#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1orf86	199990	hgsc.bcm.edu	37	1	2116880	2116880	+	Missense_Mutation	SNP	T	T	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr1:2116880T>A	ENST00000400919.3	-	8	1349	c.281A>T	c.(280-282)gAg>gTg	p.E94V	RP11-181G12.2_ENST00000444529.1_RNA|RP11-181G12.2_ENST00000333854.2_RNA|RP11-181G12.2_ENST00000536678.1_RNA	NM_001282671.1	NP_001269600.1	Q6NZ36	FAP20_HUMAN	chromosome 1 open reading frame 86	93					cellular response to DNA damage stimulus (GO:0006974)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	cell junction (GO:0030054)|chromosome (GO:0005694)|Fanconi anaemia nuclear complex (GO:0043240)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)			central_nervous_system(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		GCCCCACATCTCAGACGCAAC	0.567																																					p.E177V		Atlas-SNP	.											.	C1orf86	20	.	0			c.A530T						PASS	.						131.0	109.0	116.0					1																	2116880		692	1591	2283	SO:0001583	missense	199990	exon8			CACATCTCAGACG	AK126870	CCDS38.2, CCDS57965.1, CCDS72686.1, CCDS72687.1	1p36.33	2013-05-22			ENSG00000162585	ENSG00000162585			26428	protein-coding gene	gene with protein product		615183				14702039	Standard	NM_182533		Approved	FLJ31031, FAAP20	uc031pkt.1	Q6NZ36	OTTHUMG00000001404	ENST00000400919.3:c.281A>T	chr1.hg19:g.2116880T>A	ENSP00000383710:p.Glu94Val	317.0	0.0	.		192.0	168.0	.	NM_001146310	A6PW39|A6PW40|A6PW41|A8MQT6|F2Z2L4|Q6ZT64|Q71M24|Q96ND7	Missense_Mutation	SNP	ENST00000400919.3	hg19		.	.	.	.	.	.	.	.	.	.	T	7.453	0.643019	0.14451	.	.	ENSG00000162585	ENST00000400919	.	.	.	3.14	-1.25	0.09405	.	.	.	.	.	T	0.12135	0.0295	N	0.08118	0	0.09310	N	1	P	0.41848	0.763	B	0.35550	0.205	T	0.15492	-1.0435	8	0.87932	D	0	.	4.5477	0.12088	0.0:0.2199:0.228:0.552	.	177	Q6ZRT9	.	V	94	.	ENSP00000383710:E94V	E	-	2	0	C1orf86	2106740	0.006000	0.16342	0.000000	0.03702	0.010000	0.07245	0.022000	0.13511	-0.138000	0.11434	-0.366000	0.07423	GAG	.	.	.	none		0.567	C1orf86-202	KNOWN	basic	protein_coding	protein_coding		NM_182533	
ANKRD13C	81573	hgsc.bcm.edu	37	1	70819813	70819813	+	Silent	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr1:70819813G>A	ENST00000370944.4	-	1	592	c.279C>T	c.(277-279)gcC>gcT	p.A93A	HHLA3_ENST00000531950.1_5'Flank|ANKRD13C_ENST00000262346.6_Silent_p.A93A|HHLA3_ENST00000370940.5_5'Flank|HHLA3_ENST00000432224.1_5'Flank|HHLA3_ENST00000359875.5_5'Flank|HHLA3_ENST00000361764.4_5'Flank	NM_030816.4	NP_110443.3	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	93					protein retention in ER lumen (GO:0006621)|regulation of anoikis (GO:2000209)|regulation of receptor biosynthetic process (GO:0010869)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	19						CGGCCAGAAGGGCCGGGGACT	0.677																																					p.A93A		Atlas-SNP	.											.	ANKRD13C	36	.	0			c.C279T						PASS	.						40.0	53.0	49.0					1																	70819813		2203	4299	6502	SO:0001819	synonymous_variant	81573	exon1			CAGAAGGGCCGGG		CCDS648.2	1p32.3-p31.3	2013-01-10			ENSG00000118454	ENSG00000118454		"""Ankyrin repeat domain containing"""	25374	protein-coding gene	gene with protein product		615125				11230166	Standard	NM_030816		Approved	DKFZP566D1346, dJ677H15.3	uc001dex.4	Q8N6S4	OTTHUMG00000009343	ENST00000370944.4:c.279C>T	chr1.hg19:g.70819813G>A		91.0	0.0	.		92.0	79.0	.	NM_030816	B3KQ97|Q5VYH4|Q5VYH5|Q6PJE4|Q9H0N9	Silent	SNP	ENST00000370944.4	hg19	CCDS648.2																																																																																			.	.	.	none		0.677	ANKRD13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025903.1	NM_030816	
FCER1A	2205	hgsc.bcm.edu	37	1	159277544	159277544	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr1:159277544G>A	ENST00000368115.1	+	6	695	c.596G>A	c.(595-597)cGt>cAt	p.R199H	FCER1A_ENST00000368114.1_Missense_Mutation_p.R166H	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide	199					activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	ACAGCTCCGCGTGAGAAGTAC	0.413																																					p.R199H		Atlas-SNP	.											.	FCER1A	74	.	0			c.G596A						PASS	.						116.0	104.0	108.0					1																	159277544		2203	4300	6503	SO:0001583	missense	2205	exon6			CTCCGCGTGAGAA	BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.596G>A	chr1.hg19:g.159277544G>A	ENSP00000357097:p.Arg199His	97.0	0.0	.		95.0	5.0	.	NM_002001		Missense_Mutation	SNP	ENST00000368115.1	hg19	CCDS1184.1	.	.	.	.	.	.	.	.	.	.	G	10.76	1.441382	0.25900	.	.	ENSG00000179639	ENST00000368115;ENST00000368114	T;T	0.02050	4.82;4.48	5.37	-8.56	0.00904	.	9.584880	0.00166	N	0.000000	T	0.00356	0.0011	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45963	-0.9225	10	0.42905	T	0.14	.	0.8386	0.01145	0.2503:0.329:0.2067:0.214	.	199	P12319	FCERA_HUMAN	H	199;166	ENSP00000357097:R199H;ENSP00000357096:R166H	ENSP00000357096:R166H	R	+	2	0	FCER1A	157544168	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.697000	0.05098	-1.271000	0.02430	-2.604000	0.00161	CGT	.	.	.	none		0.413	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090328.2	NM_002001	
ASAP2	8853	hgsc.bcm.edu	37	2	9528626	9528626	+	Silent	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:9528626C>T	ENST00000281419.3	+	22	2674	c.2334C>T	c.(2332-2334)gcC>gcT	p.A778A	ASAP2_ENST00000315273.4_Silent_p.A778A|ASAP2_ENST00000491413.1_3'UTR	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	778	Pro-rich.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AGCCTGCAGCCCCCAGCACCA	0.582																																					p.A778A		Atlas-SNP	.											.	ASAP2	91	.	0			c.C2334T						PASS	.						26.0	31.0	29.0					2																	9528626		2203	4300	6503	SO:0001819	synonymous_variant	8853	exon22			TGCAGCCCCCAGC	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2334C>T	chr2.hg19:g.9528626C>T		192.0	0.0	.		111.0	54.0	.	NM_001135191	D6W4Y8	Silent	SNP	ENST00000281419.3	hg19	CCDS1661.1																																																																																			.	.	.	none		0.582	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
CCDC121	79635	hgsc.bcm.edu	37	2	27850763	27850763	+	5'UTR	SNP	C	C	A	rs555033711	byFrequency	TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:27850763C>A	ENST00000324364.3	-	0	84				GPN1_ENST00000424214.1_5'Flank|CCDC121_ENST00000394775.3_Missense_Mutation_p.R130S|GPN1_ENST00000610189.1_5'Flank|GPN1_ENST00000264718.3_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|GPN1_ENST00000503738.1_5'Flank|GPN1_ENST00000458167.2_5'Flank|GPN1_ENST00000407583.3_5'Flank|ZNF512_ENST00000556601.1_Intron|GPN1_ENST00000515877.1_5'Flank	NM_024584.4	NP_078860.2	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121											breast(1)|endometrium(3)|large_intestine(2)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(172;0.155)					GTGGAAGGAGCCTTCTGGGGC	0.408													C|||	2	0.000399361	0.0	0.0	5008	,	,		20467	0.0		0.0	False		,,,				2504	0.002				p.R130S		Atlas-SNP	.											.	CCDC121	43	.	0			c.G390T						PASS	.						31.0	22.0	25.0					2																	27850763		692	1591	2283	SO:0001623	5_prime_UTR_variant	79635	exon2			AAGGAGCCTTCTG	AK125354	CCDS1759.1, CCDS46247.1	2p23.2	2008-02-05			ENSG00000176714	ENSG00000176714			25833	protein-coding gene	gene with protein product							Standard	NM_024584		Approved	FLJ43364, FLJ13646	uc002rld.3	Q6ZUS5	OTTHUMG00000128427	ENST00000324364.3:c.-97G>T	chr2.hg19:g.27850763C>A		90.0	0.0	.		80.0	24.0	.	NM_001142683	B3KW66|J3KQZ8|Q9H8G6	Missense_Mutation	SNP	ENST00000324364.3	hg19	CCDS1759.1	.	.	.	.	.	.	.	.	.	.	C	12.28	1.890746	0.33348	.	.	ENSG00000176714	ENST00000394775;ENST00000522876	.	.	.	4.67	-3.58	0.04597	.	.	.	.	.	T	0.15392	0.0371	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.35574	-0.9783	8	0.05959	T	0.93	-2.1927	5.3223	0.15887	0.2861:0.4149:0.0:0.299	.	132	E5RHR4	.	S	130;132	.	ENSP00000412150:R130S	R	-	3	2	CCDC121	27704267	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.249000	0.00540	-0.367000	0.08052	-0.467000	0.05162	AGG	.	.	.	none		0.408	CCDC121-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250215.1	NM_024584	
IL1RL2	8808	hgsc.bcm.edu	37	2	102808484	102808484	+	Missense_Mutation	SNP	G	G	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:102808484G>C	ENST00000264257.2	+	4	519	c.393G>C	c.(391-393)gaG>gaC	p.E131D	IL1RL2_ENST00000441515.2_Intron|IL1RL2_ENST00000539491.1_Missense_Mutation_p.E131D|IL1RL2_ENST00000481806.1_Intron	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	131	Ig-like C2-type 2.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						TATCAGATGAGTACAAGCAAA	0.373																																					p.E131D		Atlas-SNP	.											.	IL1RL2	118	.	0			c.G393C						PASS	.						108.0	104.0	105.0					2																	102808484		2203	4299	6502	SO:0001583	missense	8808	exon4			AGATGAGTACAAG	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.393G>C	chr2.hg19:g.102808484G>C	ENSP00000264257:p.Glu131Asp	372.0	0.0	.		316.0	147.0	.	NM_003854	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	ENST00000264257.2	hg19	CCDS2056.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.590415	0.28357	.	.	ENSG00000115598	ENST00000264257;ENST00000421464;ENST00000539491	T;T;T	0.14516	2.5;2.5;2.5	4.87	-0.423	0.12325	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.696055	0.13195	N	0.406431	T	0.10078	0.0247	L	0.46157	1.445	0.09310	N	1	B	0.26708	0.157	B	0.29663	0.105	T	0.37174	-0.9717	10	0.19590	T	0.45	.	4.3376	0.11094	0.2773:0.3204:0.4023:0.0	.	131	Q9HB29	ILRL2_HUMAN	D	131	ENSP00000264257:E131D;ENSP00000387611:E131D;ENSP00000442184:E131D	ENSP00000264257:E131D	E	+	3	2	IL1RL2	102174916	0.000000	0.05858	0.069000	0.20011	0.782000	0.44232	-0.972000	0.03802	0.069000	0.16605	0.655000	0.94253	GAG	.	.	.	none		0.373	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854	
BAZ2B	29994	hgsc.bcm.edu	37	2	160289282	160289282	+	Missense_Mutation	SNP	T	T	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:160289282T>A	ENST00000392783.2	-	9	2381	c.1886A>T	c.(1885-1887)gAt>gTt	p.D629V	BAZ2B_ENST00000392782.1_Missense_Mutation_p.D627V|BAZ2B_ENST00000355831.2_Missense_Mutation_p.D629V|BAZ2B_ENST00000343439.5_Missense_Mutation_p.D627V	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	629	Asp/Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TTGGCTGTCATCAGAttcatc	0.313																																					p.D629V		Atlas-SNP	.											.	BAZ2B	196	.	0			c.A1886T						PASS	.						52.0	51.0	52.0					2																	160289282		1964	4171	6135	SO:0001583	missense	29994	exon9			CTGTCATCAGATT	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.1886A>T	chr2.hg19:g.160289282T>A	ENSP00000376534:p.Asp629Val	74.0	0.0	.		56.0	22.0	.	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.733|9.733	1.162697|1.162697	0.21538|0.21538	.|.	.|.	ENSG00000123636|ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439|ENST00000441143	T;T;T;T|.	0.26518|.	2.59;2.59;2.59;1.73|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.473584|.	0.15421|.	U|.	0.263251|.	T|.	0.56046|.	0.1959|.	L|L	0.29908|0.29908	0.895|0.895	0.36147|0.36147	D|D	0.847176|0.847176	D;D;D;D;D|.	0.89917|.	1.0;0.999;0.998;0.996;0.993|.	D;D;D;D;P|.	0.79108|.	0.992;0.951;0.948;0.923;0.84|.	T|.	0.61019|.	-0.7147|.	10|.	0.54805|.	T|.	0.06|.	-7.9381|-7.9381	16.0396|16.0396	0.80654|0.80654	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	629;433;627;627;629|.	Q9UIF8-3;Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8|.	.;.;.;.;BAZ2B_HUMAN|.	V|C	627;629;629;627|60	ENSP00000376533:D627V;ENSP00000376534:D629V;ENSP00000348087:D629V;ENSP00000339670:D627V|.	ENSP00000339670:D627V|.	D|X	-|-	2|3	0|0	BAZ2B|BAZ2B	159997528|159997528	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.412000|5.412000	0.66392|0.66392	2.274000|2.274000	0.75844|0.75844	0.533000|0.533000	0.62120|0.62120	GAT|TGA	.	.	.	none		0.313	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
BAZ2B	29994	hgsc.bcm.edu	37	2	160289383	160289383	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:160289383A>T	ENST00000392783.2	-	9	2280	c.1785T>A	c.(1783-1785)gaT>gaA	p.D595E	BAZ2B_ENST00000392782.1_Missense_Mutation_p.D593E|BAZ2B_ENST00000355831.2_Missense_Mutation_p.D595E|BAZ2B_ENST00000343439.5_Missense_Mutation_p.D593E	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	595	Asp/Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GAATGTCTGAATCTGTTCCTC	0.378																																					p.D595E		Atlas-SNP	.											.	BAZ2B	196	.	0			c.T1785A						PASS	.						154.0	147.0	149.0					2																	160289383		1947	4173	6120	SO:0001583	missense	29994	exon9			GTCTGAATCTGTT	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.1785T>A	chr2.hg19:g.160289383A>T	ENSP00000376534:p.Asp595Glu	98.0	0.0	.		64.0	25.0	.	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.22|14.22	2.469691|2.469691	0.43839|0.43839	.|.	.|.	ENSG00000123636|ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439|ENST00000441143	T;T;T;T|.	0.40476|.	1.03;1.03;1.03;1.03|.	5.92|5.92	3.56|3.56	0.40772|0.40772	.|.	0.000000|.	0.38164|.	U|.	0.001790|.	T|T	0.49745|0.49745	0.1575|0.1575	L|L	0.46157|0.46157	1.445|1.445	0.33282|0.33282	D|D	0.562345|0.562345	P;P;P;P;P|.	0.44946|.	0.846;0.734;0.607;0.607;0.473|.	P;B;B;B;B|.	0.49276|.	0.605;0.301;0.146;0.146;0.069|.	T|T	0.56974|0.56974	-0.7890|-0.7890	10|5	0.09590|.	T|.	0.72|.	-16.1747|-16.1747	8.3651|8.3651	0.32382|0.32382	0.6993:0.0:0.3007:0.0|0.6993:0.0:0.3007:0.0	.|.	595;399;593;593;595|.	Q9UIF8-3;Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8|.	.;.;.;.;BAZ2B_HUMAN|.	E|I	593;595;595;593|27	ENSP00000376533:D593E;ENSP00000376534:D595E;ENSP00000348087:D595E;ENSP00000339670:D593E|.	ENSP00000339670:D593E|.	D|F	-|-	3|1	2|0	BAZ2B|BAZ2B	159997629|159997629	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.568000|1.568000	0.36418|0.36418	0.504000|0.504000	0.28082|0.28082	0.533000|0.533000	0.62120|0.62120	GAT|TTC	.	.	.	none		0.378	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
SLC4A10	57282	hgsc.bcm.edu	37	2	162762260	162762260	+	Silent	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:162762260C>T	ENST00000446997.1	+	15	1953	c.1860C>T	c.(1858-1860)atC>atT	p.I620I	SLC4A10_ENST00000375514.5_Silent_p.I601I|SLC4A10_ENST00000421911.1_Silent_p.I620I|SLC4A10_ENST00000272716.5_Silent_p.I590I|SLC4A10_ENST00000415876.2_Silent_p.I590I	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	620					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TCTGCTACATCACTCGGTTTA	0.423																																					p.I620I		Atlas-SNP	.											.	SLC4A10	309	.	0			c.C1860T						PASS	.						155.0	154.0	154.0					2																	162762260		2070	4248	6318	SO:0001819	synonymous_variant	57282	exon15			CTACATCACTCGG		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.1860C>T	chr2.hg19:g.162762260C>T		145.0	0.0	.		132.0	58.0	.	NM_001178015	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Silent	SNP	ENST00000446997.1	hg19	CCDS54411.1																																																																																			.	.	.	none		0.423	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
ITGA6	3655	hgsc.bcm.edu	37	2	173352755	173352755	+	Silent	SNP	A	A	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:173352755A>G	ENST00000264106.6	+	19	2711	c.2508A>G	c.(2506-2508)ttA>ttG	p.L836L	ITGA6_ENST00000409080.1_Silent_p.L797L|ITGA6_ENST00000264107.7_Silent_p.L797L|AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000409532.1_Silent_p.L678L|ITGA6_ENST00000343713.4_Silent_p.L792L|ITGA6_ENST00000375221.2_Silent_p.L836L			P23229	ITA6_HUMAN	integrin, alpha 6	836					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AACTGCTTTTATCGGTCTCGG	0.328																																					p.L797L		Atlas-SNP	.											.	ITGA6	171	.	0			c.A2391G						PASS	.						176.0	171.0	173.0					2																	173352755		2203	4300	6503	SO:0001819	synonymous_variant	3655	exon18			GCTTTTATCGGTC		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.2508A>G	chr2.hg19:g.173352755A>G		212.0	0.0	.		150.0	65.0	.	NM_000210	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Silent	SNP	ENST00000264106.6	hg19																																																																																				.	.	.	none		0.328	ITGA6-201	KNOWN	basic	protein_coding	protein_coding			
NFE2L2	4780	hgsc.bcm.edu	37	2	178098799	178098799	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:178098799T>G	ENST00000397062.3	-	2	800	c.246A>C	c.(244-246)gaA>gaC	p.E82D	NFE2L2_ENST00000423513.1_Missense_Mutation_p.E66D|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E66D|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E66D|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E66D	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	82					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E82D(8)|p.G81_F83delGEF(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTGGGAGAAATTCACCTGTCT	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.E82D		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,0,9	NFE2L2	225	.	9	Substitution - Missense(8)|Deletion - In frame(1)	endometrium(3)|liver(2)|upper_aerodigestive_tract(1)|cervix(1)|oesophagus(1)|kidney(1)	c.A246C						PASS	.						138.0	137.0	137.0					2																	178098799		1903	4104	6007	SO:0001583	missense	4780	exon2			GAGAAATTCACCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.246A>C	chr2.hg19:g.178098799T>G	ENSP00000380252:p.Glu82Asp	70.0	0.0	.		58.0	21.0	.	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.706902	0.89018	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.67;1.67;1.53	5.78	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.58395	0.2119	M	0.87180	2.865	0.54753	D	0.999981	D;D;D;D	0.89917	0.999;0.997;1.0;0.999	D;D;D;D	0.83275	0.991;0.978;0.996;0.991	T	0.64976	-0.6280	10	0.72032	D	0.01	.	11.2269	0.48888	0.0:0.0712:0.0:0.9288	.	66;66;66;82	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	D	66;82;66;66;66;66	ENSP00000380253:E66D;ENSP00000380252:E82D;ENSP00000411575:E66D;ENSP00000400073:E66D;ENSP00000412191:E66D;ENSP00000410015:E66D	ENSP00000380252:E82D	E	-	3	2	NFE2L2	177807045	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.909000	0.39917	2.210000	0.71456	0.460000	0.39030	GAA	.	.	.	none		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
TTN	7273	hgsc.bcm.edu	37	2	179470170	179470170	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:179470170G>T	ENST00000591111.1	-	229	49153	c.48929C>A	c.(48928-48930)cCt>cAt	p.P16310H	TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P15383H|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P9011H|TTN_ENST00000460472.2_Missense_Mutation_p.P8886H|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P9078H|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P17951H|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16310	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACATTAAGAGGTAGGGATGG	0.348																																					p.P17951H		Atlas-SNP	.											.	TTN	18412	.	0			c.C53852A						PASS	.						88.0	81.0	83.0					2																	179470170		1864	4103	5967	SO:0001583	missense	7273	exon279			TTAAGAGGTAGGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48929C>A	chr2.hg19:g.179470170G>T	ENSP00000465570:p.Pro16310His	149.0	0.0	.		101.0	11.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	13.93	2.384204	0.42308	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.74	5.74	0.90152	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72755	0.3500	M	0.70108	2.13	0.58432	D	0.999991	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.67231	0.95;0.95;0.95;0.95	T	0.74515	-0.3640	9	0.87932	D	0	.	19.9346	0.97133	0.0:0.0:1.0:0.0	.	8886;9011;9078;16310	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	15383;8886;9078;9011;8886	ENSP00000343764:P15383H;ENSP00000434586:P8886H;ENSP00000340554:P9078H;ENSP00000352154:P9011H	ENSP00000340554:P9078H	P	-	2	0	TTN	179178415	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	9.728000	0.98792	2.712000	0.92718	0.563000	0.77884	CCT	.	.	.	none		0.348	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UNC80	285175	hgsc.bcm.edu	37	2	210681762	210681762	+	Missense_Mutation	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:210681762C>T	ENST00000439458.1	+	10	1545	c.1465C>T	c.(1465-1467)Cgc>Tgc	p.R489C	UNC80_ENST00000272845.6_Missense_Mutation_p.R489C	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	489					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GTCCCCCACGCGCAGCACATT	0.562																																					p.R489C		Atlas-SNP	.											UNC80_ENST00000439458,caecum,carcinoma,0,1	UNC80	280	.	0			c.C1465T						PASS	.						61.0	56.0	57.0					2																	210681762		692	1591	2283	SO:0001583	missense	285175	exon10			CCCACGCGCAGCA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.1465C>T	chr2.hg19:g.210681762C>T	ENSP00000391088:p.Arg489Cys	109.0	0.0	.		67.0	10.0	.	NM_182587	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782836	0.90282	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.37584	1.19;1.19	5.68	4.81	0.61882	.	.	.	.	.	T	0.28101	0.0693	N	0.24115	0.695	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.05338	-1.0891	9	0.87932	D	0	-6.0139	14.9218	0.70843	0.0:0.9309:0.0:0.0691	.	489	Q8N2C7	UNC80_HUMAN	C	489	ENSP00000391088:R489C;ENSP00000272845:R489C	ENSP00000272845:R489C	R	+	1	0	UNC80	210390007	0.998000	0.40836	0.952000	0.39060	0.975000	0.68041	3.822000	0.55708	1.404000	0.46819	0.563000	0.77884	CGC	.	.	.	none		0.562	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
UNC80	285175	hgsc.bcm.edu	37	2	210791711	210791711	+	Splice_Site	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr2:210791711G>T	ENST00000439458.1	+	35	5688		c.e35+1		UNC80_ENST00000272845.6_Splice_Site	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GGAGTAGCAGGTACAGTTTTG	0.463																																					.		Atlas-SNP	.											.	UNC80	280	.	0			c.5608+1G>T						PASS	.						158.0	130.0	139.0					2																	210791711		692	1591	2283	SO:0001630	splice_region_variant	285175	exon35			TAGCAGGTACAGT	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.5608+1G>T	chr2.hg19:g.210791711G>T		69.0	0.0	.		63.0	28.0	.	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Splice_Site	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813956	0.90790	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7657	0.96340	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC80	210499956	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.476000	0.97823	2.649000	0.89929	0.655000	0.94253	.	.	.	.	none		0.463	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	Intron
SETD2	29072	hgsc.bcm.edu	37	3	47144870	47144870	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr3:47144870T>G	ENST00000409792.3	-	7	4925	c.4883A>C	c.(4882-4884)aAt>aCt	p.N1628T		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1628	Inhibitor binding.|S-adenosyl-L-methionine binding.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ACAGCTGTGATTCATGAAACG	0.328			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.N1628T		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.A4883C						PASS	.						170.0	157.0	161.0					3																	47144870		2203	4300	6503	SO:0001583	missense	29072	exon7			CTGTGATTCATGA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4883A>C	chr3.hg19:g.47144870T>G	ENSP00000386759:p.Asn1628Thr	134.0	0.0	.		129.0	75.0	.	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	27.5	4.841046	0.91197	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.95238	-3.65	5.83	5.83	0.93111	SET domain (3);	0.000000	0.56097	D	0.000022	D	0.98732	0.9574	H	0.99800	4.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.99208	1.0875	10	0.87932	D	0	.	14.7708	0.69675	0.0:0.0:0.0:1.0	.	1628;1628	F2Z317;Q9BYW2	.;SETD2_HUMAN	T	1628	ENSP00000386759:N1628T	ENSP00000386759:N1628T	N	-	2	0	SETD2	47119874	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.638000	0.83328	2.240000	0.73641	0.528000	0.53228	AAT	.	.	.	none		0.328	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
PBRM1	55193	hgsc.bcm.edu	37	3	52598065	52598065	+	Splice_Site	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr3:52598065C>T	ENST00000296302.7	-	23	3877		c.e23+1		PBRM1_ENST00000410007.1_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000409767.1_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.?(3)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCAAGCTTTACCTGAAGTAGT	0.343			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																.		Atlas-SNP	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	3	Unknown(3)	kidney(3)	c.3800+1G>A						PASS	.						85.0	84.0	84.0					3																	52598065		2203	4300	6503	SO:0001630	splice_region_variant	55193	exon25			GCTTTACCTGAAG	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3875+1G>A	chr3.hg19:g.52598065C>T		71.0	0.0	.		57.0	17.0	.	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	hg19		.	.	.	.	.	.	.	.	.	.	C	24.8	4.571270	0.86542	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0144	0.92888	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBRM1	52573105	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.818000	0.86416	2.493000	0.84123	0.655000	0.94253	.	.	.	.	none		0.343	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	Intron
PBRM1	55193	hgsc.bcm.edu	37	3	52643768	52643768	+	Nonsense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr3:52643768G>A	ENST00000296302.7	-	16	2129	c.2128C>T	c.(2128-2130)Cga>Tga	p.R710*	PBRM1_ENST00000410007.1_Nonsense_Mutation_p.R710*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.R678*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.R710*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.R725*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.R710*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.R710*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.R725*			Q86U86	PB1_HUMAN	polybromo 1	710	Bromo 5. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R710*(2)|p.R678*(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATGTGACTTCGAATTTTTTCC	0.438			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.R710X		Atlas-SNP	.		Rec	yes		3	3p21	55193	polybromo 1		E	PBRM1_ENST00000356770,colon,carcinoma,0,5	PBRM1	1252	.	3	Substitution - Nonsense(3)	kidney(3)	c.C2128T						PASS	.						147.0	143.0	144.0					3																	52643768		2203	4300	6503	SO:0001587	stop_gained	55193	exon17			GACTTCGAATTTT	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2128C>T	chr3.hg19:g.52643768G>A	ENSP00000296302:p.Arg710*	184.0	0.0	.		205.0	126.0	.	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	hg19		.	.	.	.	.	.	.	.	.	.	G	38	7.040996	0.98021	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	6.17	3.13	0.36017	.	0.055075	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.7405	15.7	0.77536	0.0:0.0:0.6414:0.3586	.	.	.	.	X	678;710;710;710;710;710;725;725;710;669	.	ENSP00000296302:R710X	R	-	1	2	PBRM1	52618808	0.994000	0.37717	1.000000	0.80357	0.998000	0.95712	0.705000	0.25675	1.587000	0.49959	0.655000	0.94253	CGA	.	.	.	none		0.438	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
TOMM70A	9868	hgsc.bcm.edu	37	3	100093911	100093911	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr3:100093911G>A	ENST00000284320.5	-	7	1626	c.1178C>T	c.(1177-1179)gCt>gTt	p.A393V		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	393					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						GATGTCAGCAGCCATGTTAAA	0.448																																					p.A393V		Atlas-SNP	.											.	TOMM70A	65	.	0			c.C1178T						PASS	.						133.0	124.0	127.0					3																	100093911		2203	4300	6503	SO:0001583	missense	9868	exon7			TCAGCAGCCATGT	AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.1178C>T	chr3.hg19:g.100093911G>A	ENSP00000284320:p.Ala393Val	102.0	0.0	.		95.0	29.0	.	NM_014820	D3DN48	Missense_Mutation	SNP	ENST00000284320.5	hg19	CCDS33807.1	.	.	.	.	.	.	.	.	.	.	G	35	5.553185	0.96501	.	.	ENSG00000154174	ENST00000284320;ENST00000544924	T	0.74106	-0.81	5.76	5.76	0.90799	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.87688	0.6240	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87951	0.2723	10	0.62326	D	0.03	-9.8008	19.9574	0.97228	0.0:0.0:1.0:0.0	.	393	O94826	TOM70_HUMAN	V	393;286	ENSP00000284320:A393V	ENSP00000284320:A393V	A	-	2	0	TOMM70A	101576601	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.404000	0.97306	2.715000	0.92844	0.561000	0.74099	GCT	.	.	.	none		0.448	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353141.2		
ACAD11	84129	hgsc.bcm.edu	37	3	132361614	132361614	+	Silent	SNP	C	C	T	rs144139484		TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr3:132361614C>T	ENST00000264990.6	-	3	1253	c.282G>A	c.(280-282)ttG>ttA	p.L94L	ACAD11_ENST00000489991.1_Intron|ACAD11_ENST00000355458.3_Silent_p.L94L|ACAD11_ENST00000545291.1_5'UTR|ACAD11_ENST00000481970.2_Silent_p.L94L	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	94					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						CAATTGAAAACAAGGCTTTCT	0.318																																					p.L94L		Atlas-SNP	.											.	ACAD11	78	.	0			c.G282A						PASS	.	C		0,4406		0,0,2203	91.0	96.0	94.0		282	2.2	0.9	3	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ACAD11	NM_032169.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		94/781	132361614	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84129	exon3			TGAAAACAAGGCT	BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.282G>A	chr3.hg19:g.132361614C>T		404.0	0.0	.		430.0	264.0	.	NM_032169	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Silent	SNP	ENST00000264990.6	hg19	CCDS3074.1																																																																																			.	C|1.000;T|0.000	0.000	weak		0.318	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169	
LSG1	55341	hgsc.bcm.edu	37	3	194380833	194380833	+	Missense_Mutation	SNP	C	C	T	rs537601352		TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr3:194380833C>T	ENST00000265245.5	-	6	865	c.551G>A	c.(550-552)cGa>cAa	p.R184Q		NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	184	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		GAGTGGGTTTCGAGCATCTAC	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		21403	0.001		0.0	False		,,,				2504	0.0				p.R184Q		Atlas-SNP	.											.	LSG1	38	.	0			c.G551A						PASS	.						143.0	125.0	131.0					3																	194380833		2203	4300	6503	SO:0001583	missense	55341	exon6			GGGTTTCGAGCAT		CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.551G>A	chr3.hg19:g.194380833C>T	ENSP00000265245:p.Arg184Gln	121.0	0.0	.		132.0	6.0	.	NM_018385	A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	ENST00000265245.5	hg19	CCDS33922.1	.	.	.	.	.	.	.	.	.	.	C	34	5.302207	0.95601	.	.	ENSG00000041802	ENST00000265245	T	0.55588	0.51	5.24	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.80204	0.4580	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86713	0.1937	10	0.87932	D	0	.	14.7734	0.69696	0.0:0.9293:0.0:0.0707	.	184	Q9H089	LSG1_HUMAN	Q	184	ENSP00000265245:R184Q	ENSP00000265245:R184Q	R	-	2	0	LSG1	195862122	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.242000	0.78210	1.535000	0.49220	-0.150000	0.13652	CGA	.	.	.	none		0.423	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342740.1	NM_018385	
FRYL	285527	hgsc.bcm.edu	37	4	48550800	48550800	+	Missense_Mutation	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr4:48550800C>T	ENST00000503238.1	-	37	4794	c.4795G>A	c.(4795-4797)Gca>Aca	p.A1599T	FRYL_ENST00000358350.4_Missense_Mutation_p.A1599T|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.A1599T|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1599					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AGGATCACTGCTATGTTACAC	0.333																																					p.A1599T		Atlas-SNP	.											.	FRYL	242	.	0			c.G4795A						PASS	.						76.0	70.0	72.0					4																	48550800		1866	4101	5967	SO:0001583	missense	285527	exon40			TCACTGCTATGTT	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.4795G>A	chr4.hg19:g.48550800C>T	ENSP00000426064:p.Ala1599Thr	270.0	0.0	.		208.0	87.0	.	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	hg19	CCDS43227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.445247|5.445247	0.96187|0.96187	.|.	.|.	ENSG00000075539|ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810|ENST00000514617	T;T;T|.	0.07800|.	3.16;3.16;3.16|.	5.32|5.32	5.32|5.32	0.75619|0.75619	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77089|0.77089	0.4079|0.4079	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.998;1.0;1.0|.	D;D;D|.	0.91635|.	0.994;0.997;0.999|.	T|T	0.76231|0.76231	-0.3035|-0.3035	10|5	0.72032|.	D|.	0.01|.	.|.	19.3791|19.3791	0.94525|0.94525	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	430;1599;1599|.	Q6ZR29;O94915;F5GX82|.	.;FRYL_HUMAN;.|.	T|N	1599|469	ENSP00000426064:A1599T;ENSP00000351113:A1599T;ENSP00000441114:A1599T|.	ENSP00000351113:A1599T|.	A|S	-|-	1|2	0|0	FRYL|FRYL	48245557|48245557	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.950000|0.950000	0.60333|0.60333	7.424000|7.424000	0.80242|0.80242	2.644000|2.644000	0.89710|0.89710	0.561000|0.561000	0.74099|0.74099	GCA|AGC	.	.	.	none		0.333	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
GSTCD	79807	hgsc.bcm.edu	37	4	106744194	106744194	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr4:106744194G>T	ENST00000515279.1	+	6	1544	c.1324G>T	c.(1324-1326)Ggt>Tgt	p.G442C	GSTCD_ENST00000360505.5_Missense_Mutation_p.G442C|GSTCD_ENST00000515255.1_3'UTR|RP11-45L9.1_ENST00000509003.1_RNA|GSTCD_ENST00000394730.3_Missense_Mutation_p.G355C|RP11-45L9.1_ENST00000506527.1_RNA|GSTCD_ENST00000394728.3_Missense_Mutation_p.G442C|RP11-45L9.1_ENST00000504955.1_RNA			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	442						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		GGCCAAACCTGGTGACAGAAT	0.388																																					p.G442C		Atlas-SNP	.											.	GSTCD	69	.	0			c.G1324T						PASS	.						172.0	155.0	161.0					4																	106744194		2203	4300	6503	SO:0001583	missense	79807	exon6			AAACCTGGTGACA	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1324G>T	chr4.hg19:g.106744194G>T	ENSP00000422354:p.Gly442Cys	178.0	0.0	.		136.0	56.0	.	NM_001031720	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	ENST00000515279.1	hg19	CCDS43257.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239681	0.79800	.	.	ENSG00000138780	ENST00000394730;ENST00000515279;ENST00000360505;ENST00000394728	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	4.99	4.99	0.66335	.	0.054220	0.64402	D	0.000001	T	0.73737	0.3625	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.987	T	0.81462	-0.0922	10	0.87932	D	0	-14.8311	18.625	0.91334	0.0:0.0:1.0:0.0	.	442;65	Q8NEC7;B7Z8J7	GSTCD_HUMAN;.	C	355;442;442;442	ENSP00000378218:G355C;ENSP00000422354:G442C;ENSP00000353695:G442C;ENSP00000378216:G442C	ENSP00000353695:G442C	G	+	1	0	GSTCD	106963643	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.092000	0.71414	2.467000	0.83353	0.585000	0.79938	GGT	.	.	.	none		0.388	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
FAT1	2195	hgsc.bcm.edu	37	4	187539082	187539082	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr4:187539082T>G	ENST00000441802.2	-	10	8867	c.8658A>C	c.(8656-8658)aaA>aaC	p.K2886N		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2886	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ATGCAACCACTTTAATCTGGT	0.433										HNSCC(5;0.00058)																											p.K2886N	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.A8658C						PASS	.						182.0	165.0	171.0					4																	187539082		1976	4160	6136	SO:0001583	missense	2195	exon10			AACCACTTTAATC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8658A>C	chr4.hg19:g.187539082T>G	ENSP00000406229:p.Lys2886Asn	102.0	0.0	.		79.0	26.0	.	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	hg19	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	T	5.728	0.318720	0.10845	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.50277	0.75	4.86	1.01	0.19927	Cadherin (4);Cadherin-like (1);	0.707453	0.14542	N	0.313219	T	0.22589	0.0545	N	0.11845	0.185	0.28042	N	0.933699	B	0.22746	0.074	B	0.23852	0.049	T	0.13845	-1.0494	10	0.25751	T	0.34	.	1.6164	0.02705	0.137:0.1549:0.1427:0.5654	.	2886	Q14517	FAT1_HUMAN	N	2886;2888	ENSP00000406229:K2886N	ENSP00000260147:K2888N	K	-	3	2	FAT1	187776076	0.750000	0.28316	0.560000	0.28344	0.930000	0.56654	0.640000	0.24705	0.097000	0.17492	-0.256000	0.11100	AAA	.	.	.	none		0.433	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
CDH18	1016	hgsc.bcm.edu	37	5	19473699	19473699	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr5:19473699G>A	ENST00000507958.1	-	15	2999	c.2009C>T	c.(2008-2010)gCc>gTc	p.A670V	CDH18_ENST00000274170.4_Missense_Mutation_p.A670V|CDH18_ENST00000506372.1_3'UTR|CDH18_ENST00000510297.1_5'UTR|CDH18_ENST00000502796.1_3'UTR|CDH18_ENST00000382275.1_Missense_Mutation_p.A670V			Q13634	CAD18_HUMAN	cadherin 18, type 2	670					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GATGTCAAAGGCCTCTGTGTC	0.517																																					p.A670V		Atlas-SNP	.											.	CDH18	561	.	0			c.C2009T						PASS	.						153.0	147.0	149.0					5																	19473699		2203	4300	6503	SO:0001583	missense	1016	exon13			TCAAAGGCCTCTG	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.2009C>T	chr5.hg19:g.19473699G>A	ENSP00000425093:p.Ala670Val	104.0	0.0	.		101.0	36.0	.	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	hg19	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	G	34	5.410909	0.96072	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	T;T;T	0.80393	-1.37;-1.37;-1.37	6.16	6.16	0.99307	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.91503	0.7317	M	0.88906	2.99	0.80722	D	1	D	0.67145	0.996	D	0.70016	0.967	D	0.91416	0.5155	9	.	.	.	.	19.4236	0.94732	0.0:0.0:1.0:0.0	.	670	Q13634	CAD18_HUMAN	V	670	ENSP00000371710:A670V;ENSP00000425093:A670V;ENSP00000274170:A670V	.	A	-	2	0	CDH18	19509456	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.863000	0.99569	2.937000	0.99478	0.650000	0.86243	GCC	.	.	.	none		0.517	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
FBXO4	26272	hgsc.bcm.edu	37	5	41925546	41925546	+	Silent	SNP	T	T	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr5:41925546T>A	ENST00000281623.3	+	1	191	c.135T>A	c.(133-135)cgT>cgA	p.R45R	FBXO4_ENST00000296812.2_Silent_p.R45R|FBXO4_ENST00000509134.1_Silent_p.R45R	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4	45					positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				GGGTGGCGCGTACGACCTCAC	0.741																																					p.R45R		Atlas-SNP	.											.	FBXO4	42	.	0			c.T135A						PASS	.						8.0	8.0	8.0					5																	41925546		1807	3416	5223	SO:0001819	synonymous_variant	26272	exon1			GGCGCGTACGACC	AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.135T>A	chr5.hg19:g.41925546T>A		242.0	0.0	.		288.0	137.0	.	NM_033484	Q68CU8|Q86VT8|Q9UK98	Silent	SNP	ENST00000281623.3	hg19	CCDS3938.1																																																																																			.	.	.	none		0.741	FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211614.1		
NNT	23530	hgsc.bcm.edu	37	5	43628360	43628360	+	Missense_Mutation	SNP	A	A	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr5:43628360A>C	ENST00000264663.5	+	7	1056	c.835A>C	c.(835-837)Aag>Cag	p.K279Q	NNT_ENST00000512996.2_Missense_Mutation_p.K148Q|NNT_ENST00000344920.4_Missense_Mutation_p.K279Q	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	279					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					GGTGGACTTGAAGGAATCTGG	0.448																																					p.K279Q		Atlas-SNP	.											.	NNT	92	.	0			c.A835C						PASS	.						123.0	117.0	119.0					5																	43628360		2203	4300	6503	SO:0001583	missense	23530	exon7			GACTTGAAGGAAT	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.835A>C	chr5.hg19:g.43628360A>C	ENSP00000264663:p.Lys279Gln	174.0	0.0	.		257.0	134.0	.	NM_182977	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	hg19	CCDS3949.1	.	.	.	.	.	.	.	.	.	.	A	13.23	2.175032	0.38413	.	.	ENSG00000112992	ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.83163	-1.69;-1.69;-1.69	5.91	5.91	0.95273	Alanine dehydrogenase/PNT, C-terminal (1);	0.086607	0.85682	D	0.000000	T	0.72431	0.3459	N	0.17922	0.545	0.58432	D	0.999995	B	0.14805	0.011	B	0.23150	0.044	T	0.67280	-0.5710	10	0.10902	T	0.67	-15.1084	16.3432	0.83101	1.0:0.0:0.0:0.0	.	279	Q13423	NNTM_HUMAN	Q	279;279;148	ENSP00000264663:K279Q;ENSP00000343873:K279Q;ENSP00000426343:K148Q	ENSP00000264663:K279Q	K	+	1	0	NNT	43664117	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.413000	0.52686	2.263000	0.75096	0.377000	0.23210	AAG	.	.	.	none		0.448	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977	
PELO	53918	hgsc.bcm.edu	37	5	52096713	52096713	+	Missense_Mutation	SNP	A	A	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr5:52096713A>G	ENST00000274311.2	+	2	1470	c.485A>G	c.(484-486)aAg>aGg	p.K162R	ITGA1_ENST00000282588.6_Intron|PELO_ENST00000506949.1_Intron|ITGA1_ENST00000504086.1_Intron	NM_015946.4	NP_057030.3	Q9BRX2	PELO_HUMAN	pelota homolog (Drosophila)	162					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA catabolic process, non-stop decay (GO:0070481)|RNA surveillance (GO:0071025)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	11		Lung NSC(810;4.94e-05)|Breast(144;0.0848)				ACTCGGGCCAAGGTGGAGGTG	0.587																																					p.K162R		Atlas-SNP	.											.	PELO	25	.	0			c.A485G						PASS	.						83.0	74.0	77.0					5																	52096713		2203	4300	6503	SO:0001583	missense	53918	exon2			GGGCCAAGGTGGA		CCDS3956.1	5q11.2	2008-07-18	2001-11-28		ENSG00000152684	ENSG00000152684			8829	protein-coding gene	gene with protein product		605757	"""pelota (Drosophila) homolog"""			11060452	Standard	NM_015946		Approved		uc003jos.3	Q9BRX2	OTTHUMG00000096973	ENST00000274311.2:c.485A>G	chr5.hg19:g.52096713A>G	ENSP00000274311:p.Lys162Arg	125.0	0.0	.		198.0	86.0	.	NM_015946	Q9GZS6|Q9Y306	Missense_Mutation	SNP	ENST00000274311.2	hg19	CCDS3956.1	.	.	.	.	.	.	.	.	.	.	A	7.663	0.685319	0.14973	.	.	ENSG00000152684	ENST00000274311	T	0.44482	0.92	5.4	4.21	0.49690	eRF1 domain 2 (1);	0.000000	0.85682	U	0.000000	T	0.32041	0.0816	L	0.36672	1.1	0.80722	D	1	B	0.24721	0.11	B	0.29353	0.101	T	0.05616	-1.0874	10	0.14252	T	0.57	-18.997	11.3444	0.49552	0.8638:0.0:0.0:0.1362	.	162	Q9BRX2	PELO_HUMAN	R	162	ENSP00000274311:K162R	ENSP00000274311:K162R	K	+	2	0	PELO	52132470	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.187000	0.89708	1.014000	0.39417	0.460000	0.39030	AAG	.	.	.	none		0.587	PELO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214040.1	NM_015946	
DMXL1	1657	hgsc.bcm.edu	37	5	118582763	118582763	+	Missense_Mutation	SNP	A	A	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr5:118582763A>C	ENST00000311085.8	+	43	9013	c.8933A>C	c.(8932-8934)aAt>aCt	p.N2978T	DMXL1_ENST00000539542.1_Missense_Mutation_p.N2999T|DMXL1_ENST00000505312.1_3'UTR	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2978										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATTTTTAGAAATATTGGAACT	0.403																																					p.N2978T		Atlas-SNP	.											.	DMXL1	268	.	0			c.A8933C						PASS	.						107.0	106.0	106.0					5																	118582763		2202	4300	6502	SO:0001583	missense	1657	exon43			TTAGAAATATTGG	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8933A>C	chr5.hg19:g.118582763A>C	ENSP00000309690:p.Asn2978Thr	126.0	0.0	.		146.0	67.0	.	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	hg19	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	A	18.68	3.675682	0.67928	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.10860	2.84;2.83	5.82	5.82	0.92795	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.14614	0.0353	L	0.60845	1.875	0.80722	D	1	P;P	0.36144	0.48;0.539	B;B	0.34722	0.188;0.093	T	0.01413	-1.1361	10	0.44086	T	0.13	-26.4503	16.1802	0.81892	1.0:0.0:0.0:0.0	.	2999;2978	F5H269;Q9Y485	.;DMXL1_HUMAN	T	2978;2999	ENSP00000309690:N2978T;ENSP00000439479:N2999T	ENSP00000309690:N2978T	N	+	2	0	DMXL1	118610662	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.957000	0.93082	2.220000	0.72140	0.533000	0.62120	AAT	.	.	.	none		0.403	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
ATXN1	6310	hgsc.bcm.edu	37	6	16327888	16327888	+	Missense_Mutation	SNP	C	C	A	rs573371188	byFrequency	TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr6:16327888C>A	ENST00000244769.4	-	8	1590	c.654G>T	c.(652-654)caG>caT	p.Q218H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q218H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	218	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgctgct	0.657													-|||	5	0.000998403	0.0	0.0	5008	,	,		12853	0.003		0.002	False		,,,				2504	0.0				p.Q218H		Atlas-SNP	.											.	ATXN1	117	.	0			c.G654T						PASS	.						5.0	8.0	7.0					6																	16327888		1257	2848	4105	SO:0001583	missense	6310	exon7			CTGCTGCTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.654G>T	chr6.hg19:g.16327888C>A	ENSP00000244769:p.Gln218His	40.0	0.0	.		63.0	19.0	.	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	hg19	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	-	6.816	0.519699	0.13005	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.37752	1.18;1.18	0.86	0.86	0.19042	.	.	.	.	.	T	0.05090	0.0136	N	0.08118	0	0.09310	N	1	B	0.28713	0.22	B	0.17979	0.02	T	0.28490	-1.0042	9	0.40728	T	0.16	.	3.149	0.06481	0.0:0.6895:0.0:0.3104	.	218	P54253	ATX1_HUMAN	H	218	ENSP00000244769:Q218H;ENSP00000416360:Q218H	ENSP00000244769:Q218H	Q	-	3	2	ATXN1	16435867	0.092000	0.21681	0.008000	0.14137	0.146000	0.21551	0.245000	0.18142	0.726000	0.32339	0.205000	0.17691	CAG	.	.	.	none		0.657	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
FLOT1	10211	hgsc.bcm.edu	37	6	30698809	30698809	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr6:30698809C>G	ENST00000376389.3	-	9	1012	c.792G>C	c.(790-792)caG>caC	p.Q264H	FLOT1_ENST00000456573.2_Missense_Mutation_p.Q216H	NM_005803.2	NP_005794.1	P41440	S19A1_HUMAN	flotillin 1	243					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|prostate(1)	13					Methotrexate(DB00563)|Pralatrexate(DB06813)	GCACTGCCACCTGCTGGGCCC	0.667																																					p.Q264H		Atlas-SNP	.											.	FLOT1	28	.	0			c.G792C						PASS	.						55.0	62.0	60.0					6																	30698809		2203	4300	6503	SO:0001583	missense	10211	exon9			TGCCACCTGCTGG	AF089750	CCDS4688.1	6p21.3	2010-02-17			ENSG00000137312	ENSG00000137312			3757	protein-coding gene	gene with protein product		606998					Standard	XM_005248780		Approved		uc003nrm.3	O75955	OTTHUMG00000031151	ENST00000376389.3:c.792G>C	chr6.hg19:g.30698809C>G	ENSP00000365569:p.Gln264His	29.0	0.0	.		48.0	22.0	.	NM_005803	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	ENST00000376389.3	hg19	CCDS4688.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552759	0.86127	.	.	ENSG00000137312	ENST00000376389;ENST00000456573;ENST00000413165	T;T	0.37584	1.24;1.19	4.5	3.63	0.41609	.	0.132901	0.52532	D	0.000065	T	0.51109	0.1655	M	0.90650	3.135	0.48830	D	0.999717	D;D	0.61080	0.98;0.989	P;P	0.58577	0.841;0.841	T	0.60021	-0.7344	10	0.87932	D	0	-12.4051	10.3081	0.43693	0.0:0.9015:0.0:0.0985	.	216;264	B4DVY7;O75955	.;FLOT1_HUMAN	H	264;216;201	ENSP00000365569:Q264H;ENSP00000394375:Q216H	ENSP00000365569:Q264H	Q	-	3	2	FLOT1	30806788	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.475000	0.60210	2.511000	0.84671	0.650000	0.86243	CAG	.	.	.	none		0.667	FLOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076276.2		
GLTSCR1L	23506	hgsc.bcm.edu	37	6	42790539	42790539	+	Missense_Mutation	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr6:42790539C>T	ENST00000314073.5	+	4	223	c.47C>T	c.(46-48)cCa>cTa	p.P16L	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.P16L			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	16																	TCTAGAGACCCACAAGCATTG	0.279																																					p.P16L		Atlas-SNP	.											.	.	.	.	0			c.C47T						PASS	.						86.0	86.0	86.0					6																	42790539		2202	4299	6501	SO:0001583	missense	23506	exon3			GAGACCCACAAGC	AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.47C>T	chr6.hg19:g.42790539C>T	ENSP00000313933:p.Pro16Leu	198.0	0.0	.		252.0	106.0	.	NM_015349	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	hg19	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.299089	0.81025	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.61742	0.08;0.08	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000003	T	0.61702	0.2368	L	0.55481	1.735	0.58432	D	0.999995	P;D;D	0.56287	0.75;0.975;0.975	B;P;P	0.53861	0.235;0.736;0.672	T	0.62676	-0.6804	10	0.59425	D	0.04	-14.1586	20.1224	0.97967	0.0:1.0:0.0:0.0	.	16;16;16	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	L	16	ENSP00000313933:P16L;ENSP00000377723:P16L	ENSP00000313933:P16L	P	+	2	0	KIAA0240	42898517	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.714000	0.61902	2.749000	0.94314	0.650000	0.86243	CCA	.	.	.	none		0.279	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349	
UBE3D	90025	hgsc.bcm.edu	37	6	83767689	83767689	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr6:83767689G>A	ENST00000369747.3	-	2	252	c.130C>T	c.(130-132)Ctc>Ttc	p.L44F		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	44					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)										TTCATCTGGAGTGAAGATGGC	0.428											OREG0017549	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L44F		Atlas-SNP	.											.	.	.	.	0			c.C130T						PASS	.						70.0	66.0	67.0					6																	83767689		2203	4300	6503	SO:0001583	missense	90025	exon2			TCTGGAGTGAAGA	AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.130C>T	chr6.hg19:g.83767689G>A	ENSP00000358762:p.Leu44Phe	119.0	0.0	.	1224	135.0	67.0	.	NM_198920	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	ENST00000369747.3	hg19	CCDS34491.1	.	.	.	.	.	.	.	.	.	.	G	14.45	2.538080	0.45176	.	.	ENSG00000118420	ENST00000369747	T	0.33216	1.42	5.31	1.32	0.21799	.	0.204209	0.42964	N	0.000627	T	0.29491	0.0735	M	0.69823	2.125	0.23913	N	0.99649	D;D	0.76494	0.999;0.999	D;D	0.77557	0.986;0.99	T	0.09079	-1.0691	10	0.62326	D	0.03	-3.8166	2.1836	0.03880	0.1648:0.2847:0.4041:0.1463	.	44;44	D6RD24;Q7Z6J8	.;UB2CB_HUMAN	F	44	ENSP00000358762:L44F	ENSP00000358762:L44F	L	-	1	0	UBE2CBP	83824408	0.084000	0.21492	0.016000	0.15963	0.011000	0.07611	0.531000	0.23052	0.338000	0.23692	0.650000	0.86243	CTC	.	.	.	none		0.428	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041347.7	NM_198920	
GJA10	84694	hgsc.bcm.edu	37	6	90604946	90604946	+	Silent	SNP	T	T	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr6:90604946T>C	ENST00000369352.1	+	1	759	c.759T>C	c.(757-759)gaT>gaC	p.D253D		NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	253					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		GCATTGAGGATGAAACAGGCC	0.393																																					p.D253D		Atlas-SNP	.											.	GJA10	83	.	0			c.T759C						PASS	.						88.0	82.0	84.0					6																	90604946		2203	4300	6503	SO:0001819	synonymous_variant	84694	exon1			TGAGGATGAAACA	AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.759T>C	chr6.hg19:g.90604946T>C		74.0	0.0	.		98.0	45.0	.	NM_032602	B2R722|B3KVQ2|Q5TA63|Q96KG0	Silent	SNP	ENST00000369352.1	hg19	CCDS5025.1																																																																																			.	.	.	none		0.393	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041505.1	NM_032602	
EPM2A	7957	hgsc.bcm.edu	37	6	145948580	145948580	+	Missense_Mutation	SNP	T	T	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr6:145948580T>C	ENST00000367519.3	-	4	1493	c.968A>G	c.(967-969)aAg>aGg	p.K323R		NM_005670.3	NP_005661.1	O95278	EPM2A_HUMAN	epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)	323					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|habituation (GO:0046959)|inositol phosphate dephosphorylation (GO:0046855)|nervous system development (GO:0007399)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polysome (GO:0005844)	carbohydrate phosphatase activity (GO:0019203)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|starch binding (GO:2001070)			kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	7		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		AGAACGAACCTTCCCAAATTT	0.517																																					p.K323R		Atlas-SNP	.											.	EPM2A	21	.	0			c.A968G						PASS	.						101.0	109.0	107.0					6																	145948580		2203	4300	6503	SO:0001583	missense	7957	exon4			CGAACCTTCCCAA	AF284580	CCDS5206.1	6q24	2011-06-09			ENSG00000112425	ENSG00000112425		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3413	protein-coding gene	gene with protein product		607566	"""epilepsy, progressive myoclonus type 2, Lafora disease (laforin)"""			9222970, 7485240	Standard	XM_006715564		Approved	LDE, LD	uc003qkw.3	B3EWF7	OTTHUMG00000015747	ENST00000367519.3:c.968A>G	chr6.hg19:g.145948580T>C	ENSP00000356489:p.Lys323Arg	76.0	0.0	.		85.0	38.0	.	NM_005670	B3KMU5|B4DRZ2|O95483|Q5T3F5|Q6IS15|Q8IU96|Q8IX24|Q8IX25|Q9BS66|Q9UEN2	Missense_Mutation	SNP	ENST00000367519.3	hg19	CCDS5206.1	.	.	.	.	.	.	.	.	.	.	T	11.02	1.515139	0.27123	.	.	ENSG00000112425	ENST00000367519;ENST00000324857	D	0.95756	-3.8	5.89	5.89	0.94794	.	0.324340	0.38326	N	0.001727	D	0.87362	0.6158	L	0.38531	1.155	0.29866	N	0.827263	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.79174	-0.1912	10	0.31617	T	0.26	-26.7267	13.1249	0.59349	0.0:0.0:0.1994:0.8006	.	323;185	O95278;E1P599	EPM2A_HUMAN;.	R	323	ENSP00000356489:K323R	ENSP00000320279:K323R	K	-	2	0	EPM2A	145990273	0.998000	0.40836	0.950000	0.38849	0.698000	0.40448	2.545000	0.45769	2.257000	0.74773	0.460000	0.39030	AAG	.	.	.	none		0.517	EPM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042564.1		
MEOX2	4223	hgsc.bcm.edu	37	7	15725803	15725803	+	Silent	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr7:15725803G>A	ENST00000262041.5	-	1	634	c.225C>T	c.(223-225)caC>caT	p.H75H	AC005550.4_ENST00000442176.1_lincRNA|AC005550.5_ENST00000438923.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	75	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtgatggtggtggtggtggt	0.602																																					p.H75H	Esophageal Squamous(140;197 1769 16409 18257 29929)	Atlas-SNP	.											MEOX2,caecum,carcinoma,0,1	MEOX2	68	.	0			c.C225T						PASS	.						21.0	22.0	22.0					7																	15725803		2203	4299	6502	SO:0001819	synonymous_variant	4223	exon1			ATGGTGGTGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.225C>T	chr7.hg19:g.15725803G>A		52.0	0.0	.		71.0	3.0	.	NM_005924	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	hg19	CCDS34605.1																																																																																			.	.	.	none		0.602	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
PLEKHA8	84725	hgsc.bcm.edu	37	7	30092325	30092325	+	Splice_Site	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr7:30092325G>A	ENST00000449726.1	+	7	989	c.639G>A	c.(637-639)agG>agA	p.R213R	PLEKHA8_ENST00000396257.2_Splice_Site_p.R213R|PLEKHA8_ENST00000258679.7_Splice_Site_p.R213R|PLEKHA8_ENST00000396259.1_Splice_Site_p.R213R	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8	213					ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)	p.?(1)		breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						AAATTTGCAGGCAAATGGAGT	0.318																																					p.R213R		Atlas-SNP	.											.	PLEKHA8	68	.	1	Unknown(1)	breast(1)	c.G639A						PASS	.						25.0	27.0	27.0					7																	30092325		2189	4291	6480	SO:0001630	splice_region_variant	84725	exon7			TTGCAGGCAAATG	BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.639-1G>A	chr7.hg19:g.30092325G>A		350.0	1.0	.		503.0	234.0	.	NM_001197027	B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Silent	SNP	ENST00000449726.1	hg19	CCDS56473.1																																																																																			.	.	.	none		0.318	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032639	Silent
NPC1L1	29881	hgsc.bcm.edu	37	7	44560616	44560616	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr7:44560616G>A	ENST00000289547.4	-	13	3110	c.3055C>T	c.(3055-3057)Cgg>Tgg	p.R1019W	NPC1L1_ENST00000546276.1_Missense_Mutation_p.R973W|NPC1L1_ENST00000381160.3_Missense_Mutation_p.R1019W	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1019					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	ATGTTGGGCCGGTCGTTCAGG	0.542																																					p.R1019W		Atlas-SNP	.											.	NPC1L1	141	.	0			c.C3055T						PASS	.						159.0	163.0	162.0					7																	44560616		2203	4300	6503	SO:0001583	missense	29881	exon13			TGGGCCGGTCGTT		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3055C>T	chr7.hg19:g.44560616G>A	ENSP00000289547:p.Arg1019Trp	100.0	0.0	.		103.0	7.0	.	NM_001101648	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	hg19	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	G	8.430	0.848378	0.17034	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.93488	-3.11;-3.12;-3.23	5.35	-4.42	0.03579	.	2.832230	0.01137	N	0.006105	D	0.87842	0.6279	N	0.24115	0.695	0.09310	N	1	P;P;D;D	0.69078	0.93;0.865;0.994;0.997	P;B;B;P	0.46452	0.489;0.133;0.409;0.517	T	0.80518	-0.1347	10	0.66056	D	0.02	-1.1573	3.5307	0.07775	0.1295:0.4695:0.1562:0.2448	.	973;1019;1019;1019	B7ZLE6;Q17RV5;D3DVK9;Q9UHC9	.;.;.;NPCL1_HUMAN	W	1019;1019;973	ENSP00000289547:R1019W;ENSP00000370552:R1019W;ENSP00000438033:R973W	ENSP00000289547:R1019W	R	-	1	2	NPC1L1	44527141	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.366000	0.07563	-0.360000	0.08138	0.650000	0.86243	CGG	.	.	.	none		0.542	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
DMTF1	9988	hgsc.bcm.edu	37	7	86813800	86813800	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr7:86813800G>A	ENST00000394703.5	+	13	1471	c.908G>A	c.(907-909)gGt>gAt	p.G303D	DMTF1_ENST00000414194.2_Missense_Mutation_p.G37D|DMTF1_ENST00000413276.2_Missense_Mutation_p.G303D|DMTF1_ENST00000331242.7_Missense_Mutation_p.G303D|DMTF1_ENST00000432937.2_Missense_Mutation_p.G215D	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	303	HTH myb-type. {ECO:0000255|PROSITE- ProRule:PRU00625}.|Interaction with CCND1, CCND2 and CCND3. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					GTCACACAGGGTGTGTCTTGG	0.483																																					p.G303D		Atlas-SNP	.											.	DMTF1	48	.	0			c.G908A						PASS	.						94.0	76.0	82.0					7																	86813800		2203	4300	6503	SO:0001583	missense	9988	exon11			CACAGGGTGTGTC	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.908G>A	chr7.hg19:g.86813800G>A	ENSP00000378193:p.Gly303Asp	97.0	0.0	.		153.0	70.0	.	NM_001142327	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Missense_Mutation	SNP	ENST00000394703.5	hg19	CCDS5601.1	.	.	.	.	.	.	.	.	.	.	G	30	5.056379	0.93793	.	.	ENSG00000135164	ENST00000331242;ENST00000413276;ENST00000432937;ENST00000394703;ENST00000414194	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	6.17	6.17	0.99709	Transcription regulator HTH, Myb-type, DNA-binding (1);Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.65749	0.2721	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.58691	-0.7592	10	0.33940	T	0.23	-11.4511	19.8676	0.96824	0.0:0.0:1.0:0.0	.	303	Q9Y222	DMTF1_HUMAN	D	303;303;215;303;37	ENSP00000332171:G303D;ENSP00000402627:G303D;ENSP00000412532:G215D;ENSP00000378193:G303D;ENSP00000415910:G37D	ENSP00000332171:G303D	G	+	2	0	DMTF1	86651736	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.624000	0.98398	2.941000	0.99782	0.655000	0.94253	GGT	.	.	.	none		0.483	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5	NM_021145	
HEPACAM2	253012	hgsc.bcm.edu	37	7	92821636	92821636	+	Missense_Mutation	SNP	C	C	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr7:92821636C>A	ENST00000394468.2	-	9	1393	c.1316G>T	c.(1315-1317)gGg>gTg	p.G439V	HEPACAM2_ENST00000492616.1_5'UTR|HEPACAM2_ENST00000453812.2_Missense_Mutation_p.G462V|HEPACAM2_ENST00000341723.4_Missense_Mutation_p.G427V|HEPACAM2_ENST00000440868.1_Missense_Mutation_p.G419C	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	439					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						CAAATCTTGCCCCGATACACA	0.403																																					p.G439V		Atlas-SNP	.											.	HEPACAM2	132	.	0			c.G1316T						PASS	.						137.0	121.0	126.0					7																	92821636		2203	4300	6503	SO:0001583	missense	253012	exon9			TCTTGCCCCGATA	AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.1316G>T	chr7.hg19:g.92821636C>A	ENSP00000377980:p.Gly439Val	61.0	0.0	.		97.0	22.0	.	NM_001039372	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	ENST00000394468.2	hg19	CCDS43616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.77|12.77	2.036754|2.036754	0.35893|0.35893	.|.	.|.	ENSG00000188175|ENSG00000188175	ENST00000440868|ENST00000394468;ENST00000341723;ENST00000453812	T|T;T;T	0.62941|0.53206	-0.01|0.65;0.67;0.63	4.55|4.55	3.64|3.64	0.41730|0.41730	.|.	0.328676|0.328676	0.31859|0.31859	N|N	0.006945|0.006945	T|T	0.47655|0.47655	0.1457|0.1457	N|N	0.19112|0.19112	0.55|0.55	0.53688|0.53688	D|D	0.999979|0.999979	P|D;P;P	0.50710|0.64830	0.938|0.994;0.802;0.875	B|P;P;P	0.42882|0.59115	0.401|0.852;0.481;0.68	T|T	0.49082|0.49082	-0.8976|-0.8976	10|10	0.38643|0.48119	T|T	0.18|0.1	-7.8122|-7.8122	13.1162|13.1162	0.59301|0.59301	0.0:0.8391:0.1609:0.0|0.0:0.8391:0.1609:0.0	.|.	419|462;439;427	C9JN07|E9PDV5;A8MVW5;A8MVW5-2	.|.;HECA2_HUMAN;.	C|V	419|439;427;462	ENSP00000389592:G419C|ENSP00000377980:G439V;ENSP00000340532:G427V;ENSP00000390204:G462V	ENSP00000389592:G419C|ENSP00000340532:G427V	G|G	-|-	1|2	0|0	HEPACAM2|HEPACAM2	92659572|92659572	0.998000|0.998000	0.40836|0.40836	0.549000|0.549000	0.28204|0.28204	0.003000|0.003000	0.03518|0.03518	1.524000|1.524000	0.35942|0.35942	1.214000|1.214000	0.43395|0.43395	0.563000|0.563000	0.77884|0.77884	GGC|GGG	.	.	.	none		0.403	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151	
GPC2	221914	hgsc.bcm.edu	37	7	99768943	99768943	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr7:99768943G>T	ENST00000292377.2	-	9	1594	c.1427C>A	c.(1426-1428)gCg>gAg	p.A476E	GPC2_ENST00000471050.1_5'UTR|GAL3ST4_ENST00000360039.4_5'Flank|GAL3ST4_ENST00000423751.1_5'Flank	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	476					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGCCGTGGCCGCCCGGAGCTG	0.721																																					p.A476E		Atlas-SNP	.											.	GPC2	49	.	0			c.C1427A						PASS	.						8.0	10.0	9.0					7																	99768943		2101	4142	6243	SO:0001583	missense	221914	exon9			GTGGCCGCCCGGA	BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.1427C>A	chr7.hg19:g.99768943G>T	ENSP00000292377:p.Ala476Glu	125.0	0.0	.		172.0	42.0	.	NM_152742	A4D2A7	Missense_Mutation	SNP	ENST00000292377.2	hg19	CCDS5689.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116661	0.56505	.	.	ENSG00000213420	ENST00000292377	T	0.49139	0.79	4.26	4.26	0.50523	.	0.369108	0.25316	N	0.031543	T	0.45377	0.1339	L	0.46741	1.465	0.25189	N	0.99014	D	0.54772	0.968	P	0.54664	0.758	T	0.34875	-0.9811	10	0.05959	T	0.93	-20.9711	8.1197	0.30963	0.1128:0.0:0.8872:0.0	.	476	Q8N158	GPC2_HUMAN	E	476	ENSP00000292377:A476E	ENSP00000292377:A476E	A	-	2	0	GPC2	99606879	0.262000	0.24073	0.280000	0.24747	0.630000	0.37929	1.545000	0.36169	1.919000	0.55581	0.313000	0.20887	GCG	.	.	.	none		0.721	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337556.1	NM_152742	
PLOD3	8985	hgsc.bcm.edu	37	7	100855146	100855146	+	Missense_Mutation	SNP	T	T	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr7:100855146T>C	ENST00000223127.3	-	11	1611	c.1213A>G	c.(1213-1215)Atc>Gtc	p.I405V		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	405					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	TCAATGAGGATACGCAGGGTC	0.667																																					p.I405V		Atlas-SNP	.											.	PLOD3	79	.	0			c.A1213G						PASS	.						40.0	36.0	37.0					7																	100855146		2203	4300	6503	SO:0001583	missense	8985	exon11			TGAGGATACGCAG	AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1213A>G	chr7.hg19:g.100855146T>C	ENSP00000223127:p.Ile405Val	91.0	0.0	.		105.0	53.0	.	NM_001084	B2R6W6|Q540C3	Missense_Mutation	SNP	ENST00000223127.3	hg19	CCDS5715.1	.	.	.	.	.	.	.	.	.	.	T	5.673	0.308822	0.10733	.	.	ENSG00000106397	ENST00000223127	D	0.84730	-1.89	4.26	1.62	0.23740	.	0.294746	0.29853	N	0.011034	T	0.75421	0.3847	L	0.45698	1.435	0.23519	N	0.997508	B	0.02656	0.0	B	0.08055	0.003	T	0.57780	-0.7752	10	0.23302	T	0.38	-13.9258	5.6522	0.17622	0.0:0.0967:0.1704:0.7329	.	405	O60568	PLOD3_HUMAN	V	405	ENSP00000223127:I405V	ENSP00000223127:I405V	I	-	1	0	PLOD3	100641866	0.023000	0.18921	0.983000	0.44433	0.250000	0.25880	0.019000	0.13444	0.046000	0.15833	0.374000	0.22700	ATC	.	.	.	none		0.667	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347470.1		
NAPEPLD	222236	hgsc.bcm.edu	37	7	102760435	102760435	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr7:102760435G>A	ENST00000417955.1	-	3	684	c.530C>T	c.(529-531)cCa>cTa	p.P177L	NAPEPLD_ENST00000465647.1_Missense_Mutation_p.P177L|NAPEPLD_ENST00000427257.1_Missense_Mutation_p.P177L|NAPEPLD_ENST00000341533.4_Missense_Mutation_p.P177L|NAPEPLD_ENST00000455523.2_Missense_Mutation_p.P250L			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	177					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						CGCATCTATTGGAGGGAGTTC	0.458																																					p.P177L		Atlas-SNP	.											.	NAPEPLD	49	.	0			c.C530T						PASS	.						222.0	205.0	211.0					7																	102760435		2203	4300	6503	SO:0001583	missense	222236	exon3			TCTATTGGAGGGA	BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.530C>T	chr7.hg19:g.102760435G>A	ENSP00000407112:p.Pro177Leu	120.0	0.0	.		176.0	77.0	.	NM_001122838	Q5CZ87|Q769K1	Missense_Mutation	SNP	ENST00000417955.1	hg19	CCDS5729.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.398813	0.42512	.	.	ENSG00000161048	ENST00000341533;ENST00000417955;ENST00000465647;ENST00000427257;ENST00000455523	D;D;D;D;D	0.96856	-4.15;-4.15;-4.15;-4.15;-4.15	5.93	-5.61	0.02489	.	0.892883	0.10026	N	0.725409	D	0.92857	0.7728	M	0.62088	1.915	0.09310	N	1	P;B	0.34562	0.457;0.091	B;B	0.36030	0.216;0.102	D	0.86063	0.1533	10	0.44086	T	0.13	-10.4644	5.9653	0.19322	0.0653:0.381:0.139:0.4147	.	250;177	B4E3B0;Q6IQ20	.;NAPEP_HUMAN	L	177;177;177;177;250	ENSP00000340093:P177L;ENSP00000407112:P177L;ENSP00000419188:P177L;ENSP00000392775:P177L;ENSP00000414364:P250L	ENSP00000340093:P177L	P	-	2	0	NAPEPLD	102547671	0.000000	0.05858	0.001000	0.08648	0.773000	0.43773	-0.455000	0.06762	-0.678000	0.05224	-0.282000	0.10007	CCA	.	.	.	none		0.458	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347904.1	NM_198990	
PAXIP1	22976	hgsc.bcm.edu	37	7	154738247	154738247	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr7:154738247G>T	ENST00000404141.1	-	19	3262	c.3108C>A	c.(3106-3108)tgC>tgA	p.C1036*	PAXIP1_ENST00000397192.1_Nonsense_Mutation_p.C1036*|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	1036	BRCT 6. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		AATATTCTCGGCATAAATGAA	0.413																																					p.C1036X		Atlas-SNP	.											.	PAXIP1	150	.	0			c.C3108A						PASS	.						66.0	64.0	65.0					7																	154738247		1893	4119	6012	SO:0001587	stop_gained	22976	exon19			TTCTCGGCATAAA	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.3108C>A	chr7.hg19:g.154738247G>T	ENSP00000384048:p.Cys1036*	154.0	0.0	.		256.0	107.0	.	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Nonsense_Mutation	SNP	ENST00000404141.1	hg19	CCDS47753.1	.	.	.	.	.	.	.	.	.	.	G	39	7.444800	0.98289	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	.	.	.	5.34	-0.931	0.10438	.	0.000000	0.64402	U	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.841	13.5779	0.61885	0.418:0.0:0.582:0.0	.	.	.	.	X	1036;1036;860;989	.	ENSP00000319149:C989X	C	-	3	2	PAXIP1	154369180	0.998000	0.40836	0.504000	0.27639	0.641000	0.38312	0.608000	0.24223	-0.428000	0.07339	-0.378000	0.06908	TGC	.	.	.	none		0.413	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
ARHGEF10	9639	hgsc.bcm.edu	37	8	1814770	1814770	+	Splice_Site	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr8:1814770T>G	ENST00000398564.1	+	6	697		c.e6+2		ARHGEF10_ENST00000520359.1_Splice_Site|ARHGEF10_ENST00000398560.1_Splice_Site|ARHGEF10_ENST00000262112.6_Splice_Site|ARHGEF10_ENST00000518288.1_Splice_Site|ARHGEF10_ENST00000349830.3_Splice_Site			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10						centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GGATGGAGAGTAAGTTCCCCA	0.577																																					.		Atlas-SNP	.											.	ARHGEF10	255	.	0			c.622+2T>G						PASS	.						78.0	86.0	83.0					8																	1814770		2203	4300	6503	SO:0001630	splice_region_variant	9639	exon6			GGAGAGTAAGTTC	AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.697+2T>G	chr8.hg19:g.1814770T>G		22.0	0.0	.		20.0	13.0	.	NM_014629	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Splice_Site	SNP	ENST00000398564.1	hg19		.	.	.	.	.	.	.	.	.	.	T	21.5	4.162508	0.78226	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398560;ENST00000398564;ENST00000262112	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1393	0.72599	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGEF10	1802177	1.000000	0.71417	0.968000	0.41197	0.818000	0.46254	5.561000	0.67339	2.029000	0.59856	0.477000	0.44152	.	.	.	.	none		0.577	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding			Intron
MYOM2	9172	hgsc.bcm.edu	37	8	1998968	1998968	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr8:1998968G>A	ENST00000262113.4	+	2	229	c.88G>A	c.(88-90)Gac>Aac	p.D30N	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	30					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GTACCTGCTGGACGAATATGC	0.488																																					p.D30N		Atlas-SNP	.											.	MYOM2	251	.	0			c.G88A						PASS	.						111.0	84.0	93.0					8																	1998968		2203	4300	6503	SO:0001583	missense	9172	exon2			CTGCTGGACGAAT		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.88G>A	chr8.hg19:g.1998968G>A	ENSP00000262113:p.Asp30Asn	90.0	0.0	.		75.0	53.0	.	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	hg19	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	9.371	1.070617	0.20147	.	.	ENSG00000036448	ENST00000262113	T	0.50548	0.74	5.78	-3.17	0.05202	.	0.876047	0.10049	N	0.722425	T	0.36386	0.0965	L	0.57536	1.79	0.09310	N	0.999996	B	0.09022	0.002	B	0.06405	0.002	T	0.35992	-0.9766	10	0.40728	T	0.16	.	4.5719	0.12214	0.2464:0.1783:0.4935:0.0818	.	30	P54296	MYOM2_HUMAN	N	30	ENSP00000262113:D30N	ENSP00000262113:D30N	D	+	1	0	MYOM2	1986375	1.000000	0.71417	0.005000	0.12908	0.069000	0.16628	1.006000	0.29847	-0.172000	0.10779	0.563000	0.77884	GAC	.	.	.	none		0.488	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
AP3M2	10947	hgsc.bcm.edu	37	8	42012262	42012262	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr8:42012262T>G	ENST00000518421.1	+	3	348	c.57T>G	c.(55-57)caT>caG	p.H19Q	AP3M2_ENST00000520685.1_Intron|RP11-589C21.5_ENST00000564481.1_RNA|AP3M2_ENST00000517922.1_Missense_Mutation_p.H19Q|AP3M2_ENST00000396926.3_Missense_Mutation_p.H19Q|AP3M2_ENST00000174653.3_Missense_Mutation_p.H19Q	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	19					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			TGGAGAAACATTGGAAAAGTG	0.453																																					p.H19Q		Atlas-SNP	.											.	AP3M2	41	.	0			c.T57G						PASS	.						80.0	79.0	80.0					8																	42012262		2203	4300	6503	SO:0001583	missense	10947	exon3			GAAACATTGGAAA	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.57T>G	chr8.hg19:g.42012262T>G	ENSP00000428787:p.His19Gln	70.0	0.0	.		75.0	25.0	.	NM_001134296	B2RCR0|D3DSY2|Q7Z472	Missense_Mutation	SNP	ENST00000518421.1	hg19	CCDS6125.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.510545	0.64522	.	.	ENSG00000070718	ENST00000518421;ENST00000174653;ENST00000396926;ENST00000522288;ENST00000517922	T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.98	5.36	-1.64	0.08318	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	T	0.81143	0.4761	M	0.69185	2.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77351	-0.2620	10	0.51188	T	0.08	-21.5389	11.0086	0.47649	0.0:0.6489:0.0:0.3511	.	19;19	E7ER80;P53677	.;AP3M2_HUMAN	Q	19	ENSP00000428787:H19Q;ENSP00000174653:H19Q;ENSP00000380132:H19Q;ENSP00000429435:H19Q	ENSP00000174653:H19Q	H	+	3	2	AP3M2	42131419	0.970000	0.33590	0.966000	0.40874	0.990000	0.78478	0.183000	0.16919	-0.697000	0.05092	-0.239000	0.12128	CAT	.	.	.	none		0.453	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1		
TRPA1	8989	hgsc.bcm.edu	37	8	72987583	72987583	+	Missense_Mutation	SNP	A	A	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr8:72987583A>G	ENST00000262209.4	-	1	269	c.62T>C	c.(61-63)gTc>gCc	p.V21A		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	21					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ATCCTCATAGACAACGCCCTG	0.637																																					p.V21A		Atlas-SNP	.											.	TRPA1	256	.	0			c.T62C						PASS	.						101.0	104.0	103.0					8																	72987583		2203	4300	6503	SO:0001583	missense	8989	exon1			TCATAGACAACGC	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.62T>C	chr8.hg19:g.72987583A>G	ENSP00000262209:p.Val21Ala	22.0	0.0	.		39.0	12.0	.	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	hg19	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	A	3.912	-0.019798	0.07634	.	.	ENSG00000104321	ENST00000262209	T	0.41758	0.99	4.58	-1.05	0.10036	.	0.559178	0.19035	N	0.124452	T	0.24431	0.0592	L	0.50333	1.59	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16158	-1.0412	10	0.13108	T	0.6	-0.0577	0.093	0.00041	0.3267:0.1568:0.2116:0.3049	.	21	O75762	TRPA1_HUMAN	A	21	ENSP00000262209:V21A	ENSP00000262209:V21A	V	-	2	0	TRPA1	73150137	0.004000	0.15560	0.004000	0.12327	0.007000	0.05969	-0.206000	0.09398	-0.240000	0.09696	0.482000	0.46254	GTC	.	.	.	none		0.637	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
C9orf106	414318	hgsc.bcm.edu	37	9	132084554	132084554	+	RNA	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr9:132084554C>T	ENST00000316786.1	+	0	515							Q8NAJ2	CI106_HUMAN	chromosome 9 open reading frame 106											large_intestine(1)|lung(1)|ovary(1)|skin(1)	4		Ovarian(14;0.00556)|Medulloblastoma(224;0.235)				ACCACGTTTCCCCAGCACATC	0.612																																					p.S154S		Atlas-SNP	.											.	C9orf106	7	.	0			c.C462T						PASS	.						47.0	49.0	49.0					9																	132084554		2012	4166	6178			414318	exon2			CGTTTCCCCAGCA	AK092588		9q34.11	2013-12-05	2013-12-05	2013-12-05	ENSG00000179082	ENSG00000179082			31370	other	unknown							Standard	NM_001012715		Approved	bA65J3.5	uc004bxs.2	Q8NAJ2	OTTHUMG00000020781		chr9.hg19:g.132084554C>T		50.0	0.0	.		30.0	18.0	.	NM_001012715		Silent	SNP	ENST00000316786.1	hg19																																																																																				.	.	.	none		0.612	C9orf106-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000054576.2		
PGBD3	267004	hgsc.bcm.edu	37	10	50725003	50725003	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr10:50725003A>T	ENST00000374127.3	-	2	359	c.158T>A	c.(157-159)cTg>cAg	p.L53Q	PGBD3_ENST00000603152.1_Missense_Mutation_p.L521Q|ERCC6_ENST00000355832.5_Intron|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.L521Q|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.L521Q|PGBD3_ENST00000508005.2_Missense_Mutation_p.L53Q	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	53										breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						AGAACCTGGCAGATTATTTAT	0.428																																					p.Q53Q		Atlas-SNP	.											.	PGBD3	58	.	0			c.A158A						PASS	.						153.0	151.0	152.0					10																	50725003		2203	4300	6503	SO:0001583	missense	267004	exon2			CCTGGCAGATTAT	AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.158T>A	chr10.hg19:g.50725003A>T	ENSP00000363242:p.Leu53Gln	86.0	0.0	.		93.0	24.0	.	NM_170753	B3KQC4|Q5W0M0|Q6PIH0	Silent	SNP	ENST00000374127.3	hg19	CCDS7230.1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703019	0.68501	.	.	ENSG00000243251;ENSG00000243251;ENSG00000258838;ENSG00000258838	ENST00000374127;ENST00000508005;ENST00000515869;ENST00000447839	T;T;T;T	0.26373	1.74;1.74;2.72;2.72	0.468	0.468	0.16732	.	.	.	.	.	T	0.21631	0.0521	N	0.08118	0	0.22562	N	0.998986	D;D	0.58970	0.984;0.984	P;P	0.62435	0.902;0.902	T	0.23655	-1.0182	8	0.22109	T	0.4	-27.2962	.	.	.	.	521;53	E7EV46;Q8N328	.;PGBD3_HUMAN	Q	53;53;521;521	ENSP00000363242:L53Q;ENSP00000426963:L53Q;ENSP00000423550:L521Q;ENSP00000387966:L521Q	ENSP00000387966:L521Q	L	-	2	0	PGBD3;RP11-123B3.6	50395009	0.976000	0.34144	0.985000	0.45067	0.983000	0.72400	1.864000	0.39469	0.413000	0.25759	0.402000	0.26972	CTG	.	.	.	none		0.428	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047988.1		
TMEM26	219623	hgsc.bcm.edu	37	10	63170397	63170397	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr10:63170397G>T	ENST00000399298.3	-	6	1158	c.790C>A	c.(790-792)Caa>Aaa	p.Q264K	TMEM26_ENST00000507507.1_5'UTR	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	264						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					GGGCCATCTTGTATGAAGACG	0.507																																					p.Q264K		Atlas-SNP	.											.	TMEM26	47	.	0			c.C790A						PASS	.						76.0	79.0	78.0					10																	63170397		2109	4237	6346	SO:0001583	missense	219623	exon6			CATCTTGTATGAA	BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.790C>A	chr10.hg19:g.63170397G>T	ENSP00000382237:p.Gln264Lys	198.0	0.0	.		217.0	136.0	.	NM_178505	Q6ZVM0|Q8IVN9	Missense_Mutation	SNP	ENST00000399298.3	hg19	CCDS41530.1	.	.	.	.	.	.	.	.	.	.	G	35	5.516645	0.96402	.	.	ENSG00000196932	ENST00000399298	.	.	.	6.17	6.17	0.99709	.	0.254374	0.41938	D	0.000784	D	0.85173	0.5636	M	0.85630	2.765	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.85636	0.1273	9	0.87932	D	0	-16.2012	20.8794	0.99867	0.0:0.0:1.0:0.0	.	264	Q6ZUK4	TMM26_HUMAN	K	264	.	ENSP00000382237:Q264K	Q	-	1	0	TMEM26	62840403	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CAA	.	.	.	none		0.507	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1	NM_178505	
DLG5	9231	hgsc.bcm.edu	37	10	79579728	79579728	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr10:79579728C>G	ENST00000372391.2	-	16	3456	c.3451G>C	c.(3451-3453)Gag>Cag	p.E1151Q	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Missense_Mutation_p.E811Q	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1151					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GGTGCCCACTCCTGGAGCTCC	0.632																																					p.E1151Q		Atlas-SNP	.											.	DLG5	154	.	0			c.G3451C						PASS	.						60.0	67.0	65.0					10																	79579728		2203	4300	6503	SO:0001583	missense	9231	exon16			CCCACTCCTGGAG	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.3451G>C	chr10.hg19:g.79579728C>G	ENSP00000361467:p.Glu1151Gln	63.0	0.0	.		55.0	13.0	.	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	hg19	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	C	17.64	3.440688	0.63067	.	.	ENSG00000151208	ENST00000372391;ENST00000424842;ENST00000372388	T;T;T	0.05139	3.56;3.49;3.71	5.73	5.73	0.89815	.	0.400058	0.18419	N	0.141810	T	0.11281	0.0275	L	0.27053	0.805	0.42181	D	0.991686	B;B;D	0.59357	0.116;0.215;0.985	B;B;P	0.53689	0.124;0.094;0.732	T	0.26643	-1.0097	10	0.29301	T	0.29	.	18.083	0.89447	0.0:1.0:0.0:0.0	.	1041;1151;811	Q8TDM6-4;Q8TDM6;Q8TDM6-2	.;DLG5_HUMAN;.	Q	1151;112;811	ENSP00000361467:E1151Q;ENSP00000394797:E112Q;ENSP00000361464:E811Q	ENSP00000361464:E811Q	E	-	1	0	DLG5	79249734	1.000000	0.71417	0.999000	0.59377	0.161000	0.22273	5.585000	0.67497	2.722000	0.93159	0.655000	0.94253	GAG	.	.	.	none		0.632	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
C10orf131	100127889	hgsc.bcm.edu	37	10	97697946	97697946	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr10:97697946G>A	ENST00000423344.2	+	8	707	c.511G>A	c.(511-513)Ggt>Agt	p.G171S	ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA	NM_001130446.2	NP_001123918.2	A6NCD4	CJ131_HUMAN	chromosome 10 open reading frame 131	0										endometrium(1)|kidney(1)	2						TAGTTCTCCAGGTAACATTCT	0.289																																					p.G171S		Atlas-SNP	.											.	C10orf131	11	.	0			c.G511A						PASS	.						55.0	48.0	50.0					10																	97697946		692	1589	2281	SO:0001583	missense	100127889	exon8			TCTCCAGGTAACA		CCDS58090.1	10q24.1	2012-05-30			ENSG00000173088	ENSG00000173088			31667	protein-coding gene	gene with protein product							Standard	NM_001130446		Approved	bA690P14.3	uc010qoo.2	A6NCD4	OTTHUMG00000018824	ENST00000423344.2:c.511G>A	chr10.hg19:g.97697946G>A	ENSP00000411850:p.Gly171Ser	266.0	1.0	.		226.0	135.0	.	NM_001130446	B1AMZ2|B4DG41	Missense_Mutation	SNP	ENST00000423344.2	hg19	CCDS58090.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.54|15.54	2.863751|2.863751	0.51482|0.51482	.|.	.|.	ENSG00000173088|ENSG00000173088	ENST00000423344|ENST00000371202	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.075828	.|0.51477	.|D	.|0.000086	T|T	0.33265|0.33265	0.0857|0.0857	N|N	0.08118|0.08118	0|0	0.25894|0.25894	N|N	0.983432|0.983432	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.40887|0.40887	-0.9539|-0.9539	8|7	0.87932|0.87932	D|D	0|0	.|.	16.4606|16.4606	0.84044|0.84044	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	171|.	B4DG41|.	.|.	S|M	171|167	.|.	ENSP00000411850:G171S|ENSP00000360245:V167M	G|V	+|+	1|1	0|0	C10orf131|C10orf131	97687936|97687936	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.948000|0.948000	0.59901|0.59901	5.095000|5.095000	0.64529|0.64529	2.683000|2.683000	0.91414|0.91414	0.650000|0.650000	0.86243|0.86243	GGT|GTG	.	.	.	none		0.289	C10orf131-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468148.1	NM_001098847	
R3HCC1L	27291	hgsc.bcm.edu	37	10	99968077	99968077	+	Missense_Mutation	SNP	G	G	C	rs373657280	byFrequency	TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr10:99968077G>C	ENST00000298999.3	+	5	509	c.206G>C	c.(205-207)cGa>cCa	p.R69P	R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370586.2_Intron|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.R69P	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	69							nucleotide binding (GO:0000166)										CCGGAGGCTCGAAGACTAAAT	0.353																																					p.R69P		Atlas-SNP	.											C10orf28,colon,carcinoma,0,1	R3HCC1L	3	.	0			c.G206C						PASS	.						71.0	78.0	76.0					10																	99968077		2203	4299	6502	SO:0001583	missense	27291	exon4			AGGCTCGAAGACT	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.206G>C	chr10.hg19:g.99968077G>C	ENSP00000298999:p.Arg69Pro	203.0	0.0	.		183.0	26.0	.	NM_001256620	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	hg19	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	G	0.274	-0.991016	0.02162	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.07800	3.16;3.16	5.81	0.746	0.18365	.	0.578419	0.16601	N	0.207353	T	0.02230	0.0069	N	0.00926	-1.1	0.09310	N	0.999992	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.47736	-0.9094	9	.	.	.	0.9296	7.6295	0.28230	0.6631:0.2621:0.0748:0.0	.	69;69	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	P	69	ENSP00000359616:R69P;ENSP00000298999:R69P	.	R	+	2	0	C10orf28	99958067	0.046000	0.20272	0.000000	0.03702	0.003000	0.03518	0.453000	0.21811	-0.094000	0.12374	-2.142000	0.00338	CGA	.	.	.	none		0.353	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472	
EDRF1	26098	hgsc.bcm.edu	37	10	127411654	127411654	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr10:127411654A>T	ENST00000356792.4	+	3	567	c.335A>T	c.(334-336)gAc>gTc	p.D112V	C10orf137_ENST00000337623.3_Missense_Mutation_p.D112V	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATGGCATATGACTTTATTGAT	0.373																																					p.D112V		Atlas-SNP	.											.	C10orf137	153	.	0			c.A335T						PASS	.						392.0	357.0	369.0					10																	127411654		2203	4300	6503	SO:0001583	missense	26098	exon3			CATATGACTTTAT																												ENST00000356792.4:c.335A>T	chr10.hg19:g.127411654A>T	ENSP00000349244:p.Asp112Val	143.0	0.0	.		178.0	65.0	.	NM_015608	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	ENST00000356792.4	hg19	CCDS55733.1	.	.	.	.	.	.	.	.	.	.	A	13.19	2.163705	0.38217	.	.	ENSG00000107938	ENST00000356792;ENST00000392732;ENST00000337623	.	.	.	5.7	4.57	0.56435	.	0.091287	0.85682	D	0.000000	T	0.52322	0.1727	L	0.36672	1.1	0.80722	D	1	P;P;P	0.50272	0.933;0.933;0.933	P;P;P	0.52957	0.542;0.714;0.542	T	0.44345	-0.9334	9	0.30078	T	0.28	.	11.7725	0.51967	0.9311:0.0:0.0689:0.0	.	112;112;112	Q3B7T1;Q3B7T1-5;Q3B7T1-3	EDRF1_HUMAN;.;.	V	112	.	ENSP00000336727:D112V	D	+	2	0	C10orf137	127401644	1.000000	0.71417	0.998000	0.56505	0.375000	0.29983	6.824000	0.75288	0.988000	0.38734	-0.274000	0.10170	GAC	.	.	.	none		0.373	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		
TMEM132A	54972	hgsc.bcm.edu	37	11	60703543	60703543	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr11:60703543G>T	ENST00000453848.2	+	11	2394	c.2236G>T	c.(2236-2238)Gag>Tag	p.E746*	TMEM132A_ENST00000005286.4_Nonsense_Mutation_p.E747*			Q24JP5	T132A_HUMAN	transmembrane protein 132A	746	Binds to HSPA5/GRP78. {ECO:0000250}.|Confers cellular localization similar to full-length form. {ECO:0000250}.					endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						GCACCCGCCCGAGCCCTGCCG	0.746																																					p.E747X		Atlas-SNP	.											.	TMEM132A	135	.	0			c.G2239T						PASS	.						9.0	12.0	11.0					11																	60703543		2130	4118	6248	SO:0001587	stop_gained	54972	exon11			CCGCCCGAGCCCT	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.2236G>T	chr11.hg19:g.60703543G>T	ENSP00000405823:p.Glu746*	45.0	0.0	.		30.0	13.0	.	NM_017870	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Nonsense_Mutation	SNP	ENST00000453848.2	hg19	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	G	40	8.074232	0.98640	.	.	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286	.	.	.	4.72	4.72	0.59763	.	0.306688	0.27393	N	0.019579	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.0866	0.72158	0.0:0.0:1.0:0.0	.	.	.	.	X	497;746;747	.	ENSP00000005286:E747X	E	+	1	0	TMEM132A	60460119	1.000000	0.71417	0.955000	0.39395	0.985000	0.73830	6.464000	0.73534	2.620000	0.88729	0.561000	0.74099	GAG	.	.	.	none		0.746	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
HEPHL1	341208	hgsc.bcm.edu	37	11	93754630	93754630	+	Silent	SNP	G	G	T	rs267603252		TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr11:93754630G>T	ENST00000315765.9	+	1	104	c.96G>T	c.(94-96)ggG>ggT	p.G32G		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	32	Plastocyanin-like 1.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				ACTACATTGGGATTGTGGAAG	0.473																																					p.G32G		Atlas-SNP	.											.	HEPHL1	144	.	0			c.G96T						PASS	.						161.0	157.0	158.0					11																	93754630		1911	4120	6031	SO:0001819	synonymous_variant	341208	exon1			CATTGGGATTGTG	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.96G>T	chr11.hg19:g.93754630G>T		80.0	0.0	.		50.0	22.0	.	NM_001098672	Q3C1W7	Silent	SNP	ENST00000315765.9	hg19	CCDS44710.1																																																																																			.	.	.	none		0.473	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
KMT2A	4297	hgsc.bcm.edu	37	11	118352545	118352545	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr11:118352545G>T	ENST00000389506.5	+	7	3750	c.3750G>T	c.(3748-3750)gaG>gaT	p.E1250D	KMT2A_ENST00000354520.4_Missense_Mutation_p.E1250D|KMT2A_ENST00000534358.1_Missense_Mutation_p.E1250D			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1250					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CAGCAAGAGAGGATCCTGCCC	0.502																																					p.E1250D		Atlas-SNP	.											.	MLL	548	.	0			c.G3750T						PASS	.						107.0	98.0	101.0					11																	118352545		2200	4296	6496	SO:0001583	missense	4297	exon7			AAGAGAGGATCCT	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3750G>T	chr11.hg19:g.118352545G>T	ENSP00000374157:p.Glu1250Asp	236.0	0.0	.		165.0	80.0	.	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	hg19	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016979	0.54576	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000359313	D;T;D;D	0.83075	-1.68;0.92;-1.68;-1.63	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.76990	0.4065	L	0.47716	1.5	0.41753	D	0.989671	B;B	0.27351	0.176;0.176	B;B	0.22386	0.039;0.039	T	0.72564	-0.4255	10	0.28530	T	0.3	.	13.4678	0.61266	0.0806:0.0:0.9194:0.0	.	1250;1250	E9PQG7;Q03164	.;MLL1_HUMAN	D	1250;1283;1250;1250;160	ENSP00000436786:E1250D;ENSP00000432391:E1283D;ENSP00000374157:E1250D;ENSP00000346516:E1250D	ENSP00000346516:E1250D	E	+	3	2	MLL	117857755	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.989000	0.40707	2.680000	0.91292	0.563000	0.77884	GAG	.	.	.	none		0.502	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
ERC1	23085	hgsc.bcm.edu	37	12	1192643	1192643	+	Missense_Mutation	SNP	A	A	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr12:1192643A>C	ENST00000397203.2	+	3	1389	c.983A>C	c.(982-984)gAa>gCa	p.E328A	ERC1_ENST00000589028.1_Missense_Mutation_p.E328A|ERC1_ENST00000543086.3_Missense_Mutation_p.E328A|ERC1_ENST00000546231.2_Missense_Mutation_p.E328A|ERC1_ENST00000355446.5_Missense_Mutation_p.E328A|ERC1_ENST00000360905.4_Missense_Mutation_p.E328A			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	328					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			GCTACCGAGGAAGACCATGAG	0.458																																					p.E328A		Atlas-SNP	.											.	ERC1	95	.	0			c.A983C						PASS	.						88.0	86.0	87.0					12																	1192643		2203	4300	6503	SO:0001583	missense	23085	exon3			CCGAGGAAGACCA	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.983A>C	chr12.hg19:g.1192643A>C	ENSP00000380386:p.Glu328Ala	103.0	0.0	.		127.0	46.0	.	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	hg19	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	A	17.45	3.393749	0.62066	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000543086;ENST00000542302;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971	T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.57873	0.2083	L	0.49350	1.555	0.58432	D	0.999999	B;D;D;D	0.76494	0.3;0.999;0.999;0.975	B;D;D;P	0.80764	0.297;0.994;0.994;0.78	T	0.52419	-0.8578	10	0.27785	T	0.31	-20.1362	15.9948	0.80232	1.0:0.0:0.0:0.0	.	104;328;328;328	F5H327;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;RB6I2_HUMAN	A	328;328;328;328;328;328;328;328;328;328;104	ENSP00000340054:E328A;ENSP00000380386:E328A;ENSP00000438546:E328A;ENSP00000445336:E328A;ENSP00000442739:E328A;ENSP00000347621:E328A;ENSP00000354158:E328A;ENSP00000410064:E328A	ENSP00000340054:E328A	E	+	2	0	ERC1	1062904	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.277000	0.78572	2.234000	0.73211	0.533000	0.62120	GAA	.	.	.	none		0.458	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
LRP6	4040	hgsc.bcm.edu	37	12	12301888	12301888	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr12:12301888T>G	ENST00000261349.4	-	14	3270	c.3194A>C	c.(3193-3195)aAc>aCc	p.N1065T	LRP6_ENST00000543091.1_Missense_Mutation_p.N1065T	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1065	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TTTCTCTGGGTTTACCACAAC	0.453																																					p.N1065T		Atlas-SNP	.											.	LRP6	170	.	0			c.A3194C						PASS	.						184.0	167.0	173.0					12																	12301888		2203	4300	6503	SO:0001583	missense	4040	exon14			TCTGGGTTTACCA	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3194A>C	chr12.hg19:g.12301888T>G	ENSP00000261349:p.Asn1065Thr	94.0	0.0	.		85.0	59.0	.	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	hg19	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876601	0.72180	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.91068	-2.78;-2.78	4.82	4.82	0.62117	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	U	0.000011	D	0.92639	0.7661	L	0.49126	1.545	0.80722	D	1	D;P	0.71674	0.998;0.632	D;B	0.74674	0.984;0.325	D	0.90702	0.4621	10	0.25106	T	0.35	.	13.3996	0.60874	0.0:0.0:0.0:1.0	.	1065;1065	F5H7J9;O75581	.;LRP6_HUMAN	T	1065	ENSP00000261349:N1065T;ENSP00000442472:N1065T	ENSP00000261349:N1065T	N	-	2	0	LRP6	12193155	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.970000	0.70431	2.146000	0.66826	0.528000	0.53228	AAC	.	.	.	none		0.453	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
IFNG	3458	hgsc.bcm.edu	37	12	68551700	68551700	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr12:68551700T>G	ENST00000229135.3	-	3	490	c.359A>C	c.(358-360)aAt>aCt	p.N120T	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	120					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	CACCGAATAATTAGTCAGCTT	0.368																																					p.N120T		Atlas-SNP	.											.	IFNG	38	.	0			c.A359C						PASS	.						156.0	151.0	153.0					12																	68551700		2203	4299	6502	SO:0001583	missense	3458	exon3			GAATAATTAGTCA		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.359A>C	chr12.hg19:g.68551700T>G	ENSP00000229135:p.Asn120Thr	85.0	0.0	.		74.0	43.0	.	NM_000619	B5BU88|Q53ZV4	Missense_Mutation	SNP	ENST00000229135.3	hg19	CCDS8980.1	.	.	.	.	.	.	.	.	.	.	T	9.875	1.199940	0.22121	.	.	ENSG00000111537	ENST00000229135	T	0.43294	0.95	5.38	-1.2	0.09554	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.425740	0.04038	N	0.302620	T	0.23886	0.0578	N	0.12182	0.205	0.09310	N	1	B	0.24721	0.11	B	0.28465	0.09	T	0.13818	-1.0495	9	.	.	.	-2.0684	4.3675	0.11232	0.1454:0.3309:0.0:0.5238	.	120	P01579	IFNG_HUMAN	T	120	ENSP00000229135:N120T	.	N	-	2	0	IFNG	66837967	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.502000	0.06390	-0.370000	0.08016	-1.157000	0.01802	AAT	.	.	.	none		0.368	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402301.1		
ATXN2	6311	hgsc.bcm.edu	37	12	111893835	111893835	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr12:111893835G>T	ENST00000377617.3	-	23	3903	c.3742C>A	c.(3742-3744)Cag>Aag	p.Q1248K	ATXN2_ENST00000389153.4_Missense_Mutation_p.Q985K|ATXN2_ENST00000535949.1_Missense_Mutation_p.Q941K|ATXN2_ENST00000608853.1_Missense_Mutation_p.Q1088K|ATXN2_ENST00000542287.2_Missense_Mutation_p.Q983K|ATXN2_ENST00000550104.1_3'UTR	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	1248					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						GGTATTACCTGAGGTACGTGG	0.502																																					p.Q1248K		Atlas-SNP	.											.	ATXN2	99	.	0			c.C3742A						PASS	.						245.0	226.0	232.0					12																	111893835		2203	4300	6503	SO:0001583	missense	6311	exon23			TTACCTGAGGTAC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.3742C>A	chr12.hg19:g.111893835G>T	ENSP00000366843:p.Gln1248Lys	153.0	0.0	.		177.0	106.0	.	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	hg19	CCDS31902.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968319	0.92855	.	.	ENSG00000204842	ENST00000389154;ENST00000389153;ENST00000377617;ENST00000482777;ENST00000542287;ENST00000535949;ENST00000550844	D	0.81821	-1.54	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.86100	0.5852	L	0.36672	1.1	0.80722	D	1	P;B;B;D;D	0.63880	0.792;0.435;0.139;0.993;0.982	B;B;B;D;D	0.75020	0.415;0.115;0.056;0.985;0.968	D	0.86104	0.1558	10	0.56958	D	0.05	-6.4193	19.9595	0.97236	0.0:0.0:1.0:0.0	.	249;1248;941;983;985	Q99700-3;Q99700;Q24JQ7;F8VQP2;F8WB06	.;ATX2_HUMAN;.;.;.	K	303;985;1248;249;983;941;173	ENSP00000366843:Q1248K	ENSP00000366843:Q1248K	Q	-	1	0	ATXN2	110378218	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.974000	0.93433	2.797000	0.96272	0.563000	0.77884	CAG	.	.	.	none		0.502	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
OAS3	4940	hgsc.bcm.edu	37	12	113405314	113405314	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr12:113405314C>G	ENST00000228928.7	+	13	2960	c.2781C>G	c.(2779-2781)ttC>ttG	p.F927L	RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	927	OAS domain 3.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						CCACCTGCTTCACAGAGCTAC	0.577																																					p.F927L		Atlas-SNP	.											.	OAS3	63	.	0			c.C2781G						PASS	.						60.0	63.0	62.0					12																	113405314		2139	4269	6408	SO:0001583	missense	4940	exon13			CTGCTTCACAGAG	AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.2781C>G	chr12.hg19:g.113405314C>G	ENSP00000228928:p.Phe927Leu	155.0	0.0	.		137.0	44.0	.	NM_006187	Q2HJ14|Q9H3P5	Missense_Mutation	SNP	ENST00000228928.7	hg19	CCDS44981.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.11|15.11	2.736400|2.736400	0.49045|0.49045	.|.	.|.	ENSG00000111331|ENSG00000111331	ENST00000228928;ENST00000323881|ENST00000546973	T|.	0.55588|.	0.51|.	4.15|4.15	4.15|4.15	0.48705|0.48705	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);|.	0.000000|.	0.35936|.	U|.	0.002889|.	T|.	0.70928|.	0.3280|.	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|.	0.71159|.	-0.4674|.	10|.	0.87932|.	D|.	0|.	.|.	12.1472|12.1472	0.54029|0.54029	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	927|.	Q9Y6K5|.	OAS3_HUMAN|.	L|X	927;926|99	ENSP00000228928:F927L|.	ENSP00000228928:F927L|.	F|S	+|+	3|2	2|0	OAS3|OAS3	111889697|111889697	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.053000|0.053000	0.15095|0.15095	1.391000|1.391000	0.34475|0.34475	2.301000|2.301000	0.77427|0.77427	0.558000|0.558000	0.71614|0.71614	TTC|TCA	.	.	.	none		0.577	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405920.1		
BRI3BP	140707	hgsc.bcm.edu	37	12	125509745	125509745	+	Silent	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr12:125509745C>T	ENST00000341446.8	+	3	616	c.525C>T	c.(523-525)caC>caT	p.H175H		NM_080626.5	NP_542193.3			BRI3 binding protein											large_intestine(1)|lung(8)|ovary(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.35e-05)|Epithelial(86;0.000426)|all cancers(50;0.00576)		ACATCCTGCACAAGTACGAGG	0.617																																					p.H175H		Atlas-SNP	.											.	BRI3BP	18	.	0			c.C525T						PASS	.						127.0	97.0	107.0					12																	125509745		2203	4300	6503	SO:0001819	synonymous_variant	140707	exon3			CCTGCACAAGTAC	AF284094	CCDS9262.1	12q24.1	2008-08-04			ENSG00000184992	ENSG00000184992			14251	protein-coding gene	gene with protein product		615627				11860200, 17765869	Standard	NM_080626		Approved	BNAS1, KG19, HCCR-2	uc001uha.1	Q8WY22	OTTHUMG00000168548	ENST00000341446.8:c.525C>T	chr12.hg19:g.125509745C>T		75.0	0.0	.		95.0	32.0	.	NM_080626		Silent	SNP	ENST00000341446.8	hg19	CCDS9262.1																																																																																			.	.	.	none		0.617	BRI3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400200.2	NM_080626	
SPERT	220082	hgsc.bcm.edu	37	13	46288259	46288259	+	Nonsense_Mutation	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr13:46288259C>T	ENST00000310521.1	+	3	1179	c.1099C>T	c.(1099-1101)Cag>Tag	p.Q367*	SPERT_ENST00000378966.3_Nonsense_Mutation_p.Q331*	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	367						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		GCAGGCGCTGCAGGCCCTGCT	0.692																																					p.Q367X		Atlas-SNP	.											.	SPERT	54	.	0			c.C1099T						PASS	.						8.0	9.0	9.0					13																	46288259		2181	4250	6431	SO:0001587	stop_gained	220082	exon3			GCGCTGCAGGCCC	AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.1099C>T	chr13.hg19:g.46288259C>T	ENSP00000309189:p.Gln367*	111.0	0.0	.		127.0	59.0	.	NM_152719	A8K8I5|Q8NHV2	Nonsense_Mutation	SNP	ENST00000310521.1	hg19	CCDS9399.1	.	.	.	.	.	.	.	.	.	.	C	39	7.802377	0.98498	.	.	ENSG00000174015	ENST00000310521;ENST00000378966	.	.	.	4.83	4.83	0.62350	.	0.121108	0.37669	N	0.001987	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	14.7672	0.69648	0.0:1.0:0.0:0.0	.	.	.	.	X	367;331	.	ENSP00000309189:Q367X	Q	+	1	0	SPERT	45186260	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.125000	0.42016	2.502000	0.84385	0.609000	0.83330	CAG	.	.	.	none		0.692	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	NM_152719	
INTS6	26512	hgsc.bcm.edu	37	13	51952390	51952390	+	Silent	SNP	A	A	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr13:51952390A>T	ENST00000311234.4	-	12	2059	c.1587T>A	c.(1585-1587)gtT>gtA	p.V529V	INTS6_ENST00000497989.1_Silent_p.V351V|INTS6_ENST00000490542.1_Silent_p.V213V|INTS6_ENST00000463928.1_Intron|INTS6_ENST00000398119.2_Silent_p.V516V|INTS6_ENST00000425000.1_Silent_p.V97V	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	529					signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		TCAGCAAAGCAACTTGGAACC	0.363																																					p.V529V		Atlas-SNP	.											.	INTS6	72	.	0			c.T1587A						PASS	.						152.0	146.0	148.0					13																	51952390		2203	4300	6503	SO:0001819	synonymous_variant	26512	exon12			CAAAGCAACTTGG	AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.1587T>A	chr13.hg19:g.51952390A>T		111.0	0.0	.		174.0	86.0	.	NM_012141	Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Silent	SNP	ENST00000311234.4	hg19	CCDS9428.1																																																																																			.	.	.	none		0.363	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045023.1	NM_012141	
EML5	161436	hgsc.bcm.edu	37	14	89093338	89093338	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr14:89093338T>G	ENST00000380664.5	-	33	4559	c.4560A>C	c.(4558-4560)gaA>gaC	p.E1520D	EML5_ENST00000554922.1_Missense_Mutation_p.E1528D|EML5_ENST00000553320.1_5'Flank|EML5_ENST00000352093.5_Missense_Mutation_p.E1482D			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1520						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CTGGTCGGAATTCTGCCACAA	0.428																																					p.E1528D		Atlas-SNP	.											.	EML5	141	.	0			c.A4584C						PASS	.						138.0	131.0	133.0					14																	89093338		1850	4106	5956	SO:0001583	missense	161436	exon34			TCGGAATTCTGCC	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4560A>C	chr14.hg19:g.89093338T>G	ENSP00000370039:p.Glu1520Asp	68.0	0.0	.		77.0	24.0	.	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	hg19	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	T	14.45	2.538746	0.45176	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.49432	0.78;0.78;0.78	5.04	3.87	0.44632	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.120772	0.56097	D	0.000030	T	0.50905	0.1643	L	0.43646	1.37	0.39864	D	0.973418	B;D	0.69078	0.179;0.997	B;D	0.63283	0.121;0.913	T	0.47407	-0.9120	10	0.15499	T	0.54	-29.3795	8.3227	0.32138	0.0:0.1541:0.0:0.8459	.	1528;1520	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	D	1528;1482;1520	ENSP00000451998:E1528D;ENSP00000298315:E1482D;ENSP00000370039:E1520D	ENSP00000298315:E1482D	E	-	3	2	EML5	88163091	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.593000	0.36686	0.924000	0.37069	0.533000	0.62120	GAA	.	.	.	none		0.428	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
AHNAK2	113146	hgsc.bcm.edu	37	14	105406085	105406085	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr14:105406085A>T	ENST00000333244.5	-	7	15822	c.15703T>A	c.(15703-15705)Ttc>Atc	p.F5235I	AHNAK2_ENST00000557457.1_Missense_Mutation_p.F233I	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5235						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAAACAAGGAACTCTTTGACT	0.547																																					p.F5235I		Atlas-SNP	.											.	AHNAK2	719	.	0			c.T15703A						PASS	.						260.0	282.0	275.0					14																	105406085		2065	4199	6264	SO:0001583	missense	113146	exon7			CAAGGAACTCTTT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.15703T>A	chr14.hg19:g.105406085A>T	ENSP00000353114:p.Phe5235Ile	72.0	0.0	.		55.0	39.0	.	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	A	9.688	1.151129	0.21371	.	.	ENSG00000185567	ENST00000557457;ENST00000333244	T;T	0.02737	4.18;5.4	3.73	-3.5	0.04710	.	4.827340	0.01750	U	0.029844	T	0.01592	0.0051	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.44003	-0.9356	10	0.21014	T	0.42	.	2.4033	0.04407	0.2008:0.301:0.3769:0.1213	.	5235	Q8IVF2	AHNK2_HUMAN	I	233;5235	ENSP00000450998:F233I;ENSP00000353114:F5235I	ENSP00000353114:F5235I	F	-	1	0	AHNAK2	104477130	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.436000	0.06922	-0.671000	0.05274	-0.441000	0.05720	TTC	.	.	.	none		0.547	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
MYZAP	100820829	hgsc.bcm.edu	37	15	57967233	57967233	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr15:57967233G>T	ENST00000267853.5	+	12	1365	c.1271G>T	c.(1270-1272)aGa>aTa	p.R424I	GCOM1_ENST00000396180.1_Missense_Mutation_p.R393I|GCOM1_ENST00000572390.1_Missense_Mutation_p.R396I|MYZAP_ENST00000380565.4_Missense_Mutation_p.R396I|GCOM1_ENST00000380569.2_Missense_Mutation_p.R424I|GCOM1_ENST00000587652.1_Missense_Mutation_p.R424I|GCOM1_ENST00000380568.3_Missense_Mutation_p.R424I|GCOM1_ENST00000574161.1_Missense_Mutation_p.R424I|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000380561.2_Missense_Mutation_p.R365I|GCOM1_ENST00000380560.2_Missense_Mutation_p.R355I			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	424					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)											GTGGAAACCAGAGAGATAGGA	0.368																																					p.R424I		Atlas-SNP	.											.	GCOM1	66	.	0			c.G1271T						PASS	.						103.0	105.0	104.0					15																	57967233		2192	4292	6484	SO:0001583	missense	145781	exon12			AAACCAGAGAGAT	FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.1271G>T	chr15.hg19:g.57967233G>T	ENSP00000267853:p.Arg424Ile	196.0	0.0	.		117.0	48.0	.	NM_001018090	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	ENST00000267853.5	hg19	CCDS10162.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.229693	0.79688	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380565;ENST00000380568	T;T;T;T;T;T;T	0.36699	1.5;1.47;1.53;1.54;1.46;1.24;1.49	5.55	5.55	0.83447	.	0.090649	0.85682	D	0.000000	T	0.49440	0.1557	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.76575	0.977;0.931;0.988;0.988	T	0.49312	-0.8953	10	0.72032	D	0.01	-17.4231	14.9994	0.71459	0.0:0.0:1.0:0.0	.	424;424;396;424	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	I	424;365;393;355;424;396;424	ENSP00000369943:R424I;ENSP00000369935:R365I;ENSP00000379483:R393I;ENSP00000369933:R355I;ENSP00000267853:R424I;ENSP00000369939:R396I;ENSP00000369942:R424I	ENSP00000267853:R424I	R	+	2	0	GCOM1	55754525	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.192000	0.72069	2.598000	0.87819	0.655000	0.94253	AGA	.	.	.	none		0.368	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255716.2	NM_001018100	
SRRM2	23524	hgsc.bcm.edu	37	16	2814199	2814199	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr16:2814199G>T	ENST00000301740.8	+	11	4219	c.3670G>T	c.(3670-3672)Gag>Tag	p.E1224*		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1224	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGAAACAAAAGAGCAAAATAG	0.473																																					p.E1224X		Atlas-SNP	.											.	SRRM2	263	.	0			c.G3670T						PASS	.						120.0	124.0	123.0					16																	2814199		2198	4300	6498	SO:0001587	stop_gained	23524	exon11			ACAAAAGAGCAAA	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3670G>T	chr16.hg19:g.2814199G>T	ENSP00000301740:p.Glu1224*	115.0	0.0	.		110.0	65.0	.	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Nonsense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	39	7.886209	0.98542	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	.	.	.	6.17	5.13	0.70059	.	0.266442	0.32785	N	0.005652	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-1.4439	9.3053	0.37872	0.1728:0.0:0.8272:0.0	.	.	.	.	X	1224;1224;476	.	ENSP00000301740:E1224X	E	+	1	0	SRRM2	2754200	1.000000	0.71417	0.983000	0.44433	0.167000	0.22549	1.237000	0.32695	1.463000	0.47967	0.655000	0.94253	GAG	.	.	.	none		0.473	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
SCARF1	8578	hgsc.bcm.edu	37	17	1543778	1543778	+	Missense_Mutation	SNP	T	T	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr17:1543778T>C	ENST00000263071.4	-	5	1023	c.974A>G	c.(973-975)cAc>cGc	p.H325R	SCARF1_ENST00000574545.1_5'Flank|SCARF1_ENST00000348987.3_Missense_Mutation_p.H325R|SCARF1_ENST00000571272.1_Missense_Mutation_p.H325R	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	325	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCGCTGACAGTGGCCAGTATC	0.662																																					p.H325R		Atlas-SNP	.											.	SCARF1	46	.	0			c.A974G						PASS	.						15.0	13.0	14.0					17																	1543778		2182	4287	6469	SO:0001583	missense	8578	exon5			TGACAGTGGCCAG	D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.974A>G	chr17.hg19:g.1543778T>C	ENSP00000263071:p.His325Arg	156.0	0.0	.		155.0	43.0	.	NM_145350	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	ENST00000263071.4	hg19	CCDS11007.1	.	.	.	.	.	.	.	.	.	.	T	14.43	2.533044	0.45073	.	.	ENSG00000074660	ENST00000263071;ENST00000348987;ENST00000434376	T;T;T	0.33216	1.42;1.42;1.42	5.24	5.24	0.73138	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.000000	0.49305	D	0.000150	T	0.28400	0.0702	L	0.28344	0.845	0.22796	N	0.998725	D;P;B	0.53462	0.96;0.751;0.028	P;B;B	0.51016	0.656;0.139;0.113	T	0.11084	-1.0602	10	0.22706	T	0.39	-13.5328	10.626	0.45508	0.0:0.0:0.2943:0.7057	.	325;325;325	Q14162-2;Q14162;Q14162-3	.;SREC_HUMAN;.	R	325	ENSP00000263071:H325R;ENSP00000323964:H325R;ENSP00000411167:H325R	ENSP00000263071:H325R	H	-	2	0	SCARF1	1490528	0.001000	0.12720	0.995000	0.50966	0.941000	0.58515	0.362000	0.20284	2.199000	0.70637	0.533000	0.62120	CAC	.	.	.	none		0.662	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693	
CORO6	84940	hgsc.bcm.edu	37	17	27943974	27943974	+	Silent	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr17:27943974G>A	ENST00000445145.2	-	6	841	c.840C>T	c.(838-840)atC>atT	p.I280I	CORO6_ENST00000456796.3_Silent_p.I46I|CORO6_ENST00000580212.1_Silent_p.I240I|RP11-68I3.2_ENST00000581474.1_RNA|CORO6_ENST00000577909.1_Intron|CORO6_ENST00000345068.5_Silent_p.I280I|CORO6_ENST00000584969.1_Silent_p.I280I|CORO6_ENST00000388767.3_Silent_p.I280I			Q6QEF8	CORO6_HUMAN	coronin 6	280					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)	actin filament binding (GO:0051015)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(2)	14						ACAGGTAGACGATGCTGGAGT	0.617																																					p.I280I		Atlas-SNP	.											.	CORO6	34	.	0			c.C840T						PASS	.						171.0	159.0	163.0					17																	27943974		2203	4300	6503	SO:0001819	synonymous_variant	84940	exon6			GTAGACGATGCTG	AF193039	CCDS11252.2	17q11.2	2013-01-10			ENSG00000167549	ENSG00000167549		"""Coronins"", ""WD repeat domain containing"""	21356	protein-coding gene	gene with protein product							Standard	NM_032854		Approved	FLJ14871	uc002hel.2	Q6QEF8	OTTHUMG00000132732	ENST00000445145.2:c.840C>T	chr17.hg19:g.27943974G>A		85.0	0.0	.		90.0	58.0	.	NM_032854	B3KU26|Q71MF3|Q8WYH7|Q96K02	Silent	SNP	ENST00000445145.2	hg19																																																																																				.	.	.	none		0.617	CORO6-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000447831.1	NM_032854	
MYO1D	4642	hgsc.bcm.edu	37	17	30932207	30932207	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr17:30932207G>A	ENST00000318217.5	-	21	3066	c.2762C>T	c.(2761-2763)aCg>aTg	p.T921M	MYO1D_ENST00000579584.1_Missense_Mutation_p.T921M|MYO1D_ENST00000394649.4_Missense_Mutation_p.T833M	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	921	Myosin tail. {ECO:0000255}.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			GTTGTCTTTCGTATGGAACAC	0.423																																					p.T921M		Atlas-SNP	.											MYO1D,colon,carcinoma,0,1	MYO1D	93	.	0			c.C2762T						PASS	.						130.0	110.0	117.0					17																	30932207		2203	4300	6503	SO:0001583	missense	4642	exon21			TCTTTCGTATGGA	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.2762C>T	chr17.hg19:g.30932207G>A	ENSP00000324527:p.Thr921Met	115.0	0.0	.		140.0	10.0	.	NM_015194	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	hg19	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109801	0.56398	.	.	ENSG00000176658	ENST00000318217;ENST00000394649	T	0.36699	1.24	4.88	4.88	0.63580	Myosin tail 2 (1);	0.000000	0.40640	U	0.001050	T	0.26846	0.0657	N	0.25647	0.755	0.80722	D	1	P;P	0.38565	0.637;0.637	B;B	0.34301	0.179;0.118	T	0.09100	-1.0690	10	0.48119	T	0.1	.	15.8776	0.79178	0.0:0.0:1.0:0.0	.	832;921	Q7Z3N6;O94832	.;MYO1D_HUMAN	M	921;113	ENSP00000324527:T921M	ENSP00000324527:T921M	T	-	2	0	MYO1D	27956320	1.000000	0.71417	0.995000	0.50966	0.956000	0.61745	7.605000	0.82844	2.421000	0.82119	0.655000	0.94253	ACG	.	.	.	none		0.423	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1		
CACNB1	782	hgsc.bcm.edu	37	17	37340296	37340296	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr17:37340296G>A	ENST00000394303.3	-	10	1093	c.886C>T	c.(886-888)Cgc>Tgc	p.R296C	CACNB1_ENST00000394310.3_Missense_Mutation_p.R296C|CACNB1_ENST00000344140.5_Missense_Mutation_p.R341C|CACNB1_ENST00000582877.1_5'Flank	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	296				SNTR -> LQHT (in Ref. 3; AAA36167). {ECO:0000305}.	axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGCTGGAGCGTGTGTTGGAG	0.587																																					p.R341C	Esophageal Squamous(5;100 366 38393 41452 45827)	Atlas-SNP	.											.	CACNB1	89	.	0			c.C1021T						PASS	.						119.0	102.0	108.0					17																	37340296		2203	4300	6503	SO:0001583	missense	782	exon10			TGGAGCGTGTGTT		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.886C>T	chr17.hg19:g.37340296G>A	ENSP00000377840:p.Arg296Cys	73.0	0.0	.		61.0	41.0	.	NM_199247	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	ENST00000394303.3	hg19	CCDS42311.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415693	0.83449	.	.	ENSG00000067191	ENST00000539338;ENST00000394303;ENST00000344140;ENST00000394310;ENST00000536613	T;T;T	0.44083	0.93;0.93;0.93	5.42	5.42	0.78866	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (1);	0.000000	0.85682	D	0.000000	T	0.72137	0.3423	M	0.89715	3.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.994;0.979;0.997	T	0.78507	-0.2177	10	0.87932	D	0	-13.5845	17.986	0.89156	0.0:0.0:1.0:0.0	.	341;296;296	Q02641-2;Q02641-3;Q02641	.;.;CACB1_HUMAN	C	246;296;341;296;247	ENSP00000377840:R296C;ENSP00000345461:R341C;ENSP00000377847:R296C	ENSP00000345461:R341C	R	-	1	0	CACNB1	34593822	1.000000	0.71417	0.985000	0.45067	0.959000	0.62525	7.579000	0.82511	2.562000	0.86427	0.491000	0.48974	CGC	.	.	.	none		0.587	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3		
SCRN2	90507	hgsc.bcm.edu	37	17	45916327	45916327	+	Missense_Mutation	SNP	A	A	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr17:45916327A>C	ENST00000290216.9	-	5	727	c.602T>G	c.(601-603)aTc>aGc	p.I201S	SCRN2_ENST00000584123.1_Missense_Mutation_p.I209S|SCRN2_ENST00000407215.3_Missense_Mutation_p.I201S	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	201						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						TTGGGCCGAGATGTCCGTGCC	0.587																																					p.I201S		Atlas-SNP	.											.	SCRN2	35	.	0			c.T602G						PASS	.						84.0	88.0	87.0					17																	45916327		2203	4300	6503	SO:0001583	missense	90507	exon5			GCCGAGATGTCCG	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.602T>G	chr17.hg19:g.45916327A>C	ENSP00000290216:p.Ile201Ser	54.0	0.0	.		55.0	33.0	.	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	hg19	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.162687	0.57368	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.22945	1.93;1.93	5.52	5.52	0.82312	.	0.204208	0.50627	D	0.000110	T	0.44767	0.1309	M	0.90759	3.145	0.53688	D	0.999973	P;P;P	0.47484	0.81;0.896;0.81	P;P;P	0.49887	0.625;0.625;0.625	T	0.52786	-0.8529	10	0.52906	T	0.07	-16.3059	9.1893	0.37189	0.9175:0.0:0.0825:0.0	.	201;201;201	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	S	201	ENSP00000290216:I201S;ENSP00000383935:I201S	ENSP00000290216:I201S	I	-	2	0	SCRN2	43271326	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	7.472000	0.80996	2.091000	0.63221	0.533000	0.62120	ATC	.	.	.	none		0.587	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
ABCA8	10351	hgsc.bcm.edu	37	17	66915445	66915445	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr17:66915445T>G	ENST00000269080.2	-	13	1922	c.1785A>C	c.(1783-1785)aaA>aaC	p.K595N	ABCA8_ENST00000430352.2_Missense_Mutation_p.K595N|ABCA8_ENST00000586539.1_Missense_Mutation_p.K595N	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	595	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					TTTGTACCTCTTTATCCACTT	0.318																																					p.K595N		Atlas-SNP	.											.	ABCA8	213	.	0			c.A1785C						PASS	.						120.0	121.0	121.0					17																	66915445		2203	4300	6503	SO:0001583	missense	10351	exon13			TACCTCTTTATCC	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1785A>C	chr17.hg19:g.66915445T>G	ENSP00000269080:p.Lys595Asn	57.0	0.0	.		49.0	14.0	.	NM_007168	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	hg19	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	T	4.610	0.113350	0.08831	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225	T;D	0.93859	1.11;-3.3	4.54	2.25	0.28309	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.926293	0.09012	N	0.861352	D	0.83746	0.5321	N	0.11284	0.12	0.28435	N	0.917098	B;B;B;B;B	0.09022	0.002;0.0;0.002;0.0;0.0	B;B;B;B;B	0.12837	0.005;0.005;0.008;0.003;0.005	T	0.73597	-0.3932	10	0.56958	D	0.05	.	2.3391	0.04255	0.1542:0.0848:0.1604:0.6006	.	534;595;595;595;595	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	N	595;595;534	ENSP00000269080:K595N;ENSP00000402814:K595N	ENSP00000269080:K595N	K	-	3	2	ABCA8	64427040	0.000000	0.05858	0.501000	0.27601	0.038000	0.13279	-0.684000	0.05173	0.331000	0.23511	0.482000	0.46254	AAA	.	.	.	none		0.318	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
UBE2O	63893	hgsc.bcm.edu	37	17	74391863	74391863	+	Silent	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr17:74391863C>T	ENST00000319380.7	-	15	2953	c.2889G>A	c.(2887-2889)gcG>gcA	p.A963A	UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	963					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						TAGCCAGCAGCGCCATCTCCT	0.502																																					p.A963A		Atlas-SNP	.											.	UBE2O	207	.	0			c.G2889A						PASS	.						126.0	111.0	116.0					17																	74391863		2203	4300	6503	SO:0001819	synonymous_variant	63893	exon15			CAGCAGCGCCATC	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.2889G>A	chr17.hg19:g.74391863C>T		66.0	0.0	.		57.0	21.0	.	NM_022066	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Silent	SNP	ENST00000319380.7	hg19	CCDS32742.1																																																																																			.	.	.	none		0.502	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066	
WDR18	57418	hgsc.bcm.edu	37	19	991092	991092	+	Silent	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:991092G>A	ENST00000251289.5	+	6	776	c.753G>A	c.(751-753)agG>agA	p.R251R	WDR18_ENST00000587001.2_Silent_p.R251R	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	251					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGACAGAGGGAGAGGAGCT	0.706																																					p.R251R		Atlas-SNP	.											.	WDR18	20	.	0			c.G753A						PASS	.						42.0	36.0	38.0					19																	991092		2190	4291	6481	SO:0001819	synonymous_variant	57418	exon6			ACAGAGGGAGAGG		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.753G>A	chr19.hg19:g.991092G>A		88.0	0.0	.		73.0	44.0	.	NM_024100	O60390|Q9BWR2	Silent	SNP	ENST00000251289.5	hg19	CCDS12051.1																																																																																			.	.	.	none		0.706	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
ZNF556	80032	hgsc.bcm.edu	37	19	2877861	2877861	+	Missense_Mutation	SNP	T	T	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:2877861T>C	ENST00000307635.2	+	4	992	c.905T>C	c.(904-906)tTt>tCt	p.F302S	ZNF556_ENST00000586426.1_Missense_Mutation_p.F301S	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	302					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAACATCCTTTCAACGACAC	0.507																																					p.F302S		Atlas-SNP	.											.	ZNF556	73	.	0			c.T905C						PASS	.						61.0	57.0	58.0					19																	2877861		2203	4300	6503	SO:0001583	missense	80032	exon4			CATCCTTTCAACG	BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.905T>C	chr19.hg19:g.2877861T>C	ENSP00000302603:p.Phe302Ser	145.0	0.0	.		135.0	78.0	.	NM_024967	Q96GM3	Missense_Mutation	SNP	ENST00000307635.2	hg19	CCDS12097.1	.	.	.	.	.	.	.	.	.	.	T	16.39	3.110252	0.56398	.	.	ENSG00000172000	ENST00000307635	T	0.18810	2.19	2.3	2.3	0.28687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16938	0.0407	L	0.47078	1.49	0.09310	N	1	B	0.25850	0.136	B	0.24394	0.053	T	0.26608	-1.0098	9	0.87932	D	0	.	3.8674	0.09022	0.0:0.1859:0.0:0.8141	.	302	Q9HAH1	ZN556_HUMAN	S	302	ENSP00000302603:F302S	ENSP00000302603:F302S	F	+	2	0	ZNF556	2828861	0.000000	0.05858	0.210000	0.23637	0.362000	0.29581	-0.203000	0.09438	0.902000	0.36520	0.334000	0.21626	TTT	.	.	.	none		0.507	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451638.2	NM_024967	
PNPLA6	10908	hgsc.bcm.edu	37	19	7623951	7623951	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:7623951G>T	ENST00000221249.6	+	31	3930	c.3499G>T	c.(3499-3501)Gtc>Ttc	p.V1167F	PNPLA6_ENST00000450331.3_Missense_Mutation_p.V1167F|PNPLA6_ENST00000545201.2_Missense_Mutation_p.V1140F|PNPLA6_ENST00000414982.3_Missense_Mutation_p.V1215F|PNPLA6_ENST00000600737.1_Missense_Mutation_p.V1205F	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1206					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						GCTAGAGGTTGTCAAGTCCAG	0.572																																					p.V1215F		Atlas-SNP	.											.	PNPLA6	163	.	0			c.G3643T						PASS	.						89.0	66.0	74.0					19																	7623951		2203	4300	6503	SO:0001583	missense	10908	exon30			GAGGTTGTCAAGT	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.3499G>T	chr19.hg19:g.7623951G>T	ENSP00000221249:p.Val1167Phe	93.0	0.0	.		63.0	22.0	.	NM_001166111	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	hg19	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	g	24.7	4.563922	0.86335	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	4.78	4.78	0.61160	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.000000	0.85682	D	0.000000	T	0.64316	0.2587	M	0.85630	2.765	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	0.999;1.0;1.0;0.945	T	0.71530	-0.4565	10	0.87932	D	0	-43.7646	15.3194	0.74109	0.0:0.0:1.0:0.0	.	1206;1140;1205;1167	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	F	1167;1140;1215;1167	ENSP00000221249:V1167F;ENSP00000443323:V1140F;ENSP00000407509:V1215F;ENSP00000394348:V1167F	ENSP00000221249:V1167F	V	+	1	0	PNPLA6	7529951	1.000000	0.71417	0.819000	0.32651	0.952000	0.60782	9.869000	0.99810	2.209000	0.71365	0.561000	0.74099	GTC	.	.	.	none		0.572	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
TMED1	11018	hgsc.bcm.edu	37	19	10945735	10945735	+	Missense_Mutation	SNP	T	T	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:10945735T>C	ENST00000214869.2	-	3	438	c.340A>G	c.(340-342)Atc>Gtc	p.I114V	TMED1_ENST00000588289.1_5'UTR|C19orf38_ENST00000592854.1_5'Flank|TMED1_ENST00000591695.1_Intron	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	114	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						TTCTCGGAGATGGTGCTGAAG	0.587																																					p.I114V		Atlas-SNP	.											.	TMED1	22	.	0			c.A340G						PASS	.						109.0	107.0	107.0					19																	10945735		2203	4300	6503	SO:0001583	missense	11018	exon3			CGGAGATGGTGCT	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.340A>G	chr19.hg19:g.10945735T>C	ENSP00000214869:p.Ile114Val	83.0	0.0	.		99.0	30.0	.	NM_006858		Missense_Mutation	SNP	ENST00000214869.2	hg19	CCDS12249.1	.	.	.	.	.	.	.	.	.	.	T	13.53	2.263688	0.39995	.	.	ENSG00000099203	ENST00000214869	T	0.41758	0.99	5.15	5.15	0.70609	GOLD (3);	0.107611	0.64402	D	0.000005	T	0.36663	0.0975	L	0.39467	1.215	0.80722	D	1	B	0.18741	0.03	B	0.24701	0.055	T	0.13176	-1.0519	10	0.32370	T	0.25	-31.9399	13.9713	0.64242	0.0:0.0:0.0:1.0	.	114	Q13445	TMED1_HUMAN	V	114	ENSP00000214869:I114V	ENSP00000214869:I114V	I	-	1	0	TMED1	10806735	0.963000	0.33076	0.999000	0.59377	0.984000	0.73092	1.642000	0.37207	1.950000	0.56595	0.459000	0.35465	ATC	.	.	.	none		0.587	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
ZNF675	171392	hgsc.bcm.edu	37	19	23836072	23836072	+	Missense_Mutation	SNP	T	T	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:23836072T>G	ENST00000359788.4	-	4	1831	c.1663A>C	c.(1663-1665)Aaa>Caa	p.K555Q	ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000601935.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	555					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TGTATTTTTTTATGTTTAGTA	0.308																																					p.K555Q		Atlas-SNP	.											.	ZNF675	88	.	0			c.A1663C						PASS	.						99.0	101.0	100.0					19																	23836072		2202	4299	6501	SO:0001583	missense	171392	exon4			TTTTTTTATGTTT		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1663A>C	chr19.hg19:g.23836072T>G	ENSP00000352836:p.Lys555Gln	87.0	0.0	.		92.0	63.0	.	NM_138330	Q8N211	Missense_Mutation	SNP	ENST00000359788.4	hg19	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	0.038	-1.297753	0.01364	.	.	ENSG00000197372	ENST00000359788	T	0.36340	1.26	0.886	-1.54	0.08584	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12817	0.0311	N	0.03115	-0.41	0.20821	N	0.999848	P	0.40875	0.731	B	0.42163	0.378	T	0.14868	-1.0457	9	0.02654	T	1	.	5.3645	0.16105	0.0:0.0:0.4182:0.5818	.	555	Q8TD23	ZN675_HUMAN	Q	555	ENSP00000352836:K555Q	ENSP00000352836:K555Q	K	-	1	0	ZNF675	23627912	0.001000	0.12720	0.220000	0.23810	0.218000	0.24690	-0.209000	0.09358	0.257000	0.21650	0.254000	0.18369	AAA	.	.	.	none		0.308	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330	
RPS16	6217	hgsc.bcm.edu	37	19	39923961	39923961	+	Missense_Mutation	SNP	C	C	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:39923961C>G	ENST00000251453.3	-	5	445	c.393G>C	c.(391-393)aaG>aaC	p.K131N	RPS16_ENST00000601655.1_Missense_Mutation_p.K114N|RPS16_ENST00000599539.1_3'UTR|RPS16_ENST00000339471.4_3'UTR	NM_001020.4	NP_001011.1	P62249	RS16_HUMAN	ribosomal protein S16	131					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|large_intestine(2)|lung(2)|skin(2)	7	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;4.14e-26)|all cancers(26;2.68e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGCCTCCAAACTTTTTGGACT	0.502																																					p.K131N		Atlas-SNP	.											.	RPS16	12	.	0			c.G393C						PASS	.						59.0	62.0	61.0					19																	39923961		2203	4300	6503	SO:0001583	missense	6217	exon5			TCCAAACTTTTTG	M60854	CCDS12535.1	19q13.1	2011-04-05				ENSG00000105193		"""S ribosomal proteins"""	10396	protein-coding gene	gene with protein product	"""40S ribosomal protein S16"""	603675				2016298, 9582194	Standard	XM_005259137		Approved	S16	uc002olk.3	P62249		ENST00000251453.3:c.393G>C	chr19.hg19:g.39923961C>G	ENSP00000251453:p.Lys131Asn	102.0	0.0	.		130.0	84.0	.	NM_001020	B2RDD5|P17008	Missense_Mutation	SNP	ENST00000251453.3	hg19	CCDS12535.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263913	0.59431	.	.	ENSG00000105193	ENST00000251453	.	.	.	4.42	3.38	0.38709	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	.	.	.	.	D	0.87881	0.6289	H	0.99783	4.775	0.80722	D	1	D	0.60575	0.988	D	0.67103	0.949	D	0.87512	0.2440	7	.	.	.	.	6.8709	0.24121	0.0:0.7925:0.0:0.2075	.	131	P62249	RS16_HUMAN	N	131	.	.	K	-	3	2	RPS16	44615801	1.000000	0.71417	1.000000	0.80357	0.592000	0.36648	2.064000	0.41432	1.057000	0.40506	0.579000	0.79373	AAG	.	.	.	none		0.502	RPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464511.1	NM_001020	
SPTBN4	57731	hgsc.bcm.edu	37	19	41072264	41072264	+	Splice_Site	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:41072264C>T	ENST00000352632.3	+	30	6421	c.6335C>T	c.(6334-6336)aCg>aTg	p.T2112M	SPTBN4_ENST00000598249.1_Splice_Site_p.T2112M|SPTBN4_ENST00000392025.1_Splice_Site_p.T855M|SPTBN4_ENST00000338932.3_Splice_Site_p.T2112M			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2112					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CGCCTGACCACGGTCAGCTCC	0.612																																					p.T2112M		Atlas-SNP	.											.	SPTBN4	213	.	0			c.C6335T						PASS	.						13.0	15.0	14.0					19																	41072264		2192	4279	6471	SO:0001630	splice_region_variant	57731	exon30			TGACCACGGTCAG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.6336+1C>T	chr19.hg19:g.41072264C>T		47.0	0.0	.		63.0	36.0	.	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.646036	0.87958	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025	T;T;T	0.78707	0.7;-1.2;0.7	4.95	4.95	0.65309	.	0.000000	0.64402	D	0.000004	D	0.85566	0.5726	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.77557	0.749;0.99	D	0.86750	0.1960	10	0.72032	D	0.01	.	17.0938	0.86628	0.0:1.0:0.0:0.0	.	855;2112	C9JY79;Q9H254	.;SPTN4_HUMAN	M	2112;2112;2112;855	ENSP00000263373:T2112M;ENSP00000340345:T2112M;ENSP00000375879:T855M	ENSP00000340345:T2112M	T	+	2	0	SPTBN4	45764104	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.474000	0.81024	2.566000	0.86566	0.561000	0.74099	ACG	.	.	.	none		0.612	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		Missense_Mutation
BCKDHA	593	hgsc.bcm.edu	37	19	41928639	41928639	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:41928639A>T	ENST00000269980.2	+	7	1327	c.959A>T	c.(958-960)gAg>gTg	p.E320V	CTC-435M10.6_ENST00000598887.1_RNA|BCKDHA_ENST00000595085.1_Missense_Mutation_p.E354V|BCKDHA_ENST00000457836.2_Missense_Mutation_p.E298V|BCKDHA_ENST00000535632.1_3'UTR|CTC-435M10.3_ENST00000540732.1_Missense_Mutation_p.E354V	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide	320					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						GCTGTGGCAGAGAACCAGCCC	0.612																																					p.E320V		Atlas-SNP	.											.	BCKDHA	36	.	0			c.A959T						PASS	.						60.0	58.0	59.0					19																	41928639		2203	4300	6503	SO:0001583	missense	593	exon7			TGGCAGAGAACCA	J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128	ENST00000269980.2:c.959A>T	chr19.hg19:g.41928639A>T	ENSP00000269980:p.Glu320Val	38.0	0.0	.		37.0	16.0	.	NM_000709	B4DP47|E7EW46|Q16034|Q16472	Missense_Mutation	SNP	ENST00000269980.2	hg19	CCDS12581.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.543401	0.86022	.	.	ENSG00000255730;ENSG00000248098;ENSG00000248098;ENSG00000248098	ENST00000540732;ENST00000269980;ENST00000542943;ENST00000457836	D;D;D;D	0.95853	-3.83;-3.83;-3.83;-3.83	5.69	5.69	0.88448	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.97396	0.9148	M	0.83603	2.65	0.80722	D	1	D;P;P;P	0.63880	0.993;0.946;0.914;0.882	P;P;P;P	0.62089	0.898;0.615;0.618;0.619	D	0.97889	1.0296	10	0.66056	D	0.02	-52.8066	14.9376	0.70970	1.0:0.0:0.0:0.0	.	298;319;320;354	B4DP47;Q59EI3;P12694;F5H5P2	.;.;ODBA_HUMAN;.	V	354;320;291;298	ENSP00000443246:E354V;ENSP00000269980:E320V;ENSP00000440345:E291V;ENSP00000416000:E298V	ENSP00000269980:E320V	E	+	2	0	BCKDHA;CTC-435M10.3	46620479	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	8.521000	0.90569	2.181000	0.69327	0.459000	0.35465	GAG	.	.	.	none		0.612	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398313.3	NM_000709	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48205408	48205408	+	Silent	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:48205408G>A	ENST00000396720.3	+	15	4613	c.4419G>A	c.(4417-4419)aaG>aaA	p.K1473K	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1473										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CCCCTGCCAAGCGGCGCAAGT	0.726																																					p.K1473K		Atlas-SNP	.											.	GLTSCR1	79	.	0			c.G4419A						PASS	.						4.0	5.0	4.0					19																	48205408		1993	4017	6010	SO:0001819	synonymous_variant	29998	exon15			TGCCAAGCGGCGC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.4419G>A	chr19.hg19:g.48205408G>A		62.0	0.0	.		62.0	41.0	.	NM_015711	A8MW01	Silent	SNP	ENST00000396720.3	hg19	CCDS46134.1																																																																																			.	.	.	none		0.726	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
FOXA2	3170	hgsc.bcm.edu	37	20	22563153	22563153	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr20:22563153G>A	ENST00000377115.4	-	3	890	c.709C>T	c.(709-711)Cct>Tct	p.P237S	FOXA2_ENST00000419308.2_Missense_Mutation_p.P243S	NM_153675.2	NP_710141.1	Q9Y261	FOXA2_HUMAN	forkhead box A2	237					adult locomotory behavior (GO:0008344)|cell development (GO:0048468)|cell differentiation in hindbrain (GO:0021533)|cell fate specification (GO:0001708)|chromatin modification (GO:0016568)|connective tissue development (GO:0061448)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral neural tube patterning (GO:0021904)|ectoderm formation (GO:0001705)|endocrine pancreas development (GO:0031018)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|in utero embryonic development (GO:0001701)|lung epithelial cell differentiation (GO:0060487)|negative regulation of detection of glucose (GO:2000971)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter by glucose (GO:0000433)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|regulation of blood coagulation (GO:0030193)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in detection of glucose (GO:2000976)|response to interleukin-6 (GO:0070741)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|urinary_tract(1)	22	Lung NSC(19;0.188)					CCCGAGTCAGGGTGCAGGGTC	0.652																																					p.P243S		Atlas-SNP	.											FOXA2,caecum,carcinoma,0,1	FOXA2	48	.	0			c.C727T						PASS	.						25.0	28.0	27.0					20																	22563153		2203	4300	6503	SO:0001583	missense	3170	exon2			AGTCAGGGTGCAG	AF147787	CCDS13147.1, CCDS46585.1	20p11	2008-04-10		2002-09-20	ENSG00000125798	ENSG00000125798		"""Forkhead boxes"""	5022	protein-coding gene	gene with protein product		600288	"""hepatocyte nuclear factor 3, beta"""	HNF3B		9119385, 11875061	Standard	NM_153675		Approved		uc002wsm.3	Q9Y261	OTTHUMG00000032041	ENST00000377115.4:c.709C>T	chr20.hg19:g.22563153G>A	ENSP00000366319:p.Pro237Ser	116.0	0.0	.		134.0	63.0	.	NM_021784	Q8WUW4|Q96DF7	Missense_Mutation	SNP	ENST00000377115.4	hg19	CCDS13147.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385733	0.82792	.	.	ENSG00000125798	ENST00000377115;ENST00000419308;ENST00000319993;ENST00000444877	D;D;D	0.95656	-3.77;-3.77;-3.77	4.98	4.98	0.66077	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.64402	U	0.000011	D	0.97430	0.9159	M	0.74881	2.28	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.70227	0.94;0.968	D	0.98254	1.0495	10	0.87932	D	0	.	17.8574	0.88769	0.0:0.0:1.0:0.0	.	237;243	Q9Y261;B0ZTD4	FOXA2_HUMAN;.	S	237;237;243;123	ENSP00000366319:P237S;ENSP00000400341:P237S;ENSP00000315955:P243S	ENSP00000315955:P243S	P	-	1	0	FOXA2	22511153	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	9.688000	0.98670	2.304000	0.77564	0.574000	0.79327	CCT	.	.	.	none		0.652	FOXA2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078289.1		
ARFGEF2	10564	hgsc.bcm.edu	37	20	47648608	47648608	+	Missense_Mutation	SNP	T	T	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr20:47648608T>C	ENST00000371917.4	+	38	5086	c.5086T>C	c.(5086-5088)Tat>Cat	p.Y1696H		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1696					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AGCTCTTGCCTATTTCATCAC	0.398																																					p.Y1696H	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.T5086C						PASS	.						182.0	198.0	193.0					20																	47648608		2203	4300	6503	SO:0001583	missense	10564	exon38			CTTGCCTATTTCA	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.5086T>C	chr20.hg19:g.47648608T>C	ENSP00000360985:p.Tyr1696His	84.0	0.0	.		102.0	47.0	.	NM_006420	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	hg19	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.545282	0.86022	.	.	ENSG00000124198	ENST00000371917	T	0.67345	-0.26	5.93	5.93	0.95920	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80914	0.4715	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.78443	-0.2202	10	0.25751	T	0.34	.	16.3766	0.83401	0.0:0.0:0.0:1.0	.	1696	Q9Y6D5	BIG2_HUMAN	H	1696	ENSP00000360985:Y1696H	ENSP00000360985:Y1696H	Y	+	1	0	ARFGEF2	47082015	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	7.708000	0.84633	2.263000	0.75096	0.533000	0.62120	TAT	.	.	.	none		0.398	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
COL18A1	80781	hgsc.bcm.edu	37	21	46900748	46900748	+	Silent	SNP	T	T	C			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr21:46900748T>C	ENST00000359759.4	+	12	2853	c.2832T>C	c.(2830-2832)ggT>ggC	p.G944G	COL18A1_ENST00000400337.2_Silent_p.G529G|COL18A1_ENST00000355480.5_Silent_p.G709G			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	944	Triple-helical region 3 (COL3).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GGCGCGAGGGTCCCCCCGGGT	0.711																																					p.G709G		Atlas-SNP	.											.	COL18A1	129	.	0			c.T2127C						PASS	.						16.0	22.0	20.0					21																	46900748		1952	4118	6070	SO:0001819	synonymous_variant	80781	exon12			CGAGGGTCCCCCC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2832T>C	chr21.hg19:g.46900748T>C		111.0	0.0	.		78.0	36.0	.	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	ENST00000359759.4	hg19																																																																																				.	.	.	none		0.711	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
CHEK2	11200	hgsc.bcm.edu	37	22	29121248	29121248	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr22:29121248G>T	ENST00000405598.1	-	4	618	c.427C>A	c.(427-429)Cac>Aac	p.H143N	CHEK2_ENST00000382566.1_Missense_Mutation_p.H143N|CHEK2_ENST00000402731.1_Missense_Mutation_p.H143N|CHEK2_ENST00000382578.1_Intron|CHEK2_ENST00000328354.6_Missense_Mutation_p.H143N|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000544772.1_5'UTR|CHEK2_ENST00000404276.1_Missense_Mutation_p.H143N|CHEK2_ENST00000382580.2_Missense_Mutation_p.H186N|CHEK2_ENST00000403642.1_Intron|CHEK2_ENST00000348295.3_Missense_Mutation_p.H143N			O96017	CHK2_HUMAN	checkpoint kinase 2	143	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						ATCCGAAAGTGTTTCTTGCTG	0.378			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.H186N		Atlas-SNP	.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	.	CHEK2	438	.	0			c.C556A	GRCh37	CM077520	CHEK2	M		PASS	.						186.0	174.0	178.0					22																	29121248		2203	4300	6503	SO:0001583	missense	11200	exon4			GAAAGTGTTTCTT	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.427C>A	chr22.hg19:g.29121248G>T	ENSP00000386087:p.His143Asn	147.0	0.0	.		86.0	75.0	.	NM_001005735	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000405598.1	hg19	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327958	0.81690	.	.	ENSG00000183765	ENST00000348295;ENST00000382566;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000402731;ENST00000447421;ENST00000439200;ENST00000398017	D;D;D;D;D;D;D;D;D;D	0.99239	-5.61;-5.61;-5.61;-5.61;-5.61;-5.61;-5.61;-5.61;-5.61;-5.61	5.87	5.87	0.94306	Forkhead-associated (FHA) domain (4);SMAD/FHA domain (1);	0.000000	0.85682	D	0.000000	D	0.99722	0.9892	H	0.98629	4.285	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;0.998	D	0.97357	0.9967	10	0.87932	D	0	-12.4286	19.2001	0.93708	0.0:0.0:1.0:0.0	.	143;143;143;143;186	O96017-7;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;CHK2_HUMAN;.	N	143;143;143;143;143;186;143;143;174;153	ENSP00000329012:H143N;ENSP00000372007:H143N;ENSP00000329178:H143N;ENSP00000385747:H143N;ENSP00000386087:H143N;ENSP00000372023:H186N;ENSP00000384835:H143N;ENSP00000397478:H143N;ENSP00000408065:H174N;ENSP00000381099:H153N	ENSP00000329178:H143N	H	-	1	0	CHEK2	27451248	1.000000	0.71417	0.997000	0.53966	0.869000	0.49853	7.118000	0.77137	2.784000	0.95788	0.585000	0.79938	CAC	.	.	.	none		0.378	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
CSF2RB	1439	hgsc.bcm.edu	37	22	37331470	37331470	+	Missense_Mutation	SNP	A	A	G			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr22:37331470A>G	ENST00000403662.3	+	11	1615	c.1393A>G	c.(1393-1395)Atc>Gtc	p.I465V	CSF2RB_ENST00000406230.1_Missense_Mutation_p.I471V|CSF2RB_ENST00000262825.5_Missense_Mutation_p.I471V|CSF2RB_ENST00000536485.1_Missense_Mutation_p.I412V			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	465					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CTTCTGTGGCATCTACGGGTA	0.647																																					p.I465V		Atlas-SNP	.											.	CSF2RB	104	.	0			c.A1393G						PASS	.						115.0	89.0	98.0					22																	37331470		2203	4300	6503	SO:0001583	missense	1439	exon11			TGTGGCATCTACG	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.1393A>G	chr22.hg19:g.37331470A>G	ENSP00000384053:p.Ile465Val	64.0	0.0	.		61.0	53.0	.	NM_000395	Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	hg19	CCDS13936.1	.	.	.	.	.	.	.	.	.	.	A	6.866	0.529159	0.13127	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.91351	-2.32;-2.83;-2.83;-2.83	5.04	-8.6	0.00889	.	1.602080	0.03563	N	0.227412	T	0.74366	0.3707	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.09377	0.004;0.003	T	0.70019	-0.4987	10	0.02654	T	1	-3.7527	9.1387	0.36890	0.3465:0.1842:0.4693:0.0	.	471;465	P32927-2;P32927	.;IL3RB_HUMAN	V	465;465;471;471;412	ENSP00000384053:I465V;ENSP00000262825:I471V;ENSP00000385271:I471V;ENSP00000440003:I412V	ENSP00000262825:I471V	I	+	1	0	CSF2RB	35661416	0.000000	0.05858	0.000000	0.03702	0.995000	0.86356	-0.653000	0.05360	-2.157000	0.00789	0.454000	0.30748	ATC	.	.	.	none		0.647	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395	
RANGAP1	5905	hgsc.bcm.edu	37	22	41650402	41650402	+	Silent	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr22:41650402C>T	ENST00000455915.2	-	10	2639	c.1170G>A	c.(1168-1170)gaG>gaA	p.E390E	RANGAP1_ENST00000356244.3_Silent_p.E390E|RANGAP1_ENST00000407260.4_Silent_p.E335E|RANGAP1_ENST00000405486.1_Silent_p.E390E			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	390	Asp/Glu-rich (highly acidic).				mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)	p.E390E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						cctcctcctcctcttcttcct	0.562																																					p.E390E		Atlas-SNP	.											RANGAP1,NS,carcinoma,0,2	RANGAP1	47	.	1	Substitution - coding silent(1)	kidney(1)	c.G1170A						PASS	.						233.0	159.0	184.0					22																	41650402		2203	4300	6503	SO:0001819	synonymous_variant	5905	exon11			CTCCTCCTCTTCT	X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1170G>A	chr22.hg19:g.41650402C>T		45.0	0.0	.		47.0	5.0	.	NM_002883	Q96JJ2	Silent	SNP	ENST00000455915.2	hg19	CCDS14012.1																																																																																			.	.	.	none		0.562	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320606.1	NM_002883	
STAG2	10735	hgsc.bcm.edu	37	X	123205104	123205104	+	Nonsense_Mutation	SNP	C	C	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chrX:123205104C>T	ENST00000371160.1	+	25	2754	c.2464C>T	c.(2464-2466)Cag>Tag	p.Q822*	STAG2_ENST00000218089.9_Nonsense_Mutation_p.Q822*|STAG2_ENST00000371157.3_Nonsense_Mutation_p.Q822*|STAG2_ENST00000371144.3_Nonsense_Mutation_p.Q822*|STAG2_ENST00000371145.3_Nonsense_Mutation_p.Q822*|STAG2_ENST00000354548.5_Nonsense_Mutation_p.Q753*|STAG2_ENST00000469481.1_Intron	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	822					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TTCTTCATTGCAGTCTGAGTT	0.363																																					p.Q822X		Atlas-SNP	.											.	STAG2	309	.	0			c.C2464T						PASS	.						219.0	188.0	199.0					X																	123205104		2203	4300	6503	SO:0001587	stop_gained	10735	exon25			TCATTGCAGTCTG	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2464C>T	chrX.hg19:g.123205104C>T	ENSP00000360202:p.Gln822*	66.0	0.0	.		43.0	40.0	.	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Nonsense_Mutation	SNP	ENST00000371160.1	hg19	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	43	10.338955	0.99387	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-18.2766	18.3649	0.90388	0.0:1.0:0.0:0.0	.	.	.	.	X	822;753;822;822;822;822	.	ENSP00000218089:Q822X	Q	+	1	0	STAG2	123032785	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.818000	0.86416	2.278000	0.76064	0.538000	0.68166	CAG	.	.	.	none		0.363	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
UNC13D	201294	hgsc.bcm.edu	37	17	73832109	73832109	+	Frame_Shift_Del	DEL	C	C	-			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr17:73832109delC	ENST00000207549.4	-	17	1907	c.1528delG	c.(1528-1530)gacfs	p.D510fs	UNC13D_ENST00000412096.2_Frame_Shift_Del_p.D510fs	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	510	Interaction with RAB27A.				defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			AAGATCTTGTCCCATGTGCGC	0.617									Familial Hemophagocytic Lymphohistiocytosis																												p.D510fs		Atlas-Indel,Pindel	.											.	UNC13D	68	.	0			c.1529delA						PASS	.						153.0	148.0	150.0					17																	73832109		2203	4300	6503	SO:0001589	frameshift_variant	201294	exon17	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	.	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.1528delG	chr17.hg19:g.73832109delC	ENSP00000207549:p.Asp510fs	84.0	0.0	0		66.0	22.0	0.333333	NM_199242	B4DWG9|Q9H7K5	Frame_Shift_Del	DEL	ENST00000207549.4	hg19	CCDS11730.1																																																																																			.	.	.	none		0.617	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950	
ARMC3	219681	hgsc.bcm.edu	37	10	23287144	23287145	+	Frame_Shift_Ins	INS	-	-	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr10:23287144_23287145insT	ENST00000298032.5	+	11	1327_1328	c.1243_1244insT	c.(1243-1245)attfs	p.I415fs	ARMC3_ENST00000409049.3_Frame_Shift_Ins_p.I415fs|ARMC3_ENST00000376528.4_Frame_Shift_Ins_p.I152fs|ARMC3_ENST00000409983.3_Frame_Shift_Ins_p.I415fs|RNA5SP304_ENST00000411199.1_RNA	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	415						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AGATGGAGCCATTGCCAACGCT	0.46																																					p.I415fs		Atlas-Indel,Pindel	.											.	ARMC3	102	.	0			c.1243_1244insT						PASS	.																																			SO:0001589	frameshift_variant	219681	exon11			.	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1245dupT	chr10.hg19:g.23287146_23287146dupT	ENSP00000298032:p.Ile415fs	82.0	0.0	0		76.0	53.0	0.697368	NM_173081	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Frame_Shift_Ins	INS	ENST00000298032.5	hg19	CCDS7142.1																																																																																			.	.	.	none		0.460	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081	
PDPR	55066	hgsc.bcm.edu	37	16	70190605	70190606	+	Frame_Shift_Ins	INS	-	-	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr16:70190605_70190606insA	ENST00000288050.4	+	19	3420_3421	c.2463_2464insA	c.(2464-2466)gagfs	p.E822fs	PDPR_ENST00000542659.1_Frame_Shift_Ins_p.E167fs|PDPR_ENST00000398122.3_Frame_Shift_Ins_p.E722fs|RP11-296I10.3_ENST00000502126.1_RNA|RP11-296I10.3_ENST00000566989.1_RNA|PDPR_ENST00000562100.1_3'UTR|PDPR_ENST00000567046.1_Frame_Shift_Ins_p.E180fs|PDPR_ENST00000568530.1_Frame_Shift_Ins_p.E822fs	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	822					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		ACAATTTTTCTGAGGACACGGG	0.55																																					p.S821fs		Atlas-INDEL	.											.	PDPR	66	.	0			c.2463_2464insA						PASS	.																																			SO:0001589	frameshift_variant	55066	exon19			.		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		Exception_encountered	chr16.hg19:g.70190605_70190606insA	ENSP00000288050:p.Glu822fs	117.0	0.0	0		135.0	14.0	0.103704	NM_017990	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Frame_Shift_Ins	INS	ENST00000288050.4	hg19	CCDS45520.1																																																																																			.	.	.	none		0.550	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990	
DNAH10	196385	hgsc.bcm.edu	37	12	124323139	124323140	+	Frame_Shift_Ins	INS	-	-	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr12:124323139_124323140insA	ENST00000409039.3	+	28	4710_4711	c.4685_4686insA	c.(4684-4689)agaaatfs	p.N1563fs		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1563	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GATTCGAAGAGAAATGCTTTCC	0.515																																					p.R1562fs		Atlas-Indel,Pindel	.											DNAH10_same_name,NS,carcinoma,0,6	DNAH10	888	.	0			c.4685_4686insA						PASS	.																																			SO:0001589	frameshift_variant	196385	exon28			.	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.4688dupA	chr12.hg19:g.124323142_124323142dupA	ENSP00000386770:p.Asn1563fs	90.0	0.0	0		119.0	28.0	0.235294	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Frame_Shift_Ins	INS	ENST00000409039.3	hg19	CCDS9255.2																																																																																			.	.	.	none		0.515	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
TSC1	7248	hgsc.bcm.edu	37	9	135804182	135804183	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr9:135804182_135804183delTG	ENST00000298552.3	-	3	298_299	c.77_78delCA	c.(76-78)acafs	p.T26fs	TSC1_ENST00000475903.1_5'UTR|TSC1_ENST00000403810.1_Frame_Shift_Del_p.T26fs|TSC1_ENST00000545250.1_Frame_Shift_Del_p.T26fs|TSC1_ENST00000440111.2_Frame_Shift_Del_p.T26fs	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	26					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)			NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TAAAGACAGCTGTCACGTCGTC	0.475			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.26_27del		Atlas-Indel,Pindel	.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	167	.	0			c.78_79del						PASS	.																																			SO:0001589	frameshift_variant	7248	exon3	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	.	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.77_78delCA	chr9.hg19:g.135804182_135804183delTG	ENSP00000298552:p.Thr26fs	50.0	0.0	0		39.0	15.0	0.384615	NM_000368	B7Z897|Q5VVN5	Frame_Shift_Del	DEL	ENST00000298552.3	hg19	CCDS6956.1																																																																																			.	.	.	none		0.475	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
ZNF841	284371	hgsc.bcm.edu	37	19	52570490	52570491	+	Frame_Shift_Ins	INS	-	-	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr19:52570490_52570491insT	ENST00000426391.2	-	5	847_848	c.296_297insA	c.(295-297)aatfs	p.N99fs	ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000594295.1_Frame_Shift_Ins_p.N215fs|ZNF841_ENST00000389534.4_Frame_Shift_Ins_p.N215fs|ZNF841_ENST00000359973.2_Frame_Shift_Ins_p.N99fs			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	99					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						AAAAACAATTATTAACTGTCCT	0.337																																					p.N215fs		Atlas-Indel,Pindel	.											.	ZNF841	183	.	0			c.645_646insA						PASS	.																																			SO:0001589	frameshift_variant	284371	exon7			.	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.297dupA	chr19.hg19:g.52570492_52570492dupT	ENSP00000415453:p.Asn99fs	69.0	0.0	0		89.0	27.0	0.303371	NM_001136499	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Frame_Shift_Ins	INS	ENST00000426391.2	hg19																																																																																				.	.	.	none		0.337	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	
HSP90AA1	3320	hgsc.bcm.edu	37	14	102551272	102551273	+	Frame_Shift_Ins	INS	-	-	TTCT			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr14:102551272_102551273insTTCT	ENST00000216281.8	-	5	931_932	c.726_727insAGAA	c.(724-729)gaagaafs	p.E243fs	HSP90AA1_ENST00000441629.2_Frame_Shift_Ins_p.E64fs|HSP90AA1_ENST00000334701.7_Frame_Shift_Ins_p.E365fs	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	243					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	tctttttcttcttctttgtctt	0.386																																					p.E365fs		Atlas-Indel,Pindel	.											.	HSP90AA1	65	.	0			c.1093_1094insAGAA						PASS	.																																			SO:0001589	frameshift_variant	3320	exon6			.	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.727_730dupAGAA	chr14.hg19:g.102551273_102551276dupTTCT	ENSP00000216281:p.Glu243fs	148.0	0.0	0		158.0	30.0	0.189873	NM_001017963	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Frame_Shift_Ins	INS	ENST00000216281.8	hg19	CCDS9967.1																																																																																			.	.	.	none		0.386	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348	
ZFHX4	79776	hgsc.bcm.edu	37	8	77776566	77776571	+	In_Frame_Del	DEL	CTTCTC	CTTCTC	-			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	CTTCTC	CTTCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr8:77776566_77776571delCTTCTC	ENST00000521891.2	+	11	11064_11069	c.10616_10621delCTTCTC	c.(10615-10623)gcttctccc>gcc	p.SP3540del	ZFHX4_ENST00000518282.1_In_Frame_Del_p.SP3514del|ZFHX4_ENST00000050961.6_In_Frame_Del_p.SP3491del|ZFHX4_ENST00000455469.2_In_Frame_Del_p.SP3495del	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3491					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGGAGAGCTGCTTCTCCCCCTTCTTC	0.49										HNSCC(33;0.089)																											p.3539_3540del		Atlas-Indel,Pindel	.											ZFHX4,NS,carcinoma,0,1	ZFHX4	878	.	0			c.10615_10620del						PASS	.																																			SO:0001651	inframe_deletion	79776	exon11			.		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10616_10621delCTTCTC	chr8.hg19:g.77776566_77776571delCTTCTC	ENSP00000430497:p.Ser3540_Pro3541del	121.0	0.0	0		146.0	74.0	0.506849	NM_024721	G3V138|Q18PS0|Q6ZN20	In_Frame_Del	DEL	ENST00000521891.2	hg19	CCDS47878.2																																																																																			.	.	.	none		0.490	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
LUC7L3	51747	hgsc.bcm.edu	37	17	48827997	48827998	+	Frame_Shift_Ins	INS	-	-	T			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr17:48827997_48827998insT	ENST00000505658.1	+	10	1463_1464	c.1274_1275insT	c.(1273-1278)tctgaafs	p.E426fs	LUC7L3_ENST00000240304.1_Frame_Shift_Ins_p.E426fs|LUC7L3_ENST00000393227.2_Frame_Shift_Ins_p.E426fs|LUC7L3_ENST00000544170.1_Frame_Shift_Ins_p.E350fs			O95232	LC7L3_HUMAN	LUC7-like 3 (S. cerevisiae)	426					mRNA splice site selection (GO:0006376)|RNA splicing (GO:0008380)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U1 snRNP (GO:0005685)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	12						GACATTAAATCTGAAGGTGACA	0.396																																					p.S425fs		Atlas-Indel,Pindel	.											.	LUC7L3	32	.	0			c.1274_1275insT						PASS	.																																			SO:0001589	frameshift_variant	51747	exon10			.		CCDS11573.1	17q21.33	2010-02-17			ENSG00000108848	ENSG00000108848			24309	protein-coding gene	gene with protein product	"""cisplatin resistance associated overexpressed protein"", ""CRE-associated protein"""	609434				10631324, 12565863	Standard	NM_016424		Approved	LUC7A, CROP, OA48-18, CREAP-1, FLJ11063, CRA, hLuc7A	uc002iss.3	O95232	OTTHUMG00000162257	ENST00000505658.1:c.1275dupT	chr17.hg19:g.48827998_48827998dupT	ENSP00000425092:p.Glu426fs	296.0	0.0	0		297.0	93.0	0.313131	NM_006107	B3KN54|D3DTY1|Q6PHR9|Q9NUY0|Q9P2S7	Frame_Shift_Ins	INS	ENST00000505658.1	hg19	CCDS11573.1																																																																																			.	.	.	none		0.396	LUC7L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368205.2	NM_016424	
RAB26	25837	hgsc.bcm.edu	37	16	2203146	2203146	+	Splice_Site	DEL	G	G	-			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr16:2203146delG	ENST00000210187.6	+	8	751		c.e8-1		RAB26_ENST00000541451.1_Splice_Site|TRAF7_ENST00000326181.6_5'Flank|SNORD60_ENST00000383903.1_RNA|RP11-304L19.5_ENST00000563192.1_lincRNA	NM_014353.4	NP_055168.2	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family						exocrine system development (GO:0035272)|Golgi to plasma membrane protein transport (GO:0043001)|regulated secretory pathway (GO:0045055)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	Golgi membrane (GO:0000139)|intrinsic component of plasma membrane (GO:0031226)|secretory granule membrane (GO:0030667)	GMP binding (GO:0019002)|GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(3)	5						GCTGTTTACAGGAGTATGGAC	0.637																																					.		Atlas-Indel,Pindel	.											.	RAB26	9	.	0			c.592-2G>-						PASS	.						58.0	56.0	56.0					16																	2203146		2197	4300	6497	SO:0001630	splice_region_variant	25837	exon8			.	AB027137	CCDS10460.1	16p13.3	2008-07-28			ENSG00000167964	ENSG00000167964		"""RAB, member RAS oncogene"""	14259	protein-coding gene	gene with protein product		605455				11043516	Standard	NM_014353		Approved		uc002cou.3	Q9ULW5	OTTHUMG00000128829	ENST00000210187.6:c.592-1G>-	chr16.hg19:g.2203146delG		144.0	0.0	0		117.0	34.0	0.290598	NM_014353	B2RAA6|Q3L6K5|Q6NXS7	Splice_Site	DEL	ENST00000210187.6	hg19	CCDS10460.1																																																																																			.	.	.	none		0.637	RAB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250767.2		Intron
KLF6	1316	hgsc.bcm.edu	37	10	3824256	3824257	+	Frame_Shift_Ins	INS	-	-	A			TCGA-4A-A93X-01A-11D-A36X-10	TCGA-4A-A93X-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ecd194d-3286-4363-9701-6427c66e103c	581486c1-6d50-4794-a2c8-693606b711ff	g.chr10:3824256_3824257insA	ENST00000497571.1	-	2	512_513	c.252_253insT	c.(250-255)agtcctfs	p.P85fs	KLF6_ENST00000542957.1_Frame_Shift_Ins_p.P85fs|KLF6_ENST00000173785.4_5'Flank|KLF6_ENST00000469435.1_Frame_Shift_Ins_p.P85fs	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	85					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		TCCTCTGGAGGACTGGAAGATA	0.485											OREG0019980	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P85fs		Pindel	.											.	KLF6	38	.	0			c.253_254insT						PASS	.																																			SO:0001589	frameshift_variant	1316	exon2			.	U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.253dupT	chr10.hg19:g.3824257_3824257dupA	ENSP00000419923:p.Pro85fs	84.0	0.0	.	614	99.0	35.0	0.354	NM_001300	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Frame_Shift_Ins	INS	ENST00000497571.1	hg19	CCDS7060.1																																																																																			.	.	.	none		0.485	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046495.1		
