#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARHGEF19	128272	hgsc.bcm.edu	37	1	16532674	16532674	+	Splice_Site	SNP	C	C	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr1:16532674C>T	ENST00000270747.3	-	7	1435		c.e7+1		ARHGEF19_ENST00000478117.1_Splice_Site	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19						regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		CACTTCTTCACCTCTCGCTGG	0.632																																					.		Atlas-SNP	.											.	ARHGEF19	49	.	0			c.1298+1G>A						PASS	.						42.0	36.0	38.0					1																	16532674		2203	4300	6503	SO:0001630	splice_region_variant	128272	exon8			TCTTCACCTCTCG	BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.1298+1G>A	chr1.hg19:g.16532674C>T		111.0	0.0	.		108.0	7.0	.	NM_153213	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Splice_Site	SNP	ENST00000270747.3	hg19	CCDS170.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.052337	0.75960	.	.	ENSG00000142632	ENST00000270747;ENST00000421561;ENST00000375607;ENST00000449495;ENST00000441785	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5392	0.76027	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARHGEF19	16405261	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	6.992000	0.76238	2.274000	0.75844	0.555000	0.69702	.	.	.	.	none		0.632	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006289.1	NM_153213	Intron
OLFML2B	25903	hgsc.bcm.edu	37	1	161953624	161953624	+	Nonsense_Mutation	SNP	G	G	T	rs150437510	byFrequency	TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr1:161953624G>T	ENST00000294794.3	-	8	2517	c.2094C>A	c.(2092-2094)taC>taA	p.Y698*	OLFML2B_ENST00000367940.2_Nonsense_Mutation_p.Y699*|OLFML2B_ENST00000367938.1_Nonsense_Mutation_p.Y181*	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	698	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TGTCGAAAGCGTAGGAGATGT	0.552																																					p.Y698X		Atlas-SNP	.											.	OLFML2B	114	.	0			c.C2094A						PASS	.						374.0	346.0	355.0					1																	161953624		2203	4300	6503	SO:0001587	stop_gained	25903	exon8			GAAAGCGTAGGAG	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.2094C>A	chr1.hg19:g.161953624G>T	ENSP00000294794:p.Tyr698*	200.0	0.0	.		197.0	13.0	.	NM_015441	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Nonsense_Mutation	SNP	ENST00000294794.3	hg19	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	G	39	7.778900	0.98486	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	.	.	.	5.36	-2.37	0.06643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5642	0.50796	0.6966:0.0:0.3034:0.0	.	.	.	.	X	698;699;181	.	ENSP00000294794:Y698X	Y	-	3	2	OLFML2B	160220248	0.002000	0.14202	0.992000	0.48379	0.968000	0.65278	-1.217000	0.02979	-0.315000	0.08703	-0.224000	0.12420	TAC	.	G|1.000;A|0.000	.	alt		0.552	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
MPC2	25874	hgsc.bcm.edu	37	1	167893755	167893755	+	Missense_Mutation	SNP	A	A	G			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr1:167893755A>G	ENST00000367846.4	-	2	328	c.130T>C	c.(130-132)Tgg>Cgg	p.W44R	MPC2_ENST00000271373.4_Missense_Mutation_p.W44R	NM_015415.3	NP_056230.1	O95563	MPC2_HUMAN	mitochondrial pyruvate carrier 2	44					cellular metabolic process (GO:0044237)|mitochondrial pyruvate transport (GO:0006850)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate transmembrane transporter activity (GO:0050833)										ATTGGAGCCCAGAAGAAAACT	0.303																																					p.W44R		Atlas-SNP	.											.	.	.	.	0			c.T130C						PASS	.						18.0	19.0	19.0					1																	167893755		2201	4288	6489	SO:0001583	missense	25874	exon3			GAGCCCAGAAGAA		CCDS1266.1	1q24	2012-07-30	2012-07-30	2012-07-30	ENSG00000143158	ENSG00000143158			24515	protein-coding gene	gene with protein product		614737	"""brain protein 44"""	BRP44		3022128, 22628558	Standard	NM_015415		Approved	DKFZP564B167	uc001get.3	O95563	OTTHUMG00000034570	ENST00000367846.4:c.130T>C	chr1.hg19:g.167893755A>G	ENSP00000356820:p.Trp44Arg	552.0	0.0	.		550.0	24.0	.	NM_001143674	A8K261|Q3SXR6|Q6FIF3	Missense_Mutation	SNP	ENST00000367846.4	hg19	CCDS1266.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.298760	0.81025	.	.	ENSG00000143158	ENST00000367846;ENST00000271373;ENST00000458574	D;D;D	0.87179	-2.22;-2.22;-2.22	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.95182	0.8438	H	0.96833	3.89	0.52099	D	0.999940	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96493	0.9365	9	0.72032	D	0.01	-14.2049	13.8186	0.63308	1.0:0.0:0.0:0.0	.	44;44	B2R4Q7;O95563	.;BR44_HUMAN	R	44	ENSP00000356820:W44R;ENSP00000271373:W44R;ENSP00000392874:W44R	ENSP00000271373:W44R	W	-	1	0	BRP44	166160379	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.363000	0.79516	2.311000	0.77944	0.533000	0.62120	TGG	.	.	.	none		0.303	MPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083652.1	NM_015415	
ZNF142	7701	hgsc.bcm.edu	37	2	219508733	219508733	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr2:219508733A>T	ENST00000449707.1	-	8	2927	c.2506T>A	c.(2506-2508)Ttc>Atc	p.F836I	ZNF142_ENST00000411696.2_Missense_Mutation_p.F836I	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	836					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGGCAGCGGAAGGCTCGCCCC	0.612																																					p.F836I	Colon(170;867 1942 8995 15834 18053)	Atlas-SNP	.											.	ZNF142	190	.	0			c.T2506A						PASS	.						152.0	161.0	158.0					2																	219508733		2079	4197	6276	SO:0001583	missense	7701	exon8			AGCGGAAGGCTCG	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.2506T>A	chr2.hg19:g.219508733A>T	ENSP00000408643:p.Phe836Ile	159.0	0.0	.		126.0	10.0	.	NM_001105537	Q92510	Missense_Mutation	SNP	ENST00000449707.1	hg19	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	A	19.54	3.846106	0.71603	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.34667	1.35;1.35	5.22	5.22	0.72569	Zinc finger, C2H2-like (1);	0.119890	0.64402	D	0.000014	T	0.66005	0.2746	M	0.88640	2.97	0.35186	D	0.772903	D;D	0.69078	0.997;0.997	D;D	0.80764	0.994;0.994	T	0.79911	-0.1603	10	0.72032	D	0.01	-4.589	15.2696	0.73689	1.0:0.0:0.0:0.0	.	836;673	P52746;A8MWU9	ZN142_HUMAN;.	I	836	ENSP00000408643:F836I;ENSP00000398798:F836I	ENSP00000398798:F836I	F	-	1	0	ZNF142	219216977	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	4.295000	0.59049	2.196000	0.70406	0.533000	0.62120	TTC	.	.	.	none		0.612	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
C3orf80	401097	hgsc.bcm.edu	37	3	159943902	159943902	+	Silent	SNP	T	T	C	rs546861198	byFrequency	TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr3:159943902T>C	ENST00000326474.3	+	1	480	c.480T>C	c.(478-480)agT>agC	p.S160S	IL12A-AS1_ENST00000486168.1_RNA|RP11-431I8.1_ENST00000490320.1_RNA	NM_001168214.1	NP_001161686.1	F5H4A9	CC080_HUMAN	chromosome 3 open reading frame 80	160						integral component of membrane (GO:0016021)											TGCTGGACAGTggcggcggcg	0.761													T|||	37	0.00738818	0.028	0.0	5008	,	,		8463	0.0		0.0	False		,,,				2504	0.0				p.S160S		Atlas-SNP	.											.	C3orf80	1	.	0			c.T480C						PASS	.						2.0	4.0	3.0					3																	159943902		375	1046	1421	SO:0001819	synonymous_variant	401097	exon1			GGACAGTGGCGGC		CCDS54667.1	3q25.33	2011-08-15			ENSG00000180044	ENSG00000180044			40048	protein-coding gene	gene with protein product							Standard	NM_001168214		Approved		uc021xgp.1	F5H4A9		ENST00000326474.3:c.480T>C	chr3.hg19:g.159943902T>C		0.0	0.0	.		6.0	5.0	.	NM_001168214	Q8N5S4	Silent	SNP	ENST00000326474.3	hg19	CCDS54667.1																																																																																			.	.	.	none		0.761	C3orf80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CXXC4	80319	hgsc.bcm.edu	37	4	105412357	105412357	+	Silent	SNP	T	T	C			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr4:105412357T>C	ENST00000426831.1	-	1	110	c.96A>G	c.(94-96)ttA>ttG	p.L32L	CXXC4_ENST00000394767.2_Silent_p.L201L|AC004053.1_ENST00000500179.1_RNA|AC093628.1_ENST00000606234.1_RNA|CXXC4_ENST00000466963.1_Intron			Q9H2H0	CXXC4_HUMAN	CXXC finger protein 4	32					negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)	DNA binding (GO:0003677)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		GTTCAGGGGATAAGGTGGAGA	0.567																																					p.L201L		Atlas-SNP	.											.	CXXC4	20	.	0			c.A603G						PASS	.						139.0	153.0	148.0					4																	105412357		2203	4300	6503	SO:0001819	synonymous_variant	80319	exon2			AGGGGATAAGGTG		CCDS3665.1, CCDS3665.2	4q22-q24	2014-02-18	2011-12-01		ENSG00000168772	ENSG00000168772			24593	protein-coding gene	gene with protein product	"""Dvl-binding protein IDAX (inhibition of the Dvl and Axin complex)"""	611645				11113207	Standard	NM_025212		Approved	IDAX	uc003hxf.2	Q9H2H0	OTTHUMG00000131121	ENST00000426831.1:c.96A>G	chr4.hg19:g.105412357T>C		78.0	0.0	.		90.0	7.0	.	NM_025212		Silent	SNP	ENST00000426831.1	hg19																																																																																				.	.	.	none		0.567	CXXC4-201	KNOWN	basic	protein_coding	protein_coding		NM_025212	
RUNX2	860	hgsc.bcm.edu	37	6	45390445	45390445	+	Silent	SNP	A	A	G	rs563987595	byFrequency	TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr6:45390445A>G	ENST00000371438.1	+	2	532	c.174A>G	c.(172-174)caA>caG	p.Q58Q	RUNX2_ENST00000352853.5_Silent_p.Q126Q|RUNX2_ENST00000359524.5_Silent_p.Q44Q|RUNX2_ENST00000465038.2_Silent_p.Q58Q|RUNX2_ENST00000371436.6_Silent_p.Q58Q|RUNX2_ENST00000576263.1_Silent_p.Q58Q|RUNX2_ENST00000541979.1_Silent_p.Q126Q|RUNX2_ENST00000371432.3_Silent_p.Q44Q|RP1-244F24.1_ENST00000606796.1_RNA	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	58	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcaacagcagcagc	0.731													A|||	6	0.00119808	0.0015	0.0	5008	,	,		8050	0.002		0.0	False		,,,				2504	0.002				p.Q58Q		Atlas-SNP	.											RUNX2_ENST00000352853,lower_third,carcinoma,0,2	RUNX2	128	.	0			c.A174G						PASS	.						16.0	24.0	21.0					6																	45390445		1589	3298	4887	SO:0001819	synonymous_variant	860	exon3			GCAGCAACAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.174A>G	chr6.hg19:g.45390445A>G		79.0	0.0	.		65.0	3.0	.	NM_001024630	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	hg19	CCDS43467.2																																																																																			.	.	.	none		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
GPR126	57211	hgsc.bcm.edu	37	6	142714109	142714109	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr6:142714109A>T	ENST00000230173.6	+	8	1809	c.1333A>T	c.(1333-1335)Aac>Tac	p.N445Y	GPR126_ENST00000367609.3_Missense_Mutation_p.N445Y|GPR126_ENST00000367608.2_Missense_Mutation_p.N417Y|GPR126_ENST00000296932.8_Missense_Mutation_p.N417Y	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	445					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CCAAAATTGGAACTACACGGT	0.294																																					p.N445Y		Atlas-SNP	.											.	GPR126	192	.	0			c.A1333T						PASS	.						77.0	73.0	75.0					6																	142714109		1808	4068	5876	SO:0001583	missense	57211	exon8			AATTGGAACTACA	AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.1333A>T	chr6.hg19:g.142714109A>T	ENSP00000230173:p.Asn445Tyr	149.0	0.0	.		139.0	8.0	.	NM_198569	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	ENST00000230173.6	hg19	CCDS47490.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.125589	0.77436	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000002	T	0.53916	0.1826	L	0.55481	1.735	0.41315	D	0.98713	D;D;D;D	0.62365	0.991;0.991;0.991;0.984	P;P;P;P	0.62560	0.904;0.904;0.904;0.804	T	0.58880	-0.7558	10	0.66056	D	0.02	.	15.9301	0.79651	1.0:0.0:0.0:0.0	.	417;445;417;445	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;GP126_HUMAN	Y	445;417;417;445	ENSP00000230173:N445Y;ENSP00000356580:N417Y;ENSP00000296932:N417Y;ENSP00000356581:N445Y	ENSP00000230173:N445Y	N	+	1	0	GPR126	142755802	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	6.462000	0.73526	2.165000	0.68154	0.528000	0.53228	AAC	.	.	.	none		0.294	GPR126-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042487.2		
SP4	6671	hgsc.bcm.edu	37	7	21468306	21468306	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr7:21468306G>A	ENST00000222584.3	+	2	237	c.19G>A	c.(19-21)Gag>Aag	p.E7K		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	7	Poly-Glu.				regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TCAGAAGAAGGAGGAGGAGGA	0.512																																					p.E7K		Atlas-SNP	.											SP4,colon,carcinoma,0,1	SP4	91	.	0			c.G19A						PASS	.						20.0	20.0	20.0					7																	21468306		2171	4251	6422	SO:0001583	missense	6671	exon2			AAGAAGGAGGAGG		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.19G>A	chr7.hg19:g.21468306G>A	ENSP00000222584:p.Glu7Lys	105.0	1.0	.		143.0	6.0	.	NM_003112	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	hg19	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318989	0.41096	.	.	ENSG00000105866	ENST00000222584;ENST00000446800	T	0.09911	2.93	4.5	4.5	0.54988	.	0.061123	0.64402	N	0.000005	T	0.10937	0.0267	L	0.36672	1.1	0.44142	D	0.996934	P	0.34587	0.458	B	0.39152	0.292	T	0.20907	-1.0261	10	0.23891	T	0.37	.	12.5742	0.56355	0.0:0.0:1.0:0.0	.	7	Q02446	SP4_HUMAN	K	7	ENSP00000222584:E7K	ENSP00000222584:E7K	E	+	1	0	SP4	21434831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.555000	0.73928	2.345000	0.79718	0.563000	0.77884	GAG	.	.	.	none		0.512	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
PLXNA4	91584	hgsc.bcm.edu	37	7	131859623	131859623	+	Missense_Mutation	SNP	C	C	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr7:131859623C>T	ENST00000359827.3	-	21	4893	c.3931G>A	c.(3931-3933)Ggg>Agg	p.G1311R	PLXNA4_ENST00000321063.4_Missense_Mutation_p.G1311R			Q9HCM2	PLXA4_HUMAN	plexin A4	1311					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AACGGAATCCCGGCTCCATCC	0.582																																					p.G1311R		Atlas-SNP	.											.	PLXNA4	873	.	0			c.G3931A						PASS	.						104.0	114.0	111.0					7																	131859623		2166	4295	6461	SO:0001583	missense	91584	exon21			GAATCCCGGCTCC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.3931G>A	chr7.hg19:g.131859623C>T	ENSP00000352882:p.Gly1311Arg	94.0	0.0	.		100.0	7.0	.	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	34	5.369032	0.95900	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.15603	2.41;2.41	5.59	5.59	0.84812	Plexin, cytoplasmic RasGAP domain (1);	0.000000	0.85682	D	0.000000	T	0.44414	0.1292	M	0.72624	2.21	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.27502	-1.0072	10	0.59425	D	0.04	.	19.5911	0.95511	0.0:1.0:0.0:0.0	.	1311	Q9HCM2	PLXA4_HUMAN	R	1311	ENSP00000323194:G1311R;ENSP00000352882:G1311R	ENSP00000323194:G1311R	G	-	1	0	PLXNA4	131510163	1.000000	0.71417	0.999000	0.59377	0.954000	0.61252	7.792000	0.85828	2.643000	0.89663	0.655000	0.94253	GGG	.	.	.	none		0.582	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
CNTLN	54875	hgsc.bcm.edu	37	9	17330790	17330790	+	Missense_Mutation	SNP	C	C	A			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr9:17330790C>A	ENST00000380647.3	+	9	1586	c.1502C>A	c.(1501-1503)gCt>gAt	p.A501D	CNTLN_ENST00000262360.5_Missense_Mutation_p.A501D|CNTLN_ENST00000425824.1_Missense_Mutation_p.A501D			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	501					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		ATGACAAGTGCTGAAGGAAAA	0.373																																					p.A501D		Atlas-SNP	.											.	CNTLN	128	.	0			c.C1502A						PASS	.						105.0	99.0	101.0					9																	17330790		1877	4098	5975	SO:0001583	missense	54875	exon9			CAAGTGCTGAAGG	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.1502C>A	chr9.hg19:g.17330790C>A	ENSP00000370021:p.Ala501Asp	384.0	0.0	.		367.0	16.0	.	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	hg19	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.327537	0.24080	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.37752	1.18;1.18;1.18	5.18	4.28	0.50868	.	.	.	.	.	T	0.36468	0.0968	L	0.43152	1.355	0.27282	N	0.958076	B;P;P	0.36837	0.435;0.571;0.571	B;P;P	0.45232	0.154;0.474;0.474	T	0.17048	-1.0382	9	0.14656	T	0.56	.	11.2195	0.48846	0.0:0.8015:0.1273:0.0711	.	501;501;501	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	D	501	ENSP00000370021:A501D;ENSP00000392798:A501D;ENSP00000262360:A501D	ENSP00000262360:A501D	A	+	2	0	CNTLN	17320790	0.179000	0.23135	0.745000	0.31077	0.551000	0.35334	0.445000	0.21677	1.303000	0.44873	-0.157000	0.13467	GCT	.	.	.	none		0.373	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
OR6Q1	219952	hgsc.bcm.edu	37	11	57798465	57798465	+	Missense_Mutation	SNP	T	T	A			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr11:57798465T>A	ENST00000302622.3	+	1	64	c.41T>A	c.(40-42)tTt>tAt	p.F14Y	OR9Q1_ENST00000335397.3_Intron	NM_001005186.2	NP_001005186.2	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q, member 1	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			biliary_tract(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(21;0.0707)|all_epithelial(135;0.142)				GTAACTGAATTTGTCATGATG	0.458																																					p.F14Y		Atlas-SNP	.											.	OR6Q1	58	.	0			c.T41A						PASS	.						200.0	191.0	194.0					11																	57798465		2201	4296	6497	SO:0001583	missense	219952	exon1			CTGAATTTGTCAT	AB065737	CCDS31541.1	11q12.1	2012-08-09			ENSG00000172381	ENSG00000172381		"""GPCR / Class A : Olfactory receptors"""	15302	protein-coding gene	gene with protein product							Standard	NM_001005186		Approved		uc010rjz.2	Q8NGQ2	OTTHUMG00000168831	ENST00000302622.3:c.41T>A	chr11.hg19:g.57798465T>A	ENSP00000307734:p.Phe14Tyr	127.0	0.0	.		145.0	14.0	.	NM_001005186	B9EKW1|Q6IFH1|Q96R34	Missense_Mutation	SNP	ENST00000302622.3	hg19	CCDS31541.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.276285	0.80580	.	.	ENSG00000172381	ENST00000302622	T	0.04360	3.64	5.32	5.32	0.75619	.	0.000000	0.37219	N	0.002183	T	0.30135	0.0755	M	0.93283	3.4	0.31808	N	0.62755	D	0.89917	1.0	D	0.87578	0.998	T	0.54892	-0.8225	10	0.72032	D	0.01	.	14.2577	0.66062	0.0:0.0:0.0:1.0	.	14	Q8NGQ2	OR6Q1_HUMAN	Y	14	ENSP00000307734:F14Y	ENSP00000307734:F14Y	F	+	2	0	OR6Q1	57555041	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.294000	0.65687	2.008000	0.58898	0.523000	0.50628	TTT	.	.	.	none		0.458	OR6Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401257.1	NM_001005186	
FIGNL2	401720	hgsc.bcm.edu	37	12	52215801	52215801	+	lincRNA	SNP	G	G	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr12:52215801G>T	ENST00000562343.2	+	0	4188				RP11-923I11.4_ENST00000567167.1_lincRNA																							GCTAAAACTGGGGAGCCCCCC	0.731																																					p.P133T		Atlas-SNP	.											.	.	.	.	0			c.C397A						PASS	.						5.0	6.0	6.0					12																	52215801		1664	3789	5453			401720	exon2			AAACTGGGGAGCC																													chr12.hg19:g.52215801G>T		164.0	0.0	.		140.0	12.0	.	NM_001013690		Missense_Mutation	SNP	ENST00000562343.2	hg19																																																																																				.	.	.	none		0.731	RP11-923I11.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000430848.2		
LRP1	4035	hgsc.bcm.edu	37	12	57589521	57589521	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr12:57589521G>T	ENST00000243077.3	+	53	8984	c.8518G>T	c.(8518-8520)Gac>Tac	p.D2840Y	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2840	LDL-receptor class A 18. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GTGTGACCACGACCGTGACTG	0.622																																					p.D2840Y		Atlas-SNP	.											.	LRP1	428	.	0			c.G8518T						PASS	.						140.0	126.0	130.0					12																	57589521		2203	4300	6503	SO:0001583	missense	4035	exon53			GACCACGACCGTG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.8518G>T	chr12.hg19:g.57589521G>T	ENSP00000243077:p.Asp2840Tyr	119.0	0.0	.		120.0	10.0	.	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	hg19	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446589	0.63178	.	.	ENSG00000123384	ENST00000243077	D	0.95690	-3.78	4.95	4.95	0.65309	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97455	0.9167	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98001	1.0360	10	0.72032	D	0.01	.	17.1132	0.86681	0.0:0.0:1.0:0.0	.	2840	Q07954	LRP1_HUMAN	Y	2840	ENSP00000243077:D2840Y	ENSP00000243077:D2840Y	D	+	1	0	LRP1	55875788	1.000000	0.71417	0.995000	0.50966	0.728000	0.41692	6.544000	0.73878	2.562000	0.86427	0.561000	0.74099	GAC	.	.	.	none		0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LTK	4058	hgsc.bcm.edu	37	15	41797955	41797955	+	Silent	SNP	C	C	T	rs375203744		TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr15:41797955C>T	ENST00000263800.6	-	13	1749	c.1653G>A	c.(1651-1653)tcG>tcA	p.S551S	LTK_ENST00000453182.2_Silent_p.S421S|LTK_ENST00000355166.5_Silent_p.S490S|LTK_ENST00000561619.1_Silent_p.S249S	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	551	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CATCCTGAGGCGAGCAGAGTT	0.607										TSP Lung(18;0.14)																											p.S551S		Atlas-SNP	.											.	LTK	117	.	0			c.G1653A						PASS	.																																			SO:0001819	synonymous_variant	4058	exon13			CTGAGGCGAGCAG	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1653G>A	chr15.hg19:g.41797955C>T		250.0	0.0	.		264.0	12.0	.	NM_002344	A6NNJ8|B4DL89|E9PFX4	Silent	SNP	ENST00000263800.6	hg19	CCDS10077.1																																																																																			.	.	.	weak		0.607	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		
CREBBP	1387	hgsc.bcm.edu	37	16	3786685	3786685	+	Missense_Mutation	SNP	T	T	C			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr16:3786685T>C	ENST00000262367.5	-	27	5335	c.4526A>G	c.(4525-4527)aAg>aGg	p.K1509R	CREBBP_ENST00000382070.3_Missense_Mutation_p.K1471R	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1509	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGCAAACGCCTTGTCCAGCAT	0.488			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.K1509R		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.A4526G						PASS	.						304.0	255.0	272.0					16																	3786685		2197	4300	6497	SO:0001583	missense	1387	exon27			AACGCCTTGTCCA	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4526A>G	chr16.hg19:g.3786685T>C	ENSP00000262367:p.Lys1509Arg	156.0	0.0	.		111.0	5.0	.	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	hg19	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	t	21.9	4.214104	0.79352	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.93906	-3.31;-3.31	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.96651	0.8907	M	0.82517	2.595	0.80722	D	1	D;D	0.56035	0.974;0.974	D;D	0.75484	0.986;0.986	D	0.97056	0.9767	10	0.62326	D	0.03	-26.9444	14.6308	0.68655	0.0:0.0:0.0:1.0	.	1539;1509	Q4LE28;Q92793	.;CBP_HUMAN	R	1509;1539;1471;98	ENSP00000262367:K1509R;ENSP00000371502:K1471R	ENSP00000262367:K1509R	K	-	2	0	CREBBP	3726686	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.774000	0.85478	2.107000	0.64212	0.459000	0.35465	AAG	.	.	.	none		0.488	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
CACNG3	10368	hgsc.bcm.edu	37	16	24358125	24358125	+	Silent	SNP	C	C	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr16:24358125C>T	ENST00000005284.3	+	2	1484	c.282C>T	c.(280-282)gcC>gcT	p.A94A		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	94					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		AGGACACAGCCGAATATCTCC	0.557																																					p.A94A		Atlas-SNP	.											.	CACNG3	112	.	0			c.C282T						PASS	.						79.0	71.0	74.0					16																	24358125		2197	4300	6497	SO:0001819	synonymous_variant	10368	exon2			CACAGCCGAATAT	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.282C>T	chr16.hg19:g.24358125C>T		80.0	0.0	.		96.0	7.0	.	NM_006539		Silent	SNP	ENST00000005284.3	hg19	CCDS10620.1																																																																																			.	.	.	none		0.557	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	
DHX38	9785	hgsc.bcm.edu	37	16	72133644	72133644	+	Missense_Mutation	SNP	A	A	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr16:72133644A>T	ENST00000268482.3	+	8	1483	c.974A>T	c.(973-975)gAt>gTt	p.D325V	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	325					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				GCCGATCGGGATTGGTACATG	0.567											OREG0023926	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D325V	Melanoma(97;711 1442 7855 13832 28836)	Atlas-SNP	.											.	DHX38	91	.	0			c.A974T						PASS	.						80.0	69.0	72.0					16																	72133644		2198	4300	6498	SO:0001583	missense	9785	exon8			ATCGGGATTGGTA	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.974A>T	chr16.hg19:g.72133644A>T	ENSP00000268482:p.Asp325Val	118.0	0.0	.	1135	113.0	9.0	.	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	ENST00000268482.3	hg19	CCDS10907.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.128632	0.77549	.	.	ENSG00000140829	ENST00000268482	T	0.03242	4.0	4.69	4.69	0.59074	.	0.055445	0.64402	D	0.000001	T	0.09247	0.0228	M	0.82517	2.595	0.80722	D	1	P	0.42735	0.788	B	0.40410	0.328	T	0.02837	-1.1104	10	0.66056	D	0.02	.	14.4607	0.67448	1.0:0.0:0.0:0.0	.	325	Q92620	PRP16_HUMAN	V	325	ENSP00000268482:D325V	ENSP00000268482:D325V	D	+	2	0	DHX38	70691145	1.000000	0.71417	0.994000	0.49952	0.843000	0.47879	8.822000	0.92013	1.878000	0.54408	0.455000	0.32223	GAT	.	.	.	none		0.567	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
NCOR1	9611	hgsc.bcm.edu	37	17	15965099	15965099	+	Missense_Mutation	SNP	G	G	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr17:15965099G>T	ENST00000268712.3	-	37	5754	c.5497C>A	c.(5497-5499)Cag>Aag	p.Q1833K	NCOR1_ENST00000395851.1_Missense_Mutation_p.Q1849K|NCOR1_ENST00000395857.3_Missense_Mutation_p.Q417K	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1833	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ACATCCATCTGGGGTGCAGAA	0.532																																					p.Q1849K		Atlas-SNP	.											.	NCOR1	240	.	0			c.C5545A						PASS	.						58.0	62.0	61.0					17																	15965099		2203	4299	6502	SO:0001583	missense	9611	exon36			CCATCTGGGGTGC	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.5497C>A	chr17.hg19:g.15965099G>T	ENSP00000268712:p.Gln1833Lys	144.0	0.0	.		113.0	5.0	.	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	hg19	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.984237	0.93044	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.51325	0.71;1.03;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.63474	0.2514	L	0.43152	1.355	0.80722	D	1	D;D;D;D;D	0.69078	0.986;0.989;0.969;0.982;0.997	D;D;D;D;D	0.77557	0.979;0.966;0.93;0.968;0.99	T	0.62091	-0.6927	10	0.54805	T	0.06	-9.2428	18.9559	0.92658	0.0:0.0:1.0:0.0	.	643;1737;1833;1849;353	B4DZ48;E7EVK1;O75376;O75376-2;Q86YY1	.;.;NCOR1_HUMAN;.;.	K	1833;1849;1737;417	ENSP00000268712:Q1833K;ENSP00000379192:Q1849K;ENSP00000379198:Q417K	ENSP00000268712:Q1833K	Q	-	1	0	NCOR1	15905824	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.963000	0.93385	2.727000	0.93392	0.650000	0.86243	CAG	.	.	.	none		0.532	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
SUZ12	23512	hgsc.bcm.edu	37	17	30315477	30315477	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr17:30315477G>T	ENST00000322652.5	+	10	1391	c.1162G>T	c.(1162-1164)Gaa>Taa	p.E388*	SUZ12_ENST00000580398.1_Nonsense_Mutation_p.E365*	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	388					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TCTCCATCAGGAAAACAAGCC	0.393			T	JAZF1	endometrial stromal tumours																																p.E388X		Atlas-SNP	.		Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	.	SUZ12	61	.	0			c.G1162T						PASS	.						75.0	74.0	75.0					17																	30315477		2203	4300	6503	SO:0001587	stop_gained	23512	exon10			CATCAGGAAAACA	D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.1162G>T	chr17.hg19:g.30315477G>T	ENSP00000316578:p.Glu388*	263.0	0.0	.		267.0	14.0	.	NM_015355	Q96BD9	Nonsense_Mutation	SNP	ENST00000322652.5	hg19	CCDS11270.1	.	.	.	.	.	.	.	.	.	.	g	38	7.192437	0.98125	.	.	ENSG00000178691	ENST00000322652	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-15.3921	19.7638	0.96333	0.0:0.0:1.0:0.0	.	.	.	.	X	388	.	ENSP00000316578:E388X	E	+	1	0	SUZ12	27339590	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.543000	0.73874	2.673000	0.90976	0.650000	0.86243	GAA	.	.	.	none		0.393	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256260.2	NM_015355	
SYCP2	10388	hgsc.bcm.edu	37	20	58445040	58445040	+	Splice_Site	SNP	T	T	G			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr20:58445040T>G	ENST00000357552.3	-	36	3781		c.e36-2		SYCP2_ENST00000371001.2_Splice_Site			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2						female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			ATGTCTGGGCTATGAATGAAG	0.318																																					.		Atlas-SNP	.											.	SYCP2	204	.	0			c.3556-2A>C						PASS	.						58.0	54.0	55.0					20																	58445040		2192	4291	6483	SO:0001630	splice_region_variant	10388	exon36			CTGGGCTATGAAT	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3556-2A>C	chr20.hg19:g.58445040T>G		41.0	0.0	.		71.0	10.0	.	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Splice_Site	SNP	ENST00000357552.3	hg19	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	T	12.49	1.952546	0.34471	.	.	ENSG00000196074	ENST00000371001;ENST00000357552	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1113	0.48235	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYCP2	57878435	0.710000	0.27896	0.907000	0.35723	0.304000	0.27724	2.666000	0.46799	1.873000	0.54277	0.460000	0.39030	.	.	.	.	none		0.318	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	Intron
MXRA5	25878	hgsc.bcm.edu	37	X	3235245	3235246	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chrX:3235245_3235246CC>AA	ENST00000217939.6	-	6	6630_6631	c.6476_6477GG>TT	c.(6475-6477)aGG>aTT	p.R2159I		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2159	Ig-like C2-type 6.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTCCTCCGTACCTGACGTCCGT	0.683																																					p.R2159S|p.R2159M		Atlas-SNP	.											.	MXRA5	815	.	0			c.G6477T|c.G6476T						PASS	.																																			SO:0001583	missense	25878	exon6			TCCGTACCTGACG|CCGTACCTGACGT	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6476_6477delinsAA	chrX.hg19:g.3235245_3235246delinsAA	ENSP00000217939:p.Arg2159Ile	201.0|203.0	0.0	.		218.0|219.0	10.0	.	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	hg19	CCDS14124.1																																																																																			.	.	.	none		0.683	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
MT-CO1	4512	hgsc.bcm.edu	37	M	7020	7020	+	Missense_Mutation	SNP	G	G	A			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chrM:7020G>A	ENST00000361624.2	+	1	1117	c.1117G>A	c.(1117-1119)Gtt>Att	p.V373I	MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	373					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACACGTACTACGTTGTAGCTC	0.453																																					p.V373I		Atlas-SNP	.											.	.	.	.	0			c.G1117A						PASS	.																																			SO:0001583	missense	5742	exon1			TACTACGTTGTAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1117G>A	chrM.hg19:g.7020G>A	ENSP00000354499:p.Val373Ile	15.0	0.0	.		129.0	11.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	none		0.453	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
HEG1	57493	hgsc.bcm.edu	37	3	124732430	124732431	+	In_Frame_Ins	INS	-	-	GGAAGAGGAGGAGGAGGA	rs374949821		TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr3:124732430_124732431insGGAAGAGGAGGAGGAGGA	ENST00000311127.4	-	6	2059_2060	c.1992_1993insTCCTCCTCCTCCTCTTCC	c.(1990-1995)tcctcc>tccTCCTCCTCCTCCTCTTCCtcc	p.664_665SS>SSSSSSSS	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	664	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						gaggaggaggaggaagaggagg	0.495																																					p.S665delinsSSSSSSS		Atlas-INDEL	.											.	HEG1	109	.	0			c.1993_1994insTCCTCCTCCTCCTCTTCC						PASS	.																																			SO:0001652	inframe_insertion	57493	exon6			.	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1975_1992dupTCCTCCTCCTCCTCTTCC	chr3.hg19:g.124732430_124732431insGGAAGAGGAGGAGGAGGA	ENSP00000311502:p.Ser670_Ser671dup	95.0	0.0	0		110.0	11.0	0.1	NM_020733	Q6NX66|Q8NC40|Q9BSV0	In_Frame_Ins	INS	ENST00000311127.4	hg19	CCDS46898.1																																																																																			.	.	.	none		0.495	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
SUSD1	64420	hgsc.bcm.edu	37	9	114864480	114864480	+	Frame_Shift_Del	DEL	T	T	-			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr9:114864480delT	ENST00000374270.3	-	9	1429	c.1257delA	c.(1255-1257)aaafs	p.K419fs	SUSD1_ENST00000374263.3_Frame_Shift_Del_p.K419fs|SUSD1_ENST00000374264.2_Frame_Shift_Del_p.K419fs	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	419						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						CTGATCCAACTTTCCTAGAAC	0.328																																					p.V420fs		Atlas-Indel,Pindel	.											.	SUSD1	51	.	0			c.1258delG						PASS	.						85.0	85.0	85.0					9																	114864480		2202	4297	6499	SO:0001589	frameshift_variant	64420	exon9			.	AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.1257delA	chr9.hg19:g.114864480delT	ENSP00000363388:p.Lys419fs	252.0	0.0	0		276.0	18.0	0.0652174	NM_022486	A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Frame_Shift_Del	DEL	ENST00000374270.3	hg19	CCDS6783.1																																																																																			.	.	.	none		0.328	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053668.3	NM_022486	
ABCC6	368	hgsc.bcm.edu	37	16	16302617	16302618	+	Frame_Shift_Ins	INS	-	-	T			TCGA-4A-A93Y-01A-11D-A36X-10	TCGA-4A-A93Y-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ecd232a0-9ac6-4eda-8f3e-8ab73e39ce90	8502bb1a-6a04-42ad-88f1-4559e24b1286	g.chr16:16302617_16302618insT	ENST00000205557.7	-	7	790_791	c.761_762insA	c.(760-762)aagfs	p.K254fs	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	254					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	TCATCCACTCCTTTTCAAGCCG	0.55																																					p.K254fs		Pindel	.											.	ABCC6	110	.	0			c.762_763insA						PASS	.																																			SO:0001589	frameshift_variant	368	exon7			.	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.762dupA	chr16.hg19:g.16302621_16302621dupT	ENSP00000205557:p.Lys254fs	459.0	0.0	.		465.0	22.0	0.047	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Frame_Shift_Ins	INS	ENST00000205557.7	hg19	CCDS10568.1																																																																																			.	.	.	none		0.550	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
