#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM213B	127281	hgsc.bcm.edu	37	1	2518720	2518720	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:2518720A>T	ENST00000378425.5	+	2	330	c.254A>T	c.(253-255)gAc>gTc	p.D85V	FAM213B_ENST00000537325.1_Missense_Mutation_p.D115V|RP3-395M20.9_ENST00000424215.1_RNA|FAM213B_ENST00000484099.1_3'UTR|FAM213B_ENST00000419916.2_Missense_Mutation_p.D115V|FAM213B_ENST00000444521.2_Missense_Mutation_p.D85V|FAM213B_ENST00000378424.4_Missense_Mutation_p.D115V			Q8TBF2	PGFS_HUMAN	family with sequence similarity 213, member B	85					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|myelin sheath (GO:0043209)	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|prostaglandin-F synthase activity (GO:0047017)										CTGGACGGCGACTACTTCGCG	0.706																																					p.D115V		Atlas-SNP	.											.	.	.	.	0			c.A344T						PASS	.						17.0	18.0	18.0					1																	2518720		2183	4281	6464	SO:0001583	missense	127281	exon2			ACGGCGACTACTT	AK075273	CCDS44.1, CCDS44.2, CCDS55564.1, CCDS72690.1, CCDS72691.1	1p36.32	2011-12-08	2011-11-24	2011-11-24	ENSG00000157870	ENSG00000157870	1.11.1.20		28390	protein-coding gene	gene with protein product	"""prostamide/prostaglandin F synthase"""		"""chromosome 1 open reading frame 93"""	C1orf93		18006499	Standard	NM_152371		Approved	MGC26818	uc001ajv.2	Q8TBF2	OTTHUMG00000000847	ENST00000378425.5:c.254A>T	chr1.hg19:g.2518720A>T	ENSP00000367682:p.Asp85Val	68.0	0.0	.		58.0	31.0	.	NM_001195736	A8K793|B3KPY3|B4DQR9|B4E0S5|B7ZAC8|B9DI90|B9DI92|J3KQD0|Q8N2H0	Missense_Mutation	SNP	ENST00000378425.5	hg19		.	.	.	.	.	.	.	.	.	.	A	10.52	1.372724	0.24857	.	.	ENSG00000157870	ENST00000419916;ENST00000378424;ENST00000537325;ENST00000378425;ENST00000444521	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	3.88	1.78	0.24846	.	0.350346	0.29403	N	0.012249	T	0.22627	0.0546	N	0.14661	0.345	0.34956	D	0.751689	B;B;P;B;B;B	0.35821	0.147;0.001;0.523;0.049;0.057;0.071	B;B;B;B;B;B	0.37267	0.009;0.002;0.245;0.005;0.118;0.187	T	0.21724	-1.0237	10	0.54805	T	0.06	-4.8025	4.8945	0.13744	0.3022:0.0:0.6978:0.0	.	115;85;115;85;85;85	Q8TBF2-5;Q8TBF2-4;Q8TBF2-6;Q8TBF2-2;Q8TBF2-3;Q8TBF2	.;.;.;.;.;PGFS_HUMAN	V	115;115;115;85;85	ENSP00000394405:D115V;ENSP00000367681:D115V;ENSP00000443605:D115V;ENSP00000367682:D85V;ENSP00000413218:D85V	ENSP00000367681:D115V	D	+	2	0	C1orf93	2508580	1.000000	0.71417	0.999000	0.59377	0.013000	0.08279	2.355000	0.44107	0.830000	0.34757	-0.381000	0.06696	GAC	.	.	.	none		0.706	FAM213B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152371	
UBE4B	10277	hgsc.bcm.edu	37	1	10177640	10177640	+	Missense_Mutation	SNP	G	G	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:10177640G>C	ENST00000253251.8	+	7	1772	c.933G>C	c.(931-933)gaG>gaC	p.E311D	UBE4B_ENST00000377157.3_Missense_Mutation_p.E195D|UBE4B_ENST00000475795.1_3'UTR|UBE4B_ENST00000343090.6_Missense_Mutation_p.E440D					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TTGGAATAGAGGAAAAAAAAG	0.373																																					p.E440D		Atlas-SNP	.											.	UBE4B	233	.	0			c.G1320C						PASS	.						49.0	50.0	49.0					1																	10177640		2203	4300	6503	SO:0001583	missense	10277	exon8			AATAGAGGAAAAA	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.933G>C	chr1.hg19:g.10177640G>C	ENSP00000253251:p.Glu311Asp	319.0	1.0	.		355.0	154.0	.	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	hg19	CCDS110.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.209310	0.79240	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.49139	0.79;0.79;0.79	6.03	3.17	0.36434	.	0.000000	0.85682	D	0.000000	T	0.60766	0.2294	M	0.61703	1.905	0.54753	D	0.999985	D;D	0.69078	0.997;0.974	D;D	0.72625	0.978;0.969	T	0.57797	-0.7749	10	0.51188	T	0.08	-29.0009	8.8347	0.35104	0.337:0.0:0.663:0.0	.	440;311	O95155;O95155-2	UBE4B_HUMAN;.	D	311;195;440	ENSP00000253251:E311D;ENSP00000366362:E195D;ENSP00000343001:E440D	ENSP00000253251:E311D	E	+	3	2	UBE4B	10100227	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.338000	0.43957	0.441000	0.26529	0.655000	0.94253	GAG	.	.	.	none		0.373	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
FHAD1	114827	hgsc.bcm.edu	37	1	15627701	15627701	+	Splice_Site	SNP	G	G	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:15627701G>T	ENST00000375998.4	+	5	679	c.679G>T	c.(679-681)Gat>Tat	p.D227Y	FHAD1_ENST00000417793.1_Splice_Site_p.D227Y|FHAD1_ENST00000358897.4_Splice_Site_p.D227Y|FHAD1_ENST00000375999.3_Splice_Site_p.D227Y			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	227										skin(1)|stomach(1)	2						CTCTACCCAGGATGAAATAAT	0.483																																					p.D227Y		Atlas-SNP	.											.	FHAD1	78	.	0			c.G679T						PASS	.						35.0	33.0	34.0					1																	15627701		692	1591	2283	SO:0001630	splice_region_variant	114827	exon6			ACCCAGGATGAAA	AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.679-1G>T	chr1.hg19:g.15627701G>T		99.0	0.0	.		100.0	49.0	.	NM_052929	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	hg19		.	.	.	.	.	.	.	.	.	.	G	19.65	3.868047	0.72065	.	.	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998	T;T;T;T	0.61859	0.11;0.1;0.07;0.11	5.45	5.45	0.79879	.	0.092092	0.42053	D	0.000768	T	0.65657	0.2712	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.62544	-0.6832	9	.	.	.	-17.3501	14.7955	0.69873	0.0:0.0:1.0:0.0	.	227	B1AJZ9	FHAD1_HUMAN	Y	227	ENSP00000351770:D227Y;ENSP00000407615:D227Y;ENSP00000365167:D227Y;ENSP00000365166:D227Y	.	D	+	1	0	FHAD1	15500288	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.445000	0.66594	2.572000	0.86782	0.650000	0.86243	GAT	.	.	.	none		0.483	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	Missense_Mutation
S100A6	6277	hgsc.bcm.edu	37	1	153507304	153507304	+	Silent	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:153507304C>T	ENST00000368720.2	-	4	443	c.141G>A	c.(139-141)aaG>aaA	p.K47K	S100A6_ENST00000496817.1_Silent_p.K47K|S100A6_ENST00000368719.4_Silent_p.K47K|BX470102.3_ENST00000420695.1_RNA			P06703	S10A6_HUMAN	S100 calcium binding protein A6	47	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axonogenesis (GO:0007409)|positive regulation of fibroblast proliferation (GO:0048146)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|ion transmembrane transporter activity (GO:0015075)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)|tropomyosin binding (GO:0005523)|zinc ion binding (GO:0008270)			ovary(1)	1	all_lung(78;1.66e-32)|Lung NSC(65;5.71e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CATCCTGCAGCTTCTAATGTG	0.522																																					p.K47K		Atlas-SNP	.											.	S100A6	8	.	0			c.G141A						PASS	.						106.0	101.0	102.0					1																	153507304		2203	4300	6503	SO:0001819	synonymous_variant	6277	exon3			CTGCAGCTTCTAA	BC001431	CCDS1040.1	1q21	2013-01-10	2006-09-11		ENSG00000197956	ENSG00000197956		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10496	protein-coding gene	gene with protein product		114110	"""S100 calcium-binding protein A6 (calcyclin)"", ""S100 calcium binding protein A6 (calcyclin)"""	CACY			Standard	NM_014624		Approved	2A9, PRA, CABP	uc001fbw.1	P06703	OTTHUMG00000013549	ENST00000368720.2:c.141G>A	chr1.hg19:g.153507304C>T		78.0	0.0	.		72.0	38.0	.	NM_014624	D3DV39|Q5RHS4	Silent	SNP	ENST00000368720.2	hg19	CCDS1040.1																																																																																			.	.	.	none		0.522	S100A6-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037723.2	NM_014624	
C1orf43	25912	hgsc.bcm.edu	37	1	154180025	154180025	+	Silent	SNP	T	T	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:154180025T>G	ENST00000368521.5	-	7	864	c.666A>C	c.(664-666)acA>acC	p.T222T	C1orf43_ENST00000350592.3_Silent_p.T188T|C1orf43_ENST00000362076.4_Silent_p.T170T|C1orf189_ENST00000368525.3_5'Flank|C1orf43_ENST00000483282.1_5'UTR|C1orf43_ENST00000368519.1_Silent_p.T204T	NM_001098616.1	NP_001092086.1	Q9BWL3	CA043_HUMAN	chromosome 1 open reading frame 43	222						integral component of membrane (GO:0016021)	coenzyme binding (GO:0050662)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	10	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					AGGGGAGGTATGTCACCTGGA	0.493																																					p.T222T		Atlas-SNP	.											.	C1orf43	36	.	0			c.A666C						PASS	.						222.0	210.0	214.0					1																	154180025		2203	4300	6503	SO:0001819	synonymous_variant	25912	exon7			GAGGTATGTCACC	AF077036	CCDS1061.1, CCDS1062.1, CCDS41404.1, CCDS72924.1	1q21.2	2012-06-25			ENSG00000143612	ENSG00000143612			29876	protein-coding gene	gene with protein product						11042152, 11230159	Standard	XM_005245077		Approved	NICE-3, DKFZp586G1722	uc001fei.2	Q9BWL3	OTTHUMG00000035981	ENST00000368521.5:c.666A>C	chr1.hg19:g.154180025T>G		154.0	0.0	.		112.0	40.0	.	NM_001098616	A8K3G8|D3DV72|D3DV74|Q5M801|Q5VU73|Q5VU83|Q96HP7|Q9UFU2|Q9UGL7|Q9UGL8|Q9Y2R6	Silent	SNP	ENST00000368521.5	hg19	CCDS41404.1																																																																																			.	.	.	none		0.493	C1orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087664.2	NM_015449	
YY1AP1	55249	hgsc.bcm.edu	37	1	155646420	155646420	+	Silent	SNP	A	A	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:155646420A>C	ENST00000295566.4	-	5	464	c.441T>G	c.(439-441)gtT>gtG	p.V147V	YY1AP1_ENST00000535662.1_5'UTR|YY1AP1_ENST00000359205.5_Silent_p.V70V|YY1AP1_ENST00000368339.5_Silent_p.V219V|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000368330.2_Silent_p.V81V|YY1AP1_ENST00000438245.2_Silent_p.V81V|YY1AP1_ENST00000405763.3_Silent_p.V219V|YY1AP1_ENST00000361831.5_Silent_p.V70V|YY1AP1_ENST00000404643.1_Silent_p.V81V|YY1AP1_ENST00000347088.5_Silent_p.V81V|YY1AP1_ENST00000476093.1_5'UTR|YY1AP1_ENST00000311573.5_Silent_p.V70V|YY1AP1_ENST00000355499.4_Silent_p.V81V|YY1AP1_ENST00000368340.5_Silent_p.V219V|YY1AP1_ENST00000407221.1_Silent_p.V70V|MSTO1_ENST00000538143.1_Intron	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	147					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					ACTGGGGTTTAACCTTCTCTA	0.458																																					p.V219V		Atlas-SNP	.											.	YY1AP1	104	.	0			c.T657G						PASS	.						270.0	218.0	235.0					1																	155646420		2203	4300	6503	SO:0001819	synonymous_variant	55249	exon4			GGGTTTAACCTTC	BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.441T>G	chr1.hg19:g.155646420A>C		85.0	0.0	.		92.0	8.0	.	NM_001198904	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Silent	SNP	ENST00000295566.4	hg19	CCDS1115.1																																																																																			.	.	.	none		0.458	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086027.1	NM_139118	
LHX4	89884	hgsc.bcm.edu	37	1	180235629	180235629	+	Nonsense_Mutation	SNP	C	C	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:180235629C>A	ENST00000263726.2	+	3	595	c.351C>A	c.(349-351)tgC>tgA	p.C117*		NM_033343.3	NP_203129.1	Q969G2	LHX4_HUMAN	LIM homeobox 4	117	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)	16						GCTTTGCTTGCATCATCTGCA	0.607																																					p.C117X		Atlas-SNP	.											.	LHX4	36	.	0			c.C351A						PASS	.						70.0	68.0	68.0					1																	180235629		2203	4300	6503	SO:0001587	stop_gained	89884	exon3			TGCTTGCATCATC	AB037683	CCDS1338.1	1q25.3	2011-06-20			ENSG00000121454	ENSG00000121454		"""Homeoboxes / LIM class"""	21734	protein-coding gene	gene with protein product		602146				11844481, 11567216	Standard	NM_033343		Approved	Gsh4	uc001goe.2	Q969G2	OTTHUMG00000035115	ENST00000263726.2:c.351C>A	chr1.hg19:g.180235629C>A	ENSP00000263726:p.Cys117*	110.0	0.0	.		113.0	49.0	.	NM_033343	Q8NHE0|Q8NHM1|Q8TCJ1|Q8WWX2|Q969W2	Nonsense_Mutation	SNP	ENST00000263726.2	hg19	CCDS1338.1	.	.	.	.	.	.	.	.	.	.	C	37	6.072372	0.97256	.	.	ENSG00000121454	ENST00000263726	.	.	.	5.25	2.39	0.29439	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0658	0.30659	0.0:0.6782:0.0:0.3218	.	.	.	.	X	117	.	ENSP00000263726:C117X	C	+	3	2	LHX4	178502252	1.000000	0.71417	0.998000	0.56505	0.853000	0.48598	1.245000	0.32790	0.243000	0.21327	-0.768000	0.03414	TGC	.	.	.	none		0.607	LHX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084995.2	NM_033343	
IARS2	55699	hgsc.bcm.edu	37	1	220267580	220267580	+	Missense_Mutation	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:220267580C>T	ENST00000302637.5	+	1	126	c.22C>T	c.(22-24)Cgc>Tgc	p.R8C	IARS2_ENST00000366922.1_5'UTR	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	8					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	GCTGCGCCCTcgcgggccggg	0.731																																					p.R8C		Atlas-SNP	.											.	IARS2	106	.	0			c.C22T						PASS	.						6.0	8.0	8.0					1																	220267580		1994	4041	6035	SO:0001583	missense	55699	exon1			CGCCCTCGCGGGC	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.22C>T	chr1.hg19:g.220267580C>T	ENSP00000303279:p.Arg8Cys	89.0	0.0	.		76.0	19.0	.	NM_018060	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Missense_Mutation	SNP	ENST00000302637.5	hg19	CCDS1523.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.543372	0.45280	.	.	ENSG00000067704	ENST00000302637	T	0.18174	2.23	4.13	1.07	0.20283	.	1.149520	0.06488	N	0.734164	T	0.14787	0.0357	L	0.46157	1.445	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38542	-0.9656	10	0.87932	D	0	-5.9953	2.5425	0.04730	0.1499:0.5218:0.1466:0.1817	.	8	Q9NSE4	SYIM_HUMAN	C	8	ENSP00000303279:R8C	ENSP00000303279:R8C	R	+	1	0	IARS2	218334203	0.000000	0.05858	0.042000	0.18584	0.137000	0.21094	-0.922000	0.04004	0.933000	0.37291	0.591000	0.81541	CGC	.	.	.	none		0.731	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
TLR5	7100	hgsc.bcm.edu	37	1	223285550	223285550	+	Missense_Mutation	SNP	T	T	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:223285550T>A	ENST00000540964.1	-	4	1285	c.824A>T	c.(823-825)aAa>aTa	p.K275I	TLR5_ENST00000342210.6_Missense_Mutation_p.K275I			O60602	TLR5_HUMAN	toll-like receptor 5	275					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		GTCAGGATCTTTGATGTTATG	0.483																																					p.K275I		Atlas-SNP	.											.	TLR5	86	.	0			c.A824T						PASS	.						87.0	79.0	81.0					1																	223285550		2203	4300	6503	SO:0001583	missense	7100	exon6			GGATCTTTGATGT		CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.824A>T	chr1.hg19:g.223285550T>A	ENSP00000440643:p.Lys275Ile	157.0	0.0	.		147.0	62.0	.	NM_003268	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Missense_Mutation	SNP	ENST00000540964.1	hg19	CCDS31033.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.692938	0.48202	.	.	ENSG00000187554	ENST00000540964;ENST00000366881;ENST00000342210	T;T;T	0.38401	1.14;1.14;1.14	5.27	-1.58	0.08479	.	0.412136	0.25484	N	0.030354	T	0.53867	0.1823	M	0.79258	2.445	0.09310	N	1	P	0.47910	0.902	D	0.63597	0.916	T	0.52586	-0.8556	10	0.72032	D	0.01	.	11.276	0.49168	0.0:0.4375:0.0:0.5625	.	275	O60602	TLR5_HUMAN	I	275	ENSP00000440643:K275I;ENSP00000355846:K275I;ENSP00000340089:K275I	ENSP00000340089:K275I	K	-	2	0	TLR5	221352173	0.002000	0.14202	0.001000	0.08648	0.734000	0.41952	0.246000	0.18160	-0.591000	0.05859	0.533000	0.62120	AAA	.	.	.	none		0.483	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003268	
RYR2	6262	hgsc.bcm.edu	37	1	237713903	237713903	+	Silent	SNP	C	C	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:237713903C>A	ENST00000366574.2	+	27	3443	c.3126C>A	c.(3124-3126)acC>acA	p.T1042T	RYR2_ENST00000360064.6_Silent_p.T1040T|RYR2_ENST00000542537.1_Silent_p.T1026T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1042	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGACCGAACCAAGAAATCCA	0.507																																					p.T1042T		Atlas-SNP	.											.	RYR2	1273	.	0			c.C3126A						PASS	.						117.0	109.0	112.0					1																	237713903		1927	4150	6077	SO:0001819	synonymous_variant	6262	exon27			CCGAACCAAGAAA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3126C>A	chr1.hg19:g.237713903C>A		175.0	0.0	.		180.0	83.0	.	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	hg19	CCDS55691.1																																																																																			.	.	.	none		0.507	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
GRHL1	29841	hgsc.bcm.edu	37	2	10105481	10105481	+	Missense_Mutation	SNP	T	T	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:10105481T>C	ENST00000324907.9	+	8	1217	c.1081T>C	c.(1081-1083)Ttc>Ctc	p.F361L	GRHL1_ENST00000324883.5_Missense_Mutation_p.F172L|GRHL1_ENST00000405379.2_Missense_Mutation_p.F361L	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	361					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		CGCCATTTCCTTCACATGGGA	0.443																																					p.F361L		Atlas-SNP	.											.	GRHL1	95	.	0			c.T1081C						PASS	.						139.0	132.0	135.0					2																	10105481		2203	4300	6503	SO:0001583	missense	29841	exon8			ATTTCCTTCACAT	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1081T>C	chr2.hg19:g.10105481T>C	ENSP00000324693:p.Phe361Leu	86.0	0.0	.		85.0	38.0	.	NM_198182	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	ENST00000324907.9	hg19	CCDS33144.2	.	.	.	.	.	.	.	.	.	.	T	32	5.124591	0.94429	.	.	ENSG00000134317	ENST00000405379;ENST00000324883;ENST00000324907	T;T;T	0.18810	2.19;2.19;2.19	5.46	5.46	0.80206	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.54791	0.1880	M	0.90019	3.08	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	T	0.65158	-0.6236	10	0.72032	D	0.01	-1.3111	15.5346	0.75993	0.0:0.0:0.0:1.0	.	172;361	Q9NZI5-2;Q9NZI5	.;GRHL1_HUMAN	L	361;172;361	ENSP00000384209:F361L;ENSP00000324494:F172L;ENSP00000324693:F361L	ENSP00000324494:F172L	F	+	1	0	GRHL1	10022932	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	7.992000	0.88273	2.054000	0.61138	0.528000	0.53228	TTC	.	.	.	none		0.443	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
GRHL1	29841	hgsc.bcm.edu	37	2	10105483	10105483	+	Silent	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:10105483C>T	ENST00000324907.9	+	8	1219	c.1083C>T	c.(1081-1083)ttC>ttT	p.F361F	GRHL1_ENST00000324883.5_Silent_p.F172F|GRHL1_ENST00000405379.2_Silent_p.F361F	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	361					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		CCATTTCCTTCACATGGGACA	0.443																																					p.F361F		Atlas-SNP	.											.	GRHL1	95	.	0			c.C1083T						PASS	.						138.0	130.0	133.0					2																	10105483		2203	4300	6503	SO:0001819	synonymous_variant	29841	exon8			TTCCTTCACATGG	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1083C>T	chr2.hg19:g.10105483C>T		87.0	0.0	.		87.0	38.0	.	NM_198182	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Silent	SNP	ENST00000324907.9	hg19	CCDS33144.2																																																																																			.	.	.	none		0.443	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
ADCY3	109	hgsc.bcm.edu	37	2	25095499	25095499	+	Silent	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:25095499G>A	ENST00000260600.5	-	2	1616	c.765C>T	c.(763-765)ttC>ttT	p.F255F		NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	255					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GGGCCTCCAGGAAGGCCTTGC	0.632																																					p.F255F		Atlas-SNP	.											.	ADCY3	114	.	0			c.C765T						PASS	.						84.0	84.0	84.0					2																	25095499		2203	4300	6503	SO:0001819	synonymous_variant	109	exon2			CTCCAGGAAGGCC	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.765C>T	chr2.hg19:g.25095499G>A		182.0	0.0	.		135.0	7.0	.	NM_004036	B3KT86|Q53T54|Q9UDB1	Silent	SNP	ENST00000260600.5	hg19	CCDS1715.1																																																																																			.	.	.	none		0.632	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
SULT1C4	27233	hgsc.bcm.edu	37	2	108999668	108999668	+	Silent	SNP	T	T	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:108999668T>C	ENST00000272452.2	+	4	839	c.513T>C	c.(511-513)gcT>gcC	p.A171A	SULT1C4_ENST00000409309.3_Intron	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	171					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						CTTTTCTGGCTGGGAAAGGTG	0.423																																					p.A171A		Atlas-SNP	.											.	SULT1C4	41	.	0			c.T513C						PASS	.						106.0	103.0	104.0					2																	108999668		2203	4300	6503	SO:0001819	synonymous_variant	27233	exon4			TCTGGCTGGGAAA	AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.513T>C	chr2.hg19:g.108999668T>C		146.0	0.0	.		126.0	40.0	.	NM_006588	Q069I8|Q08AS5|Q53S63	Silent	SNP	ENST00000272452.2	hg19	CCDS2077.1																																																																																			.	.	.	none		0.423	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588	
MERTK	10461	hgsc.bcm.edu	37	2	112767644	112767644	+	Splice_Site	SNP	G	G	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:112767644G>C	ENST00000295408.4	+	15	2336		c.e15+1		MERTK_ENST00000409780.1_Splice_Site|MERTK_ENST00000421804.2_Splice_Site			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase						apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						AGGACCAAAGGTAATGATCTC	0.448																																					.		Atlas-SNP	.											.	MERTK	112	.	0			c.2079+1G>C						PASS	.						140.0	135.0	137.0					2																	112767644		2203	4300	6503	SO:0001630	splice_region_variant	10461	exon15			CCAAAGGTAATGA	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2079+1G>C	chr2.hg19:g.112767644G>C		52.0	0.0	.		54.0	16.0	.	NM_006343	Q9HBB4	Splice_Site	SNP	ENST00000295408.4	hg19	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737730	0.89573	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000409780	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1899	0.98228	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MERTK	112484115	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	8.731000	0.91529	2.873000	0.98535	0.563000	0.77884	.	.	.	.	none		0.448	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		Intron
KLHL23	151230	hgsc.bcm.edu	37	2	170592248	170592248	+	Nonsense_Mutation	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:170592248C>T	ENST00000392647.2	+	2	968	c.724C>T	c.(724-726)Caa>Taa	p.Q242*	KLHL23_ENST00000272797.4_Nonsense_Mutation_p.Q242*|KLHL23_ENST00000602521.1_Intron	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	242										breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						CTTAGGCCTTCAAAGAAGCTG	0.403																																					p.Q242X		Atlas-SNP	.											.	KLHL23	52	.	0			c.C724T						PASS	.						61.0	64.0	63.0					2																	170592248		2203	4299	6502	SO:0001587	stop_gained	151230	exon2			GGCCTTCAAAGAA	BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.724C>T	chr2.hg19:g.170592248C>T	ENSP00000376419:p.Gln242*	301.0	0.0	.		277.0	127.0	.	NM_144711	Q8N9B9|Q96FT8	Nonsense_Mutation	SNP	ENST00000392647.2	hg19	CCDS2236.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617647	0.87359	.	.	ENSG00000213160	ENST00000272797;ENST00000392647;ENST00000437875	.	.	.	5.81	5.81	0.92471	.	0.177188	0.52532	D	0.000070	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	14.2573	0.66060	0.0:0.9292:0.0:0.0708	.	.	.	.	X	242;242;63	.	ENSP00000272797:Q242X	Q	+	1	0	KLHL23	170300494	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.335000	0.52105	2.738000	0.93877	0.655000	0.94253	CAA	.	.	.	none		0.403	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255271.2	NM_144711	
TTN	7273	hgsc.bcm.edu	37	2	179506980	179506980	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:179506980T>G	ENST00000591111.1	-	169	35843	c.35619A>C	c.(35617-35619)gaA>gaC	p.E11873D	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E13514D|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E4574D|TTN_ENST00000460472.2_Missense_Mutation_p.E4449D|TTN_ENST00000342175.6_Missense_Mutation_p.E4641D|TTN_ENST00000342992.6_Missense_Mutation_p.E10946D|RP11-171I2.3_ENST00000605021.1_lincRNA			Q8WZ42	TITIN_HUMAN	titin	11873	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGAACAACTTCTTCCTTTG	0.328																																					p.E13514D		Atlas-SNP	.											.	TTN	18412	.	0			c.A40542C						PASS	.						55.0	52.0	53.0					2																	179506980		1811	4066	5877	SO:0001583	missense	7273	exon219			AACAACTTCTTCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35619A>C	chr2.hg19:g.179506980T>G	ENSP00000465570:p.Glu11873Asp	120.0	0.0	.		123.0	55.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	17.18	3.324057	0.60634	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000414766;ENST00000434777	T;T;T;T	0.70399	-0.48;0.16;0.1;0.13	5.55	4.4	0.53042	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.74283	0.3696	L	0.46157	1.445	0.35153	D	0.769946	B;B;B;B;D	0.65815	0.256;0.256;0.256;0.38;0.995	B;B;B;B;P	0.57371	0.133;0.133;0.133;0.133;0.819	T	0.81068	-0.1100	9	0.87932	D	0	.	10.6265	0.45510	0.0:0.0763:0.0:0.9237	.	4449;4574;4641;11873;10640	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-5	.;.;.;TITIN_HUMAN;.	D	10946;4449;4641;4574;4449;835;173	ENSP00000343764:E10946D;ENSP00000434586:E4449D;ENSP00000340554:E4641D;ENSP00000352154:E4574D	ENSP00000340554:E4641D	E	-	3	2	TTN	179215225	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.633000	0.54295	0.953000	0.37825	0.482000	0.46254	GAA	.	.	.	none		0.328	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
INO80D	54891	hgsc.bcm.edu	37	2	206921321	206921321	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:206921321C>G	ENST00000403263.1	-	4	969	c.565G>C	c.(565-567)Gtt>Ctt	p.V189L		NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	189					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						TCTTGTCGAACTTTTAAAATC	0.502																																					p.V189L		Atlas-SNP	.											.	INO80D	134	.	0			c.G565C						PASS	.						44.0	47.0	46.0					2																	206921321		2046	4186	6232	SO:0001583	missense	54891	exon4			GTCGAACTTTTAA		CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.565G>C	chr2.hg19:g.206921321C>G	ENSP00000384198:p.Val189Leu	89.0	0.0	.		76.0	38.0	.	NM_017759	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	ENST00000403263.1	hg19	CCDS46500.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.227209	0.39399	.	.	ENSG00000114933	ENST00000403263;ENST00000233270;ENST00000424117	T;T	0.29917	1.55;1.55	5.7	5.7	0.88788	.	0.195959	0.45126	D	0.000397	T	0.26919	0.0659	N	0.19112	0.55	0.40562	D	0.981221	P	0.40834	0.73	B	0.41202	0.35	T	0.02654	-1.1128	10	0.36615	T	0.2	.	19.8388	0.96673	0.0:1.0:0.0:0.0	.	189	Q53TQ3-2	.	L	189;189;84	ENSP00000384198:V189L;ENSP00000402369:V84L	ENSP00000233270:V189L	V	-	1	0	INO80D	206629566	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.880000	0.39628	2.695000	0.91970	0.561000	0.74099	GTT	.	.	.	none		0.502	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336459.1	NM_017759	
DGKD	8527	hgsc.bcm.edu	37	2	234343452	234343452	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:234343452A>T	ENST00000264057.2	+	5	503	c.491A>T	c.(490-492)cAc>cTc	p.H164L	DGKD_ENST00000409813.3_Missense_Mutation_p.H120L	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	164					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TCAGGGATGCACAATTGGTAC	0.537																																					p.H164L		Atlas-SNP	.											.	DGKD	106	.	0			c.A491T						PASS	.						196.0	171.0	179.0					2																	234343452		2203	4300	6503	SO:0001583	missense	8527	exon5			GGATGCACAATTG	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.491A>T	chr2.hg19:g.234343452A>T	ENSP00000264057:p.His164Leu	75.0	0.0	.		69.0	22.0	.	NM_152879	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	hg19	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.772147	0.90108	.	.	ENSG00000077044	ENST00000264057;ENST00000427930;ENST00000447484;ENST00000409813	D;D;T;D	0.99719	-6.52;-6.52;1.65;-6.52	4.92	4.92	0.64577	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.166625	0.39759	N	0.001280	D	0.99819	0.9920	H	0.96691	3.865	0.80722	D	1	P;D;D;B	0.89917	0.763;1.0;0.999;0.055	P;D;D;B	0.97110	0.656;1.0;0.994;0.081	D	0.96723	0.9534	10	0.87932	D	0	.	15.0541	0.71897	1.0:0.0:0.0:0.0	.	48;100;120;164	Q53SE4;C9JY42;Q16760-2;Q16760	.;.;.;DGKD_HUMAN	L	164;100;134;120	ENSP00000264057:H164L;ENSP00000407938:H100L;ENSP00000395530:H134L;ENSP00000386455:H120L	ENSP00000264057:H164L	H	+	2	0	DGKD	234008191	1.000000	0.71417	0.998000	0.56505	0.940000	0.58332	8.631000	0.90991	2.200000	0.70718	0.460000	0.39030	CAC	.	.	.	none		0.537	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
CHL1	10752	hgsc.bcm.edu	37	3	433428	433428	+	Silent	SNP	A	A	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:433428A>G	ENST00000256509.2	+	23	3504	c.2862A>G	c.(2860-2862)ctA>ctG	p.L954L	CHL1_ENST00000397491.2_Silent_p.L938L	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CTTGGGGACTACCTAAGAAAT	0.313																																					p.L954L		Atlas-SNP	.											.	CHL1	242	.	0			c.A2862G						PASS	.						84.0	85.0	85.0					3																	433428		2203	4300	6503	SO:0001819	synonymous_variant	10752	exon21			GGGACTACCTAAG	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2862A>G	chr3.hg19:g.433428A>G		106.0	0.0	.		117.0	5.0	.	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000256509.2	hg19	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	A	6.380	0.438192	0.12104	.	.	ENSG00000134121	ENST00000445697	.	.	.	5.62	-5.76	0.02376	.	.	.	.	.	T	0.34832	0.0911	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43360	-0.9396	4	.	.	.	.	0.6894	0.00888	0.2664:0.179:0.3048:0.2498	.	.	.	.	C	141	.	.	Y	+	2	0	CHL1	408428	0.026000	0.19158	0.042000	0.18584	0.811000	0.45836	-0.893000	0.04127	-0.543000	0.06240	0.528000	0.53228	TAC	.	.	.	none		0.313	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CNTN6	27255	hgsc.bcm.edu	37	3	1424739	1424739	+	Silent	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:1424739G>A	ENST00000446702.2	+	18	2907	c.2280G>A	c.(2278-2280)agG>agA	p.R760R	CNTN6_ENST00000539053.1_Silent_p.R688R|CNTN6_ENST00000350110.2_Silent_p.R760R			Q9UQ52	CNTN6_HUMAN	contactin 6	760	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R760S(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AATCATCAAGGTTTGTCTACA	0.458																																					p.R760R		Atlas-SNP	.											CNTN6,NS,carcinoma,+1,1	CNTN6	245	.	1	Substitution - Missense(1)	lung(1)	c.G2280A						PASS	.						167.0	153.0	158.0					3																	1424739		2203	4300	6503	SO:0001819	synonymous_variant	27255	exon18			ATCAAGGTTTGTC	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2280G>A	chr3.hg19:g.1424739G>A		279.0	0.0	.		243.0	90.0	.	NM_014461	Q2KHM2	Silent	SNP	ENST00000446702.2	hg19	CCDS2557.1																																																																																			.	.	.	none		0.458	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
CXCR6	10663	hgsc.bcm.edu	37	3	45988986	45988986	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:45988986G>A	ENST00000458629.1	+	1	2476	c.1013G>A	c.(1012-1014)aGc>aAc	p.S338N	FYCO1_ENST00000438446.1_Intron|CXCR6_ENST00000438735.1_Missense_Mutation_p.S338N|FYCO1_ENST00000296137.2_Intron|CXCR6_ENST00000304552.4_Missense_Mutation_p.S338N|FYCO1_ENST00000535325.1_Intron|CXCR6_ENST00000457814.1_Missense_Mutation_p.S338N			O00574	CXCR6_HUMAN	chemokine (C-X-C motif) receptor 6	338					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|viral genome replication (GO:0019079)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(3)|lung(1)|prostate(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GAGGCCACCAGCATGTTCCAG	0.498																																					p.S338N	Esophageal Squamous(63;1005 1117 15521 45762 47089)	Atlas-SNP	.											.	CXCR6	17	.	0			c.G1013A						PASS	.						72.0	69.0	70.0					3																	45988986		2203	4300	6503	SO:0001583	missense	10663	exon2			CCACCAGCATGTT	AF007545	CCDS2735.1	3p21	2012-08-08			ENSG00000172215	ENSG00000172215		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	16647	protein-coding gene	gene with protein product		605163				9166430, 9230441	Standard	XM_005264809		Approved	TYMSTR, STRL33, BONZO, CD186	uc003cpc.1	O00574	OTTHUMG00000133448	ENST00000458629.1:c.1013G>A	chr3.hg19:g.45988986G>A	ENSP00000395704:p.Ser338Asn	98.0	0.0	.		113.0	40.0	.	NM_006564	O00575|Q9HCA5	Missense_Mutation	SNP	ENST00000458629.1	hg19	CCDS2735.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580107	0.46006	.	.	ENSG00000172215	ENST00000438735;ENST00000304552;ENST00000458629;ENST00000457814	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.58	0.378	0.16204	.	0.374134	0.28940	N	0.013651	T	0.57184	0.2036	M	0.62723	1.935	0.30459	N	0.774467	B	0.10296	0.003	B	0.09377	0.004	T	0.55205	-0.8177	10	0.66056	D	0.02	.	6.2004	0.20573	0.275:0.3366:0.3884:0.0	.	338	O00574	CXCR6_HUMAN	N	338	ENSP00000396218:S338N;ENSP00000304414:S338N;ENSP00000395704:S338N;ENSP00000396886:S338N	ENSP00000304414:S338N	S	+	2	0	CXCR6	45963990	0.980000	0.34600	0.998000	0.56505	0.982000	0.71751	0.153000	0.16323	0.040000	0.15660	0.561000	0.74099	AGC	.	.	.	none		0.498	CXCR6-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344395.1		
PHF7	51533	hgsc.bcm.edu	37	3	52456291	52456291	+	Missense_Mutation	SNP	A	A	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:52456291A>G	ENST00000327906.3	+	9	1394	c.734A>G	c.(733-735)tAt>tGt	p.Y245C	PHF7_ENST00000347025.2_Intron	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7	245						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		TATCAGCGCTATCAGCACTGT	0.498																																					p.Y245C		Atlas-SNP	.											.	PHF7	29	.	0			c.A734G						PASS	.						98.0	94.0	95.0					3																	52456291		2203	4300	6503	SO:0001583	missense	51533	exon9			AGCGCTATCAGCA	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495	ENST00000327906.3:c.734A>G	chr3.hg19:g.52456291A>G	ENSP00000333024:p.Tyr245Cys	89.0	0.0	.		102.0	38.0	.	NM_016483	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	hg19	CCDS2854.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.70|19.70	3.876288|3.876288	0.72180|0.72180	.|.	.|.	ENSG00000010318|ENSG00000010318	ENST00000461861|ENST00000478707;ENST00000327906;ENST00000394916	.|T;T	.|0.09163	.|3.01;3.01	5.75|5.75	5.75|5.75	0.90469|0.90469	.|Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE/PHD-type (1);	.|0.120863	.|0.64402	.|D	.|0.000016	T|T	0.24470|0.24470	0.0593|0.0593	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|P	.|0.57371	.|0.819	T|T	0.00888|0.00888	-1.1526|-1.1526	5|10	.|0.34782	.|T	.|0.22	-0.6876|-0.6876	12.4509|12.4509	0.55677|0.55677	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|245	.|Q9BWX1	.|PHF7_HUMAN	V|C	205|245;245;154	.|ENSP00000419316:Y245C;ENSP00000333024:Y245C	.|ENSP00000333024:Y245C	I|Y	+|+	1|2	0|0	PHF7|PHF7	52431331|52431331	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.358000|5.358000	0.66064|0.66064	2.196000|2.196000	0.70406|0.70406	0.533000|0.533000	0.62120|0.62120	ATC|TAT	.	.	.	none		0.498	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
ABI3BP	25890	hgsc.bcm.edu	37	3	100565235	100565235	+	Silent	SNP	T	T	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:100565235T>C	ENST00000284322.5	-	18	1687	c.1578A>G	c.(1576-1578)gaA>gaG	p.E526E	ABI3BP_ENST00000383691.4_5'UTR|ABI3BP_ENST00000495063.1_Silent_p.E575E|ABI3BP_ENST00000471714.1_Silent_p.E575E	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	526	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TGTGTGTCACTTCTGGGCTGA	0.333																																					p.E526E		Atlas-SNP	.											.	ABI3BP	305	.	0			c.A1578G						PASS	.						74.0	69.0	71.0					3																	100565235		1807	4064	5871	SO:0001819	synonymous_variant	25890	exon18			TGTCACTTCTGGG	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1578A>G	chr3.hg19:g.100565235T>C		109.0	0.0	.		134.0	62.0	.	NM_015429	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Silent	SNP	ENST00000284322.5	hg19	CCDS46880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.023|7.023	0.559028|0.559028	0.13436|0.13436	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000495591;ENST00000528490;ENST00000533855|ENST00000466947	.|.	.|.	.|.	5.58|5.58	-1.95|-1.95	0.07548|0.07548	.|.	.|.	.|.	.|.	.|.	T|T	0.18509|0.18509	0.0444|0.0444	.|.	.|.	.|.	0.19300|0.19300	N|N	0.999973|0.999973	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.23797|0.23797	-1.0178|-1.0178	4|4	.|.	.|.	.|.	-1.12|-1.12	1.3054|1.3054	0.02087|0.02087	0.2159:0.1298:0.3307:0.3236|0.2159:0.1298:0.3307:0.3236	.|.	.|.	.|.	.|.	R|G	13;43;204|14	.|.	.|.	K|S	-|-	2|1	0|0	ABI3BP|ABI3BP	102047925|102047925	0.001000|0.001000	0.12720|0.12720	0.098000|0.098000	0.21074|0.21074	0.996000|0.996000	0.88848|0.88848	0.181000|0.181000	0.16880|0.16880	-0.457000|-0.457000	0.07033|0.07033	0.477000|0.477000	0.44152|0.44152	AAG|AGT	.	.	.	none		0.333	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1		
PLOD2	5352	hgsc.bcm.edu	37	3	145806425	145806425	+	Nonsense_Mutation	SNP	A	A	T	rs367818257		TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:145806425A>T	ENST00000360060.3	-	9	1130	c.953T>A	c.(952-954)tTg>tAg	p.L318*	RP11-274H2.2_ENST00000480247.1_RNA|PLOD2_ENST00000282903.5_Nonsense_Mutation_p.L318*|PLOD2_ENST00000461497.1_5'Flank|PLOD2_ENST00000494950.1_Nonsense_Mutation_p.L263*	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	318					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	CAGTGTCAACAATATGTCCAG	0.313																																					p.L318X		Atlas-SNP	.											.	PLOD2	81	.	0			c.T953A						PASS	.						84.0	79.0	81.0					3																	145806425		2202	4298	6500	SO:0001587	stop_gained	5352	exon9			GTCAACAATATGT	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.953T>A	chr3.hg19:g.145806425A>T	ENSP00000353170:p.Leu318*	386.0	1.0	.		434.0	187.0	.	NM_182943	B3KWS3|Q59ED2|Q8N170	Nonsense_Mutation	SNP	ENST00000360060.3	hg19	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	A	37	6.340514	0.97489	.	.	ENSG00000152952	ENST00000282903;ENST00000360060;ENST00000494950	.	.	.	5.33	5.33	0.75918	.	0.069303	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.431	15.3138	0.74056	1.0:0.0:0.0:0.0	.	.	.	.	X	318;318;263	.	ENSP00000282903:L318X	L	-	2	0	PLOD2	147289115	0.998000	0.40836	0.669000	0.29828	0.277000	0.26821	8.938000	0.92943	2.016000	0.59253	0.528000	0.53228	TTG	.	.	.	alt		0.313	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	
PRKCI	5584	hgsc.bcm.edu	37	3	170016826	170016826	+	Missense_Mutation	SNP	C	C	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:170016826C>A	ENST00000295797.4	+	17	1936	c.1631C>A	c.(1630-1632)tCt>tAt	p.S544Y		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	544	AGC-kinase C-terminal.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	CCAAATATTTCTGGGGAATTT	0.388																																					p.S544Y		Atlas-SNP	.											PRKCI,NS,carcinoma,0,1	PRKCI	82	.	0			c.C1631A						PASS	.						88.0	87.0	88.0					3																	170016826		2203	4300	6503	SO:0001583	missense	5584	exon17			ATATTTCTGGGGA		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.1631C>A	chr3.hg19:g.170016826C>A	ENSP00000295797:p.Ser544Tyr	99.0	0.0	.		140.0	70.0	.	NM_002740	D3DNQ4|Q8WW06	Missense_Mutation	SNP	ENST00000295797.4	hg19	CCDS3212.2	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739807	0.89573	.	.	ENSG00000163558	ENST00000295797	T	0.62639	0.01	5.22	5.22	0.72569	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.059408	0.64402	D	0.000001	T	0.67211	0.2869	L	0.52126	1.63	0.80722	D	1	D	0.57257	0.979	P	0.50860	0.652	T	0.66052	-0.6019	9	.	.	.	.	19.1471	0.93473	0.0:1.0:0.0:0.0	.	544	P41743	KPCI_HUMAN	Y	544	ENSP00000295797:S544Y	.	S	+	2	0	PRKCI	171499520	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.456000	0.80751	2.578000	0.87016	0.650000	0.86243	TCT	.	.	.	none		0.388	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3	NM_002740	
C4orf46	201725	hgsc.bcm.edu	37	4	159592804	159592804	+	Silent	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr4:159592804C>T	ENST00000379205.4	-	1	394	c.150G>A	c.(148-150)gtG>gtA	p.V50V	C4orf46_ENST00000508836.1_Intron|ETFDH_ENST00000307738.5_5'Flank|ETFDH_ENST00000511912.1_5'Flank|C4orf46_ENST00000508457.1_Silent_p.V50V	NM_001008393.2	NP_001008394.1	Q504U0	CD046_HUMAN	chromosome 4 open reading frame 46	50										kidney(1)|lung(3)|skin(1)	5						CCAGCTGGTCCACCGTTGGGC	0.692																																					p.V50V		Atlas-SNP	.											.	C4orf46	11	.	0			c.G150A						PASS	.						35.0	30.0	31.0					4																	159592804		2203	4300	6503	SO:0001819	synonymous_variant	201725	exon1			CTGGTCCACCGTT		CCDS34088.1	4q32.1	2014-07-30			ENSG00000205208	ENSG00000205208			27320	protein-coding gene	gene with protein product	"""renal cancer differentiation gene 1"""						Standard	NM_001008393		Approved	LOC201725, RCDG1	uc003iqa.3	Q504U0	OTTHUMG00000161919	ENST00000379205.4:c.150G>A	chr4.hg19:g.159592804C>T		236.0	0.0	.		226.0	100.0	.	NM_001008393	B3KNH7	Silent	SNP	ENST00000379205.4	hg19	CCDS34088.1																																																																																			.	.	.	none		0.692	C4orf46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366378.1	NM_001008393	
MFAP3L	9848	hgsc.bcm.edu	37	4	170913146	170913146	+	Missense_Mutation	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr4:170913146C>T	ENST00000361618.3	-	3	920	c.613G>A	c.(613-615)Gcc>Acc	p.A205T	MFAP3L_ENST00000393704.3_Missense_Mutation_p.A102T|RP11-6E9.4_ENST00000508955.1_RNA	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		ATGCGCTTGGCGATCTCAAAT	0.512																																					p.A205T		Atlas-SNP	.											MFAP3L,caecum,carcinoma,0,1	MFAP3L	59	.	0			c.G613A						PASS	.						135.0	140.0	138.0					4																	170913146		2203	4300	6503	SO:0001583	missense	9848	exon3			GCTTGGCGATCTC	AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.613G>A	chr4.hg19:g.170913146C>T	ENSP00000354583:p.Ala205Thr	137.0	0.0	.		122.0	44.0	.	NM_021647	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Missense_Mutation	SNP	ENST00000361618.3	hg19	CCDS34103.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710617	0.89112	.	.	ENSG00000198948	ENST00000393704;ENST00000361618;ENST00000512698	D;D;D	0.98835	-5.17;-1.96;-4.95	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.98887	0.9623	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99391	1.0925	10	0.34782	T	0.22	-32.4843	19.4847	0.95025	0.0:1.0:0.0:0.0	.	205	O75121	MFA3L_HUMAN	T	102;205;102	ENSP00000377307:A102T;ENSP00000354583:A205T;ENSP00000422791:A102T	ENSP00000354583:A205T	A	-	1	0	MFAP3L	171149721	1.000000	0.71417	0.999000	0.59377	0.846000	0.48090	7.818000	0.86416	2.602000	0.87976	0.555000	0.69702	GCC	.	.	.	none		0.512	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363043.2	NM_021647	
SV2C	22987	hgsc.bcm.edu	37	5	75427885	75427885	+	Missense_Mutation	SNP	G	G	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr5:75427885G>C	ENST00000502798.2	+	2	752	c.310G>C	c.(310-312)Gac>Cac	p.D104H	SV2C_ENST00000322285.7_Missense_Mutation_p.D104H	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	104					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		CCAAGCGAAGGACAGCATCGT	0.557																																					p.D104H		Atlas-SNP	.											.	SV2C	97	.	0			c.G310C						PASS	.						86.0	90.0	89.0					5																	75427885		2109	4241	6350	SO:0001583	missense	22987	exon2			GCGAAGGACAGCA	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.310G>C	chr5.hg19:g.75427885G>C	ENSP00000423541:p.Asp104His	117.0	0.0	.		123.0	49.0	.	NM_014979	Q496K1|Q9UPU8	Missense_Mutation	SNP	ENST00000502798.2	hg19	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.767148	0.49574	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.33216	1.42;1.42	5.76	5.76	0.90799	Major facilitator superfamily domain, general substrate transporter (1);	0.218772	0.47093	D	0.000256	T	0.37517	0.1006	L	0.51422	1.61	0.80722	D	1	P	0.41393	0.748	B	0.42882	0.401	T	0.06356	-1.0831	10	0.46703	T	0.11	-21.7026	19.9694	0.97278	0.0:0.0:1.0:0.0	.	104	Q496J9	SV2C_HUMAN	H	104	ENSP00000423541:D104H;ENSP00000316983:D104H	ENSP00000316983:D104H	D	+	1	0	SV2C	75463641	1.000000	0.71417	0.790000	0.31976	0.526000	0.34562	6.822000	0.75277	2.719000	0.93026	0.655000	0.94253	GAC	.	.	.	none		0.557	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4		
MEF2C	4208	hgsc.bcm.edu	37	5	88027620	88027620	+	Missense_Mutation	SNP	A	A	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr5:88027620A>C	ENST00000437473.2	-	7	1153	c.736T>G	c.(736-738)Tta>Gta	p.L246V	MEF2C_ENST00000514015.1_Missense_Mutation_p.L246V|MEF2C_ENST00000539796.1_Missense_Mutation_p.L198V|MEF2C_ENST00000508569.1_Missense_Mutation_p.L246V|MEF2C_ENST00000504921.2_Missense_Mutation_p.L246V|MEF2C_ENST00000510942.1_Missense_Mutation_p.L246V|MEF2C_ENST00000503554.1_5'Flank|MEF2C_ENST00000514028.1_Missense_Mutation_p.L246V|MEF2C_ENST00000340208.5_Missense_Mutation_p.L264V|MEF2C_ENST00000424173.2_Missense_Mutation_p.L244V|MEF2C_ENST00000506554.1_Missense_Mutation_p.L246V	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	246					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TTCATTCCTAAATTCATTGGG	0.428										HNSCC(66;0.2)																											p.L264V		Atlas-SNP	.											.	MEF2C	184	.	0			c.T790G						PASS	.						99.0	97.0	98.0					5																	88027620		1851	4087	5938	SO:0001583	missense	4208	exon9			TTCCTAAATTCAT	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.736T>G	chr5.hg19:g.88027620A>C	ENSP00000396219:p.Leu246Val	92.0	0.0	.		81.0	5.0	.	NM_001193347	C9JMZ0|D7F7N5|F8W7V7	Missense_Mutation	SNP	ENST00000437473.2	hg19	CCDS47245.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.856714	0.51376	.	.	ENSG00000081189	ENST00000340208;ENST00000424173;ENST00000504921;ENST00000514028;ENST00000437473;ENST00000510942;ENST00000506554;ENST00000508569;ENST00000514015;ENST00000539796	T;T;T;T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5	6.17	1.18	0.20946	.	0.000000	0.85682	D	0.000000	T	0.25717	0.0626	L	0.35644	1.08	0.52501	D	0.999959	B;P;P;P	0.45126	0.215;0.851;0.552;0.603	B;P;B;B	0.44447	0.071;0.45;0.257;0.421	T	0.02326	-1.1176	10	0.52906	T	0.07	-3.6707	9.8788	0.41220	0.5416:0.0:0.4584:0.0	.	244;264;246;246	C9JMZ0;F8W7V7;Q06413;Q06413-2	.;.;MEF2C_HUMAN;.	V	264;244;246;246;246;246;246;246;246;198	ENSP00000340874:L264V;ENSP00000389610:L244V;ENSP00000421925:L246V;ENSP00000426665:L246V;ENSP00000396219:L246V;ENSP00000422390:L246V;ENSP00000425636:L246V;ENSP00000423597:L246V;ENSP00000424606:L246V;ENSP00000441153:L198V	ENSP00000340874:L264V	L	-	1	2	MEF2C	88063376	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	0.696000	0.25541	0.204000	0.20548	0.533000	0.62120	TTA	.	.	.	none		0.428	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	
GPR98	84059	hgsc.bcm.edu	37	5	89949370	89949370	+	Missense_Mutation	SNP	G	G	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr5:89949370G>C	ENST00000405460.2	+	20	4075	c.3979G>C	c.(3979-3981)Gct>Cct	p.A1327P		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1327					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGGAACGGATGCTTTGTACTT	0.448																																					p.A1327P		Atlas-SNP	.											.	GPR98	605	.	0			c.G3979C						PASS	.						127.0	116.0	120.0					5																	89949370		1958	4141	6099	SO:0001583	missense	84059	exon20			ACGGATGCTTTGT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.3979G>C	chr5.hg19:g.89949370G>C	ENSP00000384582:p.Ala1327Pro	149.0	0.0	.		151.0	69.0	.	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.091508|4.091508	0.76756|0.76756	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043|ENST00000504142	T|.	0.03441|.	3.93|.	5.38|5.38	5.38|5.38	0.77491|0.77491	Concanavalin A-like lectin/glucanase (1);|.	0.147481|.	0.64402|.	D|.	0.000008|.	T|T	0.75170|0.75170	0.3813|0.3813	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	D|.	0.63046|.	0.992|.	D|.	0.64410|.	0.925|.	T|T	0.72896|0.72896	-0.4153|-0.4153	10|5	0.51188|.	T|.	0.08|.	.|.	19.4938|19.4938	0.95064|0.95064	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1327|.	Q8WXG9|.	GPR98_HUMAN|.	P|S	1327|915	ENSP00000384582:A1327P|.	ENSP00000296619:A1327P|.	A|C	+|+	1|2	0|0	GPR98|GPR98	89985126|89985126	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.952000|0.952000	0.60782|0.60782	6.159000|6.159000	0.71856|0.71856	2.691000|2.691000	0.91804|0.91804	0.650000|0.650000	0.86243|0.86243	GCT|TGC	.	.	.	none		0.448	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
FGFR4	2264	hgsc.bcm.edu	37	5	176518791	176518791	+	Missense_Mutation	SNP	T	T	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr5:176518791T>C	ENST00000292408.4	+	6	954	c.709T>C	c.(709-711)Tac>Cac	p.Y237H	FGFR4_ENST00000393637.1_Missense_Mutation_p.Y237H|FGFR4_ENST00000393648.2_Missense_Mutation_p.Y237H|FGFR4_ENST00000292410.3_Missense_Mutation_p.Y237H|FGFR4_ENST00000502906.1_Missense_Mutation_p.Y237H	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	237	Ig-like C2-type 2.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	CCGCTATAACTACCTGCTAGA	0.617										TSP Lung(9;0.080)																											p.Y237H		Atlas-SNP	.											.	FGFR4	174	.	0			c.T709C						PASS	.						90.0	81.0	84.0					5																	176518791		2203	4300	6503	SO:0001583	missense	2264	exon5			TATAACTACCTGC	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.709T>C	chr5.hg19:g.176518791T>C	ENSP00000292408:p.Tyr237His	91.0	0.0	.		86.0	29.0	.	NM_022963	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	hg19	CCDS4410.1	.	.	.	.	.	.	.	.	.	.	T	15.66	2.900458	0.52227	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	4.13	4.13	0.48395	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.49440	0.1557	L	0.55103	1.725	0.53005	D	0.999962	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.997;0.999	T	0.52756	-0.8533	10	0.87932	D	0	.	13.2525	0.60060	0.0:0.0:0.0:1.0	.	237;237;237;237	B5A965;B4DVP5;P22455-2;P22455	.;.;.;FGFR4_HUMAN	H	237;237;237;237;237;349	ENSP00000292408:Y237H;ENSP00000377259:Y237H;ENSP00000424960:Y237H;ENSP00000292410:Y237H;ENSP00000377254:Y237H	ENSP00000292408:Y237H	Y	+	1	0	FGFR4	176451397	1.000000	0.71417	0.994000	0.49952	0.090000	0.18270	7.825000	0.86693	1.867000	0.54127	0.402000	0.26972	TAC	.	.	.	none		0.617	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1		
SLC22A1	6580	hgsc.bcm.edu	37	6	160560884	160560884	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr6:160560884A>T	ENST00000366963.4	+	7	1408	c.1261A>T	c.(1261-1263)Att>Ttt	p.I421F	SLC22A1_ENST00000324965.4_Missense_Mutation_p.I421F|SLC22A1_ENST00000457470.2_Missense_Mutation_p.I421F	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	421					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)		SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	CCTCGTCATGATTTTTATCTC	0.527																																					p.I421F		Atlas-SNP	.											SLC22A1,colon,carcinoma,0,1	SLC22A1	69	.	0			c.A1261T						PASS	.						62.0	58.0	59.0					6																	160560884		2203	4299	6502	SO:0001583	missense	6580	exon7			GTCATGATTTTTA	U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.1261A>T	chr6.hg19:g.160560884A>T	ENSP00000355930:p.Ile421Phe	35.0	2.0	.		32.0	4.0	.	NM_153187	A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Missense_Mutation	SNP	ENST00000366963.4	hg19	CCDS5274.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634717	0.47049	.	.	ENSG00000175003	ENST00000366963;ENST00000324965;ENST00000457470	T;T;T	0.73469	-0.75;0.32;0.32	5.08	-10.2	0.00374	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.782081	0.11578	N	0.550023	T	0.46756	0.1409	M	0.66439	2.03	0.09310	N	0.999999	P;B	0.39940	0.696;0.302	B;B	0.38921	0.254;0.285	T	0.47509	-0.9112	10	0.29301	T	0.29	.	12.514	0.56021	0.1707:0.2871:0.5423:0.0	.	421;421	O15245-2;O15245	.;S22A1_HUMAN	F	421	ENSP00000355930:I421F;ENSP00000318103:I421F;ENSP00000409557:I421F	ENSP00000318103:I421F	I	+	1	0	SLC22A1	160480874	0.104000	0.21937	0.003000	0.11579	0.012000	0.07955	0.127000	0.15790	-2.186000	0.00760	-0.441000	0.05720	ATT	.	.	.	none		0.527	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042938.2		
FAM20C	56975	hgsc.bcm.edu	37	7	208933	208933	+	Missense_Mutation	SNP	A	A	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr7:208933A>G	ENST00000313766.5	+	3	1051	c.820A>G	c.(820-822)Atg>Gtg	p.M274V		NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	274				MTFQNYGQALFKPMK -> FLSDKPFLFLSCFLR (in Ref. 6; CAB99089). {ECO:0000305}.	dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		GAAGCTCATCATGACCTTCCA	0.612																																					p.M274V		Atlas-SNP	.											.	FAM20C	18	.	0			c.A820G						PASS	.						52.0	58.0	56.0					7																	208933		2076	4193	6269	SO:0001583	missense	56975	exon3			CTCATCATGACCT	BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.820A>G	chr7.hg19:g.208933A>G	ENSP00000322323:p.Met274Val	84.0	0.0	.		112.0	36.0	.	NM_020223	A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Missense_Mutation	SNP	ENST00000313766.5	hg19	CCDS47522.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.391528	0.42410	.	.	ENSG00000177706	ENST00000313766	T	0.75938	-0.98	5.23	4.06	0.47325	.	0.000000	0.64402	D	0.000003	T	0.66208	0.2766	L	0.54965	1.715	0.47584	D	0.999468	B	0.22983	0.078	B	0.20577	0.03	T	0.61959	-0.6955	10	0.51188	T	0.08	.	6.9119	0.24340	0.6948:0.1559:0.0:0.1493	.	274	Q8IXL6	DMP4_HUMAN	V	274	ENSP00000322323:M274V	ENSP00000322323:M274V	M	+	1	0	FAM20C	304016	1.000000	0.71417	0.996000	0.52242	0.974000	0.67602	5.854000	0.69503	0.806000	0.34183	0.533000	0.62120	ATG	.	.	.	none		0.612	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322476.2	NM_020223	
TNS3	64759	hgsc.bcm.edu	37	7	47451362	47451362	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr7:47451362A>T	ENST00000398879.1	-	13	1052	c.686T>A	c.(685-687)gTc>gAc	p.V229D	TNS3_ENST00000442536.2_Missense_Mutation_p.V229D|TNS3_ENST00000355730.3_Missense_Mutation_p.V229D|TNS3_ENST00000311160.9_Missense_Mutation_p.V229D|TNS3_ENST00000458317.2_Missense_Mutation_p.V229D			Q68CZ2	TENS3_HUMAN	tensin 3	229	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						CGGCTCGATGACGATGCAGAT	0.522																																					p.V229D		Atlas-SNP	.											.	TNS3	140	.	0			c.T686A						PASS	.						67.0	74.0	72.0					7																	47451362		2036	4178	6214	SO:0001583	missense	64759	exon13			TCGATGACGATGC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.686T>A	chr7.hg19:g.47451362A>T	ENSP00000381854:p.Val229Asp	116.0	0.0	.		160.0	102.0	.	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	hg19	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	a	8.595	0.885502	0.17540	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000457718;ENST00000450444;ENST00000442536;ENST00000458317	D;D;D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16	5.17	0.24	0.15489	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.537282	0.20705	N	0.087184	T	0.77343	0.4116	L	0.29908	0.895	0.19300	N	0.999977	B;B	0.21071	0.043;0.051	B;B	0.24006	0.049;0.05	T	0.61594	-0.7031	10	0.29301	T	0.29	-17.3607	9.5619	0.39373	0.3035:0.0:0.6965:0.0	.	229;229	Q68CZ2-4;Q68CZ2	.;TENS3_HUMAN	D	229;339;229;229;332;318;229;229	ENSP00000312143:V229D;ENSP00000381854:V229D;ENSP00000347968:V229D;ENSP00000414358:V332D;ENSP00000396914:V318D;ENSP00000389285:V229D;ENSP00000388318:V229D	ENSP00000312143:V229D	V	-	2	0	TNS3	47417887	0.924000	0.31332	0.001000	0.08648	0.372000	0.29890	1.604000	0.36804	-0.257000	0.09459	-1.216000	0.01612	GTC	.	.	.	none		0.522	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
PTCD1	26024	hgsc.bcm.edu	37	7	99023210	99023210	+	Silent	SNP	T	T	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr7:99023210T>C	ENST00000292478.4	-	6	1195	c.945A>G	c.(943-945)ctA>ctG	p.L315L	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.L364L|PTCD1_ENST00000555673.1_Silent_p.L364L	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	315					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GGCTCGGCTGTAGCCCTAGAC	0.647																																					p.L364L		Atlas-SNP	.											.	.	.	.	0			c.A1092G						PASS	.						11.0	11.0	11.0					7																	99023210		2179	4271	6450	SO:0001819	synonymous_variant	100526740	exon7			CGGCTGTAGCCCT	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.945A>G	chr7.hg19:g.99023210T>C		64.0	0.0	.		70.0	37.0	.	NM_001198879	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	ENST00000292478.4	hg19	CCDS34691.1																																																																																			.	.	.	none		0.647	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
MET	4233	hgsc.bcm.edu	37	7	116417457	116417457	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr7:116417457G>A	ENST00000318493.6	+	16	3515	c.3328G>A	c.(3328-3330)Gta>Ata	p.V1110I	MET_ENST00000539704.1_5'UTR|MET_ENST00000397752.3_Missense_Mutation_p.V1092I			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTTGGTTGTGTATATCATGG	0.338			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.V1110I		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET	412	.	0			c.G3328A	GRCh37	CM990852	MET	M		PASS	.						191.0	176.0	180.0					7																	116417457		1827	4084	5911	SO:0001583	missense	4233	exon16	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GGTTGTGTATATC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3328G>A	chr7.hg19:g.116417457G>A	ENSP00000317272:p.Val1110Ile	140.0	0.0	.		153.0	95.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834124	0.91036	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	T;T	0.64991	-0.13;-0.13	5.16	5.16	0.70880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81178	0.4768	M	0.80422	2.495	0.80722	D	1	D;D	0.76494	0.999;0.99	D;D	0.85130	0.997;0.99	D	0.83726	0.0195	10	0.87932	D	0	.	19.0107	0.92871	0.0:0.0:1.0:0.0	.	1110;1092	P08581-2;P08581	.;MET_HUMAN	I	1092;1110	ENSP00000380860:V1092I;ENSP00000317272:V1110I	ENSP00000317272:V1110I	V	+	1	0	MET	116204693	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.813000	0.99286	2.560000	0.86352	0.563000	0.77884	GTA	.	.	.	none		0.338	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
BMP1	649	hgsc.bcm.edu	37	8	22069171	22069171	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr8:22069171T>G	ENST00000306385.5	+	20	3561	c.2891T>G	c.(2890-2892)aTc>aGc	p.I964S	BMP1_ENST00000354870.5_3'UTR	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	964	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		GATGACACCATCACCAAAAAA	0.567																																					p.I964S		Atlas-SNP	.											.	BMP1	131	.	0			c.T2891G						PASS	.						142.0	119.0	127.0					8																	22069171		2203	4300	6503	SO:0001583	missense	649	exon20			ACACCATCACCAA		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.2891T>G	chr8.hg19:g.22069171T>G	ENSP00000305714:p.Ile964Ser	79.0	0.0	.		88.0	35.0	.	NM_006129	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	ENST00000306385.5	hg19	CCDS6026.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.970260	0.74246	.	.	ENSG00000168487	ENST00000306385	T	0.34072	1.38	4.7	4.7	0.59300	CUB (5);	0.000000	0.37012	U	0.002298	T	0.48822	0.1521	M	0.74881	2.28	0.80722	D	1	P	0.39748	0.686	P	0.48334	0.574	T	0.48603	-0.9021	10	0.38643	T	0.18	.	13.295	0.60292	0.0:0.0:0.0:1.0	.	964	P13497	BMP1_HUMAN	S	964	ENSP00000305714:I964S	ENSP00000305714:I964S	I	+	2	0	BMP1	22125116	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.848000	0.86902	1.977000	0.57605	0.533000	0.62120	ATC	.	.	.	none		0.567	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	NM_006132	
LYN	4067	hgsc.bcm.edu	37	8	56922657	56922657	+	Missense_Mutation	SNP	G	G	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr8:56922657G>C	ENST00000519728.1	+	13	1823	c.1527G>C	c.(1525-1527)caG>caC	p.Q509H	LYN_ENST00000520220.2_Missense_Mutation_p.Q488H	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	509					B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	GGCAATACCAGCAGCAGCCTT	0.483																																					p.Q509H		Atlas-SNP	.											.	LYN	54	.	0			c.G1527C						PASS	.						72.0	69.0	70.0					8																	56922657		2203	4300	6503	SO:0001583	missense	4067	exon13			ATACCAGCAGCAG	M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1527G>C	chr8.hg19:g.56922657G>C	ENSP00000428924:p.Gln509His	187.0	0.0	.		173.0	59.0	.	NM_002350	A0AVQ5	Missense_Mutation	SNP	ENST00000519728.1	hg19	CCDS6162.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963785	0.74131	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	T;T	0.75050	-0.86;-0.9	5.95	2.85	0.33270	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79656	0.4483	L	0.55990	1.75	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.984	T	0.77923	-0.2406	10	0.59425	D	0.04	.	7.0536	0.25087	0.4347:0.0:0.5652:0.0	.	579;509	Q6NUK7;P07948	.;LYN_HUMAN	H	509;488	ENSP00000428924:Q509H;ENSP00000428424:Q488H	ENSP00000428924:Q509H	Q	+	3	2	LYN	57085211	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	1.705000	0.37867	0.863000	0.35553	0.655000	0.94253	CAG	.	.	.	none		0.483	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378155.1	NM_002350	
LYN	4067	hgsc.bcm.edu	37	8	56922659	56922659	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr8:56922659A>T	ENST00000519728.1	+	13	1825	c.1529A>T	c.(1528-1530)cAg>cTg	p.Q510L	LYN_ENST00000520220.2_Missense_Mutation_p.Q489L	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	510					B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	CAATACCAGCAGCAGCCTTAG	0.483																																					p.Q510L		Atlas-SNP	.											.	LYN	54	.	0			c.A1529T						PASS	.						70.0	68.0	68.0					8																	56922659		2203	4300	6503	SO:0001583	missense	4067	exon13			ACCAGCAGCAGCC	M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1529A>T	chr8.hg19:g.56922659A>T	ENSP00000428924:p.Gln510Leu	184.0	0.0	.		171.0	59.0	.	NM_002350	A0AVQ5	Missense_Mutation	SNP	ENST00000519728.1	hg19	CCDS6162.1	.	.	.	.	.	.	.	.	.	.	A	15.60	2.882332	0.51908	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	T;T	0.74315	-0.78;-0.83	5.95	5.95	0.96441	Protein kinase-like domain (1);	0.050322	0.85682	D	0.000000	T	0.50171	0.1600	N	0.01352	-0.895	0.80722	D	1	B;B	0.10296	0.003;0.002	B;B	0.12837	0.008;0.004	T	0.50642	-0.8804	10	0.37606	T	0.19	.	16.4237	0.83790	1.0:0.0:0.0:0.0	.	580;510	Q6NUK7;P07948	.;LYN_HUMAN	L	510;489	ENSP00000428924:Q510L;ENSP00000428424:Q489L	ENSP00000428924:Q510L	Q	+	2	0	LYN	57085213	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	6.107000	0.71517	2.279000	0.76181	0.533000	0.62120	CAG	.	.	.	none		0.483	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378155.1	NM_002350	
DECR1	1666	hgsc.bcm.edu	37	8	91055027	91055027	+	Splice_Site	SNP	A	A	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr8:91055027A>C	ENST00000220764.2	+	7	825	c.737A>C	c.(736-738)aAa>aCa	p.K246T	DECR1_ENST00000522161.1_Splice_Site_p.K237T	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	246					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.K246T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			ATAAAAACCAAAGTAAGTTGT	0.338																																					p.K246T		Atlas-SNP	.											DECR1,colon,carcinoma,0,1	DECR1	37	.	1	Substitution - Missense(1)	large_intestine(1)	c.A737C						PASS	.						159.0	152.0	155.0					8																	91055027		2203	4300	6503	SO:0001630	splice_region_variant	1666	exon7			AAACCAAAGTAAG	L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.738+1A>C	chr8.hg19:g.91055027A>C		64.0	0.0	.		79.0	35.0	.	NM_001359	B7Z6B8|Q2M304|Q93085	Missense_Mutation	SNP	ENST00000220764.2	hg19	CCDS6250.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.763756	0.49574	.	.	ENSG00000104325	ENST00000220764;ENST00000522161	T;T	0.22134	1.97;1.97	5.24	5.24	0.73138	NAD(P)-binding domain (1);	0.044737	0.85682	D	0.000000	T	0.32941	0.0846	N	0.26042	0.785	0.80722	D	1	D;B	0.76494	0.999;0.06	D;B	0.76575	0.988;0.224	T	0.04723	-1.0931	10	0.35671	T	0.21	.	15.4185	0.74991	1.0:0.0:0.0:0.0	.	237;246	B7Z6B8;Q16698	.;DECR_HUMAN	T	246;237	ENSP00000220764:K246T;ENSP00000429779:K237T	ENSP00000220764:K246T	K	+	2	0	DECR1	91124203	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.733000	0.91539	2.109000	0.64355	0.528000	0.53228	AAA	.	.	.	none		0.338	DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375822.1		Missense_Mutation
RBM12B	389677	hgsc.bcm.edu	37	8	94748429	94748429	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr8:94748429C>G	ENST00000399300.2	-	3	423	c.210G>C	c.(208-210)gaG>gaC	p.E70D	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.E70D|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	70							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TAAGAAAGAGCTCTACAGATG	0.443																																					p.E70D		Atlas-SNP	.											.	RBM12B	78	.	0			c.G210C						PASS	.						180.0	171.0	174.0					8																	94748429		1831	4091	5922	SO:0001583	missense	389677	exon3			AAAGAGCTCTACA		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.210G>C	chr8.hg19:g.94748429C>G	ENSP00000382239:p.Glu70Asp	100.0	0.0	.		105.0	45.0	.	NM_203390	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	hg19	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574938	0.45902	.	.	ENSG00000183808	ENST00000399300;ENST00000517700;ENST00000519109;ENST00000518597;ENST00000520560;ENST00000521947	T;T;T;T;T;T	0.34667	2.57;2.6;1.8;1.84;1.96;1.35	5.71	3.92	0.45320	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.64402	D	0.000018	T	0.48150	0.1484	M	0.63428	1.95	0.31929	N	0.612458	P	0.38223	0.623	P	0.49953	0.627	T	0.59139	-0.7510	10	0.56958	D	0.05	-22.8351	11.8401	0.52348	0.0:0.8573:0.0:0.1427	.	70	Q8IXT5	RB12B_HUMAN	D	70	ENSP00000382239:E70D;ENSP00000427729:E70D;ENSP00000430474:E70D;ENSP00000428269:E70D;ENSP00000429807:E70D;ENSP00000430466:E70D	ENSP00000382239:E70D	E	-	3	2	RBM12B	94817605	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.543000	0.23237	0.764000	0.33197	0.655000	0.94253	GAG	.	.	.	none		0.443	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390	
RC3H2	54542	hgsc.bcm.edu	37	9	125612011	125612011	+	Silent	SNP	G	G	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr9:125612011G>C	ENST00000373670.1	-	20	4071	c.3471C>G	c.(3469-3471)acC>acG	p.T1157T	RC3H2_ENST00000357244.2_Silent_p.T1157T			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	1157					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						TGACAGATGTGGTGATGGGGA	0.423																																					p.T1157T		Atlas-SNP	.											.	RC3H2	150	.	0			c.C3471G						PASS	.						79.0	75.0	76.0					9																	125612011		1888	4136	6024	SO:0001819	synonymous_variant	54542	exon21			AGATGTGGTGATG	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.3471C>G	chr9.hg19:g.125612011G>C		187.0	0.0	.		150.0	58.0	.	NM_001100588	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Silent	SNP	ENST00000373670.1	hg19	CCDS43874.1																																																																																			.	.	.	none		0.423	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835	
ANXA7	310	hgsc.bcm.edu	37	10	75156296	75156296	+	Missense_Mutation	SNP	T	T	G	rs534428824	byFrequency	TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr10:75156296T>G	ENST00000372921.5	-	5	472	c.416A>C	c.(415-417)cAa>cCa	p.Q139P	ANXA7_ENST00000535178.1_Missense_Mutation_p.Q9P|ANXA7_ENST00000492380.1_5'UTR	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	139	Repeat-rich region.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					GTAAGTAGGTTGTCCTCCAGG	0.393																																					p.Q139P		Atlas-SNP	.											.	ANXA7	50	.	0			c.A416C						PASS	.						73.0	68.0	70.0					10																	75156296		2203	4300	6503	SO:0001583	missense	310	exon5			GTAGGTTGTCCTC	J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.416A>C	chr10.hg19:g.75156296T>G	ENSP00000362012:p.Gln139Pro	324.0	0.0	.		355.0	149.0	.	NM_004034	Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	ENST00000372921.5	hg19	CCDS7325.1	.	.	.	.	.	.	.	.	.	.	T	11.46	1.645066	0.29246	.	.	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178;ENST00000394847	T;T;T	0.04706	3.57;4.44;3.57	5.45	4.29	0.51040	.	1.042900	0.07566	N	0.917788	T	0.06735	0.0172	L	0.29908	0.895	0.35337	D	0.786159	B;P;P;P;B	0.49090	0.003;0.867;0.778;0.919;0.003	B;B;B;P;B	0.47044	0.001;0.334;0.184;0.535;0.006	T	0.41413	-0.9510	10	0.21540	T	0.41	.	9.6326	0.39789	0.0:0.0:0.1757:0.8243	.	139;139;66;139;139	Q53HM8;B2R7L2;B4DWU2;P20073-2;P20073	.;.;.;.;ANXA7_HUMAN	P	139;139;9;139	ENSP00000362012:Q139P;ENSP00000362010:Q139P;ENSP00000442864:Q9P	ENSP00000362010:Q139P	Q	-	2	0	ANXA7	74826302	0.985000	0.35326	0.960000	0.40013	0.982000	0.71751	2.182000	0.42556	0.967000	0.38186	0.528000	0.53228	CAA	.	.	.	none		0.393	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048646.2	NM_001156	
PSMD13	5719	hgsc.bcm.edu	37	11	244701	244701	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr11:244701C>G	ENST00000532097.1	+	6	840	c.336C>G	c.(334-336)atC>atG	p.I112M	PSMD13_ENST00000431206.2_Missense_Mutation_p.I114M|PSMD13_ENST00000352303.5_Missense_Mutation_p.I112M	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	112					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		AGGCAGTGATCCTGTGTAAAA	0.373																																					p.I114M		Atlas-SNP	.											.	PSMD13	53	.	0			c.C342G						PASS	.						92.0	95.0	94.0					11																	244701		2203	4300	6503	SO:0001583	missense	5719	exon4			AGTGATCCTGTGT	AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.336C>G	chr11.hg19:g.244701C>G	ENSP00000436186:p.Ile112Met	377.0	0.0	.		359.0	143.0	.	NM_175932	B3KT15|O75831|Q53XU2|Q9UNV3	Missense_Mutation	SNP	ENST00000532097.1	hg19	CCDS7692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.95|16.95	3.262842|3.262842	0.59431|0.59431	.|.	.|.	ENSG00000185627|ENSG00000185627	ENST00000532097;ENST00000538343;ENST00000431206;ENST00000528906;ENST00000352303|ENST00000526783	T;T;T;T|.	0.20463|.	2.12;2.07;2.1;2.11|.	5.6|5.6	3.74|3.74	0.42951|0.42951	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72771|0.72771	0.3502|0.3502	M|M	0.83483|0.83483	2.645|2.645	0.51233|0.51233	D|D	0.999919|0.999919	D;P;D;D|.	0.76494|.	0.999;0.941;0.963;0.963|.	D;P;P;P|.	0.71870|.	0.975;0.804;0.74;0.74|.	T|T	0.72401|0.72401	-0.4305|-0.4305	10|5	0.48119|.	T|.	0.1|.	.|.	8.8689|8.8689	0.35303|0.35303	0.0:0.7051:0.0:0.2949|0.0:0.7051:0.0:0.2949	.|.	114;47;112;112|.	Q9UNM6-2;B4DJ66;B2RBM7;Q9UNM6|.	.;.;.;PSD13_HUMAN|.	M|C	112;47;114;74;112|23	ENSP00000436186:I112M;ENSP00000396937:I114M;ENSP00000433364:I74M;ENSP00000333811:I112M|.	ENSP00000333811:I112M|.	I|S	+|+	3|2	3|0	PSMD13|PSMD13	234701|234701	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	1.777000|1.777000	0.38604|0.38604	0.852000|0.852000	0.35287|0.35287	-0.253000|-0.253000	0.11424|0.11424	ATC|TCC	.	.	.	none		0.373	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2	NM_002817	
OR51A7	119687	hgsc.bcm.edu	37	11	4929473	4929473	+	Missense_Mutation	SNP	T	T	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr11:4929473T>A	ENST00000359350.4	+	1	874	c.874T>A	c.(874-876)Tgt>Agt	p.C292S	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CATTGTGTACTGTGTAAAGAC	0.418																																					p.C292S		Atlas-SNP	.											.	OR51A7	86	.	0			c.T874A						PASS	.						133.0	126.0	128.0					11																	4929473		2201	4298	6499	SO:0001583	missense	119687	exon1			GTGTACTGTGTAA	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.874T>A	chr11.hg19:g.4929473T>A	ENSP00000352305:p.Cys292Ser	116.0	0.0	.		102.0	44.0	.	NM_001004749	Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	hg19	CCDS31364.1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.092179	0.00364	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.35236	1.32	5.02	5.02	0.67125	.	0.128592	0.36200	N	0.002737	T	0.12944	0.0314	N	0.04018	-0.295	0.26535	N	0.974196	B	0.12630	0.006	B	0.14578	0.011	T	0.33752	-0.9856	10	0.02654	T	1	.	5.9373	0.19173	0.1627:0.0:0.1696:0.6677	.	292	Q8NH64	O51A7_HUMAN	S	292;292;281	ENSP00000352305:C292S	ENSP00000352305:C292S	C	+	1	0	OR51A7	4886049	0.000000	0.05858	0.998000	0.56505	0.134000	0.20937	-1.501000	0.02281	2.098000	0.63641	0.533000	0.62120	TGT	.	.	.	none		0.418	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749	
ELP4	26610	hgsc.bcm.edu	37	11	31531372	31531372	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr11:31531372C>G	ENST00000350638.5	+	1	76	c.41C>G	c.(40-42)aCt>aGt	p.T14S	IMMP1L_ENST00000526776.1_5'Flank|ELP4_ENST00000395934.2_Missense_Mutation_p.T14S|IMMP1L_ENST00000532287.1_5'Flank|ELP4_ENST00000379163.5_Missense_Mutation_p.T14S|IMMP1L_ENST00000528161.1_5'Flank|IMMP1L_ENST00000533642.1_5'Flank|IMMP1L_ENST00000534812.1_5'Flank|IMMP1L_ENST00000278200.1_5'Flank	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	14					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					GCCGCGAGTACTGGGTCTGCA	0.592																																					p.T14S		Atlas-SNP	.											.	ELP4	78	.	0			c.C41G						PASS	.						43.0	50.0	47.0					11																	31531372		2108	4240	6348	SO:0001583	missense	26610	exon1			CGAGTACTGGGTC	AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.41C>G	chr11.hg19:g.31531372C>G	ENSP00000298937:p.Thr14Ser	114.0	0.0	.		88.0	45.0	.	NM_019040	B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	ENST00000350638.5	hg19	CCDS7875.2	.	.	.	.	.	.	.	.	.	.	C	6.234	0.411373	0.11812	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.43294	1.01;0.95;1.52	5.32	-0.0982	0.13629	.	1.001760	0.08046	N	0.995845	T	0.17280	0.0415	N	0.11427	0.14	0.09310	N	1	B;B;B	0.10296	0.0;0.003;0.0	B;B;B	0.10450	0.001;0.005;0.001	T	0.25152	-1.0140	10	0.06494	T	0.89	-13.6166	2.3958	0.04389	0.1418:0.4226:0.2756:0.16	.	14;14;14	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	S	14	ENSP00000298937:T14S;ENSP00000368461:T14S;ENSP00000379267:T14S	ENSP00000298937:T14S	T	+	2	0	ELP4	31487948	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.092000	0.11129	-0.191000	0.10448	-0.263000	0.10527	ACT	.	.	.	none		0.592	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	NM_019040	
DAGLA	747	hgsc.bcm.edu	37	11	61507009	61507009	+	Missense_Mutation	SNP	C	C	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr11:61507009C>A	ENST00000257215.5	+	17	1845	c.1729C>A	c.(1729-1731)Ctg>Atg	p.L577M		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	577					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		GGTGACCACCCTGGCCAGCAC	0.657																																					p.L577M		Atlas-SNP	.											.	DAGLA	109	.	0			c.C1729A						PASS	.						131.0	117.0	122.0					11																	61507009		2202	4299	6501	SO:0001583	missense	747	exon17			ACCACCCTGGCCA	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1729C>A	chr11.hg19:g.61507009C>A	ENSP00000257215:p.Leu577Met	97.0	0.0	.		73.0	35.0	.	NM_006133	A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	hg19	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.703596	0.30232	.	.	ENSG00000134780	ENST00000257215	T	0.25414	1.8	4.23	1.89	0.25635	.	0.239340	0.36519	N	0.002560	T	0.13030	0.0316	L	0.27053	0.805	0.29500	N	0.854976	B	0.06786	0.001	B	0.06405	0.002	T	0.07290	-1.0780	10	0.33940	T	0.23	-13.8817	1.9957	0.03455	0.3039:0.3924:0.1987:0.105	.	577	Q9Y4D2	DGLA_HUMAN	M	577	ENSP00000257215:L577M	ENSP00000257215:L577M	L	+	1	2	DAGLA	61263585	0.797000	0.28877	0.985000	0.45067	0.968000	0.65278	1.386000	0.34419	0.875000	0.35847	0.462000	0.41574	CTG	.	.	.	none		0.657	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
C11orf48	79081	hgsc.bcm.edu	37	11	62432403	62432403	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr11:62432403G>A	ENST00000431002.2	-	3	2392	c.659C>T	c.(658-660)tCg>tTg	p.S220L	C11orf48_ENST00000354588.3_Missense_Mutation_p.S194L|C11orf48_ENST00000525675.1_Missense_Mutation_p.R28W|C11orf48_ENST00000524958.1_Missense_Mutation_p.R28W|C11orf48_ENST00000532208.1_Missense_Mutation_p.S194L|RP11-831H9.11_ENST00000528405.1_Missense_Mutation_p.R28W|METTL12_ENST00000532971.1_5'Flank|SNORA57_ENST00000383870.1_RNA			Q9BQE6	CK048_HUMAN	chromosome 11 open reading frame 48	220										endometrium(1)|lung(5)|urinary_tract(1)	7						CGCCGCTCCCGATTCAACACC	0.632																																					p.S194L		Atlas-SNP	.											.	C11orf48	18	.	0			c.C581T						PASS	.						27.0	28.0	28.0					11																	62432403		2202	4297	6499	SO:0001583	missense	79081	exon5			GCTCCCGATTCAA	BC001434	CCDS8028.1	11q12.3	2014-02-12			ENSG00000162194	ENSG00000162194			28351	protein-coding gene	gene with protein product						12477932	Standard	NM_024099		Approved	MGC2477	uc001nuf.3	Q9BQE6	OTTHUMG00000167588	ENST00000431002.2:c.659C>T	chr11.hg19:g.62432403G>A	ENSP00000416856:p.Ser220Leu	76.0	0.0	.		95.0	36.0	.	NM_024099	Q96NA4	Missense_Mutation	SNP	ENST00000431002.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.124301|4.124301	0.77436|0.77436	.|.	.|.	ENSG00000255432;ENSG00000162194;ENSG00000162194;ENSG00000162194|ENSG00000162194	ENST00000528405;ENST00000524958;ENST00000525675;ENST00000415855|ENST00000354588;ENST00000431002;ENST00000532208	.|.	.|.	.|.	4.84|4.84	3.9|3.9	0.45041|0.45041	.|.	.|.	.|.	.|.	.|.	T|T	0.21227|0.21227	0.0511|0.0511	N|N	0.14661|0.14661	0.345|0.345	0.27538|0.27538	N|N	0.950884|0.950884	.|B	.|0.33904	.|0.431	.|B	.|0.26770	.|0.073	T|T	0.08006|0.08006	-1.0743|-1.0743	6|8	0.87932|0.40728	D|T	0|0.16	-1.3326|-1.3326	12.4856|12.4856	0.55871|0.55871	0.0:0.0:0.825:0.175|0.0:0.0:0.825:0.175	.|.	.|194	.|Q9BQE6-2	.|.	W|L	28;28;28;64|194;220;194	.|.	ENSP00000410979:R64W|ENSP00000346600:S194L	R|S	-|-	1|2	2|0	C11orf48;RP11-831H9.11|C11orf48	62188979|62188979	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.497000|0.497000	0.33675|0.33675	1.639000|1.639000	0.37176|0.37176	1.307000|1.307000	0.44944|0.44944	0.655000|0.655000	0.94253|0.94253	CGG|TCG	.	.	.	none		0.632	C11orf48-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000395233.1	NM_024099	
GNG3	2785	hgsc.bcm.edu	37	11	62474607	62474607	+	5'Flank	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr11:62474607G>A	ENST00000294117.5	+	0	0				BSCL2_ENST00000433053.1_Nonsense_Mutation_p.Q21*|BSCL2_ENST00000405837.1_Nonsense_Mutation_p.Q21*|BSCL2_ENST00000537604.1_5'Flank|HNRNPUL2-BSCL2_ENST00000403734.2_3'UTR|BSCL2_ENST00000360796.5_Nonsense_Mutation_p.Q21*|BSCL2_ENST00000407022.3_5'Flank|BSCL2_ENST00000278893.7_5'Flank|BSCL2_ENST00000421906.1_5'Flank|BSCL2_ENST00000403550.1_5'Flank	NM_012202.4	NP_036334.1	P63215	GBG3_HUMAN	guanine nucleotide binding protein (G protein), gamma 3						activation of MAPK activity (GO:0000187)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	5						CCTTTGATCTGGTCTCCGCAC	0.542																																					p.Q21X		Atlas-SNP	.											.	BSCL2	35	.	0			c.C61T						PASS	.						249.0	216.0	226.0					11																	62474607		692	1591	2283	SO:0001631	upstream_gene_variant	26580	exon1			TGATCTGGTCTCC	AF075042	CCDS8032.1	11p11	2008-07-18				ENSG00000162188			4405	protein-coding gene	gene with protein product	"""guanine nucleotide-binding protein gamma-3 subunit"", ""NBP gamma-3"""	608941				10644457	Standard	NM_012202		Approved		uc001nuv.4	P63215			chr11.hg19:g.62474607G>A	Exception_encountered	114.0	0.0	.		108.0	46.0	.	NM_001122955	B2R4S7|P29798|Q61014	Nonsense_Mutation	SNP	ENST00000294117.5	hg19	CCDS8032.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648671	0.47258	.	.	ENSG00000168000	ENST00000405837;ENST00000433053;ENST00000360796;ENST00000531524;ENST00000524862;ENST00000525000;ENST00000532818;ENST00000464544;ENST00000530009;ENST00000528874	.	.	.	4.28	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.9783	12.5249	0.56081	0.0:0.0:1.0:0.0	.	.	.	.	X	21;21;21;21;21;4;21;21;21;21	.	ENSP00000301781:Q21X	Q	-	1	0	BSCL2	62231183	0.872000	0.30054	0.340000	0.25575	0.344000	0.29017	3.627000	0.54252	2.665000	0.90641	0.655000	0.94253	CAG	.	.	.	none		0.542	GNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395020.1	NM_012202	
IGSF9B	22997	hgsc.bcm.edu	37	11	133805518	133805518	+	Missense_Mutation	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr11:133805518C>T	ENST00000321016.8	-	7	1191	c.961G>A	c.(961-963)Gtg>Atg	p.V321M	IGSF9B_ENST00000533871.2_Missense_Mutation_p.V321M			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	321					homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TCACACTGCACGGTCAGGTAC	0.632																																					p.V321M		Atlas-SNP	.											.	IGSF9B	290	.	0			c.G961A						PASS	.						18.0	21.0	20.0					11																	133805518		1988	4151	6139	SO:0001583	missense	22997	exon7			ACTGCACGGTCAG	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.961G>A	chr11.hg19:g.133805518C>T	ENSP00000317980:p.Val321Met	48.0	0.0	.		59.0	19.0	.	NM_014987	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	hg19		.	.	.	.	.	.	.	.	.	.	C	28.2	4.902639	0.92035	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	T;T;T	0.61158	0.13;0.13;0.13	5.36	5.36	0.76844	Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84474	0.5480	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89501	0.3764	9	0.87932	D	0	.	19.0883	0.93215	0.0:1.0:0.0:0.0	.	321	Q9UPX0	TUTLB_HUMAN	M	321;163;321	ENSP00000317980:V321M;ENSP00000436552:V163M;ENSP00000436576:V321M	ENSP00000317980:V321M	V	-	1	0	IGSF9B	133310728	1.000000	0.71417	0.986000	0.45419	0.947000	0.59692	7.406000	0.80017	2.500000	0.84329	0.561000	0.74099	GTG	.	.	.	none		0.632	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
HOXC6	3223	hgsc.bcm.edu	37	12	54422675	54422675	+	Missense_Mutation	SNP	C	C	A	rs80157375		TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr12:54422675C>A	ENST00000243108.4	+	1	534	c.370C>A	c.(370-372)Ccc>Acc	p.P124T	HOXC6_ENST00000394331.3_Missense_Mutation_p.P42T|RP11-834C11.12_ENST00000513209.1_Intron|RP11-834C11.14_ENST00000512206.1_RNA|HOXC4_ENST00000303406.4_Intron	NM_004503.3	NP_004494.1	P09630	HXC6_HUMAN	homeobox C6	124					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCAGATTTACCCCTGGATGCA	0.473																																					p.P124T		Atlas-SNP	.											.	HOXC6	30	.	0			c.C370A						PASS	.						88.0	94.0	92.0					12																	54422675		2203	4300	6503	SO:0001583	missense	3223	exon1			ATTTACCCCTGGA		CCDS8871.1, CCDS41792.1	12q13.13	2011-06-20	2005-12-22		ENSG00000197757	ENSG00000197757		"""Homeoboxes / ANTP class : HOXL subclass"""	5128	protein-coding gene	gene with protein product		142972	"""homeo box C6"""	HOX3C, HOX3		1973146, 1358459	Standard	NM_153693		Approved		uc001sev.3	P09630	OTTHUMG00000160027	ENST00000243108.4:c.370C>A	chr12.hg19:g.54422675C>A	ENSP00000243108:p.Pro124Thr	42.0	0.0	.		35.0	16.0	.	NM_004503	B2RBV2|Q6DK09	Missense_Mutation	SNP	ENST00000243108.4	hg19	CCDS8871.1	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656619	0.67586	.	.	ENSG00000197757	ENST00000504315;ENST00000509328;ENST00000394331;ENST00000243108	D;D	0.95622	-3.76;-3.76	5.53	5.53	0.82687	Homeobox protein, antennapedia type, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98223	0.9412	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.98802	1.0740	10	0.87932	D	0	.	18.396	0.90499	0.0:1.0:0.0:0.0	.	124	P09630	HXC6_HUMAN	T	42;42;42;124	ENSP00000377864:P42T;ENSP00000243108:P124T	ENSP00000243108:P124T	P	+	1	0	HOXC6	52708942	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.238000	0.78173	2.882000	0.98803	0.655000	0.94253	CCC	.	C|1.000;T|0.000	.	alt		0.473	HOXC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358943.2		
ARHGAP9	64333	hgsc.bcm.edu	37	12	57871296	57871296	+	Missense_Mutation	SNP	A	A	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr12:57871296A>C	ENST00000356411.2	-	4	840	c.702T>G	c.(700-702)aaT>aaG	p.N234K	ARHGAP9_ENST00000550454.1_5'UTR|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.N234K|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.N234K|ARHGAP9_ENST00000430041.2_Missense_Mutation_p.N50K|ARHGAP9_ENST00000550288.1_Missense_Mutation_p.N313K|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.N305K			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	234	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			CAGTCAGTGAATTTATGTAGA	0.637																																					p.N234K		Atlas-SNP	.											.	ARHGAP9	79	.	0			c.T702G						PASS	.						57.0	63.0	61.0					12																	57871296		2203	4300	6503	SO:0001583	missense	64333	exon3			CAGTGAATTTATG	AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.702T>G	chr12.hg19:g.57871296A>C	ENSP00000348782:p.Asn234Lys	274.0	0.0	.		201.0	82.0	.	NM_001080157	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	ENST00000356411.2	hg19		.	.	.	.	.	.	.	.	.	.	A	8.988	0.977083	0.18812	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000430041;ENST00000548139;ENST00000552604;ENST00000551452;ENST00000552066;ENST00000549602	T;T;T;T;T;T;T;T;T;D	0.92149	-1.35;-1.35;-1.35;-1.35;-1.35;0.35;0.35;0.35;0.35;-2.98	3.29	-3.24	0.05094	WW/Rsp5/WWP (2);	0.185494	0.43416	N	0.000565	D	0.89291	0.6673	M	0.85710	2.77	0.20074	N	0.999939	P;P;B;P;B;B	0.46784	0.608;0.884;0.361;0.799;0.008;0.023	B;B;B;B;B;B	0.37888	0.202;0.179;0.086;0.26;0.004;0.01	D	0.83749	0.0208	10	0.54805	T	0.06	.	9.9059	0.41375	0.3394:0.0:0.6606:0.0	.	234;313;234;234;234;50	B4E248;Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9;B4DVI3	.;.;RHG09_HUMAN;.;.;.	K	234;234;234;305;283;50;50;50;87;50;50	ENSP00000377380:N234K;ENSP00000348782:N234K;ENSP00000394307:N234K;ENSP00000377386:N305K;ENSP00000397950:N50K;ENSP00000449829:N50K;ENSP00000450256:N50K;ENSP00000446932:N87K;ENSP00000448424:N50K;ENSP00000450223:N50K	ENSP00000344852:N283K	N	-	3	2	ARHGAP9	56157563	0.887000	0.30362	0.042000	0.18584	0.034000	0.12701	0.087000	0.14958	-0.743000	0.04784	-0.899000	0.02877	AAT	.	.	.	none		0.637	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_032496	
NAV3	89795	hgsc.bcm.edu	37	12	78562567	78562567	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr12:78562567T>G	ENST00000397909.2	+	24	5075	c.4902T>G	c.(4900-4902)atT>atG	p.I1634M	NAV3_ENST00000536525.2_Missense_Mutation_p.I1634M|NAV3_ENST00000228327.6_Missense_Mutation_p.I1634M|NAV3_ENST00000266692.7_Missense_Mutation_p.I1457M			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1634						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GAGAAACCATTGAAATGCTGA	0.408										HNSCC(70;0.22)																											p.I1634M		Atlas-SNP	.											.	NAV3	506	.	0			c.T4902G						PASS	.						77.0	78.0	78.0					12																	78562567		1812	4077	5889	SO:0001583	missense	89795	exon24			AACCATTGAAATG	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4902T>G	chr12.hg19:g.78562567T>G	ENSP00000381007:p.Ile1634Met	207.0	0.0	.		209.0	84.0	.	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.70|16.70	3.195863|3.195863	0.58126|0.58126	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	D;D;D;D;D|.	0.94650|.	-3.48;-3.48;-3.48;-3.48;-3.48|.	5.41|5.41	2.89|2.89	0.33648|0.33648	.|.	0.000000|.	0.40385|.	U|.	0.001119|.	T|.	0.63212|.	0.2492|.	M|M	0.75085|0.75085	2.285|2.285	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.977;0.997;0.977;0.999|.	P;D;P;D|.	0.83275|.	0.863;0.994;0.703;0.996|.	T|.	0.61133|.	-0.7124|.	10|.	0.66056|.	D|.	0.02|.	-9.4096|-9.4096	6.1373|6.1373	0.20241|0.20241	0.2374:0.0707:0.0:0.6919|0.2374:0.0707:0.0:0.6919	.|.	1634;1457;1634;1634|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	M|G	1634;1634;1634;1457;255;263|529	ENSP00000446132:I1634M;ENSP00000381007:I1634M;ENSP00000228327:I1634M;ENSP00000266692:I1457M;ENSP00000448303:I263M|.	ENSP00000228327:I1634M|.	I|X	+|+	3|1	3|0	NAV3|NAV3	77086698|77086698	0.992000|0.992000	0.36948|0.36948	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.197000|0.197000	0.17197|0.17197	0.995000|0.995000	0.38917|0.38917	0.528000|0.528000	0.53228|0.53228	ATT|TGA	.	.	.	none		0.408	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
SOHLH2	54937	hgsc.bcm.edu	37	13	36744692	36744692	+	Silent	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr13:36744692C>T	ENST00000379881.3	-	10	1321	c.1233G>A	c.(1231-1233)acG>acA	p.T411T	SOHLH2_ENST00000554962.1_Silent_p.T488T|CCDC169-SOHLH2_ENST00000511166.1_Silent_p.T488T	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	411					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		GTGTAGTGCACGTCTGGCCCA	0.512																																					p.T488T		Atlas-SNP	.											.	.	.	.	0			c.G1464A						PASS	.						75.0	61.0	65.0					13																	36744692		2203	4300	6503	SO:0001819	synonymous_variant	100526761	exon15			AGTGCACGTCTGG	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.1233G>A	chr13.hg19:g.36744692C>T		129.0	0.0	.		135.0	66.0	.	NM_001198910	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Silent	SNP	ENST00000379881.3	hg19	CCDS9355.1																																																																																			.	.	.	none		0.512	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
DGKH	160851	hgsc.bcm.edu	37	13	42733507	42733507	+	Splice_Site	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr13:42733507G>A	ENST00000337343.4	+	6	749	c.728G>A	c.(727-729)gGc>gAc	p.G243D	DGKH_ENST00000540693.1_Splice_Site_p.G243D|DGKH_ENST00000536612.1_Splice_Site_p.G107D|DGKH_ENST00000538674.1_Intron|DGKH_ENST00000379274.2_Splice_Site_p.G107D|DGKH_ENST00000261491.5_Splice_Site_p.G243D|DGKH_ENST00000498255.2_3'UTR	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	243					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		GATGAAGATGGCGTAAGCTGC	0.423																																					p.G243D		Atlas-SNP	.											.	DGKH	106	.	0			c.G728A						PASS	.						84.0	65.0	72.0					13																	42733507		2203	4300	6503	SO:0001630	splice_region_variant	160851	exon7			AAGATGGCGTAAG	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.729+1G>A	chr13.hg19:g.42733507G>A		88.0	0.0	.		93.0	45.0	.	NM_001204504	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	hg19	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292173	0.59976	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	5.31	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.89945	0.6862	L	0.55743	1.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.978	D;D;P	0.97110	0.998;1.0;0.841	D	0.90134	0.4208	10	0.56958	D	0.05	.	13.9054	0.63831	0.0737:0.0:0.9263:0.0	.	107;243;243	Q86XP1-3;Q86XP1-2;Q86XP1	.;.;DGKH_HUMAN	D	243;243;243;107;107	ENSP00000440823:G243D;ENSP00000337572:G243D;ENSP00000261491:G243D;ENSP00000368576:G107D;ENSP00000445114:G107D	ENSP00000261491:G243D	G	+	2	0	DGKH	41631507	1.000000	0.71417	0.693000	0.30195	0.158000	0.22134	9.416000	0.97383	1.224000	0.43551	0.655000	0.94253	GGC	.	.	.	none		0.423	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	Missense_Mutation
MYCBP2	23077	hgsc.bcm.edu	37	13	77642846	77642846	+	Missense_Mutation	SNP	A	A	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr13:77642846A>C	ENST00000544440.2	-	70	11928	c.11911T>G	c.(11911-11913)Tct>Gct	p.S3971A	MYCBP2_ENST00000407578.2_Missense_Mutation_p.S4009A|MYCBP2_ENST00000357337.6_Missense_Mutation_p.S3971A					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TAGGCATCAGAGGAGGCATCT	0.473																																					p.S4009A		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.T12025G						PASS	.						242.0	190.0	208.0					13																	77642846		2203	4300	6503	SO:0001583	missense	23077	exon70			CATCAGAGGAGGC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.11911T>G	chr13.hg19:g.77642846A>C	ENSP00000444596:p.Ser3971Ala	108.0	0.0	.		117.0	46.0	.	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.26|15.26	2.780536|2.780536	0.49891|0.49891	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000429715|ENST00000357337;ENST00000407578;ENST00000544440	.|T;T;T	.|0.65732	.|-0.17;-0.17;-0.17	5.84|5.84	4.63|4.63	0.57726|0.57726	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46814|0.46814	0.1412|0.1412	N|N	0.21448|0.21448	0.665|0.665	0.51012|0.51012	D|D	0.999903|0.999903	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.28170|0.28170	-1.0052|-1.0052	5|10	.|0.23302	.|T	.|0.38	.|.	12.9953|12.9953	0.58644|0.58644	0.8651:0.1349:0.0:0.0|0.8651:0.1349:0.0:0.0	.|.	.|3971	.|O75592	.|MYCB2_HUMAN	R|A	391|3971;4009;3971	.|ENSP00000349892:S3971A;ENSP00000384288:S4009A;ENSP00000444596:S3971A	.|ENSP00000349892:S3971A	L|S	-|-	2|1	0|0	MYCBP2|MYCBP2	76540847|76540847	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.998000|0.998000	0.95712|0.95712	8.906000|8.906000	0.92626|0.92626	0.991000|0.991000	0.38814|0.38814	0.528000|0.528000	0.53228|0.53228	CTC|TCT	.	.	.	none		0.473	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
NYNRIN	57523	hgsc.bcm.edu	37	14	24868618	24868618	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr14:24868618G>T	ENST00000382554.3	+	2	484	c.166G>T	c.(166-168)Gag>Tag	p.E56*		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	56					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GCTACAGCTCGAGGGGCCCCG	0.627																																					p.E56X		Atlas-SNP	.											.	NYNRIN	120	.	0			c.G166T						PASS	.						20.0	26.0	25.0					14																	24868618		1904	4111	6015	SO:0001587	stop_gained	57523	exon2			CAGCTCGAGGGGC	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.166G>T	chr14.hg19:g.24868618G>T	ENSP00000371994:p.Glu56*	124.0	0.0	.		106.0	45.0	.	NM_025081	Q6P153|Q86TR3|Q9HAC4	Nonsense_Mutation	SNP	ENST00000382554.3	hg19	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	G	39	7.662585	0.98419	.	.	ENSG00000205978	ENST00000382554	.	.	.	4.46	1.38	0.22167	.	0.538297	0.11631	U	0.544789	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.1501	0.06485	0.0954:0.3385:0.392:0.1741	.	.	.	.	X	56	.	ENSP00000371994:E56X	E	+	1	0	NYNRIN	23938458	0.972000	0.33761	0.982000	0.44146	0.993000	0.82548	0.917000	0.28665	0.089000	0.17243	0.491000	0.48974	GAG	.	.	.	none		0.627	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
PPP1R13B	23368	hgsc.bcm.edu	37	14	104206573	104206573	+	Missense_Mutation	SNP	T	T	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr14:104206573T>A	ENST00000202556.9	-	12	2462	c.2180A>T	c.(2179-2181)tAc>tTc	p.Y727F	PPP1R13B_ENST00000423488.2_Missense_Mutation_p.Y146F|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	727	Pro-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				GAAGCGCTGGTACAGCAGCTT	0.662																																					p.Y727F		Atlas-SNP	.											.	PPP1R13B	72	.	0			c.A2180T						PASS	.						47.0	56.0	53.0					14																	104206573		1954	4129	6083	SO:0001583	missense	23368	exon12			CGCTGGTACAGCA	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.2180A>T	chr14.hg19:g.104206573T>A	ENSP00000202556:p.Tyr727Phe	55.0	0.0	.		53.0	27.0	.	NM_015316	B2RMX5|O94870	Missense_Mutation	SNP	ENST00000202556.9	hg19	CCDS41997.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.849691	0.91277	.	.	ENSG00000088808	ENST00000202556;ENST00000423488	T;T	0.76839	-0.44;-1.05	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.86426	0.5930	M	0.67700	2.07	0.53005	D	0.99996	D	0.69078	0.997	D	0.70716	0.97	D	0.87435	0.2391	10	0.59425	D	0.04	.	15.6938	0.77477	0.0:0.0:0.0:1.0	.	727	Q96KQ4	ASPP1_HUMAN	F	727;146	ENSP00000202556:Y727F;ENSP00000395213:Y146F	ENSP00000202556:Y727F	Y	-	2	0	PPP1R13B	103276326	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.678000	0.84035	2.102000	0.63906	0.448000	0.29417	TAC	.	.	.	none		0.662	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316	
ASPG	374569	hgsc.bcm.edu	37	14	104559866	104559866	+	Missense_Mutation	SNP	T	T	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr14:104559866T>A	ENST00000551177.1	+	3	322	c.230T>A	c.(229-231)cTg>cAg	p.L77Q	ASPG_ENST00000546892.2_Missense_Mutation_p.L77Q|ASPG_ENST00000455920.2_Missense_Mutation_p.L77Q	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase	77	Asparaginase.|Asparaginase/glutaminase. {ECO:0000255|PROSITE-ProRule:PRU01068}.				asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						TACACCGTGCTGGAGTGCCAG	0.632																																					p.L77Q		Atlas-SNP	.											.	ASPG	34	.	0			c.T230A						PASS	.						77.0	89.0	85.0					14																	104559866		2068	4187	6255	SO:0001583	missense	374569	exon3			CCGTGCTGGAGTG		CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.230T>A	chr14.hg19:g.104559866T>A	ENSP00000450040:p.Leu77Gln	78.0	0.0	.		57.0	23.0	.	NM_001080464	B9EGQ2|Q8IV80	Missense_Mutation	SNP	ENST00000551177.1	hg19	CCDS45170.2	.	.	.	.	.	.	.	.	.	.	T	13.99	2.402521	0.42613	.	.	ENSG00000166183	ENST00000551177;ENST00000299234;ENST00000546892;ENST00000455920	T;T;T	0.24151	1.87;1.87;1.87	3.57	3.57	0.40892	.	0.156561	0.42821	D	0.000653	T	0.46014	0.1371	M	0.73753	2.245	0.45183	D	0.998195	P;D;D;D	0.58620	0.942;0.975;0.968;0.983	P;P;P;D	0.66497	0.8;0.886;0.819;0.944	T	0.40553	-0.9557	10	0.38643	T	0.18	-8.8351	11.416	0.49951	0.0:0.0:0.0:1.0	.	77;77;77;105	G3V1Y8;Q86U10;Q86U10-3;E5RFC2	.;LPP60_HUMAN;.;.	Q	77;105;77;77	ENSP00000450040:L77Q;ENSP00000448911:L77Q;ENSP00000389003:L77Q	ENSP00000299234:L105Q	L	+	2	0	ASPG	103629619	1.000000	0.71417	0.994000	0.49952	0.644000	0.38419	4.913000	0.63341	1.406000	0.46857	0.402000	0.26972	CTG	.	.	.	none		0.632	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407005.1	NM_001080464	
MAPKBP1	23005	hgsc.bcm.edu	37	15	42114511	42114511	+	Silent	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr15:42114511G>A	ENST00000456763.2	+	27	3334	c.3138G>A	c.(3136-3138)gaG>gaA	p.E1046E	MAPKBP1_ENST00000260357.7_Silent_p.E879E|MAPKBP1_ENST00000457542.2_Silent_p.E1040E|RP11-23P13.4_ENST00000510176.1_RNA|MAPKBP1_ENST00000514566.1_Silent_p.E1040E|MAPKBP1_ENST00000221214.6_Silent_p.E923E	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	1046	Poly-Glu.									breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		AGGAAGAAGAGGAGGGAGGCA	0.587																																					p.E1046E		Atlas-SNP	.											.	MAPKBP1	120	.	0			c.G3138A						PASS	.						44.0	45.0	45.0					15																	42114511		2203	4300	6503	SO:0001819	synonymous_variant	23005	exon27			AGAAGAGGAGGGA	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.3138G>A	chr15.hg19:g.42114511G>A		49.0	0.0	.		55.0	27.0	.	NM_001128608	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Silent	SNP	ENST00000456763.2	hg19	CCDS45239.1																																																																																			.	.	.	none		0.587	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
IGDCC4	57722	hgsc.bcm.edu	37	15	65676599	65676599	+	Silent	SNP	G	G	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr15:65676599G>T	ENST00000352385.2	-	20	3710	c.3501C>A	c.(3499-3501)atC>atA	p.I1167I	IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	1167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						CAACACCCGAGATGAGATCAG	0.622																																					p.I1167I		Atlas-SNP	.											.	IGDCC4	95	.	0			c.C3501A						PASS	.						29.0	32.0	31.0					15																	65676599		2201	4299	6500	SO:0001819	synonymous_variant	57722	exon20			ACCCGAGATGAGA		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.3501C>A	chr15.hg19:g.65676599G>T		143.0	0.0	.		101.0	38.0	.	NM_020962	Q9HCE4	Silent	SNP	ENST00000352385.2	hg19	CCDS10206.1																																																																																			.	.	.	none		0.622	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
WDR24	84219	hgsc.bcm.edu	37	16	734812	734812	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr16:734812G>T	ENST00000248142.6	-	13	2684	c.2685C>A	c.(2683-2685)caC>caA	p.H895Q	JMJD8_ENST00000293882.4_5'Flank|WDR24_ENST00000293883.4_Missense_Mutation_p.H765Q|JMJD8_ENST00000609261.1_5'Flank|JMJD8_ENST00000562824.1_5'Flank|JMJD8_ENST00000412368.2_5'Flank|JMJD8_ENST00000454700.1_5'Flank|JMJD8_ENST00000562111.1_5'Flank			Q96S15	WDR24_HUMAN	WD repeat domain 24	895										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				TGTGCTGCAGGTGGCCGCCGT	0.677																																					p.H765Q		Atlas-SNP	.											.	WDR24	111	.	0			c.C2295A						PASS	.						16.0	14.0	14.0					16																	734812		2152	4256	6408	SO:0001583	missense	84219	exon9			CTGCAGGTGGCCG	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.2685C>A	chr16.hg19:g.734812G>T	ENSP00000248142:p.His895Gln	106.0	0.0	.		77.0	42.0	.	NM_032259	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	ENST00000248142.6	hg19		.	.	.	.	.	.	.	.	.	.	g	13.02	2.111265	0.37242	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	D;D	0.98419	-4.92;-3.35	4.77	-1.03	0.10102	.	0.000000	0.85682	D	0.000000	D	0.98817	0.9601	M	0.92923	3.36	0.53005	D	0.999969	D	0.76494	0.999	D	0.78314	0.991	D	0.98611	1.0663	10	0.87932	D	0	-36.2207	9.962	0.41701	0.4486:0.0:0.5514:0.0	.	765	Q96S15-2	.	Q	895;765	ENSP00000248142:H895Q;ENSP00000293883:H765Q	ENSP00000248142:H895Q	H	-	3	2	WDR24	674813	0.998000	0.40836	0.998000	0.56505	0.957000	0.61999	0.387000	0.20718	-0.015000	0.14150	-0.360000	0.07572	CAC	.	.	.	none		0.677	WDR24-201	KNOWN	basic	protein_coding	protein_coding		NM_032259	
TNRC6A	27327	hgsc.bcm.edu	37	16	24801496	24801496	+	Silent	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr16:24801496G>A	ENST00000395799.3	+	6	1662	c.1533G>A	c.(1531-1533)gaG>gaA	p.E511E	TNRC6A_ENST00000315183.7_Silent_p.E511E	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	511	Interaction with argonaute family proteins.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GCAATGGAGAGTCAAAAAGTG	0.483																																					p.E511E		Atlas-SNP	.											.	TNRC6A	171	.	0			c.G1533A						PASS	.						107.0	104.0	105.0					16																	24801496		2197	4300	6497	SO:0001819	synonymous_variant	27327	exon6			TGGAGAGTCAAAA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1533G>A	chr16.hg19:g.24801496G>A		133.0	0.0	.		100.0	36.0	.	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	hg19	CCDS10624.2																																																																																			.	.	.	none		0.483	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
E2F4	1874	hgsc.bcm.edu	37	16	67233133	67233133	+	IGR	SNP	A	A	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr16:67233133A>G	ENST00000379378.3	+	0	2096				ELMO3_ENST00000360833.1_Silent_p.G21G|ELMO3_ENST00000477898.1_5'Flank|ELMO3_ENST00000393997.2_Silent_p.G21G	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		TCGGAAAGGGAGGACCTCCTC	0.692																																					p.G21G		Atlas-SNP	.											ELMO3,caecum,carcinoma,0,1	ELMO3	41	.	0			c.A63G						PASS	.						21.0	30.0	27.0					16																	67233133		2078	4199	6277	SO:0001628	intergenic_variant	79767	exon1			AAAGGGAGGACCT	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		chr16.hg19:g.67233133A>G		141.0	0.0	.		124.0	41.0	.	NM_024712	A6NGR8|B5BU56|Q12991|Q15328	Silent	SNP	ENST00000379378.3	hg19	CCDS32464.1																																																																																			.	.	.	none		0.692	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
JPH3	57338	hgsc.bcm.edu	37	16	87724046	87724046	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr16:87724046G>T	ENST00000284262.2	+	4	2322	c.2080G>T	c.(2080-2082)Gac>Tac	p.D694Y	JPH3_ENST00000563609.1_3'UTR	NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	694					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		GCTGCGTTGGGACTTGACCTT	0.662																																					p.D694Y		Atlas-SNP	.											.	JPH3	95	.	0			c.G2080T						PASS	.						13.0	12.0	12.0					16																	87724046		2172	4276	6448	SO:0001583	missense	57338	exon4			CGTTGGGACTTGA	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.2080G>T	chr16.hg19:g.87724046G>T	ENSP00000284262:p.Asp694Tyr	93.0	0.0	.		87.0	27.0	.	NM_020655	D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Missense_Mutation	SNP	ENST00000284262.2	hg19	CCDS10962.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.931957	0.73442	.	.	ENSG00000154118	ENST00000537256;ENST00000284262	T	0.58210	0.35	4.3	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.62502	0.2433	L	0.34521	1.04	0.58432	D	0.999999	D	0.89917	1.0	D	0.76071	0.987	T	0.67457	-0.5666	10	0.72032	D	0.01	.	15.8177	0.78615	0.0:0.0:1.0:0.0	.	694	Q8WXH2	JPH3_HUMAN	Y	557;694	ENSP00000284262:D694Y	ENSP00000284262:D694Y	D	+	1	0	JPH3	86281547	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.048000	0.93830	1.972000	0.57404	0.650000	0.86243	GAC	.	.	.	none		0.662	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2		
ANKRD11	29123	hgsc.bcm.edu	37	16	89348979	89348979	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr16:89348979G>A	ENST00000301030.4	-	9	4431	c.3971C>T	c.(3970-3972)tCt>tTt	p.S1324F	ANKRD11_ENST00000378330.2_Missense_Mutation_p.S1324F	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1324	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CTCCGTGAAAGAGACCTCCAG	0.582																																					p.S1324F		Atlas-SNP	.											.	ANKRD11	195	.	0			c.C3971T						PASS	.						38.0	39.0	39.0					16																	89348979		2198	4299	6497	SO:0001583	missense	29123	exon9			GTGAAAGAGACCT	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.3971C>T	chr16.hg19:g.89348979G>A	ENSP00000301030:p.Ser1324Phe	58.0	0.0	.		52.0	26.0	.	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	hg19	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.204556	0.38905	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.51325	0.71;0.71	5.21	5.21	0.72293	.	0.484210	0.22246	N	0.062606	T	0.63010	0.2475	M	0.67953	2.075	0.53688	D	0.999977	D	0.62365	0.991	P	0.55161	0.77	T	0.67162	-0.5740	10	0.87932	D	0	.	18.7133	0.91666	0.0:0.0:1.0:0.0	.	1324	Q6UB99	ANR11_HUMAN	F	1324	ENSP00000301030:S1324F;ENSP00000367581:S1324F	ENSP00000301030:S1324F	S	-	2	0	ANKRD11	87876480	0.998000	0.40836	0.044000	0.18714	0.062000	0.15995	5.689000	0.68234	2.577000	0.86979	0.563000	0.77884	TCT	.	.	.	none		0.582	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
ZNF594	84622	hgsc.bcm.edu	37	17	5086715	5086715	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr17:5086715A>T	ENST00000399604.4	-	1	977	c.837T>A	c.(835-837)agT>agA	p.S279R	ZNF594_ENST00000575779.1_Missense_Mutation_p.S279R			Q96JF6	ZN594_HUMAN	zinc finger protein 594	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CAAGGTGTGAACTTTGACTGA	0.413																																					p.S279R		Atlas-SNP	.											.	ZNF594	89	.	0			c.T837A						PASS	.						78.0	81.0	80.0					17																	5086715		2191	4295	6486	SO:0001583	missense	84622	exon2			GTGTGAACTTTGA	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.837T>A	chr17.hg19:g.5086715A>T	ENSP00000382513:p.Ser279Arg	35.0	0.0	.		44.0	31.0	.	NM_032530	Q6RFS0	Missense_Mutation	SNP	ENST00000399604.4	hg19	CCDS42241.1	.	.	.	.	.	.	.	.	.	.	A	0.815	-0.750550	0.03041	.	.	ENSG00000180626	ENST00000399604	T	0.35973	1.28	2.5	0.216	0.15258	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18882	0.0453	N	0.21282	0.65	0.09310	N	1	P	0.46621	0.881	B	0.42653	0.394	T	0.09185	-1.0686	9	0.15499	T	0.54	.	2.072	0.03615	0.4378:0.0:0.3138:0.2484	.	279	Q96JF6	ZN594_HUMAN	R	279	ENSP00000382513:S279R	ENSP00000382513:S279R	S	-	3	2	ZNF594	5027439	0.000000	0.05858	0.994000	0.49952	0.847000	0.48162	-1.795000	0.01752	0.217000	0.20800	0.379000	0.24179	AGT	.	.	.	none		0.413	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	XM_290737	
KRT17	3872	hgsc.bcm.edu	37	17	39780421	39780421	+	Missense_Mutation	SNP	A	A	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr17:39780421A>G	ENST00000311208.8	-	1	408	c.341T>C	c.(340-342)gTg>gCg	p.V114A	JUP_ENST00000540235.1_Intron|KRT42P_ENST00000438131.1_RNA	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	114	Coil 1A.|Peptide epitope S1; induces T-cell and keratinocyte proliferation and IFN-gamma production.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				ACGGATCTTCACCTCCAGCTC	0.617																																					p.V114A	Pancreas(92;1242 2086 39193 50508)	Atlas-SNP	.											.	KRT17	57	.	0			c.T341C						PASS	.						99.0	110.0	106.0					17																	39780421		2203	4300	6503	SO:0001583	missense	3872	exon1			ATCTTCACCTCCA	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.341T>C	chr17.hg19:g.39780421A>G	ENSP00000308452:p.Val114Ala	175.0	0.0	.		262.0	79.0	.	NM_000422	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Missense_Mutation	SNP	ENST00000311208.8	hg19	CCDS11402.1	.	.	.	.	.	.	.	.	.	.	A	7.338	0.620347	0.14193	.	.	ENSG00000128422	ENST00000311208	D	0.88124	-2.34	4.77	4.77	0.60923	Filament (1);	0.651197	0.12932	N	0.427268	T	0.76737	0.4029	N	0.21583	0.68	0.80722	D	1	B	0.20550	0.046	B	0.28991	0.097	T	0.65911	-0.6053	10	0.08837	T	0.75	.	6.9946	0.24774	0.7002:0.1529:0.0:0.1469	.	114	Q04695	K1C17_HUMAN	A	114	ENSP00000308452:V114A	ENSP00000308452:V114A	V	-	2	0	KRT17	37033947	0.988000	0.35896	1.000000	0.80357	0.572000	0.35998	1.849000	0.39318	2.132000	0.65825	0.260000	0.18958	GTG	.	.	.	none		0.617	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422	
ASB16	92591	hgsc.bcm.edu	37	17	42249482	42249482	+	Missense_Mutation	SNP	A	A	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr17:42249482A>C	ENST00000293414.1	+	2	454	c.370A>C	c.(370-372)Aca>Cca	p.T124P		NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	124					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCGAGGCTACACAGACTGTGC	0.632																																					p.T124P		Atlas-SNP	.											.	ASB16	34	.	0			c.A370C						PASS	.						59.0	54.0	56.0					17																	42249482		2203	4300	6503	SO:0001583	missense	92591	exon2			GGCTACACAGACT	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.370A>C	chr17.hg19:g.42249482A>C	ENSP00000293414:p.Thr124Pro	44.0	0.0	.		54.0	36.0	.	NM_080863	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	hg19	CCDS11478.1	.	.	.	.	.	.	.	.	.	.	A	13.17	2.157459	0.38119	.	.	ENSG00000161664	ENST00000293414	T	0.65178	-0.14	5.55	4.48	0.54585	Ankyrin repeat-containing domain (4);	0.366498	0.31734	N	0.007154	T	0.48059	0.1479	N	0.16833	0.445	0.09310	N	0.99999	P	0.42941	0.794	P	0.46629	0.522	T	0.42050	-0.9474	10	0.62326	D	0.03	-3.1755	4.6071	0.12383	0.6723:0.1645:0.1631:0.0	.	124	Q96NS5	ASB16_HUMAN	P	124	ENSP00000293414:T124P	ENSP00000293414:T124P	T	+	1	0	ASB16	39605008	0.001000	0.12720	0.589000	0.28718	0.238000	0.25445	0.447000	0.21710	1.127000	0.42034	0.533000	0.62120	ACA	.	.	.	none		0.632	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
OSBPL1A	114876	hgsc.bcm.edu	37	18	21761235	21761235	+	Silent	SNP	G	G	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr18:21761235G>T	ENST00000319481.3	-	19	1892	c.1686C>A	c.(1684-1686)tcC>tcA	p.S562S	OSBPL1A_ENST00000357041.4_Silent_p.S180S|OSBPL1A_ENST00000399443.3_Silent_p.S49S	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	562					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TCGTGATCTTGGATAGTTCCT	0.388																																					p.S562S		Atlas-SNP	.											.	OSBPL1A	94	.	0			c.C1686A						PASS	.						111.0	101.0	104.0					18																	21761235		2203	4300	6503	SO:0001819	synonymous_variant	114876	exon19			GATCTTGGATAGT	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.1686C>A	chr18.hg19:g.21761235G>T		66.0	0.0	.		84.0	38.0	.	NM_080597	B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	hg19	CCDS11884.1																																																																																			.	.	.	none		0.388	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	
SOCS6	9306	hgsc.bcm.edu	37	18	67992862	67992862	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr18:67992862A>T	ENST00000397942.3	+	2	1274	c.958A>T	c.(958-960)Aat>Tat	p.N320Y	SOCS6_ENST00000582322.1_Missense_Mutation_p.N320Y	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	320					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				AATGCAGAATAATCAAATCCA	0.512																																					p.N320Y	Melanoma(84;1024 1361 24382 36583 42651)	Atlas-SNP	.											.	SOCS6	54	.	0			c.A958T						PASS	.						75.0	72.0	73.0					18																	67992862		2203	4300	6503	SO:0001583	missense	9306	exon2			CAGAATAATCAAA	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.958A>T	chr18.hg19:g.67992862A>T	ENSP00000381034:p.Asn320Tyr	88.0	0.0	.		84.0	35.0	.	NM_004232	Q8WUM3	Missense_Mutation	SNP	ENST00000397942.3	hg19	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	A	11.13	1.546894	0.27652	.	.	ENSG00000170677	ENST00000397942	T	0.27256	1.68	5.08	1.26	0.21427	.	0.395352	0.23121	N	0.051698	T	0.15392	0.0371	L	0.27053	0.805	0.40211	D	0.977624	B	0.30455	0.28	B	0.26693	0.072	T	0.07028	-1.0794	10	0.72032	D	0.01	-7.4994	7.6716	0.28462	0.6301:0.2986:0.0713:0.0	.	320	O14544	SOCS6_HUMAN	Y	320	ENSP00000381034:N320Y	ENSP00000381034:N320Y	N	+	1	0	SOCS6	66143842	0.999000	0.42202	0.004000	0.12327	0.961000	0.63080	3.127000	0.50484	-0.029000	0.13827	-0.466000	0.05196	AAT	.	.	.	none		0.512	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
ATP8B3	148229	hgsc.bcm.edu	37	19	1802569	1802569	+	Missense_Mutation	SNP	T	T	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr19:1802569T>A	ENST00000310127.6	-	11	1218	c.980A>T	c.(979-981)tAc>tTc	p.Y327F	ATP8B3_ENST00000539485.1_Missense_Mutation_p.Y327F|ATP8B3_ENST00000525591.1_Missense_Mutation_p.Y274F|ATP8B3_ENST00000526092.2_Missense_Mutation_p.Y274F	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	327					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCAGGGAGTATTTCTTGTC	0.577																																					p.Y327F		Atlas-SNP	.											.	ATP8B3	108	.	0			c.A980T						PASS	.						130.0	141.0	138.0					19																	1802569		2127	4225	6352	SO:0001583	missense	148229	exon11			AGGGAGTATTTCT	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.980A>T	chr19.hg19:g.1802569T>A	ENSP00000311336:p.Tyr327Phe	56.0	0.0	.		55.0	30.0	.	NM_138813	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	hg19	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	t	4.280	0.051064	0.08243	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591;ENST00000526092;ENST00000382339	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	3.72	3.72	0.42706	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.450694	0.23629	U	0.046144	T	0.70500	0.3231	L	0.48362	1.52	0.09310	N	1	D;P;P	0.53312	0.959;0.891;0.695	B;P;P	0.48400	0.444;0.494;0.576	T	0.61118	-0.7127	10	0.23302	T	0.38	.	11.7676	0.51939	0.0:0.0:0.0:1.0	.	274;327;274	F5H3R9;O60423;Q7Z485	.;AT8B3_HUMAN;.	F	327;327;274;274;274	ENSP00000311336:Y327F;ENSP00000443574:Y327F;ENSP00000437115:Y274F;ENSP00000445204:Y274F	ENSP00000311336:Y327F	Y	-	2	0	ATP8B3	1753569	0.219000	0.23619	0.600000	0.28864	0.209000	0.24338	3.028000	0.49705	1.569000	0.49696	0.370000	0.22315	TAC	.	.	.	none		0.577	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
SIPA1L3	23094	hgsc.bcm.edu	37	19	38631838	38631838	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr19:38631838C>G	ENST00000222345.6	+	11	3667	c.3158C>G	c.(3157-3159)aCc>aGc	p.T1053S		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1053					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TGGCCGGAGACCTACGACATG	0.622																																					p.T1053S		Atlas-SNP	.											.	SIPA1L3	150	.	0			c.C3158G						PASS	.						57.0	53.0	54.0					19																	38631838		2203	4299	6502	SO:0001583	missense	23094	exon11			CGGAGACCTACGA	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3158C>G	chr19.hg19:g.38631838C>G	ENSP00000222345:p.Thr1053Ser	121.0	0.0	.		124.0	62.0	.	NM_015073	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	hg19	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773459	0.31411	.	.	ENSG00000105738	ENST00000222345	T	0.60299	0.2	4.96	4.96	0.65561	.	0.255793	0.40469	N	0.001090	T	0.50752	0.1634	L	0.50333	1.59	0.34666	D	0.723161	B	0.11235	0.004	B	0.12837	0.008	T	0.54892	-0.8225	10	0.10111	T	0.7	-40.2674	17.133	0.86730	0.0:1.0:0.0:0.0	.	1053	O60292	SI1L3_HUMAN	S	1053	ENSP00000222345:T1053S	ENSP00000222345:T1053S	T	+	2	0	SIPA1L3	43323678	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	2.167000	0.42415	2.583000	0.87209	0.460000	0.39030	ACC	.	.	.	none		0.622	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
FBXO17	115290	hgsc.bcm.edu	37	19	39435737	39435737	+	Missense_Mutation	SNP	C	C	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr19:39435737C>A	ENST00000292852.4	-	5	906	c.565G>T	c.(565-567)Gct>Tct	p.A189S	FBXO17_ENST00000595329.1_Missense_Mutation_p.A189S|SARS2_ENST00000448145.2_Missense_Mutation_p.A24S|CTC-360G5.8_ENST00000599996.1_Missense_Mutation_p.R93L	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	189	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TTCTCTCGAGCGCCCCACCTG	0.627																																					p.A198S		Atlas-SNP	.											.	FBXO17	42	.	0			c.G592T						PASS	.						53.0	50.0	51.0					19																	39435737		2203	4300	6503	SO:0001583	missense	115290	exon5			CTCGAGCGCCCCA	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.565G>T	chr19.hg19:g.39435737C>A	ENSP00000292852:p.Ala189Ser	65.0	0.0	.		87.0	32.0	.	NM_148169	Q96LQ4	Missense_Mutation	SNP	ENST00000292852.4	hg19	CCDS12526.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.470041	0.26423	.	.	ENSG00000104835	ENST00000448145;ENST00000392076;ENST00000292852	T;T	0.29655	1.56;1.56	4.58	4.58	0.56647	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.118955	0.35870	N	0.002926	T	0.44912	0.1316	L	0.60455	1.87	.	.	.	P;D	0.76494	0.657;0.999	B;D	0.85130	0.271;0.997	T	0.43458	-0.9390	9	0.09590	T	0.72	.	10.9909	0.47549	0.0:0.8108:0.1892:0.0	.	24;189	E7EX87;Q96EF6	.;FBX17_HUMAN	S	24;198;189	ENSP00000399330:A24S;ENSP00000292852:A189S	ENSP00000292852:A189S	A	-	1	0	FBXO17	44127577	0.879000	0.30193	0.861000	0.33841	0.182000	0.23217	1.427000	0.34881	2.530000	0.85305	0.467000	0.42956	GCT	.	.	.	none		0.627	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
EGLN2	112398	hgsc.bcm.edu	37	19	41306764	41306764	+	Missense_Mutation	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr19:41306764C>T	ENST00000593726.1	+	1	1315	c.287C>T	c.(286-288)gCt>gTt	p.A96V	EGLN2_ENST00000303961.4_Missense_Mutation_p.A96V|CTC-490E21.12_ENST00000601627.1_5'Flank|EGLN2_ENST00000406058.2_Missense_Mutation_p.A96V|EGLN2_ENST00000594140.1_5'Flank|RAB4B-EGLN2_ENST00000594136.1_3'UTR			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	96	Bipartite nuclear localization signal.				cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	AGTGAAGGCGCTGCAGCGCTG	0.682																																					p.A96V		Atlas-SNP	.											.	EGLN2	31	.	0			c.C287T						PASS	.						15.0	17.0	17.0					19																	41306764		2199	4295	6494	SO:0001583	missense	112398	exon2			AAGGCGCTGCAGC	AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.287C>T	chr19.hg19:g.41306764C>T	ENSP00000469686:p.Ala96Val	79.0	0.0	.		72.0	37.0	.	NM_053046	A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	hg19	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576639	0.65878	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.28255	1.62;1.62	4.04	4.04	0.47022	.	0.091223	0.43416	D	0.000568	T	0.19087	0.0458	N	0.19112	0.55	0.26530	N	0.974273	B	0.26935	0.164	B	0.22753	0.041	T	0.15435	-1.0437	10	0.62326	D	0.03	-8.2587	10.0167	0.42018	0.0:0.7939:0.2061:0.0	.	96	Q96KS0	EGLN2_HUMAN	V	96	ENSP00000307080:A96V;ENSP00000385253:A96V	ENSP00000307080:A96V	A	+	2	0	EGLN2	45998604	0.086000	0.21541	0.992000	0.48379	0.870000	0.49936	1.134000	0.31442	2.250000	0.74265	0.491000	0.48974	GCT	.	.	.	none		0.682	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1		
CYP2S1	29785	hgsc.bcm.edu	37	19	41703754	41703754	+	Silent	SNP	G	G	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr19:41703754G>C	ENST00000310054.4	+	3	630	c.414G>C	c.(412-414)ctG>ctC	p.L138L	CYP2S1_ENST00000542619.1_Intron	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1	138					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						TGCGGGACCTGGGCATGGGGA	0.617																																					p.L138L		Atlas-SNP	.											.	CYP2S1	47	.	0			c.G414C						PASS	.						77.0	74.0	75.0					19																	41703754		2203	4300	6503	SO:0001819	synonymous_variant	29785	exon3			GGACCTGGGCATG	AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.414G>C	chr19.hg19:g.41703754G>C		79.0	0.0	.		77.0	22.0	.	NM_030622	Q9BZ66	Silent	SNP	ENST00000310054.4	hg19	CCDS12573.1																																																																																			.	.	.	none		0.617	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463287.1		
ZNF649	65251	hgsc.bcm.edu	37	19	52400157	52400157	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr19:52400157C>G	ENST00000354957.3	-	3	374	c.90G>C	c.(88-90)aaG>aaC	p.K30N	CTC-429C10.2_ENST00000600329.1_RNA|ZNF649_ENST00000600738.1_Missense_Mutation_p.K30N	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	30	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GGTACAGGTCCTTCTGAGCAG	0.547																																					p.K30N		Atlas-SNP	.											.	ZNF649	72	.	0			c.G90C						PASS	.						189.0	174.0	179.0					19																	52400157		2203	4300	6503	SO:0001583	missense	65251	exon3			CAGGTCCTTCTGA	BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.90G>C	chr19.hg19:g.52400157C>G	ENSP00000347043:p.Lys30Asn	147.0	0.0	.		127.0	47.0	.	NM_023074	A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	ENST00000354957.3	hg19	CCDS12843.1	.	.	.	.	.	.	.	.	.	.	C	6.417	0.445140	0.12164	.	.	ENSG00000198093	ENST00000354957	T	0.02944	4.1	2.51	2.51	0.30379	Krueppel-associated box (4);	.	.	.	.	T	0.16471	0.0396	H	0.95079	3.62	0.19945	N	0.99994	D	0.58620	0.983	P	0.57502	0.822	T	0.05162	-1.0902	9	0.87932	D	0	.	8.5183	0.33259	0.0:1.0:0.0:0.0	.	30	Q9BS31	ZN649_HUMAN	N	30	ENSP00000347043:K30N	ENSP00000347043:K30N	K	-	3	2	ZNF649	57091969	0.071000	0.21146	0.242000	0.24170	0.005000	0.04900	0.529000	0.23019	1.402000	0.46780	0.543000	0.68304	AAG	.	.	.	none		0.547	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074	
U2AF2	11338	hgsc.bcm.edu	37	19	56180949	56180949	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr19:56180949A>T	ENST00000308924.4	+	11	1224	c.1184A>T	c.(1183-1185)tAt>tTt	p.Y395F	CTD-2537I9.12_ENST00000589456.1_RNA|U2AF2_ENST00000590551.1_Missense_Mutation_p.Y227F|U2AF2_ENST00000450554.2_Missense_Mutation_p.Y391F|CTD-2537I9.13_ENST00000592252.1_RNA|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	395	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Y395F(1)		biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GACGAGGAGTATGAGGAGATC	0.642																																					p.Y395F		Atlas-SNP	.											U2AF2,NS,carcinoma,0,1	U2AF2	62	.	1	Substitution - Missense(1)	lung(1)	c.A1184T						PASS	.						154.0	136.0	142.0					19																	56180949		2203	4300	6503	SO:0001583	missense	11338	exon11			AGGAGTATGAGGA	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.1184A>T	chr19.hg19:g.56180949A>T	ENSP00000307863:p.Tyr395Phe	173.0	0.0	.		145.0	62.0	.	NM_007279	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	hg19	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	A	16.71	3.199227	0.58126	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.15834	2.43;2.39	4.72	4.72	0.59763	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.64402	D	0.000001	T	0.32346	0.0826	L	0.56396	1.775	0.80722	D	1	B;P	0.39326	0.214;0.668	P;P	0.54856	0.462;0.762	T	0.02244	-1.1189	10	0.29301	T	0.29	-7.7435	13.4951	0.61421	1.0:0.0:0.0:0.0	.	395;391	P26368;P26368-2	U2AF2_HUMAN;.	F	395;391	ENSP00000307863:Y395F;ENSP00000388475:Y391F	ENSP00000307863:Y395F	Y	+	2	0	U2AF2	60872761	1.000000	0.71417	0.884000	0.34674	0.008000	0.06430	8.801000	0.91905	1.911000	0.55334	0.533000	0.62120	TAT	.	.	.	none		0.642	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279	
ZNF543	125919	hgsc.bcm.edu	37	19	57840518	57840518	+	Missense_Mutation	SNP	C	C	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr19:57840518C>A	ENST00000321545.4	+	4	2033	c.1688C>A	c.(1687-1689)aCc>aAc	p.T563N		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	563					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGAAACCCTACCATTGTAACA	0.428																																					p.T563N		Atlas-SNP	.											.	ZNF543	61	.	0			c.C1688A						PASS	.						94.0	87.0	89.0					19																	57840518		2203	4300	6503	SO:0001583	missense	125919	exon4			ACCCTACCATTGT	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.1688C>A	chr19.hg19:g.57840518C>A	ENSP00000322545:p.Thr563Asn	165.0	0.0	.		230.0	11.0	.	NM_213598	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	ENST00000321545.4	hg19	CCDS33130.1	.	.	.	.	.	.	.	.	.	.	C	9.223	1.033879	0.19590	.	.	ENSG00000178229	ENST00000321545	T	0.06608	3.28	2.35	-1.29	0.09288	.	.	.	.	.	T	0.01976	0.0062	N	0.01576	-0.805	0.09310	N	1	B	0.32731	0.382	B	0.29176	0.099	T	0.41324	-0.9515	9	0.72032	D	0.01	.	3.2089	0.06676	0.1777:0.2393:0.0:0.5829	.	563	Q08ER8	ZN543_HUMAN	N	563	ENSP00000322545:T563N	ENSP00000322545:T563N	T	+	2	0	ZNF543	62532330	0.000000	0.05858	0.000000	0.03702	0.175000	0.22909	-0.247000	0.08866	-0.402000	0.07633	-0.379000	0.06801	ACC	.	.	.	none		0.428	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865	
SMOX	54498	hgsc.bcm.edu	37	20	4167467	4167467	+	Intron	SNP	G	G	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr20:4167467G>C	ENST00000305958.4	+	7	1755				SMOX_ENST00000339123.6_Intron|SMOX_ENST00000278795.3_Missense_Mutation_p.R483S|SMOX_ENST00000379460.2_Intron|SMOX_ENST00000346595.2_Intron	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase						cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	atgctaacaggggcgccgtaa	0.473																																					p.R536S		Atlas-SNP	.											.	SMOX	119	.	0			c.G1608C						PASS	.						70.0	69.0	69.0					20																	4167467		2203	4300	6503	SO:0001627	intron_variant	54498	exon7			TAACAGGGGCGCC	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.1531-450G>C	chr20.hg19:g.4167467G>C		54.0	0.0	.		92.0	30.0	.	NM_001270691	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Missense_Mutation	SNP	ENST00000305958.4	hg19	CCDS13075.1	.	.	.	.	.	.	.	.	.	.	G	5.907	0.351463	0.11182	.	.	ENSG00000088826	ENST00000278795;ENST00000457205	T;T	0.28895	1.59;1.6	3.49	0.43	0.16515	.	.	.	.	.	T	0.12008	0.0292	.	.	.	0.80722	D	1	B;B	0.30889	0.299;0.072	B;B	0.15052	0.012;0.008	T	0.19614	-1.0300	8	0.10377	T	0.69	.	5.7954	0.18383	0.3566:0.0:0.6434:0.0	.	536;483	Q9NWM0-6;Q9NWM0-4	.;.	S	483;393	ENSP00000278795:R483S;ENSP00000407269:R393S	ENSP00000278795:R483S	R	+	3	2	SMOX	4115467	1.000000	0.71417	0.992000	0.48379	0.923000	0.55619	2.300000	0.43620	0.127000	0.18452	-0.140000	0.14226	AGG	.	.	.	none		0.473	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
PAX1	5075	hgsc.bcm.edu	37	20	21695396	21695396	+	Silent	SNP	C	C	T	rs368125977		TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr20:21695396C>T	ENST00000398485.2	+	5	1614	c.1560C>T	c.(1558-1560)ttC>ttT	p.F520F	PAX1_ENST00000444366.2_3'UTR	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	520					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CACCACACTTCCTTTATTGGT	0.632																																					p.F520F		Atlas-SNP	.											.	PAX1	152	.	0			c.C1560T						PASS	.						62.0	56.0	58.0					20																	21695396		2203	4300	6503	SO:0001819	synonymous_variant	5075	exon5			ACACTTCCTTTAT		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.1560C>T	chr20.hg19:g.21695396C>T		76.0	0.0	.		88.0	59.0	.	NM_006192	B4E0D6|Q642X9|Q6NTC0|Q9Y558	Silent	SNP	ENST00000398485.2	hg19	CCDS13146.2																																																																																			.	.	.	weak		0.632	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3		
SLC32A1	140679	hgsc.bcm.edu	37	20	37356236	37356236	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr20:37356236G>T	ENST00000217420.1	+	2	795	c.532G>T	c.(532-534)Gag>Tag	p.E178*		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	178					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.E178*(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	TGAAGACGGCGAGGTGGTGCG	0.637																																					p.E178X		Atlas-SNP	.											SLC32A1,NS,carcinoma,0,2	SLC32A1	81	.	1	Substitution - Nonsense(1)	lung(1)	c.G532T						PASS	.						79.0	63.0	68.0					20																	37356236		2203	4300	6503	SO:0001587	stop_gained	140679	exon2			GACGGCGAGGTGG	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.532G>T	chr20.hg19:g.37356236G>T	ENSP00000217420:p.Glu178*	30.0	0.0	.		44.0	2.0	.	NM_080552	Q8N489	Nonsense_Mutation	SNP	ENST00000217420.1	hg19	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	G	37	6.235027	0.97399	.	.	ENSG00000101438	ENST00000217420	.	.	.	4.13	3.16	0.36331	.	0.058315	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-13.9018	11.7879	0.52053	0.0:0.1796:0.8204:0.0	.	.	.	.	X	178	.	ENSP00000217420:E178X	E	+	1	0	SLC32A1	36789650	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.814000	0.62627	1.081000	0.41110	-0.302000	0.09304	GAG	.	.	.	none		0.637	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
PTPRT	11122	hgsc.bcm.edu	37	20	40790019	40790019	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr20:40790019C>G	ENST00000373187.1	-	17	2654	c.2655G>C	c.(2653-2655)caG>caC	p.Q885H	PTPRT_ENST00000373190.1_Missense_Mutation_p.Q884H|PTPRT_ENST00000356100.2_Missense_Mutation_p.Q894H|PTPRT_ENST00000373201.1_Missense_Mutation_p.Q875H|PTPRT_ENST00000373184.1_Missense_Mutation_p.Q875H|PTPRT_ENST00000373198.4_Missense_Mutation_p.Q904H|PTPRT_ENST00000373193.3_Missense_Mutation_p.Q888H			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	885					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				ACCCGTAGCCCTGGCCTCTCT	0.557																																					p.Q904H		Atlas-SNP	.											.	PTPRT	372	.	0			c.G2712C						PASS	.						64.0	68.0	67.0					20																	40790019		2105	4252	6357	SO:0001583	missense	11122	exon18			GTAGCCCTGGCCT	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2655G>C	chr20.hg19:g.40790019C>G	ENSP00000362283:p.Gln885His	108.0	0.0	.		148.0	48.0	.	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	hg19	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459433	0.63401	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54	5.2	0.45	0.16624	.	0.057706	0.64402	N	0.000001	T	0.38188	0.1031	L	0.54323	1.7	0.58432	D	0.999998	P;P	0.52692	0.955;0.845	P;B	0.56088	0.791;0.382	T	0.17961	-1.0352	10	0.87932	D	0	.	8.101	0.30857	0.0:0.6568:0.1185:0.2247	.	907;885	O14522-1;O14522	.;PTPRT_HUMAN	H	884;885;888;894;907;875;875	ENSP00000362286:Q884H;ENSP00000362283:Q885H;ENSP00000362289:Q888H;ENSP00000348408:Q894H;ENSP00000362294:Q907H;ENSP00000362280:Q875H;ENSP00000362297:Q875H	ENSP00000348408:Q894H	Q	-	3	2	PTPRT	40223433	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.886000	0.28241	0.201000	0.20466	-0.182000	0.12963	CAG	.	.	.	none		0.557	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
PTGIS	5740	hgsc.bcm.edu	37	20	48129710	48129710	+	Silent	SNP	G	G	A	rs561620152		TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr20:48129710G>A	ENST00000244043.4	-	8	1142	c.1113C>T	c.(1111-1113)gaC>gaT	p.D371D	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	371					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)	p.D371D(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	ATTCTCGCCCGTCTGCCATGG	0.602													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16866	0.0		0.0	False		,,,				2504	0.0				p.D371D		Atlas-SNP	.											PTGIS,colon,carcinoma,0,1	PTGIS	60	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1113T						PASS	.						97.0	86.0	89.0					20																	48129710		2203	4300	6503	SO:0001819	synonymous_variant	5740	exon8			TCGCCCGTCTGCC		CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.1113C>T	chr20.hg19:g.48129710G>A		75.0	0.0	.		109.0	34.0	.	NM_000961	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Silent	SNP	ENST00000244043.4	hg19	CCDS13419.1																																																																																			.	.	.	none		0.602	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2		
PHACTR3	116154	hgsc.bcm.edu	37	20	58415459	58415459	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr20:58415459G>A	ENST00000371015.1	+	10	1887	c.1420G>A	c.(1420-1422)Gaa>Aaa	p.E474K	PHACTR3_ENST00000359926.3_Missense_Mutation_p.E471K|PHACTR3_ENST00000355648.4_Missense_Mutation_p.E433K|PHACTR3_ENST00000395639.4_Missense_Mutation_p.E363K|PHACTR3_ENST00000395636.2_Missense_Mutation_p.E433K|PHACTR3_ENST00000541461.1_Missense_Mutation_p.E433K|PHACTR3_ENST00000361300.4_Missense_Mutation_p.E363K	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	474	Required for PP1CA binding and inhibition of PP1 activity.					nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AGAAAGAAGAGAAATCAAGCA	0.358																																					p.E474K		Atlas-SNP	.											.	PHACTR3	104	.	0			c.G1420A						PASS	.						138.0	129.0	132.0					20																	58415459		2203	4300	6503	SO:0001583	missense	116154	exon10			AGAAGAGAAATCA	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.1420G>A	chr20.hg19:g.58415459G>A	ENSP00000360054:p.Glu474Lys	244.0	0.0	.		334.0	87.0	.	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	hg19	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700042	0.88924	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.37058	1.51;1.4;1.22;1.53;1.53;1.53;1.22	5.55	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.59676	0.2211	M	0.71581	2.175	0.80722	D	1	D;D;P;D	0.89917	1.0;0.999;0.869;0.987	D;D;P;D	0.85130	0.997;0.996;0.587;0.937	T	0.64198	-0.6464	10	0.62326	D	0.03	-21.4747	15.4682	0.75419	0.0:0.139:0.861:0.0	.	433;363;474;471	B1AN68;Q96KR7-3;Q96KR7;B1AKX0	.;.;PHAR3_HUMAN;.	K	471;474;363;433;433;433;363	ENSP00000353002:E471K;ENSP00000360054:E474K;ENSP00000379001:E363K;ENSP00000442483:E433K;ENSP00000347866:E433K;ENSP00000378998:E433K;ENSP00000354555:E363K	ENSP00000347866:E433K	E	+	1	0	PHACTR3	57848854	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	9.609000	0.98334	1.333000	0.45449	0.655000	0.94253	GAA	.	.	.	none		0.358	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
C22orf42	150297	hgsc.bcm.edu	37	22	32555136	32555136	+	Missense_Mutation	SNP	C	C	T			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr22:32555136C>T	ENST00000382097.3	-	1	139	c.67G>A	c.(67-69)Gat>Aat	p.D23N	RP1-90G24.8_ENST00000426354.1_lincRNA	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	23										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						GGTCCCACATCTGGCCTGCAG	0.557																																					p.D23N		Atlas-SNP	.											.	C22orf42	37	.	0			c.G67A						PASS	.						78.0	72.0	74.0					22																	32555136		2203	4300	6503	SO:0001583	missense	150297	exon1			CCACATCTGGCCT	BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.67G>A	chr22.hg19:g.32555136C>T	ENSP00000371529:p.Asp23Asn	62.0	0.0	.		80.0	34.0	.	NM_001010859	A4QPH5	Missense_Mutation	SNP	ENST00000382097.3	hg19	CCDS33639.1	.	.	.	.	.	.	.	.	.	.	C	3.630	-0.075776	0.07184	.	.	ENSG00000205856	ENST00000382097	T	0.26067	1.76	0.131	-0.261	0.12963	.	.	.	.	.	T	0.17534	0.0421	N	0.08118	0	0.09310	N	1	P	0.46395	0.877	P	0.53518	0.728	T	0.13899	-1.0492	8	0.54805	T	0.06	.	.	.	.	.	23	Q6IC83	CV042_HUMAN	N	23	ENSP00000371529:D23N	ENSP00000371529:D23N	D	-	1	0	C22orf42	30885136	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-1.069000	0.03444	-1.313000	0.02303	-1.326000	0.01283	GAT	.	.	.	none		0.557	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859	
NOL12	79159	hgsc.bcm.edu	37	22	38087326	38087326	+	Silent	SNP	C	C	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr22:38087326C>A	ENST00000359114.4	+	6	695	c.625C>A	c.(625-627)Cgg>Agg	p.R209R	NOL12_ENST00000493862.1_3'UTR	NM_024313.2	NP_077289.1	Q9UGY1	NOL12_HUMAN	nucleolar protein 12	209						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	8	Melanoma(58;0.0574)					AGGCAAAGCACGGCACAGCGG	0.657																																					p.R209R		Atlas-SNP	.											.	NOL12	22	.	0			c.C625A						PASS	.						39.0	39.0	39.0					22																	38087326		2203	4300	6503	SO:0001819	synonymous_variant	79159	exon6			AAAGCACGGCACA	Z83844	CCDS13955.1	22q13.1	2012-05-02			ENSG00000256872	ENSG00000273899			28585	protein-coding gene	gene with protein product						12477932	Standard	NM_024313		Approved	MGC3731, Nop25, RRP17	uc003atp.3	Q9UGY1	OTTHUMG00000150660	ENST00000359114.4:c.625C>A	chr22.hg19:g.38087326C>A		253.0	1.0	.		240.0	108.0	.	NM_024313		Silent	SNP	ENST00000359114.4	hg19	CCDS13955.1																																																																																			.	.	.	none		0.657	NOL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319476.1	NM_024313	
HUWE1	10075	hgsc.bcm.edu	37	X	53566667	53566667	+	Silent	SNP	C	C	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chrX:53566667C>A	ENST00000342160.3	-	74	12040	c.11583G>T	c.(11581-11583)ggG>ggT	p.G3861G	HUWE1_ENST00000262854.6_Silent_p.G3861G			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3861					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TTAGACACTCCCCAAGCATGT	0.562																																					p.G3861G		Atlas-SNP	.											.	HUWE1	724	.	0			c.G11583T						PASS	.						118.0	95.0	103.0					X																	53566667		2203	4300	6503	SO:0001819	synonymous_variant	10075	exon75			ACACTCCCCAAGC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11583G>T	chrX.hg19:g.53566667C>A		100.0	0.0	.		107.0	52.0	.	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386343	0.25031	.	.	ENSG00000086758	ENST00000427052;ENST00000426907	.	.	.	5.81	1.61	0.23674	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	5.6485	0.17602	0.0:0.3479:0.3332:0.3189	.	.	.	.	X	2895;684	.	ENSP00000403236:G684X	G	-	1	0	HUWE1	53583392	0.730000	0.28100	1.000000	0.80357	0.992000	0.81027	-0.225000	0.09151	0.149000	0.19098	0.600000	0.82982	GGA	.	.	.	none		0.562	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
MAGEE1	57692	hgsc.bcm.edu	37	X	75651091	75651091	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chrX:75651091G>A	ENST00000361470.2	+	1	3046	c.2768G>A	c.(2767-2769)aGa>aAa	p.R923K		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	923	Interaction with DTNA. {ECO:0000250}.|MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						AGAATCCACAGAAAGGAACCA	0.493																																					p.R923K		Atlas-SNP	.											.	MAGEE1	236	.	0			c.G2768A						PASS	.						71.0	66.0	68.0					X																	75651091		2203	4300	6503	SO:0001583	missense	57692	exon1			TCCACAGAAAGGA	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.2768G>A	chrX.hg19:g.75651091G>A	ENSP00000354912:p.Arg923Lys	426.0	0.0	.		367.0	130.0	.	NM_020932	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	ENST00000361470.2	hg19	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	.	4.934	0.173547	0.09391	.	.	ENSG00000198934	ENST00000361470	T	0.03272	3.99	2.21	1.33	0.21861	.	.	.	.	.	T	0.01353	0.0044	N	0.04508	-0.205	0.22001	N	0.999426	B	0.27286	0.174	B	0.19148	0.024	T	0.44757	-0.9307	9	0.02654	T	1	.	4.1401	0.10189	0.216:0.0:0.784:0.0	.	923	Q9HCI5	MAGE1_HUMAN	K	923	ENSP00000354912:R923K	ENSP00000354912:R923K	R	+	2	0	MAGEE1	75567495	1.000000	0.71417	0.766000	0.31476	0.977000	0.68977	0.700000	0.25601	0.369000	0.24510	0.529000	0.55759	AGA	.	.	.	none		0.493	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
TCEAL3	85012	hgsc.bcm.edu	37	X	102864302	102864302	+	Missense_Mutation	SNP	G	G	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chrX:102864302G>C	ENST00000372628.1	+	3	668	c.310G>C	c.(310-312)Gat>Cat	p.D104H	TCEAL3_ENST00000372627.5_Missense_Mutation_p.D104H|TCEAL3_ENST00000243286.3_Missense_Mutation_p.D104H|TCEAL3_ENST00000477014.1_Intron			Q969E4	TCAL3_HUMAN	transcription elongation factor A (SII)-like 3	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	16						CCCGGCTGAAGATTATGTGCC	0.607																																					p.D104H		Atlas-SNP	.											.	TCEAL3	24	.	0			c.G310C						PASS	.						80.0	82.0	82.0					X																	102864302		2203	4300	6503	SO:0001583	missense	85012	exon3			GCTGAAGATTATG	BC008703	CCDS14511.1	Xq22.2	2014-03-21			ENSG00000196507	ENSG00000196507			28247	protein-coding gene	gene with protein product						16221301	Standard	NM_032926		Approved	MGC15737, WEX8	uc004ekr.3	Q969E4	OTTHUMG00000022106	ENST00000372628.1:c.310G>C	chrX.hg19:g.102864302G>C	ENSP00000361711:p.Asp104His	318.0	0.0	.		275.0	120.0	.	NM_001006933	D3DXA4	Missense_Mutation	SNP	ENST00000372628.1	hg19	CCDS14511.1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854858	0.71719	.	.	ENSG00000196507	ENST00000372628;ENST00000372627;ENST00000243286	T;T;T	0.10573	2.86;2.86;2.86	4.47	4.47	0.54385	.	0.198219	0.25114	N	0.033032	T	0.28067	0.0692	M	0.68952	2.095	0.38999	D	0.959307	D	0.71674	0.998	D	0.68943	0.961	T	0.01998	-1.1232	10	0.72032	D	0.01	.	11.4217	0.49985	0.0:0.0:1.0:0.0	.	104	Q969E4	TCAL3_HUMAN	H	104	ENSP00000361711:D104H;ENSP00000361710:D104H;ENSP00000243286:D104H	ENSP00000243286:D104H	D	+	1	0	TCEAL3	102750958	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.021000	0.41020	2.468000	0.83385	0.538000	0.68166	GAT	.	.	.	none		0.607	TCEAL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057737.1	NM_032926	
SASH3	54440	hgsc.bcm.edu	37	X	128922424	128922424	+	Silent	SNP	A	A	C			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chrX:128922424A>C	ENST00000356892.3	+	3	285	c.171A>C	c.(169-171)tcA>tcC	p.S57S		NM_018990.3	NP_061863.1	O75995	SASH3_HUMAN	SAM and SH3 domain containing 3	57					homeostasis of number of cells within a tissue (GO:0048873)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tumor necrosis factor production (GO:0032760)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	12						AAGATGACTCAGGTGTCCCCA	0.552																																					p.S57S		Atlas-SNP	.											.	SASH3	35	.	0			c.A171C						PASS	.						78.0	64.0	69.0					X																	128922424		2203	4300	6503	SO:0001819	synonymous_variant	54440	exon3			TGACTCAGGTGTC	BC051881	CCDS14614.1	Xq26	2013-01-10	2008-02-18	2008-02-18	ENSG00000122122	ENSG00000122122		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	15975	protein-coding gene	gene with protein product		300441	"""chromosome X open reading frame 9"""	CXorf9		11470164	Standard	NM_018990		Approved	SLY, 753P9, SH3D6C, HACS2	uc004euu.3	O75995	OTTHUMG00000022372	ENST00000356892.3:c.171A>C	chrX.hg19:g.128922424A>C		404.0	0.0	.		350.0	27.0	.	NM_018990	A6NCH1|A8K7K8|Q5JZ38	Silent	SNP	ENST00000356892.3	hg19	CCDS14614.1																																																																																			.	.	.	none		0.552	SASH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058208.1	NM_018990	
ZKSCAN4	387032	hgsc.bcm.edu	37	6	28213691	28213692	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr6:28213691_28213692delGC	ENST00000377294.2	-	5	1083_1084	c.840_841delGC	c.(838-843)gagcatfs	p.H281fs	ZKSCAN4_ENST00000423974.2_Frame_Shift_Del_p.H126fs	NM_019110.3	NP_061983.2	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	281	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						ATCTTCCCATGCTCCTTTTCTG	0.49																																					p.281_281del		Atlas-Indel,Pindel	.											.	ZKSCAN4	42	.	0			c.841_842del						PASS	.																																			SO:0001589	frameshift_variant	387032	exon5			.	AK056698	CCDS4647.1	6p21	2013-01-09	2007-02-20	2007-02-20	ENSG00000187626	ENSG00000187626		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13854	protein-coding gene	gene with protein product		611643	"""zinc finger protein 307"", ""zinc finger protein 427"""	ZNF307, ZNF427		12477932	Standard	NM_019110		Approved	p373c6.1, P1P373C6, FLJ32136, ZSCAN36	uc003nks.1	Q969J2	OTTHUMG00000014511	ENST00000377294.2:c.840_841delGC	chr6.hg19:g.28213691_28213692delGC	ENSP00000366509:p.His281fs	108.0	0.0	0		85.0	36.0	0.423529	NM_019110	B2RE32|Q5U7L4	Frame_Shift_Del	DEL	ENST00000377294.2	hg19	CCDS4647.1																																																																																			.	.	.	none		0.490	ZKSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040179.1	NM_019110	
HNRNPA1	3178	hgsc.bcm.edu	37	12	54675281	54675282	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr12:54675281_54675282delTG	ENST00000340913.6	+	2	180_181	c.127_128delTG	c.(127-129)tgtfs	p.C43fs	HNRNPA1_ENST00000330752.8_Frame_Shift_Del_p.C43fs|CBX5_ENST00000209875.4_5'Flank|RP11-968A15.2_ENST00000547177.1_RNA|HNRNPA1_ENST00000546500.1_Frame_Shift_Del_p.C43fs|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000547276.1_Frame_Shift_Del_p.C43fs	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	43	Globular A domain.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						GCTCACGGACTGTGTGGTAAGA	0.47																																					p.42_43del	Colon(83;502 1289 8436 16406 24870)	Atlas-Indel,Pindel	.											.	HNRNPA1	72	.	0			c.126_127del						PASS	.																																			SO:0001589	frameshift_variant	3178	exon2			.	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.127_128delTG	chr12.hg19:g.54675285_54675286delTG	ENSP00000341826:p.Cys43fs	31.0	0.0	0		36.0	16.0	0.444444	NM_002136	A8K4Z8|Q3MIB7|Q6PJZ7	Frame_Shift_Del	DEL	ENST00000340913.6	hg19	CCDS44909.1																																																																																			.	.	.	none		0.470	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
FSD2	123722	hgsc.bcm.edu	37	15	83428118	83428118	+	Frame_Shift_Del	DEL	T	T	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr15:83428118delT	ENST00000334574.8	-	13	2413	c.2232delA	c.(2230-2232)aaafs	p.K744fs	RP11-752G15.6_ENST00000561107.1_RNA|RP11-752G15.6_ENST00000558174.1_RNA|RP11-752G15.6_ENST00000559366.1_RNA|FSD2_ENST00000541889.1_Frame_Shift_Del_p.K699fs			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	744	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.									breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						AAGTGACATGTTTTGGCATTG	0.438																																					p.H745fs		Atlas-Indel,Pindel	.											.	FSD2	45	.	0			c.2233delC						PASS	.						71.0	75.0	73.0					15																	83428118		1968	4158	6126	SO:0001589	frameshift_variant	123722	exon13			.	AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.2232delA	chr15.hg19:g.83428118delT	ENSP00000335651:p.Lys744fs	80.0	0.0	0		67.0	34.0	0.507463	NM_001007122	B3KVG1|B7ZM02	Frame_Shift_Del	DEL	ENST00000334574.8	hg19	CCDS45332.1																																																																																			.	.	.	none		0.438	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418385.1	NM_001007122	
ITIH3	3699	hgsc.bcm.edu	37	3	52835082	52835082	+	Frame_Shift_Del	DEL	T	T	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:52835082delT	ENST00000449956.2	+	11	1309	c.1303delT	c.(1303-1305)ttcfs	p.F435fs	ITIH3_ENST00000416872.2_Frame_Shift_Del_p.F435fs	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	435	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GAATTATAACTTCCTGGAGAA	0.502																																					p.N434fs		Atlas-Indel,Pindel	.											.	ITIH3	132	.	0			c.1302delC						PASS	.						102.0	105.0	104.0					3																	52835082		1922	4124	6046	SO:0001589	frameshift_variant	3699	exon11			.		CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.1303delT	chr3.hg19:g.52835082delT	ENSP00000415769:p.Phe435fs	170.0	0.0	0		153.0	59.0	0.385621	NM_002217	Q3B7H5|Q53F06|Q6LAM2|Q99085	Frame_Shift_Del	DEL	ENST00000449956.2	hg19	CCDS46845.1																																																																																			.	.	.	none		0.502	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217	
ING4	51147	hgsc.bcm.edu	37	12	6760546	6760546	+	Frame_Shift_Del	DEL	G	G	-	rs371902029		TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr12:6760546delG	ENST00000396807.4	-	7	692	c.654delC	c.(652-654)tccfs	p.S218fs	ING4_ENST00000423703.2_Frame_Shift_Del_p.P169fs|ING4_ENST00000444704.2_Frame_Shift_Del_p.S194fs|ING4_ENST00000412586.2_Frame_Shift_Del_p.S215fs|ING4_ENST00000486287.1_5'UTR|ING4_ENST00000341550.4_Frame_Shift_Del_p.S217fs|ING4_ENST00000446105.2_Frame_Shift_Del_p.S214fs	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4	218					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						ACCACTCAATGGAACACTGGA	0.532																																					p.I219fs		Atlas-INDEL	.											.	ING4	31	.	0			c.655delA						PASS	.						88.0	74.0	79.0					12																	6760546		2203	4300	6503	SO:0001589	frameshift_variant	51147	exon7			.	AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.654delC	chr12.hg19:g.6760546delG	ENSP00000380024:p.Ser218fs	103.0	0.0	0		164.0	13.0	0.0792683	NM_001127582	A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Frame_Shift_Del	DEL	ENST00000396807.4	hg19	CCDS44813.1																																																																																			.	.	.	none		0.532	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280467.2	NM_198287	
MYO3B	140469	hgsc.bcm.edu	37	2	171319897	171319898	+	Frame_Shift_Ins	INS	-	-	A			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr2:171319897_171319898insA	ENST00000408978.4	+	24	2893_2894	c.2750_2751insA	c.(2749-2754)atacggfs	p.R918fs	MYO3B_ENST00000409044.3_Frame_Shift_Ins_p.R918fs|MYO3B_ENST00000334231.6_Frame_Shift_Ins_p.R927fs|MYO3B_ENST00000602629.1_Intron	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	918	Myosin motor.		R -> Q (in dbSNP:rs55769829). {ECO:0000269|PubMed:17344846}.		peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						CTGGAGGTGATACGGCATCCGG	0.49																																					p.I917fs		Atlas-Indel,Pindel	.											.	MYO3B	320	.	0			c.2750_2751insA						PASS	.																																			SO:0001589	frameshift_variant	140469	exon24			.		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2751dupA	chr2.hg19:g.171319898_171319898dupA	ENSP00000386213:p.Arg918fs	123.0	0.0	0		108.0	50.0	0.462963	NM_001083615	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Frame_Shift_Ins	INS	ENST00000408978.4	hg19	CCDS42773.1																																																																																			.	.	.	none		0.490	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		
ATCAY	85300	hgsc.bcm.edu	37	19	3905489	3905489	+	Frame_Shift_Del	DEL	C	C	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr19:3905489delC	ENST00000450849.2	+	4	661	c.194delC	c.(193-195)gccfs	p.A65fs	ATCAY_ENST00000301260.6_Frame_Shift_Del_p.A65fs|ATCAY_ENST00000398448.3_Frame_Shift_Del_p.A71fs|ATCAY_ENST00000600960.1_Frame_Shift_Del_p.A65fs	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	65					apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)	p.A65V(2)		breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		ACGCTGGTGGCCCCAGAGATC	0.488																																					p.A65fs		Atlas-Indel,Pindel	.											.	ATCAY	84	.	2	Substitution - Missense(2)	kidney(2)	c.193delG						PASS	.						66.0	67.0	66.0					19																	3905489		1958	4142	6100	SO:0001589	frameshift_variant	85300	exon4			.		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.194delC	chr19.hg19:g.3905489delC	ENSP00000390941:p.Ala65fs	127.0	0.0	0		115.0	43.0	0.373913	NM_033064	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Frame_Shift_Del	DEL	ENST00000450849.2	hg19	CCDS45923.1																																																																																			.	.	.	none		0.488	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2		
PEX5L	51555	hgsc.bcm.edu	37	3	179615950	179615950	+	Frame_Shift_Del	DEL	G	G	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:179615950delG	ENST00000467460.1	-	3	508	c.178delC	c.(178-180)ctcfs	p.L61fs	PEX5L_ENST00000464614.1_Frame_Shift_Del_p.L18fs|PEX5L_ENST00000472994.1_Intron|PEX5L_ENST00000465751.1_Frame_Shift_Del_p.L37fs|PEX5L_ENST00000263962.8_Frame_Shift_Del_p.L59fs|PEX5L_ENST00000468741.1_Intron|PEX5L_ENST00000392649.3_Frame_Shift_Del_p.L18fs|PEX5L_ENST00000476138.1_Frame_Shift_Del_p.L18fs|PEX5L_ENST00000485199.1_Intron|PEX5L-AS2_ENST00000462801.1_RNA	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	61					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			ATAGTAAGGAGGGGCTTTTCT	0.438																																					p.L60fs		Atlas-Indel,Pindel	.											.	PEX5L	104	.	0			c.179delT						PASS	.						111.0	105.0	107.0					3																	179615950		2203	4300	6503	SO:0001589	frameshift_variant	51555	exon3			.	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.178delC	chr3.hg19:g.179615950delG	ENSP00000419975:p.Leu61fs	98.0	0.0	0		112.0	45.0	0.401786	NM_016559	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Frame_Shift_Del	DEL	ENST00000467460.1	hg19	CCDS3236.1																																																																																			.	.	.	none		0.438	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	
RNF32	140545	hgsc.bcm.edu	37	7	156451243	156451243	+	Frame_Shift_Del	DEL	A	A	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr7:156451243delA	ENST00000405335.1	+	8	1072	c.663delA	c.(661-663)agafs	p.R221fs	AC005534.8_ENST00000455709.1_RNA|RNF32_ENST00000432459.2_Frame_Shift_Del_p.R221fs|RNF32_ENST00000392743.2_Frame_Shift_Del_p.R221fs|RNF32_ENST00000343665.4_Frame_Shift_Del_p.R197fs|RNF32_ENST00000480011.1_3'UTR|RNF32_ENST00000311822.8_Frame_Shift_Del_p.R221fs|RNF32_ENST00000392741.2_Frame_Shift_Del_p.R221fs|RNF32_ENST00000317955.5_Frame_Shift_Del_p.R221fs			Q9H0A6	RNF32_HUMAN	ring finger protein 32	221						aggresome (GO:0016235)|endosome (GO:0005768)	zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(2)	15	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CCAAGTTAAGAAAAAAATTCT	0.423																																					p.R221fs		Atlas-Indel,Pindel	.											.	RNF32	77	.	0			c.662delG						PASS	.						76.0	82.0	80.0					7																	156451243		2203	4300	6503	SO:0001589	frameshift_variant	140545	exon7			.		CCDS5944.1	7q36	2013-08-05			ENSG00000105982	ENSG00000105982		"""RING-type (C3HC4) zinc fingers"""	17118	protein-coding gene	gene with protein product		610241				11890671	Standard	NM_001184996		Approved	FKSG33, HSD15, LMBR2	uc003wmr.3	Q9H0A6	OTTHUMG00000151440	ENST00000405335.1:c.663delA	chr7.hg19:g.156451243delA	ENSP00000385285:p.Arg221fs	125.0	0.0	0		204.0	103.0	0.504902	NM_030936	Q6FIB3|Q6X7T4|Q8N6V8|Q8TDG0|Q96BM5|Q9Y6U1	Frame_Shift_Del	DEL	ENST00000405335.1	hg19	CCDS5944.1																																																																																			.	.	.	none		0.423	RNF32-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322660.2	NM_030936	
ZDHHC7	55625	hgsc.bcm.edu	37	16	85012877	85012877	+	Frame_Shift_Del	DEL	C	C	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr16:85012877delC	ENST00000313732.4	-	5	807	c.455delG	c.(454-456)tgtfs	p.C152fs	ZDHHC7_ENST00000564466.1_Frame_Shift_Del_p.C189fs|ZDHHC7_ENST00000569488.1_5'UTR	NM_017740.2	NP_060210.2	Q9NXF8	ZDHC7_HUMAN	zinc finger, DHHC-type containing 7	152					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(4)	10						TTTCCGAATACATCTTTTGCA	0.348																																					p.C189X		Atlas-Indel,Pindel	.											.	ZDHHC7	55	.	0			c.567delT						PASS	.						104.0	101.0	102.0					16																	85012877		2199	4300	6499	SO:0001589	frameshift_variant	55625	exon6			.	AK000286	CCDS10950.1, CCDS45538.1	16q23.1	2010-02-09			ENSG00000153786	ENSG00000153786		"""Zinc fingers, DHHC-type"""	18459	protein-coding gene	gene with protein product	"""Sertoli cell gene with zinc finger domain-&#946;"""	614604					Standard	NM_017740		Approved	FLJ10792, ZNF370, FLJ20279, SERZ-B, SERZ1	uc002fiq.2	Q9NXF8	OTTHUMG00000137645	ENST00000313732.4:c.455delG	chr16.hg19:g.85012877delC	ENSP00000315604:p.Cys152fs	256.0	0.0	0		207.0	90.0	0.434783	NM_001145548	D3DUM1|Q8WV42|Q9NVD8	Frame_Shift_Del	DEL	ENST00000313732.4	hg19	CCDS10950.1																																																																																			.	.	.	none		0.348	ZDHHC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269087.1	NM_017740	
MAP3K6	9064	hgsc.bcm.edu	37	1	27689486	27689486	+	Frame_Shift_Del	DEL	T	T	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr1:27689486delT	ENST00000493901.1	-	8	1237	c.998delA	c.(997-999)aagfs	p.K333fs	MAP3K6_ENST00000374040.3_Frame_Shift_Del_p.K325fs|MAP3K6_ENST00000357582.2_Frame_Shift_Del_p.K333fs	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	333					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		AGACAGGGCCTTCGCCCGGTC	0.607																																					p.K333fs		Atlas-Indel,Pindel	.											.	MAP3K6	134	.	0			c.999delG						PASS	.						33.0	38.0	36.0					1																	27689486		2203	4300	6503	SO:0001589	frameshift_variant	9064	exon7			.	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.998delA	chr1.hg19:g.27689486delT	ENSP00000419591:p.Lys333fs	187.0	0.0	0		170.0	70.0	0.411765	NM_004672	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Frame_Shift_Del	DEL	ENST00000493901.1	hg19	CCDS299.1																																																																																			.	.	.	none		0.607	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	NM_004672	
ABI3BP	25890	hgsc.bcm.edu	37	3	100565237	100565237	+	Frame_Shift_Del	DEL	C	C	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:100565237delC	ENST00000284322.5	-	18	1685	c.1576delG	c.(1576-1578)gaafs	p.E526fs	ABI3BP_ENST00000383691.4_5'UTR|ABI3BP_ENST00000495063.1_Frame_Shift_Del_p.E575fs|ABI3BP_ENST00000471714.1_Frame_Shift_Del_p.E575fs	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	526	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TGTGTCACTTCTGGGCTGAGA	0.333																																					p.E526fs		Atlas-INDEL	.											.	ABI3BP	305	.	0			c.1577delA						PASS	.						74.0	69.0	71.0					3																	100565237		1806	4066	5872	SO:0001589	frameshift_variant	25890	exon18			.	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1576delG	chr3.hg19:g.100565237delC	ENSP00000284322:p.Glu526fs	108.0	0.0	0		133.0	60.0	0.451128	NM_015429	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Frame_Shift_Del	DEL	ENST00000284322.5	hg19	CCDS46880.1																																																																																			.	.	.	none		0.333	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1		
ABI3BP	25890	hgsc.bcm.edu	37	3	100565235	100565237	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-4A-A93W-01A-11D-A36X-10	TCGA-4A-A93W-10A-01D-A370-10	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c87c7ca-a0f4-4ba3-93f2-2d9f3a1db03a	afcc0a63-8340-47fc-a4da-380a1f4fda4a	g.chr3:100565235_100565237delTTC	ENST00000284322.5	-	18	1685_1687	c.1576_1578delGAA	c.(1576-1578)gaadel	p.E526del	ABI3BP_ENST00000383691.4_5'UTR|ABI3BP_ENST00000495063.1_In_Frame_Del_p.E575del|ABI3BP_ENST00000471714.1_In_Frame_Del_p.E575del	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	526	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TGTGTGTCACTTCTGGGCTGAGA	0.335																																					p.526_527del		Pindel	.											.	ABI3BP	305	.	0			c.1577_1579del						PASS	.																																			SO:0001651	inframe_deletion	25890	exon18			.	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1576_1578delGAA	chr3.hg19:g.100565235_100565237delTTC	ENSP00000284322:p.Glu526del	107.0	0.0	.		132.0	43.0	0.326	NM_015429	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	In_Frame_Del	DEL	ENST00000284322.5	hg19	CCDS46880.1																																																																																			.	.	.	none		0.335	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1		
