#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARHGEF19	128272	hgsc.bcm.edu	37	1	16532449	16532449	+	Silent	SNP	C	C	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr1:16532449C>T	ENST00000270747.3	-	8	1564	c.1428G>A	c.(1426-1428)caG>caA	p.Q476Q	ARHGEF19_ENST00000478117.1_5'UTR	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	476	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		AGGTGCGCTCCTGGTAGGCCT	0.662																																					p.Q476Q		Atlas-SNP	.											.	ARHGEF19	49	.	0			c.G1428A						PASS	.						41.0	40.0	40.0					1																	16532449		2203	4300	6503	SO:0001819	synonymous_variant	128272	exon8			GCGCTCCTGGTAG	BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.1428G>A	chr1.hg19:g.16532449C>T		80.0	0.0	.		98.0	23.0	.	NM_153213	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Silent	SNP	ENST00000270747.3	hg19	CCDS170.1	.	.	.	.	.	.	.	.	.	.	C	9.573	1.121595	0.20877	.	.	ENSG00000142632	ENST00000449495	.	.	.	4.88	2.62	0.31277	.	.	.	.	.	T	0.59252	0.2180	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55749	-0.8092	4	.	.	.	.	10.0467	0.42190	0.0:0.7963:0.0:0.2037	.	.	.	.	K	165	.	.	R	-	2	0	ARHGEF19	16405036	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.513000	0.45494	1.044000	0.40200	-0.254000	0.11334	AGG	.	.	.	none		0.662	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006289.1	NM_153213	
SFPQ	6421	hgsc.bcm.edu	37	1	35657046	35657046	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr1:35657046G>A	ENST00000357214.5	-	2	1011	c.913C>T	c.(913-915)Cct>Tct	p.P305S		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	305	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				ATATCAGCAGGTAGATTCCCA	0.388			T	TFE3	papillary renal cell																																p.P305S		Atlas-SNP	.		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ	51	.	0			c.C913T						PASS	.						103.0	104.0	104.0					1																	35657046		2203	4300	6503	SO:0001583	missense	6421	exon2			CAGCAGGTAGATT	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.913C>T	chr1.hg19:g.35657046G>A	ENSP00000349748:p.Pro305Ser	126.0	0.0	.		134.0	31.0	.	NM_005066	P30808|Q5SZ71	Missense_Mutation	SNP	ENST00000357214.5	hg19	CCDS388.1	.	.	.	.	.	.	.	.	.	.	G	33	5.223348	0.95139	.	.	ENSG00000116560	ENST00000357214	T	0.08807	3.05	5.26	5.26	0.73747	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.22475	0.0542	L	0.35644	1.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00770	-1.1573	10	0.66056	D	0.02	-12.496	18.8921	0.92408	0.0:0.0:1.0:0.0	.	305	P23246	SFPQ_HUMAN	S	305	ENSP00000349748:P305S	ENSP00000349748:P305S	P	-	1	0	SFPQ	35429633	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	9.807000	0.99171	2.439000	0.82584	0.563000	0.77884	CCT	.	.	.	none		0.388	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
KIF14	9928	hgsc.bcm.edu	37	1	200587031	200587031	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr1:200587031T>C	ENST00000367350.4	-	2	1259	c.821A>G	c.(820-822)gAa>gGa	p.E274G		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	274	Required for PRC1-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TGTTCTTTTTTCTAAGCTCCC	0.383																																					p.E274G		Atlas-SNP	.											.	KIF14	156	.	0			c.A821G						PASS	.						203.0	199.0	200.0					1																	200587031		2203	4300	6503	SO:0001583	missense	9928	exon2			CTTTTTTCTAAGC	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.821A>G	chr1.hg19:g.200587031T>C	ENSP00000356319:p.Glu274Gly	79.0	0.0	.		96.0	32.0	.	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	hg19	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.085732	0.36758	.	.	ENSG00000118193	ENST00000367350	T	0.76186	-1.0	5.24	2.91	0.33838	.	0.398430	0.23777	N	0.044665	T	0.61223	0.2330	L	0.29908	0.895	0.27788	N	0.94291	B	0.15141	0.012	B	0.11329	0.006	T	0.55939	-0.8061	10	0.72032	D	0.01	.	9.4118	0.38496	0.0:0.1458:0.0:0.8542	.	274	Q15058	KIF14_HUMAN	G	274	ENSP00000356319:E274G	ENSP00000356319:E274G	E	-	2	0	KIF14	198853654	0.991000	0.36638	0.168000	0.22838	0.811000	0.45836	2.660000	0.46749	0.321000	0.23259	0.477000	0.44152	GAA	.	.	.	none		0.383	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
ADCY3	109	hgsc.bcm.edu	37	2	25062898	25062898	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr2:25062898T>A	ENST00000260600.5	-	6	2050	c.1199A>T	c.(1198-1200)tAt>tTt	p.Y400F	ADCY3_ENST00000405392.1_Missense_Mutation_p.Y11F	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	400					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CTCCCGCACATACCTGCCAGG	0.637																																					p.Y400F		Atlas-SNP	.											.	ADCY3	114	.	0			c.A1199T						PASS	.						85.0	94.0	91.0					2																	25062898		2203	4300	6503	SO:0001583	missense	109	exon6			CGCACATACCTGC	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.1199A>T	chr2.hg19:g.25062898T>A	ENSP00000260600:p.Tyr400Phe	66.0	0.0	.		85.0	23.0	.	NM_004036	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	hg19	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	T	18.04	3.535166	0.64972	.	.	ENSG00000138031	ENST00000260600;ENST00000405392;ENST00000415879;ENST00000454027;ENST00000427849;ENST00000435135	T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44	5.05	5.05	0.67936	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.125643	0.56097	D	0.000028	D	0.83266	0.5217	L	0.33245	0.995	0.37564	D	0.919179	D;D;D	0.76494	0.999;0.999;0.992	D;D;D	0.79108	0.992;0.992;0.966	D	0.84410	0.0565	10	0.36615	T	0.2	.	13.0155	0.58754	0.0:0.0:0.0:1.0	.	400;400;11	B7ZLX9;O60266;B3KT86	.;ADCY3_HUMAN;.	F	400;11;375;26;156;350	ENSP00000260600:Y400F;ENSP00000384484:Y11F;ENSP00000410120:Y26F;ENSP00000399275:Y156F;ENSP00000389799:Y350F	ENSP00000260600:Y400F	Y	-	2	0	ADCY3	24916402	1.000000	0.71417	0.995000	0.50966	0.925000	0.55904	3.945000	0.56637	1.885000	0.54596	0.448000	0.29417	TAT	.	.	.	none		0.637	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
GTF2A1L	11036	hgsc.bcm.edu	37	2	48896944	48896944	+	Silent	SNP	T	T	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr2:48896944T>C	ENST00000403751.3	+	7	1099	c.1062T>C	c.(1060-1062)gaT>gaC	p.D354D	STON1-GTF2A1L_ENST00000394751.3_Silent_p.D1011D|STON1-GTF2A1L_ENST00000405008.1_Silent_p.D1058D|LHCGR_ENST00000420913.3_5'Flank|GTF2A1L_ENST00000430487.2_Silent_p.D320D|STON1-GTF2A1L_ENST00000394754.1_Silent_p.D1058D|STON1-GTF2A1L_ENST00000402114.2_Silent_p.D1058D|STON1-GTF2A1L_ENST00000309827.2_Silent_p.D1058D	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	354					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAAGCGGTGATACATCTTCCA	0.373																																					p.D1058D		Atlas-SNP	.											.	STON1-GTF2A1L	180	.	0			c.T3174C						PASS	.						109.0	116.0	114.0					2																	48896944		2203	4300	6503	SO:0001819	synonymous_variant	286749	exon9			CGGTGATACATCT	AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.1062T>C	chr2.hg19:g.48896944T>C		203.0	0.0	.		199.0	36.0	.	NM_001198593	B4DY14|Q53FD9|Q5D050	Silent	SNP	ENST00000403751.3	hg19	CCDS46281.1																																																																																			.	.	.	none		0.373	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323852.4	NM_006872	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613036	+	Missense_Mutation	SNP	G	G	C	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr2:73613036G>C	ENST00000264448.6	+	1	151	c.40G>C	c.(40-42)Gag>Cag	p.E14Q	ALMS1_ENST00000409009.1_Missense_Mutation_p.E14Q|ALMS1_ENST00000377715.1_Missense_Mutation_p.E14Q	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggagga	0.692																																					p.E14Q		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C						PASS	.						3.0	4.0	4.0					2																	73613036		1509	3234	4743	SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.40G>C	chr2.hg19:g.73613036G>C	ENSP00000264448:p.Glu14Gln	177.0	0.0	.		255.0	13.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731519	0.48939	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.26373	2.4;2.61;1.74	3.19	3.19	0.36642	.	0.259523	0.20097	U	0.099311	T	0.32436	0.0829	N	0.19112	0.55	0.22317	N	0.999202	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.03493	-1.1031	10	0.87932	D	0	.	10.1262	0.42652	0.0:0.0:1.0:0.0	.	14;14	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	Q	14	ENSP00000386627:E14Q;ENSP00000264448:E14Q;ENSP00000366944:E14Q	ENSP00000264448:E14Q	E	+	1	0	ALMS1	73466544	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	2.034000	0.41145	2.070000	0.61991	0.484000	0.47621	GAG	.	.	.	none		0.692	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125367417	125367417	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr2:125367417G>A	ENST00000431078.1	+	12	2157	c.1793G>A	c.(1792-1794)gGg>gAg	p.G598E		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	598	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGGCACCAGGGGAATACAGCC	0.532																																					p.G598E		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.G1793A						PASS	.						72.0	71.0	71.0					2																	125367417		1870	4106	5976	SO:0001583	missense	129684	exon12			ACCAGGGGAATAC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1793G>A	chr2.hg19:g.125367417G>A	ENSP00000399013:p.Gly598Glu	68.0	0.0	.		71.0	17.0	.	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828320	0.90955	.	.	ENSG00000155052	ENST00000431078	T	0.21734	1.99	5.66	5.66	0.87406	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (2);	0.000000	0.50627	D	0.000105	T	0.56645	0.1999	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63664	-0.6586	10	0.72032	D	0.01	.	18.6671	0.91495	0.0:0.0:1.0:0.0	.	598	Q8WYK1	CNTP5_HUMAN	E	598	ENSP00000399013:G598E	ENSP00000399013:G598E	G	+	2	0	CNTNAP5	125083887	1.000000	0.71417	0.993000	0.49108	0.731000	0.41821	8.884000	0.92432	2.826000	0.97356	0.655000	0.94253	GGG	.	.	.	none		0.532	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
NGEF	25791	hgsc.bcm.edu	37	2	233785268	233785268	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr2:233785268T>A	ENST00000264051.3	-	5	832	c.554A>T	c.(553-555)aAa>aTa	p.K185I	NGEF_ENST00000373552.4_Missense_Mutation_p.K93I|NGEF_ENST00000409079.1_Missense_Mutation_p.K93I	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	185	Regulatory region; modulates activity toward RHOA, RAC1 and CDC42. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		GAGAGTCGATTTATCTCGGTA	0.443																																					p.K185I		Atlas-SNP	.											.	NGEF	198	.	0			c.A554T						PASS	.						84.0	90.0	88.0					2																	233785268		2203	4300	6503	SO:0001583	missense	25791	exon5			GTCGATTTATCTC	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.554A>T	chr2.hg19:g.233785268T>A	ENSP00000264051:p.Lys185Ile	55.0	0.0	.		56.0	9.0	.	NM_019850	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	ENST00000264051.3	hg19	CCDS2500.1	.	.	.	.	.	.	.	.	.	.	T	14.55	2.569333	0.45798	.	.	ENSG00000066248	ENST00000264051;ENST00000373552;ENST00000541023;ENST00000409079	T;T	0.72725	-0.5;-0.68	5.01	5.01	0.66863	.	0.052813	0.85682	D	0.000000	T	0.75295	0.3830	L	0.29908	0.895	0.80722	D	1	B;D;P	0.71674	0.323;0.998;0.952	B;D;B	0.78314	0.079;0.991;0.438	T	0.74934	-0.3495	10	0.36615	T	0.2	-13.8527	14.714	0.69254	0.0:0.0:0.0:1.0	.	93;93;185	E9PC42;B4DMB8;Q8N5V2	.;.;NGEF_HUMAN	I	185;93;75;93	ENSP00000264051:K185I;ENSP00000362653:K93I	ENSP00000264051:K185I	K	-	2	0	NGEF	233493512	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	4.295000	0.59049	1.887000	0.54652	0.402000	0.26972	AAA	.	.	.	none		0.443	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799	
ZNF385D	79750	hgsc.bcm.edu	37	3	21465455	21465455	+	Splice_Site	SNP	C	C	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr3:21465455C>A	ENST00000281523.2	-	7	1472	c.954G>T	c.(952-954)ggG>ggT	p.G318G		NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	318						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						TGACACTCACCCCCAGTGGAT	0.453																																					p.G318G		Atlas-SNP	.											.	ZNF385D	93	.	0			c.G954T						PASS	.						141.0	141.0	141.0					3																	21465455		2203	4300	6503	SO:0001630	splice_region_variant	79750	exon7			ACTCACCCCCAGT	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.954+1G>T	chr3.hg19:g.21465455C>A		122.0	0.0	.		141.0	30.0	.	NM_024697		Silent	SNP	ENST00000281523.2	hg19	CCDS2636.1																																																																																			.	.	.	none		0.453	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697	Silent
ZNF197	10168	hgsc.bcm.edu	37	3	44671000	44671000	+	Silent	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr3:44671000G>A	ENST00000396058.1	+	1	521	c.354G>A	c.(352-354)gaG>gaA	p.E118E	ZNF197_ENST00000383745.2_Silent_p.E118E|RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000344387.4_Silent_p.E118E|ZNF197_ENST00000383744.4_Silent_p.E118E			O14709	ZN197_HUMAN	zinc finger protein 197	118	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		CCCTGGTAGAGGAGCTGCAGA	0.567																																					p.E118E		Atlas-SNP	.											.	ZNF197	81	.	0			c.G354A						PASS	.						43.0	43.0	43.0					3																	44671000		2203	4300	6503	SO:0001819	synonymous_variant	10168	exon2			GGTAGAGGAGCTG	AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.354G>A	chr3.hg19:g.44671000G>A		181.0	0.0	.		255.0	55.0	.	NM_001024855	B2RAH8|Q86VG0	Silent	SNP	ENST00000396058.1	hg19	CCDS2717.1																																																																																			.	.	.	none		0.567	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256747.4	NM_006991	
TWF2	11344	hgsc.bcm.edu	37	3	52266117	52266117	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr3:52266117G>A	ENST00000305533.5	-	3	368	c.125C>T	c.(124-126)tCg>tTg	p.S42L	TLR9_ENST00000597542.1_5'UTR|TLR9_ENST00000494383.1_5'Flank|TWF2_ENST00000499914.2_Missense_Mutation_p.S42L	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	42	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TGGCTCCTGCGAGGCACCCAG	0.697											OREG0015610	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S42L		Atlas-SNP	.											.	TWF2	33	.	0			c.C125T						PASS	.						28.0	28.0	28.0					3																	52266117		2200	4297	6497	SO:0001583	missense	11344	exon3			TCCTGCGAGGCAC	Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.125C>T	chr3.hg19:g.52266117G>A	ENSP00000303908:p.Ser42Leu	85.0	0.0	.	983	96.0	6.0	.	NM_007284	Q9Y3F5	Missense_Mutation	SNP	ENST00000305533.5	hg19	CCDS2849.1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.883869	0.33255	.	.	ENSG00000247596	ENST00000305533;ENST00000499914	T;T	0.28454	1.61;1.61	5.61	1.31	0.21738	Actin-binding, cofilin/tropomyosin type (3);	.	.	.	.	T	0.11452	0.0279	N	0.17082	0.46	0.32664	N	0.517723	B;P	0.35542	0.309;0.508	B;B	0.24701	0.036;0.055	T	0.23261	-1.0193	9	0.10902	T	0.67	.	3.575	0.07932	0.2903:0.0:0.4331:0.2766	.	42;42	D6RG15;Q6IBS0	.;TWF2_HUMAN	L	42	ENSP00000303908:S42L;ENSP00000426464:S42L	ENSP00000303908:S42L	S	-	2	0	TWF2	52241157	0.998000	0.40836	0.818000	0.32626	0.944000	0.59088	2.573000	0.46007	0.733000	0.32492	0.455000	0.32223	TCG	.	.	.	none		0.697	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2		
PRR23B	389151	hgsc.bcm.edu	37	3	138739039	138739039	+	Nonsense_Mutation	SNP	G	G	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr3:138739039G>C	ENST00000329447.5	-	1	729	c.465C>G	c.(463-465)taC>taG	p.Y155*	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	155										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CGTCCTCCTCGTAGGCCTCTT	0.632																																					p.Y155X		Atlas-SNP	.											.	PRR23B	56	.	0			c.C465G						PASS	.						38.0	44.0	42.0					3																	138739039		2203	4300	6503	SO:0001587	stop_gained	389151	exon1			CTCCTCGTAGGCC	BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.465C>G	chr3.hg19:g.138739039G>C	ENSP00000328768:p.Tyr155*	153.0	0.0	.		175.0	39.0	.	NM_001013650	B2RNV9	Nonsense_Mutation	SNP	ENST00000329447.5	hg19	CCDS33868.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845131	0.71603	.	.	ENSG00000184814	ENST00000329447	.	.	.	2.41	-3.3	0.05003	.	3.020250	0.01139	N	0.006140	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8996	0.29727	0.6481:0.0:0.3519:0.0	.	.	.	.	X	155	.	ENSP00000328768:Y155X	Y	-	3	2	PRR23B	140221729	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.259000	0.02861	-0.945000	0.03681	0.456000	0.33151	TAC	.	.	.	none		0.632	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361501.1	NM_001013650	
FAM193A	8603	hgsc.bcm.edu	37	4	2696771	2696771	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr4:2696771A>G	ENST00000324666.5	+	15	2669	c.2318A>G	c.(2317-2319)cAc>cGc	p.H773R	FAM193A_ENST00000382839.3_Missense_Mutation_p.H773R|FAM193A_ENST00000502458.1_Missense_Mutation_p.H795R|FAM193A_ENST00000545951.1_Missense_Mutation_p.H773R|FAM193A_ENST00000505311.1_Missense_Mutation_p.H773R	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	773										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						TGCTCTGAGCACAGCTCCAGC	0.597																																					p.H795R		Atlas-SNP	.											.	FAM193A	103	.	0			c.A2384G						PASS	.						101.0	71.0	81.0					4																	2696771		2203	4300	6503	SO:0001583	missense	8603	exon16			CTGAGCACAGCTC	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.2318A>G	chr4.hg19:g.2696771A>G	ENSP00000324587:p.His773Arg	78.0	0.0	.		76.0	15.0	.	NM_001256667	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	hg19	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	A	18.58	3.655329	0.67586	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.46190	0.1380	N	0.20685	0.6	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.75484	0.986;0.986;0.986;0.961;0.986	T	0.30851	-0.9964	10	0.10902	T	0.67	-19.6886	14.9019	0.70687	1.0:0.0:0.0:0.0	.	773;795;773;795;773	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	R	773;773;773;795;627	ENSP00000372290:H773R;ENSP00000324587:H773R;ENSP00000443617:H773R;ENSP00000427505:H795R;ENSP00000427260:H627R	ENSP00000324587:H773R	H	+	2	0	FAM193A	2666569	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.338000	0.79269	2.108000	0.64289	0.533000	0.62120	CAC	.	.	.	none		0.597	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704	
FAM47E	100129583	hgsc.bcm.edu	37	4	77204610	77204610	+	Nonstop_Mutation	SNP	A	A	G	rs573597519		TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr4:77204610A>G	ENST00000424749.2	+	8	1187	c.1181A>G	c.(1180-1182)tAg>tGg	p.*394W	FAM47E_ENST00000339906.6_Nonstop_Mutation_p.*296W|FAM47E-STBD1_ENST00000539752.1_Intron|FAM47E_ENST00000515604.1_Intron|FAM47E_ENST00000510197.1_Nonstop_Mutation_p.*296W	NM_001136570.2	NP_001130042.1	Q6ZV65	FA47E_HUMAN	family with sequence similarity 47, member E	0																	ACTCAAGCATAGAAGAATCGT	0.343													A|||	1	0.000199681	0.0	0.0	5008	,	,		20542	0.0		0.001	False		,,,				2504	0.0				p.X394W		Atlas-SNP	.											.	FAM47E	20	.	0			c.A1181G						PASS	.						201.0	171.0	180.0					4																	77204610		692	1591	2283	SO:0001578	stop_lost	100129583	exon8			AAGCATAGAAGAA	AC034139, AK124936, CR591456, CR627383	CCDS47081.1, CCDS58907.1	4q21.1	2013-04-23			ENSG00000189157	ENSG00000189157			34343	protein-coding gene	gene with protein product	"""similar to genethonin 1"""						Standard	NM_001136570		Approved	FLJ42946, LOC100129583	uc003hjx.3	Q6ZV65	OTTHUMG00000185390	ENST00000424749.2:c.1181A>G	chr4.hg19:g.77204610A>G	ENSP00000409423:p.*394Trpext*30	76.0	0.0	.		98.0	25.0	.	NM_001136570	D6R8Y4	Missense_Mutation	SNP	ENST00000424749.2	hg19	CCDS47081.1	.	.	.	.	.	.	.	.	.	.	A	10.34	1.322644	0.23994	.	.	ENSG00000189157	ENST00000510197;ENST00000339906;ENST00000424749	.	.	.	3.8	1.4	0.22301	.	.	.	.	.	.	.	.	.	.	.	0.26753	N	0.970168	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2825	0.15682	0.7644:0.0:0.2356:0.0	.	.	.	.	W	296;296;394	.	.	X	+	2	0	FAM47E	77423634	0.001000	0.12720	0.313000	0.25210	0.361000	0.29550	0.215000	0.17562	0.320000	0.23234	0.459000	0.35465	TAG	.	.	.	none		0.343	FAM47E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362528.2	NM_001136570	
PAPSS1	9061	hgsc.bcm.edu	37	4	108615096	108615096	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr4:108615096A>C	ENST00000265174.4	-	3	514	c.242T>G	c.(241-243)aTt>aGt	p.I81S	PAPSS1_ENST00000511304.1_Intron	NM_005443.4	NP_005434.4	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 1	81					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			NS(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|ovary(1)	16		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		GTAGCATGGAATACCATGACA	0.443																																					p.I81S		Atlas-SNP	.											.	PAPSS1	57	.	0			c.T242G						PASS	.						114.0	103.0	107.0					4																	108615096		2203	4300	6503	SO:0001583	missense	9061	exon3			CATGGAATACCAT	Y10387	CCDS3676.1	4q24	2012-07-13			ENSG00000138801	ENSG00000138801	2.7.7.4, 2.7.1.25		8603	protein-coding gene	gene with protein product		603262				9576487, 9771708	Standard	NM_005443		Approved	ATPSK1, PAPSS	uc003hyk.3	O43252	OTTHUMG00000131210	ENST00000265174.4:c.242T>G	chr4.hg19:g.108615096A>C	ENSP00000265174:p.Ile81Ser	55.0	0.0	.		64.0	13.0	.	NM_005443	O43841|O75332|Q96FB1|Q96TF4|Q9P1P9|Q9UE98	Missense_Mutation	SNP	ENST00000265174.4	hg19	CCDS3676.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.718287	0.89205	.	.	ENSG00000138801	ENST00000265174	T	0.77098	-1.07	5.67	5.67	0.87782	Adenylylsulphate kinase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.89801	0.6820	M	0.88512	2.96	0.80722	D	1	D	0.67145	0.996	D	0.91635	0.999	D	0.91416	0.5155	10	0.62326	D	0.03	-29.0903	15.9108	0.79473	1.0:0.0:0.0:0.0	.	81	O43252	PAPS1_HUMAN	S	81	ENSP00000265174:I81S	ENSP00000265174:I81S	I	-	2	0	PAPSS1	108834545	1.000000	0.71417	0.972000	0.41901	0.985000	0.73830	8.789000	0.91839	2.156000	0.67533	0.454000	0.30748	ATT	.	.	.	none		0.443	PAPSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253946.2		
KIAA1109	84162	hgsc.bcm.edu	37	4	123207818	123207818	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr4:123207818A>G	ENST00000264501.4	+	53	9533	c.9160A>G	c.(9160-9162)Atg>Gtg	p.M3054V	KIAA1109_ENST00000455637.1_Missense_Mutation_p.M3054V|KIAA1109_ENST00000388738.3_Missense_Mutation_p.M3054V			Q2LD37	K1109_HUMAN	KIAA1109	3054					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CCCTGTTACCATGTCAGGGAA	0.403																																					p.M3054V		Atlas-SNP	.											.	KIAA1109	424	.	0			c.A9160G						PASS	.						148.0	139.0	142.0					4																	123207818		1896	4124	6020	SO:0001583	missense	84162	exon51			GTTACCATGTCAG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.9160A>G	chr4.hg19:g.123207818A>G	ENSP00000264501:p.Met3054Val	233.0	0.0	.		256.0	58.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.80|10.80	1.453953|1.453953	0.26161|0.26161	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000419325|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.18502	.|2.8;2.8;2.21	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.17066|0.17066	0.0410|0.0410	N|N	0.11560|0.11560	0.145|0.145	0.47511|0.47511	D|D	0.999445|0.999445	.|B;P	.|0.40332	.|0.452;0.713	.|P;P	.|0.54815	.|0.557;0.761	T|T	0.03443|0.03443	-1.1036|-1.1036	5|10	.|0.02654	.|T	.|1	.|.	15.8352|15.8352	0.78793|0.78793	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|3054;3054	.|Q2LD37-6;Q2LD37	.|.;K1109_HUMAN	R|V	1011|3054	.|ENSP00000264501:M3054V;ENSP00000373390:M3054V;ENSP00000389925:M3054V	.|ENSP00000264501:M3054V	H|M	+|+	2|1	0|0	KIAA1109|KIAA1109	123427268|123427268	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.975000|0.975000	0.68041|0.68041	8.815000|8.815000	0.91973|0.91973	2.149000|2.149000	0.67028|0.67028	0.528000|0.528000	0.53228|0.53228	CAT|ATG	.	.	.	none		0.403	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
FAT4	79633	hgsc.bcm.edu	37	4	126411503	126411503	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr4:126411503T>C	ENST00000394329.3	+	17	13539	c.13526T>C	c.(13525-13527)gTg>gCg	p.V4509A	FAT4_ENST00000335110.5_Missense_Mutation_p.V2750A	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4509					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCTGCCATCGTGGGCAGCTGC	0.572																																					p.V4509A		Atlas-SNP	.											.	FAT4	1752	.	0			c.T13526C						PASS	.						67.0	67.0	67.0					4																	126411503		2203	4300	6503	SO:0001583	missense	79633	exon17			CCATCGTGGGCAG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.13526T>C	chr4.hg19:g.126411503T>C	ENSP00000377862:p.Val4509Ala	54.0	0.0	.		75.0	19.0	.	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	T	17.80	3.477797	0.63849	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.76968	-0.82;-1.06	5.17	4.0	0.46444	.	0.000000	0.31233	U	0.008019	T	0.71178	0.3309	L	0.58583	1.82	0.48632	D	0.999688	B;B;B	0.20780	0.041;0.048;0.041	B;B;B	0.17433	0.012;0.018;0.012	T	0.68697	-0.5340	10	0.38643	T	0.18	.	9.6102	0.39659	0.0:0.0821:0.0:0.9179	.	2750;4509;4508	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	A	4509;2750	ENSP00000377862:V4509A;ENSP00000335169:V2750A	ENSP00000335169:V2750A	V	+	2	0	FAT4	126630953	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.897000	0.63231	1.941000	0.56285	0.459000	0.35465	GTG	.	.	.	none		0.572	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
TDO2	6999	hgsc.bcm.edu	37	4	156831319	156831319	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr4:156831319C>G	ENST00000536354.2	+	6	638	c.574C>G	c.(574-576)Cta>Gta	p.L192V		NM_005651.3	NP_005642.1			tryptophan 2,3-dioxygenase											breast(3)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	18	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)		AAATGAACTGCTACTTAAATC	0.333																																					p.L192V	Colon(57;928 1036 2595 6946 26094)	Atlas-SNP	.											.	TDO2	51	.	0			c.C574G						PASS	.						73.0	78.0	76.0					4																	156831319		2203	4300	6503	SO:0001583	missense	6999	exon6			GAACTGCTACTTA		CCDS34086.1	4q31-q32	2008-02-05				ENSG00000151790	1.13.11.11		11708	protein-coding gene	gene with protein product		191070					Standard	NM_005651		Approved	TDO, TPH2	uc003ipf.2	P48775		ENST00000536354.2:c.574C>G	chr4.hg19:g.156831319C>G	ENSP00000444788:p.Leu192Val	127.0	0.0	.		114.0	23.0	.	NM_005651		Missense_Mutation	SNP	ENST00000536354.2	hg19	CCDS34086.1	.	.	.	.	.	.	.	.	.	.	C	8.259	0.810699	0.16537	.	.	ENSG00000151790	ENST00000536354	.	.	.	4.92	4.06	0.47325	.	0.069633	0.64402	D	0.000014	T	0.46756	0.1409	L	0.35288	1.05	0.53688	D	0.999978	B	0.31009	0.303	B	0.35727	0.209	T	0.33548	-0.9864	8	.	.	.	-10.8364	11.2334	0.48925	0.0:0.8473:0.0:0.1527	.	192	P48775	T23O_HUMAN	V	192	.	.	L	+	1	2	TDO2	157050769	0.987000	0.35691	0.113000	0.21522	0.342000	0.28953	1.693000	0.37742	1.174000	0.42811	0.644000	0.83932	CTA	.	.	.	none		0.333	TDO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366209.3	NM_005651	
PRKAA1	5562	hgsc.bcm.edu	37	5	40764924	40764924	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr5:40764924C>A	ENST00000397128.2	-	7	1246	c.1238G>T	c.(1237-1239)aGt>aTt	p.S413I	PRKAA1_ENST00000354209.3_Missense_Mutation_p.S428I	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	413					activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)	p.S428T(1)		breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	TCGACTTTGACTTCTAATTCC	0.358																																					p.S428I		Atlas-SNP	.											PRKAA1,NS,carcinoma,0,2	PRKAA1	27	.	1	Substitution - Missense(1)	lung(1)	c.G1283T						PASS	.						123.0	108.0	113.0					5																	40764924		1853	4113	5966	SO:0001583	missense	5562	exon8			CTTTGACTTCTAA		CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.1238G>T	chr5.hg19:g.40764924C>A	ENSP00000380317:p.Ser413Ile	116.0	0.0	.		124.0	28.0	.	NM_206907	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Missense_Mutation	SNP	ENST00000397128.2	hg19	CCDS3932.2	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668512	0.88348	.	.	ENSG00000132356	ENST00000397128;ENST00000354209	D;D	0.84070	-1.67;-1.8	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	M	0.91663	3.23	0.80722	D	1	D;D	0.71674	0.996;0.998	P;D	0.66602	0.883;0.945	D	0.93633	0.6958	10	0.87932	D	0	-15.1947	20.5211	0.99222	0.0:1.0:0.0:0.0	.	413;428	Q13131;Q13131-2	AAPK1_HUMAN;.	I	413;428	ENSP00000380317:S413I;ENSP00000346148:S428I	ENSP00000346148:S428I	S	-	2	0	AC008810.1	40800681	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.861000	0.98227	0.650000	0.86243	AGT	.	.	.	none		0.358	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253833.2	NM_006251	
TTC37	9652	hgsc.bcm.edu	37	5	94814018	94814018	+	Silent	SNP	T	T	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr5:94814018T>A	ENST00000358746.2	-	40	4639	c.4341A>T	c.(4339-4341)gcA>gcT	p.A1447A		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	1447						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						ATGCAAGTAGTGCTAGTCTCA	0.378																																					p.A1447A		Atlas-SNP	.											.	TTC37	128	.	0			c.A4341T						PASS	.						89.0	81.0	84.0					5																	94814018		2203	4300	6503	SO:0001819	synonymous_variant	9652	exon40			AAGTAGTGCTAGT	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.4341A>T	chr5.hg19:g.94814018T>A		156.0	0.0	.		146.0	32.0	.	NM_014639	O15077|Q6PJI3	Silent	SNP	ENST00000358746.2	hg19	CCDS4072.1																																																																																			.	.	.	none		0.378	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639	
SPATA9	83890	hgsc.bcm.edu	37	5	94994606	94994606	+	Silent	SNP	A	A	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr5:94994606A>T	ENST00000274432.8	-	5	627	c.486T>A	c.(484-486)gtT>gtA	p.V162V	SPATA9_ENST00000477047.2_5'UTR|RFESD_ENST00000508206.1_Intron	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	162					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		GCACAGCATTAACACAGACTG	0.343																																					p.V162V		Atlas-SNP	.											.	SPATA9	17	.	0			c.T486A						PASS	.						104.0	101.0	102.0					5																	94994606		2203	4300	6503	SO:0001819	synonymous_variant	83890	exon5			AGCATTAACACAG	AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.486T>A	chr5.hg19:g.94994606A>T		78.0	0.0	.		108.0	21.0	.	NM_031952	A8K8H3|Q4G122|Q86X33|Q8NA28	Silent	SNP	ENST00000274432.8	hg19	CCDS4076.1																																																																																			.	.	.	none		0.343	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304036.1	NM_031952	
GABRG2	2566	hgsc.bcm.edu	37	5	161495091	161495091	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr5:161495091T>A	ENST00000361925.4	+	1	306	c.86T>A	c.(85-87)cTc>cAc	p.L29H	GABRG2_ENST00000414552.2_Missense_Mutation_p.L29H|GABRG2_ENST00000393933.4_5'UTR|GABRG2_ENST00000356592.3_Missense_Mutation_p.L29H			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	29					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGGATTCTGCTCCTGCTGTCG	0.493																																					p.L29H		Atlas-SNP	.											.	GABRG2	142	.	0			c.T86A						PASS	.						92.0	83.0	86.0					5																	161495091		2203	4300	6503	SO:0001583	missense	2566	exon1			TTCTGCTCCTGCT		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.86T>A	chr5.hg19:g.161495091T>A	ENSP00000354651:p.Leu29His	74.0	0.0	.		95.0	29.0	.	NM_198904	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	hg19	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	T	15.93	2.977680	0.53720	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925	D;T;D	0.81821	-1.54;-1.06;-1.54	5.08	5.08	0.68730	.	0.601929	0.18116	N	0.151218	D	0.83119	0.5185	L	0.57536	1.79	0.80722	D	1	P;P;P	0.44260	0.828;0.69;0.83	P;B;P	0.50860	0.652;0.219;0.569	T	0.82794	-0.0281	10	0.46703	T	0.11	.	12.8183	0.57677	0.0:0.0:0.0:1.0	.	29;29;29	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	H	29	ENSP00000349000:L29H;ENSP00000410732:L29H;ENSP00000354651:L29H	ENSP00000349000:L29H	L	+	2	0	GABRG2	161427669	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.764000	0.62264	1.917000	0.55516	0.402000	0.26972	CTC	.	.	.	none		0.493	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
RCAN2	10231	hgsc.bcm.edu	37	6	46424516	46424516	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr6:46424516C>A	ENST00000371374.1	-	2	389	c.198G>T	c.(196-198)caG>caT	p.Q66H	RCAN2_ENST00000405162.1_Missense_Mutation_p.Q66H|RCAN2_ENST00000306764.7_Missense_Mutation_p.Q66H	NM_001251974.1	NP_001238903.1	Q14206	RCAN2_HUMAN	regulator of calcineurin 2	20					calcineurin-NFAT signaling cascade (GO:0033173)|locomotion involved in locomotory behavior (GO:0031987)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)		nucleotide binding (GO:0000166)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						CAAACACTGACTGGTGAACAT	0.448																																					p.Q66H		Atlas-SNP	.											.	RCAN2	39	.	0			c.G198T						PASS	.																																			SO:0001583	missense	10231	exon2			CACTGACTGGTGA	D83407	CCDS43469.1, CCDS59023.1	6p12.3	2008-10-31	2007-06-26	2007-06-26	ENSG00000172348	ENSG00000172348			3041	protein-coding gene	gene with protein product		604876	"""Down syndrome critical region gene 1-like 1"""	DSCR1L1		8662924	Standard	NM_001251973		Approved	ZAKI-4	uc003oyc.2	Q14206	OTTHUMG00000014782	ENST00000371374.1:c.198G>T	chr6.hg19:g.46424516C>A	ENSP00000360425:p.Gln66His	119.0	0.0	.		92.0	15.0	.	NM_001251973	A6ND07|B3KR46|Q5VWF7|Q5VWF8|Q8N116	Missense_Mutation	SNP	ENST00000371374.1	hg19	CCDS59023.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.423058	0.62733	.	.	ENSG00000172348	ENST00000371374;ENST00000306764;ENST00000405162	.	.	.	5.31	4.45	0.53987	.	1.265600	0.05385	N	0.537852	T	0.59335	0.2186	.	.	.	0.37069	D	0.898432	D	0.57571	0.98	P	0.53062	0.717	T	0.53394	-0.8445	8	0.87932	D	0	-7.617	13.1398	0.59428	0.0:0.9228:0.0:0.0772	.	66	Q14206-2	.	H	66	.	ENSP00000305223:Q66H	Q	-	3	2	RCAN2	46532475	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	0.946000	0.29069	1.255000	0.44051	0.467000	0.42956	CAG	.	.	.	none		0.448	RCAN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040783.1		
PHIP	55023	hgsc.bcm.edu	37	6	79655729	79655729	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr6:79655729G>C	ENST00000275034.4	-	38	4786	c.4619C>G	c.(4618-4620)cCa>cGa	p.P1540R	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1540					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TGTTTTCCCTGGTATTGCAGA	0.343																																					p.P1540R		Atlas-SNP	.											.	PHIP	177	.	0			c.C4619G						PASS	.						96.0	94.0	95.0					6																	79655729		2203	4300	6503	SO:0001583	missense	55023	exon38			TTCCCTGGTATTG	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.4619C>G	chr6.hg19:g.79655729G>C	ENSP00000275034:p.Pro1540Arg	82.0	0.0	.		97.0	21.0	.	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	hg19	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.973618	0.34848	.	.	ENSG00000146247	ENST00000275034;ENST00000355098	T	0.39592	1.07	6.11	6.11	0.99139	.	0.406312	0.26369	N	0.024775	T	0.17450	0.0419	N	0.19112	0.55	0.38749	D	0.954061	B;B	0.29085	0.232;0.232	B;B	0.23716	0.048;0.048	T	0.05484	-1.0882	9	.	.	.	-14.0131	19.298	0.94131	0.0:0.0:1.0:0.0	.	1540;1540	A7J992;Q8WWQ0	.;PHIP_HUMAN	R	1540;266	ENSP00000275034:P1540R	.	P	-	2	0	PHIP	79712448	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	4.951000	0.63610	2.906000	0.99361	0.655000	0.94253	CCA	.	.	.	none		0.343	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
PRDM13	59336	hgsc.bcm.edu	37	6	100062606	100062606	+	Missense_Mutation	SNP	G	G	T	rs543525191	byFrequency	TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr6:100062606G>T	ENST00000369215.4	+	4	2400	c.2095G>T	c.(2095-2097)Gtt>Ttt	p.V699F		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	699					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		CGACCCCGAGGTTGGGGGCGG	0.657													G|||	2	0.000399361	0.0	0.0	5008	,	,		14126	0.002		0.0	False		,,,				2504	0.0				p.V699F		Atlas-SNP	.											.	PRDM13	65	.	0			c.G2095T						PASS	.						32.0	35.0	35.0					6																	100062606		1536	3504	5040	SO:0001583	missense	59336	exon4			CCCGAGGTTGGGG	AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.2095G>T	chr6.hg19:g.100062606G>T	ENSP00000358217:p.Val699Phe	173.0	0.0	.		141.0	33.0	.	NM_021620	Q5TGC1|Q5TGC2	Missense_Mutation	SNP	ENST00000369215.4	hg19	CCDS43487.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950907	0.34471	.	.	ENSG00000112238	ENST00000369215;ENST00000369214	T;T	0.05717	3.4;3.4	5.66	4.69	0.59074	.	0.355912	0.20414	N	0.092810	T	0.01320	0.0043	N	0.08118	0	0.23862	N	0.996637	B	0.18863	0.031	B	0.22753	0.041	T	0.45804	-0.9236	10	0.72032	D	0.01	-9.2832	6.5857	0.22620	0.2509:0.0:0.7491:0.0	.	699	Q9H4Q3	PRD13_HUMAN	F	699;709	ENSP00000358217:V699F;ENSP00000358216:V709F	ENSP00000358216:V709F	V	+	1	0	PRDM13	100169327	0.496000	0.26059	0.965000	0.40720	0.399000	0.30720	0.923000	0.28757	2.680000	0.91292	0.561000	0.74099	GTT	.	.	.	none		0.657	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041619.2		
EIF3B	8662	hgsc.bcm.edu	37	7	2415106	2415106	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr7:2415106G>A	ENST00000360876.4	+	14	2028	c.1972G>A	c.(1972-1974)Gaa>Aaa	p.E658K	EIF3B_ENST00000397011.2_Missense_Mutation_p.E658K	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		TTCCGACGTCGAATGGGATCC	0.547																																					p.E658K		Atlas-SNP	.											.	EIF3B	54	.	0			c.G1972A						PASS	.						199.0	143.0	162.0					7																	2415106		2203	4300	6503	SO:0001583	missense	8662	exon14			GACGTCGAATGGG	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1972G>A	chr7.hg19:g.2415106G>A	ENSP00000354125:p.Glu658Lys	107.0	0.0	.		125.0	35.0	.	NM_001037283		Missense_Mutation	SNP	ENST00000360876.4	hg19	CCDS5332.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375384	0.61735	.	.	ENSG00000106263	ENST00000314800;ENST00000360876;ENST00000397011;ENST00000489558	T;T	0.05513	3.43;3.43	5.46	5.46	0.80206	Translation initiation factor 2A, beta propellor-like domain (1);Six-bladed beta-propeller, TolB-like (1);	0.089506	0.85682	D	0.000000	T	0.15305	0.0369	M	0.86028	2.79	0.80722	D	1	P	0.41345	0.746	B	0.38264	0.269	T	0.02457	-1.1156	10	0.72032	D	0.01	-48.6025	18.9193	0.92519	0.0:0.0:1.0:0.0	.	658	P55884	EIF3B_HUMAN	K	658;658;658;582	ENSP00000354125:E658K;ENSP00000380206:E658K	ENSP00000316638:E658K	E	+	1	0	EIF3B	2381632	1.000000	0.71417	0.944000	0.38274	0.019000	0.09904	9.670000	0.98625	2.571000	0.86741	0.655000	0.94253	GAA	.	.	.	none		0.547	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1		
DYNC1I1	1780	hgsc.bcm.edu	37	7	95439731	95439731	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr7:95439731G>A	ENST00000324972.6	+	3	329	c.136G>A	c.(136-138)Gtt>Att	p.V46I	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.V46I|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.V46I|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.V46I|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.V46I|DYNC1I1_ENST00000413338.1_Missense_Mutation_p.V46I|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.V46I	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	46	Interaction with DCTN1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			GAAAGAACCCGTTCAGGACGA	0.433																																					p.V46I		Atlas-SNP	.											DYNC1I1,NS,carcinoma,0,1	DYNC1I1	111	.	0			c.G136A						PASS	.						80.0	79.0	80.0					7																	95439731		2202	4300	6502	SO:0001583	missense	1780	exon3			GAACCCGTTCAGG	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.136G>A	chr7.hg19:g.95439731G>A	ENSP00000320130:p.Val46Ile	105.0	0.0	.		112.0	37.0	.	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	hg19	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	11.10	1.538558	0.27475	.	.	ENSG00000158560	ENST00000447467;ENST00000524053;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000413338;ENST00000518089;ENST00000457059	T;T;T;T;T;T;T	0.73897	-0.59;2.65;-0.79;-0.59;-0.56;2.65;-0.59	4.76	2.96	0.34315	.	0.420143	0.24601	N	0.037126	T	0.52338	0.1728	N	0.14661	0.345	0.22933	N	0.998548	B;B;B;B;B	0.06786	0.001;0.0;0.001;0.0;0.001	B;B;B;B;B	0.08055	0.0;0.002;0.001;0.001;0.003	T	0.31138	-0.9954	10	0.19590	T	0.45	-13.6404	7.9351	0.29925	0.3129:0.0:0.6871:0.0	.	46;46;46;46;46	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	I	46	ENSP00000392337:V46I;ENSP00000320130:V46I;ENSP00000438377:V46I;ENSP00000398118:V46I;ENSP00000352348:V46I;ENSP00000428273:V46I;ENSP00000412444:V46I	ENSP00000320130:V46I	V	+	1	0	DYNC1I1	95277667	0.998000	0.40836	0.205000	0.23548	0.885000	0.51271	3.060000	0.49955	0.731000	0.32448	0.655000	0.94253	GTT	.	.	.	none		0.433	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
NOBOX	135935	hgsc.bcm.edu	37	7	144096177	144096177	+	Silent	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr7:144096177G>A	ENST00000467773.1	-	8	1334	c.1335C>T	c.(1333-1335)ccC>ccT	p.P445P	NOBOX_ENST00000483238.1_Silent_p.P413P|NOBOX_ENST00000223140.5_Silent_p.P328P	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	445	Pro-rich.				oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					GCACAGGTGGGGGGCTGAAGA	0.632																																					p.P445P		Atlas-SNP	.											.	NOBOX	130	.	0			c.C1335T						PASS	.						11.0	12.0	11.0					7																	144096177		1824	3970	5794	SO:0001819	synonymous_variant	135935	exon8			AGGTGGGGGGCTG			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.1335C>T	chr7.hg19:g.144096177G>A		75.0	0.0	.		99.0	23.0	.	NM_001080413	A6NCD3|A8MZN5	Silent	SNP	ENST00000467773.1	hg19																																																																																				.	.	.	none		0.632	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	XM_001134420	
TCEB1	6921	hgsc.bcm.edu	37	8	74858968	74858968	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr8:74858968T>C	ENST00000522337.1	-	5	555	c.236A>G	c.(235-237)tAc>tGc	p.Y79C	TCEB1_ENST00000523815.1_Missense_Mutation_p.Y79C|TCEB1_ENST00000520242.1_Missense_Mutation_p.Y79C|TCEB1_ENST00000519487.1_Missense_Mutation_p.Y79C|TCEB1_ENST00000518127.1_Missense_Mutation_p.Y79C|TCEB1_ENST00000284811.8_Missense_Mutation_p.Y79C|TCEB1_ENST00000602840.1_Intron|TCEB1_ENST00000520210.1_Missense_Mutation_p.Y63C			Q15369	ELOC_HUMAN	transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)	79					cellular response to hypoxia (GO:0071456)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.Y79F(1)|p.Y79L(1)		endometrium(2)|kidney(3)|lung(1)|prostate(1)	7	Breast(64;0.0311)		Epithelial(68;0.0136)|all cancers(69;0.0431)|BRCA - Breast invasive adenocarcinoma(89;0.0499)			GCGAACCTTGTACGTAAAATA	0.413																																					p.Y79C		Atlas-SNP	.											TCEB1,NS,carcinoma,0,5	TCEB1	16	.	2	Substitution - Missense(2)	kidney(2)	c.A236G						PASS	.						95.0	77.0	83.0					8																	74858968		2203	4300	6503	SO:0001583	missense	6921	exon4			ACCTTGTACGTAA	L34587	CCDS34910.1, CCDS56539.1	8q13.3	2010-04-21	2002-08-29		ENSG00000154582	ENSG00000154582			11617	protein-coding gene	gene with protein product		600788	"""transcription elongation factor B (SIII), polypeptide 1 (15kD, elongin C)"""			7821821, 7660122	Standard	NM_005648		Approved	SIII	uc003xzx.2	Q15369	OTTHUMG00000164501	ENST00000522337.1:c.236A>G	chr8.hg19:g.74858968T>C	ENSP00000429906:p.Tyr79Cys	223.0	2.0	.		193.0	58.0	.	NM_005648	E5RGD9|Q567Q6	Missense_Mutation	SNP	ENST00000522337.1	hg19	CCDS34910.1	.	.	.	.	.	.	.	.	.	.	T	15.63	2.889194	0.52014	.	.	ENSG00000154582	ENST00000518127;ENST00000520210;ENST00000520242;ENST00000519487;ENST00000284811;ENST00000522337;ENST00000523815;ENST00000519082	T;T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85;0.85	5.66	5.66	0.87406	BTB/POZ fold (2);	0.000000	0.48286	D	0.000198	T	0.64778	0.2629	H	0.94264	3.515	0.80722	D	1	B	0.26195	0.144	B	0.31614	0.133	T	0.70230	-0.4929	10	0.87932	D	0	-1.9844	15.8997	0.79362	0.0:0.0:0.0:1.0	.	79	Q15369	ELOC_HUMAN	C	79;63;79;79;79;79;79;79	ENSP00000428334:Y79C;ENSP00000430224:Y63C;ENSP00000428171:Y79C;ENSP00000429596:Y79C;ENSP00000284811:Y79C;ENSP00000429906:Y79C;ENSP00000428074:Y79C;ENSP00000429789:Y79C	ENSP00000284811:Y79C	Y	-	2	0	TCEB1	75021522	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.513000	0.81739	2.157000	0.67596	0.482000	0.46254	TAC	.	.	.	none		0.413	TCEB1-010	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000379020.1	NM_005648	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110439255	110439255	+	Missense_Mutation	SNP	C	C	T	rs35375999	byFrequency	TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr8:110439255C>T	ENST00000378402.5	+	25	2974	c.2870C>T	c.(2869-2871)gCa>gTa	p.A957V		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	957			A -> E (in dbSNP:rs35375999).		immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTGTCAGCTGCAGATCTGCAG	0.557										HNSCC(38;0.096)																											p.A957V		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.C2870T						PASS	.						74.0	76.0	76.0					8																	110439255		1980	4166	6146	SO:0001583	missense	93035	exon25			CAGCTGCAGATCT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2870C>T	chr8.hg19:g.110439255C>T	ENSP00000367655:p.Ala957Val	83.0	0.0	.		71.0	9.0	.	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071060	0.36566	.	.	ENSG00000205038	ENST00000378402	D	0.85861	-2.04	5.45	1.06	0.20224	.	0.770532	0.12118	N	0.497923	T	0.71108	0.3301	N	0.25426	0.745	0.23823	N	0.996742	B	0.09022	0.002	B	0.08055	0.003	T	0.52305	-0.8593	10	0.13108	T	0.6	.	6.1929	0.20534	0.0:0.5062:0.0:0.4938	.	957	Q86WI1	PKHL1_HUMAN	V	957	ENSP00000367655:A957V	ENSP00000367655:A957V	A	+	2	0	PKHD1L1	110508431	0.004000	0.15560	0.997000	0.53966	0.897000	0.52465	0.192000	0.17096	0.279000	0.22186	-0.225000	0.12378	GCA	.	C|0.985;A|0.015	.	alt		0.557	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
AKR1C1	1645	hgsc.bcm.edu	37	10	5008141	5008141	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr10:5008141G>T	ENST00000380872.4	+	2	312	c.120G>T	c.(118-120)ttG>ttT	p.L40F	AKR1C1_ENST00000434459.2_Missense_Mutation_p.L40F|AKR1C1_ENST00000477661.1_3'UTR|AKR1C1_ENST00000380859.1_Missense_Mutation_p.L42F	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	40					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	CCACCAAATTGGCAATTGAAG	0.448																																					p.L40F	Colon(130;2054 2316 13360 15380)	Atlas-SNP	.											.	AKR1C1	39	.	0			c.G120T						PASS	.						92.0	84.0	87.0					10																	5008141		2203	4300	6503	SO:0001583	missense	1645	exon2			CAAATTGGCAATT	D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.120G>T	chr10.hg19:g.5008141G>T	ENSP00000370254:p.Leu40Phe	155.0	0.0	.		184.0	20.0	.	NM_001353	P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	ENST00000380872.4	hg19	CCDS7061.1	.	.	.	.	.	.	.	.	.	.	G	0.039	-1.290978	0.01375	.	.	ENSG00000187134	ENST00000434459;ENST00000380872;ENST00000380859	T;T;T	0.25414	1.8;1.8;1.8	2.48	-3.93	0.04143	NADP-dependent oxidoreductase domain (3);	1.106620	0.07086	N	0.837917	T	0.11879	0.0289	N	0.16478	0.41	0.18873	N	0.999983	B;B;B	0.13594	0.008;0.001;0.001	B;B;B	0.21360	0.034;0.004;0.009	T	0.36529	-0.9744	10	0.12766	T	0.61	.	4.7478	0.13045	0.248:0.0:0.5559:0.1961	.	40;40;40	B4E0M1;Q2XPP3;Q04828	.;.;AK1C1_HUMAN	F	40;40;42	ENSP00000412248:L40F;ENSP00000370254:L40F;ENSP00000370240:L42F	ENSP00000370240:L42F	L	+	3	2	AKR1C1	4998141	0.002000	0.14202	0.003000	0.11579	0.009000	0.06853	-0.301000	0.08232	-0.700000	0.05070	0.305000	0.20034	TTG	.	.	.	none		0.448	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353	
UPF2	26019	hgsc.bcm.edu	37	10	11985132	11985132	+	Silent	SNP	T	T	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr10:11985132T>C	ENST00000356352.2	-	16	3683	c.3210A>G	c.(3208-3210)gaA>gaG	p.E1070E	UPF2_ENST00000357604.5_Silent_p.E1070E|UPF2_ENST00000397053.2_Silent_p.E1070E			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	1070	Glu-rich.|Sufficient for interaction with EIF4A1 and EIF1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				CTTCCTCCTCTTCTTCTCCCT	0.328																																					p.E1070E		Atlas-SNP	.											.	UPF2	111	.	0			c.A3210G						PASS	.						159.0	142.0	147.0					10																	11985132		2202	4300	6502	SO:0001819	synonymous_variant	26019	exon17			CTCCTCTTCTTCT	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.3210A>G	chr10.hg19:g.11985132T>C		43.0	0.0	.		75.0	19.0	.	NM_080599	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Silent	SNP	ENST00000356352.2	hg19	CCDS7086.1																																																																																			.	.	.	none		0.328	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1		
SLC16A9	220963	hgsc.bcm.edu	37	10	61413535	61413535	+	Missense_Mutation	SNP	A	A	G	rs372708622		TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr10:61413535A>G	ENST00000395348.3	-	5	1885	c.1249T>C	c.(1249-1251)Tat>Cat	p.Y417H	SLC16A9_ENST00000395347.1_Missense_Mutation_p.Y417H	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	417					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						GTGGTCACATATGGAAAGATG	0.443																																					p.Y417H		Atlas-SNP	.											.	SLC16A9	58	.	0			c.T1249C						PASS	.	A	HIS/TYR	1,4405	2.1+/-5.4	0,1,2202	116.0	108.0	111.0		1249	5.2	1.0	10		111	0,8600		0,0,4300	no	missense	SLC16A9	NM_194298.2	83	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	417/510	61413535	1,13005	2203	4300	6503	SO:0001583	missense	220963	exon5			TCACATATGGAAA	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.1249T>C	chr10.hg19:g.61413535A>G	ENSP00000378757:p.Tyr417His	90.0	0.0	.		109.0	22.0	.	NM_194298	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	hg19	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.109161	0.77096	2.27E-4	0.0	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.58940	0.3;0.3	5.2	5.2	0.72013	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.107752	0.64402	D	0.000003	T	0.72630	0.3484	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70407	-0.4880	10	0.26408	T	0.33	.	15.0446	0.71816	1.0:0.0:0.0:0.0	.	417	Q7RTY1	MOT9_HUMAN	H	417	ENSP00000378757:Y417H;ENSP00000378756:Y417H	ENSP00000378756:Y417H	Y	-	1	0	SLC16A9	61083541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	1.956000	0.56807	0.482000	0.46254	TAT	.	.	.	none		0.443	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
WDR11	55717	hgsc.bcm.edu	37	10	122650370	122650370	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr10:122650370G>T	ENST00000263461.6	+	19	2732	c.2486G>T	c.(2485-2487)tGc>tTc	p.C829F	WDR11_ENST00000604509.1_Intron	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						AAGTCTGCGTGCTTTAGAATG	0.433																																					p.C829F		Atlas-SNP	.											.	WDR11	95	.	0			c.G2486T						PASS	.						206.0	192.0	197.0					10																	122650370		2203	4300	6503	SO:0001583	missense	55717	exon19			CTGCGTGCTTTAG	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.2486G>T	chr10.hg19:g.122650370G>T	ENSP00000263461:p.Cys829Phe	108.0	0.0	.		127.0	26.0	.	NM_018117	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000263461.6	hg19	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568063	0.86439	.	.	ENSG00000120008	ENST00000263461	D	0.90788	-2.73	5.51	5.51	0.81932	WD40/YVTN repeat-like-containing domain (1);	0.094012	0.85682	D	0.000000	D	0.82889	0.5135	N	0.22421	0.69	0.58432	D	0.999999	B;B;P;B	0.47604	0.41;0.139;0.898;0.167	B;B;B;B	0.37550	0.205;0.016;0.253;0.034	T	0.81854	-0.0741	10	0.10636	T	0.68	-13.3	19.4182	0.94710	0.0:0.0:1.0:0.0	.	829;829;120;358	Q9BZH6;B2RCJ6;Q9NWV7;Q659C9	WDR11_HUMAN;.;.;.	F	829	ENSP00000263461:C829F	ENSP00000263461:C829F	C	+	2	0	WDR11	122640360	1.000000	0.71417	0.025000	0.17156	0.888000	0.51559	9.296000	0.96104	2.575000	0.86900	0.655000	0.94253	TGC	.	.	.	none		0.433	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2		
OR51E2	81285	hgsc.bcm.edu	37	11	4703537	4703537	+	Silent	SNP	G	G	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr11:4703537G>T	ENST00000396950.3	-	2	644	c.405C>A	c.(403-405)ctC>ctA	p.L135L		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	135					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		CTGTATTGTTGAGCACTGCAG	0.557																																					p.L135L		Atlas-SNP	.											.	OR51E2	77	.	0			c.C405A						PASS	.						59.0	49.0	52.0					11																	4703537		2201	4298	6499	SO:0001819	synonymous_variant	81285	exon2			ATTGTTGAGCACT	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.405C>A	chr11.hg19:g.4703537G>T		77.0	0.0	.		95.0	25.0	.	NM_030774	B2RA63|Q6IF94	Silent	SNP	ENST00000396950.3	hg19	CCDS7751.1																																																																																			.	.	.	none		0.557	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774	
CKAP5	9793	hgsc.bcm.edu	37	11	46799725	46799725	+	Silent	SNP	G	G	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr11:46799725G>T	ENST00000529230.1	-	22	2758	c.2712C>A	c.(2710-2712)gcC>gcA	p.A904A	CKAP5_ENST00000354558.3_Silent_p.A904A|CKAP5_ENST00000312055.5_Silent_p.A904A|CKAP5_ENST00000415402.1_Silent_p.A904A			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	904					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GACCCTTCAAGGCAGTTGGAA	0.403																																					p.A904A	Ovarian(4;85 273 2202 4844 13323)	Atlas-SNP	.											.	CKAP5	134	.	0			c.C2712A						PASS	.						145.0	152.0	149.0					11																	46799725		2201	4299	6500	SO:0001819	synonymous_variant	9793	exon22			CTTCAAGGCAGTT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.2712C>A	chr11.hg19:g.46799725G>T		105.0	0.0	.		92.0	20.0	.	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Silent	SNP	ENST00000529230.1	hg19	CCDS31477.1																																																																																			.	.	.	none		0.403	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
RPS6KB2	6199	hgsc.bcm.edu	37	11	67201948	67201948	+	Missense_Mutation	SNP	C	C	G	rs369245928		TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr11:67201948C>G	ENST00000312629.5	+	13	1193	c.1148C>G	c.(1147-1149)gCc>gGc	p.A383G	AP003419.16_ENST00000535922.1_RNA	NM_003952.2	NP_003943.2	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 2	383	AGC-kinase C-terminal.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|signal transduction (GO:0007165)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|salivary_gland(1)|stomach(2)	25			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			GCCAACCAGGCCTTCCTGGTG	0.647																																					p.A383G		Atlas-SNP	.											.	RPS6KB2	92	.	0			c.C1148G						PASS	.						24.0	28.0	27.0					11																	67201948		2080	4189	6269	SO:0001583	missense	6199	exon13			ACCAGGCCTTCCT	AB019245	CCDS41677.1	11q13.1	2011-04-05	2002-08-29		ENSG00000175634	ENSG00000175634			10437	protein-coding gene	gene with protein product		608939	"""ribosomal protein S6 kinase, 70kD, polypeptide 2"""			9878560, 9804755	Standard	XM_005274164		Approved	p70S6Kb, P70-BETA, STK14B, KLS	uc001old.3	Q9UBS0	OTTHUMG00000167673	ENST00000312629.5:c.1148C>G	chr11.hg19:g.67201948C>G	ENSP00000308413:p.Ala383Gly	42.0	0.0	.		47.0	4.0	.	NM_003952	B2RMZ9|B4DML8|O94809|Q9UEC1	Missense_Mutation	SNP	ENST00000312629.5	hg19	CCDS41677.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.119441	0.37436	.	.	ENSG00000175634	ENST00000312629	T	0.58060	0.36	4.52	4.52	0.55395	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.50086	0.1595	M	0.62088	1.915	0.80722	D	1	B;B	0.15719	0.014;0.005	B;B	0.22601	0.04;0.012	T	0.54622	-0.8266	10	0.87932	D	0	.	10.6873	0.45850	0.0:0.9105:0.0:0.0895	.	383;383	Q9BRS0;Q9UBS0	.;KS6B2_HUMAN	G	383	ENSP00000308413:A383G	ENSP00000308413:A383G	A	+	2	0	RPS6KB2	66958524	1.000000	0.71417	1.000000	0.80357	0.391000	0.30476	1.875000	0.39578	2.339000	0.79563	0.313000	0.20887	GCC	.	.	.	alt		0.647	RPS6KB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395508.1	NM_003952	
CARD17	440068	hgsc.bcm.edu	37	11	104971430	104971430	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr11:104971430T>A	ENST00000375707.1	-	2	100	c.84A>T	c.(82-84)gaA>gaT	p.E28D	CASP1_ENST00000598974.1_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000593315.1_Intron|CARD16_ENST00000525374.1_Intron|CASP1_ENST00000415981.2_Intron	NM_001007232.1	NP_001007233.1	Q5XLA6	CAR17_HUMAN	caspase recruitment domain family, member 17	28	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	6						TCTCCAATAATTCACCCAGTA	0.438																																					p.E28D		Atlas-SNP	.											.	CARD17	15	.	0			c.A84T						PASS	.						198.0	187.0	191.0					11																	104971430		2202	4299	6501	SO:0001583	missense	440068	exon2			CAATAATTCACCC		CCDS31662.1	11q22.3	2009-01-13				ENSG00000255221			33827	protein-coding gene	gene with protein product	"""Inhibitory CARD"""	609490				15383541	Standard	NM_001007232		Approved	INCA	uc001pir.1	Q5XLA6		ENST00000375707.1:c.84A>T	chr11.hg19:g.104971430T>A	ENSP00000364859:p.Glu28Asp	95.0	0.0	.		125.0	36.0	.	NM_001007232		Missense_Mutation	SNP	ENST00000375707.1	hg19	CCDS31662.1	.	.	.	.	.	.	.	.	.	.	.	4.355	0.065284	0.08388	.	.	ENSG00000255221	ENST00000375707	T	0.20069	2.1	2.92	-3.18	0.05186	DEATH-like (2);Caspase Recruitment (3);	.	.	.	.	T	0.12390	0.0301	N	0.24115	0.695	0.09310	N	1	B	0.29481	0.245	B	0.44044	0.439	T	0.40961	-0.9535	9	0.02654	T	1	.	0.3399	0.00332	0.3708:0.1307:0.1905:0.3079	.	28	Q5XLA6	CAR17_HUMAN	D	28	ENSP00000364859:E28D	ENSP00000364859:E28D	E	-	3	2	CARD17	104476640	0.000000	0.05858	0.026000	0.17262	0.040000	0.13550	-1.024000	0.03603	-0.391000	0.07763	0.418000	0.28097	GAA	.	.	.	none		0.438	CARD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388181.1	NM_001007232	
ARF3	377	hgsc.bcm.edu	37	12	49332835	49332835	+	Silent	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr12:49332835G>A	ENST00000256682.4	-	5	775	c.441C>T	c.(439-441)tcC>tcT	p.S147S	ARF3_ENST00000541967.1_5'Flank|ARF3_ENST00000541959.1_Silent_p.S147S|AC073610.5_ENST00000537495.1_Silent_p.S22S|RP11-302B13.5_ENST00000398092.4_Intron|ARF3_ENST00000447318.2_Silent_p.S110S	NM_001659.2	NP_001650.1	P61204	ARF3_HUMAN	ADP-ribosylation factor 3	147					GTP catabolic process (GO:0006184)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|lung(2)|skin(1)	4						GGTGACGAAGGGAATGCAGGC	0.537																																					p.S147S	Pancreas(189;1862 2134 4419 30933 49364)	Atlas-SNP	.											.	ARF3	11	.	0			c.C441T						PASS	.						145.0	124.0	131.0					12																	49332835		2203	4300	6503	SO:0001819	synonymous_variant	377	exon5			ACGAAGGGAATGC	M74491	CCDS8774.1	12q13.12	2013-01-22			ENSG00000134287	ENSG00000134287		"""ADP-ribosylation factors"""	654	protein-coding gene	gene with protein product	"""small GTP binding protein"""	103190				8661066	Standard	NM_001659		Approved		uc001rsr.2	P61204	OTTHUMG00000168080	ENST00000256682.4:c.441C>T	chr12.hg19:g.49332835G>A		98.0	0.0	.		116.0	28.0	.	NM_001659	A8K6G8|B7ZB63|P16587	Silent	SNP	ENST00000256682.4	hg19	CCDS8774.1																																																																																			.	.	.	none		0.537	ARF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258242.2	NM_001659	
VTI1B	10490	hgsc.bcm.edu	37	14	68126460	68126460	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr14:68126460C>A	ENST00000554659.1	-	3	695	c.354G>T	c.(352-354)gaG>gaT	p.E118D	RP11-1012A1.4_ENST00000554493.1_5'Flank|5S_rRNA_ENST00000607639.1_RNA	NM_006370.2	NP_006361.1	Q9UEU0	VTI1B_HUMAN	vesicle transport through interaction with t-SNAREs 1B	118					cell proliferation (GO:0008283)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			endometrium(1)|large_intestine(2)|stomach(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)		TATGCTCATTCTCTACAGCAT	0.408																																					p.E118D		Atlas-SNP	.											.	VTI1B	15	.	0			c.G354T						PASS	.						84.0	74.0	78.0					14																	68126460		2203	4300	6503	SO:0001583	missense	10490	exon3			CTCATTCTCTACA	AF060902	CCDS9786.1	14q23.3	2012-12-10	2012-12-10		ENSG00000100568	ENSG00000100568			17793	protein-coding gene	gene with protein product		603207	"""vesicle transport through interaction with t-SNAREs homolog 1B (yeast)"""			9636656, 9446565	Standard	NM_006370		Approved	VTI2	uc001xjt.3	Q9UEU0	OTTHUMG00000171251	ENST00000554659.1:c.354G>T	chr14.hg19:g.68126460C>A	ENSP00000450731:p.Glu118Asp	36.0	0.0	.		51.0	19.0	.	NM_006370	O43547|Q96J28	Missense_Mutation	SNP	ENST00000554659.1	hg19	CCDS9786.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.08|12.08	1.829916|1.829916	0.32329|0.32329	.|.	.|.	ENSG00000100568|ENSG00000100568	ENST00000554659|ENST00000554636;ENST00000556461	.|.	.|.	.|.	5.12|5.12	0.197|0.197	0.15164|0.15164	.|.	0.239820|0.239820	0.44285|0.44285	D|D	0.000468|0.000468	T|.	0.30386|.	0.0763|.	N|N	0.08118|0.08118	0|0	0.44104|0.44104	D|D	0.996874|0.996874	P;P|.	0.52463|.	0.953;0.919|.	P;P|.	0.47603|.	0.551;0.45|.	T|.	0.03344|.	-1.1046|.	9|.	0.15066|.	T|.	0.55|.	.|.	9.4955|9.4955	0.38986|0.38986	0.0:0.3897:0.0:0.6103|0.0:0.3897:0.0:0.6103	.|.	118;118|.	A8K6M4;Q9UEU0|.	.;VTI1B_HUMAN|.	D|X	118|17;35	.|.	ENSP00000216456:E118D|.	E|E	-|-	3|1	2|0	VTI1B|VTI1B	67196213|67196213	0.996000|0.996000	0.38824|0.38824	0.964000|0.964000	0.40570|0.40570	0.573000|0.573000	0.36030|0.36030	0.404000|0.404000	0.20999|0.20999	-0.060000|-0.060000	0.13132|0.13132	-0.244000|-0.244000	0.11960|0.11960	GAG|GAA	.	.	.	none		0.408	VTI1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412558.2		
ECI1	1632	hgsc.bcm.edu	37	16	2301546	2301546	+	Silent	SNP	G	G	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr16:2301546G>T	ENST00000301729.4	-	1	69	c.22C>A	c.(22-24)Cga>Aga	p.R8R	ECI1_ENST00000562238.1_Silent_p.R8R|ECI1_ENST00000570258.1_Intron|AC009065.1_ENST00000454671.1_5'Flank	NM_001919.3	NP_001910.2	P42126	ECI1_HUMAN	enoyl-CoA delta isomerase 1	8					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|intramolecular oxidoreductase activity (GO:0016860)			endometrium(1)|large_intestine(2)|lung(6)	9						GCCGGGACTCGCACAGAAGCC	0.736																																					p.R8R		Atlas-SNP	.											.	ECI1	20	.	0			c.C22A						PASS	.						3.0	5.0	5.0					16																	2301546		1966	3980	5946	SO:0001819	synonymous_variant	1632	exon1			GGACTCGCACAGA		CCDS10464.1, CCDS58410.1	16p13.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000167969	ENSG00000167969	5.3.3.8		2703	protein-coding gene	gene with protein product	"""3,2 trans-enoyl-CoA isomerase"""	600305	"""dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)"", ""dodecenoyl-CoA isomerase"""	DCI		7829074	Standard	NM_001178029		Approved		uc002cpr.3	P42126	OTTHUMG00000128830	ENST00000301729.4:c.22C>A	chr16.hg19:g.2301546G>T		97.0	0.0	.		108.0	22.0	.	NM_001178029	A8K512|Q13290|Q7Z2L6|Q7Z2L7|Q9BUB8|Q9BW05|Q9UDG6	Silent	SNP	ENST00000301729.4	hg19	CCDS10464.1																																																																																			.	.	.	none		0.736	ECI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250768.1		
PPL	5493	hgsc.bcm.edu	37	16	4935927	4935927	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr16:4935927T>G	ENST00000345988.2	-	22	2818	c.2729A>C	c.(2728-2730)gAg>gCg	p.E910A	PPL_ENST00000590782.2_Missense_Mutation_p.E908A	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	910					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						GACCTCGTTCTCCAGCTGCCG	0.577																																					p.E910A		Atlas-SNP	.											.	PPL	168	.	0			c.A2729C						PASS	.						81.0	85.0	84.0					16																	4935927		2197	4300	6497	SO:0001583	missense	5493	exon22			TCGTTCTCCAGCT	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2729A>C	chr16.hg19:g.4935927T>G	ENSP00000340510:p.Glu910Ala	28.0	0.0	.		38.0	9.0	.	NM_002705	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	hg19	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.035131	0.75617	.	.	ENSG00000118898	ENST00000345988	T	0.55588	0.51	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.71005	0.3289	M	0.72118	2.19	0.58432	D	0.999999	D	0.69078	0.997	D	0.77004	0.989	T	0.74990	-0.3475	10	0.72032	D	0.01	.	14.8296	0.70137	0.0:0.0:0.0:1.0	.	910	O60437	PEPL_HUMAN	A	910	ENSP00000340510:E910A	ENSP00000340510:E910A	E	-	2	0	PPL	4875928	1.000000	0.71417	0.994000	0.49952	0.575000	0.36095	8.003000	0.88520	1.918000	0.55548	0.374000	0.22700	GAG	.	.	.	none		0.577	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
CACNG3	10368	hgsc.bcm.edu	37	16	24372986	24372986	+	Silent	SNP	C	C	T	rs148951012		TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr16:24372986C>T	ENST00000005284.3	+	4	1952	c.750C>T	c.(748-750)atC>atT	p.I250I		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	250					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		TGTCCCCCATCAGCAAAGGCT	0.587																																					p.I250I		Atlas-SNP	.											.	CACNG3	112	.	0			c.C750T						PASS	.			0,4394		0,0,2197	96.0	101.0	100.0		750	4.0	1.0	16	dbSNP_134	100	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CACNG3	NM_006539.3		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		250/316	24372986	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	10368	exon4			CCCCATCAGCAAA	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.750C>T	chr16.hg19:g.24372986C>T		125.0	0.0	.		121.0	23.0	.	NM_006539		Silent	SNP	ENST00000005284.3	hg19	CCDS10620.1																																																																																			.	C|1.000;T|0.000	0.000	weak		0.587	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	
ZNF469	84627	hgsc.bcm.edu	37	16	88501018	88501018	+	Silent	SNP	A	A	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr16:88501018A>T	ENST00000437464.1	+	2	7056	c.7056A>T	c.(7054-7056)ccA>ccT	p.P2352P	ZNF469_ENST00000565624.1_Silent_p.P2380P	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CGGAGGACCCAGGGACCCCTG	0.672																																					p.P2352P		Atlas-SNP	.											.	ZNF469	121	.	0			c.A7056T						PASS	.						20.0	29.0	26.0					16																	88501018		692	1589	2281	SO:0001819	synonymous_variant	84627	exon2			GGACCCAGGGACC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7056A>T	chr16.hg19:g.88501018A>T		143.0	0.0	.		186.0	47.0	.	NM_001127464		Silent	SNP	ENST00000437464.1	hg19	CCDS45544.1																																																																																			.	.	.	none		0.672	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
HES7	84667	hgsc.bcm.edu	37	17	8024974	8024974	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr17:8024974G>A	ENST00000317814.4	-	4	592	c.593C>T	c.(592-594)cCg>cTg	p.P198L	ALOXE3_ENST00000318227.3_5'Flank|HES7_ENST00000541682.2_Missense_Mutation_p.P203L			Q9BYE0	HES7_HUMAN	hes family bHLH transcription factor 7	198	Pro-rich.				mesoderm development (GO:0007498)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|post-anal tail morphogenesis (GO:0036342)|regulation of somitogenesis (GO:0014807)|rhythmic process (GO:0048511)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)										CGGTGGCGGCGGCAGCAGTCC	0.761																																					p.P203L		Atlas-SNP	.											.	.	.	.	0			c.C608T						PASS	.						1.0	1.0	1.0					17																	8024974		690	1880	2570	SO:0001583	missense	84667	exon4			GGCGGCGGCAGCA	AB049064	CCDS42258.1, CCDS54085.1	17p13.1	2013-10-17	2013-10-17			ENSG00000179111		"""Basic helix-loop-helix proteins"""	15977	protein-coding gene	gene with protein product	"""bHLH factor Hes7"""	608059	"""hairy and enhancer of split 7 (Drosophila)"""			11260262	Standard	NM_032580		Approved	bHLHb37	uc002gkb.2	Q9BYE0		ENST00000317814.4:c.593C>T	chr17.hg19:g.8024974G>A	ENSP00000314774:p.Pro198Leu	361.0	0.0	.		386.0	89.0	.	NM_001165967	F8VPC9	Missense_Mutation	SNP	ENST00000317814.4	hg19	CCDS42258.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192157	0.58017	.	.	ENSG00000179111	ENST00000541682;ENST00000317814	T;T	0.79454	-1.27;-1.16	5.1	4.1	0.47936	.	1.346370	0.05201	N	0.505001	T	0.79913	0.4528	N	0.19112	0.55	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.69824	0.925;0.966	T	0.66176	-0.5989	10	0.20519	T	0.43	-7.0736	10.6303	0.45532	0.0:0.0:0.8077:0.1923	.	198;203	Q9BYE0;F8VPC9	HES7_HUMAN;.	L	203;198	ENSP00000446205:P203L;ENSP00000314774:P198L	ENSP00000314774:P198L	P	-	2	0	HES7	7965699	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	1.887000	0.39698	1.075000	0.40932	0.460000	0.39030	CCG	.	.	.	none		0.761	HES7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441479.1	NM_032580	
MYH3	4621	hgsc.bcm.edu	37	17	10538254	10538254	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr17:10538254T>C	ENST00000583535.1	-	31	4346	c.4259A>G	c.(4258-4260)cAg>cGg	p.Q1420R	MYH3_ENST00000226209.7_Missense_Mutation_p.Q1420R	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1420					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TTGCAGCCTCTGCTTGGTCTT	0.483																																					p.Q1420R		Atlas-SNP	.											.	MYH3	227	.	0			c.A4259G						PASS	.						121.0	111.0	114.0					17																	10538254		2203	4300	6503	SO:0001583	missense	4621	exon31			AGCCTCTGCTTGG		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.4259A>G	chr17.hg19:g.10538254T>C	ENSP00000464317:p.Gln1420Arg	97.0	0.0	.		105.0	34.0	.	NM_002470	Q15492	Missense_Mutation	SNP	ENST00000583535.1	hg19	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843566	0.91197	.	.	ENSG00000109063	ENST00000226209	T	0.77750	-1.12	5.27	5.27	0.74061	Myosin tail (1);	.	.	.	.	D	0.87075	0.6087	M	0.85777	2.775	0.45056	D	0.998071	D	0.52996	0.957	P	0.57468	0.821	D	0.88963	0.3395	9	0.59425	D	0.04	.	15.4719	0.75446	0.0:0.0:0.0:1.0	.	1420	P11055	MYH3_HUMAN	R	1420	ENSP00000226209:Q1420R	ENSP00000226209:Q1420R	Q	-	2	0	MYH3	10478979	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.291000	0.59025	2.104000	0.64026	0.533000	0.62120	CAG	.	.	.	none		0.483	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
RAI1	10743	hgsc.bcm.edu	37	17	17701402	17701402	+	Nonsense_Mutation	SNP	A	A	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr17:17701402A>T	ENST00000353383.1	+	3	5609	c.5140A>T	c.(5140-5142)Aaa>Taa	p.K1714*	RAI1_ENST00000261641.6_Intron	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1714					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CTGCCTCCCCAAAAAGAAGCC	0.577																																					p.K1714X		Atlas-SNP	.											.	RAI1	121	.	0			c.A5140T						PASS	.						53.0	57.0	56.0					17																	17701402		2203	4300	6503	SO:0001587	stop_gained	10743	exon3			CTCCCCAAAAAGA	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.5140A>T	chr17.hg19:g.17701402A>T	ENSP00000323074:p.Lys1714*	146.0	0.0	.		165.0	36.0	.	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Nonsense_Mutation	SNP	ENST00000353383.1	hg19	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	A	48	13.919646	0.99770	.	.	ENSG00000108557	ENST00000353383;ENST00000395776;ENST00000315321	.	.	.	5.09	4.01	0.46588	.	0.073600	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1809	0.54211	0.8568:0.1432:0.0:0.0	.	.	.	.	X	1714;1714;1602	.	ENSP00000322928:K1602X	K	+	1	0	RAI1	17642127	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	4.724000	0.61972	0.794000	0.33899	-0.375000	0.07067	AAA	.	.	.	none		0.577	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
CDK5RAP3	80279	hgsc.bcm.edu	37	17	46048728	46048728	+	Splice_Site	SNP	G	G	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr17:46048728G>T	ENST00000338399.4	+	2	113	c.7G>T	c.(7-9)Gac>Tac	p.D3Y	RP11-6N17.9_ENST00000582262.1_RNA|CDK5RAP3_ENST00000536708.2_Splice_Site_p.D28Y	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	3					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						TTCCCGCCAGGACCATCAGCA	0.682																																					p.D3Y		Atlas-SNP	.											.	CDK5RAP3	38	.	0			c.G7T						PASS	.						27.0	31.0	30.0					17																	46048728		2089	4198	6287	SO:0001630	splice_region_variant	80279	exon2			CGCCAGGACCATC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.7-1G>T	chr17.hg19:g.46048728G>T		114.0	0.0	.		141.0	39.0	.	NM_176096	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Missense_Mutation	SNP	ENST00000338399.4	hg19	CCDS42356.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.316083	0.81469	.	.	ENSG00000108465	ENST00000536708;ENST00000338399	T;T	0.53640	0.61;0.61	5.0	5.0	0.66597	.	0.051123	0.85682	D	0.000000	T	0.57431	0.2053	M	0.71036	2.16	0.80722	D	1	P	0.45474	0.859	P	0.50440	0.641	T	0.58634	-0.7602	9	.	.	.	4.6964	13.7672	0.63002	0.0:0.0:1.0:0.0	.	3	Q96JB5	CK5P3_HUMAN	Y	28;3	ENSP00000438886:D28Y;ENSP00000344683:D3Y	.	D	+	1	0	CDK5RAP3	43403727	1.000000	0.71417	0.999000	0.59377	0.780000	0.44128	6.238000	0.72350	2.337000	0.79520	0.561000	0.74099	GAC	.	.	.	none		0.682	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096	Missense_Mutation
CD7	924	hgsc.bcm.edu	37	17	80274160	80274160	+	Missense_Mutation	SNP	C	C	T	rs200504177		TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr17:80274160C>T	ENST00000312648.3	-	3	629	c.523G>A	c.(523-525)Gca>Aca	p.A175T	CD7_ENST00000584284.1_Missense_Mutation_p.A175T|CD7_ENST00000578509.1_Missense_Mutation_p.A75T|CD7_ENST00000583376.1_Missense_Mutation_p.A75T	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	175	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GCAGAGGCTGCTGGCGGGTCA	0.716																																					p.A175T	Pancreas(45;804 1068 19702 28207 28798)	Atlas-SNP	.											.	CD7	25	.	0			c.G523A						PASS	.						11.0	13.0	13.0					17																	80274160		2157	4241	6398	SO:0001583	missense	924	exon3			AGGCTGCTGGCGG	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.523G>A	chr17.hg19:g.80274160C>T	ENSP00000312027:p.Ala175Thr	42.0	0.0	.		83.0	25.0	.	NM_006137		Missense_Mutation	SNP	ENST00000312648.3	hg19	CCDS11807.1	.	.	.	.	.	.	.	.	.	.	c	7.421	0.636759	0.14386	.	.	ENSG00000173762	ENST00000312648	T	0.23552	1.9	2.36	-1.28	0.09318	.	.	.	.	.	T	0.10337	0.0253	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35992	-0.9766	9	0.19590	T	0.45	3.6689	5.816	0.18492	0.0:0.4734:0.0:0.5266	.	175;175	Q29VG3;P09564	.;CD7_HUMAN	T	175	ENSP00000312027:A175T	ENSP00000312027:A175T	A	-	1	0	CD7	77867449	0.227000	0.23707	0.003000	0.11579	0.013000	0.08279	0.220000	0.17660	-0.330000	0.08514	-1.031000	0.02408	GCA	.	.	.	weak		0.716	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
CD7	924	hgsc.bcm.edu	37	17	80274162	80274162	+	Missense_Mutation	SNP	G	G	T	rs201027731|rs555569626	byFrequency	TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr17:80274162G>T	ENST00000312648.3	-	3	627	c.521C>A	c.(520-522)cCa>cAa	p.P174Q	CD7_ENST00000584284.1_Missense_Mutation_p.P174Q|CD7_ENST00000578509.1_Missense_Mutation_p.P74Q|CD7_ENST00000583376.1_Missense_Mutation_p.P74Q	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	174	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			AGAGGCTGCTGGCGGGTCAGG	0.716																																					p.P174Q	Pancreas(45;804 1068 19702 28207 28798)	Atlas-SNP	.											.,1	CD7	25	.	0			c.C521A						PASS	.						11.0	14.0	13.0					17																	80274162		2162	4241	6403	SO:0001583	missense	924	exon3			GCTGCTGGCGGGT	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.521C>A	chr17.hg19:g.80274162G>T	ENSP00000312027:p.Pro174Gln	46.0	0.0	.		81.0	9.0	.	NM_006137		Missense_Mutation	SNP	ENST00000312648.3	hg19	CCDS11807.1	.	.	.	.	.	.	.	.	.	.	G	4.195	0.034900	0.08101	.	.	ENSG00000173762	ENST00000312648	T	0.19806	2.12	1.69	-3.31	0.04988	.	.	.	.	.	T	0.07503	0.0189	N	0.08118	0	0.09310	N	1	P;P	0.34724	0.465;0.465	B;B	0.30646	0.118;0.118	T	0.36601	-0.9741	9	0.16896	T	0.51	-2.5328	6.7819	0.23650	0.3361:0.0:0.6639:0.0	.	174;174	Q29VG3;P09564	.;CD7_HUMAN	Q	174	ENSP00000312027:P174Q	ENSP00000312027:P174Q	P	-	2	0	CD7	77867451	0.791000	0.28800	0.003000	0.11579	0.009000	0.06853	0.125000	0.15749	-0.861000	0.04094	0.306000	0.20318	CCA	.	.	.	weak		0.716	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
CD7	924	hgsc.bcm.edu	37	17	80274183	80274183	+	Missense_Mutation	SNP	G	G	C	rs199986856		TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr17:80274183G>C	ENST00000312648.3	-	3	606	c.500C>G	c.(499-501)gCc>gGc	p.A167G	CD7_ENST00000584284.1_Missense_Mutation_p.A167G|CD7_ENST00000578509.1_Missense_Mutation_p.A67G|CD7_ENST00000583376.1_Missense_Mutation_p.A67G	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	167	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GAGGGCAGAGGCTGTCTGCGG	0.711																																					p.A167G	Pancreas(45;804 1068 19702 28207 28798)	Atlas-SNP	.											CD7,rectum,carcinoma,0,2	CD7	25	.	0			c.C500G						PASS	.																																			SO:0001583	missense	924	exon3			GCAGAGGCTGTCT	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.500C>G	chr17.hg19:g.80274183G>C	ENSP00000312027:p.Ala167Gly	87.0	0.0	.		90.0	9.0	.	NM_006137		Missense_Mutation	SNP	ENST00000312648.3	hg19	CCDS11807.1	.	.	.	.	.	.	.	.	.	.	G	1.766	-0.485462	0.04352	.	.	ENSG00000173762	ENST00000312648	T	0.25912	1.77	0.122	-0.245	0.13027	.	.	.	.	.	T	0.08537	0.0212	N	0.08118	0	0.20926	N	0.999825	P;P	0.38110	0.618;0.618	B;B	0.28638	0.092;0.092	T	0.27088	-1.0084	9	0.21540	T	0.41	.	4.5003	0.11860	0.3195:0.0:0.6805:0.0	.	167;167	Q29VG3;P09564	.;CD7_HUMAN	G	167	ENSP00000312027:A167G	ENSP00000312027:A167G	A	-	2	0	CD7	77867472	0.013000	0.17824	0.007000	0.13788	0.007000	0.05969	0.000000	0.12993	-1.039000	0.03275	-1.031000	0.02408	GCC	.	G|0.999;A|0.001	.	alt		0.711	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
MAP2K7	5609	hgsc.bcm.edu	37	19	7975205	7975205	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr19:7975205G>T	ENST00000397979.3	+	4	448	c.394G>T	c.(394-396)Ggc>Tgc	p.G132C	MAP2K7_ENST00000545011.1_Missense_Mutation_p.G174C|CTD-3193O13.13_ENST00000595655.1_RNA|MAP2K7_ENST00000397983.3_Missense_Mutation_p.G148C|MAP2K7_ENST00000397981.3_Missense_Mutation_p.G132C	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	132	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						CGGCACCTGCGGCCAGGTGTG	0.667																																					p.G132C		Atlas-SNP	.											MAP2K7,NS,carcinoma,0,1	MAP2K7	66	.	0			c.G394T						PASS	.						32.0	39.0	37.0					19																	7975205		2033	4174	6207	SO:0001583	missense	5609	exon4			ACCTGCGGCCAGG	AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.394G>T	chr19.hg19:g.7975205G>T	ENSP00000381066:p.Gly132Cys	134.0	0.0	.		153.0	40.0	.	NM_145185	B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	Missense_Mutation	SNP	ENST00000397979.3	hg19	CCDS42491.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016907	0.93404	.	.	ENSG00000076984	ENST00000397981;ENST00000397983;ENST00000545011;ENST00000425613;ENST00000397979	T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41	5.31	5.31	0.75309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94345	0.8182	H	0.99156	4.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96653	0.9483	10	0.87932	D	0	-12.8954	16.4609	0.84044	0.0:0.0:1.0:0.0	.	132;132	O14733-4;O14733	.;MP2K7_HUMAN	C	132;148;174;148;132	ENSP00000381068:G132C;ENSP00000381070:G148C;ENSP00000443946:G174C;ENSP00000381066:G132C	ENSP00000381066:G132C	G	+	1	0	MAP2K7	7881205	1.000000	0.71417	0.995000	0.50966	0.918000	0.54935	9.407000	0.97325	2.502000	0.84385	0.561000	0.74099	GGC	.	.	.	none		0.667	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000267980.1		
MUC16	94025	hgsc.bcm.edu	37	19	9045908	9045908	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr19:9045908G>C	ENST00000397910.4	-	5	35926	c.35723C>G	c.(35722-35724)aCa>aGa	p.T11908R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11910	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTATCAGTTGTTATAGAGGC	0.517																																					p.T11908R		Atlas-SNP	.											.	MUC16	4315	.	0			c.C35723G						PASS	.						99.0	94.0	95.0					19																	9045908		1901	4127	6028	SO:0001583	missense	94025	exon5			TCAGTTGTTATAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35723C>G	chr19.hg19:g.9045908G>C	ENSP00000381008:p.Thr11908Arg	90.0	0.0	.		121.0	31.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	G	6.583	0.475972	0.12521	.	.	ENSG00000181143	ENST00000397910	T	0.02258	4.37	3.79	1.67	0.24075	.	.	.	.	.	T	0.04588	0.0125	N	0.24115	0.695	.	.	.	D	0.76494	0.999	D	0.72075	0.976	T	0.38415	-0.9662	8	0.87932	D	0	.	5.8956	0.18937	0.2331:0.0:0.7669:0.0	.	11908	B5ME49	.	R	11908	ENSP00000381008:T11908R	ENSP00000381008:T11908R	T	-	2	0	MUC16	8906908	0.019000	0.18553	0.002000	0.10522	0.008000	0.06430	1.589000	0.36644	0.584000	0.29591	0.555000	0.69702	ACA	.	.	.	none		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
PRKCG	5582	hgsc.bcm.edu	37	19	54385763	54385763	+	Silent	SNP	C	C	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr19:54385763C>T	ENST00000263431.3	+	1	297	c.15C>T	c.(13-15)ggC>ggT	p.G5G	PRKCG_ENST00000536044.1_Silent_p.G5G|PRKCG_ENST00000540413.1_Silent_p.G5G|PRKCG_ENST00000542049.1_5'Flank	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	5					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CTGGTCTGGGCCCCGGCGTAG	0.617																																					p.G5G		Atlas-SNP	.											.	PRKCG	246	.	0			c.C15T						PASS	.						71.0	85.0	80.0					19																	54385763		2200	4298	6498	SO:0001819	synonymous_variant	5582	exon1			TCTGGGCCCCGGC	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.15C>T	chr19.hg19:g.54385763C>T		109.0	0.0	.		124.0	27.0	.	NM_002739	B7Z8Q0	Silent	SNP	ENST00000263431.3	hg19	CCDS12867.1																																																																																			.	.	.	none		0.617	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
TMC2	117532	hgsc.bcm.edu	37	20	2618194	2618194	+	Missense_Mutation	SNP	A	A	C	rs186977735		TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr20:2618194A>C	ENST00000358864.1	+	19	2475	c.2460A>C	c.(2458-2460)aaA>aaC	p.K820N		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	820					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						ACACACCTAAAAGCAGCTCCA	0.438																																					p.K820N		Atlas-SNP	.											.	TMC2	121	.	0			c.A2460C						PASS	.						154.0	145.0	148.0					20																	2618194		2203	4300	6503	SO:0001583	missense	117532	exon19			ACCTAAAAGCAGC	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.2460A>C	chr20.hg19:g.2618194A>C	ENSP00000351732:p.Lys820Asn	105.0	0.0	.		83.0	11.0	.	NM_080751	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	ENST00000358864.1	hg19	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	a	6.895	0.534564	0.13188	.	.	ENSG00000149488	ENST00000358864	T	0.64991	-0.13	4.88	-0.0212	0.13952	.	0.456200	0.22845	N	0.054932	T	0.42607	0.1210	L	0.44542	1.39	0.09310	N	1	B	0.25521	0.128	B	0.14023	0.01	T	0.13764	-1.0497	10	0.22109	T	0.4	-3.5909	3.5807	0.07952	0.5572:0.0:0.2825:0.1603	.	820	Q8TDI7	TMC2_HUMAN	N	820	ENSP00000351732:K820N	ENSP00000351732:K820N	K	+	3	2	TMC2	2566194	0.000000	0.05858	0.000000	0.03702	0.645000	0.38454	0.406000	0.21032	-0.110000	0.12022	-0.386000	0.06593	AAA	.	A|1.000;G|0.000	.	alt		0.438	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382426	24382426	+	IGR	SNP	G	G	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chrX:24382426G>C								AC004552.1 (15403 upstream) : PDK3 (100911 downstream)																							tgctgctgctgctcctgctcc	0.627																																					p.A517P		Atlas-SNP	.											.	.	.	.	0			c.G1549C						PASS	.						2.0	2.0	2.0					X																	24382426		1073	2483	3556	SO:0001628	intergenic_variant	100130302	exon1			GCTGCTGCTCCTG																													chrX.hg19:g.24382426G>C		80.0	0.0	.		86.0	11.0	.	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.627								
MT-CO2	4513	hgsc.bcm.edu	37	M	7814	7814	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chrM:7814G>A	ENST00000361739.1	+	1	229	c.229G>A	c.(229-231)Gcc>Acc	p.A77T	MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND3_ENST00000361227.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	77					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TAGTCCTCATCGCCCTCCCAT	0.468																																					p.A77T		Atlas-SNP	.											.	.	.	.	0			c.G229A						PASS	.																																			SO:0001583	missense	5743	exon1			CTCATCGCCCTCC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.229G>A	chrM.hg19:g.7814G>A	ENSP00000354876:p.Ala77Thr	20.0	0.0	.		21.0	4.0	.	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	hg19																																																																																				.	.	.	none		0.468	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
MT-ND6	4541	hgsc.bcm.edu	37	M	14261	14261	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chrM:14261T>C	ENST00000361681.2	-	1	412	c.413A>G	c.(412-414)gAt>gGt	p.D138G	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	138					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CACCAATAGGATCCTCCCGAA	0.423																																					p.D138G		Atlas-SNP	.											.	.	.	.	0			c.A413G						PASS	.																																			SO:0001583	missense	0	exon1			ATAGGATCCTCCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.413A>G	chrM.hg19:g.14261T>C	ENSP00000354665:p.Asp138Gly	22.0	0.0	.		32.0	15.0	.	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.	.	none		0.423	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
CD7	924	hgsc.bcm.edu	37	17	80274159	80274160	+	Frame_Shift_Ins	INS	-	-	T	rs569923406|rs200504177	byFrequency	TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr17:80274159_80274160insT	ENST00000312648.3	-	3	629_630	c.523_524insA	c.(523-525)gcafs	p.A175fs	CD7_ENST00000584284.1_Frame_Shift_Ins_p.A175fs|CD7_ENST00000578509.1_Frame_Shift_Ins_p.A75fs|CD7_ENST00000583376.1_Frame_Shift_Ins_p.A75fs	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	175	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GGCAGAGGCTGCTGGCGGGTCA	0.718													?|-|T|unsure	60	0.0119808	0.0008	0.0274	5008	,	,		11744	0.001		0.0338	False		,,,				2504	0.0051				p.A175fs	Pancreas(45;804 1068 19702 28207 28798)	Atlas-INDEL	.											.,1	CD7	25	.	0			c.524_525insA						PASS	.																																			SO:0001589	frameshift_variant	924	exon3			.	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.523_524insA	chr17.hg19:g.80274159_80274160insT	ENSP00000312027:p.Ala175fs	59.0	0.0	0		85.0	16.0	0.188235	NM_006137		Frame_Shift_Ins	INS	ENST00000312648.3	hg19	CCDS11807.1																																																																																			.	.	.	none		0.718	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
MARCH8	220972	hgsc.bcm.edu	37	10	45953921	45953921	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr10:45953921delA	ENST00000319836.3	-	7	1391	c.642delT	c.(640-642)tttfs	p.F214fs	MARCH8_ENST00000476962.1_5'UTR|MARCH8_ENST00000395769.2_Frame_Shift_Del_p.F214fs|MARCH8_ENST00000453424.2_Frame_Shift_Del_p.F496fs|MARCH8_ENST00000395771.3_Frame_Shift_Del_p.F214fs	NM_145021.4	NP_659458.2	Q5T0T0	MARH8_HUMAN	membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase	214					immune system process (GO:0002376)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	12						GAACATACATAAAAAGAAGTC	0.408																																					p.M215fs	NSCLC(102;658 1594 2173 16344 34808)	Atlas-Indel,Pindel	.											.	MARCH8	29	.	0			c.643delA						PASS	.						84.0	86.0	85.0					10																	45953921		2203	4300	6503	SO:0001589	frameshift_variant	220972	exon7			.	AL833316	CCDS7213.1, CCDS60519.1	10q11.22	2013-01-09	2012-02-23	2005-01-27	ENSG00000165406	ENSG00000165406		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	23356	protein-coding gene	gene with protein product		613335	"""c-mir, cellular modulator of immune recognition"", ""membrane-associated ring finger (C3HC4) 8"""	MIR		12582153, 14722266	Standard	XM_005271804		Approved	c-MIR, MARCH-VIII, RNF178	uc001jch.2	Q5T0T0	OTTHUMG00000019345	ENST00000319836.3:c.642delT	chr10.hg19:g.45953921delA	ENSP00000317087:p.Phe214fs	95.0	0.0	0		85.0	19.0	0.223529	NM_001002266	B2R8E7|H0Y7C6|Q5T0S8|Q8TC72	Frame_Shift_Del	DEL	ENST00000319836.3	hg19	CCDS7213.1																																																																																			.	.	.	none		0.408	MARCH8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051217.1	NM_145021	
BOD1L1	259282	hgsc.bcm.edu	37	4	13605661	13605662	+	Frame_Shift_Ins	INS	-	-	T			TCGA-5P-A9JV-01A-12D-A42J-10	TCGA-5P-A9JV-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	16f56910-a925-41a1-8bbc-d8554292616a	d2370805-678e-421c-83ac-49a5cec3cf51	g.chr4:13605661_13605662insT	ENST00000040738.5	-	10	2997_2998	c.2862_2863insA	c.(2860-2865)aaacagfs	p.Q955fs		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	955	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										GACTTACGCTGTTTTTCTGAGT	0.386																																					p.Q955fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.2863_2864insA						PASS	.																																			SO:0001589	frameshift_variant	259282	exon10			.	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.2863dupA	chr4.hg19:g.13605666_13605666dupT	ENSP00000040738:p.Gln955fs	100.0	0.0	0		101.0	24.0	0.237624	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Frame_Shift_Ins	INS	ENST00000040738.5	hg19	CCDS3411.2																																																																																			.	.	.	none		0.386	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
