#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PADI6	353238	hgsc.bcm.edu	37	1	17721468	17721468	+	RNA	SNP	T	T	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr1:17721468T>C	ENST00000434762.2	+	0	1410							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GGGCCATGAGTAAGACCCTCC	0.587																																					p.S453S		Atlas-SNP	.											.	PADI6	51	.	0			c.T1359C						PASS	.						41.0	45.0	44.0					1																	17721468		2104	4264	6368			353238	exon13			CATGAGTAAGACC	AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		chr1.hg19:g.17721468T>C		62.0	0.0	.		52.0	18.0	.	NM_207421	Q330K5|Q70SX3	Silent	SNP	ENST00000434762.2	hg19																																																																																				.	.	.	none		0.587	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4	NM_207421	
NT5C1A	84618	hgsc.bcm.edu	37	1	40126872	40126872	+	Missense_Mutation	SNP	C	C	T	rs572504200		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr1:40126872C>T	ENST00000235628.1	-	5	619	c.620G>A	c.(619-621)cGc>cAc	p.R207H		NM_032526.1	NP_115915.1	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	207					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|purine nucleobase metabolic process (GO:0006144)|purine nucleoside monophosphate catabolic process (GO:0009128)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			breast(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)	15	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GAAGGCCACGCGCAGCTGACT	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		19843	0.0		0.0	False		,,,				2504	0.001				p.R207H		Atlas-SNP	.											.	NT5C1A	46	.	0			c.G620A						PASS	.						60.0	52.0	55.0					1																	40126872		2203	4300	6503	SO:0001583	missense	84618	exon5			GCCACGCGCAGCT	AF331801	CCDS440.1	1p34.3-p33	2008-07-18			ENSG00000116981	ENSG00000116981			17819	protein-coding gene	gene with protein product	"""cytosolic 5' nucleotidase, type 1A"", ""AMP-specific 5'-NT"", ""cytosolic 5'-nucleotidase IA"""	610525				11133996, 11690631	Standard	NM_032526		Approved	CN-I, CN-IA, CN1A, CN1, MGC119199, MGC119201	uc001cdq.1	Q9BXI3	OTTHUMG00000009244	ENST00000235628.1:c.620G>A	chr1.hg19:g.40126872C>T	ENSP00000235628:p.Arg207His	78.0	0.0	.		75.0	8.0	.	NM_032526	Q3SYB9|Q5TG98|Q9BWT8	Missense_Mutation	SNP	ENST00000235628.1	hg19	CCDS440.1	.	.	.	.	.	.	.	.	.	.	C	35	5.544326	0.96488	.	.	ENSG00000116981	ENST00000235628	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.87712	0.6246	H	0.95539	3.685	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.91239	0.5020	9	0.72032	D	0.01	-4.9323	18.8667	0.92294	0.0:1.0:0.0:0.0	.	207	Q9BXI3	5NT1A_HUMAN	H	207	.	ENSP00000235628:R207H	R	-	2	0	NT5C1A	39899459	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	7.792000	0.85828	2.543000	0.85770	0.650000	0.86243	CGC	.	.	.	none		0.627	NT5C1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025626.1	NM_032526	
TGFBR3	7049	hgsc.bcm.edu	37	1	92182200	92182200	+	Silent	SNP	C	C	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr1:92182200C>T	ENST00000525962.1	-	10	1693	c.1632G>A	c.(1630-1632)gaG>gaA	p.E544E	TGFBR3_ENST00000370399.2_Silent_p.E543E|TGFBR3_ENST00000212355.4_Silent_p.E544E			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	544	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TATCACCTGACTCCAGATCTT	0.463																																					p.E544E		Atlas-SNP	.											.	TGFBR3	103	.	0			c.G1632A						PASS	.						288.0	298.0	294.0					1																	92182200		2203	4300	6503	SO:0001819	synonymous_variant	7049	exon11			ACCTGACTCCAGA	L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.1632G>A	chr1.hg19:g.92182200C>T		210.0	0.0	.		215.0	93.0	.	NM_003243	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Silent	SNP	ENST00000525962.1	hg19	CCDS30770.1																																																																																			.	.	.	none		0.463	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243	
GLMN	11146	hgsc.bcm.edu	37	1	92712690	92712690	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr1:92712690A>T	ENST00000370360.3	-	18	1678	c.1597T>A	c.(1597-1599)Tct>Act	p.S533T	GLMN_ENST00000534881.1_Missense_Mutation_p.S519T	NM_053274.2	NP_444504.1	Q92990	GLMN_HUMAN	glomulin, FKBP associated protein	533					muscle cell differentiation (GO:0042692)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of T cell proliferation (GO:0042130)|neural tube closure (GO:0001843)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of phosphorylation (GO:0042327)|regulation of gene expression, epigenetic (GO:0040029)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|vasculogenesis (GO:0001570)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cullin-RING ubiquitin ligase complex (GO:0031461)|intracellular (GO:0005622)	hepatocyte growth factor receptor binding (GO:0005171)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase inhibitor activity (GO:0055105)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	17		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		AGATCTTTAGATTTCTGGGCC	0.338									Multiple Glomus Tumors (of the Skin), Familial																												p.S533T		Atlas-SNP	.											.	GLMN	37	.	0			c.T1597A						PASS	.						109.0	115.0	113.0					1																	92712690		2203	4300	6503	SO:0001583	missense	11146	exon18	Familial Cancer Database	Multiple Familial Glomangiomas, Hereditary Multiple Glomus Tumors, Familial Multiple Glomangiomatosis, Inherited Cutaneous Venous Anomalies, incl. Familial Multiple Glomangiomyoma	CTTTAGATTTCTG	U73704	CCDS738.1	1p22.1	2008-02-05	2004-07-01		ENSG00000174842	ENSG00000174842			14373	protein-coding gene	gene with protein product		601749	"""venous malformation with glomus cells"""	VMGLOM		8955134	Standard	XM_005270400		Approved	FAP48, GLML, GVM, FKBPAP	uc001dor.3	Q92990	OTTHUMG00000010283	ENST00000370360.3:c.1597T>A	chr1.hg19:g.92712690A>T	ENSP00000359385:p.Ser533Thr	40.0	0.0	.		21.0	6.0	.	NM_053274	Q5VVC3|Q9BVE8	Missense_Mutation	SNP	ENST00000370360.3	hg19	CCDS738.1	.	.	.	.	.	.	.	.	.	.	A	11.11	1.542990	0.27563	.	.	ENSG00000174842	ENST00000370360;ENST00000534881	T;T	0.47528	0.85;0.84	5.97	0.375	0.16188	.	0.644862	0.17527	N	0.171029	T	0.19406	0.0466	L	0.47716	1.5	0.09310	N	0.999993	B;B	0.33777	0.222;0.425	B;B	0.39971	0.122;0.315	T	0.28364	-1.0046	10	0.20046	T	0.44	-1.6953	6.4009	0.21638	0.5904:0.0:0.0699:0.3397	.	519;533	B4DJ85;Q92990	.;GLMN_HUMAN	T	533;519	ENSP00000359385:S533T;ENSP00000440156:S519T	ENSP00000359385:S533T	S	-	1	0	GLMN	92485278	0.746000	0.28272	0.903000	0.35520	0.916000	0.54674	1.332000	0.33805	0.122000	0.18314	-0.327000	0.08410	TCT	.	.	.	none		0.338	GLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028358.1	NM_007070	
NUF2	83540	hgsc.bcm.edu	37	1	163318835	163318835	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr1:163318835A>C	ENST00000271452.3	+	13	1504	c.1225A>C	c.(1225-1227)Aaa>Caa	p.K409Q	NUF2_ENST00000367900.3_Missense_Mutation_p.K409Q|NUF2_ENST00000524800.1_Missense_Mutation_p.K362Q	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	409	Interaction with the C-terminus of NDC80 and the SPBC24-SPBC25 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					TCAACAACTAAAAGATGCTGC	0.323																																					p.K409Q		Atlas-SNP	.											.	NUF2	138	.	0			c.A1225C						PASS	.						58.0	61.0	60.0					1																	163318835		2203	4299	6502	SO:0001583	missense	83540	exon13			CAACTAAAAGATG	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1225A>C	chr1.hg19:g.163318835A>C	ENSP00000271452:p.Lys409Gln	556.0	0.0	.		567.0	41.0	.	NM_145697	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	hg19	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.455210	0.26161	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.35973	1.28;1.44;1.44	5.5	3.0	0.34707	.	0.231097	0.49916	D	0.000136	T	0.09069	0.0224	N	0.22421	0.69	0.22982	N	0.998474	B;B	0.14438	0.01;0.01	B;B	0.09377	0.004;0.004	T	0.16276	-1.0408	9	0.17369	T	0.5	-21.3294	10.6004	0.45362	0.6939:0.3061:0.0:0.0	.	362;409	E9PQC4;Q9BZD4	.;NUF2_HUMAN	Q	362;409;409	ENSP00000436888:K362Q;ENSP00000356875:K409Q;ENSP00000271452:K409Q	ENSP00000271452:K409Q	K	+	1	0	NUF2	161585459	0.992000	0.36948	0.215000	0.23724	0.796000	0.44982	3.395000	0.52558	1.047000	0.40274	0.533000	0.62120	AAA	.	.	.	none		0.323	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697	
ABL2	27	hgsc.bcm.edu	37	1	179078368	179078368	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr1:179078368C>A	ENST00000502732.1	-	12	2237	c.2034G>T	c.(2032-2034)caG>caT	p.Q678H	ABL2_ENST00000408940.3_Missense_Mutation_p.Q642H|ABL2_ENST00000511413.1_Missense_Mutation_p.Q678H|ABL2_ENST00000507173.1_Missense_Mutation_p.Q657H|ABL2_ENST00000504405.1_Missense_Mutation_p.Q642H|ABL2_ENST00000512653.1_Missense_Mutation_p.Q663H|ABL2_ENST00000367623.4_Missense_Mutation_p.Q657H|ABL2_ENST00000344730.3_Missense_Mutation_p.Q663H	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	678					actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TCTTATGGGGCTGATTCTCCA	0.512			T	ETV6	AML																																p.Q678H		Atlas-SNP	.		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	.	ABL2	307	.	0			c.G2034T						PASS	.						199.0	212.0	208.0					1																	179078368		2203	4300	6503	SO:0001583	missense	27	exon12			ATGGGGCTGATTC	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.2034G>T	chr1.hg19:g.179078368C>A	ENSP00000427562:p.Gln678His	92.0	0.0	.		108.0	46.0	.	NM_007314	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	hg19	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	C	8.471	0.857571	0.17106	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413	T;T;T;T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58	5.46	3.53	0.40419	.	0.000000	0.49305	D	0.000142	T	0.20170	0.0485	L	0.31752	0.955	0.80722	D	1	D;D;B;D;B;D;B;B	0.76494	0.999;0.998;0.038;0.994;0.052;0.998;0.052;0.069	D;D;B;D;B;D;B;B	0.85130	0.997;0.994;0.018;0.916;0.028;0.994;0.028;0.062	T	0.03608	-1.1020	10	0.26408	T	0.33	.	7.7144	0.28696	0.0:0.74:0.0:0.26	.	657;657;678;642;678;663;642;663	P42684-6;P42684-7;P42684-5;P42684-4;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;ABL2_HUMAN;.;.;.	H	678;642;663;663;642;657;657;678	ENSP00000427562:Q678H;ENSP00000386152:Q642H;ENSP00000339209:Q663H;ENSP00000423578:Q663H;ENSP00000426831:Q642H;ENSP00000356595:Q657H;ENSP00000423413:Q657H;ENSP00000424697:Q678H	ENSP00000339209:Q663H	Q	-	3	2	ABL2	177344991	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	0.656000	0.24948	1.246000	0.43901	0.591000	0.81541	CAG	.	.	.	none		0.512	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158	
TRMT1L	81627	hgsc.bcm.edu	37	1	185106774	185106774	+	Nonsense_Mutation	SNP	C	C	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr1:185106774C>A	ENST00000367506.5	-	10	1745	c.1477G>T	c.(1477-1479)Gag>Tag	p.E493*	TRMT1L_ENST00000367504.3_Nonsense_Mutation_p.E337*	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	493	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.				adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						AAAATTCTCTCTTCACACCAC	0.358																																					p.E493X		Atlas-SNP	.											.	TRMT1L	50	.	0			c.G1477T						PASS	.						141.0	139.0	140.0					1																	185106774		2203	4300	6503	SO:0001587	stop_gained	81627	exon10			TTCTCTCTTCACA	AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.1477G>T	chr1.hg19:g.185106774C>A	ENSP00000356476:p.Glu493*	93.0	0.0	.		83.0	26.0	.	NM_030934	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Nonsense_Mutation	SNP	ENST00000367506.5	hg19	CCDS1366.1	.	.	.	.	.	.	.	.	.	.	C	45	11.739919	0.99597	.	.	ENSG00000121486	ENST00000367504;ENST00000367506;ENST00000458395	.	.	.	5.82	5.82	0.92795	.	0.049538	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-19.1751	20.0812	0.97776	0.0:1.0:0.0:0.0	.	.	.	.	X	337;493;117	.	ENSP00000356474:E337X	E	-	1	0	TRMT1L	183373397	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.679000	0.84048	2.744000	0.94065	0.585000	0.79938	GAG	.	.	.	none		0.358	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085787.1	NM_030934	
FAM89A	375061	hgsc.bcm.edu	37	1	231155814	231155814	+	Missense_Mutation	SNP	G	G	A	rs147790876		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr1:231155814G>A	ENST00000366654.4	-	2	384	c.350C>T	c.(349-351)tCg>tTg	p.S117L	FAM89A_ENST00000494111.1_5'UTR|MIR1182_ENST00000408363.1_RNA	NM_198552.2	NP_940954.1	Q96GI7	FA89A_HUMAN	family with sequence similarity 89, member A	117										endometrium(1)|upper_aerodigestive_tract(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				CTCCTGAATCGACTCGTAGAG	0.552																																					p.S117L		Atlas-SNP	.											FAM89A,NS,carcinoma,+1,1	FAM89A	8	.	0			c.C350T						PASS	.	G	LEU/SER	0,4406		0,0,2203	72.0	68.0	69.0		350	5.8	1.0	1	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	missense	FAM89A	NM_198552.2	145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	117/185	231155814	1,13005	2203	4300	6503	SO:0001583	missense	375061	exon2			TGAATCGACTCGT	BC009447	CCDS1590.1	1q42.2	2008-02-05	2005-09-13	2005-09-13	ENSG00000182118	ENSG00000182118			25057	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 153"""	C1orf153		12477932	Standard	NM_198552		Approved	MGC15887	uc001hui.2	Q96GI7	OTTHUMG00000037960	ENST00000366654.4:c.350C>T	chr1.hg19:g.231155814G>A	ENSP00000355614:p.Ser117Leu	43.0	0.0	.		44.0	20.0	.	NM_198552		Missense_Mutation	SNP	ENST00000366654.4	hg19	CCDS1590.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971514	0.92919	0.0	1.16E-4	ENSG00000182118	ENST00000366654	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.77177	0.4092	M	0.78049	2.395	0.80722	D	1	D	0.76494	0.999	P	0.55667	0.781	T	0.79262	-0.1876	9	0.87932	D	0	-12.6922	20.3277	0.98707	0.0:0.0:1.0:0.0	.	117	Q96GI7	FA89A_HUMAN	L	117	.	ENSP00000355614:S117L	S	-	2	0	FAM89A	229222437	1.000000	0.71417	0.995000	0.50966	0.825000	0.46686	7.783000	0.85696	2.879000	0.98667	0.650000	0.86243	TCG	.	G|1.000;A|0.000	0.000	weak		0.552	FAM89A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092652.1	NM_198552	
NBAS	51594	hgsc.bcm.edu	37	2	15534394	15534394	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr2:15534394C>G	ENST00000281513.5	-	28	3239	c.3214G>C	c.(3214-3216)Gca>Cca	p.A1072P	NBAS_ENST00000441750.1_Missense_Mutation_p.A952P	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1072					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						AGCTTGCGTGCCTCTTCTGAG	0.338																																					p.A1072P		Atlas-SNP	.											.	NBAS	246	.	0			c.G3214C						PASS	.						57.0	54.0	55.0					2																	15534394		2203	4297	6500	SO:0001583	missense	51594	exon28			TGCGTGCCTCTTC	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3214G>C	chr2.hg19:g.15534394C>G	ENSP00000281513:p.Ala1072Pro	102.0	0.0	.		112.0	28.0	.	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	hg19	CCDS1685.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	29.5|29.5|29.5	5.014392|5.014392|5.014392	0.93404|0.93404|0.93404	.|.|.	.|.|.	ENSG00000151779|ENSG00000151779|ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000441755|ENST00000429842|ENST00000442506	T;T;T|.|.	0.18502|.|.	2.21;2.21;2.21|.|.	5.48|5.48|5.48	5.48|5.48|5.48	0.80851|0.80851|0.80851	Secretory pathway Sec39 (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.76521|0.76521|0.76521	0.3999|0.3999|0.3999	M|M|M	0.74258|0.74258|0.74258	2.255|2.255|2.255	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D|.|.	0.89917|.|.	1.0;1.0|.|.	D;D|.|.	0.97110|.|.	0.998;1.0|.|.	T|T|T	0.75941|0.75941|0.75941	-0.3140|-0.3140|-0.3140	10|5|5	0.87932|.|.	D|.|.	0|.|.	.|.|.	18.1585|18.1585|18.1585	0.89701|0.89701|0.89701	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	952;1072|.|.	A2RRP1-2;A2RRP1|.|.	.;NBAS_HUMAN|.|.	P|A|S	952;1072;119|169|119	ENSP00000413201:A952P;ENSP00000281513:A1072P;ENSP00000396501:A119P|.|.	ENSP00000281513:A1072P|.|.	A|G|R	-|-|-	1|2|3	0|0|2	NBAS|NBAS|NBAS	15451845|15451845|15451845	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.997000|0.997000|0.997000	0.53966|0.53966|0.53966	0.864000|0.864000|0.864000	0.49448|0.49448|0.49448	6.752000|6.752000|6.752000	0.74898|0.74898|0.74898	2.572000|2.572000|2.572000	0.86782|0.86782|0.86782	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GCA|GGC|AGG	.	.	.	none		0.338	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
USP34	9736	hgsc.bcm.edu	37	2	61433163	61433164	+	Missense_Mutation	DNP	TT	TT	CA			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr2:61433163_61433164TT>CA	ENST00000398571.2	-	72	9218_9219	c.9142_9143AA>TG	c.(9142-9144)AAt>TGt	p.N3048C	USP34_ENST00000472689.1_5'Flank	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3048					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TATACAGGCATTTCTAAGTTCT	0.381																																					p.N3048S|p.N3048Y		Atlas-SNP	.											.	USP34	334	.	0			c.A9143G|c.A9142T						PASS	.																																			SO:0001583	missense	9736	exon72			CAGGCATTTCTAA|AGGCATTTCTAAG	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.9142_9143delinsCA	chr2.hg19:g.61433163_61433164delinsCA	ENSP00000381577:p.Asn3048Cys	93.0	0.0	.		80.0|82.0	38.0	.	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	hg19	CCDS42686.1																																																																																			.	.	.	none		0.381	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
TTC21B	79809	hgsc.bcm.edu	37	2	166799781	166799781	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr2:166799781T>C	ENST00000243344.7	-	5	637	c.500A>G	c.(499-501)tAt>tGt	p.Y167C	AC010127.5_ENST00000440322.1_RNA|AC010127.5_ENST00000443032.1_RNA	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	167					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						CTCTTCAAAATACTTCAGTGC	0.338																																					p.Y167C		Atlas-SNP	.											.	TTC21B	130	.	0			c.A500G						PASS	.						122.0	115.0	117.0					2																	166799781		2203	4300	6503	SO:0001583	missense	79809	exon5			TCAAAATACTTCA	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.500A>G	chr2.hg19:g.166799781T>C	ENSP00000243344:p.Tyr167Cys	120.0	0.0	.		108.0	51.0	.	NM_024753	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	ENST00000243344.7	hg19	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	T	11.08	1.533262	0.27387	.	.	ENSG00000123607	ENST00000243344	T	0.65364	-0.15	5.33	-0.0208	0.13954	Tetratricopeptide-like helical (1);	0.321357	0.34386	N	0.004013	T	0.49949	0.1587	L	0.49640	1.575	0.80722	D	1	B;B	0.23540	0.087;0.01	B;B	0.26693	0.072;0.01	T	0.30297	-0.9983	10	0.51188	T	0.08	-0.3028	5.7902	0.18357	0.0:0.2217:0.1291:0.6492	.	167;167	Q7Z4L5-2;Q7Z4L5	.;TT21B_HUMAN	C	167	ENSP00000243344:Y167C	ENSP00000243344:Y167C	Y	-	2	0	TTC21B	166508027	0.983000	0.35010	0.127000	0.21898	0.634000	0.38068	0.672000	0.25187	-0.238000	0.09724	-0.408000	0.06270	TAT	.	.	.	none		0.338	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753	
PIKFYVE	200576	hgsc.bcm.edu	37	2	209150550	209150550	+	Silent	SNP	T	T	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr2:209150550T>C	ENST00000264380.4	+	6	872	c.714T>C	c.(712-714)gaT>gaC	p.D238D	PIKFYVE_ENST00000308862.6_Silent_p.D152D|PIKFYVE_ENST00000392202.3_Silent_p.D141D|PIKFYVE_ENST00000407449.1_Silent_p.D238D	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	238					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						CTCTTTCAGATTCTGCTTGCT	0.438																																					p.D238D		Atlas-SNP	.											.	PIKFYVE	223	.	0			c.T714C						PASS	.						152.0	149.0	150.0					2																	209150550		2203	4300	6503	SO:0001819	synonymous_variant	200576	exon6			TTCAGATTCTGCT	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.714T>C	chr2.hg19:g.209150550T>C		97.0	0.0	.		95.0	41.0	.	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	hg19	CCDS2382.1																																																																																			.	.	.	none		0.438	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
KIF1A	547	hgsc.bcm.edu	37	2	241658507	241658507	+	Silent	SNP	G	G	A	rs553465326		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr2:241658507G>A	ENST00000320389.7	-	45	4985	c.4827C>T	c.(4825-4827)agC>agT	p.S1609S	KIF1A_ENST00000498729.2_Silent_p.S1710S	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1609	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		TGTCCTTGTCGCTGTTGTACA	0.637																																					p.S1710S		Atlas-SNP	.											.	KIF1A	152	.	0			c.C5130T						PASS	.						90.0	102.0	98.0					2																	241658507		2176	4284	6460	SO:0001819	synonymous_variant	547	exon47			CTTGTCGCTGTTG	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.4827C>T	chr2.hg19:g.241658507G>A		102.0	0.0	.		109.0	44.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Silent	SNP	ENST00000320389.7	hg19	CCDS46561.1																																																																																			.	.	.	none		0.637	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
TBC1D23	55773	hgsc.bcm.edu	37	3	100025388	100025388	+	Splice_Site	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr3:100025388G>A	ENST00000394144.4	+	13	1420		c.e13+1		TBC1D23_ENST00000475134.1_Splice_Site|TBC1D23_ENST00000486274.1_Splice_Site|TBC1D23_ENST00000344949.5_Splice_Site	NM_001199198.2	NP_001186127.1	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23						positive regulation of interleukin-6 production (GO:0032755)|regulation of inflammatory response (GO:0050727)|regulation of tumor necrosis factor production (GO:0032680)		Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(10)|ovary(1)|prostate(2)|skin(2)	25						TTCTGTTGATGTAAGTATATG	0.408																																					.		Atlas-SNP	.											TBC1D23_ENST00000394144,right_lower_lobe,carcinoma,0,2	TBC1D23	133	.	0			c.1413+1G>A						PASS	.						92.0	77.0	82.0					3																	100025388		2203	4300	6503	SO:0001630	splice_region_variant	55773	exon13			GTTGATGTAAGTA	AK001908	CCDS2936.1, CCDS56265.1	3q12.2	2013-07-10			ENSG00000036054	ENSG00000036054			25622	protein-coding gene	gene with protein product						22312129	Standard	NM_001199198		Approved	FLJ11046	uc003dtt.4	Q9NUY8	OTTHUMG00000159067	ENST00000394144.4:c.1413+1G>A	chr3.hg19:g.100025388G>A		63.0	0.0	.		64.0	50.0	.	NM_018309	B9A6M5|Q8TCN8|Q8WUB7|Q96D90|Q9NV75	Splice_Site	SNP	ENST00000394144.4	hg19	CCDS56265.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609777	0.87258	.	.	ENSG00000036054	ENST00000344949;ENST00000394144;ENST00000475134	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.712	0.88324	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D23	101508078	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.962000	0.93254	2.785000	0.95823	0.655000	0.94253	.	.	.	.	none		0.408	TBC1D23-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353150.1	NM_018309	Intron
WWTR1	25937	hgsc.bcm.edu	37	3	149374844	149374844	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr3:149374844G>C	ENST00000465804.1	-	3	506	c.250C>G	c.(250-252)Cat>Gat	p.H84D	WWTR1-AS1_ENST00000495094.1_RNA|WWTR1_ENST00000467467.1_Missense_Mutation_p.H84D|WWTR1-AS1_ENST00000479752.1_RNA|WWTR1-AS1_ENST00000466836.1_RNA|WWTR1_ENST00000360632.3_Missense_Mutation_p.H84D	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	84					cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GAGCGGACATGCTGGGCACCC	0.726			T	CAMTA1	epitheliod hemangioendothelioma																																p.H84D		Atlas-SNP	.		Dom	yes		3	3q23-q24	607392	WW domain containing transcription regulator 1		M	.	WWTR1	42	.	0			c.C250G						PASS	.						6.0	8.0	7.0					3																	149374844		2132	4104	6236	SO:0001583	missense	25937	exon3			GGACATGCTGGGC	AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.250C>G	chr3.hg19:g.149374844G>C	ENSP00000419465:p.His84Asp	55.0	0.0	.		78.0	61.0	.	NM_001168278	D3DNH7|Q8N3P2|Q9Y3W6	Missense_Mutation	SNP	ENST00000465804.1	hg19	CCDS3144.1	.	.	.	.	.	.	.	.	.	.	G	33	5.195253	0.94960	.	.	ENSG00000018408	ENST00000465804;ENST00000360632;ENST00000467467;ENST00000479238;ENST00000485352;ENST00000475579	T;T;T;T	0.53640	0.62;0.62;0.62;0.61	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.69387	0.3105	M	0.74467	2.265	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	T	0.72010	-0.4419	10	0.54805	T	0.06	-25.132	18.4973	0.90869	0.0:0.0:1.0:0.0	.	84	Q9GZV5	WWTR1_HUMAN	D	84	ENSP00000419465:H84D;ENSP00000353847:H84D;ENSP00000419234:H84D;ENSP00000418580:H84D	ENSP00000353847:H84D	H	-	1	0	WWTR1	150857534	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.333000	0.96459	2.360000	0.80028	0.462000	0.41574	CAT	.	.	.	none		0.726	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356498.1	NM_015472	
FGFRL1	53834	hgsc.bcm.edu	37	4	1018294	1018294	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr4:1018294T>A	ENST00000398484.2	+	7	1494	c.914T>A	c.(913-915)gTg>gAg	p.V305E	FGFRL1_ENST00000510644.1_Missense_Mutation_p.V305E|FGFRL1_ENST00000264748.6_Missense_Mutation_p.V305E|FGFRL1_ENST00000504138.1_Missense_Mutation_p.V305E			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	305	Ig-like C2-type 3.				diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			AAGTTTGTGGTGCTGCCCACG	0.652																																					p.V305E		Atlas-SNP	.											.	FGFRL1	77	.	0			c.T914A						PASS	.						53.0	53.0	53.0					4																	1018294		2203	4298	6501	SO:0001583	missense	53834	exon6			TTGTGGTGCTGCC		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.914T>A	chr4.hg19:g.1018294T>A	ENSP00000381498:p.Val305Glu	132.0	0.0	.		162.0	55.0	.	NM_001004356	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Missense_Mutation	SNP	ENST00000398484.2	hg19	CCDS3344.1	.	.	.	.	.	.	.	.	.	.	t	26.7	4.758736	0.89843	.	.	ENSG00000127418	ENST00000398484;ENST00000542622;ENST00000510644;ENST00000504138;ENST00000264748	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.45	5.45	0.79879	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83945	0.5364	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83076	-0.0140	10	0.26408	T	0.33	-23.5219	14.6694	0.68932	0.0:0.0:0.0:1.0	.	305	Q8N441	FGRL1_HUMAN	E	305;275;305;305;305	ENSP00000381498:V305E;ENSP00000425025:V305E;ENSP00000423091:V305E;ENSP00000264748:V305E	ENSP00000264748:V305E	V	+	2	0	FGFRL1	1008294	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	4.872000	0.63050	2.062000	0.61559	0.478000	0.44815	GTG	.	.	.	none		0.652	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239195.2	NM_021923	
DSPP	1834	hgsc.bcm.edu	37	4	88536436	88536436	+	Silent	SNP	C	C	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr4:88536436C>T	ENST00000282478.7	+	4	2655	c.2622C>T	c.(2620-2622)agC>agT	p.S874S	DSPP_ENST00000399271.1_Silent_p.S874S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	874	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaacagcagtg	0.502																																					p.S874S		Atlas-SNP	.											.	DSPP	174	.	0			c.C2622T						PASS	.						70.0	85.0	79.0					4																	88536436		1641	2936	4577	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2622C>T	chr4.hg19:g.88536436C>T		224.0	0.0	.		233.0	23.0	.	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.	.	none		0.502	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PCLO	27445	hgsc.bcm.edu	37	7	82581488	82581488	+	Missense_Mutation	SNP	T	T	A	rs10630259|rs10694231	byFrequency	TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr7:82581488T>A	ENST00000333891.9	-	5	9118	c.8781A>T	c.(8779-8781)gaA>gaT	p.E2927D	PCLO_ENST00000423517.2_Missense_Mutation_p.E2927D|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CAACGGGTTTTTCATCTTCTA	0.433																																					p.E2927D		Atlas-SNP	.											Q9Y6V0-3,colon,carcinoma,0,3	PCLO	1506	.	0			c.A8781T						PASS	.						123.0	122.0	123.0					7																	82581488		1902	4128	6030	SO:0001583	missense	27445	exon5			GGGTTTTTCATCT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8781A>T	chr7.hg19:g.82581488T>A	ENSP00000334319:p.Glu2927Asp	57.0	0.0	.		89.0	6.0	.	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	8.487	0.861147	0.17178	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.20881	2.1;2.04	5.67	0.321	0.15883	.	.	.	.	.	T	0.08980	0.0222	N	0.11201	0.11	0.80722	D	1	B;B	0.14012	0.009;0.009	B;B	0.12156	0.007;0.007	T	0.18587	-1.0332	9	0.87932	D	0	.	2.0445	0.03557	0.1172:0.1463:0.2418:0.4947	.	2927;2927	Q9Y6V0-5;Q9Y6V0-6	.;.	D	2858;2927;2927	ENSP00000334319:E2927D;ENSP00000388393:E2927D	ENSP00000334319:E2927D	E	-	3	2	PCLO	82419424	0.964000	0.33143	0.999000	0.59377	0.737000	0.42083	0.165000	0.16564	0.413000	0.25759	0.455000	0.32223	GAA	.	.	.	none		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu	37	7	82581494	82581494	+	Missense_Mutation	SNP	T	T	A	rs78195222		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr7:82581494T>A	ENST00000333891.9	-	5	9112	c.8775A>T	c.(8773-8775)gaA>gaT	p.E2925D	PCLO_ENST00000423517.2_Missense_Mutation_p.E2925D|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E2925D(2)|p.E2856D(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTTTTTCATCTTCTATTATTT	0.438																																					p.E2925D		Atlas-SNP	.											Q9Y6V0-3,rectum,carcinoma,0,15	PCLO	1506	.	3	Substitution - Missense(3)	central_nervous_system(3)	c.A8775T						PASS	.						139.0	137.0	137.0					7																	82581494		1905	4127	6032	SO:0001583	missense	27445	exon5			TTCATCTTCTATT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8775A>T	chr7.hg19:g.82581494T>A	ENSP00000334319:p.Glu2925Asp	59.0	0.0	.		97.0	10.0	.	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	9.279	1.047607	0.19827	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.18810	2.19;2.2	5.68	0.559	0.17272	.	.	.	.	.	T	0.19005	0.0456	M	0.61703	1.905	0.80722	D	1	B;B	0.24043	0.096;0.096	B;B	0.19666	0.026;0.026	T	0.05920	-1.0856	9	0.87932	D	0	.	5.3684	0.16127	0.1196:0.2007:0.0:0.6797	.	2925;2925	Q9Y6V0-5;Q9Y6V0-6	.;.	D	2856;2925;2925	ENSP00000334319:E2925D;ENSP00000388393:E2925D	ENSP00000334319:E2925D	E	-	3	2	PCLO	82419430	0.999000	0.42202	1.000000	0.80357	0.858000	0.48976	0.471000	0.22100	0.071000	0.16664	-0.490000	0.04691	GAA	.	T|0.500;A|0.500	0.500	weak		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
TRIP6	7205	hgsc.bcm.edu	37	7	100468243	100468243	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr7:100468243G>C	ENST00000200457.4	+	6	1237	c.877G>C	c.(877-879)Gtt>Ctt	p.V293L		NM_003302.2	NP_003293.2	Q15654	TRIP6_HUMAN	thyroid hormone receptor interactor 6	293	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				focal adhesion assembly (GO:0048041)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|kinase binding (GO:0019900)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|liver(1)|lung(5)	14	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGGGGCTGGGGTTGTGGCCCT	0.602																																					p.V293L		Atlas-SNP	.											.	TRIP6	45	.	0			c.G877C						PASS	.						195.0	176.0	182.0					7																	100468243		2203	4300	6503	SO:0001583	missense	7205	exon6			GCTGGGGTTGTGG	L40374, AF000974	CCDS5708.1	7q22	2006-09-05			ENSG00000087077	ENSG00000087077			12311	protein-coding gene	gene with protein product		602933				9598321, 7776974	Standard	NM_003302		Approved	ZRP-1, OIP1, MGC10556, MGC10558, MGC29959, MGC3837, MGC4423	uc003uww.3	Q15654	OTTHUMG00000157029	ENST00000200457.4:c.877G>C	chr7.hg19:g.100468243G>C	ENSP00000200457:p.Val293Leu	47.0	0.0	.		87.0	25.0	.	NM_003302	A4D2E7|F2ZC07|F2ZC08|O15170|O15275|Q9BTB2|Q9BUE5|Q9BXP3|Q9UNT4	Missense_Mutation	SNP	ENST00000200457.4	hg19	CCDS5708.1	.	.	.	.	.	.	.	.	.	.	g	24.6	4.552765	0.86127	.	.	ENSG00000087077	ENST00000200457	T	0.42900	0.96	5.79	5.79	0.91817	Zinc finger, LIM-type (5);	0.119641	0.64402	D	0.000019	T	0.41811	0.1175	N	0.13235	0.315	0.39933	D	0.974314	P	0.50819	0.939	P	0.57720	0.826	T	0.38200	-0.9672	10	0.46703	T	0.11	.	12.4811	0.55842	0.0:0.0:0.8328:0.1672	.	293	Q15654	TRIP6_HUMAN	L	293	ENSP00000200457:V293L	ENSP00000200457:V293L	V	+	1	0	TRIP6	100306179	1.000000	0.71417	0.969000	0.41365	0.832000	0.47134	5.454000	0.66651	2.737000	0.93849	0.645000	0.84053	GTT	.	.	.	none		0.602	TRIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347151.2	NM_003302	
SSPO	23145	hgsc.bcm.edu	37	7	149476014	149476014	+	RNA	SNP	A	A	G			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr7:149476014A>G	ENST00000378016.2	+	0	980							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGGCTCTACAATGGCTGGCCA	0.627																																					p.N327S		Atlas-SNP	.											.	.	.	.	0			c.A980G						PASS	.						119.0	138.0	131.0					7																	149476014		2025	4190	6215			23145	exon7			TCTACAATGGCTG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149476014A>G		115.0	0.0	.		142.0	63.0	.	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	hg19																																																																																				.	.	.	none		0.627	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
INTS8	55656	hgsc.bcm.edu	37	8	95835690	95835690	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr8:95835690G>A	ENST00000523731.1	+	1	164	c.31G>A	c.(31-33)Gcc>Acc	p.A11T	INTS8_ENST00000447247.1_Missense_Mutation_p.A11T	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	11					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					CCGGGAGGCGGCCACCTCCAG	0.706																																					p.A11T		Atlas-SNP	.											.	INTS8	92	.	0			c.G31A						PASS	.						7.0	8.0	8.0					8																	95835690		1952	3843	5795	SO:0001583	missense	55656	exon1			GAGGCGGCCACCT	AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.31G>A	chr8.hg19:g.95835690G>A	ENSP00000430338:p.Ala11Thr	68.0	0.0	.		113.0	44.0	.	NM_017864	B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	ENST00000523731.1	hg19	CCDS34925.1	.	.	.	.	.	.	.	.	.	.	g	14.75	2.627809	0.46944	.	.	ENSG00000164941	ENST00000519457;ENST00000523731;ENST00000447247	.	.	.	5.09	3.23	0.37069	.	0.221578	0.46442	N	0.000289	T	0.51719	0.1691	L	0.44542	1.39	0.44937	D	0.997952	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.53265	-0.8463	9	0.54805	T	0.06	-16.2241	10.3689	0.44042	0.0715:0.0:0.7951:0.1334	.	11;11	Q75QN2;Q75QN2-2	INT8_HUMAN;.	T	11	.	ENSP00000343274:A11T	A	+	1	0	INTS8	95904866	1.000000	0.71417	1.000000	0.80357	0.039000	0.13416	6.519000	0.73768	1.347000	0.45714	-0.187000	0.12897	GCC	.	.	.	none		0.706	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864	
DSCC1	79075	hgsc.bcm.edu	37	8	120854141	120854141	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr8:120854141C>A	ENST00000313655.4	-	7	1031	c.817G>T	c.(817-819)Gca>Tca	p.A273S		NM_024094.2	NP_076999.2	Q9BVC3	DCC1_HUMAN	DNA replication and sister chromatid cohesion 1	273					DNA replication (GO:0006260)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|pancreas(1)	9	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			AGCATTCGTGCTGCTGCTCTA	0.358																																					p.A273S		Atlas-SNP	.											.	DSCC1	40	.	0			c.G817T						PASS	.						107.0	92.0	97.0					8																	120854141		2203	4300	6503	SO:0001583	missense	79075	exon7			TTCGTGCTGCTGC		CCDS6330.1	8q24.12	2013-05-24	2013-05-24		ENSG00000136982	ENSG00000136982			24453	protein-coding gene	gene with protein product	"""defective in sister chromatid cohesion homolog 1 (S. cerevisiae)"""	613203	"""defective in sister chromatid cohesion 1 homolog (S. cerevisiae)"""			12766176, 20826785	Standard	NM_024094		Approved	DCC1, hDCC1, MGC5528	uc003yov.3	Q9BVC3	OTTHUMG00000165010	ENST00000313655.4:c.817G>T	chr8.hg19:g.120854141C>A	ENSP00000322180:p.Ala273Ser	74.0	0.0	.		90.0	26.0	.	NM_024094	Q969N5	Missense_Mutation	SNP	ENST00000313655.4	hg19	CCDS6330.1	.	.	.	.	.	.	.	.	.	.	c	24.4	4.524072	0.85600	.	.	ENSG00000136982	ENST00000313655	T	0.56444	0.46	6.14	6.14	0.99180	.	0.000000	0.85682	D	0.000000	T	0.79082	0.4386	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.80324	-0.1430	10	0.62326	D	0.03	-18.737	20.8449	0.99727	0.0:1.0:0.0:0.0	.	273	Q9BVC3	DCC1_HUMAN	S	273	ENSP00000322180:A273S	ENSP00000322180:A273S	A	-	1	0	DSCC1	120923322	1.000000	0.71417	0.537000	0.28052	0.354000	0.29330	7.342000	0.79310	2.933000	0.99390	0.645000	0.84053	GCA	.	.	.	none		0.358	DSCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381443.1	NM_024094	
FAM91A1	157769	hgsc.bcm.edu	37	8	124811759	124811759	+	Splice_Site	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr8:124811759G>A	ENST00000334705.7	+	17	1806		c.e17-1		FAM91A1_ENST00000521166.1_Splice_Site	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1											breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			TATGATTGTAGCATATTGGAC	0.358																																					.		Atlas-SNP	.											.	FAM91A1	77	.	0			c.1561-1G>A						PASS	.						107.0	95.0	99.0					8																	124811759		1869	4092	5961	SO:0001630	splice_region_variant	157769	exon17			ATTGTAGCATATT	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.1561-1G>A	chr8.hg19:g.124811759G>A		75.0	0.0	.		60.0	16.0	.	NM_144963	B6YY23|Q658T5|Q8TE89	Splice_Site	SNP	ENST00000334705.7	hg19	CCDS6346.2	.	.	.	.	.	.	.	.	.	.	G	24.2	4.505033	0.85282	.	.	ENSG00000176853	ENST00000521166;ENST00000334705	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6151	0.95630	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAM91A1	124880940	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	7.885000	0.87282	2.710000	0.92621	0.643000	0.83706	.	.	.	.	none		0.358	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963	Intron
MROH6	642475	hgsc.bcm.edu	37	8	144653908	144653908	+	Silent	SNP	C	C	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr8:144653908C>T	ENST00000398882.3	-	3	787	c.531G>A	c.(529-531)ctG>ctA	p.L177L	MROH6_ENST00000533679.1_5'Flank|RP11-661A12.9_ENST00000531730.1_RNA|MROH6_ENST00000534459.1_5'Flank|MROH6_ENST00000524906.1_5'Flank	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	177																	CCAGTGCGCTCAGCACTCGCA	0.726																																					p.L177L		Atlas-SNP	.											.	.	.	.	0			c.G531A						PASS	.						10.0	15.0	13.0					8																	144653908		2065	4106	6171	SO:0001819	synonymous_variant	642475	exon3			TGCGCTCAGCACT	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.531G>A	chr8.hg19:g.144653908C>T		106.0	0.0	.		200.0	61.0	.	NM_001100878	A8MWB1	Silent	SNP	ENST00000398882.3	hg19	CCDS47928.1																																																																																			.	.	.	none		0.726	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
RABL6	55684	hgsc.bcm.edu	37	9	139718091	139718091	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr9:139718091G>T	ENST00000311502.7	+	2	481	c.245G>T	c.(244-246)aGc>aTc	p.S82I	RABL6_ENST00000432842.2_Missense_Mutation_p.S44I|RABL6_ENST00000371663.4_Missense_Mutation_p.S82I|RP11-216L13.18_ENST00000471502.1_RNA|RABL6_ENST00000357466.2_Missense_Mutation_p.S82I|RABL6_ENST00000371671.4_Missense_Mutation_p.S82I|RABL6_ENST00000371675.3_5'Flank			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	82	Small GTPase-like.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CAGGTCACCAGCATCCACTGG	0.637																																					p.S82I		Atlas-SNP	.											.	.	.	.	0			c.G245T						PASS	.						37.0	44.0	42.0					9																	139718091		2061	4181	6242	SO:0001583	missense	55684	exon2			TCACCAGCATCCA	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.245G>T	chr9.hg19:g.139718091G>T	ENSP00000311134:p.Ser82Ile	46.0	0.0	.		62.0	30.0	.	NM_024718	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Missense_Mutation	SNP	ENST00000311502.7	hg19	CCDS48058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.64|18.64	3.667015|3.667015	0.67814|0.67814	.|.	.|.	ENSG00000196642|ENSG00000196642	ENST00000436380|ENST00000371673;ENST00000371663;ENST00000371671;ENST00000311502;ENST00000357466;ENST00000432842	.|T;T;T;T;T	.|0.66815	.|-0.23;-0.23;-0.23;-0.23;-0.23	4.31|4.31	4.31|4.31	0.51392|0.51392	.|Mitochondrial Rho-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.82029|0.82029	0.4948|0.4948	M|M	0.80332|0.80332	2.49|2.49	0.80722|0.80722	D|D	1|1	.|D;D;D;D;P	.|0.76494	.|0.998;0.993;0.999;0.999;0.745	.|D;D;D;D;P	.|0.87578	.|0.986;0.958;0.997;0.998;0.447	D|D	0.85292|0.85292	0.1068|0.1068	5|10	.|0.72032	.|D	.|0.01	-22.9255|-22.9255	15.3476|15.3476	0.74350|0.74350	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|82;82;82;82;82	.|A8QVZ8;C6K8I5;Q3YEC7-2;Q3YEC7;C6K8I4	.|.;.;.;PARF_HUMAN;.	H|I	38|82;82;82;82;82;44	.|ENSP00000360727:S82I;ENSP00000360736:S82I;ENSP00000311134:S82I;ENSP00000350056:S82I;ENSP00000414081:S44I	.|ENSP00000311134:S82I	Q|S	+|+	3|2	2|0	C9orf86|C9orf86	138837912|138837912	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	9.203000|9.203000	0.95033|0.95033	1.935000|1.935000	0.56089|0.56089	0.313000|0.313000	0.20887|0.20887	CAG|AGC	.	.	.	none		0.637	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055141.4	NM_024718	
ZNF248	57209	hgsc.bcm.edu	37	10	38120750	38120750	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr10:38120750T>G	ENST00000395867.3	-	6	2083	c.1533A>C	c.(1531-1533)caA>caC	p.Q511H	ZNF248_ENST00000374648.3_Intron|ZNF248_ENST00000494133.1_Intron|AL135791.1_ENST00000583461.1_RNA|ZNF248_ENST00000357328.4_Missense_Mutation_p.Q511H	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						TGTGAGTTCTTTGATGTACAA	0.423																																					p.Q511H		Atlas-SNP	.											.	ZNF248	61	.	0			c.A1533C						PASS	.						111.0	107.0	108.0					10																	38120750		2203	4299	6502	SO:0001583	missense	57209	exon6			AGTTCTTTGATGT	AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.1533A>C	chr10.hg19:g.38120750T>G	ENSP00000379208:p.Gln511His	87.0	0.0	.		56.0	41.0	.	NM_001267597	Q8NDV8|Q9UMP3	Missense_Mutation	SNP	ENST00000395867.3	hg19	CCDS7194.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.165662	0.38217	.	.	ENSG00000198105	ENST00000395867;ENST00000357328	T;T	0.36520	1.25;1.25	4.52	-0.28	0.12886	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47455	D	0.000237	T	0.38081	0.1027	L	0.43923	1.385	0.28002	N	0.935245	D	0.61080	0.989	P	0.56127	0.792	T	0.25572	-1.0128	10	0.51188	T	0.08	.	8.0331	0.30476	0.0:0.4007:0.0:0.5993	.	511	Q8NDW4	ZN248_HUMAN	H	511	ENSP00000379208:Q511H;ENSP00000349882:Q511H	ENSP00000349882:Q511H	Q	-	3	2	ZNF248	38160756	0.187000	0.23238	0.999000	0.59377	0.997000	0.91878	0.299000	0.19138	0.059000	0.16252	0.528000	0.53228	CAA	.	.	.	none		0.423	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1	NM_021045	
CCAR1	55749	hgsc.bcm.edu	37	10	70550999	70550999	+	Silent	SNP	C	C	G			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr10:70550999C>G	ENST00000265872.6	+	25	3548	c.3429C>G	c.(3427-3429)tcC>tcG	p.S1143S	CCAR1_ENST00000543719.1_Silent_p.S1128S|CCAR1_ENST00000535016.1_Silent_p.S1128S	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	1143					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						ATCAAAAATCCAAGGAGAATG	0.264																																					p.S1143S		Atlas-SNP	.											.	CCAR1	118	.	0			c.C3429G						PASS	.						69.0	76.0	74.0					10																	70550999		2200	4285	6485	SO:0001819	synonymous_variant	55749	exon25			AAAATCCAAGGAG	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.3429C>G	chr10.hg19:g.70550999C>G		582.0	0.0	.		361.0	237.0	.	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Silent	SNP	ENST00000265872.6	hg19	CCDS7282.1																																																																																			.	.	.	none		0.264	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
GPR26	2849	hgsc.bcm.edu	37	10	125447637	125447637	+	Silent	SNP	C	C	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr10:125447637C>T	ENST00000284674.1	+	3	1028	c.975C>T	c.(973-975)ggC>ggT	p.G325G		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	325					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				GCCTCACAGGCGACTCTCACA	0.562																																					p.G325G		Atlas-SNP	.											.	GPR26	47	.	0			c.C975T						PASS	.						47.0	43.0	44.0					10																	125447637		2203	4300	6503	SO:0001819	synonymous_variant	2849	exon3			CACAGGCGACTCT		CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.975C>T	chr10.hg19:g.125447637C>T		51.0	0.0	.		37.0	20.0	.	NM_153442	Q2M2E2	Silent	SNP	ENST00000284674.1	hg19	CCDS7636.1																																																																																			.	.	.	none		0.562	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050850.1		
IRF7	3665	hgsc.bcm.edu	37	11	613956	613956	+	Missense_Mutation	SNP	G	G	A	rs571836045		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr11:613956G>A	ENST00000397574.2	-	7	1130	c.761C>T	c.(760-762)aCg>aTg	p.T254M	IRF7_ENST00000330243.5_Missense_Mutation_p.T267M|IRF7_ENST00000397570.1_Intron|IRF7_ENST00000348655.6_Intron|IRF7_ENST00000525445.1_Missense_Mutation_p.T148M|IRF7_ENST00000397566.1_Missense_Mutation_p.T267M|IRF7_ENST00000397562.3_De_novo_Start_OutOfFrame	NM_001572.3	NP_001563.2	Q92985	IRF7_HUMAN	interferon regulatory factor 7	254					cellular response to DNA damage stimulus (GO:0006974)|cytokine-mediated signaling pathway (GO:0019221)|establishment of viral latency (GO:0019043)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-alpha production (GO:0032607)|interferon-beta production (GO:0032608)|interferon-gamma-mediated signaling pathway (GO:0060333)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of adaptive immune response (GO:0002819)|regulation of immune response (GO:0050776)|regulation of monocyte differentiation (GO:0045655)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|regulation of MyD88-independent toll-like receptor signaling pathway (GO:0034127)|regulation of type I interferon production (GO:0032479)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTCACCTGTCGTTAGTGCCGC	0.697													g|||	1	0.000199681	0.0008	0.0	5008	,	,		8770	0.0		0.0	False		,,,				2504	0.0				p.T267M		Atlas-SNP	.											.	IRF7	23	.	0			c.C800T						PASS	.						14.0	18.0	16.0					11																	613956		2195	4293	6488	SO:0001583	missense	3665	exon5			CCTGTCGTTAGTG	U53830	CCDS7703.1, CCDS7704.1, CCDS7705.1	11p15.5	2005-10-10			ENSG00000185507	ENSG00000185507			6122	protein-coding gene	gene with protein product		605047					Standard	XM_005252906		Approved		uc001lqh.3	Q92985	OTTHUMG00000132019	ENST00000397574.2:c.761C>T	chr11.hg19:g.613956G>A	ENSP00000380704:p.Thr254Met	79.0	0.0	.		88.0	10.0	.	NM_004031	B9EGL3|O00331|O00332|O00333|O75924|Q9UE79	Missense_Mutation	SNP	ENST00000397574.2	hg19	CCDS7703.1	.	.	.	.	.	.	.	.	.	.	g	5.627	0.300345	0.10678	.	.	ENSG00000185507	ENST00000525445;ENST00000397566;ENST00000397574;ENST00000330243	D;D;D;D	0.96011	-2.92;-3.83;-3.88;-3.83	2.06	-1.94	0.07571	.	.	.	.	.	D	0.84831	0.5559	N	0.03608	-0.345	0.22521	N	0.999023	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.73849	-0.3853	9	0.30854	T	0.27	.	6.3773	0.21515	0.5791:0.0:0.4209:0.0	.	148;254;267	E9PSE3;Q92985;Q92985-4	.;IRF7_HUMAN;.	M	148;267;254;267	ENSP00000434009:T148M;ENSP00000380697:T267M;ENSP00000380704:T254M;ENSP00000329411:T267M	ENSP00000329411:T267M	T	-	2	0	IRF7	603956	0.000000	0.05858	0.002000	0.10522	0.033000	0.12548	-2.121000	0.01322	-0.521000	0.06426	-0.994000	0.02522	ACG	.	.	.	none		0.697	IRF7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255026.1	NM_001572	
MUC2	4583	hgsc.bcm.edu	37	11	1093323	1093323	+	Silent	SNP	C	C	T	rs7948036		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr11:1093323C>T	ENST00000441003.2	+	30	5169	c.5142C>T	c.(5140-5142)acC>acT	p.T1714T	MUC2_ENST00000359061.5_Silent_p.T1681T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.T2T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caacacccaccggcacacaga	0.637																																					p.T1714T		Atlas-SNP	.											.	MUC2	614	.	0			c.C5142T						PASS	.	C		29,3837		0,29,1904	171.0	218.0	202.0		5139	-0.5	0.0	11	dbSNP_116	202	60,7230		0,60,3585	no	coding-synonymous	MUC2	NM_002457.2		0,89,5489	TT,TC,CC		0.823,0.7501,0.7978		1713/2813	1093323	89,11067	1933	3645	5578	SO:0001819	synonymous_variant	4583	exon30			ACCCACCGGCACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5142C>T	chr11.hg19:g.1093323C>T		24.0	0.0	.		31.0	4.0	.	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	hg19																																																																																				.	.	.	weak		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR51B4	79339	hgsc.bcm.edu	37	11	5323073	5323073	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr11:5323073G>A	ENST00000380224.1	-	1	153	c.104C>T	c.(103-105)tCc>tTc	p.S35F	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_033179.2	NP_149419.2	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B, member 4	35					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAAAGGACGGAGAAGTAGAT	0.498																																					p.S35F		Atlas-SNP	.											.	OR51B4	64	.	0			c.C104T						PASS	.						93.0	93.0	93.0					11																	5323073		2201	4297	6498	SO:0001583	missense	79339	exon1			AGGACGGAGAAGT	BC069094	CCDS7757.1	11p15.4	2012-08-09			ENSG00000183251	ENSG00000183251		"""GPCR / Class A : Olfactory receptors"""	14708	protein-coding gene	gene with protein product							Standard	NM_033179		Approved		uc010qza.2	Q9Y5P0	OTTHUMG00000066665	ENST00000380224.1:c.104C>T	chr11.hg19:g.5323073G>A	ENSP00000369573:p.Ser35Phe	166.0	0.0	.		210.0	96.0	.	NM_033179	A7MAV5|Q6NTD7	Missense_Mutation	SNP	ENST00000380224.1	hg19	CCDS7757.1	.	.	.	.	.	.	.	.	.	.	G	9.110	1.006205	0.19199	.	.	ENSG00000183251	ENST00000380224	T	0.03242	4.0	4.39	-0.842	0.10748	.	0.448981	0.18455	N	0.140712	T	0.02727	0.0082	N	0.25485	0.75	0.09310	N	1	B	0.17268	0.021	B	0.19946	0.027	T	0.38308	-0.9667	10	0.59425	D	0.04	.	5.8023	0.18420	0.3677:0.2394:0.3928:0.0	.	35	Q9Y5P0	O51B4_HUMAN	F	35	ENSP00000369573:S35F	ENSP00000369573:S35F	S	-	2	0	OR51B4	5279649	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.874000	0.28065	-0.689000	0.05149	-0.795000	0.03280	TCC	.	.	.	none		0.498	OR51B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142956.2	NM_033179	
TTC17	55761	hgsc.bcm.edu	37	11	43469573	43469573	+	Missense_Mutation	SNP	G	G	A	rs150211914		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr11:43469573G>A	ENST00000039989.4	+	19	2701	c.2687G>A	c.(2686-2688)cGt>cAt	p.R896H		NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	896					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						GACTACCAGCGTCTGGGATGG	0.498																																					p.R896H		Atlas-SNP	.											.	TTC17	112	.	0			c.G2687A						PASS	.	G	HIS/ARG	2,4404	2.1+/-5.4	0,2,2201	85.0	80.0	82.0		2687	6.1	1.0	11	dbSNP_134	82	0,8600		0,0,4300	no	missense	TTC17	NM_018259.5	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	896/1142	43469573	2,13004	2203	4300	6503	SO:0001583	missense	55761	exon19			ACCAGCGTCTGGG	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2687G>A	chr11.hg19:g.43469573G>A	ENSP00000039989:p.Arg896His	83.0	0.0	.		92.0	19.0	.	NM_018259	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	hg19	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.303374	0.60195	4.54E-4	0.0	ENSG00000052841	ENST00000039989	T	0.30182	1.54	6.07	6.07	0.98685	.	0.040651	0.85682	D	0.000000	T	0.12774	0.0310	N	0.08118	0	0.29721	N	0.838639	P	0.49559	0.925	B	0.29353	0.101	T	0.09796	-1.0658	10	0.33141	T	0.24	-6.402	13.8057	0.63230	0.0695:0.0:0.9305:0.0	.	896	Q96AE7	TTC17_HUMAN	H	896	ENSP00000039989:R896H	ENSP00000039989:R896H	R	+	2	0	TTC17	43426149	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.092000	0.76930	2.885000	0.99019	0.655000	0.94253	CGT	.	G|1.000;A|0.000	0.000	weak		0.498	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
CDC42BPG	55561	hgsc.bcm.edu	37	11	64601408	64601408	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr11:64601408G>A	ENST00000342711.5	-	21	2454	c.2455C>T	c.(2455-2457)Cgg>Tgg	p.R819W	CDC42BPG_ENST00000491280.1_5'Flank	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						TCTGAGCTCCGGAAGGACAGG	0.597																																					p.R819W		Atlas-SNP	.											.	CDC42BPG	101	.	0			c.C2455T						PASS	.						192.0	203.0	199.0					11																	64601408		2201	4297	6498	SO:0001583	missense	55561	exon21			AGCTCCGGAAGGA	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.2455C>T	chr11.hg19:g.64601408G>A	ENSP00000345133:p.Arg819Trp	131.0	0.0	.		124.0	47.0	.	NM_017525		Missense_Mutation	SNP	ENST00000342711.5	hg19	CCDS31601.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.620693	0.28889	.	.	ENSG00000171219	ENST00000342711	T	0.68331	-0.32	5.08	-1.14	0.09741	.	1.156120	0.06554	N	0.745533	T	0.44540	0.1298	N	0.08118	0	0.23773	N	0.996881	B	0.06786	0.001	B	0.04013	0.001	T	0.25745	-1.0123	10	0.37606	T	0.19	.	8.5718	0.33574	0.5624:0.0:0.4376:0.0	.	819	Q6DT37	MRCKG_HUMAN	W	819	ENSP00000345133:R819W	ENSP00000345133:R819W	R	-	1	2	CDC42BPG	64357984	0.933000	0.31639	0.989000	0.46669	0.825000	0.46686	-0.228000	0.09114	-0.385000	0.07833	-0.258000	0.10820	CGG	.	.	.	none		0.597	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
TIMM8B	26521	hgsc.bcm.edu	37	11	111956122	111956122	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr11:111956122G>A	ENST00000504148.2	-	2	220	c.149C>T	c.(148-150)tCt>tTt	p.S50F	SDHD_ENST00000532699.1_5'Flank|SDHD_ENST00000528182.1_5'Flank|SDHD_ENST00000525291.1_5'Flank|TIMM8B_ENST00000507614.1_5'UTR|SDHD_ENST00000528021.1_5'Flank|TIMM8B_ENST00000541231.1_Missense_Mutation_p.S65F|SDHD_ENST00000526592.1_5'Flank|SDHD_ENST00000528048.1_5'Flank|SDHD_ENST00000375549.3_5'Flank	NM_012459.2	NP_036591.2	Q9Y5J9	TIM8B_HUMAN	translocase of inner mitochondrial membrane 8 homolog B (yeast)	50					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein transport (GO:0072321)|protein targeting to mitochondrion (GO:0006626)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space protein transporter complex (GO:0042719)	zinc ion binding (GO:0008270)			large_intestine(1)	1		all_cancers(61;1.84e-10)|all_epithelial(67;9.33e-06)|Melanoma(852;4.01e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;6.01e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.03e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0512)		TTCAGTGCGAGAGTCTAGGCG	0.473																																					p.S65F		Atlas-SNP	.											.	TIMM8B	13	.	0			c.C194T						PASS	.						136.0	109.0	118.0					11																	111956122		2201	4297	6498	SO:0001583	missense	26521	exon2			GTGCGAGAGTCTA	AF150087	CCDS8357.1, CCDS8357.2	11q23.1-q23.2	2010-11-23	2001-11-28		ENSG00000150779	ENSG00000150779			11818	protein-coding gene	gene with protein product	"""mitochondrial import inner membrane translocase subunit Tim8 B"""	606659	"""translocase of inner mitochondrial membrane 8 (yeast) homolog B"""			10552927	Standard	NM_012459		Approved	TIM8B, DDP2, FLJ21744, MGC102866, MGC117373	uc001pmx.3	Q9Y5J9	OTTHUMG00000162261	ENST00000504148.2:c.149C>T	chr11.hg19:g.111956122G>A	ENSP00000422122:p.Ser50Phe	104.0	0.0	.		76.0	27.0	.	NM_012459	B0YJA5|Q3KQS9|Q9UN04	Missense_Mutation	SNP	ENST00000504148.2	hg19		.	.	.	.	.	.	.	.	.	.	G	21.2	4.110278	0.77210	.	.	ENSG00000150779	ENST00000504148;ENST00000541231	T;T	0.66460	-0.21;-0.21	5.56	5.56	0.83823	.	0.293556	0.38663	N	0.001618	T	0.75443	0.3850	.	.	.	0.45239	D	0.998241	D	0.53745	0.962	P	0.51615	0.675	T	0.78489	-0.2184	9	0.87932	D	0	-15.0727	18.3499	0.90335	0.0:0.0:1.0:0.0	.	50	Q9Y5J9	TIM8B_HUMAN	F	50;65	ENSP00000422122:S50F;ENSP00000438455:S65F	ENSP00000422122:S50F	S	-	2	0	TIMM8B	111461332	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.523000	0.53488	2.645000	0.89757	0.549000	0.68633	TCT	.	.	.	none		0.473	TIMM8B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000368270.2	NM_012459	
WNK1	65125	hgsc.bcm.edu	37	12	1005251	1005251	+	Silent	SNP	A	A	G			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr12:1005251A>G	ENST00000315939.6	+	24	6241	c.5598A>G	c.(5596-5598)gcA>gcG	p.A1866A	WNK1_ENST00000530271.2_Silent_p.A2364A|WNK1_ENST00000535572.1_Silent_p.A1618A|WNK1_ENST00000537687.1_Silent_p.A2126A|WNK1_ENST00000340908.4_Silent_p.A1459A	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1866					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CTGTTGCAGCAGACGGTGCCC	0.358																																					p.A2126A	Colon(19;451 567 6672 12618 28860)	Atlas-SNP	.											.	WNK1	403	.	0			c.A6378G						PASS	.						73.0	75.0	75.0					12																	1005251		2203	4300	6503	SO:0001819	synonymous_variant	65125	exon24			TGCAGCAGACGGT	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.5598A>G	chr12.hg19:g.1005251A>G		144.0	0.0	.		149.0	59.0	.	NM_001184985	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	hg19	CCDS8506.1																																																																																			.	.	.	none		0.358	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
SCNN1A	6337	hgsc.bcm.edu	37	12	6472823	6472823	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr12:6472823G>A	ENST00000228916.2	-	3	568	c.470C>T	c.(469-471)aCg>aTg	p.T157M	SCNN1A_ENST00000358945.3_Missense_Mutation_p.T157M|SCNN1A_ENST00000540037.1_De_novo_Start_OutOfFrame|SCNN1A_ENST00000396966.2_Missense_Mutation_p.T157M|SCNN1A_ENST00000360168.3_Missense_Mutation_p.T216M|SCNN1A_ENST00000543768.1_Missense_Mutation_p.T180M|SCNN1A_ENST00000538979.1_Intron	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	157					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	GTCAAAGAGCGTCTGCTCTGT	0.647																																					p.T216M		Atlas-SNP	.											.	SCNN1A	54	.	0			c.C647T						PASS	.						34.0	38.0	37.0					12																	6472823		2203	4300	6503	SO:0001583	missense	6337	exon2			AAGAGCGTCTGCT	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.470C>T	chr12.hg19:g.6472823G>A	ENSP00000228916:p.Thr157Met	86.0	0.0	.		86.0	32.0	.	NM_001159576	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Missense_Mutation	SNP	ENST00000228916.2	hg19	CCDS8543.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009860	0.75046	.	.	ENSG00000111319	ENST00000360168;ENST00000358945;ENST00000228916;ENST00000396966;ENST00000543768	T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000003	T	0.75064	0.3799	M	0.82517	2.595	0.47819	D	0.999528	D;D;D	0.63880	0.993;0.993;0.976	P;P;B	0.52109	0.69;0.56;0.301	T	0.80188	-0.1486	10	0.87932	D	0	-10.8711	16.8039	0.85621	0.0:0.0:1.0:0.0	.	180;157;216	B4E2Q5;P37088;P37088-2	.;SCNNA_HUMAN;.	M	216;157;157;157;180	ENSP00000353292:T216M;ENSP00000351825:T157M;ENSP00000228916:T157M;ENSP00000380166:T157M;ENSP00000438739:T180M	ENSP00000228916:T157M	T	-	2	0	SCNN1A	6343084	1.000000	0.71417	1.000000	0.80357	0.451000	0.32288	4.654000	0.61469	2.535000	0.85469	0.561000	0.74099	ACG	.	.	.	none		0.647	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399055.1		
ITGA5	3678	hgsc.bcm.edu	37	12	54792434	54792434	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr12:54792434G>C	ENST00000293379.4	-	28	3151	c.2890C>G	c.(2890-2892)Ctg>Gtg	p.L964V	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	964					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						GGCATCTTCAGGGCTTTGTAC	0.572																																					p.L964V		Atlas-SNP	.											.	ITGA5	99	.	0			c.C2890G						PASS	.						105.0	91.0	95.0					12																	54792434		2203	4300	6503	SO:0001583	missense	3678	exon28			TCTTCAGGGCTTT		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.2890C>G	chr12.hg19:g.54792434G>C	ENSP00000293379:p.Leu964Val	82.0	0.0	.		94.0	36.0	.	NM_002205	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	hg19	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.552305	0.45487	.	.	ENSG00000161638	ENST00000293379	T	0.21932	1.98	5.36	1.45	0.22620	.	0.287995	0.31897	N	0.006894	T	0.10809	0.0264	L	0.34521	1.04	0.22601	N	0.998941	P	0.44986	0.847	B	0.35278	0.199	T	0.22312	-1.0220	10	0.31617	T	0.26	.	5.3109	0.15829	0.2368:0.0:0.6205:0.1427	.	964	P08648	ITA5_HUMAN	V	964	ENSP00000293379:L964V	ENSP00000293379:L964V	L	-	1	2	ITGA5	53078701	0.361000	0.24972	0.984000	0.44739	0.992000	0.81027	1.036000	0.30228	0.069000	0.16605	0.655000	0.94253	CTG	.	.	.	none		0.572	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
EFS	10278	hgsc.bcm.edu	37	14	23828684	23828684	+	Missense_Mutation	SNP	G	G	A	rs147068550		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr14:23828684G>A	ENST00000216733.3	-	4	1610	c.1003C>T	c.(1003-1005)Cgg>Tgg	p.R335W	EFS_ENST00000429593.2_Missense_Mutation_p.R166W|RP11-124D2.3_ENST00000554010.1_RNA|EFS_ENST00000351354.3_Missense_Mutation_p.R242W	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	335	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		GGCAGAGGCCGGTCCTGGATG	0.721																																					p.R335W		Atlas-SNP	.											.	EFS	37	.	0			c.C1003T						PASS	.	G	TRP/ARG,TRP/ARG	0,3888		0,0,1944	22.0	24.0	23.0		1003,724	1.2	1.0	14	dbSNP_134	23	2,7684		0,2,3841	no	missense,missense	EFS	NM_005864.2,NM_032459.1	101,101	0,2,5785	AA,AG,GG		0.026,0.0,0.0173	probably-damaging,probably-damaging	335/562,242/469	23828684	2,11572	1944	3843	5787	SO:0001583	missense	10278	exon4			GAGGCCGGTCCTG	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.1003C>T	chr14.hg19:g.23828684G>A	ENSP00000216733:p.Arg335Trp	25.0	0.0	.		39.0	14.0	.	NM_005864	B2RAJ7|B4DJ56|E9PGU2|O43282	Missense_Mutation	SNP	ENST00000216733.3	hg19	CCDS9595.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629049	0.67015	0.0	2.6E-4	ENSG00000100842	ENST00000216733;ENST00000351354;ENST00000429593	T;T;T	0.69926	-0.44;0.28;0.39	5.43	1.23	0.21249	.	0.510812	0.18859	N	0.129190	T	0.71945	0.3400	L	0.34521	1.04	0.41759	D	0.989702	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.942;0.976	T	0.71820	-0.4477	10	0.72032	D	0.01	-19.2141	14.0841	0.64944	0.0:0.0:0.4685:0.5314	.	166;242;335	B4DJ56;O43281-2;O43281	.;.;EFS_HUMAN	W	335;242;166	ENSP00000216733:R335W;ENSP00000340607:R242W;ENSP00000416684:R166W	ENSP00000216733:R335W	R	-	1	2	EFS	22898524	0.979000	0.34478	0.998000	0.56505	0.996000	0.88848	0.152000	0.16302	-0.050000	0.13356	0.655000	0.94253	CGG	.	G|1.000;A|0.000	0.000	weak		0.721	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2		
RIPK3	11035	hgsc.bcm.edu	37	14	24807103	24807103	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr14:24807103G>T	ENST00000216274.5	-	6	1026	c.808C>A	c.(808-810)Ccc>Acc	p.P270T	RP11-934B9.3_ENST00000555591.1_5'Flank|RIPK3_ENST00000554338.1_5'Flank|ADCY4_ENST00000554068.2_5'Flank|ADCY4_ENST00000558563.1_5'Flank|ADCY4_ENST00000310677.4_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	270	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		CTGTCCTTGGGCTCACTGCTC	0.572																																					p.P270T	Pancreas(58;918 1191 4668 13304 15331)	Atlas-SNP	.											.	RIPK3	43	.	0			c.C808A						PASS	.						63.0	65.0	64.0					14																	24807103		2203	4300	6503	SO:0001583	missense	11035	exon6			CCTTGGGCTCACT	AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.808C>A	chr14.hg19:g.24807103G>T	ENSP00000216274:p.Pro270Thr	97.0	0.0	.		81.0	31.0	.	NM_006871	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Missense_Mutation	SNP	ENST00000216274.5	hg19	CCDS9628.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.797112	0.50208	.	.	ENSG00000129465	ENST00000216274	T	0.70986	-0.53	4.46	2.59	0.31030	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.278577	0.26268	N	0.025359	D	0.83760	0.5324	M	0.90252	3.1	0.09310	N	0.999996	D	0.71674	0.998	D	0.68353	0.957	T	0.74494	-0.3647	10	0.72032	D	0.01	-9.3819	9.2661	0.37641	0.1827:0.0:0.8173:0.0	.	270	Q9Y572	RIPK3_HUMAN	T	270	ENSP00000216274:P270T	ENSP00000216274:P270T	P	-	1	0	RIPK3	23876943	0.994000	0.37717	0.031000	0.17742	0.005000	0.04900	2.658000	0.46733	0.789000	0.33779	0.655000	0.94253	CCC	.	.	.	none		0.572	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871	
SYT16	83851	hgsc.bcm.edu	37	14	62462841	62462842	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T|A	T|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr14:62462841_62462842TA>AT	ENST00000430451.2	+	1	301_302	c.104_105TA>AT	c.(103-105)tTA>tAT	p.L35Y	SYT16_ENST00000446982.2_Missense_Mutation_p.L35Y	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	35					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GGAGATATGTTATCTGCTTCGC	0.421																																					p.L35X|p.L35F		Atlas-SNP	.											.	SYT16	144	.	0			c.T104A|c.A105T						PASS	.																																			SO:0001583	missense	83851	exon1			ATATGTTATCTGC|TATGTTATCTGCT	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	Exception_encountered	chr14.hg19:g.62462841_62462842delinsAT	ENSP00000394700:p.Leu35Tyr	133.0	0.0	.		136.0	47.0|46.0	.	NM_031914	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000430451.2	hg19	CCDS45121.1																																																																																			.	.	.	none		0.421	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
AHNAK2	113146	hgsc.bcm.edu	37	14	105408237	105408237	+	Silent	SNP	G	G	A	rs574414313		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr14:105408237G>A	ENST00000333244.5	-	7	13670	c.13551C>T	c.(13549-13551)tcC>tcT	p.S4517S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4517						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCAGGTCGGCGGAAGGGGCCT	0.622													-|||	1	0.000199681	0.0	0.0	5008	,	,		19322	0.0		0.001	False		,,,				2504	0.0				p.S4517S		Atlas-SNP	.											.	AHNAK2	719	.	0			c.C13551T						PASS	.						107.0	116.0	113.0					14																	105408237		1972	4154	6126	SO:0001819	synonymous_variant	113146	exon7			GTCGGCGGAAGGG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13551C>T	chr14.hg19:g.105408237G>A		143.0	0.0	.		117.0	54.0	.	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	hg19	CCDS45177.1																																																																																			.	.	.	none		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
VPS39	23339	hgsc.bcm.edu	37	15	42456665	42456665	+	Silent	SNP	A	A	G			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr15:42456665A>G	ENST00000348544.4	-	20	1949	c.1950T>C	c.(1948-1950)gcT>gcC	p.A650A	VPS39_ENST00000318006.5_Silent_p.A639A			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	650					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		CTTCCTCTCCAGCTGGGACTG	0.493																																					p.A639A		Atlas-SNP	.											.	VPS39	53	.	0			c.T1917C						PASS	.						61.0	61.0	61.0					15																	42456665		2203	4299	6502	SO:0001819	synonymous_variant	23339	exon19			CTCTCCAGCTGGG	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.1950T>C	chr15.hg19:g.42456665A>G		61.0	0.0	.		77.0	31.0	.	NM_015289	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Silent	SNP	ENST00000348544.4	hg19	CCDS10083.1																																																																																			.	.	.	none		0.493	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
DUOXA1	90527	hgsc.bcm.edu	37	15	45411430	45411430	+	Silent	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr15:45411430G>A	ENST00000560572.1	-	6	911	c.906C>T	c.(904-906)ctC>ctT	p.L302L	DUOXA1_ENST00000430224.2_Silent_p.L257L|DUOXA1_ENST00000267803.4_Silent_p.L302L|DUOXA1_ENST00000558422.1_Silent_p.L257L|DUOXA1_ENST00000559014.1_Silent_p.L302L|DUOXA1_ENST00000558996.1_Silent_p.L257L	NM_001276266.1	NP_001263195.1	Q1HG43	DOXA1_HUMAN	dual oxidase maturation factor 1	302					hydrogen peroxide metabolic process (GO:0042743)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(109;6.02e-08)|all_epithelial(112;1.83e-06)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.82e-18)|GBM - Glioblastoma multiforme(94;4.39e-07)|COAD - Colon adenocarcinoma(120;0.0676)|Colorectal(133;0.0686)		GGGGGCTCAGGAGTCCACCTT	0.597																																					p.L302L		Atlas-SNP	.											.	DUOXA1	32	.	0			c.C906T						PASS	.						76.0	74.0	75.0					15																	45411430		2198	4298	6496	SO:0001819	synonymous_variant	90527	exon9			GCTCAGGAGTCCA	BC029819	CCDS10119.1, CCDS61619.1, CCDS61620.1, CCDS61621.1	15q21.1	2006-11-29	2006-01-23	2006-07-25	ENSG00000140254	ENSG00000140254			26507	protein-coding gene	gene with protein product		612771				16651268	Standard	NM_144565		Approved	FLJ32334, NUMBIP, NIP, mol	uc010bec.4	Q1HG43	OTTHUMG00000131352	ENST00000560572.1:c.906C>T	chr15.hg19:g.45411430G>A		79.0	0.0	.		130.0	56.0	.	NM_144565	Q8N6K9|Q96MI4	Silent	SNP	ENST00000560572.1	hg19																																																																																				.	.	.	none		0.597	DUOXA1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000416242.1	NM_144565	
MYO9A	4649	hgsc.bcm.edu	37	15	72192260	72192260	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr15:72192260G>C	ENST00000356056.5	-	24	3710	c.3238C>G	c.(3238-3240)Ctt>Gtt	p.L1080V	MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000564571.1_Missense_Mutation_p.L1080V|MYO9A_ENST00000566885.1_Missense_Mutation_p.L700V|MYO9A_ENST00000444904.1_Missense_Mutation_p.L1061V|MYO9A_ENST00000424560.1_Missense_Mutation_p.L1080V	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1080	IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.|Neck or regulatory domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GCTTGGAGAAGAGCAGCTGCA	0.488																																					p.L1080V		Atlas-SNP	.											.	MYO9A	203	.	0			c.C3238G						PASS	.						63.0	63.0	63.0					15																	72192260		2199	4297	6496	SO:0001583	missense	4649	exon24			GGAGAAGAGCAGC	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.3238C>G	chr15.hg19:g.72192260G>C	ENSP00000348349:p.Leu1080Val	58.0	0.0	.		72.0	28.0	.	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	hg19	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	G	4.193	0.034411	0.08101	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864	T;T;T	0.71817	-0.58;-0.59;-0.6	5.66	-1.37	0.09056	.	.	.	.	.	T	0.44435	0.1293	N	0.11927	0.2	0.09310	N	1	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.10450	0.003;0.002;0.005	T	0.23797	-1.0178	9	0.17832	T	0.49	.	4.621	0.12449	0.0687:0.2989:0.1867:0.4456	.	1061;1061;1080	B2RTY4-2;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	V	1080;1080;1061;1061	ENSP00000348349:L1080V;ENSP00000399162:L1080V;ENSP00000398250:L1061V	ENSP00000261864:L1061V	L	-	1	0	MYO9A	69979314	0.000000	0.05858	0.020000	0.16555	0.931000	0.56810	-0.735000	0.04888	0.087000	0.17167	0.655000	0.94253	CTT	.	.	.	none		0.488	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
SLC28A1	9154	hgsc.bcm.edu	37	15	85452001	85452001	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr15:85452001T>C	ENST00000286749.3	+	8	860	c.770T>C	c.(769-771)cTg>cCg	p.L257P	SLC28A1_ENST00000537624.1_Missense_Mutation_p.L257P|SLC28A1_ENST00000537216.1_Missense_Mutation_p.L257P|SLC28A1_ENST00000394573.1_Missense_Mutation_p.L257P|SLC28A1_ENST00000537703.1_Missense_Mutation_p.L179P|SLC28A1_ENST00000538177.1_Missense_Mutation_p.L257P			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	257					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	GGGGAGGCGCTGGTCAAGGAT	0.547																																					p.L257P		Atlas-SNP	.											.	SLC28A1	118	.	0			c.T770C						PASS	.						81.0	79.0	80.0					15																	85452001		2203	4299	6502	SO:0001583	missense	9154	exon9			AGGCGCTGGTCAA	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.770T>C	chr15.hg19:g.85452001T>C	ENSP00000286749:p.Leu257Pro	49.0	0.0	.		56.0	24.0	.	NM_004213	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	ENST00000286749.3	hg19	CCDS10334.1	.	.	.	.	.	.	.	.	.	.	T	11.25	1.582919	0.28268	.	.	ENSG00000156222	ENST00000537216;ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573;ENST00000537703	T;T;T;T;T;T	0.04603	4.33;4.06;4.52;4.5;4.5;3.59	4.59	4.59	0.56863	.	0.071749	0.56097	D	0.000021	T	0.23727	0.0574	M	0.88310	2.945	0.80722	D	1	D;B;D;B;D	0.89917	1.0;0.149;1.0;0.106;1.0	D;B;D;B;D	0.87578	0.992;0.115;0.998;0.183;0.991	T	0.01360	-1.1375	10	0.72032	D	0.01	-2.9199	10.289	0.43584	0.0:0.0:0.0:1.0	.	257;257;257;179;257	B7Z533;F5H560;B7Z3L6;B7Z3M4;O00337	.;.;.;.;S28A1_HUMAN	P	257;257;257;257;257;179	ENSP00000440546:L257P;ENSP00000443752:L257P;ENSP00000444700:L257P;ENSP00000286749:L257P;ENSP00000378074:L257P;ENSP00000443764:L179P	ENSP00000286749:L257P	L	+	2	0	SLC28A1	83253005	1.000000	0.71417	0.955000	0.39395	0.184000	0.23303	5.694000	0.68272	1.930000	0.55929	0.459000	0.35465	CTG	.	.	.	none		0.547	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2		
AKAP13	11214	hgsc.bcm.edu	37	15	86122639	86122639	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr15:86122639A>C	ENST00000394518.2	+	7	1435	c.1340A>C	c.(1339-1341)cAg>cCg	p.Q447P	AKAP13_ENST00000361243.2_Missense_Mutation_p.Q447P|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	447					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GCTGTGCTTCAGAGAGACTTG	0.517																																					p.Q447P	Melanoma(94;603 1453 3280 32295 32951)	Atlas-SNP	.											.	AKAP13	394	.	0			c.A1340C						PASS	.						63.0	67.0	65.0					15																	86122639		2202	4299	6501	SO:0001583	missense	11214	exon7			TGCTTCAGAGAGA	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1340A>C	chr15.hg19:g.86122639A>C	ENSP00000378026:p.Gln447Pro	159.0	0.0	.		207.0	94.0	.	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	hg19	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	A	10.85	1.467257	0.26335	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.12361	2.71;2.69	5.3	-3.83	0.04269	.	.	.	.	.	T	0.08403	0.0209	L	0.29908	0.895	0.09310	N	0.999999	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.33650	-0.9860	9	0.51188	T	0.08	.	5.4318	0.16458	0.2672:0.5391:0.0749:0.1188	.	447;447	Q12802;Q12802-2	AKP13_HUMAN;.	P	447;447;446;446	ENSP00000354718:Q447P;ENSP00000378026:Q447P	ENSP00000354718:Q447P	Q	+	2	0	AKAP13	83923643	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.075000	0.11431	-0.915000	0.03823	-0.374000	0.07098	CAG	.	.	.	none		0.517	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
TMC5	79838	hgsc.bcm.edu	37	16	19474683	19474683	+	Silent	SNP	T	T	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr16:19474683T>A	ENST00000396229.2	+	7	1979	c.1230T>A	c.(1228-1230)atT>atA	p.I410I	TMC5_ENST00000219821.5_Silent_p.I164I|TMC5_ENST00000381414.4_Silent_p.I410I|TMC5_ENST00000561503.1_Silent_p.I51I|TMC5_ENST00000541464.1_Silent_p.I410I|TMC5_ENST00000564959.1_Silent_p.I93I|TMC5_ENST00000542583.2_Silent_p.I410I	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	410					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TGAACTCCATTTCCCGGGTAA	0.458																																					p.I410I		Atlas-SNP	.											.	TMC5	169	.	0			c.T1230A						PASS	.						118.0	108.0	111.0					16																	19474683		2197	4300	6497	SO:0001819	synonymous_variant	79838	exon7			CTCCATTTCCCGG	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1230T>A	chr16.hg19:g.19474683T>A		109.0	0.0	.		78.0	30.0	.	NM_001105249	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Silent	SNP	ENST00000396229.2	hg19	CCDS45431.1																																																																																			.	.	.	none		0.458	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
RBBP6	5930	hgsc.bcm.edu	37	16	24578519	24578519	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr16:24578519T>C	ENST00000319715.4	+	15	2077	c.1645T>C	c.(1645-1647)Tca>Cca	p.S549P	RBBP6_ENST00000348022.2_Missense_Mutation_p.S549P|RBBP6_ENST00000381039.3_Intron	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	549					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		TCAAGGCCCGTCACTACCAGC	0.488																																					p.S549P		Atlas-SNP	.											.	RBBP6	158	.	0			c.T1645C						PASS	.						169.0	155.0	160.0					16																	24578519		2197	4300	6497	SO:0001583	missense	5930	exon15			GGCCCGTCACTAC		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.1645T>C	chr16.hg19:g.24578519T>C	ENSP00000317872:p.Ser549Pro	108.0	0.0	.		125.0	40.0	.	NM_018703	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	hg19	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.949100	0.34377	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.14893	2.47;2.47	5.8	5.8	0.92144	.	0.000000	0.41396	D	0.000886	T	0.11836	0.0288	N	0.19112	0.55	0.33759	D	0.621639	B;B	0.11235	0.004;0.002	B;B	0.11329	0.006;0.003	T	0.13710	-1.0499	10	0.32370	T	0.25	-13.6566	11.5317	0.50614	0.1922:0.0:0.0:0.8078	.	549;549	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	P	549	ENSP00000317872:S549P;ENSP00000316291:S549P	ENSP00000317872:S549P	S	+	1	0	RBBP6	24486020	0.989000	0.36119	1.000000	0.80357	0.991000	0.79684	1.675000	0.37555	2.209000	0.71365	0.460000	0.39030	TCA	.	.	.	none		0.488	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
BCKDK	10295	hgsc.bcm.edu	37	16	31121525	31121525	+	Splice_Site	SNP	G	G	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr16:31121525G>T	ENST00000394951.1	+	7	1046		c.e7-1		AC135050.1_ENST00000517000.2_RNA|BCKDK_ENST00000219794.6_Splice_Site|BCKDK_ENST00000394950.3_Splice_Site|BCKDK_ENST00000287507.3_Splice_Site			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase						branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|stomach(1)	2						GTGACCTGCAGATCAAGGACC	0.617																																					.		Atlas-SNP	.											.	BCKDK	52	.	0			c.424-1G>T						PASS	.						93.0	91.0	92.0					16																	31121525		2197	4300	6497	SO:0001630	splice_region_variant	10295	exon6			CCTGCAGATCAAG	AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.424-1G>T	chr16.hg19:g.31121525G>T		79.0	0.0	.		78.0	32.0	.	NM_001271926	A8MY43|Q6FGL4|Q96G95|Q96IN5	Splice_Site	SNP	ENST00000394951.1	hg19	CCDS10705.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947194	0.73672	.	.	ENSG00000103507	ENST00000394951;ENST00000219794;ENST00000394950;ENST00000287507	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4154	0.90568	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BCKDK	31029026	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	8.797000	0.91882	2.720000	0.93068	0.655000	0.94253	.	.	.	.	none		0.617	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108514.1	NM_005881	Intron
SRR	63826	hgsc.bcm.edu	37	17	2226627	2226627	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr17:2226627G>T	ENST00000344595.5	+	7	1110	c.792G>T	c.(790-792)gaG>gaT	p.E264D	SRR_ENST00000576848.1_Missense_Mutation_p.E38D|TSR1_ENST00000301364.5_3'UTR	NM_021947.1	NP_068766.1	Q9GZT4	SRR_HUMAN	serine racemase	264					aging (GO:0007568)|brain development (GO:0007420)|D-serine biosynthetic process (GO:0070179)|D-serine metabolic process (GO:0070178)|L-serine metabolic process (GO:0006563)|protein homotetramerization (GO:0051289)|pyruvate biosynthetic process (GO:0042866)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|serine family amino acid metabolic process (GO:0009069)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|D-serine ammonia-lyase activity (GO:0008721)|glycine binding (GO:0016594)|L-serine ammonia-lyase activity (GO:0003941)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|serine racemase activity (GO:0030378)|threonine racemase activity (GO:0018114)			NS(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;3.24e-06)|READ - Rectum adenocarcinoma(1115;0.0649)	L-Serine(DB00133)	CTGTCACAGAGGATGAAATTA	0.448																																					p.E264D		Atlas-SNP	.											.	SRR	21	.	0			c.G792T						PASS	.						103.0	97.0	99.0					17																	2226627		2203	4300	6503	SO:0001583	missense	63826	exon7			CACAGAGGATGAA	AF169974	CCDS11017.1	17p13	2007-01-18			ENSG00000167720	ENSG00000167720			14398	protein-coding gene	gene with protein product		606477				17067558, 15953485, 15193426	Standard	NM_021947		Approved	ILV1, ISO1	uc002fue.1	Q9GZT4	OTTHUMG00000090583	ENST00000344595.5:c.792G>T	chr17.hg19:g.2226627G>T	ENSP00000339435:p.Glu264Asp	172.0	0.0	.		144.0	17.0	.	NM_021947	D3DTI5|Q6IA55	Missense_Mutation	SNP	ENST00000344595.5	hg19	CCDS11017.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.517749	0.27123	.	.	ENSG00000167720	ENST00000344595	D	0.96365	-3.99	5.88	2.55	0.30701	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	D	0.92041	0.7478	L	0.35487	1.065	0.80722	D	1	B	0.28713	0.22	B	0.37422	0.249	D	0.83449	0.0047	10	0.06365	T	0.9	-30.1951	9.8933	0.41302	0.2377:0.0:0.7623:0.0	.	264	Q9GZT4	SRR_HUMAN	D	264	ENSP00000339435:E264D	ENSP00000339435:E264D	E	+	3	2	SRR	2173377	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.152000	0.42272	0.297000	0.22615	0.555000	0.69702	GAG	.	.	.	none		0.448	SRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207129.2	NM_021947	
ZNF594	84622	hgsc.bcm.edu	37	17	5085263	5085263	+	Nonsense_Mutation	SNP	A	A	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr17:5085263A>T	ENST00000399604.4	-	1	2429	c.2289T>A	c.(2287-2289)tgT>tgA	p.C763*	ZNF594_ENST00000575779.1_Nonsense_Mutation_p.C763*			Q96JF6	ZN594_HUMAN	zinc finger protein 594	763					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TACACTGATTACACCAATAAA	0.408																																					p.C763X		Atlas-SNP	.											.	ZNF594	89	.	0			c.T2289A						PASS	.						208.0	210.0	209.0					17																	5085263		1983	4172	6155	SO:0001587	stop_gained	84622	exon2			CTGATTACACCAA	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.2289T>A	chr17.hg19:g.5085263A>T	ENSP00000382513:p.Cys763*	90.0	0.0	.		94.0	33.0	.	NM_032530	Q6RFS0	Nonsense_Mutation	SNP	ENST00000399604.4	hg19	CCDS42241.1	.	.	.	.	.	.	.	.	.	.	A	29.6	5.023323	0.93462	.	.	ENSG00000180626	ENST00000399604	.	.	.	1.04	1.04	0.20106	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9142	0.19045	1.0:0.0:0.0:0.0	.	.	.	.	X	763	.	ENSP00000382513:C763X	C	-	3	2	ZNF594	5025987	0.055000	0.20627	0.019000	0.16419	0.154000	0.21943	0.151000	0.16283	0.418000	0.25898	0.248000	0.18094	TGT	.	.	.	none		0.408	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	XM_290737	
GRN	2896	hgsc.bcm.edu	37	17	42427873	42427873	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr17:42427873A>C	ENST00000053867.3	+	6	588	c.526A>C	c.(526-528)Acc>Ccc	p.T176P	GRN_ENST00000589265.1_Intron	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	176					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CCTGGTTCACACCCGCTGCAT	0.617											OREG0024459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T176P		Atlas-SNP	.											.	GRN	51	.	0			c.A526C						PASS	.						116.0	111.0	112.0					17																	42427873		2203	4300	6503	SO:0001583	missense	2896	exon6			GTTCACACCCGCT	M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.526A>C	chr17.hg19:g.42427873A>C	ENSP00000053867:p.Thr176Pro	54.0	0.0	.	908	62.0	8.0	.	NM_002087	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Missense_Mutation	SNP	ENST00000053867.3	hg19	CCDS11483.1	.	.	.	.	.	.	.	.	.	.	A	8.948	0.967566	0.18659	.	.	ENSG00000030582	ENST00000053867;ENST00000357351	T	0.72615	-0.67	4.43	-0.595	0.11660	Granulin (2);	1.360170	0.04868	N	0.445459	T	0.60932	0.2307	L	0.34521	1.04	0.09310	N	1	B	0.33238	0.403	B	0.41691	0.364	T	0.48906	-0.8993	10	0.24483	T	0.36	-3.2852	2.7752	0.05345	0.2261:0.0:0.3737:0.4002	.	176	P28799	GRN_HUMAN	P	176	ENSP00000053867:T176P	ENSP00000053867:T176P	T	+	1	0	GRN	39783399	0.004000	0.15560	0.004000	0.12327	0.017000	0.09413	1.212000	0.32394	0.021000	0.15133	-0.464000	0.05259	ACC	.	.	.	none		0.617	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	NM_002087	
GREB1L	80000	hgsc.bcm.edu	37	18	19031043	19031043	+	Nonsense_Mutation	SNP	G	G	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr18:19031043G>T	ENST00000580732.2	+	13	2161	c.1780G>T	c.(1780-1782)Gaa>Taa	p.E594*	GREB1L_ENST00000400483.4_Nonsense_Mutation_p.E594*|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000578368.1_3'UTR|SNORD23_ENST00000408212.1_RNA|GREB1L_ENST00000431264.1_Nonsense_Mutation_p.E594*|GREB1L_ENST00000269218.6_Nonsense_Mutation_p.E485*|GREB1L_ENST00000424526.1_Nonsense_Mutation_p.E594*			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	594						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GTTTTTGAAAGAAATTAGTTA	0.458																																					p.E594X		Atlas-SNP	.											.	GREB1L	69	.	0			c.G1780T						PASS	.						87.0	83.0	84.0					18																	19031043		692	1591	2283	SO:0001587	stop_gained	80000	exon13			TTGAAAGAAATTA	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.1780G>T	chr18.hg19:g.19031043G>T	ENSP00000464162:p.Glu594*	93.0	0.0	.		87.0	9.0	.	NM_001142966	A4QN17|Q9H8F1	Nonsense_Mutation	SNP	ENST00000580732.2	hg19	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	G	41	8.659604	0.98903	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	0.6021	20.6452	0.99591	0.0:0.0:1.0:0.0	.	.	.	.	X	594;485;594;594	.	ENSP00000269218:E485X	E	+	1	0	GREB1L	17285041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.472000	0.97709	2.886000	0.99085	0.650000	0.86243	GAA	.	.	.	none		0.458	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
ESCO1	114799	hgsc.bcm.edu	37	18	19154134	19154134	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr18:19154134G>A	ENST00000269214.5	-	4	1608	c.671C>T	c.(670-672)tCt>tTt	p.S224F		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	224					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						ACACTTTTCAGATCCTTGCGT	0.408																																					p.S224F		Atlas-SNP	.											.	ESCO1	89	.	0			c.C671T						PASS	.						167.0	163.0	164.0					18																	19154134		2203	4300	6503	SO:0001583	missense	114799	exon4			TTTTCAGATCCTT	AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.671C>T	chr18.hg19:g.19154134G>A	ENSP00000269214:p.Ser224Phe	52.0	0.0	.		50.0	20.0	.	NM_052911	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	ENST00000269214.5	hg19	CCDS32800.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443142	0.25987	.	.	ENSG00000141446	ENST00000269214;ENST00000383276	T;T	0.63255	-0.03;1.49	4.98	3.2	0.36748	.	0.917970	0.09279	N	0.824061	T	0.57946	0.2088	M	0.62723	1.935	0.24024	N	0.996137	P	0.48162	0.906	B	0.41723	0.365	T	0.52193	-0.8608	10	0.87932	D	0	-10.7597	5.6599	0.17662	0.1623:0.0:0.6812:0.1565	.	224	Q5FWF5	ESCO1_HUMAN	F	224	ENSP00000269214:S224F;ENSP00000372763:S224F	ENSP00000269214:S224F	S	-	2	0	ESCO1	17408132	0.149000	0.22717	0.976000	0.42696	0.380000	0.30137	1.587000	0.36622	0.710000	0.31997	-0.140000	0.14226	TCT	.	.	.	none		0.408	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1	NM_052911	
MEX3C	51320	hgsc.bcm.edu	37	18	48703464	48703464	+	5'UTR	SNP	C	C	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr18:48703464C>T	ENST00000591040.1	-	0	525							Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		AAGCTTACATCGGTACCATTG	0.443																																					p.D413N		Atlas-SNP	.											.	MEX3C	77	.	0			c.G1237A						PASS	.						103.0	97.0	99.0					18																	48703464		2203	4300	6503	SO:0001623	5_prime_UTR_variant	51320	exon2			TTACATCGGTACC	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.-274G>A	chr18.hg19:g.48703464C>T		75.0	0.0	.		76.0	4.0	.	NM_016626	A1L022|Q9NZE3	Missense_Mutation	SNP	ENST00000591040.1	hg19		.	.	.	.	.	.	.	.	.	.	C	26.5	4.744251	0.89663	.	.	ENSG00000176624	ENST00000406189	T	0.51574	0.7	5.97	5.97	0.96955	.	0.044645	0.85682	D	0.000000	T	0.67496	0.2899	M	0.68952	2.095	0.58432	D	0.999999	D	0.89917	1.0	D	0.64506	0.926	T	0.67189	-0.5733	10	0.62326	D	0.03	-15.0661	19.2102	0.93751	0.0:1.0:0.0:0.0	.	413	Q5U5Q3	MEX3C_HUMAN	N	413	ENSP00000385610:D413N	ENSP00000385610:D413N	D	-	1	0	MEX3C	46957462	1.000000	0.71417	0.631000	0.29282	0.995000	0.86356	7.818000	0.86416	2.836000	0.97738	0.655000	0.94253	GAT	.	.	.	none		0.443	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
NFIC	4782	hgsc.bcm.edu	37	19	3381992	3381992	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr19:3381992G>A	ENST00000443272.2	+	2	364	c.313G>A	c.(313-315)Gtg>Atg	p.V105M	NFIC_ENST00000341919.3_Missense_Mutation_p.V105M|NFIC_ENST00000586919.1_Missense_Mutation_p.V96M|NFIC_ENST00000589123.1_Missense_Mutation_p.V96M|NFIC_ENST00000346156.5_Missense_Mutation_p.V96M|NFIC_ENST00000395111.3_Missense_Mutation_p.V96M|NFIC_ENST00000590282.1_Missense_Mutation_p.V105M	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	105					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		GCCGGGCTGCGTGCTCTCCAA	0.672																																					p.V105M		Atlas-SNP	.											.	NFIC	36	.	0			c.G313A						PASS	.						76.0	81.0	79.0					19																	3381992		2203	4300	6503	SO:0001583	missense	4782	exon2			GGCTGCGTGCTCT	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.313G>A	chr19.hg19:g.3381992G>A	ENSP00000396843:p.Val105Met	60.0	0.0	.		68.0	7.0	.	NM_001245004	A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Missense_Mutation	SNP	ENST00000443272.2	hg19	CCDS59330.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420303	0.83559	.	.	ENSG00000141905	ENST00000443272;ENST00000395111;ENST00000346156;ENST00000341919;ENST00000343825;ENST00000269778	T;T;T	0.81078	-1.45;-1.45;-1.45	3.88	3.88	0.44766	MAD homology 1, Dwarfin-type (2);CTF transcription factor/nuclear factor 1, DNA-binding domain (1);	0.000000	0.64402	D	0.000002	D	0.87200	0.6118	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.998;0.998	D	0.88894	0.3348	10	0.87932	D	0	-20.5809	14.8198	0.70062	0.0:0.0:1.0:0.0	.	105;105;96;105;96	B7Z4U5;P08651;P08651-3;P08651-5;P08651-2	.;NFIC_HUMAN;.;.;.	M	96;96;96;105;105;105	ENSP00000378543:V96M;ENSP00000301935:V96M;ENSP00000342194:V105M	ENSP00000269778:V105M	V	+	1	0	NFIC	3332992	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.472000	0.97709	1.879000	0.54435	0.467000	0.42956	GTG	.	.	.	none		0.672	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1	NM_005597	
CYP2A13	1553	hgsc.bcm.edu	37	19	41596036	41596037	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr19:41596036_41596037GC>TT	ENST00000330436.3	+	3	428_429	c.428_429GC>TT	c.(427-429)cGC>cTT	p.R143L		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	143					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R143H(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GTGGGCAAGCGCGGCATCGAGG	0.698																																					p.R143L|p.R143R		Atlas-SNP	.											CYP2A13,NS,carcinoma,0,1|.	CYP2A13	90	.	1	Substitution - Missense(1)	prostate(1)	c.G428T|c.C429T						PASS	.																																			SO:0001583	missense	1553	exon3			GCAAGCGCGGCAT|CAAGCGCGGCATC	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	Exception_encountered	chr19.hg19:g.41596036_41596037delinsTT	ENSP00000332679:p.Arg143Leu	146.0|144.0	0.0	.		176.0	20.0	.	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation|Silent	SNP	ENST00000330436.3	hg19	CCDS12571.1																																																																																			.	.	.	none		0.698	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41808585	41808585	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr19:41808585C>A	ENST00000392006.3	+	12	1876	c.1703C>A	c.(1702-1704)cCa>cAa	p.P568Q	HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.P479Q|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.P468Q|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.P568Q|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.P454Q|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.P468Q|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.P468Q	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	568	Necessary for interaction with BRD7 and transcriptional activation.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						TTCACGTTGCCAGATGTTGGG	0.547																																					p.P568Q		Atlas-SNP	.											.	HNRNPUL1	73	.	0			c.C1703A						PASS	.						80.0	79.0	79.0					19																	41808585		2203	4298	6501	SO:0001583	missense	11100	exon12			CGTTGCCAGATGT	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1703C>A	chr19.hg19:g.41808585C>A	ENSP00000375863:p.Pro568Gln	85.0	0.0	.		82.0	23.0	.	NM_007040	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	hg19	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.567631	0.86439	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.81044	0.4741	M	0.90082	3.085	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.991;0.999;1.0;1.0	D	0.84535	0.0635	10	0.87932	D	0	-7.3032	17.9067	0.88920	0.0:1.0:0.0:0.0	.	479;468;568;92;454;568;468	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-5;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;.;HNRL1_HUMAN;.	Q	468;568;454;479	ENSP00000340857:P468Q;ENSP00000375863:P568Q;ENSP00000367460:P454Q;ENSP00000263367:P479Q	ENSP00000263367:P479Q	P	+	2	0	HNRNPUL1	46500425	1.000000	0.71417	0.412000	0.26496	0.984000	0.73092	7.283000	0.78640	2.837000	0.97791	0.591000	0.81541	CCA	.	.	.	none		0.547	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
BCAM	4059	hgsc.bcm.edu	37	19	45322442	45322442	+	Missense_Mutation	SNP	G	G	A	rs577903824	byFrequency	TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr19:45322442G>A	ENST00000270233.6	+	11	1488	c.1466G>A	c.(1465-1467)gGg>gAg	p.G489E	BCAM_ENST00000589651.1_Missense_Mutation_p.G489E	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	489	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				AGCCAATTGGGGGGCAGCGTA	0.602													G|||	2	0.000399361	0.0	0.0	5008	,	,		15204	0.0		0.0	False		,,,				2504	0.002				p.G489E		Atlas-SNP	.											.	BCAM	53	.	0			c.G1466A						PASS	.						82.0	86.0	84.0					19																	45322442		2203	4300	6503	SO:0001583	missense	4059	exon11			AATTGGGGGGCAG	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1466G>A	chr19.hg19:g.45322442G>A	ENSP00000270233:p.Gly489Glu	85.0	0.0	.		79.0	37.0	.	NM_001013257	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	hg19	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	12.24	1.878110	0.33162	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.15718	2.4;2.4	4.37	3.33	0.38152	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.38746	0.1052	M	0.78637	2.42	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.15896	-1.0421	9	0.25106	T	0.35	-6.5398	10.0929	0.42458	0.0:0.0:0.7988:0.2012	.	489	P50895	BCAM_HUMAN	E	489	ENSP00000270233:G489E;ENSP00000375817:G489E	ENSP00000270233:G489E	G	+	2	0	BCAM	50014282	0.736000	0.28164	0.004000	0.12327	0.000000	0.00434	1.570000	0.36439	0.983000	0.38602	-0.349000	0.07799	GGG	.	.	.	none		0.602	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581	
USP29	57663	hgsc.bcm.edu	37	19	57640983	57640984	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr19:57640983_57640984CT>AA	ENST00000254181.4	+	4	1394_1395	c.940_941CT>AA	c.(940-942)CTc>AAc	p.L314N	USP29_ENST00000598197.1_Missense_Mutation_p.L314N	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	314	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGATGACTTACTCACTCAAGGT	0.421																																					p.L314I|p.L314H		Atlas-SNP	.											.	USP29	186	.	0			c.C940A|c.T941A						PASS	.																																			SO:0001583	missense	57663	exon4			GACTTACTCACTC|ACTTACTCACTCA		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		Exception_encountered	chr19.hg19:g.57640983_57640984delinsAA	ENSP00000254181:p.Leu314Asn	120.0	0.0	.		127.0|128.0	42.0|45.0	.	NM_020903		Missense_Mutation	SNP	ENST00000254181.4	hg19	CCDS33124.1																																																																																			.	.	.	none		0.421	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
VN1R1	57191	hgsc.bcm.edu	37	19	57967199	57967199	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr19:57967199A>G	ENST00000321039.3	-	1	655	c.656T>C	c.(655-657)tTa>tCa	p.L219S	AC004076.9_ENST00000596831.1_Intron|AC004076.9_ENST00000415705.3_Intron	NM_020633.3	NP_065684.1	Q9GZP7	VN1R1_HUMAN	vomeronasal 1 receptor 1	219					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)		GACTGCATGTAATGAGCTAAA	0.398																																					p.L219S		Atlas-SNP	.											.	VN1R1	48	.	0			c.T656C						PASS	.						106.0	100.0	102.0					19																	57967199		2203	4300	6503	SO:0001583	missense	57191	exon1			GCATGTAATGAGC	AF255342	CCDS12951.1	19q13.4	2012-08-22	2003-01-15		ENSG00000178201	ENSG00000178201		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	13548	protein-coding gene	gene with protein product		605234	"""vomeronasal olfactory receptor, (chromosome 19) subtype I, member 1"""	VNR19I1		10973240	Standard	NM_020633		Approved	V1RL1, ZVNR1, ZVNH1	uc002qos.2	Q9GZP7		ENST00000321039.3:c.656T>C	chr19.hg19:g.57967199A>G	ENSP00000322339:p.Leu219Ser	91.0	0.0	.		100.0	38.0	.	NM_020633	B3KSV5|Q7Z5H8|Q7Z5H9	Missense_Mutation	SNP	ENST00000321039.3	hg19	CCDS12951.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.469117	0.43839	.	.	ENSG00000178201	ENST00000321039	T	0.39056	1.1	4.11	3.0	0.34707	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.55257	0.1909	M	0.67625	2.065	0.09310	N	1	D	0.58268	0.982	D	0.63381	0.914	T	0.40534	-0.9558	9	0.87932	D	0	.	6.4555	0.21928	0.783:0.0:0.0:0.217	.	219	Q9GZP7	VN1R1_HUMAN	S	219	ENSP00000322339:L219S	ENSP00000322339:L219S	L	-	2	0	VN1R1	62659011	0.012000	0.17670	0.002000	0.10522	0.002000	0.02628	1.890000	0.39728	1.885000	0.54596	0.481000	0.45027	TTA	.	.	.	none		0.398	VN1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466464.1	NM_020633	
ZNF341	84905	hgsc.bcm.edu	37	20	32376749	32376749	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr20:32376749G>A	ENST00000375200.1	+	13	2298	c.1933G>A	c.(1933-1935)Gag>Aag	p.E645K	ZNF341_ENST00000342427.2_Missense_Mutation_p.E638K|RP4-553F4.6_ENST00000423074.1_RNA|RP4-553F4.6_ENST00000443171.1_RNA|RP4-553F4.6_ENST00000439444.1_RNA	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	645					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						GTTGATCCACGAGCCCTTCAA	0.552																																					p.E638K		Atlas-SNP	.											.	ZNF341	73	.	0			c.G1912A						PASS	.						120.0	99.0	106.0					20																	32376749		2203	4300	6503	SO:0001583	missense	84905	exon13			ATCCACGAGCCCT	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.1933G>A	chr20.hg19:g.32376749G>A	ENSP00000364346:p.Glu645Lys	209.0	0.0	.		199.0	24.0	.	NM_032819	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	ENST00000375200.1	hg19		.	.	.	.	.	.	.	.	.	.	G	21.8	4.207734	0.79240	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.08008	3.14;3.14	4.7	4.7	0.59300	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.061993	0.64402	D	0.000007	T	0.10380	0.0254	N	0.04355	-0.22	0.54753	D	0.999989	D;D;D;D	0.76494	0.999;0.957;0.999;0.999	P;B;P;P	0.56751	0.727;0.198;0.727;0.805	T	0.44847	-0.9301	10	0.72032	D	0.01	-30.0808	18.1856	0.89791	0.0:0.0:1.0:0.0	.	586;497;645;638	Q504V9;B3KU97;Q9BYN7;Q9BYN7-2	.;.;ZN341_HUMAN;.	K	638;645	ENSP00000344308:E638K;ENSP00000364346:E645K	ENSP00000344308:E638K	E	+	1	0	ZNF341	31840410	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.413000	0.80104	2.624000	0.88883	0.555000	0.69702	GAG	.	.	.	none		0.552	ZNF341-201	KNOWN	basic	protein_coding	protein_coding			
ADNP	23394	hgsc.bcm.edu	37	20	49510165	49510165	+	Silent	SNP	T	T	C			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr20:49510165T>C	ENST00000396029.3	-	5	1653	c.1086A>G	c.(1084-1086)caA>caG	p.Q362Q	ADNP_ENST00000349014.3_Silent_p.Q362Q|ADNP_ENST00000396032.3_Silent_p.Q362Q|ADNP_ENST00000371602.4_Silent_p.Q362Q	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	362					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						CAGACTGAGATTGTTGAGGAA	0.498																																					p.Q362Q		Atlas-SNP	.											.	ADNP	106	.	0			c.A1086G						PASS	.						142.0	134.0	137.0					20																	49510165		2203	4300	6503	SO:0001819	synonymous_variant	23394	exon5			CTGAGATTGTTGA	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.1086A>G	chr20.hg19:g.49510165T>C		66.0	0.0	.		63.0	22.0	.	NM_015339	E1P5Y2|O94881|Q5BKU2|Q9UG34	Silent	SNP	ENST00000396029.3	hg19	CCDS13433.1																																																																																			.	.	.	none		0.498	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
SMARCB1	6598	hgsc.bcm.edu	37	22	24176330	24176330	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr22:24176330G>A	ENST00000263121.7	+	9	1317	c.1121G>A	c.(1120-1122)cGg>cAg	p.R374Q	SMARCB1_ENST00000407082.3_Missense_Mutation_p.R328Q|DERL3_ENST00000464023.1_5'Flank|SMARCB1_ENST00000407422.3_Missense_Mutation_p.R365Q|SMARCB1_ENST00000344921.6_Missense_Mutation_p.R383Q	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	374					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)|p.R374Q(1)|p.L266_*386del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				TCTTCCAGGCGGATGAGGCGT	0.662			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.R374Q		Atlas-SNP	.	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	SMARCB1_ENST00000344921,NS,carcinoma,0,4	SMARCB1	586	.	4	Unknown(2)|Substitution - Missense(1)|Deletion - In frame(1)	central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)	c.G1121A						PASS	.						34.0	26.0	29.0					22																	24176330		2194	4299	6493	SO:0001583	missense	6598	exon9			CCAGGCGGATGAG	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.1121G>A	chr22.hg19:g.24176330G>A	ENSP00000263121:p.Arg374Gln	98.0	0.0	.		64.0	44.0	.	NM_003073	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	ENST00000263121.7	hg19	CCDS13817.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551141	0.86127	.	.	ENSG00000099956	ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	D;D;D;D	0.97352	-4.27;-4.35;-4.3;-4.18	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.97996	0.9340	M	0.76574	2.34	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	P;P;P	0.61397	0.888;0.598;0.776	D	0.98914	1.0781	10	0.87932	D	0	-9.4379	17.5847	0.87978	0.0:0.0:1.0:0.0	.	383;365;374	G5E975;Q17S11;Q12824	.;.;SNF5_HUMAN	Q	383;374;365;328	ENSP00000340883:R383Q;ENSP00000263121:R374Q;ENSP00000383984:R365Q;ENSP00000385226:R328Q	ENSP00000263121:R374Q	R	+	2	0	SMARCB1	22506330	1.000000	0.71417	0.998000	0.56505	0.252000	0.25951	9.473000	0.97714	2.475000	0.83589	0.442000	0.29010	CGG	.	.	.	none		0.662	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
VSIG4	11326	hgsc.bcm.edu	37	X	65253395	65253395	+	Silent	SNP	G	G	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chrX:65253395G>A	ENST00000374737.4	-	2	441	c.333C>T	c.(331-333)taC>taT	p.Y111Y	VSIG4_ENST00000412866.2_Silent_p.Y111Y|VSIG4_ENST00000455586.2_Silent_p.Y111Y	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	111	Ig-like 1.				complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTTCACACGTGTAGTGGCTCC	0.547																																					p.Y111Y		Atlas-SNP	.											.	VSIG4	54	.	0			c.C333T						PASS	.						140.0	121.0	128.0					X																	65253395		2203	4300	6503	SO:0001819	synonymous_variant	11326	exon2			ACACGTGTAGTGG	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.333C>T	chrX.hg19:g.65253395G>A		91.0	0.0	.		133.0	104.0	.	NM_001100431	Q6UXI4	Silent	SNP	ENST00000374737.4	hg19	CCDS14383.1	.	.	.	.	.	.	.	.	.	.	G	0.087	-1.173588	0.01646	.	.	ENSG00000155659	ENST00000427538	.	.	.	4.89	2.08	0.27032	.	.	.	.	.	T	0.48537	0.1505	.	.	.	0.34643	D	0.720888	.	.	.	.	.	.	T	0.53760	-0.8393	4	.	.	.	-14.3402	7.2184	0.25973	0.3107:0.0:0.6893:0.0	.	.	.	.	Y	38	.	.	H	-	1	0	VSIG4	65170120	0.637000	0.27216	0.623000	0.29173	0.038000	0.13279	0.292000	0.19011	0.318000	0.23185	0.600000	0.82982	CAC	.	.	.	none		0.547	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268	
AMOT	154796	hgsc.bcm.edu	37	X	112065566	112065566	+	Nonsense_Mutation	SNP	A	A	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chrX:112065566A>T	ENST00000524145.1	-	2	863	c.789T>A	c.(787-789)taT>taA	p.Y263*	AMOT_ENST00000462114.1_5'Flank|AMOT_ENST00000371958.1_Nonsense_Mutation_p.Y31*|AMOT_ENST00000371959.3_Nonsense_Mutation_p.Y263*|AMOT_ENST00000304758.1_Intron|AMOT_ENST00000371962.1_Nonsense_Mutation_p.Y31*			Q4VCS5	AMOT_HUMAN	angiomotin	263					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						GATGCTCACTATAGAAGTGCC	0.557																																					p.Y263X		Atlas-SNP	.											.	AMOT	204	.	0			c.T789A						PASS	.						99.0	84.0	89.0					X																	112065566		692	1591	2283	SO:0001587	stop_gained	154796	exon1			CTCACTATAGAAG	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.789T>A	chrX.hg19:g.112065566A>T	ENSP00000429013:p.Tyr263*	63.0	0.0	.		62.0	49.0	.	NM_001113490	Q504X5|Q9HD27|Q9UPT1	Nonsense_Mutation	SNP	ENST00000524145.1	hg19	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	A	32	5.111330	0.94339	.	.	ENSG00000126016	ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	.	.	.	5.36	3.02	0.34903	.	0.059683	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.9868	8.5979	0.33727	0.8525:0.0:0.1475:0.0	.	.	.	.	X	263;31;263;31	.	ENSP00000361026:Y31X	Y	-	3	2	AMOT	111952222	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.688000	0.54699	1.798000	0.52647	0.430000	0.28490	TAT	.	.	.	none		0.557	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
AP2A1	160	hgsc.bcm.edu	37	19	50305265	50305285	+	In_Frame_Del	DEL	CTGGGGCTGCGGGCAGCCCCT	CTGGGGCTGCGGGCAGCCCCT	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	CTGGGGCTGCGGGCAGCCCCT	CTGGGGCTGCGGGCAGCCCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr19:50305265_50305285delCTGGGGCTGCGGGCAGCCCCT	ENST00000359032.5	+	15	1981_2001	c.1981_2001delCTGGGGCTGCGGGCAGCCCCT	c.(1981-2001)ctggggctgcgggcagcccctdel	p.LGLRAAP661del	AP2A1_ENST00000354293.5_In_Frame_Del_p.LGLRAAP661del	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	661					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CGCCGACCTCCTGGGGCTGCGGGCAGCCCCTCCCCCGGCAG	0.756																																					p.660_667del		Atlas-Indel,Pindel	.											.	AP2A1	108	.	0			c.1980_2000del						PASS	.																																			SO:0001651	inframe_deletion	160	exon15			.	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.1981_2001delCTGGGGCTGCGGGCAGCCCCT	chr19.hg19:g.50305265_50305285delCTGGGGCTGCGGGCAGCCCCT	ENSP00000351926:p.Leu661_Pro667del	82.0	0.0	0		58.0	13.0	0.224138	NM_130787	Q96CI7|Q96PP6|Q96PP7|Q9H070	In_Frame_Del	DEL	ENST00000359032.5	hg19	CCDS46148.1																																																																																			.	.	.	none		0.756	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1		
PLEKHO2	80301	hgsc.bcm.edu	37	15	65157740	65157740	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr15:65157740delC	ENST00000323544.4	+	6	1254	c.1126delC	c.(1126-1128)cccfs	p.P377fs	AC069368.3_ENST00000437723.1_Intron	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	377	Pro-rich.									NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						CACAGCACTGCCCCCCTGGGA	0.632																																					p.L375fs		Atlas-Indel,Pindel	.											.	PLEKHO2	50	.	0			c.1125delG						PASS	.						81.0	80.0	80.0					15																	65157740		2202	4299	6501	SO:0001589	frameshift_variant	80301	exon6			.	AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.1126delC	chr15.hg19:g.65157740delC	ENSP00000326706:p.Pro377fs	43.0	0.0	0		54.0	24.0	0.444444	NM_025201	Q7L4H4|Q8WYS8	Frame_Shift_Del	DEL	ENST00000323544.4	hg19	CCDS10196.1																																																																																			.	.	.	none		0.632	PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256659.1	NM_025201	
PCCB	5096	hgsc.bcm.edu	37	3	135974705	135974706	+	Frame_Shift_Ins	INS	-	-	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr3:135974705_135974706insA	ENST00000251654.4	+	2	261_262	c.191_192insA	c.(190-195)ctaacafs	p.T65fs	PCCB_ENST00000462637.1_Frame_Shift_Ins_p.T65fs|PCCB_ENST00000468777.1_Frame_Shift_Ins_p.T65fs|PCCB_ENST00000474833.1_Intron|PCCB_ENST00000466072.1_Frame_Shift_Ins_p.T65fs|PCCB_ENST00000483687.1_Frame_Shift_Ins_p.T65fs|PCCB_ENST00000482086.1_Intron|PCCB_ENST00000478469.1_Frame_Shift_Ins_p.T65fs|PCCB_ENST00000469217.1_Frame_Shift_Ins_p.T65fs|PCCB_ENST00000471595.1_Frame_Shift_Ins_p.T65fs|PCCB_ENST00000490504.1_Frame_Shift_Ins_p.T65fs	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	65	Carboxyltransferase.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	TAGGGAAAGCTAACAGCCAGGG	0.48																																					p.L64fs		Atlas-Indel,Pindel	.											.	PCCB	52	.	0			c.191_192insA						PASS	.																																			SO:0001589	frameshift_variant	5096	exon2			.		CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.193dupA	chr3.hg19:g.135974707_135974707dupA	ENSP00000251654:p.Thr65fs	110.0	0.0	0		113.0	50.0	0.442478	NM_001178014	B7Z2Z4|Q16813|Q96CX0	Frame_Shift_Ins	INS	ENST00000251654.4	hg19	CCDS3089.1																																																																																			.	.	.	none		0.480	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357335.1		
ZNF77	58492	hgsc.bcm.edu	37	19	2936619	2936620	+	Frame_Shift_Ins	INS	-	-	A			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr19:2936619_2936620insA	ENST00000314531.4	-	3	305_306	c.213_214insT	c.(211-216)attgtafs	p.V72fs	ZNF77_ENST00000588050.1_5'Flank	NM_021217.2	NP_067040.1	Q15935	ZNF77_HUMAN	zinc finger protein 77	72	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGAACTTTACAATCTCTTCAT	0.391																																					p.V72fs		Atlas-Indel,Pindel	.											.	ZNF77	47	.	0			c.214_215insT						PASS	.																																			SO:0001589	frameshift_variant	58492	exon3			.	X65230	CCDS12099.1	19p13.3	2013-01-08	2006-05-12					"""Zinc fingers, C2H2-type"", ""-"""	13150	protein-coding gene	gene with protein product		194551	"""zinc finger protein 77 (pT1)"""			8478004	Standard	NM_021217		Approved	pT1	uc002lws.4	Q15935		ENST00000314531.4:c.214dupT	chr19.hg19:g.2936621_2936621dupA	ENSP00000319053:p.Val72fs	68.0	0.0	0		80.0	30.0	0.375	NM_021217	Q86XJ3|Q9NPP0	Frame_Shift_Ins	INS	ENST00000314531.4	hg19	CCDS12099.1																																																																																			.	.	.	none		0.391	ZNF77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451924.1	NM_021217	
RNF216	54476	hgsc.bcm.edu	37	7	5792508	5792510	+	In_Frame_Del	DEL	TCT	TCT	-	rs370004752		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr7:5792508_5792510delTCT	ENST00000425013.2	-	3	392_394	c.168_170delAGA	c.(166-171)gaagag>gag	p.56_57EE>E	RNF216_ENST00000389902.3_In_Frame_Del_p.56_57EE>E	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	56					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		ATCCAGGTCCTCTTCTTCATGCT	0.453																																					p.57_57del		Atlas-Indel,Pindel	.											.	RNF216	71	.	0			c.169_171del						PASS	.																																			SO:0001651	inframe_deletion	54476	exon3			.	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.168_170delAGA	chr7.hg19:g.5792511_5792513delTCT	ENSP00000404602:p.Glu57del	53.0	0.0	0		104.0	20.0	0.192308	NM_207111	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	In_Frame_Del	DEL	ENST00000425013.2	hg19	CCDS34595.1																																																																																			.	.	.	none		0.453	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
UBE3B	89910	hgsc.bcm.edu	37	12	109961880	109961880	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr12:109961880delC	ENST00000342494.3	+	22	3057	c.2462delC	c.(2461-2463)tctfs	p.S821fs	UBE3B_ENST00000434735.2_Frame_Shift_Del_p.S821fs	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	821	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						GAACTGCCTTCTCTGGACTCC	0.527																																					p.S821fs		Atlas-Indel,Pindel	.											.	UBE3B	116	.	0			c.2461delT						PASS	.						129.0	109.0	116.0					12																	109961880		2203	4300	6503	SO:0001589	frameshift_variant	89910	exon22			.	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.2462delC	chr12.hg19:g.109961880delC	ENSP00000340596:p.Ser821fs	81.0	0.0	0		63.0	19.0	0.301587	NM_183415	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Frame_Shift_Del	DEL	ENST00000342494.3	hg19	CCDS9129.1																																																																																			.	.	.	none		0.527	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	
CD3EAP	10849	hgsc.bcm.edu	37	19	45911526	45911526	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr19:45911526delG	ENST00000309424.3	+	3	788	c.300delG	c.(298-300)gagfs	p.E100fs	ERCC1_ENST00000300853.3_3'UTR|CD3EAP_ENST00000589804.1_Frame_Shift_Del_p.E102fs|PPP1R13L_ENST00000418234.2_5'Flank|ERCC1_ENST00000423698.2_3'UTR|ERCC1_ENST00000588738.1_5'Flank	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	100					rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		CCTCAACGGAGGCAGGAGGTG	0.642																																					p.E100fs		Atlas-Indel,Pindel	.											.	CD3EAP	27	.	0			c.299delA						PASS	.						56.0	62.0	60.0					19																	45911526		2203	4300	6503	SO:0001589	frameshift_variant	10849	exon3			.	U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.300delG	chr19.hg19:g.45911526delG	ENSP00000310966:p.Glu100fs	51.0	0.0	0		70.0	32.0	0.457143	NM_012099	Q32N11|Q7Z5U2|Q9UPF6	Frame_Shift_Del	DEL	ENST00000309424.3	hg19	CCDS12661.1																																																																																			.	.	.	none		0.642	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459538.1	NM_012099	
ABCG1	9619	hgsc.bcm.edu	37	21	43693428	43693428	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr21:43693428delG	ENST00000361802.2	+	4	565	c.420delG	c.(418-420)aagfs	p.K140fs	ABCG1_ENST00000347800.2_Frame_Shift_Del_p.K137fs|ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000398457.2_Frame_Shift_Del_p.K142fs|ABCG1_ENST00000343687.3_Frame_Shift_Del_p.K151fs|ABCG1_ENST00000398449.3_Frame_Shift_Del_p.K140fs|ABCG1_ENST00000398437.1_Frame_Shift_Del_p.K286fs|ABCG1_ENST00000340588.4_Frame_Shift_Del_p.K248fs	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	140	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	CGGGCATGAAGGGGGCCGTCC	0.657																																					p.K151fs		Atlas-Indel,Pindel	.											.	ABCG1	140	.	0			c.452delA						PASS	.						60.0	65.0	64.0					21																	43693428		2203	4300	6503	SO:0001589	frameshift_variant	9619	exon4			.	U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.420delG	chr21.hg19:g.43693428delG	ENSP00000354995:p.Lys140fs	55.0	0.0	0		84.0	33.0	0.392857	NM_207174	Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Frame_Shift_Del	DEL	ENST00000361802.2	hg19	CCDS13682.1																																																																																			.	.	.	none		0.657	ABCG1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195318.2	NM_207174	
CASC3	22794	hgsc.bcm.edu	37	17	38297029	38297030	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr17:38297029_38297030delGT	ENST00000264645.7	+	1	454_455	c.228_229delGT	c.(226-231)gagtgtfs	p.C77fs		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	77					gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						AGGAGTCGGAGTGTGTGAGTGC	0.703																																					p.76_76del		Atlas-Indel,Pindel	.											.	CASC3	39	.	0			c.227_228del						PASS	.																																			SO:0001589	frameshift_variant	22794	exon1			.	X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.228_229delGT	chr17.hg19:g.38297033_38297034delGT	ENSP00000264645:p.Cys77fs	106.0	0.0	0		114.0	34.0	0.298246	NM_007359	A8K8R0	Frame_Shift_Del	DEL	ENST00000264645.7	hg19	CCDS11362.1																																																																																			.	.	.	none		0.703	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257127.3	NM_007359	
PTDSS2	81490	hgsc.bcm.edu	37	11	460237	460243	+	Frame_Shift_Del	DEL	ATGTGAC	ATGTGAC	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	ATGTGAC	ATGTGAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr11:460237_460243delATGTGAC	ENST00000308020.5	+	2	409_415	c.233_239delATGTGAC	c.(232-240)tatgtgacgfs	p.YVT78fs	RP13-317D12.3_ENST00000525893.1_RNA	NM_030783.1	NP_110410.1	Q9BVG9	PTSS2_HUMAN	phosphatidylserine synthase 2	78					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CDP-diacylglycerol-serine O-phosphatidyltransferase activity (GO:0003882)			autonomic_ganglia(1)|breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(1)	9		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;2.76e-26)|Epithelial(43;2.56e-25)|OV - Ovarian serous cystadenocarcinoma(40;7.54e-20)|BRCA - Breast invasive adenocarcinoma(625;8.76e-05)|Lung(200;0.0407)|LUSC - Lung squamous cell carcinoma(625;0.0735)	Phosphatidylserine(DB00144)	ACGCTTGGCTATGTGACGCTGCTGGAG	0.56																																					p.78_80del		Atlas-Indel,Pindel	.											.	PTDSS2	27	.	0			c.232_238del						PASS	.																																			SO:0001589	frameshift_variant	81490	exon2			.	BC001210	CCDS7696.1	11p15	2008-05-02			ENSG00000174915	ENSG00000174915			15463	protein-coding gene	gene with protein product		612793				14984733	Standard	NM_030783		Approved	PSS2	uc001lpj.3	Q9BVG9	OTTHUMG00000119087	ENST00000308020.5:c.233_239delATGTGAC	chr11.hg19:g.460237_460243delATGTGAC	ENSP00000308258:p.Tyr78fs	148.0	0.0	0		111.0	32.0	0.288288	NM_030783		Frame_Shift_Del	DEL	ENST00000308020.5	hg19	CCDS7696.1																																																																																			.	.	.	none		0.560	PTDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239301.2		
RP1L1	94137	hgsc.bcm.edu	37	8	10466011	10466031	+	In_Frame_Del	DEL	TCCCCTTCAGCCTCCTGGGCA	TCCCCTTCAGCCTCCTGGGCA	-	rs199577777|rs199959237|rs535482422|rs558932296|rs527932965|rs542254783	byFrequency	TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	TCCCCTTCAGCCTCCTGGGCA	TCCCCTTCAGCCTCCTGGGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr8:10466011_10466031delTCCCCTTCAGCCTCCTGGGCA	ENST00000382483.3	-	4	5800_5820	c.5577_5597delTGCCCAGGAGGCTGAAGGGGA	c.(5575-5598)gatgcccaggaggctgaaggggag>gag	p.DAQEAEG1859del		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1939					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.E1862E(1)|p.D1859E(1)|p.Q1861P(1)|p.A1863D(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGGCTGGGCCTCCCCTTCAGCCTCCTGGGCATCCCCTTCTG	0.629																																					p.1860_1866del		Atlas-INDEL	.											RP1L1,NS,malignant_melanoma,0,1	RP1L1	453	.	4	Substitution - Missense(3)|Substitution - coding silent(1)	lung(4)	c.5578_5598del						PASS	.																																			SO:0001651	inframe_deletion	94137	exon4			.	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5577_5597delTGCCCAGGAGGCTGAAGGGGA	chr8.hg19:g.10466011_10466031delTCCCCTTCAGCCTCCTGGGCA	ENSP00000371923:p.Asp1859_Gly1865del	38.0	0.0	0		45.0	14.0	0.311111	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	In_Frame_Del	DEL	ENST00000382483.3	hg19	CCDS43708.1																																																																																			.	.	.	none		0.629	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
CACNA1S	779	hgsc.bcm.edu	37	1	201009812	201009815	+	Frame_Shift_Del	DEL	GCAT	GCAT	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	GCAT	GCAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr1:201009812_201009815delGCAT	ENST00000362061.3	-	42	5387_5390	c.5161_5164delATGC	c.(5161-5166)atgctgfs	p.ML1721fs	RP11-168O16.2_ENST00000415359.1_RNA|CACNA1S_ENST00000367338.3_Frame_Shift_Del_p.ML1702fs	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1721					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGTCCCTTCAGCATCTCCACACAG	0.613																																					p.1721_1722del		Atlas-Indel,Pindel	.											.	CACNA1S	249	.	0			c.5162_5165del						PASS	.																																			SO:0001589	frameshift_variant	779	exon42			.	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.5161_5164delATGC	chr1.hg19:g.201009812_201009815delGCAT	ENSP00000355192:p.Met1721fs	59.0	0.0	0		45.0	18.0	0.4	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Frame_Shift_Del	DEL	ENST00000362061.3	hg19	CCDS1407.1																																																																																			.	.	.	none		0.613	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
ASAP2	8853	hgsc.bcm.edu	37	2	9347341	9347342	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr2:9347341_9347342delTG	ENST00000281419.3	+	1	448_449	c.108_109delTG	c.(106-111)actgtgfs	p.V37fs	ASAP2_ENST00000315273.4_Frame_Shift_Del_p.V37fs	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	37					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						GCCGGAACACTGTGGCGGCCAT	0.718																																					p.36_36del		Atlas-Indel,Pindel	.											.	ASAP2	91	.	0			c.107_108del						PASS	.																																			SO:0001589	frameshift_variant	8853	exon1			.	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.108_109delTG	chr2.hg19:g.9347343_9347344delTG	ENSP00000281419:p.Val37fs	70.0	0.0	0		96.0	24.0	0.25	NM_001135191	D6W4Y8	Frame_Shift_Del	DEL	ENST00000281419.3	hg19	CCDS1661.1																																																																																			.	.	.	none		0.718	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
FAM172A	83989	hgsc.bcm.edu	37	5	93217216	93217216	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr5:93217216delT	ENST00000395965.3	-	7	888	c.746delA	c.(745-747)aacfs	p.N249fs	FAM172A_ENST00000509163.1_Frame_Shift_Del_p.N203fs|FAM172A_ENST00000505869.1_Frame_Shift_Del_p.N139fs|FAM172A_ENST00000509739.1_Frame_Shift_Del_p.N102fs	NM_032042.5	NP_114431.2	Q8WUF8	F172A_HUMAN	family with sequence similarity 172, member A	249						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9						TCTTTGGGGGTTACGATACTT	0.318																																					p.N249fs		Atlas-Indel,Pindel	.											.	FAM172A	38	.	0			c.747delC						PASS	.						183.0	177.0	179.0					5																	93217216		2203	4299	6502	SO:0001589	frameshift_variant	83989	exon7			.		CCDS4069.1, CCDS54879.1, CCDS54880.1	5q15	2008-06-16	2008-06-16	2008-06-16	ENSG00000113391	ENSG00000113391			25365	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 21"""	C5orf21		11230166	Standard	NM_032042		Approved	DKFZP564D172	uc010jbd.3	Q8WUF8	OTTHUMG00000131329	ENST00000395965.3:c.746delA	chr5.hg19:g.93217216delT	ENSP00000379294:p.Asn249fs	75.0	0.0	0		88.0	35.0	0.397727	NM_032042	B2R7C6|B4DJ14|B4DLG5|Q9H0U8	Frame_Shift_Del	DEL	ENST00000395965.3	hg19	CCDS4069.1																																																																																			.	.	.	none		0.318	FAM172A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254100.3	NM_032042	
SLC12A7	10723	hgsc.bcm.edu	37	5	1094341	1094342	+	In_Frame_Ins	INS	-	-	TTT	rs376148374		TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr5:1094341_1094342insTTT	ENST00000264930.5	-	2	189_190	c.146_147insAAA	c.(145-147)aac>aaAAAc	p.48_49insK		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	48					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GGAATGGGCTGTTTTCTCTTGG	0.421																																					p.N49delinsKN		Atlas-Indel,Pindel	.											.	SLC12A7	97	.	0			c.147_148insAAA						PASS	.																																			SO:0001652	inframe_insertion	10723	exon2			.	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.144_146dupAAA	chr5.hg19:g.1094342_1094344dupTTT	ENSP00000264930:p.Glu48_Asn49insLys	86.0	0.0	0		84.0	35.0	0.416667	NM_006598	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	In_Frame_Ins	INS	ENST00000264930.5	hg19	CCDS34129.1																																																																																			.	.	.	none		0.421	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
TRPM1	4308	hgsc.bcm.edu	37	15	31330016	31330017	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr15:31330016_31330017delCT	ENST00000256552.6	-	20	2615_2616	c.2468_2469delAG	c.(2467-2469)aagfs	p.K823fs	TRPM1_ENST00000397795.2_Frame_Shift_Del_p.K801fs|RP11-348B17.1_ENST00000558755.1_RNA|TRPM1_ENST00000542188.1_Frame_Shift_Del_p.K840fs|RP11-348B17.1_ENST00000561299.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CCTCATCCCCCTTTCTTGAGCC	0.48																																					p.840_841del		Atlas-Indel,Pindel	.											TRPM1,colon,carcinoma,0,1	TRPM1	183	.	0			c.2520_2521del						PASS	.																																			SO:0001589	frameshift_variant	4308	exon19			.	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.2468_2469delAG	chr15.hg19:g.31330016_31330017delCT	ENSP00000256552:p.Lys823fs	63.0	0.0	0		87.0	30.0	0.344828	NM_001252020		Frame_Shift_Del	DEL	ENST00000256552.6	hg19	CCDS58346.1																																																																																			.	.	.	none		0.480	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
ZNF141	7700	hgsc.bcm.edu	37	4	367429	367430	+	In_Frame_Ins	INS	-	-	ACA			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr4:367429_367430insACA	ENST00000240499.7	+	4	1352_1353	c.1203_1204insACA	c.(1204-1206)aaa>ACAaaa	p.401_402insT	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	401					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						AAGAATGTGGCAAAGCCTTTAG	0.386																																					p.G401delinsGT		Atlas-Indel,Pindel	.											.	ZNF141	48	.	0			c.1203_1204insACA						PASS	.																																			SO:0001652	inframe_insertion	7700	exon4			.	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		Exception_encountered	chr4.hg19:g.367429_367430insACA	ENSP00000240499:p.Gly401_Lys402insThr	304.0	0.0	0		277.0	110.0	0.397112	NM_003441	Q6DK07	In_Frame_Ins	INS	ENST00000240499.7	hg19	CCDS33931.1																																																																																			.	.	.	none		0.386	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ATP7B	540	hgsc.bcm.edu	37	13	52516678	52516679	+	Frame_Shift_Ins	INS	-	-	T			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr13:52516678_52516679insT	ENST00000242839.4	-	15	3411_3412	c.3255_3256insA	c.(3253-3258)acagagfs	p.E1086fs	ATP7B_ENST00000344297.5_Frame_Shift_Ins_p.E879fs|ATP7B_ENST00000418097.2_Frame_Shift_Ins_p.E1021fs|ATP7B_ENST00000400370.3_Frame_Shift_Ins_p.E656fs|ATP7B_ENST00000417240.2_Frame_Shift_Ins_p.E297fs|ATP7B_ENST00000448424.2_Frame_Shift_Ins_p.E1008fs|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000400366.3_Frame_Shift_Ins_p.E975fs	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1086					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CCCAAGGTCTCTGTTCCAAGTT	0.579									Wilson disease																												p.E1086fs		Atlas-Indel,Pindel	.											.	ATP7B	123	.	0			c.3256_3257insA						PASS	.																																			SO:0001589	frameshift_variant	540	exon15	Familial Cancer Database		.	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.3256dupA	chr13.hg19:g.52516679_52516679dupT	ENSP00000242839:p.Glu1086fs	57.0	0.0	0		42.0	15.0	0.357143	NM_000053	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Frame_Shift_Ins	INS	ENST00000242839.4	hg19	CCDS41892.1																																																																																			.	.	.	none		0.579	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
PBRM1	55193	hgsc.bcm.edu	37	3	52597437	52597437	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr3:52597437delA	ENST00000296302.7	-	24	3949	c.3948delT	c.(3946-3948)tttfs	p.F1316fs	RNU6ATAC16P_ENST00000408591.1_RNA|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.F1284fs|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.F1316fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.F1291fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.F1291fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.F1331fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.F1331fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.F1316fs			Q86U86	PB1_HUMAN	polybromo 1	1316					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CTAACTCGGCAAATTTAGCTT	0.423			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.A1292fs		Atlas-Indel,Pindel	.		Rec	yes		3	3p21	55193	polybromo 1		E	.,3	PBRM1	1252	.	0			c.3874delG						PASS	.						148.0	132.0	137.0					3																	52597437		2203	4300	6503	SO:0001589	frameshift_variant	55193	exon25			.	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3948delT	chr3.hg19:g.52597437delA	ENSP00000296302:p.Phe1316fs	100.0	0.0	0		108.0	89.0	0.824074	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	hg19																																																																																				.	.	.	none		0.423	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
SETD2	29072	hgsc.bcm.edu	37	3	47162892	47162892	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr3:47162892delC	ENST00000409792.3	-	3	3276	c.3234delG	c.(3232-3234)ttgfs	p.L1078fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1078					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTTCCATGGGCAAAGTAGAAT	0.413			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.P1079fs		Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.3235delC						PASS	.						107.0	104.0	105.0					3																	47162892		2203	4300	6503	SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.3234delG	chr3.hg19:g.47162892delC	ENSP00000386759:p.Leu1078fs	40.0	0.0	0		48.0	41.0	0.854167	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	hg19	CCDS2749.2																																																																																			.	.	.	none		0.413	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
GLRB	2743	hgsc.bcm.edu	37	4	157999276	157999277	+	In_Frame_Ins	INS	-	-	AGAAGCAGTATCTATGCCCATCGTATGTTCTTCATGTCTTATATT			TCGA-5P-A9JU-01A-11D-A42J-10	TCGA-5P-A9JU-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6969c41-5fa5-4853-95a0-0e473b44a505	f87abecd-d116-48b1-bf22-7584bab45053	g.chr4:157999276_157999277insAGAAGCAGTATCTATGCCCATCGTATGTTCTTCATGTCTTATATT	ENST00000264428.4	+	2	370_371	c.100_101insAGAAGCAGTATCTATGCCCATCGTATGTTCTTCATGTCTTATATT	c.(100-102)aag>aAGAAGCAGTATCTATGCCCATCGTATGTTCTTCATGTCTTATATTag	p.34_35insKQYLCPSYVLHVLY*	GLRB_ENST00000512619.1_In_Frame_Ins_p.34_35insKQYLCPSYVLHVLY*|GLRB_ENST00000541722.1_In_Frame_Ins_p.34_35insKQYLCPSYVLHVLY*|GLRB_ENST00000509282.1_In_Frame_Ins_p.34_35insKQYLCPSYVLHVLY*	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	34					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)			central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	GAAGGGGAAAAAGAAGCAGTAT	0.337																																					p.K34delinsKKQYLCPSYVLHVLYX		Pindel	.											.	GLRB	74	.	0			c.100_101insAGAAGCAGTATCTATGCCCATCGTATGTTCTTCATGTCTTATATT						PASS	.																																			SO:0001652	inframe_insertion	2743	exon2			.	U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	Exception_encountered	chr4.hg19:g.157999276_157999277insAGAAGCAGTATCTATGCCCATCGTATGTTCTTCATGTCTTATATT	ENSP00000264428:p.Lys34_Lys35insLysGlnTyrLeuCysProSerTyrValLeuHisValLeuTyr*	129.0	0.0	.		111.0	21.0	0.189	NM_000824	A8K3K2|D3DP23|F5GWE1	In_Frame_Ins	INS	ENST00000264428.4	hg19	CCDS3796.1																																																																																			.	.	.	none		0.337	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	
