	0	.	6.5776	0.22575	0.0:0.8626:0.0:0.1374	.	249;249	D6RAR4;Q04756	.;HGFA_HUMAN	H	249	ENSP00000372224:P249H;ENSP00000421801:P249H	ENSP00000372224:P249H	P	+	2	0	HGFAC	3416163	0.002000	0.14202	0.962000	0.40283	0.793000	0.44817	0.145000	0.16157	0.782000	0.33613	0.462000	0.41574	CCT	.	.	.	none		0.716	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
LRRC66	339977	hgsc.bcm.edu	37	4	52861855	52861855	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr4:52861855C>T	ENST00000343457.3	-	4	1339	c.1333G>A	c.(1333-1335)Gta>Ata	p.V445I		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	445						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						TGAGGAAATACTTGGCGCAGA	0.552																																					p.V445I		Atlas-SNP	.											.	LRRC66	128	.	0			c.G1333A						PASS	.						100.0	106.0	104.0					4																	52861855		2046	4191	6237	SO:0001583	missense	339977	exon4			GAAATACTTGGCG	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1333G>A	chr4.hg19:g.52861855C>T	ENSP00000341944:p.Val445Ile	64.0	0.0	.		55.0	15.0	.	NM_001024611		Missense_Mutation	SNP	ENST00000343457.3	hg19	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	C	10.40	1.339748	0.24339	.	.	ENSG00000188993	ENST00000343457	T	0.45276	0.9	3.89	-2.63	0.06133	.	1.981150	0.02460	N	0.086453	T	0.20618	0.0496	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.06917	-1.0800	10	0.37606	T	0.19	4.8277	1.4223	0.02314	0.1424:0.2988:0.1409:0.4179	.	445	Q68CR7	LRC66_HUMAN	I	445	ENSP00000341944:V445I	ENSP00000341944:V445I	V	-	1	0	LRRC66	52556612	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.354000	0.07681	-0.779000	0.04560	0.467000	0.42956	GTA	.	.	.	none		0.552	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
WDFY3	23001	hgsc.bcm.edu	37	4	85642588	85642588	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr4:85642588G>T	ENST00000295888.4	-	47	7986	c.7579C>A	c.(7579-7581)Ctg>Atg	p.L2527M	WDFY3_ENST00000322366.6_Missense_Mutation_p.L2510M	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2527	Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AACAGGCGCAGTAAGGTAGCA	0.428																																					p.L2527M		Atlas-SNP	.											WDFY3,NS,carcinoma,0,1	WDFY3	314	.	0			c.C7579A						PASS	.						211.0	196.0	201.0					4																	85642588		2203	4300	6503	SO:0001583	missense	23001	exon47			GGCGCAGTAAGGT	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.7579C>A	chr4.hg19:g.85642588G>T	ENSP00000295888:p.Leu2527Met	47.0	0.0	.		32.0	7.0	.	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544984	0.65198	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.67171	-0.25;-0.23;-0.22	5.77	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.59905	0.2228	N	0.24115	0.695	0.80722	D	1	D	0.59357	0.985	P	0.49887	0.625	T	0.57057	-0.7876	10	0.21540	T	0.41	.	15.2503	0.73539	0.0676:0.0:0.9324:0.0	.	2527	Q8IZQ1	WDFY3_HUMAN	M	2510;2527;130	ENSP00000318466:L2510M;ENSP00000295888:L2527M;ENSP00000424987:L130M	ENSP00000295888:L2527M	L	-	1	2	WDFY3	85861612	1.000000	0.71417	0.908000	0.35775	0.810000	0.45777	6.376000	0.73141	1.585000	0.49928	0.585000	0.79938	CTG	.	.	.	none		0.428	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
SLC38A9	153129	hgsc.bcm.edu	37	5	54965109	54965109	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr5:54965109C>G	ENST00000396865.2	-	7	1064	c.473G>C	c.(472-474)gGc>gCc	p.G158A	SLC38A9_ENST00000539768.1_Missense_Mutation_p.G158A|SLC38A9_ENST00000512595.1_Missense_Mutation_p.G131A|SLC38A9_ENST00000416547.2_Missense_Mutation_p.G34A|SLC38A9_ENST00000318672.3_Missense_Mutation_p.G158A|SLC38A9_ENST00000515629.1_Missense_Mutation_p.G95A	NM_173514.3	NP_775785.2	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9	158					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				TGTTAAAAGGCCCATCAGTAT	0.328																																					p.G158A		Atlas-SNP	.											.	SLC38A9	50	.	0			c.G473C						PASS	.						187.0	190.0	189.0					5																	54965109		2203	4300	6503	SO:0001583	missense	153129	exon7			AAAAGGCCCATCA		CCDS3968.1, CCDS58947.1, CCDS58948.1, CCDS75243.1	5q11.2	2013-05-22			ENSG00000177058	ENSG00000177058		"""Solute carriers"""	26907	protein-coding gene	gene with protein product							Standard	NM_173514		Approved	FLJ90709	uc003jqf.3	Q8NBW4	OTTHUMG00000131189	ENST00000396865.2:c.473G>C	chr5.hg19:g.54965109C>G	ENSP00000380074:p.Gly158Ala	131.0	0.0	.		113.0	32.0	.	NM_173514	B3KXV1|B7Z7D0|Q0P5S0|Q6MZJ8	Missense_Mutation	SNP	ENST00000396865.2	hg19	CCDS3968.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.982358	0.53827	.	.	ENSG00000177058	ENST00000396865;ENST00000318672;ENST00000539768;ENST00000515629;ENST00000416547;ENST00000512595;ENST00000511233;ENST00000512208;ENST00000503817	T;T;T;T;T;T;T;T;T	0.02158	4.42;4.42;4.42;4.42;4.42;4.42;4.42;4.42;4.42	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.05686	0.0149	N	0.26130	0.795	0.80722	D	1	D;D	0.67145	0.957;0.996	P;D	0.72075	0.615;0.976	T	0.46582	-0.9181	10	0.02654	T	1	-18.6055	19.3048	0.94157	0.0:1.0:0.0:0.0	.	131;158	B3KXV1;Q8NBW4	.;S38A9_HUMAN	A	158;158;158;95;34;131;158;95;95	ENSP00000380074:G158A;ENSP00000316596:G158A;ENSP00000437771:G158A;ENSP00000420934:G95A;ENSP00000397429:G34A;ENSP00000427335:G131A;ENSP00000423219:G158A;ENSP00000426413:G95A;ENSP00000424918:G95A	ENSP00000316596:G158A	G	-	2	0	SLC38A9	55000866	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.065000	0.76727	2.622000	0.88805	0.650000	0.86243	GGC	.	.	.	none		0.328	SLC38A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253912.2	NM_173514	
RASA1	5921	hgsc.bcm.edu	37	5	86665669	86665669	+	Silent	SNP	A	A	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr5:86665669A>G	ENST00000274376.6	+	12	2214	c.1650A>G	c.(1648-1650)gaA>gaG	p.E550E	RASA1_ENST00000456692.2_Silent_p.E373E|RASA1_ENST00000512763.1_Silent_p.E383E|RASA1_ENST00000506290.1_Silent_p.E384E	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	550	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ACTTTAGTGAAGAACATTACA	0.303																																					p.E550E		Atlas-SNP	.											.	RASA1	213	.	0			c.A1650G						PASS	.						67.0	66.0	67.0					5																	86665669		2203	4297	6500	SO:0001819	synonymous_variant	5921	exon12			TAGTGAAGAACAT		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1650A>G	chr5.hg19:g.86665669A>G		462.0	0.0	.		472.0	155.0	.	NM_002890	B2R6W3|Q9UDI1	Silent	SNP	ENST00000274376.6	hg19	CCDS34200.1																																																																																			.	.	.	none		0.303	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
SEMA6A	57556	hgsc.bcm.edu	37	5	115782689	115782689	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr5:115782689C>G	ENST00000343348.6	-	19	3500	c.2713G>C	c.(2713-2715)Gaa>Caa	p.E905Q	SEMA6A_ENST00000282394.6_Missense_Mutation_p.E382Q|SEMA6A_ENST00000510263.1_Missense_Mutation_p.E905Q|CTB-118N6.3_ENST00000512128.1_RNA|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000508424.1_RNA|SEMA6A_ENST00000257414.8_Missense_Mutation_p.E922Q|SEMA6A_ENST00000513137.1_Missense_Mutation_p.E332Q|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000503865.1_Missense_Mutation_p.E284Q|CTB-118N6.3_ENST00000508640.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	905					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		TGGTGCATTTCCAGCCGCTTG	0.602																																					p.E905Q		Atlas-SNP	.											.	SEMA6A	93	.	0			c.G2713C						PASS	.						67.0	75.0	72.0					5																	115782689		1955	4151	6106	SO:0001583	missense	57556	exon19			GCATTTCCAGCCG	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.2713G>C	chr5.hg19:g.115782689C>G	ENSP00000345512:p.Glu905Gln	72.0	0.0	.		72.0	26.0	.	NM_020796	Q9P2H9	Missense_Mutation	SNP	ENST00000343348.6	hg19	CCDS47256.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.01|16.01	3.000846|3.000846	0.54254|0.54254	.|.	.|.	ENSG00000092421|ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000513137;ENST00000282394;ENST00000503865;ENST00000510263|ENST00000515129	T;T;T;T;T;T|.	0.50813|.	2.14;2.16;0.73;2.57;0.75;2.14|.	5.22|5.22	5.22|5.22	0.72569|0.72569	.|.	0.531003|.	0.18032|.	N|.	0.153898|.	T|T	0.54870|0.54870	0.1885|0.1885	N|N	0.22421|0.22421	0.69|0.69	0.54753|0.54753	D|D	0.99998|0.99998	B;B;D;P;P;P|.	0.56746|.	0.241;0.376;0.977;0.592;0.856;0.787|.	B;B;P;P;P;P|.	0.52514|.	0.192;0.23;0.701;0.479;0.464;0.479|.	T|T	0.50406|0.50406	-0.8832|-0.8832	10|5	0.51188|.	T|.	0.08|.	.|.	18.3652|18.3652	0.90388|0.90388	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	284;905;449;922;382;332|.	E9PDV9;Q9H2E6;Q96SM8;Q9H2E6-2;E7ERF3;B3KU01|.	.;SEM6A_HUMAN;.;.;.;.|.	Q|C	905;922;332;382;284;905|419	ENSP00000345512:E905Q;ENSP00000257414:E922Q;ENSP00000422997:E332Q;ENSP00000282394:E382Q;ENSP00000425364:E284Q;ENSP00000424388:E905Q|.	ENSP00000257414:E922Q|.	E|W	-|-	1|3	0|0	SEMA6A|SEMA6A	115810588|115810588	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.881000|0.881000	0.50899|0.50899	7.443000|7.443000	0.80521|0.80521	2.436000|2.436000	0.82500|0.82500	0.563000|0.563000	0.77884|0.77884	GAA|TGG	.	.	.	none		0.602	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796	
DMXL1	1657	hgsc.bcm.edu	37	5	118480323	118480323	+	Silent	SNP	A	A	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr5:118480323A>G	ENST00000311085.8	+	15	2639	c.2559A>G	c.(2557-2559)ttA>ttG	p.L853L	DMXL1_ENST00000539542.1_Silent_p.L853L	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	853										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ACAGCATTTTATCTAATGCAG	0.323																																					p.L853L		Atlas-SNP	.											.	DMXL1	268	.	0			c.A2559G						PASS	.						87.0	96.0	93.0					5																	118480323		2201	4295	6496	SO:0001819	synonymous_variant	1657	exon15			CATTTTATCTAAT	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2559A>G	chr5.hg19:g.118480323A>G		283.0	0.0	.		328.0	108.0	.	NM_005509		Silent	SNP	ENST00000311085.8	hg19	CCDS4125.1																																																																																			.	.	.	none		0.323	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
PDE6A	5145	hgsc.bcm.edu	37	5	149279060	149279060	+	Missense_Mutation	SNP	T	T	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr5:149279060T>G	ENST00000255266.5	-	9	1260	c.1141A>C	c.(1141-1143)Atg>Ctg	p.M381L		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	381	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	TTTTTAATCATCCATCCAGAC	0.418																																					p.M381L		Atlas-SNP	.											.	PDE6A	98	.	0			c.A1141C						PASS	.						207.0	203.0	205.0					5																	149279060		2203	4300	6503	SO:0001583	missense	5145	exon9			TAATCATCCATCC		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.1141A>C	chr5.hg19:g.149279060T>G	ENSP00000255266:p.Met381Leu	85.0	0.0	.		116.0	40.0	.	NM_000440	Q0P638	Missense_Mutation	SNP	ENST00000255266.5	hg19	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	T	13.25	2.180514	0.38511	.	.	ENSG00000132915	ENST00000255266	T	0.66280	-0.2	5.49	3.1	0.35709	GAF (2);	0.390516	0.31041	N	0.008361	T	0.35364	0.0929	N	0.08118	0	0.38599	D	0.950611	B	0.02656	0.0	B	0.06405	0.002	T	0.10154	-1.0642	10	0.12430	T	0.62	.	8.5252	0.33300	0.0:0.1603:0.0:0.8397	.	381	P16499	PDE6A_HUMAN	L	381	ENSP00000255266:M381L	ENSP00000255266:M381L	M	-	1	0	PDE6A	149259253	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.207000	0.32333	0.472000	0.27344	0.533000	0.62120	ATG	.	.	.	none		0.418	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2		
RREB1	6239	hgsc.bcm.edu	37	6	7189549	7189549	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr6:7189549T>C	ENST00000349384.6	+	6	733	c.419T>C	c.(418-420)aTg>aCg	p.M140T	RREB1_ENST00000379933.3_Missense_Mutation_p.M140T|RREB1_ENST00000334984.6_Missense_Mutation_p.M140T|RREB1_ENST00000379938.2_Missense_Mutation_p.M140T|Y_RNA_ENST00000364613.1_RNA	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	140					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				AATGGGAACATGCACAGGTGG	0.592																																					p.M140T		Atlas-SNP	.											.	RREB1	242	.	0			c.T419C						PASS	.						62.0	49.0	53.0					6																	7189549		2203	4299	6502	SO:0001583	missense	6239	exon6			GGAACATGCACAG	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.419T>C	chr6.hg19:g.7189549T>C	ENSP00000305560:p.Met140Thr	48.0	0.0	.		58.0	17.0	.	NM_001003700	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	hg19	CCDS34336.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.508313	0.85282	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000471433;ENST00000349384;ENST00000334984;ENST00000483150	T;T;T;T;T;T	0.07800	3.16;3.16;3.16;3.16;3.16;3.16	5.65	5.65	0.86999	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.19805	0.0476	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.987;0.99;1.0	D;D;D	0.83275	0.961;0.962;0.996	T	0.00664	-1.1620	10	0.87932	D	0	-58.6326	15.8788	0.79185	0.0:0.0:0.0:1.0	.	140;140;140	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	T	140	ENSP00000369265:M140T;ENSP00000369270:M140T;ENSP00000420299:M140T;ENSP00000305560:M140T;ENSP00000335574:M140T;ENSP00000419511:M140T	ENSP00000335574:M140T	M	+	2	0	RREB1	7134548	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.449000	0.80643	2.155000	0.67459	0.482000	0.46254	ATG	.	.	.	none		0.592	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
ZBTB22	9278	hgsc.bcm.edu	37	6	33283498	33283498	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr6:33283498G>T	ENST00000431845.2	-	2	1347	c.1196C>A	c.(1195-1197)tCa>tAa	p.S399*	TAPBP_ENST00000426633.2_5'Flank|ZBTB22_ENST00000418724.1_Nonsense_Mutation_p.S399*|TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000489157.1_5'Flank|TAPBP_ENST00000434618.2_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	399					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						TGGCCCCCCTGAGTCATCAAG	0.617																																					p.S399X		Atlas-SNP	.											.	ZBTB22	48	.	0			c.C1196A						PASS	.						125.0	137.0	133.0					6																	33283498		2203	4300	6503	SO:0001587	stop_gained	9278	exon2			CCCCCTGAGTCAT	Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.1196C>A	chr6.hg19:g.33283498G>T	ENSP00000407545:p.Ser399*	64.0	0.0	.		66.0	22.0	.	NM_001145338	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Nonsense_Mutation	SNP	ENST00000431845.2	hg19	CCDS4775.1	.	.	.	.	.	.	.	.	.	.	G	31	5.089417	0.94149	.	.	ENSG00000236104	ENST00000418724;ENST00000431845	.	.	.	4.09	4.09	0.47781	.	0.318682	0.17604	N	0.168311	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8509	0.63496	0.0:0.0:1.0:0.0	.	.	.	.	X	399	.	ENSP00000404403:S399X	S	-	2	0	ZBTB22	33391476	0.736000	0.28164	0.670000	0.29842	0.909000	0.53808	2.389000	0.44407	2.107000	0.64212	0.448000	0.29417	TCA	.	.	.	none		0.617	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076183.2		
KIFC1	3833	hgsc.bcm.edu	37	6	33371727	33371727	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr6:33371727G>T	ENST00000428849.2	+	6	1027	c.577G>T	c.(577-579)Gcc>Tcc	p.A193S		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	193					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						GGGGCATTTAGCCAAGGTACA	0.607																																					p.A193S		Atlas-SNP	.											.	KIFC1	47	.	0			c.G577T						PASS	.						115.0	115.0	115.0					6																	33371727		2203	4300	6503	SO:0001583	missense	3833	exon6			CATTTAGCCAAGG	D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.577G>T	chr6.hg19:g.33371727G>T	ENSP00000393963:p.Ala193Ser	147.0	0.0	.		107.0	5.0	.	NM_002263	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	ENST00000428849.2	hg19	CCDS34430.1	.	.	.	.	.	.	.	.	.	.	G	0.208	-1.038804	0.02013	.	.	ENSG00000237649	ENST00000428849	T	0.77750	-1.12	5.17	-0.976	0.10286	.	0.591918	0.18780	N	0.131354	T	0.39306	0.1073	L	0.44542	1.39	0.09310	N	1	B;B	0.14012	0.009;0.005	B;B	0.08055	0.003;0.003	T	0.29305	-1.0016	10	0.12103	T	0.63	-18.0933	5.2986	0.15766	0.4038:0.0:0.4622:0.134	.	185;193	B4E063;Q9BW19	.;KIFC1_HUMAN	S	193	ENSP00000393963:A193S	ENSP00000393963:A193S	A	+	1	0	KIFC1	33479705	0.142000	0.22610	0.355000	0.25773	0.014000	0.08584	0.418000	0.21230	0.085000	0.17107	-0.251000	0.11542	GCC	.	.	.	none		0.607	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1	NM_002263	
UTRN	7402	hgsc.bcm.edu	37	6	144843189	144843189	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr6:144843189A>G	ENST00000367545.3	+	39	5615	c.5615A>G	c.(5614-5616)tAt>tGt	p.Y1872C		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1872					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CCTACAGATTATCTGGTTGAA	0.333																																					p.Y1872C		Atlas-SNP	.											.	UTRN	327	.	0			c.A5615G						PASS	.						132.0	139.0	136.0					6																	144843189		2203	4300	6503	SO:0001583	missense	7402	exon39			CAGATTATCTGGT	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.5615A>G	chr6.hg19:g.144843189A>G	ENSP00000356515:p.Tyr1872Cys	99.0	0.0	.		77.0	23.0	.	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	hg19	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.124519	0.77436	.	.	ENSG00000152818	ENST00000367545	T	0.68765	-0.35	5.7	5.7	0.88788	.	0.000000	0.49305	D	0.000155	T	0.77458	0.4133	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.81169	-0.1055	10	0.87932	D	0	.	15.9596	0.79918	1.0:0.0:0.0:0.0	.	1872	P46939	UTRO_HUMAN	C	1872	ENSP00000356515:Y1872C	ENSP00000356515:Y1872C	Y	+	2	0	UTRN	144884882	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	8.698000	0.91311	2.177000	0.69029	0.459000	0.35465	TAT	.	.	.	none		0.333	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
BRAT1	221927	hgsc.bcm.edu	37	7	2581812	2581812	+	Silent	SNP	G	G	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr7:2581812G>C	ENST00000340611.4	-	7	1213	c.957C>G	c.(955-957)gtC>gtG	p.V319V	BRAT1_ENST00000473879.1_5'Flank	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	319					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						GCTGGAGAAGGACCTGGAAGG	0.642																																					p.V319V		Atlas-SNP	.											.	BRAT1	57	.	0			c.C957G						PASS	.						31.0	27.0	28.0					7																	2581812		2171	4273	6444	SO:0001819	synonymous_variant	221927	exon7			GAGAAGGACCTGG	BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.957C>G	chr7.hg19:g.2581812G>C		223.0	0.0	.		268.0	132.0	.	NM_152743	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Silent	SNP	ENST00000340611.4	hg19	CCDS5334.1																																																																																			.	.	.	none		0.642	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743	
YAE1D1	57002	hgsc.bcm.edu	37	7	39610143	39610143	+	Silent	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr7:39610143T>C	ENST00000223273.2	+	2	211	c.168T>C	c.(166-168)gtT>gtC	p.V56V	YAE1D1_ENST00000448268.1_Silent_p.V56V|YAE1D1_ENST00000469737.1_3'UTR|YAE1D1_ENST00000432096.2_Silent_p.V56V	NM_020192.3	NP_064577.1	Q9NRH1	YAED1_HUMAN	Yae1 domain containing 1	56																	GCAAAGCAGTTACTCTTCAAC	0.363																																					p.V56V		Atlas-SNP	.											.	YAE1D1	2	.	0			c.T168C						PASS	.						133.0	136.0	135.0					7																	39610143		2203	4300	6503	SO:0001819	synonymous_variant	57002	exon2			AGCAGTTACTCTT	AF226046	CCDS5459.1, CCDS64630.1	7p14.1	2011-11-24	2011-11-24	2011-11-24	ENSG00000241127	ENSG00000241127			24857	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 36"""	C7orf36		12477932	Standard	NM_020192		Approved	GK003	uc003thc.4	Q9NRH1	OTTHUMG00000128689	ENST00000223273.2:c.168T>C	chr7.hg19:g.39610143T>C		146.0	0.0	.		140.0	64.0	.	NM_020192	A4D1W4|B4DE83|Q6IAF7|Q8WVZ5	Silent	SNP	ENST00000223273.2	hg19	CCDS5459.1																																																																																			.	.	.	none		0.363	YAE1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250586.1	NM_020192	
MBLAC1	255374	hgsc.bcm.edu	37	7	99725518	99725518	+	Missense_Mutation	SNP	C	C	G	rs35757966		TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr7:99725518C>G	ENST00000398075.2	+	2	899	c.500C>G	c.(499-501)cCg>cGg	p.P167R	RP11-506M12.1_ENST00000494221.1_RNA	NM_203397.1	NP_981942.1	A4D2B0	MBLC1_HUMAN	metallo-beta-lactamase domain containing 1	167							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	7						TGGGCCACGCCGGGCCACGGG	0.741																																					p.P167R		Atlas-SNP	.											.	MBLAC1	13	.	0			c.C500G						PASS	.						20.0	22.0	21.0					7																	99725518		1902	4006	5908	SO:0001583	missense	255374	exon2			CCACGCCGGGCCA	BC031288	CCDS43620.1	7q22	2014-02-12	2009-04-08		ENSG00000214309	ENSG00000214309			22180	protein-coding gene	gene with protein product							Standard	XM_005250250		Approved	MGC49416	uc003utp.3	A4D2B0	OTTHUMG00000154846	ENST00000398075.2:c.500C>G	chr7.hg19:g.99725518C>G	ENSP00000381150:p.Pro167Arg	97.0	0.0	.		89.0	44.0	.	NM_203397	Q8N5X8	Missense_Mutation	SNP	ENST00000398075.2	hg19	CCDS43620.1	.	.	.	.	.	.	.	.	.	.	C	30	5.055427	0.93793	.	.	ENSG00000214309	ENST00000398075	T	0.42513	0.97	4.68	4.68	0.58851	Beta-lactamase-like (2);	0.000000	0.56097	U	0.000031	T	0.67050	0.2852	M	0.82923	2.615	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.72865	-0.4163	10	0.87932	D	0	.	15.1263	0.72486	0.0:1.0:0.0:0.0	.	167	A4D2B0	MBLC1_HUMAN	R	167	ENSP00000381150:P167R	ENSP00000381150:P167R	P	+	2	0	MBLAC1	99563454	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.800000	0.75165	2.440000	0.82611	0.561000	0.74099	CCG	.	.	.	none		0.741	MBLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337353.1	NM_203397	
REPIN1	29803	hgsc.bcm.edu	37	7	150068585	150068585	+	Silent	SNP	G	G	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr7:150068585G>A	ENST00000425389.2	+	1	333	c.255G>A	c.(253-255)ttG>ttA	p.L85L	REPIN1_ENST00000540729.1_Silent_p.L85L|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000518514.1_Missense_Mutation_p.A134T|REPIN1_ENST00000444957.1_Silent_p.L85L|REPIN1_ENST00000489432.2_Silent_p.L142L|REPIN1_ENST00000482680.1_3'UTR|REPIN1_ENST00000518462.1_3'UTR|REPIN1_ENST00000397281.2_Silent_p.L85L	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	85					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			GGCTGCCCTTGCCCTGCCCTG	0.692																																					p.L142L		Atlas-SNP	.											.	REPIN1	74	.	0			c.G426A						PASS	.						16.0	19.0	18.0					7																	150068585		2106	4220	6326	SO:0001819	synonymous_variant	29803	exon3			GCCCTTGCCCTGC	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.255G>A	chr7.hg19:g.150068585G>A		54.0	0.0	.		60.0	33.0	.	NM_001099695	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Silent	SNP	ENST00000425389.2	hg19	CCDS43677.1	.	.	.	.	.	.	.	.	.	.	G	9.998	1.232626	0.22626	.	.	ENSG00000214022	ENST00000518514	.	.	.	5.54	2.6	0.31112	.	.	.	.	.	T	0.58892	0.2154	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59112	-0.7515	5	0.87932	D	0	-3.1465	3.7036	0.08391	0.2659:0.0:0.5615:0.1726	.	.	.	.	T	134	.	ENSP00000428129:A134T	A	+	1	0	REPIN1	149699518	0.000000	0.05858	0.992000	0.48379	0.829000	0.46940	-0.141000	0.10327	0.702000	0.31825	0.462000	0.41574	GCC	.	.	.	none		0.692	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	NM_014374	
INTS9	55756	hgsc.bcm.edu	37	8	28669861	28669861	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr8:28669861G>A	ENST00000521022.1	-	8	808	c.727C>T	c.(727-729)Ctt>Ttt	p.L243F	INTS9_ENST00000521777.1_Missense_Mutation_p.L219F|INTS9_ENST00000397363.4_Missense_Mutation_p.L137F|INTS9_ENST00000416984.2_Missense_Mutation_p.L222F	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	243					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		TGTGTGGTAAGCAAGGAGGAT	0.463																																					p.L243F		Atlas-SNP	.											.	INTS9	43	.	0			c.C727T						PASS	.						114.0	105.0	108.0					8																	28669861		2203	4300	6503	SO:0001583	missense	55756	exon8			TGGTAAGCAAGGA	BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.727C>T	chr8.hg19:g.28669861G>A	ENSP00000429065:p.Leu243Phe	108.0	0.0	.		100.0	32.0	.	NM_018250	B7Z560|B7Z6M5|O00224|Q8TB16	Missense_Mutation	SNP	ENST00000521022.1	hg19	CCDS34873.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.83|18.83	3.707284|3.707284	0.68615|0.68615	.|.	.|.	ENSG00000104299|ENSG00000104299	ENST00000524081|ENST00000521022;ENST00000416984;ENST00000541706;ENST00000521777;ENST00000397363	.|T;T;T;T	.|0.47869	.|0.83;0.84;0.83;0.83	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.41673|0.41673	0.1169|0.1169	L|L	0.41415|0.41415	1.275|1.275	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.28801	.|0.125;0.045;0.223	.|B;B;B	.|0.28553	.|0.091;0.049;0.059	T|T	0.22556|0.22556	-1.0213|-1.0213	5|10	.|0.12766	.|T	.|0.61	-18.4337|-18.4337	19.7483|19.7483	0.96259|0.96259	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|222;243;243	.|B7Z6M5;G3XAN1;Q9NV88	.|.;.;INT9_HUMAN	V|F	205|243;222;87;219;137	.|ENSP00000429065:L243F;ENSP00000398208:L222F;ENSP00000430943:L219F;ENSP00000380520:L137F	.|ENSP00000380520:L137F	A|L	-|-	2|1	0|0	INTS9|INTS9	28725780|28725780	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	9.701000|9.701000	0.98710|0.98710	2.779000|2.779000	0.95612|0.95612	0.655000|0.655000	0.94253|0.94253	GCT|CTT	.	.	.	none		0.463	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376846.1	NM_018250	
VCPIP1	80124	hgsc.bcm.edu	37	8	67546979	67546979	+	Silent	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr8:67546979T>C	ENST00000310421.4	-	3	3684	c.3426A>G	c.(3424-3426)gaA>gaG	p.E1142E		NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	1142					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			AACTCACAACTTCTGTTTTCC	0.423																																					p.E1142E	NSCLC(179;265 2915 6144 43644)	Atlas-SNP	.											.	VCPIP1	110	.	0			c.A3426G						PASS	.						97.0	96.0	96.0					8																	67546979		2203	4300	6503	SO:0001819	synonymous_variant	80124	exon3			CACAACTTCTGTT	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.3426A>G	chr8.hg19:g.67546979T>C		82.0	0.0	.		111.0	36.0	.	NM_025054	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Silent	SNP	ENST00000310421.4	hg19	CCDS6192.1																																																																																			.	.	.	none		0.423	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1		
ZFAND5	7763	hgsc.bcm.edu	37	9	74975669	74975669	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr9:74975669G>T	ENST00000237937.3	-	2	583	c.26C>A	c.(25-27)cCg>cAg	p.P9Q	ZFAND5_ENST00000343431.2_Missense_Mutation_p.P9Q|ZFAND5_ENST00000376962.5_Missense_Mutation_p.P9Q|ZFAND5_ENST00000376960.4_Missense_Mutation_p.P9Q|ZFAND5_ENST00000488164.1_5'UTR	NM_001102421.1|NM_001278243.1|NM_001278244.1|NM_001278245.1|NM_006007.2	NP_001095891.1|NP_001265172.1|NP_001265173.1|NP_001265174.1|NP_005998.1	O76080	ZFAN5_HUMAN	zinc finger, AN1-type domain 5	9					face development (GO:0060324)|fibroblast migration (GO:0010761)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|kidney(2)|lung(2)|prostate(1)	6						CATGGGCCCCGGGGTCTGGTT	0.403																																					p.P9Q		Atlas-SNP	.											.	ZFAND5	14	.	0			c.C26A						PASS	.						88.0	94.0	92.0					9																	74975669		2203	4297	6500	SO:0001583	missense	7763	exon2			GGCCCCGGGGTCT	AF062072	CCDS6642.1	9q13-q21	2008-05-02	2006-07-07	2006-07-07	ENSG00000107372	ENSG00000107372		"""Zinc fingers, AN1-type domain containing"""	13008	protein-coding gene	gene with protein product		604761	"""zinc finger protein 216"", ""zinc finger, A20 domain containing 2"""	ZNF216, ZA20D2		9758550	Standard	NM_001278243		Approved	ZFAND5A	uc004aiy.2	O76080	OTTHUMG00000020008	ENST00000237937.3:c.26C>A	chr9.hg19:g.74975669G>T	ENSP00000237937:p.Pro9Gln	95.0	0.0	.		65.0	14.0	.	NM_001102421	A8K484	Missense_Mutation	SNP	ENST00000237937.3	hg19	CCDS6642.1	.	.	.	.	.	.	.	.	.	.	G	3.765	-0.048781	0.07407	.	.	ENSG00000107372	ENST00000237937;ENST00000376960;ENST00000376962;ENST00000343431;ENST00000376956	.	.	.	5.89	5.89	0.94794	Zinc finger, A20-type (1);	.	.	.	.	T	0.18215	0.0437	N	0.00174	-1.93	0.80722	D	1	B	0.25904	0.137	B	0.26310	0.068	T	0.50874	-0.8776	8	0.02654	T	1	-5.8486	20.2561	0.98419	0.0:0.0:1.0:0.0	.	9	O76080	ZFAN5_HUMAN	Q	9;9;9;9;61	.	ENSP00000237937:P9Q	P	-	2	0	ZFAND5	74165489	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.483000	0.66838	2.797000	0.96272	0.563000	0.77884	CCG	.	.	.	none		0.403	ZFAND5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052644.1		
PCSK5	5125	hgsc.bcm.edu	37	9	78936460	78936460	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr9:78936460A>C	ENST00000545128.1	+	30	4464	c.3926A>C	c.(3925-3927)cAg>cCg	p.Q1309P		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1309	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GGAGTGTGCCAGGAAAACTGC	0.537																																					p.Q1309P		Atlas-SNP	.											.	PCSK5	329	.	0			c.A3926C						PASS	.						157.0	127.0	136.0					9																	78936460		876	1991	2867	SO:0001583	missense	5125	exon30			TGTGCCAGGAAAA		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.3926A>C	chr9.hg19:g.78936460A>C	ENSP00000446280:p.Gln1309Pro	63.0	0.0	.		79.0	33.0	.	NM_001190482	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	hg19	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	A	7.666	0.686044	0.14973	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.30182	1.54;1.57	5.54	-9.2	0.00682	.	1.414240	0.04434	N	0.369738	T	0.23014	0.0556	L	0.38175	1.15	0.09310	N	1	.	.	.	.	.	.	T	0.34725	-0.9817	8	0.41790	T	0.15	-0.711	7.0396	0.25013	0.5803:0.0:0.1515:0.2682	.	.	.	.	P	1309;1039;1009	ENSP00000446280:Q1309P;ENSP00000411654:Q1009P	ENSP00000365945:Q1039P	Q	+	2	0	PCSK5	78126280	0.000000	0.05858	0.000000	0.03702	0.477000	0.33069	-0.854000	0.04299	-1.754000	0.01321	0.459000	0.35465	CAG	.	.	.	none		0.537	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SVIL	6840	hgsc.bcm.edu	37	10	29760115	29760115	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr10:29760115T>C	ENST00000355867.4	-	31	6339	c.5587A>G	c.(5587-5589)Atg>Gtg	p.M1863V	PTCHD3P1_ENST00000414457.1_RNA|SVIL_ENST00000375398.2_Missense_Mutation_p.M1863V|PTCHD3P1_ENST00000423223.1_RNA|SVIL_ENST00000460007.1_5'Flank|SVIL_ENST00000375400.3_Missense_Mutation_p.M1437V|PTCHD3P1_ENST00000413405.1_RNA|PTCHD3P1_ENST00000455774.1_RNA|PTCHD3P1_ENST00000446807.1_RNA|SVIL_ENST00000535393.1_Missense_Mutation_p.M777V	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1863					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TGCACCACCATCCCCCCCTGG	0.527																																					p.M1863V		Atlas-SNP	.											.,1	SVIL	226	.	0			c.A5587G						PASS	.						77.0	63.0	68.0					10																	29760115		2203	4300	6503	SO:0001583	missense	6840	exon31			CCACCATCCCCCC	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.5587A>G	chr10.hg19:g.29760115T>C	ENSP00000348128:p.Met1863Val	198.0	2.0	.		150.0	42.0	.	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	hg19	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.800002	0.90538	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.60090	0.2242	M	0.73598	2.24	0.80722	D	1	P;P;D	0.55605	0.875;0.72;0.972	P;P;P	0.55222	0.771;0.692;0.616	T	0.64676	-0.6351	10	0.87932	D	0	-31.3148	16.5582	0.84512	0.0:0.0:0.0:1.0	.	777;1437;1863	F5H2Q5;O95425-2;O95425	.;.;SVIL_HUMAN	V	1437;1863;1863;777	ENSP00000364549:M1437V;ENSP00000364547:M1863V;ENSP00000348128:M1863V;ENSP00000445472:M777V	ENSP00000348128:M1863V	M	-	1	0	SVIL	29800121	1.000000	0.71417	0.969000	0.41365	0.958000	0.62258	7.901000	0.87382	2.308000	0.77769	0.533000	0.62120	ATG	.	.	.	none		0.527	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
ABCC2	1244	hgsc.bcm.edu	37	10	101595920	101595920	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr10:101595920T>C	ENST00000370449.4	+	25	3600	c.3487T>C	c.(3487-3489)Ttc>Ctc	p.F1163L		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1163	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CTACTCTCACTTCAGCGAGAC	0.493																																					p.F1163L		Atlas-SNP	.											.	ABCC2	160	.	0			c.T3487C						PASS	.						149.0	135.0	140.0					10																	101595920		2203	4300	6503	SO:0001583	missense	1244	exon25			TCTCACTTCAGCG	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3487T>C	chr10.hg19:g.101595920T>C	ENSP00000359478:p.Phe1163Leu	198.0	0.0	.		179.0	58.0	.	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	hg19	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	T	34	5.351795	0.95830	.	.	ENSG00000023839	ENST00000370449	D	0.88277	-2.36	5.78	5.78	0.91487	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.94368	0.8189	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94944	0.8094	10	0.87932	D	0	-9.1981	16.1127	0.81273	0.0:0.0:0.0:1.0	.	1163	Q92887	MRP2_HUMAN	L	1163	ENSP00000359478:F1163L	ENSP00000359478:F1163L	F	+	1	0	ABCC2	101585910	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	8.037000	0.88933	2.212000	0.71576	0.260000	0.18958	TTC	.	.	.	none		0.493	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
POLL	27343	hgsc.bcm.edu	37	10	103343263	103343263	+	Splice_Site	SNP	A	A	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr10:103343263A>C	ENST00000370162.3	-	6	1560		c.e6+1		POLL_ENST00000463515.1_5'Flank|POLL_ENST00000436284.2_3'UTR|DPCD_ENST00000416979.2_Intron|POLL_ENST00000299206.4_Splice_Site|POLL_ENST00000370158.3_Splice_Site|DPCD_ENST00000470165.1_Intron|POLL_ENST00000370169.1_Splice_Site|POLL_ENST00000456836.2_Splice_Site|POLL_ENST00000339310.3_Splice_Site|POLL_ENST00000370168.3_5'Flank|POLL_ENST00000370172.1_Splice_Site	NM_001174084.1|NM_001174085.1|NM_013274.3	NP_001167555.1|NP_001167556.1|NP_037406.1	Q9UGP5	DPOLL_HUMAN	polymerase (DNA directed), lambda						DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|nucleotide-excision repair (GO:0006289)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		CCAGGGTGTGACCTGTTGGTA	0.567								DNA polymerases (catalytic subunits)																													.		Atlas-SNP	.											.	POLL	43	.	0			c.789+2T>G						PASS	.						102.0	85.0	90.0					10																	103343263		2203	4300	6503	SO:0001630	splice_region_variant	27343	exon7			GGTGTGACCTGTT	AF161019	CCDS7513.1	10q23	2012-05-18			ENSG00000166169	ENSG00000166169		"""DNA polymerases"""	9184	protein-coding gene	gene with protein product		606343				17686665	Standard	NM_001174084		Approved		uc001kti.2	Q9UGP5	OTTHUMG00000018933	ENST00000370162.3:c.1065+1T>G	chr10.hg19:g.103343263A>C		54.0	0.0	.		50.0	12.0	.	NM_001174085	D3DR76|Q5JQP5|Q6NUM2|Q9BTN8|Q9HA10|Q9HB35	Splice_Site	SNP	ENST00000370162.3	hg19	CCDS7513.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.158773	0.78226	.	.	ENSG00000166169	ENST00000299206;ENST00000370174;ENST00000370169;ENST00000339310;ENST00000370172;ENST00000370162;ENST00000370158;ENST00000370157;ENST00000456836;ENST00000415897;ENST00000429502	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2147	0.82198	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	POLL	103333253	1.000000	0.71417	0.994000	0.49952	0.842000	0.47809	8.908000	0.92640	2.231000	0.72958	0.460000	0.39030	.	.	.	.	none		0.567	POLL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049946.1	NM_013274	Intron
PPP6R3	55291	hgsc.bcm.edu	37	11	68305152	68305152	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr11:68305152T>C	ENST00000393800.2	+	3	274	c.20T>C	c.(19-21)cTt>cCt	p.L7P	PPP6R3_ENST00000393801.3_Missense_Mutation_p.L7P|PPP6R3_ENST00000524904.1_Missense_Mutation_p.L7P|PPP6R3_ENST00000265637.4_Missense_Mutation_p.L7P|PPP6R3_ENST00000524845.1_Missense_Mutation_p.L7P|PPP6R3_ENST00000393799.2_Missense_Mutation_p.L7P|PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000265636.5_Missense_Mutation_p.L7P|PPP6R3_ENST00000529710.1_Missense_Mutation_p.L7P|PPP6R3_ENST00000527403.2_Missense_Mutation_p.L7P	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	7					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AAATTTGATCTTCACTCATCA	0.318																																					p.L7P		Atlas-SNP	.											.	PPP6R3	159	.	0			c.T20C						PASS	.						86.0	77.0	80.0					11																	68305152		2200	4294	6494	SO:0001583	missense	55291	exon3			TTGATCTTCACTC	AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.20T>C	chr11.hg19:g.68305152T>C	ENSP00000377389:p.Leu7Pro	207.0	0.0	.		236.0	60.0	.	NM_001164162	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	ENST00000393800.2	hg19	CCDS53672.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.301170	0.81136	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000528635;ENST00000533127;ENST00000529344;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000531244	T;T;T;T;T;T;T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.76744	0.4030	M	0.90814	3.15	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.998;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.993;0.987;0.997;0.984;1.0;0.997	T	0.82232	-0.0559	9	.	.	.	.	14.3003	0.66341	0.0:0.0:0.0:1.0	.	7;7;7;7;7;7	Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;PP6R3_HUMAN;.;.	P	7	ENSP00000377388:L7P;ENSP00000377389:L7P;ENSP00000433768:L7P;ENSP00000433551:L7P;ENSP00000431415:L7P;ENSP00000265637:L7P;ENSP00000433058:L7P;ENSP00000377390:L7P;ENSP00000265636:L7P;ENSP00000437329:L7P;ENSP00000433565:L7P;ENSP00000432837:L7P	.	L	+	2	0	PPP6R3	68061728	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.774000	0.85478	1.973000	0.57446	0.455000	0.32223	CTT	.	.	.	none		0.318	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395275.1	NM_018312	
DDX25	29118	hgsc.bcm.edu	37	11	125787115	125787115	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr11:125787115T>A	ENST00000263576.6	+	9	1162	c.1007T>A	c.(1006-1008)aTc>aAc	p.I336N	RP11-680F20.9_ENST00000533033.2_RNA|DDX25_ENST00000525943.1_3'UTR	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	336	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		TATGGCAGCATCACCATTGGT	0.502																																					p.I336N		Atlas-SNP	.											.	DDX25	65	.	0			c.T1007A						PASS	.						38.0	37.0	38.0					11																	125787115		2128	4248	6376	SO:0001583	missense	29118	exon9			GCAGCATCACCAT	AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.1007T>A	chr11.hg19:g.125787115T>A	ENSP00000263576:p.Ile336Asn	46.0	0.0	.		58.0	14.0	.	NM_013264	B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	Missense_Mutation	SNP	ENST00000263576.6	hg19	CCDS44766.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.618207	0.46736	.	.	ENSG00000109832	ENST00000525943;ENST00000263576;ENST00000526875	T	0.04917	3.53	5.89	5.89	0.94794	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.13713	0.0332	L	0.28694	0.88	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.58928	0.848;0.848	T	0.01030	-1.1475	10	0.87932	D	0	-23.2211	15.9893	0.80188	0.0:0.0:0.0:1.0	.	336;336	B4DHI6;Q9UHL0	.;DDX25_HUMAN	N	222;336;202	ENSP00000263576:I336N	ENSP00000263576:I336N	I	+	2	0	DDX25	125292325	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.621000	0.83083	2.254000	0.74563	0.533000	0.62120	ATC	.	.	.	none		0.502	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386736.3	NM_013264	
SLC6A13	6540	hgsc.bcm.edu	37	12	369149	369149	+	Missense_Mutation	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr12:369149T>C	ENST00000343164.4	-	2	122	c.70A>G	c.(70-72)Aag>Gag	p.K24E	SLC6A13_ENST00000445055.2_Missense_Mutation_p.K24E|RP11-283I3.4_ENST00000540868.1_RNA|SLC6A13_ENST00000436453.1_Missense_Mutation_p.K24E	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	24				Missing (in Ref. 1; AAF64247). {ECO:0000305}.	neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			TCTTCCTCCTTCTTTTCCATG	0.522																																					p.K24E		Atlas-SNP	.											.	SLC6A13	62	.	0			c.A70G						PASS	.						237.0	218.0	224.0					12																	369149		2203	4300	6503	SO:0001583	missense	6540	exon2			CCTCCTTCTTTTC	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.70A>G	chr12.hg19:g.369149T>C	ENSP00000339260:p.Lys24Glu	94.0	0.0	.		153.0	79.0	.	NM_016615	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	hg19	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.687081	0.00738	.	.	ENSG00000010379	ENST00000445055;ENST00000343164;ENST00000546319;ENST00000436453	T;T;T;T	0.73363	-0.7;-0.74;0.13;0.46	5.94	1.65	0.23941	.	1.192160	0.05617	N	0.579148	T	0.49423	0.1556	N	0.03608	-0.345	0.19775	N	0.999955	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.30060	-0.9991	10	0.05351	T	0.99	.	10.5688	0.45188	0.0:0.6942:0.0:0.3058	.	24;24;24	B4DJL1;Q8WW56;Q9NSD5	.;.;S6A13_HUMAN	E	24	ENSP00000407104:K24E;ENSP00000339260:K24E;ENSP00000444606:K24E;ENSP00000389316:K24E	ENSP00000339260:K24E	K	-	1	0	SLC6A13	239410	0.712000	0.27916	0.864000	0.33941	0.053000	0.15095	0.179000	0.16840	-0.052000	0.13311	-2.020000	0.00432	AAG	.	.	.	none		0.522	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
LTBR	4055	hgsc.bcm.edu	37	12	6494235	6494235	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr12:6494235G>A	ENST00000228918.4	+	3	567	c.241G>A	c.(241-243)Gcc>Acc	p.A81T	LTBR_ENST00000546296.1_3'UTR|LTBR_ENST00000543190.1_5'UTR|LTBR_ENST00000539925.1_Missense_Mutation_p.A62T|LTBR_ENST00000541102.1_5'Flank	NM_002342.2	NP_002333.1	P36941	TNR3_HUMAN	lymphotoxin beta receptor (TNFR superfamily, member 3)	81					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15						CACAGTTTGTGCCACATGTGC	0.587																																					p.A81T		Atlas-SNP	.											.	LTBR	30	.	0			c.G241A						PASS	.						139.0	128.0	132.0					12																	6494235		2203	4300	6503	SO:0001583	missense	4055	exon3			GTTTGTGCCACAT	L04270	CCDS8544.1, CCDS59233.1	12p13	2013-05-22				ENSG00000111321		"""Tumor necrosis factor receptor superfamily"""	6718	protein-coding gene	gene with protein product		600979		D12S370		8171323, 8486360	Standard	NM_002342		Approved	TNFCR, TNFR-RP, TNFR2-RP, TNF-R-III, TNFRSF3	uc001qny.2	P36941		ENST00000228918.4:c.241G>A	chr12.hg19:g.6494235G>A	ENSP00000228918:p.Ala81Thr	64.0	0.0	.		80.0	18.0	.	NM_002342	B7Z1D2|D3DUR2|F5GXE7	Missense_Mutation	SNP	ENST00000228918.4	hg19	CCDS8544.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.624615	0.28889	.	.	ENSG00000111321	ENST00000539925;ENST00000228918;ENST00000536876	T;T;T	0.69685	-0.42;-0.42;-0.42	4.64	-3.91	0.04168	.	0.671765	0.13866	N	0.357310	T	0.44371	0.1290	L	0.37561	1.115	0.20926	N	0.99983	B;B;B	0.24721	0.11;0.027;0.024	B;B;B	0.17433	0.018;0.006;0.005	T	0.25152	-1.0140	10	0.19147	T	0.46	0.0217	4.8169	0.13371	0.4152:0.0:0.3823:0.2026	.	62;62;81	F5GXE7;B7Z1D2;P36941	.;.;TNR3_HUMAN	T	62;81;76	ENSP00000440875:A62T;ENSP00000228918:A81T;ENSP00000437647:A76T	ENSP00000228918:A81T	A	+	1	0	LTBR	6364496	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-1.019000	0.03622	-0.623000	0.05618	-0.367000	0.07326	GCC	.	.	.	none		0.587	LTBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399422.1		
PEX5	5830	hgsc.bcm.edu	37	12	7351609	7351609	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr12:7351609C>A	ENST00000455147.2	+	7	1031	c.451C>A	c.(451-453)Ccc>Acc	p.P151T	PEX5_ENST00000266563.5_Missense_Mutation_p.P151T|PEX5_ENST00000420616.2_Missense_Mutation_p.P151T|PEX5_ENST00000266564.3_Missense_Mutation_p.P151T|PEX5_ENST00000412720.2_Missense_Mutation_p.P172T|PEX5_ENST00000545220.1_Intron|PEX5_ENST00000434354.2_Missense_Mutation_p.P166T	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5	151					cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						CCTTGCAGACCCCTTGTCTGT	0.542																																					p.P166T		Atlas-SNP	.											.	PEX5	63	.	0			c.C496A						PASS	.						67.0	60.0	62.0					12																	7351609		2203	4300	6503	SO:0001583	missense	5830	exon6			GCAGACCCCTTGT	U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.451C>A	chr12.hg19:g.7351609C>A	ENSP00000400647:p.Pro151Thr	62.0	0.0	.		83.0	38.0	.	NM_001131023	A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	Missense_Mutation	SNP	ENST00000455147.2	hg19	CCDS44823.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.504553	0.44558	.	.	ENSG00000139197	ENST00000536883;ENST00000542539;ENST00000455147;ENST00000266563;ENST00000543974;ENST00000434354;ENST00000545574;ENST00000420616;ENST00000412720;ENST00000396637;ENST00000266564;ENST00000545845	D;D;D;D;D;D;D	0.88201	-2.3;-2.35;-2.32;-2.3;-2.32;-2.18;-2.32	5.91	4.99	0.66335	.	0.149257	0.45606	D	0.000347	D	0.85008	0.5599	L	0.33485	1.01	0.58432	D	0.999999	P;B;B;B;B	0.48407	0.91;0.073;0.205;0.307;0.138	P;B;B;B;B	0.45099	0.469;0.028;0.032;0.069;0.023	D	0.83524	0.0087	10	0.31617	T	0.26	.	14.2253	0.65855	0.0:0.9262:0.0:0.0738	.	172;166;151;151;151	B4E0T2;B4DZ45;P50542;P50542-3;P50542-2	.;.;PEX5_HUMAN;.;.	T	68;151;151;151;68;166;139;151;172;166;151;68	ENSP00000400647:P151T;ENSP00000266563:P151T;ENSP00000407401:P166T;ENSP00000410159:P151T;ENSP00000391601:P172T;ENSP00000379877:P166T;ENSP00000266564:P151T	ENSP00000266563:P151T	P	+	1	0	PEX5	7242876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.918000	0.63376	1.434000	0.47414	0.655000	0.94253	CCC	.	.	.	none		0.542	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398611.1	NM_000319	
SUOX	6821	hgsc.bcm.edu	37	12	56397604	56397604	+	Missense_Mutation	SNP	A	A	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr12:56397604A>T	ENST00000394109.3	+	3	1155	c.431A>T	c.(430-432)aAc>aTc	p.N144I	SUOX_ENST00000550478.1_3'UTR|SUOX_ENST00000548274.1_Missense_Mutation_p.N144I|SUOX_ENST00000394115.2_Missense_Mutation_p.N144I|SUOX_ENST00000266971.3_Missense_Mutation_p.N144I|SUOX_ENST00000551841.2_Intron|SUOX_ENST00000356124.4_Missense_Mutation_p.N144I			P51687	SUOX_HUMAN	sulfite oxidase	144	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			GCTGTTCACAACCAGTCCCAT	0.557																																					p.N144I		Atlas-SNP	.											.	SUOX	33	.	0			c.A431T						PASS	.						99.0	97.0	97.0					12																	56397604		2203	4300	6503	SO:0001583	missense	6821	exon6			TTCACAACCAGTC	BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.431A>T	chr12.hg19:g.56397604A>T	ENSP00000377668:p.Asn144Ile	161.0	0.0	.		180.0	74.0	.	NM_000456		Missense_Mutation	SNP	ENST00000394109.3	hg19	CCDS8901.2	.	.	.	.	.	.	.	.	.	.	A	15.77	2.932930	0.52866	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000548274;ENST00000546833;ENST00000394109	T;T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43;-1.43	4.46	2.08	0.27032	Cytochrome b5 (4);	0.103271	0.64402	D	0.000005	T	0.79924	0.4530	M	0.68317	2.08	0.45403	D	0.99838	B	0.32526	0.374	B	0.42593	0.392	T	0.74228	-0.3733	10	0.40728	T	0.16	-6.0079	8.0486	0.30564	0.8148:0.0:0.1852:0.0	.	144	P51687	SUOX_HUMAN	I	144	ENSP00000348440:N144I;ENSP00000266971:N144I;ENSP00000377674:N144I;ENSP00000450245:N144I;ENSP00000449872:N144I;ENSP00000377668:N144I	ENSP00000266971:N144I	N	+	2	0	SUOX	54683871	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.061000	0.49963	0.463000	0.27118	0.533000	0.62120	AAC	.	.	.	none		0.557	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250309.1	NM_000456	
RAB21	23011	hgsc.bcm.edu	37	12	72167772	72167772	+	Silent	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr12:72167772T>C	ENST00000261263.3	+	4	617	c.361T>C	c.(361-363)Ttg>Ctg	p.L121L		NM_014999.2	NP_055814.1	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	121					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)	6						ACGGAAAATGTTGGGAAATGA	0.294																																					p.L121L		Atlas-SNP	.											.	RAB21	17	.	0			c.T361C						PASS	.						75.0	80.0	78.0					12																	72167772		2203	4294	6497	SO:0001819	synonymous_variant	23011	exon4			AAAATGTTGGGAA	AF091035	CCDS9003.1	12q21.1	2014-09-04			ENSG00000080371	ENSG00000080371		"""RAB, member RAS oncogene"""	18263	protein-coding gene	gene with protein product		612398				10887961, 11697911, 16754960	Standard	NM_014999		Approved	KIAA0118	uc001swt.3	Q9UL25	OTTHUMG00000169572	ENST00000261263.3:c.361T>C	chr12.hg19:g.72167772T>C		132.0	0.0	.		147.0	75.0	.	NM_014999	Q14466|Q569H3	Silent	SNP	ENST00000261263.3	hg19	CCDS9003.1																																																																																			.	.	.	none		0.294	RAB21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404855.1		
NAP1L1	4673	hgsc.bcm.edu	37	12	76462722	76462722	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr12:76462722C>A	ENST00000261182.8	-	3	556	c.70G>T	c.(70-72)Gaa>Taa	p.E24*	NAP1L1_ENST00000544816.1_Intron|NAP1L1_ENST00000393263.3_Nonsense_Mutation_p.E24*|NAP1L1_ENST00000542344.1_Intron|NAP1L1_ENST00000431879.3_5'UTR|NAP1L1_ENST00000535020.2_Nonsense_Mutation_p.E24*|NAP1L1_ENST00000549596.1_Nonsense_Mutation_p.E24*|NAP1L1_ENST00000547773.1_Intron|NAP1L1_ENST00000548044.1_5'UTR|NAP1L1_ENST00000552342.1_Nonsense_Mutation_p.E24*	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	24	Asp/Glu-rich (acidic).				DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				GTTTCCTCTTCTTCTACTTCT	0.358																																					p.E24X		Atlas-SNP	.											.	NAP1L1	33	.	0			c.G70T						PASS	.						215.0	212.0	213.0					12																	76462722		2203	4300	6503	SO:0001587	stop_gained	4673	exon3			CCTCTTCTTCTAC		CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.70G>T	chr12.hg19:g.76462722C>A	ENSP00000261182:p.Glu24*	80.0	0.0	.		93.0	42.0	.	NM_004537	B3KNT8	Nonsense_Mutation	SNP	ENST00000261182.8	hg19	CCDS9013.1	.	.	.	.	.	.	.	.	.	.	C	38	6.800209	0.97849	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000535020;ENST00000549596;ENST00000552342;ENST00000550934;ENST00000551992;ENST00000551600;ENST00000547704;ENST00000547479	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	19.7353	0.96200	0.0:1.0:0.0:0.0	.	.	.	.	X	24;18;24;24;24;24;24;24;24;24;24	.	ENSP00000261182:E24X	E	-	1	0	NAP1L1	74748989	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.979000	0.70508	2.743000	0.94032	0.655000	0.94253	GAA	.	.	.	none		0.358	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405850.3	NM_139207	
MED13L	23389	hgsc.bcm.edu	37	12	116453057	116453057	+	Silent	SNP	A	A	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr12:116453057A>G	ENST00000281928.3	-	8	1238	c.1032T>C	c.(1030-1032)agT>agC	p.S344S		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	344						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GACTGGCAGCACTCTGCATAC	0.428																																					p.S344S		Atlas-SNP	.											.	MED13L	193	.	0			c.T1032C						PASS	.						148.0	132.0	137.0					12																	116453057		2203	4300	6503	SO:0001819	synonymous_variant	23389	exon8			GGCAGCACTCTGC	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.1032T>C	chr12.hg19:g.116453057A>G		106.0	0.0	.		153.0	68.0	.	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Silent	SNP	ENST00000281928.3	hg19	CCDS9177.1																																																																																			.	.	.	none		0.428	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
PXN	5829	hgsc.bcm.edu	37	12	120660781	120660781	+	Silent	SNP	T	T	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr12:120660781T>G	ENST00000228307.7	-	4	519	c.378A>C	c.(376-378)tcA>tcC	p.S126S	PXN_ENST00000267257.7_Silent_p.S126S|PXN_ENST00000538144.1_5'UTR|PXN_ENST00000424649.2_Silent_p.S126S|PXN_ENST00000536957.1_Silent_p.S124S|PXN_ENST00000458477.2_5'UTR	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	126					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAGGCTCAGCTGATTTCTGCT	0.532																																					p.S126S		Atlas-SNP	.											.	PXN	69	.	0			c.A378C						PASS	.						104.0	106.0	105.0					12																	120660781		2035	4186	6221	SO:0001819	synonymous_variant	5829	exon4			CTCAGCTGATTTC	U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.378A>C	chr12.hg19:g.120660781T>G		125.0	0.0	.		163.0	43.0	.	NM_001080855	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Silent	SNP	ENST00000228307.7	hg19	CCDS44997.1																																																																																			.	.	.	none		0.532	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402679.4	NM_002859	
LTK	4058	hgsc.bcm.edu	37	15	41804906	41804906	+	Splice_Site	SNP	G	G	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr15:41804906G>A	ENST00000263800.6	-	3	454	c.358C>T	c.(358-360)Ctg>Ttg	p.L120L	LTK_ENST00000355166.5_Splice_Site_p.L120L|LTK_ENST00000561619.1_Intron|LTK_ENST00000453182.2_Splice_Site_p.L120L	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	120					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TGCACTTACAGATACTGGCCA	0.667										TSP Lung(18;0.14)																											p.L120L		Atlas-SNP	.											LTK_ENST00000263800,NS,carcinoma,0,2	LTK	117	.	0			c.C358T						PASS	.						11.0	12.0	11.0					15																	41804906		2183	4252	6435	SO:0001630	splice_region_variant	4058	exon3			CTTACAGATACTG	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.359+1C>T	chr15.hg19:g.41804906G>A		62.0	0.0	.		44.0	14.0	.	NM_001135685	A6NNJ8|B4DL89|E9PFX4	Silent	SNP	ENST00000263800.6	hg19	CCDS10077.1																																																																																			.	.	.	none		0.667	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		Silent
ZNF598	90850	hgsc.bcm.edu	37	16	2053710	2053710	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr16:2053710A>G	ENST00000563630.1	-	2	319	c.77T>C	c.(76-78)cTt>cCt	p.L26P	ZNF598_ENST00000562103.1_Missense_Mutation_p.L26P|ZNF598_ENST00000431526.1_Missense_Mutation_p.L81P			Q86UK7	ZN598_HUMAN	zinc finger protein 598	81							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						AAAGGCAGGAAGCTTCTTCCC	0.537											OREG0023548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L81P		Atlas-SNP	.											.	ZNF598	55	.	0			c.T242C						PASS	.						97.0	103.0	101.0					16																	2053710		2078	4219	6297	SO:0001583	missense	90850	exon4			GCAGGAAGCTTCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.77T>C	chr16.hg19:g.2053710A>G	ENSP00000455882:p.Leu26Pro	119.0	0.0	.	600	90.0	28.0	.	NM_178167	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000563630.1	hg19		.	.	.	.	.	.	.	.	.	.	.	14.36	2.511915	0.44660	.	.	ENSG00000167962	ENST00000431526	T	0.28255	1.62	5.05	5.05	0.67936	.	0.145740	0.48767	D	0.000168	T	0.19446	0.0467	N	0.16708	0.43	0.80722	D	1	P	0.37500	0.597	B	0.34873	0.191	T	0.05750	-1.0866	10	0.30854	T	0.27	-18.4695	13.9561	0.64150	1.0:0.0:0.0:0.0	.	81	Q86UK7	ZN598_HUMAN	P	81	ENSP00000411409:L81P	ENSP00000411409:L81P	L	-	2	0	ZNF598	1993711	1.000000	0.71417	0.990000	0.47175	0.934000	0.57294	5.859000	0.69539	1.911000	0.55334	0.402000	0.26972	CTT	.	.	.	none		0.537	ZNF598-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000434439.1	NM_178167	
NAGPA	51172	hgsc.bcm.edu	37	16	5075564	5075564	+	Missense_Mutation	SNP	T	T	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr16:5075564T>A	ENST00000312251.3	-	10	1482	c.1463A>T	c.(1462-1464)tAc>tTc	p.Y488F	RP11-165E7.1_ENST00000588778.1_RNA|NAGPA_ENST00000381955.3_Missense_Mutation_p.Y454F	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	488					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)			endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	CAGCGGGTGGTATGCATAGTC	0.637																																					p.Y488F		Atlas-SNP	.											.	NAGPA	30	.	0			c.A1463T						PASS	.						67.0	75.0	72.0					16																	5075564		2197	4300	6497	SO:0001583	missense	51172	exon10			GGGTGGTATGCAT	AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.1463A>T	chr16.hg19:g.5075564T>A	ENSP00000310998:p.Tyr488Phe	99.0	0.0	.		122.0	56.0	.	NM_016256	B2RAS1|Q96EJ8	Missense_Mutation	SNP	ENST00000312251.3	hg19	CCDS10527.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311544	0.60414	.	.	ENSG00000103174	ENST00000312251;ENST00000381955	T;T	0.52057	2.2;0.68	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.66386	0.2784	M	0.72894	2.215	0.38705	D	0.953078	D;D	0.76494	0.999;0.996	D;D	0.78314	0.991;0.99	T	0.72669	-0.4223	10	0.72032	D	0.01	-43.9859	12.7796	0.57469	0.0:0.0:0.0:1.0	.	488;454	Q9UK23;Q9UK23-2	NAGPA_HUMAN;.	F	488;454	ENSP00000310998:Y488F;ENSP00000371381:Y454F	ENSP00000310998:Y488F	Y	-	2	0	NAGPA	5015565	1.000000	0.71417	0.996000	0.52242	0.066000	0.16364	3.790000	0.55461	1.962000	0.57031	0.459000	0.35465	TAC	.	.	.	none		0.637	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207003.1	NM_016256	
ATP2A1	487	hgsc.bcm.edu	37	16	28914368	28914368	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr16:28914368C>T	ENST00000357084.3	+	20	3029	c.2762C>T	c.(2761-2763)tCc>tTc	p.S921F	ATP2A1_ENST00000536376.1_Missense_Mutation_p.S796F|ATP2A1_ENST00000395503.4_Missense_Mutation_p.S921F	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	921					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						GAGAACCAGTCCCTGCTGCGG	0.632																																					p.S921F		Atlas-SNP	.											.	ATP2A1	116	.	0			c.C2762T						PASS	.						101.0	82.0	89.0					16																	28914368		2197	4300	6497	SO:0001583	missense	487	exon20			ACCAGTCCCTGCT		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2762C>T	chr16.hg19:g.28914368C>T	ENSP00000349595:p.Ser921Phe	35.0	0.0	.		59.0	17.0	.	NM_004320	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	hg19	CCDS10643.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542099	0.85917	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000536376	D;D;D	0.90261	-2.64;-2.64;-2.52	4.74	4.74	0.60224	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97117	0.9058	H	0.97291	3.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.997	D	0.98541	1.0632	10	0.87932	D	0	.	16.6475	0.85180	0.0:1.0:0.0:0.0	.	796;921;921	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	F	921;921;796	ENSP00000349595:S921F;ENSP00000378879:S921F;ENSP00000443101:S796F	ENSP00000349595:S921F	S	+	2	0	ATP2A1	28821869	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.608000	0.82898	2.456000	0.83038	0.561000	0.74099	TCC	.	.	.	none		0.632	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	
OR1E2	8388	hgsc.bcm.edu	37	17	3336754	3336754	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr17:3336754A>G	ENST00000248384.1	-	1	381	c.382T>C	c.(382-384)Ttc>Ctc	p.F128L		NM_003554.1	NP_003545.1	P47887	OR1E2_HUMAN	olfactory receptor, family 1, subfamily E, member 2	128					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)			endometrium(3)|large_intestine(3)|lung(3)	9						TGCATGGGGAAGCAGATGGCC	0.557																																					p.F128L		Atlas-SNP	.											.	OR1E2	25	.	0			c.T382C						PASS	.						98.0	80.0	86.0					17																	3336754		2203	4300	6503	SO:0001583	missense	8388	exon1			TGGGGAAGCAGAT	U04686	CCDS11026.1	17p13.3	2012-08-09			ENSG00000127780	ENSG00000127780		"""GPCR / Class A : Olfactory receptors"""	8190	protein-coding gene	gene with protein product				OR1E4		8004088, 9500546	Standard	NM_003554		Approved	OR17-93, OR17-135	uc010vre.2	P47887	OTTHUMG00000090651	ENST00000248384.1:c.382T>C	chr17.hg19:g.3336754A>G	ENSP00000248384:p.Phe128Leu	149.0	0.0	.		195.0	86.0	.	NM_003554	O43877|O95632|Q0VAD5|Q0VAD6|Q9UL13	Missense_Mutation	SNP	ENST00000248384.1	hg19	CCDS11026.1	.	.	.	.	.	.	.	.	.	.	-	13.49	2.253554	0.39797	.	.	ENSG00000127780	ENST00000248384;ENST00000454364	T	0.00388	7.59	5.47	1.98	0.26296	GPCR, rhodopsin-like superfamily (1);	0.300607	0.29355	N	0.012388	T	0.00144	0.0004	N	0.05050	-0.12	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.44832	-0.9302	10	0.72032	D	0.01	.	3.5344	0.07789	0.473:0.0:0.354:0.1731	.	128	P47887	OR1E2_HUMAN	L	128;127	ENSP00000248384:F128L	ENSP00000248384:F128L	F	-	1	0	OR1E2	3283504	0.000000	0.05858	0.884000	0.34674	0.914000	0.54420	-1.011000	0.03652	0.517000	0.28361	0.528000	0.53228	TTC	.	.	.	none		0.557	OR1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207311.1		
CTNS	1497	hgsc.bcm.edu	37	17	3563642	3563642	+	Silent	SNP	G	G	A	rs371189196	byFrequency	TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr17:3563642G>A	ENST00000046640.3	+	12	1676	c.1083G>A	c.(1081-1083)ccG>ccA	p.P361P	RP11-235E17.6_ENST00000575741.1_RNA|CTNS_ENST00000381870.3_Silent_p.P361P|CTNS_ENST00000441220.2_Silent_p.P253P|CTNS_ENST00000414524.2_Silent_p.P214P	NM_004937.2	NP_004928.2	O60931	CTNS_HUMAN	cystinosin, lysosomal cystine transporter	361					adult walking behavior (GO:0007628)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|cellular amino acid metabolic process (GO:0006520)|cognition (GO:0050890)|glutathione metabolic process (GO:0006749)|grooming behavior (GO:0007625)|L-cystine transport (GO:0015811)|lens development in camera-type eye (GO:0002088)|long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	L-cystine transmembrane transporter activity (GO:0015184)	p.P361P(2)		NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)	10				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)	GAAAGAGACCGGGGTATGACC	0.582													G|||	2	0.000399361	0.0	0.0	5008	,	,		18448	0.0		0.001	False		,,,				2504	0.001				p.P361P		Atlas-SNP	.											CTNS,NS,carcinoma,+1,1	CTNS	42	.	2	Substitution - coding silent(2)	endometrium(2)	c.G1083A						PASS	.						92.0	95.0	94.0					17																	3563642		2203	4300	6503	SO:0001819	synonymous_variant	1497	exon12			GAGACCGGGGTAT	AJ222967	CCDS11031.1, CCDS32530.1	17p13	2011-06-07	2011-06-07		ENSG00000040531	ENSG00000040531			2518	protein-coding gene	gene with protein product		606272	"""cystinosis, nephropathic"""			9537412, 15128704	Standard	NM_004937		Approved	CTNS-LSB, PQLC4	uc002fwa.3	O60931	OTTHUMG00000090693	ENST00000046640.3:c.1083G>A	chr17.hg19:g.3563642G>A		90.0	0.0	.		90.0	51.0	.	NM_001031681	D3DTJ5|Q8IZ01|Q9UNK6	Silent	SNP	ENST00000046640.3	hg19	CCDS11031.1																																																																																			.	.	.	weak		0.582	CTNS-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317696.1	NM_004937	
KCTD11	147040	hgsc.bcm.edu	37	17	7256855	7256855	+	Missense_Mutation	SNP	G	G	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr17:7256855G>T	ENST00000333751.3	+	1	1648	c.594G>T	c.(592-594)gaG>gaT	p.E198D	RP11-542C16.1_ENST00000572417.1_RNA|TMEM95_ENST00000576060.1_5'Flank|TMEM95_ENST00000330767.4_5'Flank|TMEM95_ENST00000389982.4_5'Flank	NM_001002914.2	NP_001002914.1	Q693B1	KCD11_HUMAN	potassium channel tetramerization domain containing 11	198					cell cycle (GO:0007049)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)				kidney(1)|large_intestine(2)|lung(1)	4		Prostate(122;0.157)				GCTTCCTGGAGGAGGTGCTGC	0.667																																					p.E198D		Atlas-SNP	.											.	KCTD11	17	.	0			c.G594T						PASS	.						18.0	21.0	20.0					17																	7256855		2175	4269	6444	SO:0001583	missense	147040	exon1			CCTGGAGGAGGTG	AK056227	CCDS32545.1	17p13.2	2013-06-20	2013-06-20	2003-11-26	ENSG00000213859	ENSG00000213859			21302	protein-coding gene	gene with protein product		609848	"""chromosome 17 open reading frame 36"", ""potassium channel tetramerisation domain containing 11"""	C17orf36		12186855, 21472142	Standard	NM_001002914		Approved	REN, KCASH1	uc002gge.4	Q693B1	OTTHUMG00000132061	ENST00000333751.3:c.594G>T	chr17.hg19:g.7256855G>T	ENSP00000328352:p.Glu198Asp	38.0	0.0	.		43.0	10.0	.	NM_001002914	B3KPE0	Missense_Mutation	SNP	ENST00000333751.3	hg19	CCDS32545.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893530	0.72639	.	.	ENSG00000213859	ENST00000333751	T	0.79033	-1.23	4.79	1.74	0.24563	.	0.000000	0.46442	U	0.000295	T	0.76300	0.3968	L	0.29908	0.895	0.32060	N	0.595776	D	0.63880	0.993	D	0.67548	0.952	T	0.75184	-0.3407	10	0.46703	T	0.11	.	6.6193	0.22794	0.298:0.0:0.702:0.0	.	198	Q693B1	KCD11_HUMAN	D	198	ENSP00000328352:E198D	ENSP00000328352:E198D	E	+	3	2	KCTD11	7197579	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	1.616000	0.36933	0.258000	0.21686	-0.379000	0.06801	GAG	.	.	.	none		0.667	KCTD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255084.2	NM_001002914	
NF1	4763	hgsc.bcm.edu	37	17	29687644	29687644	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr17:29687644A>G	ENST00000358273.4	+	57	8683	c.8300A>G	c.(8299-8301)cAg>cGg	p.Q2767R	NF1_ENST00000444181.2_Missense_Mutation_p.Q560R|NF1_ENST00000356175.3_Missense_Mutation_p.Q2746R	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2767					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCTGCACTGCAGAGCCAGCTT	0.458			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.Q2767R		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.A8300G						PASS	.						219.0	198.0	205.0					17																	29687644		2203	4300	6503	SO:0001583	missense	4763	exon57	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	CACTGCAGAGCCA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.8300A>G	chr17.hg19:g.29687644A>G	ENSP00000351015:p.Gln2767Arg	89.0	0.0	.		133.0	74.0	.	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	hg19	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.889195	0.91889	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181	T;T;T;T	0.48836	3.15;3.29;2.98;0.8	5.87	5.87	0.94306	.	0.057056	0.64402	D	0.000001	T	0.43188	0.1236	N	0.24115	0.695	0.80722	D	1	D;B;B	0.56968	0.978;0.206;0.131	P;B;B	0.47402	0.546;0.085;0.039	T	0.41520	-0.9504	10	0.52906	T	0.07	.	16.27	0.82612	1.0:0.0:0.0:0.0	.	560;2746;2767	B4DXH1;P21359-2;P21359	.;.;NF1_HUMAN	R	2767;2746;2412;560	ENSP00000351015:Q2767R;ENSP00000348498:Q2746R;ENSP00000389907:Q2412R;ENSP00000396481:Q560R	ENSP00000348498:Q2746R	Q	+	2	0	NF1	26711770	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.000000	0.76290	2.248000	0.74166	0.533000	0.62120	CAG	.	.	.	none		0.458	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
ABCA10	10349	hgsc.bcm.edu	37	17	67146187	67146187	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr17:67146187G>A	ENST00000269081.4	-	38	5324	c.4415C>T	c.(4414-4416)gCg>gTg	p.A1472V	ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_5'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	1472					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TAACTTATACGCCATTAAAGA	0.363																																					p.A1472V		Atlas-SNP	.											.	ABCA10	209	.	0			c.C4415T						PASS	.						75.0	74.0	75.0					17																	67146187		2203	4300	6503	SO:0001583	missense	10349	exon38			TTATACGCCATTA	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.4415C>T	chr17.hg19:g.67146187G>A	ENSP00000269081:p.Ala1472Val	127.0	0.0	.		163.0	34.0	.	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	hg19	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	0.086	-1.175617	0.01646	.	.	ENSG00000154263	ENST00000269081	D	0.82526	-1.62	3.15	-5.77	0.02369	.	0.651141	0.11480	U	0.559768	T	0.49115	0.1538	N	0.00869	-1.13	0.44067	D	0.99681	B;B	0.15719	0.007;0.014	B;B	0.09377	0.004;0.002	T	0.48410	-0.9038	10	0.02654	T	1	.	13.728	0.62769	0.6887:0.0:0.3113:0.0	.	464;1472	B4DPV2;Q8WWZ4	.;ABCAA_HUMAN	V	1472	ENSP00000269081:A1472V	ENSP00000269081:A1472V	A	-	2	0	ABCA10	64657782	0.001000	0.12720	0.000000	0.03702	0.064000	0.16182	-0.130000	0.10498	-1.288000	0.02378	-0.369000	0.07265	GCG	.	.	.	none		0.363	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
METTL23	124512	hgsc.bcm.edu	37	17	74729620	74729620	+	Missense_Mutation	SNP	A	A	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr17:74729620A>C	ENST00000341249.6	+	5	757	c.425A>C	c.(424-426)gAa>gCa	p.E142A	METTL23_ENST00000591571.1_3'UTR|METTL23_ENST00000586738.1_3'UTR|MFSD11_ENST00000588460.1_5'Flank|MFSD11_ENST00000586622.1_5'Flank|MIR636_ENST00000384825.1_RNA|METTL23_ENST00000586752.1_Missense_Mutation_p.E75A|METTL23_ENST00000590964.1_Missense_Mutation_p.E75A|METTL23_ENST00000588783.1_3'UTR|METTL23_ENST00000588302.1_3'UTR|METTL23_ENST00000586200.1_Missense_Mutation_p.E23A|METTL23_ENST00000588822.1_Missense_Mutation_p.E75A|RP11-318A15.7_ENST00000587459.1_Intron	NM_001206984.1	NP_001193913.1	Q86XA0	MET23_HUMAN	methyltransferase like 23	142						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	methyltransferase activity (GO:0008168)			large_intestine(2)|lung(1)	3						TGGTCACTTGAAGCTTTACTC	0.348																																					p.E142A		Atlas-SNP	.											.	METTL23	19	.	0			c.A425C						PASS	.						207.0	205.0	206.0					17																	74729620		1855	4090	5945	SO:0001583	missense	124512	exon5			CACTTGAAGCTTT		CCDS45787.1, CCDS59298.1	17q25.2	2011-03-03	2011-03-03	2011-03-03	ENSG00000181038	ENSG00000181038			26988	protein-coding gene	gene with protein product		615262	"""chromosome 17 open reading frame 95"""	C17orf95		12477932	Standard	NM_001080510		Approved	LOC124512	uc021udl.1	Q86XA0		ENST00000341249.6:c.425A>C	chr17.hg19:g.74729620A>C	ENSP00000341543:p.Glu142Ala	179.0	0.0	.		192.0	87.0	.	NM_001206984	H9ZYJ0|K7EK32	Missense_Mutation	SNP	ENST00000341249.6	hg19	CCDS45787.1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.965668	0.53507	.	.	ENSG00000181038	ENST00000317409;ENST00000341249	T	0.24723	1.84	5.93	3.68	0.42216	.	0.279419	0.39615	N	0.001306	T	0.22244	0.0536	L	0.46157	1.445	0.51767	D	0.999939	B	0.16396	0.017	B	0.23852	0.049	T	0.03807	-1.1002	10	0.33940	T	0.23	-13.1078	8.6686	0.34137	0.8037:0.13:0.0664:0.0	.	142	Q86XA0	MET23_HUMAN	A	221;142	ENSP00000341543:E142A	ENSP00000316862:E221A	E	+	2	0	METTL23	72241215	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.715000	0.68430	0.480000	0.27534	0.533000	0.62120	GAA	.	.	.	none		0.348	METTL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451002.1	NM_001080510	
ZNF750	79755	hgsc.bcm.edu	37	17	80789569	80789569	+	Silent	SNP	G	G	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr17:80789569G>C	ENST00000269394.3	-	2	1595	c.762C>G	c.(760-762)acC>acG	p.T254T	TBCD_ENST00000539345.2_Intron|TBCD_ENST00000355528.4_Intron|ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000397466.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	254					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GCGAGTAGATGGTGGCCAGCC	0.582																																					p.T254T		Atlas-SNP	.											.	ZNF750	60	.	0			c.C762G						PASS	.						64.0	69.0	67.0					17																	80789569		2203	4300	6503	SO:0001819	synonymous_variant	79755	exon2			GTAGATGGTGGCC	AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.762C>G	chr17.hg19:g.80789569G>C		88.0	0.0	.		113.0	33.0	.	NM_024702	Q9H899	Silent	SNP	ENST00000269394.3	hg19	CCDS11819.1																																																																																			.	.	.	none		0.582	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439074.2	NM_024702	
MYOM1	8736	hgsc.bcm.edu	37	18	3067525	3067525	+	Missense_Mutation	SNP	C	C	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr18:3067525C>G	ENST00000356443.4	-	38	5126	c.4793G>C	c.(4792-4794)gGa>gCa	p.G1598A	MYOM1_ENST00000400569.3_Missense_Mutation_p.G1598A|MYOM1_ENST00000261606.7_Missense_Mutation_p.G1502A	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1598	Ig-like C2-type 5.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AGGCGGGTCTCCCCACACGTT	0.527																																					p.G1598A		Atlas-SNP	.											.	MYOM1	192	.	0			c.G4793C						PASS	.						41.0	46.0	44.0					18																	3067525		2112	4239	6351	SO:0001583	missense	8736	exon38			GGGTCTCCCCACA	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4793G>C	chr18.hg19:g.3067525C>G	ENSP00000348821:p.Gly1598Ala	61.0	0.0	.		88.0	26.0	.	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	hg19	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.340439	0.81911	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.79141	-1.24;-1.24;-1.24	5.79	5.79	0.91817	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.89529	0.6741	M	0.82433	2.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.89108	0.3494	10	0.51188	T	0.08	.	20.0371	0.97565	0.0:1.0:0.0:0.0	.	1502;1598	P52179-2;P52179	.;MYOM1_HUMAN	A	1598;1598;1502	ENSP00000348821:G1598A;ENSP00000383413:G1598A;ENSP00000261606:G1502A	ENSP00000261606:G1502A	G	-	2	0	MYOM1	3057525	1.000000	0.71417	0.967000	0.41034	0.469000	0.32828	7.818000	0.86416	2.734000	0.93682	0.655000	0.94253	GGA	.	.	.	none		0.527	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
ASXL3	80816	hgsc.bcm.edu	37	18	31325189	31325189	+	Missense_Mutation	SNP	G	G	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr18:31325189G>C	ENST00000269197.5	+	12	5377	c.5377G>C	c.(5377-5379)Gag>Cag	p.E1793Q		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1793					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AACAGCACCAGAGAGAAACGT	0.488																																					p.E1793Q		Atlas-SNP	.											.	ASXL3	405	.	0			c.G5377C						PASS	.						70.0	70.0	70.0					18																	31325189		1894	4124	6018	SO:0001583	missense	80816	exon12			GCACCAGAGAGAA	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5377G>C	chr18.hg19:g.31325189G>C	ENSP00000269197:p.Glu1793Gln	85.0	0.0	.		99.0	34.0	.	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	hg19	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663192	0.47572	.	.	ENSG00000141431	ENST00000269197	T	0.18174	2.23	5.7	5.7	0.88788	.	.	.	.	.	T	0.19525	0.0469	N	0.24115	0.695	0.31181	N	0.702038	D	0.54397	0.966	P	0.46479	0.518	T	0.01829	-1.1265	9	0.54805	T	0.06	.	19.8478	0.96722	0.0:0.0:1.0:0.0	.	1793	Q9C0F0	ASXL3_HUMAN	Q	1793	ENSP00000269197:E1793Q	ENSP00000269197:E1793Q	E	+	1	0	ASXL3	29579187	1.000000	0.71417	0.953000	0.39169	0.708000	0.40852	4.103000	0.57783	2.698000	0.92095	0.655000	0.94253	GAG	.	.	.	none		0.488	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
CTDP1	9150	hgsc.bcm.edu	37	18	77440069	77440069	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr18:77440069C>T	ENST00000299543.7	+	1	269	c.122C>T	c.(121-123)gCg>gTg	p.A41V	CTDP1_ENST00000075430.7_Missense_Mutation_p.A41V|RP11-567M16.3_ENST00000317008.4_lincRNA	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	41					exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		GCGGCGGGCGCGGCCGTGCGC	0.796																																					p.A41V		Atlas-SNP	.											.	CTDP1	67	.	0			c.C122T						PASS	.																																			SO:0001583	missense	9150	exon1			CGGGCGCGGCCGT	AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.122C>T	chr18.hg19:g.77440069C>T	ENSP00000299543:p.Ala41Val	35.0	0.0	.		26.0	12.0	.	NM_004715	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	ENST00000299543.7	hg19	CCDS12017.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719634	0.68844	.	.	ENSG00000060069	ENST00000299543;ENST00000075430	T;T	0.10763	2.85;2.84	3.86	3.86	0.44501	.	0.208152	0.41294	D	0.000914	T	0.19604	0.0471	M	0.75085	2.285	0.49213	D	0.999765	D;P	0.55605	0.972;0.952	P;B	0.47626	0.552;0.349	T	0.10154	-1.0642	10	0.28530	T	0.3	-27.8058	15.3998	0.74830	0.0:1.0:0.0:0.0	.	41;41	Q9Y5B0-4;Q9Y5B0	.;CTDP1_HUMAN	V	41	ENSP00000299543:A41V;ENSP00000075430:A41V	ENSP00000075430:A41V	A	+	2	0	CTDP1	75541057	0.999000	0.42202	1.000000	0.80357	0.671000	0.39405	3.115000	0.50391	1.694000	0.51137	0.484000	0.47621	GCG	.	.	.	none		0.796	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715	
ABCA7	10347	hgsc.bcm.edu	37	19	1051189	1051189	+	Missense_Mutation	SNP	G	G	T	rs545859049		TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr19:1051189G>T	ENST00000263094.6	+	20	2951	c.2720G>T	c.(2719-2721)cGg>cTg	p.R907L	ABCA7_ENST00000433129.1_Missense_Mutation_p.R907L|ABCA7_ENST00000435683.2_Missense_Mutation_p.R769L	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	907	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCTATGGGCGGCTGAAGGGT	0.652																																					p.R907L		Atlas-SNP	.											.	ABCA7	174	.	0			c.G2720T						PASS	.						59.0	56.0	57.0					19																	1051189		2188	4290	6478	SO:0001583	missense	10347	exon20			ATGGGCGGCTGAA	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.2720G>T	chr19.hg19:g.1051189G>T	ENSP00000263094:p.Arg907Leu	59.0	0.0	.		48.0	11.0	.	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	hg19	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.707765	0.48412	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	T;T	0.80480	-1.38;-1.38	4.37	4.37	0.52481	ATPase, AAA+ type, core (1);ABC transporter-like (2);	.	.	.	.	D	0.85340	0.5674	L	0.56769	1.78	0.34708	D	0.727406	D;B	0.54047	0.964;0.05	P;B	0.59221	0.854;0.062	D	0.89415	0.3706	9	0.48119	T	0.1	.	14.3646	0.66799	0.0:0.0:1.0:0.0	.	769;907	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	L	907	ENSP00000263094:R907L;ENSP00000414062:R907L	ENSP00000263094:R907L	R	+	2	0	ABCA7	1002189	0.064000	0.20934	0.833000	0.33012	0.101000	0.19017	2.144000	0.42197	1.984000	0.57885	0.305000	0.20034	CGG	.	.	.	none		0.652	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
FBN3	84467	hgsc.bcm.edu	37	19	8130912	8130912	+	Missense_Mutation	SNP	C	C	T	rs139098536		TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr19:8130912C>T	ENST00000600128.1	-	64	8735	c.8321G>A	c.(8320-8322)cGg>cAg	p.R2774Q	FBN3_ENST00000601739.1_Missense_Mutation_p.R2774Q|FBN3_ENST00000270509.2_Missense_Mutation_p.R2774Q			Q75N90	FBN3_HUMAN	fibrillin 3	2774						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R2774L(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CACCTCCAGCCGGTAGGTTCC	0.677													C|||	1	0.000199681	0.0	0.0	5008	,	,		15911	0.0		0.001	False		,,,				2504	0.0				p.R2774Q		Atlas-SNP	.											FBN3,NS,carcinoma,0,1	FBN3	300	.	1	Substitution - Missense(1)	lung(1)	c.G8321A						PASS	.	C	GLN/ARG	3,4401		0,3,2199	37.0	40.0	39.0		8321	-0.4	1.0	19	dbSNP_134	39	0,8594		0,0,4297	no	missense	FBN3	NM_032447.3	43	0,3,6496	TT,TC,CC		0.0,0.0681,0.0231	benign	2774/2810	8130912	3,12995	2202	4297	6499	SO:0001583	missense	84467	exon63			TCCAGCCGGTAGG		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.8321G>A	chr19.hg19:g.8130912C>T	ENSP00000470498:p.Arg2774Gln	123.0	1.0	.		104.0	38.0	.	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	hg19	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	3.458	-0.110482	0.06924	6.81E-4	0.0	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.86694	-2.16	4.55	-0.394	0.12434	.	0.739374	0.12731	N	0.443827	T	0.64427	0.2597	N	0.03608	-0.345	0.22066	N	0.999389	B;B	0.10296	0.0;0.003	B;B	0.04013	0.0;0.001	T	0.52260	-0.8599	10	0.14252	T	0.57	.	3.819	0.08827	0.1372:0.4926:0.1402:0.2301	.	2774;837	Q75N90;Q6ZNB8	FBN3_HUMAN;.	Q	2774;837	ENSP00000270509:R2774Q	ENSP00000270509:R2774Q	R	-	2	0	FBN3	8036912	0.000000	0.05858	0.987000	0.45799	0.104000	0.19210	-0.211000	0.09332	-0.062000	0.13088	-0.238000	0.12139	CGG	.	C|1.000;T|0.000	0.000	weak		0.677	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
CAPNS1	826	hgsc.bcm.edu	37	19	36631958	36631958	+	Silent	SNP	C	C	G	rs567500165		TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr19:36631958C>G	ENST00000246533.3	+	2	643	c.45C>G	c.(43-45)ggC>ggG	p.G15G	CAPNS1_ENST00000589146.1_Silent_p.G15G|CAPNS1_ENST00000587718.1_Silent_p.G15G|CAPNS1_ENST00000590874.1_Silent_p.G15G|CAPNS1_ENST00000588815.1_Silent_p.G15G|CAPNS1_ENST00000588780.1_Silent_p.G15G	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	15	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcgggggaggcg	0.736													C|||	1	0.000199681	0.0	0.0	5008	,	,		3971	0.001		0.0	False		,,,				2504	0.0				p.G15G	Esophageal Squamous(129;1541 1691 5780 18353 34150)	Atlas-SNP	.											.	CAPNS1	19	.	0			c.C45G						PASS	.						6.0	7.0	7.0					19																	36631958		1958	3947	5905	SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGGGGA	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.45C>G	chr19.hg19:g.36631958C>G		84.0	0.0	.		65.0	4.0	.	NM_001749	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	hg19	CCDS12489.1																																																																																			.	.	.	none		0.736	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457411.2		
LILRB4	11006	hgsc.bcm.edu	37	19	55175397	55175397	+	Missense_Mutation	SNP	C	C	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr19:55175397C>T	ENST00000391736.1	+	5	571	c.256C>T	c.(256-258)Cca>Tca	p.P86S	LILRB4_ENST00000270452.2_Missense_Mutation_p.P86S|LILRB4_ENST00000391733.3_Missense_Mutation_p.P86S|LILRB4_ENST00000391734.3_Missense_Mutation_p.P86S|LILRB4_ENST00000430952.2_Missense_Mutation_p.P86S	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	86	Ig-like C2-type 1.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		ATTCTCCATCCCATCCATGAC	0.582																																					p.P86S		Atlas-SNP	.											.	LILRB4	86	.	0			c.C256T						PASS	.						313.0	275.0	288.0					19																	55175397		2203	4300	6503	SO:0001583	missense	11006	exon3			TCCATCCCATCCA	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.256C>T	chr19.hg19:g.55175397C>T	ENSP00000375616:p.Pro86Ser	120.0	0.0	.		135.0	32.0	.	NM_006847	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	hg19	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	C	2.499	-0.315654	0.05422	.	.	ENSG00000186818	ENST00000420271;ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59;2.59	2.43	-3.34	0.04943	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.07324	0.0185	L	0.35593	1.075	0.09310	N	1	B;B;B;B;B;P	0.45283	0.133;0.07;0.173;0.002;0.009;0.855	B;B;B;B;B;B	0.40199	0.029;0.016;0.017;0.006;0.01;0.322	T	0.25710	-1.0124	9	0.22706	T	0.39	.	2.2596	0.04063	0.4231:0.2687:0.0:0.3081	.	86;86;86;86;86;127	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6;C9JHA6	.;.;.;.;LIRB4_HUMAN;.	S	127;86;86;86;86;86;86	ENSP00000375616:P86S;ENSP00000270452:P86S;ENSP00000408995:P86S;ENSP00000375614:P86S;ENSP00000375613:P86S;ENSP00000401962:P86S	ENSP00000270452:P86S	P	+	1	0	LILRB4	59867209	0.000000	0.05858	0.005000	0.12908	0.017000	0.09413	-4.855000	0.00177	-0.487000	0.06735	0.407000	0.27541	CCA	.	.	.	none		0.582	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
ZSCAN22	342945	hgsc.bcm.edu	37	19	58850450	58850450	+	Missense_Mutation	SNP	G	G	A	rs138721519		TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr19:58850450G>A	ENST00000329665.4	+	3	1381	c.1234G>A	c.(1234-1236)Gcg>Acg	p.A412T		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	412					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		CAAGTGTGACGCGTGTGGCCG	0.582																																					p.A412T		Atlas-SNP	.											.	ZSCAN22	47	.	0			c.G1234A						PASS	.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	87.0	79.0	82.0		1234	0.6	0.0	19	dbSNP_134	82	0,8600		0,0,4300	no	missense	ZSCAN22	NM_181846.2	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	412/492	58850450	1,13005	2203	4300	6503	SO:0001583	missense	342945	exon3			TGTGACGCGTGTG	M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.1234G>A	chr19.hg19:g.58850450G>A	ENSP00000332433:p.Ala412Thr	79.0	0.0	.		80.0	6.0	.	NM_181846	Q15922|Q7Z3L8	Missense_Mutation	SNP	ENST00000329665.4	hg19	CCDS12975.1	.	.	.	.	.	.	.	.	.	.	G	5.713	0.316043	0.10789	2.27E-4	0.0	ENSG00000182318	ENST00000329665	T	0.07567	3.18	3.84	0.551	0.17225	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03011	0.0089	N	0.02539	-0.55	0.09310	N	1	B	0.29766	0.256	B	0.16722	0.016	T	0.40997	-0.9533	9	0.66056	D	0.02	.	7.5259	0.27656	0.3122:0.0:0.6878:0.0	.	412	P10073	ZSC22_HUMAN	T	412	ENSP00000332433:A412T	ENSP00000332433:A412T	A	+	1	0	ZSCAN22	63542262	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.917000	0.28665	0.410000	0.25675	-1.010000	0.02471	GCG	.	G|1.000;A|0.000	0.000	weak		0.582	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466765.1	NM_181846	
SON	6651	hgsc.bcm.edu	37	21	34926409	34926409	+	Silent	SNP	T	T	C			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr21:34926409T>C	ENST00000356577.4	+	3	5347	c.4872T>C	c.(4870-4872)aaT>aaC	p.N1624N	SON_ENST00000290239.6_Silent_p.N1624N|SON_ENST00000381679.4_Silent_p.N1624N|SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Silent_p.N1624N	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1624					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GTTTAGTTAATAAATATGATG	0.383																																					p.N1624N		Atlas-SNP	.											.	SON	343	.	0			c.T4872C						PASS	.						55.0	56.0	56.0					21																	34926409		2203	4300	6503	SO:0001819	synonymous_variant	6651	exon3			AGTTAATAAATAT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.4872T>C	chr21.hg19:g.34926409T>C		137.0	0.0	.		90.0	52.0	.	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	hg19	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	T	2.148	-0.395098	0.04899	.	.	ENSG00000159140	ENST00000436227	.	.	.	5.0	3.84	0.44239	.	.	.	.	.	T	0.47488	0.1448	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.39663	-0.9603	4	.	.	.	.	3.8858	0.09097	0.1818:0.1031:0.0:0.7151	.	.	.	.	T	619	.	.	I	+	2	0	SON	33848279	0.995000	0.38212	0.941000	0.38009	0.950000	0.60333	0.655000	0.24933	0.909000	0.36697	0.482000	0.46254	ATA	.	.	.	none		0.383	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
RIPK4	54101	hgsc.bcm.edu	37	21	43176834	43176834	+	Missense_Mutation	SNP	C	C	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr21:43176834C>A	ENST00000352483.2	-	2	389	c.325G>T	c.(325-327)Gct>Tct	p.A109S	RIPK4_ENST00000544709.1_Missense_Mutation_p.A46S|RIPK4_ENST00000542057.1_Missense_Mutation_p.A46S|RIPK4_ENST00000332512.3_Missense_Mutation_p.A109S			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	109	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GGCTCCGAAGCCAGCAGCTTT	0.607																																					p.A109S		Atlas-SNP	.											.	RIPK4	151	.	0			c.G325T						PASS	.						81.0	77.0	78.0					21																	43176834		2203	4300	6503	SO:0001583	missense	54101	exon2			CCGAAGCCAGCAG	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.325G>T	chr21.hg19:g.43176834C>A	ENSP00000330161:p.Ala109Ser	106.0	0.0	.		66.0	29.0	.	NM_020639	Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	hg19		.	.	.	.	.	.	.	.	.	.	C	16.16	3.043353	0.55003	.	.	ENSG00000183421	ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	4.97	4.97	0.65823	.	0.000000	0.56097	D	0.000021	T	0.61048	0.2316	N	0.11023	0.085	0.58432	D	0.999999	D	0.71674	0.998	D	0.80764	0.994	T	0.61407	-0.7069	10	0.28530	T	0.3	-33.7177	14.1534	0.65401	0.1503:0.8497:0.0:0.0	.	109	P57078-2	.	S	109;109;46;46	ENSP00000332454:A109S;ENSP00000330161:A109S;ENSP00000441754:A46S;ENSP00000442901:A46S	ENSP00000332454:A109S	A	-	1	0	RIPK4	42049903	1.000000	0.71417	0.980000	0.43619	0.369000	0.29798	5.852000	0.69488	2.466000	0.83321	0.563000	0.77884	GCT	.	.	.	none		0.607	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639	
KRTAP12-1	353332	hgsc.bcm.edu	37	21	46101934	46101934	+	Nonsense_Mutation	SNP	G	G	T	rs56135164	byFrequency	TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr21:46101934G>T	ENST00000391617.1	-	1	144	c.105C>A	c.(103-105)tgC>tgA	p.C35*	TSPEAR_ENST00000323084.4_Intron	NM_181686.1	NP_859014.1	P59990	KR121_HUMAN	keratin associated protein 12-1	35	14 X 5 AA approximate repeats.					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(1)|skin(2)	5						TCACGGGCACGCACACGGAGG	0.687																																					p.C35X		Atlas-SNP	.											.	KRTAP12-1	9	.	0			c.C105A						PASS	.						58.0	68.0	64.0					21																	46101934		2189	4272	6461	SO:0001587	stop_gained	353332	exon1			GGGCACGCACACG	AJ566388	CCDS42966.1	21q22.3	2006-03-13			ENSG00000187175	ENSG00000187175		"""Keratin associated proteins"""	20529	protein-coding gene	gene with protein product							Standard	NM_181686		Approved	KRTAP12.1, KAP12.1	uc002zfv.3	P59990	OTTHUMG00000057639	ENST00000391617.1:c.105C>A	chr21.hg19:g.46101934G>T	ENSP00000375475:p.Cys35*	115.0	0.0	.		96.0	4.0	.	NM_181686	Q0VAS3	Nonsense_Mutation	SNP	ENST00000391617.1	hg19	CCDS42966.1	.	.	.	.	.	.	.	.	.	.	a	8.104	0.777274	0.16120	.	.	ENSG00000187175	ENST00000391617	.	.	.	2.88	-1.66	0.08265	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4733	0.32999	0.5179:0.0:0.4821:0.0	.	.	.	.	X	35	.	ENSP00000375475:C35X	C	-	3	2	KRTAP12-1	44926362	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-0.346000	0.07760	-1.005000	0.03417	-3.231000	0.00052	TGC	.	G|0.954;A|0.046	.	alt		0.687	KRTAP12-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128043.1	NM_181686	
L3MBTL2	83746	hgsc.bcm.edu	37	22	41616759	41616759	+	Missense_Mutation	SNP	A	A	G			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr22:41616759A>G	ENST00000216237.5	+	7	898	c.740A>G	c.(739-741)tAt>tGt	p.Y247C		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	247					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTGCTTCGGTATGAAGGCTTT	0.498																																					p.Y247C		Atlas-SNP	.											.	L3MBTL2	61	.	0			c.A740G						PASS	.						120.0	105.0	110.0					22																	41616759		2203	4300	6503	SO:0001583	missense	83746	exon7			TTCGGTATGAAGG	AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.740A>G	chr22.hg19:g.41616759A>G	ENSP00000216237:p.Tyr247Cys	62.0	0.0	.		40.0	12.0	.	NM_031488	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	hg19	CCDS14011.1	.	.	.	.	.	.	.	.	.	.	A	13.67	2.306926	0.40795	.	.	ENSG00000100395	ENST00000216237	T	0.53423	0.62	5.37	5.37	0.77165	.	0.335401	0.36101	N	0.002788	T	0.72244	0.3436	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.975;0.997	T	0.77778	-0.2460	10	0.87932	D	0	.	15.677	0.77336	1.0:0.0:0.0:0.0	.	247;247	Q969R5-3;Q969R5	.;LMBL2_HUMAN	C	247	ENSP00000216237:Y247C	ENSP00000216237:Y247C	Y	+	2	0	L3MBTL2	39946705	1.000000	0.71417	0.933000	0.37362	0.815000	0.46073	9.279000	0.95777	2.169000	0.68431	0.374000	0.22700	TAT	.	.	.	none		0.498	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488	
PPP6R2	9701	hgsc.bcm.edu	37	22	50860699	50860699	+	Missense_Mutation	SNP	G	G	A			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr22:50860699G>A	ENST00000216061.5	+	10	1232	c.862G>A	c.(862-864)Gac>Aac	p.D288N	PPP6R2_ENST00000359139.3_Missense_Mutation_p.D288N|PPP6R2_ENST00000395744.3_Missense_Mutation_p.D288N|PPP6R2_ENST00000395741.3_Missense_Mutation_p.D289N			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	288						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						GGGCTTGGTGGACTCCTTTTC	0.582																																					p.D289N		Atlas-SNP	.											.	PPP6R2	71	.	0			c.G865A						PASS	.						102.0	99.0	100.0					22																	50860699		2203	4300	6503	SO:0001583	missense	9701	exon9			TTGGTGGACTCCT	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.862G>A	chr22.hg19:g.50860699G>A	ENSP00000216061:p.Asp288Asn	76.0	0.0	.		71.0	15.0	.	NM_001242899	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	hg19		.	.	.	.	.	.	.	.	.	.	G	18.28	3.589334	0.66105	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.32753	1.45;1.49;1.45;1.44	5.32	5.32	0.75619	.	0.135251	0.64402	D	0.000003	T	0.30230	0.0758	L	0.44542	1.39	0.40878	D	0.983972	B;B;B;B;B	0.15473	0.01;0.013;0.005;0.01;0.005	B;B;B;B;B	0.31869	0.084;0.137;0.03;0.084;0.03	T	0.09751	-1.0660	10	0.36615	T	0.2	-27.8965	11.6177	0.51099	0.0:0.0:0.8222:0.1778	.	288;288;289;288;288	O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;PP6R2_HUMAN;.;.;.	N	288;289;288;288	ENSP00000352051:D288N;ENSP00000379090:D289N;ENSP00000379093:D288N;ENSP00000216061:D288N	ENSP00000216061:D288N	D	+	1	0	PPP6R2	49207565	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.233000	0.95337	2.498000	0.84270	0.456000	0.33151	GAC	.	.	.	none		0.582	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
HAO2	51179	hgsc.bcm.edu	37	1	119935262	119935263	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr1:119935262_119935263delGT	ENST00000325945.3	+	7	1025_1026	c.952_953delGT	c.(952-954)gttfs	p.V318fs	HAO2_ENST00000482991.1_3'UTR|HAO2_ENST00000361035.4_Frame_Shift_Del_p.V331fs	NM_001005783.1|NM_016527.2	NP_001005783.1|NP_057611.1	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2 (long chain)	318	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				fatty acid oxidation (GO:0019395)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)		TGTTAAGGAAGTTTTGAACATT	0.401																																					p.317_318del		Atlas-Indel,Pindel	.											.	HAO2	62	.	0			c.951_952del						PASS	.																																			SO:0001589	frameshift_variant	51179	exon8			.	AF231917	CCDS901.1	1p13.3-p13.1	2008-07-18			ENSG00000116882	ENSG00000116882	1.1.3.15		4810	protein-coding gene	gene with protein product	"""(S)-2-hydroxy-acid oxidase"", ""glycolate oxidase"", ""long-chain L-2-hydroxy acid oxidase"", ""growth-inhibiting protein 16"""	605176				10777549	Standard	XM_005270913		Approved	HAOX2, GIG16	uc001ehr.1	Q9NYQ3	OTTHUMG00000012410	ENST00000325945.3:c.952_953delGT	chr1.hg19:g.119935262_119935263delGT	ENSP00000316339:p.Val318fs	107.0	0.0	0		111.0	28.0	0.252252	NM_001005783	Q2TU86|Q5QP00|Q9UJS6	Frame_Shift_Del	DEL	ENST00000325945.3	hg19	CCDS901.1																																																																																			.	.	.	none		0.401	HAO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034984.1	NM_001005783	
SPIDR	23514	hgsc.bcm.edu	37	8	48352889	48352889	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr8:48352889delA	ENST00000297423.4	+	8	1266	c.882delA	c.(880-882)agafs	p.R294fs	SPIDR_ENST00000518074.1_Frame_Shift_Del_p.R234fs|SPIDR_ENST00000541342.1_Frame_Shift_Del_p.R224fs|SPIDR_ENST00000521214.1_3'UTR	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	294	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											TTCTAGGTAGAAAATCTGGTG	0.393																																					p.R294fs		Atlas-Indel,Pindel	.											.	KIAA0146	64	.	0			c.881delG						PASS	.						67.0	62.0	64.0					8																	48352889		1849	4119	5968	SO:0001589	frameshift_variant	23514	exon8			.	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.882delA	chr8.hg19:g.48352889delA	ENSP00000297423:p.Arg294fs	49.0	0.0	0		77.0	26.0	0.337662	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Frame_Shift_Del	DEL	ENST00000297423.4	hg19	CCDS43737.1																																																																																			.	.	.	none		0.393	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
MICAL3	57553	hgsc.bcm.edu	37	22	18383762	18383762	+	Splice_Site	DEL	C	C	-			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr22:18383762delC	ENST00000441493.2	-	6	1045	c.693delG	c.(691-693)ggg>gg	p.G231fs	MICAL3_ENST00000429452.1_Splice_Site_p.G231fs|MICAL3_ENST00000585038.1_Splice_Site_p.G231fs|MICAL3_ENST00000444520.1_Splice_Site_p.G231fs|MICAL3_ENST00000414725.2_Splice_Site_p.G231fs|MICAL3_ENST00000207726.7_Splice_Site_p.G231fs|MICAL3_ENST00000400561.2_Splice_Site_p.G231fs|MICAL3_ENST00000383094.3_Splice_Site_p.G231fs	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	231	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TCCGACGAAACCCTGGAGGGA	0.438																																					p.F232fs		Atlas-Indel,Pindel	.											.	MICAL3	53	.	0			c.694delT						PASS	.						115.0	101.0	105.0					22																	18383762		1568	3582	5150	SO:0001630	splice_region_variant	57553	exon6			.	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.692-1G>-	chr22.hg19:g.18383762delC		72.0	0.0	0		73.0	18.0	0.246575	NM_001136004	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Frame_Shift_Del	DEL	ENST00000441493.2	hg19	CCDS46659.1																																																																																			.	.	.	none		0.438	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		Frame_Shift_Del
ANKHD1	54882	hgsc.bcm.edu	37	5	139919000	139919001	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr5:139919000_139919001insT	ENST00000360839.2	+	34	7780_7781	c.7626_7627insT	c.(7627-7629)taafs	p.*2543fs	ANKHD1_ENST00000297183.6_Intron|ANKHD1-EIF4EBP3_ENST00000532219.1_Intron|ANKHD1_ENST00000544120.1_Frame_Shift_Ins_p.*867fs	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	0						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATATGTCAACTAAGTTAGAAG	0.371																																					p.N2542fs		Atlas-Indel,Pindel	.											.	ANKHD1	233	.	0			c.7626_7627insT						PASS	.																																			SO:0001589	frameshift_variant	54882	exon34			.	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.7627dupT	chr5.hg19:g.139919001_139919001dupT	ENSP00000354085:p.*2543fs	99.0	0.0	0		95.0	23.0	0.242105	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Frame_Shift_Ins	INS	ENST00000360839.2	hg19	CCDS4225.1																																																																																			.	.	.	none		0.371	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
EXT2	2132	hgsc.bcm.edu	37	11	44129501	44129501	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr11:44129501delG	ENST00000343631.3	+	2	368	c.239delG	c.(238-240)cggfs	p.R80fs	EXT2_ENST00000395673.3_Frame_Shift_Del_p.R113fs|EXT2_ENST00000533608.1_Frame_Shift_Del_p.R80fs|EXT2_ENST00000358681.4_Frame_Shift_Del_p.R80fs			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	80					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						ATCCCAGAGCGGGGGGATCTC	0.498			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																												p.R113fs		Atlas-Indel,Pindel	.	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	.	EXT2	129	.	0			c.337delC						PASS	.						80.0	72.0	75.0					11																	44129501		2203	4300	6503	SO:0001589	frameshift_variant	2132	exon2	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	.		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.239delG	chr11.hg19:g.44129501delG	ENSP00000342656:p.Arg80fs	141.0	0.0	0		149.0	43.0	0.288591	NM_000401	B2R5Z6|C9JU51|J3KPT2|O15288	Frame_Shift_Del	DEL	ENST00000343631.3	hg19	CCDS7908.1																																																																																			.	.	.	none		0.498	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390074.1	NM_000401	
TSPAN3	10099	hgsc.bcm.edu	37	15	77346604	77346612	+	In_Frame_Del	DEL	ATCAACCTC	ATCAACCTC	-			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	ATCAACCTC	ATCAACCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr15:77346604_77346612delATCAACCTC	ENST00000267970.4	-	4	613_621	c.340_348delGAGGTTGAT	c.(340-348)gaggttgatdel	p.EVD114del	TSPAN3_ENST00000561277.1_5'UTR|TSPAN3_ENST00000346495.2_In_Frame_Del_p.EVD89del|TSPAN3_ENST00000424443.3_In_Frame_Del_p.EVD50del|TSPAN3_ENST00000559494.1_In_Frame_Del_p.EVD25del|TSPAN3_ENST00000558394.1_5'UTR|TSPAN3_ENST00000558745.1_5'UTR	NM_001168412.1|NM_005724.5|NM_198902.2	NP_001161884.1|NP_005715.1|NP_944492.1	O60637	TSN3_HUMAN	tetraspanin 3	114						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	10				all cancers(203;1.14e-19)		GAATGCTGCGATCAACCTCATTTTCCACC	0.388																																					p.114_117del		Atlas-Indel,Pindel	.											.	TSPAN3	21	.	0			c.341_349del						PASS	.																																			SO:0001651	inframe_deletion	10099	exon4			.		CCDS10292.1, CCDS10293.1, CCDS53963.1	15q23	2013-02-14	2005-03-21	2005-03-21	ENSG00000140391	ENSG00000140391		"""Tetraspanins"""	17752	protein-coding gene	gene with protein product		613134	"""transmembrane 4 superfamily member 8"""	TM4SF8			Standard	NM_005724		Approved	TM4-A, TSPAN-3	uc002bcj.3	O60637	OTTHUMG00000143728	ENST00000267970.4:c.340_348delGAGGTTGAT	chr15.hg19:g.77346604_77346612delATCAACCTC	ENSP00000267970:p.Glu114_Asp116del	58.0	0.0	0		52.0	10.0	0.192308	NM_005724	A6NEH4|B3KQQ2|B4DP19|Q9BW22|Q9NVX9	In_Frame_Del	DEL	ENST00000267970.4	hg19	CCDS10292.1																																																																																			.	.	.	none		0.388	TSPAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289792.3	NM_005724	
NALCN	259232	hgsc.bcm.edu	37	13	102047671	102047671	+	Frame_Shift_Del	DEL	A	A	-	rs188237867		TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr13:102047671delA	ENST00000251127.6	-	3	235	c.154delT	c.(154-156)tctfs	p.S52fs	NALCN_ENST00000376200.5_Frame_Shift_Del_p.S52fs|NALCN_ENST00000376196.3_Frame_Shift_Del_p.S52fs|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	52					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATACAAACAGAAATGACGCTG	0.443																																					p.S52fs		Atlas-Indel,Pindel	.											.	NALCN	431	.	0			c.155delC						PASS	.						143.0	113.0	123.0					13																	102047671		2203	4300	6503	SO:0001589	frameshift_variant	259232	exon3			.	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.154delT	chr13.hg19:g.102047671delA	ENSP00000251127:p.Ser52fs	84.0	0.0	0		104.0	29.0	0.278846	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Frame_Shift_Del	DEL	ENST00000251127.6	hg19	CCDS9498.1																																																																																			.	.	.	none		0.443	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
KNTC1	9735	hgsc.bcm.edu	37	12	123075197	123075201	+	Frame_Shift_Del	DEL	ACTGC	ACTGC	-			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	ACTGC	ACTGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr12:123075197_123075201delACTGC	ENST00000333479.7	+	41	4220_4224	c.4043_4047delACTGC	c.(4042-4047)tactgcfs	p.YC1348fs	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1348					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GCGTTGGGTTACTGCACTCTCTTAC	0.385																																					p.1348_1349del		Atlas-Indel,Pindel	.											.	KNTC1	182	.	0			c.4042_4046del						PASS	.																																			SO:0001589	frameshift_variant	9735	exon41			.		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.4043_4047delACTGC	chr12.hg19:g.123075197_123075201delACTGC	ENSP00000328236:p.Tyr1348fs	136.0	0.0	0		126.0	45.0	0.357143	NM_014708	A7E2C4|B3KSG2	Frame_Shift_Del	DEL	ENST00000333479.7	hg19	CCDS45002.1																																																																																			.	.	.	none		0.385	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
LRP2	4036	hgsc.bcm.edu	37	2	170063527	170063532	+	In_Frame_Del	DEL	TGACAA	TGACAA	-			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	TGACAA	TGACAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr2:170063527_170063532delTGACAA	ENST00000263816.3	-	39	6983_6988	c.6698_6703delTTGTCA	c.(6697-6705)attgtcaca>aca	p.IV2233del		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2233					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CCCCGTGGTGTGACAATGCCCTCTGA	0.461																																					p.2233_2235del		Atlas-Indel,Pindel	.											.	LRP2	751	.	0			c.6699_6704del						PASS	.																																			SO:0001651	inframe_deletion	4036	exon39			.		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.6698_6703delTTGTCA	chr2.hg19:g.170063527_170063532delTGACAA	ENSP00000263816:p.Ile2233_Val2234del	121.0	0.0	0		146.0	34.0	0.232877	NM_004525	O00711|Q16215	In_Frame_Del	DEL	ENST00000263816.3	hg19	CCDS2232.1																																																																																			.	.	.	none		0.461	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
MAGI1	9223	hgsc.bcm.edu	37	3	65425621	65425622	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr3:65425621_65425622delCT	ENST00000497477.2	-	9	1201_1202	c.1202_1203delAG	c.(1201-1203)gagfs	p.E401fs	MAGI1_ENST00000402939.2_Frame_Shift_Del_p.E401fs|MAGI1_ENST00000330909.8_Frame_Shift_Del_p.E401fs|MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000483466.1_Frame_Shift_Del_p.E401fs			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	401					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		gctgctgctgctCAAGCTGCTT	0.505											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.401_402del		Atlas-INDEL	.											.	MAGI1	481	.	0			c.1203_1204del						PASS	.																																			SO:0001589	frameshift_variant	9223	exon9			.	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1202_1203delAG	chr3.hg19:g.65425621_65425622delCT	ENSP00000424369:p.Glu401fs	28.0	0.0	0	1084	24.0	12.0	0.5	NM_001033057	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Frame_Shift_Del	DEL	ENST00000497477.2	hg19																																																																																				.	.	.	none		0.505	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
ATP6V1C1	528	hgsc.bcm.edu	37	8	104068108	104068109	+	Frame_Shift_Del	DEL	CG	CG	-	rs368547373		TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr8:104068108_104068109delCG	ENST00000395862.3	+	8	744_745	c.585_586delCG	c.(583-588)aacgacfs	p.ND195fs	ATP6V1C1_ENST00000521514.1_Frame_Shift_Del_p.ND120fs|ATP6V1C1_ENST00000518738.1_Frame_Shift_Del_p.ND195fs|ATP6V1C1_ENST00000518857.1_Frame_Shift_Del_p.ND120fs	NM_001695.4	NP_001686.1	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1	195					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transporter activity (GO:0005215)	p.D196N(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			TAAACCACAACGACTGGATTAA	0.361																																					p.195_195del		Atlas-Indel,Pindel	.											.	ATP6V1C1	33	.	1	Substitution - Missense(1)	large_intestine(1)	c.584_585del						PASS	.																																			SO:0001589	frameshift_variant	528	exon8			.	X69151	CCDS6296.1	8p22.3	2011-05-24	2006-01-13	2002-05-10	ENSG00000155097	ENSG00000155097	3.6.3.14	"""ATPases / V-type"""	856	protein-coding gene	gene with protein product		603097	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 42kD"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C, isoform 1"""	ATP6D, ATP6C		8250920, 14580332	Standard	NM_001695		Approved	VATC, Vma5	uc003ykz.4	P21283	OTTHUMG00000164761	ENST00000395862.3:c.585_586delCG	chr8.hg19:g.104068108_104068109delCG	ENSP00000379203:p.Asn195fs	154.0	0.0	0		176.0	55.0	0.3125	NM_001695		Frame_Shift_Del	DEL	ENST00000395862.3	hg19	CCDS6296.1																																																																																			.	.	.	none		0.361	ATP6V1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380101.1	NM_001695	
KIF24	347240	hgsc.bcm.edu	37	9	34256932	34256932	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr9:34256932delG	ENST00000402558.2	-	10	2697	c.2673delC	c.(2671-2673)agcfs	p.S891fs	KIF24_ENST00000345050.2_Frame_Shift_Del_p.S757fs|KIF24_ENST00000379166.2_Frame_Shift_Del_p.S891fs|KIF24_ENST00000379174.3_Frame_Shift_Del_p.S757fs			Q5T7B8	KIF24_HUMAN	kinesin family member 24	891					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			AGTCCACCCAGCTTTTAGTTA	0.547																																					p.W892fs		Atlas-Indel,Pindel	.											.	KIF24	64	.	0			c.2674delT						PASS	.						71.0	73.0	72.0					9																	34256932		2203	4300	6503	SO:0001589	frameshift_variant	347240	exon11			.	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.2673delC	chr9.hg19:g.34256932delG	ENSP00000384433:p.Ser891fs	82.0	0.0	0		103.0	35.0	0.339806	NM_194313	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Frame_Shift_Del	DEL	ENST00000402558.2	hg19	CCDS6551.2																																																																																			.	.	.	none		0.547	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5		
PAMR1	25891	hgsc.bcm.edu	37	11	35456322	35456326	+	Frame_Shift_Del	DEL	GGAGC	GGAGC	-	rs559149381		TCGA-2Z-A9JT-01A-11D-A42J-10	TCGA-2Z-A9JT-10A-01D-A42M-10	GGAGC	GGAGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a0ad5b36-8f0c-4c60-9ff2-0992e47d1368	bcef5136-1bb4-4cff-a8db-659687674ecd	g.chr11:35456322_35456326delGGAGC	ENST00000378880.2	-	10	1805_1809	c.1360_1364delGCTCC	c.(1360-1365)gctccafs	p.AP454fs	PAMR1_ENST00000278360.3_Frame_Shift_Del_p.AP471fs|PAMR1_ENST00000532848.1_Frame_Shift_Del_p.AP414fs|PAMR1_ENST00000378878.3_Frame_Shift_Del_p.AP343fs	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	454	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TTGGGTCTTTGGAGCAGTGATGTTC	0.527																																					p.471_472del		Atlas-Indel,Pindel	.											.	PAMR1	85	.	0			c.1412_1416del						PASS	.																																			SO:0001589	frameshift_variant	25891	exon11			.		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1360_1364delGCTCC	chr11.hg19:g.35456322_35456326delGGAGC	ENSP00000368158:p.Ala454fs	53.0	0.0	0		54.0	17.0	0.314815	NM_015430	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Frame_Shift_Del	DEL	ENST00000378880.2	hg19	CCDS31460.1																																																																																			.	.	.	none		0.527	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430	
