#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATP13A2	23400	hgsc.bcm.edu	37	1	17328590	17328590	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr1:17328590A>C	ENST00000326735.8	-	8	677	c.644T>G	c.(643-645)aTt>aGt	p.I215S	ATP13A2_ENST00000452699.1_Missense_Mutation_p.I210S|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000502860.1_5'Flank|ATP13A2_ENST00000341676.5_Missense_Mutation_p.I210S			Q9NQ11	AT132_HUMAN	ATPase type 13A2	215					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		GGGGCCGTAAATGGCCTTCCT	0.637																																					p.I215S		Atlas-SNP	.											.	ATP13A2	85	.	0			c.T644G						PASS	.						64.0	58.0	60.0					1																	17328590		2203	4300	6503	SO:0001583	missense	23400	exon8			CCGTAAATGGCCT	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.644T>G	chr1.hg19:g.17328590A>C	ENSP00000327214:p.Ile215Ser	227.0	0.0	.		277.0	85.0	.	NM_022089	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	hg19	CCDS175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.02|13.02	2.111352|2.111352	0.37242|0.37242	.|.	.|.	ENSG00000159363|ENSG00000159363	ENST00000510069;ENST00000508222|ENST00000326735;ENST00000341676;ENST00000452699;ENST00000511957	.|D;D;D;D	.|0.88896	.|-2.44;-2.44;-2.44;-2.44	4.89|4.89	4.89|4.89	0.63831|0.63831	.|ATPase, P-type cation-transporter, N-terminal (1);	.|0.405796	.|0.29594	.|N	.|0.011708	D|D	0.90553|0.90553	0.7039|0.7039	M|M	0.90425|0.90425	3.115|3.115	0.23416|0.23416	N|N	0.997725|0.997725	.|P;P;P	.|0.44776	.|0.784;0.843;0.756	.|B;B;B	.|0.41723	.|0.326;0.365;0.288	D|D	0.86293|0.86293	0.1675|0.1675	5|10	.|0.51188	.|T	.|0.08	-5.3789|-5.3789	12.0045|12.0045	0.53251|0.53251	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|210;210;215	.|Q5JXY1;Q6S9Z9;Q9NQ11	.|.;.;AT132_HUMAN	Q|S	189;121|215;210;210;119	.|ENSP00000327214:I215S;ENSP00000341115:I210S;ENSP00000413307:I210S;ENSP00000427241:I119S	.|ENSP00000327214:I215S	H|I	-|-	3|2	2|0	ATP13A2|ATP13A2	17201177|17201177	1.000000|1.000000	0.71417|0.71417	0.085000|0.085000	0.20634|0.20634	0.421000|0.421000	0.31385|0.31385	6.664000|6.664000	0.74437|0.74437	2.065000|2.065000	0.61736|0.61736	0.459000|0.459000	0.35465|0.35465	CAT|ATT	.	.	.	none		0.637	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
RPA2	6118	hgsc.bcm.edu	37	1	28240584	28240584	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr1:28240584T>G	ENST00000373912.3	-	2	406	c.107A>C	c.(106-108)gAa>gCa	p.E36A	RPA2_ENST00000313433.7_Missense_Mutation_p.E124A|RPA2_ENST00000373909.3_Missense_Mutation_p.E44A	NM_002946.3	NP_002937.1	P15927	RFA2_HUMAN	replication protein A2, 32kDa	36					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of DNA damage checkpoint (GO:2000001)|regulation of double-strand break repair via homologous recombination (GO:0010569)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|enzyme binding (GO:0019899)|protein phosphatase binding (GO:0019903)|single-stranded DNA binding (GO:0003697)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(3)|skin(1)	11		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		TGATTTCTTTTCGGCTTGAGA	0.498								Direct reversal of damage;Nucleotide excision repair (NER)																													p.E36A		Atlas-SNP	.											.	RPA2	34	.	0			c.A107C						PASS	.						62.0	71.0	68.0					1																	28240584		2203	4300	6503	SO:0001583	missense	6118	exon2			TTCTTTTCGGCTT	BC021257	CCDS314.1, CCDS72740.1	1p35	2008-02-05	2002-08-29		ENSG00000117748	ENSG00000117748			10290	protein-coding gene	gene with protein product		179836	"""replication protein A2 (32kD)"""			8454588	Standard	XM_005245965		Approved		uc001bpe.1	P15927	OTTHUMG00000003915	ENST00000373912.3:c.107A>C	chr1.hg19:g.28240584T>G	ENSP00000363021:p.Glu36Ala	97.0	0.0	.		99.0	27.0	.	NM_002946	Q52II0|Q5TEI9|Q5TEJ5	Missense_Mutation	SNP	ENST00000373912.3	hg19	CCDS314.1	.	.	.	.	.	.	.	.	.	.	T	11.95	1.790742	0.31685	.	.	ENSG00000117748	ENST00000373912;ENST00000373909;ENST00000313433;ENST00000444045	T;T;T;T	0.22134	2.29;2.28;2.25;1.97	4.59	4.59	0.56863	.	0.048023	0.85682	D	0.000000	T	0.20577	0.0495	L	0.58101	1.795	0.50467	D	0.999874	B;B	0.24043	0.001;0.096	B;B	0.20184	0.003;0.028	T	0.04140	-1.0974	10	0.14656	T	0.56	-13.889	13.2408	0.59995	0.0:0.0:0.0:1.0	.	36;44	P15927;P15927-2	RFA2_HUMAN;.	A	36;44;124;40	ENSP00000363021:E36A;ENSP00000363017:E44A;ENSP00000363015:E124A;ENSP00000387649:E40A	ENSP00000363015:E124A	E	-	2	0	RPA2	28113171	0.998000	0.40836	0.963000	0.40424	0.220000	0.24768	3.230000	0.51286	1.834000	0.53371	0.454000	0.30748	GAA	.	.	.	none		0.498	RPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011179.1	NM_002946	
DENND2C	163259	hgsc.bcm.edu	37	1	115143493	115143493	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr1:115143493G>A	ENST00000393274.1	-	14	2529	c.1904C>T	c.(1903-1905)gCt>gTt	p.A635V	DENND2C_ENST00000481894.1_5'UTR|DENND2C_ENST00000393277.1_Missense_Mutation_p.A635V|DENND2C_ENST00000393276.3_Missense_Mutation_p.A578V	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	635	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCGTCCAGGAGCTGGGAAAGG	0.448																																					p.A635V		Atlas-SNP	.											.	DENND2C	105	.	0			c.C1904T						PASS	.						128.0	124.0	125.0					1																	115143493		2203	4300	6503	SO:0001583	missense	163259	exon14			CCAGGAGCTGGGA		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.1904C>T	chr1.hg19:g.115143493G>A	ENSP00000376955:p.Ala635Val	136.0	0.0	.		116.0	28.0	.	NM_001256404	B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	ENST00000393274.1	hg19	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	G	35	5.559025	0.96514	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.12465	2.68;2.68;2.68	5.18	5.18	0.71444	DENN (3);	0.000000	0.49916	U	0.000121	T	0.31389	0.0795	M	0.72576	2.205	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.986	T	0.08743	-1.0707	10	0.87932	D	0	.	18.7701	0.91888	0.0:0.0:1.0:0.0	.	635;578	Q68D51;Q68D51-3	DEN2C_HUMAN;.	V	578;635;635;635	ENSP00000376957:A578V;ENSP00000376955:A635V;ENSP00000376958:A635V	ENSP00000358553:A635V	A	-	2	0	DENND2C	114945016	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.431000	0.82371	0.650000	0.86243	GCT	.	.	.	none		0.448	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459	
RGL1	23179	hgsc.bcm.edu	37	1	183876147	183876147	+	Splice_Site	SNP	T	T	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr1:183876147T>G	ENST00000360851.3	+	14	1652	c.1474T>G	c.(1474-1476)Tat>Gat	p.Y492D	RGL1_ENST00000536277.1_Splice_Site_p.Y490D|RGL1_ENST00000539189.1_Splice_Site_p.Y463D|RGL1_ENST00000304685.4_Splice_Site_p.Y527D			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	492	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						CTTTCTCAGCTATGCCCTGTC	0.493																																					p.Y527D		Atlas-SNP	.											.	RGL1	91	.	0			c.T1579G						PASS	.						52.0	48.0	50.0					1																	183876147		2203	4300	6503	SO:0001630	splice_region_variant	23179	exon15			CTCAGCTATGCCC	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1473-1T>G	chr1.hg19:g.183876147T>G		59.0	0.0	.		63.0	17.0	.	NM_015149	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	hg19		.	.	.	.	.	.	.	.	.	.	T	23.7	4.452241	0.84209	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000543395;ENST00000360851;ENST00000539189	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	5.1	5.1	0.69264	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.71668	0.3367	H	0.95884	3.735	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.998;0.997;0.998;0.998	D;D;D;D;D	0.85130	0.997;0.994;0.986;0.994;0.994	T	0.81920	-0.0712	10	0.87932	D	0	.	14.5673	0.68185	0.0:0.0:0.0:1.0	.	463;490;297;492;527	F5H6U6;B7Z2W5;F5H3C3;Q9NZL6;Q5SXQ6	.;.;.;RGL1_HUMAN;.	D	527;527;490;297;492;463	ENSP00000303192:Y527D;ENSP00000356501:Y527D;ENSP00000438662:Y490D;ENSP00000354097:Y492D;ENSP00000437355:Y463D	ENSP00000303192:Y527D	Y	+	1	0	RGL1	182142770	1.000000	0.71417	0.991000	0.47740	0.929000	0.56500	7.564000	0.82326	1.920000	0.55613	0.459000	0.35465	TAT	.	.	.	none		0.493	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	Missense_Mutation
EPCAM	4072	hgsc.bcm.edu	37	2	47601159	47601159	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr2:47601159A>C	ENST00000263735.4	+	3	755	c.397A>C	c.(397-399)Ata>Cta	p.I133L	EPCAM_ENST00000405271.1_Missense_Mutation_p.I161L	NM_002354.2	NP_002345.2	P16422	EPCAM_HUMAN	epithelial cell adhesion molecule	133	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|stem cell differentiation (GO:0048863)|ureteric bud development (GO:0001657)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	protein complex binding (GO:0032403)	p.0?(2)|p.?(1)		endometrium(3)|large_intestine(1)|liver(2)|lung(7)|skin(1)|stomach(1)	15						GGACACTGAAATAACCTGCTC	0.453																																					p.I133L		Atlas-SNP	.											.	EPCAM	27	.	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)	c.A397C						PASS	.						61.0	56.0	58.0					2																	47601159		2203	4300	6503	SO:0001583	missense	4072	exon3			ACTGAAATAACCT	M33011	CCDS1833.1	2p21	2014-09-17	2008-12-16	2008-12-16	ENSG00000119888	ENSG00000119888		"""CD molecules"""	11529	protein-coding gene	gene with protein product		185535	"""antigen identified by monoclonal antibody AUA1"", ""tumor-associated calcium signal transducer 1"""	M4S1, MIC18, TACSTD1		8382772, 11306819	Standard	NM_002354		Approved	Ly74, TROP1, GA733-2, EGP34, EGP40, EGP-2, KSA, CD326, Ep-CAM, HEA125, KS1/4, MK-1, MH99, MOC31, 323/A3, 17-1A, TACST-1, CO-17A, ESA	uc002rvx.3	P16422	OTTHUMG00000128853	ENST00000263735.4:c.397A>C	chr2.hg19:g.47601159A>C	ENSP00000263735:p.Ile133Leu	134.0	0.0	.		115.0	34.0	.	NM_002354	P18180|Q6FG26|Q6FG49|Q96C47|Q9UCD0	Missense_Mutation	SNP	ENST00000263735.4	hg19	CCDS1833.1	.	.	.	.	.	.	.	.	.	.	A	6.234	0.411217	0.11812	.	.	ENSG00000119888	ENST00000405271;ENST00000263735	T;T	0.61510	0.1;0.1	5.93	5.93	0.95920	Thyroglobulin type-1 (4);	0.396683	0.28414	N	0.015423	T	0.33760	0.0874	N	0.13327	0.33	0.33639	D	0.60697	B;B	0.17465	0.022;0.022	B;B	0.19946	0.027;0.027	T	0.38564	-0.9655	10	0.02654	T	1	-14.877	8.4191	0.32690	0.7393:0.1257:0.0:0.135	.	133;161	P16422;B5MCA4	EPCAM_HUMAN;.	L	161;133	ENSP00000385476:I161L;ENSP00000263735:I133L	ENSP00000263735:I133L	I	+	1	0	EPCAM	47454663	0.876000	0.30132	0.840000	0.33206	0.979000	0.70002	1.427000	0.34881	2.281000	0.76405	0.533000	0.62120	ATA	.	.	.	none		0.453	EPCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250792.2		
SMEK2	57223	hgsc.bcm.edu	37	2	55826141	55826141	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr2:55826141T>G	ENST00000345102.5	-	4	633	c.332A>C	c.(331-333)cAg>cCg	p.Q111P	SMEK2_ENST00000272313.5_Missense_Mutation_p.Q111P|SMEK2_ENST00000407823.3_Missense_Mutation_p.Q111P	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	111					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AATGAGGTCCTGTGTGACTTC	0.348																																					p.Q111P		Atlas-SNP	.											.	SMEK2	86	.	0			c.A332C						PASS	.						114.0	123.0	120.0					2																	55826141		2203	4300	6503	SO:0001583	missense	57223	exon4			AGGTCCTGTGTGA	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.332A>C	chr2.hg19:g.55826141T>G	ENSP00000339769:p.Gln111Pro	29.0	0.0	.		50.0	11.0	.	NM_001122964	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	ENST00000345102.5	hg19	CCDS46289.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.982446	0.74474	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.44083	0.93;0.93;0.93	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.60779	0.2295	M	0.67397	2.05	0.80722	D	1	D;D;D	0.67145	0.98;0.996;0.991	P;D;P	0.65323	0.844;0.934;0.844	T	0.58819	-0.7569	10	0.34782	T	0.22	-7.2839	16.0711	0.80936	0.0:0.0:0.0:1.0	.	111;111;111	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3	.;P4R3B_HUMAN;.	P	111	ENSP00000272313:Q111P;ENSP00000385912:Q111P;ENSP00000339769:Q111P	ENSP00000272313:Q111P	Q	-	2	0	SMEK2	55679645	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.197000	0.70478	0.482000	0.46254	CAG	.	.	.	none		0.348	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
STARD7	56910	hgsc.bcm.edu	37	2	96852507	96852507	+	Missense_Mutation	SNP	G	G	T	rs114169229	byFrequency	TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr2:96852507G>T	ENST00000337288.5	-	8	1457	c.1074C>A	c.(1072-1074)aaC>aaA	p.N358K	STARD7_ENST00000462501.1_5'UTR	NM_020151.3	NP_064536.2	Q9NQZ5	STAR7_HUMAN	StAR-related lipid transfer (START) domain containing 7	358						mitochondrion (GO:0005739)	lipid binding (GO:0008289)			endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|stomach(2)	14						AGCTGCCCTCGTTCTTTCGCT	0.502																																					p.N358K		Atlas-SNP	.											.	STARD7	49	.	0			c.C1074A						PASS	.						74.0	69.0	71.0					2																	96852507		2203	4300	6503	SO:0001583	missense	56910	exon8			GCCCTCGTTCTTT	AF270647	CCDS2017.2	2p11.1	2011-09-12	2007-08-16		ENSG00000084090	ENSG00000084090		"""StAR-related lipid transfer (START) domain containing"""	18063	protein-coding gene	gene with protein product			"""START domain containing 7"""				Standard	NM_020151		Approved	GTT1	uc002svm.4	Q9NQZ5	OTTHUMG00000130457	ENST00000337288.5:c.1074C>A	chr2.hg19:g.96852507G>T	ENSP00000338030:p.Asn358Lys	110.0	0.0	.		104.0	32.0	.	NM_020151	D3DXG9|Q53T44|Q6GU43|Q969M6	Missense_Mutation	SNP	ENST00000337288.5	hg19	CCDS2017.2	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845469	0.32606	.	.	ENSG00000084090	ENST00000337288	T	0.42131	0.98	5.84	-7.15	0.01521	.	0.464535	0.25375	N	0.031122	T	0.18551	0.0445	N	0.14661	0.345	0.31229	N	0.696539	B	0.02656	0.0	B	0.04013	0.001	T	0.22277	-1.0221	10	0.15066	T	0.55	-2.3782	13.2244	0.59907	0.1327:0.0:0.7731:0.0942	.	358	Q9NQZ5	STAR7_HUMAN	K	358	ENSP00000338030:N358K	ENSP00000338030:N358K	N	-	3	2	STARD7	96216234	0.000000	0.05858	0.020000	0.16555	0.505000	0.33919	-1.852000	0.01667	-1.229000	0.02564	-0.302000	0.09304	AAC	.	G|0.998;A|0.002	.	alt		0.502	STARD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252848.2		
CCDC148	130940	hgsc.bcm.edu	37	2	159170296	159170296	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr2:159170296T>C	ENST00000283233.5	-	8	1188	c.875A>G	c.(874-876)tAt>tGt	p.Y292C	CCDC148_ENST00000409187.1_Missense_Mutation_p.Y301C|CCDC148_ENST00000536771.1_Missense_Mutation_p.Y206C	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	292										endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						GTGAGGAAAATATCTTTGTAA	0.378																																					p.Y292C		Atlas-SNP	.											.	CCDC148	64	.	0			c.A875G						PASS	.						110.0	111.0	111.0					2																	159170296		2203	4300	6503	SO:0001583	missense	130940	exon8			GGAAAATATCTTT		CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.875A>G	chr2.hg19:g.159170296T>C	ENSP00000283233:p.Tyr292Cys	68.0	0.0	.		99.0	32.0	.	NM_138803	F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Missense_Mutation	SNP	ENST00000283233.5	hg19	CCDS33304.1	.	.	.	.	.	.	.	.	.	.	T	11.37	1.618527	0.28801	.	.	ENSG00000153237	ENST00000283233;ENST00000375617;ENST00000409187;ENST00000536771	T;T;T	0.31510	1.94;1.94;1.49	5.25	2.81	0.32909	.	.	.	.	.	T	0.39410	0.1077	L	0.35288	1.05	0.28868	N	0.895142	D;D;D;B;B	0.89917	1.0;1.0;1.0;0.003;0.001	D;D;D;B;B	0.73380	0.98;0.98;0.98;0.005;0.003	T	0.14448	-1.0472	9	0.38643	T	0.18	-1.2543	8.4684	0.32971	0.0:0.1691:0.0:0.8309	.	206;140;140;301;292	F5H839;C9JR76;Q8NFR7-2;B8ZZV3;Q8NFR7	.;.;.;.;CC148_HUMAN	C	292;140;301;206	ENSP00000283233:Y292C;ENSP00000386674:Y301C;ENSP00000443740:Y206C	ENSP00000283233:Y292C	Y	-	2	0	CCDC148	158878542	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	0.803000	0.27083	0.841000	0.35020	0.460000	0.39030	TAT	.	.	.	none		0.378	CCDC148-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333270.1	NM_138803	
SP3	6670	hgsc.bcm.edu	37	2	174829164	174829164	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr2:174829164T>C	ENST00000310015.6	-	2	655	c.125A>G	c.(124-126)aAc>aGc	p.N42S	SP3_ENST00000483084.1_5'Flank|SP3_ENST00000455789.2_Missense_Mutation_p.N30S|SP3_ENST00000418194.2_5'Flank	NM_001172712.1|NM_003111.4	NP_001166183.1|NP_003102.1	Q02447	SP3_HUMAN	Sp3 transcription factor	42					B cell differentiation (GO:0030183)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|granulocyte differentiation (GO:0030851)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|monocyte differentiation (GO:0030224)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|T cell differentiation (GO:0030217)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)		EWSR1/SP3(3)	NS(2)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.185)			CACCGCACCGTTTCCGTGCTG	0.721																																					p.N42S		Atlas-SNP	.											.	SP3	82	.	0			c.A125G						PASS	.						2.0	3.0	3.0					2																	174829164		1635	3328	4963	SO:0001583	missense	6670	exon2			GCACCGTTTCCGT	M97191	CCDS2254.1, CCDS46452.1	2q31	2013-01-08			ENSG00000172845	ENSG00000172845		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11208	protein-coding gene	gene with protein product		601804				1341900, 1454515	Standard	NM_003111		Approved	SPR-2	uc002uig.3	Q02447	OTTHUMG00000132333	ENST00000310015.6:c.125A>G	chr2.hg19:g.174829164T>C	ENSP00000310301:p.Asn42Ser	41.0	0.0	.		30.0	7.0	.	NM_001172712	A0AVL9|B4E2B7|Q69B26|Q69B27|Q8TD56|Q8WWU4|Q9BQR1	Missense_Mutation	SNP	ENST00000310015.6	hg19	CCDS2254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	11.88|11.88	1.770428|1.770428	0.31320|0.31320	.|.	.|.	ENSG00000172845|ENSG00000172845	ENST00000310015;ENST00000455789|ENST00000416195	T;T|.	0.05996|.	3.58;3.36|.	2.46|2.46	2.46|2.46	0.29980|0.29980	.|.	1.639320|.	0.04616|.	U|.	0.401148|.	T|T	0.19046|0.19046	0.0457|0.0457	N|N	0.08118|0.08118	0|0	0.20307|0.20307	N|N	0.999915|0.999915	B;B;B|.	0.26445|.	0.092;0.092;0.149|.	B;B;B|.	0.15052|.	0.007;0.007;0.012|.	T|T	0.23440|0.23440	-1.0188|-1.0188	10|5	0.14656|.	T|.	0.56|.	.|.	9.5141|9.5141	0.39095|0.39095	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	42;42;30|.	B7ZLN9;Q02447;Q02447-6|.	.;SP3_HUMAN;.|.	S|A	42;30|40	ENSP00000310301:N42S;ENSP00000388903:N30S|.	ENSP00000310301:N42S|.	N|T	-|-	2|1	0|0	SP3|SP3	174537410|174537410	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.709000|0.709000	0.40893|0.40893	1.163000|1.163000	0.31798|0.31798	0.925000|0.925000	0.37094|0.37094	0.353000|0.353000	0.21931|0.21931	AAC|ACG	.	.	.	none		0.721	SP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255452.1	NM_003111	
NDUFA10	4705	hgsc.bcm.edu	37	2	240954246	240954246	+	Silent	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr2:240954246G>A	ENST00000252711.2	-	5	679	c.579C>T	c.(577-579)gtC>gtT	p.V193V	NDUFA10_ENST00000404554.1_Silent_p.V193V|NDUFA10_ENST00000307300.4_Silent_p.V233V	NM_004544.3	NP_004535.1	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa	193					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|nucleoside kinase activity (GO:0019206)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)	16		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)		CGCAGATGGTGACGCTCTTCA	0.552																																					p.V193V		Atlas-SNP	.											.	NDUFA10	40	.	0			c.C579T						PASS	.						121.0	103.0	109.0					2																	240954246		2203	4300	6503	SO:0001819	synonymous_variant	4705	exon5			GATGGTGACGCTC	AF087661	CCDS2531.1	2q37.3	2011-07-04	2002-08-29		ENSG00000130414	ENSG00000130414		"""Mitochondrial respiratory chain complex / Complex I"""	7684	protein-coding gene	gene with protein product	"""complex I 42kDa subunit"""	603835	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10 (42kD)"""			9878551	Standard	NM_004544		Approved	CI-42k	uc002vyn.3	O95299	OTTHUMG00000133350	ENST00000252711.2:c.579C>T	chr2.hg19:g.240954246G>A		111.0	0.0	.		134.0	33.0	.	NM_004544	Q8WXC9	Silent	SNP	ENST00000252711.2	hg19	CCDS2531.1																																																																																			.	.	.	none		0.552	NDUFA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257180.2	NM_004544	
SETMAR	6419	hgsc.bcm.edu	37	3	4355443	4355443	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr3:4355443G>C	ENST00000358065.4	+	2	1085	c.1018G>C	c.(1018-1020)Gag>Cag	p.E340Q	SETMAR_ENST00000430981.1_Missense_Mutation_p.E340Q|SETMAR_ENST00000425863.1_Missense_Mutation_p.E201Q|SUMF1_ENST00000534863.1_Intron	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	340	Histone-lysine N-methyltransferase.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		ATTGACCCTTGAGGTGAGTCT	0.502								Chromatin Structure																													p.E340Q		Atlas-SNP	.											.	SETMAR	30	.	0			c.G1018C						PASS	.						95.0	89.0	91.0					3																	4355443		2203	4300	6503	SO:0001583	missense	6419	exon2			ACCCTTGAGGTGA	U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.1018G>C	chr3.hg19:g.4355443G>C	ENSP00000373354:p.Glu340Gln	76.0	0.0	.		91.0	29.0	.	NM_006515	B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	hg19	CCDS2563.2	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376893	0.24857	.	.	ENSG00000170364	ENST00000358065;ENST00000430981;ENST00000425863;ENST00000358950	D;D;T	0.95447	-3.65;-3.71;0.48	3.52	-3.91	0.04168	.	.	.	.	.	D	0.83959	0.5367	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.25105	0.118;0.068;0.068;0.043;0.004	B;B;B;B;B	0.18263	0.015;0.021;0.014;0.003;0.002	T	0.73500	-0.3963	9	0.40728	T	0.16	.	0.2421	0.00193	0.346:0.1408:0.2007:0.3125	.	84;201;327;85;340	B4DND2;E7EN68;Q53H47;Q96H41;C9JHK2	.;.;SETMR_HUMAN;.;.	Q	340;340;201;104	ENSP00000373354:E340Q;ENSP00000403000:E340Q;ENSP00000403145:E201Q	ENSP00000373354:E340Q	E	+	1	0	SETMAR	4330443	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-4.345000	0.00249	-0.959000	0.03618	0.655000	0.94253	GAG	.	.	.	none		0.502	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	NM_006515	
CACNA1D	776	hgsc.bcm.edu	37	3	53694259	53694259	+	Silent	SNP	C	C	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr3:53694259C>A	ENST00000350061.5	+	5	1234	c.723C>A	c.(721-723)gcC>gcA	p.A241A	CACNA1D_ENST00000288139.4_Silent_p.A241A|CACNA1D_ENST00000422281.2_Silent_p.A241A	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	241					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCTCCGTGCCTTTCGAGTGT	0.473																																					p.A241A		Atlas-SNP	.											.	CACNA1D	324	.	0			c.C723A						PASS	.						66.0	62.0	64.0					3																	53694259		2203	4300	6503	SO:0001819	synonymous_variant	776	exon5			CCGTGCCTTTCGA	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.723C>A	chr3.hg19:g.53694259C>A		112.0	0.0	.		95.0	29.0	.	NM_001128840	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	ENST00000350061.5	hg19	CCDS46848.1																																																																																			.	.	.	none		0.473	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
QTRTD1	79691	hgsc.bcm.edu	37	3	113786834	113786834	+	Splice_Site	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr3:113786834G>A	ENST00000281273.4	+	5	514	c.257G>A	c.(256-258)gGc>gAc	p.G86D	QTRTD1_ENST00000466050.1_Intron|QTRTD1_ENST00000493014.1_Intron|QTRTD1_ENST00000479882.1_Intron|QTRTD1_ENST00000485050.1_Splice_Site_p.G98D	NM_024638.3	NP_078914.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						GTTTATACAGGCATGCCAGAA	0.458																																					p.G98D		Atlas-SNP	.											.	QTRTD1	29	.	0			c.G293A						PASS	.						201.0	180.0	187.0					3																	113786834		2203	4300	6503	SO:0001630	splice_region_variant	79691	exon4			ATACAGGCATGCC	AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000281273.4:c.257-1G>A	chr3.hg19:g.113786834G>A		74.0	0.0	.		71.0	24.0	.	NM_001256835		Missense_Mutation	SNP	ENST00000281273.4	hg19	CCDS33828.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.978009	0.92982	.	.	ENSG00000151576	ENST00000472599;ENST00000485050;ENST00000281273;ENST00000482307	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.84220	0.5424	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.98	T	0.83339	-0.0009	8	.	.	.	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	100;86	C9JJ71;Q9H974	.;QTRD1_HUMAN	D	100;98;86;86	.	.	G	+	2	0	QTRTD1	115269524	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	8.916000	0.92745	2.894000	0.99253	0.655000	0.94253	GGC	.	.	.	none		0.458	QTRTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354708.2	NM_024638	Missense_Mutation
MYLK	4638	hgsc.bcm.edu	37	3	123452791	123452791	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr3:123452791C>T	ENST00000475616.1	-	7	1051	c.1052G>A	c.(1051-1053)aGa>aAa	p.R351K	MYLK_ENST00000360304.3_Missense_Mutation_p.R351K|MYLK_ENST00000346322.5_Missense_Mutation_p.R351K|MYLK_ENST00000360772.3_Missense_Mutation_p.R351K|MYLK_ENST00000359169.1_Missense_Mutation_p.R351K			Q15746	MYLK_HUMAN	myosin light chain kinase	351					actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CGGCTGAACTCTTGCGGCCTG	0.632																																					p.R351K		Atlas-SNP	.											.	MYLK	224	.	0			c.G1052A						PASS	.						74.0	80.0	78.0					3																	123452791		2203	4300	6503	SO:0001583	missense	4638	exon10			TGAACTCTTGCGG	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.1052G>A	chr3.hg19:g.123452791C>T	ENSP00000418335:p.Arg351Lys	312.0	0.0	.		359.0	122.0	.	NM_053025	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	hg19	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	2.490	-0.317658	0.05386	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.64085	-0.08;-0.03;-0.08;0.05;-0.03	5.43	-2.45	0.06481	.	.	.	.	.	T	0.32704	0.0838	N	0.04880	-0.145	0.09310	N	0.999993	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.001;0.002;0.001;0.001	T	0.32798	-0.9893	9	0.02654	T	1	.	11.7978	0.52110	0.0:0.561:0.0:0.439	.	351;351;351;351;351	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	K	351	ENSP00000354004:R351K;ENSP00000353452:R351K;ENSP00000352088:R351K;ENSP00000320622:R351K;ENSP00000418335:R351K	ENSP00000320622:R351K	R	-	2	0	MYLK	124935481	0.326000	0.24669	0.000000	0.03702	0.004000	0.04260	0.159000	0.16442	-0.306000	0.08818	-0.136000	0.14681	AGA	.	.	.	none		0.632	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
CCDC14	64770	hgsc.bcm.edu	37	3	123663747	123663747	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr3:123663747T>G	ENST00000488653.2	-	9	1526	c.1436A>C	c.(1435-1437)gAg>gCg	p.E479A	CCDC14_ENST00000485727.1_Missense_Mutation_p.E279A|CCDC14_ENST00000310351.4_Missense_Mutation_p.E319A|CCDC14_ENST00000489746.1_Missense_Mutation_p.E279A|CCDC14_ENST00000433542.2_Missense_Mutation_p.E438A|CCDC14_ENST00000483247.1_Intron			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	479					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		CAGTGCTATCTCAACTTGAAT	0.378																																					p.E438A		Atlas-SNP	.											.	CCDC14	97	.	0			c.A1313C						PASS	.						158.0	128.0	138.0					3																	123663747		2203	4300	6503	SO:0001583	missense	64770	exon8			GCTATCTCAACTT	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.1436A>C	chr3.hg19:g.123663747T>G	ENSP00000420180:p.Glu479Ala	162.0	0.0	.		168.0	47.0	.	NM_022757	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	ENST00000488653.2	hg19		.	.	.	.	.	.	.	.	.	.	T	14.04	2.416581	0.42918	.	.	ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697;ENST00000419247	T;T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44;0.44	5.09	5.09	0.68999	.	0.192154	0.35805	N	0.002962	T	0.69486	0.3116	M	0.65498	2.005	0.47476	D	0.999439	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.69855	-0.5032	10	0.44086	T	0.13	.	14.2744	0.66170	0.0:0.0:0.0:1.0	.	479;438;279;320	Q49A88;Q49A88-6;Q49A88-4;Q49A88-5	CCD14_HUMAN;.;.;.	A	479;319;279;279;438;460;120	ENSP00000420180:E479A;ENSP00000312031:E319A;ENSP00000418002:E279A;ENSP00000418403:E279A;ENSP00000395706:E438A;ENSP00000386866:E460A;ENSP00000400957:E120A	ENSP00000312031:E319A	E	-	2	0	CCDC14	125146437	1.000000	0.71417	1.000000	0.80357	0.003000	0.03518	5.326000	0.65875	2.267000	0.75376	0.383000	0.25322	GAG	.	.	.	none		0.378	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757	
CEP135	9662	hgsc.bcm.edu	37	4	56841058	56841058	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr4:56841058C>T	ENST00000257287.4	+	11	1520	c.1396C>T	c.(1396-1398)Cat>Tat	p.H466Y		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	466					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GAGACTCCAACATATAATACA	0.353																																					p.H466Y		Atlas-SNP	.											.	CEP135	115	.	0			c.C1396T						PASS	.						78.0	80.0	80.0					4																	56841058		2203	4300	6503	SO:0001583	missense	9662	exon11			CTCCAACATATAA	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.1396C>T	chr4.hg19:g.56841058C>T	ENSP00000257287:p.His466Tyr	334.0	0.0	.		309.0	100.0	.	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	hg19	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.304988	0.40795	.	.	ENSG00000174799	ENST00000257287	T	0.41758	0.99	5.89	4.97	0.65823	.	0.426257	0.26948	N	0.021687	T	0.38321	0.1036	L	0.44542	1.39	0.23632	N	0.997242	B	0.28258	0.205	B	0.30495	0.116	T	0.40270	-0.9572	10	0.66056	D	0.02	.	13.7008	0.62608	0.2299:0.7701:0.0:0.0	.	466	Q66GS9	CP135_HUMAN	Y	466	ENSP00000257287:H466Y	ENSP00000257287:H466Y	H	+	1	0	CEP135	56535815	0.973000	0.33851	0.989000	0.46669	0.725000	0.41563	2.255000	0.43222	2.781000	0.95711	0.555000	0.69702	CAT	.	.	.	none		0.353	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
C4orf22	255119	hgsc.bcm.edu	37	4	81256926	81256926	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr4:81256926G>C	ENST00000358105.3	+	1	53	c.4G>C	c.(4-6)Gat>Cat	p.D2H	C4orf22_ENST00000508675.1_Missense_Mutation_p.D2H|C4orf22_ENST00000512931.1_3'UTR	NM_152770.2	NP_689983.2	Q6V702	CD022_HUMAN	chromosome 4 open reading frame 22	2								p.D2Y(1)		NS(1)|large_intestine(3)|lung(5)|prostate(1)|skin(5)	15						TACCGCAATGGATCAGGAAGA	0.542											OREG0016247	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D2H		Atlas-SNP	.											C4orf22,NS,carcinoma,0,1	C4orf22	35	.	1	Substitution - Missense(1)	lung(1)	c.G4C						PASS	.						99.0	89.0	92.0					4																	81256926		2203	4300	6503	SO:0001583	missense	255119	exon1			GCAATGGATCAGG	BC034296	CCDS3587.1, CCDS56336.1	4q21.21	2008-02-05			ENSG00000197826	ENSG00000197826			28554	protein-coding gene	gene with protein product						12477932	Standard	NM_152770		Approved		uc010ijp.3	Q6V702	OTTHUMG00000130289	ENST00000358105.3:c.4G>C	chr4.hg19:g.81256926G>C	ENSP00000350818:p.Asp2His	29.0	0.0	.	1204	38.0	9.0	.	NM_152770	E7EQ13|Q6ZQY4|Q8N4G9	Missense_Mutation	SNP	ENST00000358105.3	hg19	CCDS3587.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283543	0.40394	.	.	ENSG00000197826	ENST00000358105;ENST00000508675	T;T	0.35605	1.3;1.33	5.37	4.53	0.55603	.	0.656132	0.14642	N	0.307175	T	0.35307	0.0927	L	0.36672	1.1	0.36933	D	0.891999	P;P	0.44946	0.846;0.755	P;P	0.45610	0.487;0.487	T	0.41378	-0.9512	10	0.72032	D	0.01	.	11.1806	0.48625	0.0853:0.0:0.9147:0.0	.	2;2	E7EQ13;Q6V702	.;CD022_HUMAN	H	2	ENSP00000350818:D2H;ENSP00000425786:D2H	ENSP00000350818:D2H	D	+	1	0	C4orf22	81475950	1.000000	0.71417	0.988000	0.46212	0.010000	0.07245	2.982000	0.49337	1.505000	0.48720	0.655000	0.94253	GAT	.	.	.	none		0.542	C4orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252629.2	NM_152770	
ELF2	1998	hgsc.bcm.edu	37	4	140046428	140046428	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr4:140046428G>T	ENST00000394235.2	-	4	630	c.128C>A	c.(127-129)gCc>gAc	p.A43D	ELF2_ENST00000379550.1_Missense_Mutation_p.A43D|ELF2_ENST00000265495.4_Missense_Mutation_p.A43D	NM_001276458.1	NP_001263387.1			E74-like factor 2 (ets domain transcription factor)											endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	19	all_hematologic(180;0.162)					CTCTAATCTGGCACTTGGAAC	0.398																																					p.A43D		Atlas-SNP	.											.	ELF2	43	.	0			c.C128A						PASS	.						149.0	142.0	144.0					4																	140046428		2203	4300	6503	SO:0001583	missense	1998	exon3			AATCTGGCACTTG	AF256222	CCDS3744.1, CCDS3745.1, CCDS64062.1, CCDS64063.1	4q28	2008-02-05			ENSG00000109381	ENSG00000109381			3317	protein-coding gene	gene with protein product						8756667	Standard	NM_201999		Approved	EU32, NERF, NERF-2, NERF-1A, NERF-1B	uc003ihm.2	Q15723	OTTHUMG00000133383	ENST00000394235.2:c.128C>A	chr4.hg19:g.140046428G>T	ENSP00000377782:p.Ala43Asp	108.0	0.0	.		89.0	13.0	.	NM_201999		Missense_Mutation	SNP	ENST00000394235.2	hg19	CCDS3744.1	.	.	.	.	.	.	.	.	.	.	G	31	5.100421	0.94245	.	.	ENSG00000109381	ENST00000394235;ENST00000379550;ENST00000265495	T;T;T	0.57752	0.38;0.38;0.38	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.67135	0.2861	M	0.75264	2.295	0.80722	D	1	P	0.50369	0.934	P	0.51999	0.687	T	0.66578	-0.5888	9	.	.	.	.	19.8298	0.96631	0.0:0.0:1.0:0.0	.	43	Q15723-1	.	D	43	ENSP00000377782:A43D;ENSP00000368868:A43D;ENSP00000265495:A43D	.	A	-	2	0	ELF2	140265878	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.211000	0.95120	2.687000	0.91594	0.591000	0.81541	GCC	.	.	.	none		0.398	ELF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257233.2	NM_006874	
WDR17	116966	hgsc.bcm.edu	37	4	177098210	177098210	+	Splice_Site	SNP	C	C	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr4:177098210C>A	ENST00000280190.4	+	29	3724	c.3568C>A	c.(3568-3570)Cag>Aag	p.Q1190K	WDR17_ENST00000508596.1_Splice_Site_p.Q1151K|WDR17_ENST00000393643.2_Splice_Site_p.Q1166K|WDR17_ENST00000507824.2_Splice_Site_p.Q1165K			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	1190										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CACGTTCAGTCAGCTATTAAA	0.348																																					p.Q1190K		Atlas-SNP	.											.	WDR17	198	.	0			c.C3568A						PASS	.						62.0	62.0	62.0					4																	177098210		2203	4300	6503	SO:0001630	splice_region_variant	116966	exon29			TTCAGTCAGCTAT	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.3567-1C>A	chr4.hg19:g.177098210C>A		97.0	0.0	.		84.0	20.0	.	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	hg19	CCDS3825.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.53|19.53	3.844105|3.844105	0.71488|0.71488	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824|ENST00000443118	T;T;T|.	0.54479|.	0.57;0.57;0.57|.	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.76435|.	0.3987|.	M|M	0.70595|0.70595	2.14|2.14	0.80722|0.80722	D|D	1|1	P;D;D|.	0.61080|.	0.925;0.989;0.989|.	P;D;D|.	0.69824|.	0.48;0.966;0.966|.	T|.	0.72465|.	-0.4285|.	10|.	0.38643|0.35671	T|T	0.18|0.21	-12.2134|-12.2134	20.2184|20.2184	0.98308|0.98308	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1166;1151;1190|.	E7EP77;E7EQX0;Q8IZU2|.	.;.;WDR17_HUMAN|.	K|X	1151;1166;1190;1166|424	ENSP00000422763:Q1151K;ENSP00000377258:Q1166K;ENSP00000280190:Q1190K|.	ENSP00000280190:Q1190K|ENSP00000426985:S424X	Q|S	+|+	1|2	0|0	WDR17|WDR17	177335204|177335204	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.858000|0.858000	0.48976|0.48976	7.004000|7.004000	0.76317|0.76317	2.775000|2.775000	0.95449|0.95449	0.644000|0.644000	0.83932|0.83932	CAG|TCA	.	.	.	none		0.348	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		Missense_Mutation
CENPU	79682	hgsc.bcm.edu	37	4	185637572	185637572	+	Silent	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr4:185637572G>A	ENST00000281453.5	-	6	667	c.597C>T	c.(595-597)aaC>aaT	p.N199N	MLF1IP_ENST00000506535.1_5'Flank|MLF1IP_ENST00000541971.1_Silent_p.N199N	NM_024629.3	NP_078905.2														endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|stomach(1)	13		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		CTATTGCCAAGTTCTCTTTTT	0.428																																					p.N199N		Atlas-SNP	.											.	MLF1IP	33	.	0			c.C597T						PASS	.						72.0	71.0	71.0					4																	185637572		2203	4300	6503	SO:0001819	synonymous_variant	79682	exon6			TGCCAAGTTCTCT																												ENST00000281453.5:c.597C>T	chr4.hg19:g.185637572G>A		92.0	0.0	.		110.0	38.0	.	NM_024629		Silent	SNP	ENST00000281453.5	hg19	CCDS3838.1																																																																																			.	.	.	none		0.428	MLF1IP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360841.2		
SEMA5A	9037	hgsc.bcm.edu	37	5	9052121	9052121	+	Silent	SNP	C	C	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr5:9052121C>G	ENST00000382496.5	-	20	3374	c.2709G>C	c.(2707-2709)tcG>tcC	p.S903S	MIR4636_ENST00000582271.1_RNA	NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	903	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CAGACCAGTCCGACCACTCCG	0.592																																					p.S903S		Atlas-SNP	.											.	SEMA5A	236	.	0			c.G2709C						PASS	.						28.0	30.0	29.0					5																	9052121		2203	4300	6503	SO:0001819	synonymous_variant	9037	exon20			CCAGTCCGACCAC	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2709G>C	chr5.hg19:g.9052121C>G		140.0	0.0	.		142.0	48.0	.	NM_003966	D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	hg19	CCDS3875.1																																																																																			.	.	.	none		0.592	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
HTR1A	3350	hgsc.bcm.edu	37	5	63257506	63257506	+	Nonsense_Mutation	SNP	G	G	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr5:63257506G>T	ENST00000323865.3	-	1	274	c.41C>A	c.(40-42)tCa>tAa	p.S14*	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	14					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	AGCCGGTGGTGATGTGGTGTT	0.622																																					p.S14X		Atlas-SNP	.											.	HTR1A	128	.	0			c.C41A						PASS	.						100.0	94.0	96.0					5																	63257506		2203	4300	6503	SO:0001587	stop_gained	3350	exon1			GGTGGTGATGTGG	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.41C>A	chr5.hg19:g.63257506G>T	ENSP00000316244:p.Ser14*	197.0	0.0	.		224.0	71.0	.	NM_000524	Q6LAE7	Nonsense_Mutation	SNP	ENST00000323865.3	hg19	CCDS34168.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.788319	0.70337	.	.	ENSG00000178394	ENST00000323865;ENST00000506598	.	.	.	4.48	4.48	0.54585	.	1.590520	0.03632	N	0.238045	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	16.1532	0.81636	0.0:0.0:1.0:0.0	.	.	.	.	X	14	.	ENSP00000316244:S14X	S	-	2	0	HTR1A	63293262	0.019000	0.18553	0.013000	0.15412	0.101000	0.19017	1.258000	0.32944	2.053000	0.61076	0.561000	0.74099	TCA	.	.	.	none		0.622	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524	
SEPT8	23176	hgsc.bcm.edu	37	5	132099512	132099512	+	Silent	SNP	G	G	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr5:132099512G>T	ENST00000378719.2	-	4	657	c.420C>A	c.(418-420)cgC>cgA	p.R140R	SEPT8_ENST00000378699.2_Silent_p.R80R|SEPT8_ENST00000448933.1_Silent_p.R80R|SEPT8_ENST00000458488.2_Silent_p.R140R|SEPT8_ENST00000481030.1_5'Flank|SEPT8_ENST00000378701.1_Silent_p.R138R|SEPT8_ENST00000378721.4_Silent_p.R138R|SEPT8_ENST00000378706.1_Silent_p.R140R|SEPT8_ENST00000296873.7_Silent_p.R140R	NM_001098811.1	NP_001092281.1	Q92599	SEPT8_HUMAN	septin 8	140	Septin-type G.				cell cycle (GO:0007049)	septin complex (GO:0031105)	GTP binding (GO:0005525)		SEPT8/AFF4(2)	kidney(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CGAAGAGCGAGCGGCGGATCT	0.517											OREG0003468	type=REGULATORY REGION|Gene=LOC540614|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.R140R		Atlas-SNP	.											.	SEPT8	28	.	0			c.C420A						PASS	.						158.0	161.0	160.0					5																	132099512		2001	4182	6183	SO:0001819	synonymous_variant	23176	exon4			GAGCGAGCGGCGG	AF179995	CCDS43358.1, CCDS43359.1, CCDS43360.1, CCDS47262.1, CCDS75298.1	5q31	2013-01-21			ENSG00000164402	ENSG00000164402		"""Septins"""	16511	protein-coding gene	gene with protein product		608418				9039502, 9149945	Standard	NM_001098812		Approved	KIAA0202, SEP2	uc003kxr.2	Q92599	OTTHUMG00000059735	ENST00000378719.2:c.420C>A	chr5.hg19:g.132099512G>T		109.0	0.0	.	1592	126.0	36.0	.	NM_015146	A6NC65|A6NKP6|F6W7K9|Q8IX36|Q8IX37|Q9BVB3	Silent	SNP	ENST00000378719.2	hg19	CCDS43358.1																																																																																			.	.	.	none		0.517	SEPT8-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132827.2	XM_034872	
NEU1	4758	hgsc.bcm.edu	37	6	31829963	31829963	+	Silent	SNP	C	C	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr6:31829963C>T	ENST00000375631.4	-	2	294	c.165G>A	c.(163-165)caG>caA	p.Q55Q		NM_000434.3	NP_000425.1	Q99519	NEUR1_HUMAN	sialidase 1 (lysosomal sialidase)	55					glycosphingolipid metabolic process (GO:0006687)|lipid catabolic process (GO:0016042)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10					Oseltamivir(DB00198)	TCACCAGCGGCTGCACCTGTC	0.587																																					p.Q55Q		Atlas-SNP	.											.	NEU1	21	.	0			c.G165A						PASS	.						68.0	44.0	52.0					6																	31829963		1510	2709	4219	SO:0001819	synonymous_variant	4758	exon2			CAGCGGCTGCACC	AF040958	CCDS4723.1	6p21	2012-10-02			ENSG00000204386	ENSG00000204386	3.2.1.18		7758	protein-coding gene	gene with protein product		608272		NEU		9054950	Standard	NM_000434		Approved		uc003nxq.4	Q99519	OTTHUMG00000031284	ENST00000375631.4:c.165G>A	chr6.hg19:g.31829963C>T		100.0	0.0	.		117.0	24.0	.	NM_000434		Silent	SNP	ENST00000375631.4	hg19	CCDS4723.1																																																																																			.	.	.	none		0.587	NEU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076616.2		
PKHD1	5314	hgsc.bcm.edu	37	6	51889838	51889838	+	Silent	SNP	G	G	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr6:51889838G>C	ENST00000371117.3	-	32	5045	c.4770C>G	c.(4768-4770)ctC>ctG	p.L1590L	PKHD1_ENST00000340994.4_Silent_p.L1590L	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1590	IPT/TIG 11.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTATGGTCAAGAGGCTTCCAC	0.473																																					p.L1590L		Atlas-SNP	.											.	PKHD1	927	.	0			c.C4770G						PASS	.						111.0	101.0	104.0					6																	51889838		2203	4300	6503	SO:0001819	synonymous_variant	5314	exon32			GGTCAAGAGGCTT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4770C>G	chr6.hg19:g.51889838G>C		71.0	0.0	.		73.0	19.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	hg19	CCDS4935.1																																																																																			.	.	.	none		0.473	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
MB21D1	115004	hgsc.bcm.edu	37	6	74161674	74161674	+	Silent	SNP	A	A	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr6:74161674A>G	ENST00000370315.3	-	1	325	c.231T>C	c.(229-231)acT>acC	p.T77T	MB21D1_ENST00000370318.1_Silent_p.T77T	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	77					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						CGCGGGCCCCAGTTGCGCGGA	0.726																																					p.T77T		Atlas-SNP	.											.	MB21D1	33	.	0			c.T231C						PASS	.						4.0	4.0	4.0					6																	74161674		1811	3645	5456	SO:0001819	synonymous_variant	115004	exon1			GGCCCCAGTTGCG	BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.231T>C	chr6.hg19:g.74161674A>G		138.0	0.0	.		151.0	31.0	.	NM_138441	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Silent	SNP	ENST00000370315.3	hg19	CCDS4978.1																																																																																			.	.	.	none		0.726	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041221.5	NM_138441	
CD164	8763	hgsc.bcm.edu	37	6	109697298	109697298	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr6:109697298C>T	ENST00000310786.4	-	4	414	c.349G>A	c.(349-351)Gtg>Atg	p.V117M	CD164_ENST00000512821.1_Missense_Mutation_p.V117M|CD164_ENST00000368961.5_Intron|CD164_ENST00000275080.7_Intron|CD164_ENST00000413644.2_Missense_Mutation_p.V117M|CD164_ENST00000324953.5_Missense_Mutation_p.V117M|CD164_ENST00000506649.1_5'UTR|CD164_ENST00000504373.1_Missense_Mutation_p.V83M	NM_001142404.1|NM_006016.4	NP_001135876.1|NP_006007.2	Q04900	MUC24_HUMAN	CD164 molecule, sialomucin	117	Thr-rich.				cell adhesion (GO:0007155)|hemopoiesis (GO:0030097)|heterophilic cell-cell adhesion (GO:0007157)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(1)|lung(2)	3		all_cancers(87;4.65e-22)|all_epithelial(87;2.54e-20)|all_lung(197;1.6e-05)|Lung NSC(302;2.92e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.0175)		Epithelial(106;7.83e-46)|all cancers(137;1.15e-45)|OV - Ovarian serous cystadenocarcinoma(136;2.89e-26)|BRCA - Breast invasive adenocarcinoma(108;0.00128)|GBM - Glioblastoma multiforme(226;0.16)		GCTGTTGGCACTGGAGTGGCC	0.323																																					p.V117M		Atlas-SNP	.											.	CD164	10	.	0			c.G349A						PASS	.						54.0	56.0	55.0					6																	109697298		2203	4300	6503	SO:0001583	missense	8763	exon4			TTGGCACTGGAGT	AF106518	CCDS5073.1, CCDS47462.1, CCDS47463.1, CCDS47464.1, CCDS47465.1	6q21	2014-09-05	2006-03-28		ENSG00000135535	ENSG00000135535		"""CD molecules"""	1632	protein-coding gene	gene with protein product		603356	"""CD164 antigen, sialomucin"""			9680353, 9763543	Standard	NM_006016		Approved	MUC-24, MGC-24	uc003pte.3	Q04900	OTTHUMG00000015339	ENST00000310786.4:c.349G>A	chr6.hg19:g.109697298C>T	ENSP00000309376:p.Val117Met	58.0	0.0	.		39.0	11.0	.	NM_006016	B4DQ85|E1P5E7|E1P5E8|E1P5E9|O95413|Q5JSU6|Q9BPV0|Q9NR26	Missense_Mutation	SNP	ENST00000310786.4	hg19	CCDS5073.1	.	.	.	.	.	.	.	.	.	.	C	8.205	0.799104	0.16397	.	.	ENSG00000135535	ENST00000413644;ENST00000324953;ENST00000310786;ENST00000512821;ENST00000504373	T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27	4.56	-3.14	0.05250	.	1.016850	0.07895	N	0.971727	T	0.16385	0.0394	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.16802	0.015;0.015;0.019;0.015	B;B;B;B	0.18561	0.015;0.022;0.016;0.009	T	0.24728	-1.0152	10	0.45353	T	0.12	3.8623	4.7218	0.12922	0.3874:0.178:0.0:0.4346	.	117;117;117;117	Q04900-5;Q04900-4;Q04900;Q04900-2	.;.;MUC24_HUMAN;.	M	117;117;117;117;83	ENSP00000402237:V117M;ENSP00000314177:V117M;ENSP00000309376:V117M;ENSP00000427546:V117M;ENSP00000422999:V83M	ENSP00000309376:V117M	V	-	1	0	CD164	109803991	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	-0.149000	0.10204	-0.711000	0.04995	-1.115000	0.02055	GTG	.	.	.	none		0.323	CD164-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041742.1	NM_006016	
STK17A	9263	hgsc.bcm.edu	37	7	43663376	43663376	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr7:43663376A>T	ENST00000319357.5	+	6	988	c.809A>T	c.(808-810)gAa>gTa	p.E270V		NM_004760.2	NP_004751.2	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a	270	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein phosphorylation (GO:0006468)|regulation of reactive oxygen species metabolic process (GO:2000377)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						GATAAACAAGAAACATTCTTA	0.318																																					p.E270V		Atlas-SNP	.											.	STK17A	31	.	0			c.A809T						PASS	.						97.0	98.0	98.0					7																	43663376		2202	4293	6495	SO:0001583	missense	9263	exon6			AACAAGAAACATT	AB011420	CCDS5470.1	7p13	2008-05-15	2007-02-12		ENSG00000164543	ENSG00000164543			11395	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 1"""	604726	"""serine/threonine kinase 17a (apoptosis-inducing)"""			9786912	Standard	NM_004760		Approved	DRAK1	uc003tih.3	Q9UEE5	OTTHUMG00000022825	ENST00000319357.5:c.809A>T	chr7.hg19:g.43663376A>T	ENSP00000319192:p.Glu270Val	65.0	0.0	.		71.0	17.0	.	NM_004760	A4D1V6|Q8IVC8	Missense_Mutation	SNP	ENST00000319357.5	hg19	CCDS5470.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.612206	0.87258	.	.	ENSG00000164543	ENST00000319357	T	0.66638	-0.22	4.97	4.97	0.65823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48767	D	0.000167	T	0.79528	0.4461	M	0.69523	2.12	0.80722	D	1	D	0.69078	0.997	D	0.65573	0.936	T	0.82464	-0.0444	10	0.87932	D	0	.	14.6526	0.68808	1.0:0.0:0.0:0.0	.	270	Q9UEE5	ST17A_HUMAN	V	270	ENSP00000319192:E270V	ENSP00000319192:E270V	E	+	2	0	STK17A	43629901	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.695000	0.91298	1.844000	0.53588	0.455000	0.32223	GAA	.	.	.	none		0.318	STK17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250902.1	NM_004760	
PCLO	27445	hgsc.bcm.edu	37	7	82465003	82465003	+	Silent	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr7:82465003G>A	ENST00000333891.9	-	16	14566	c.14229C>T	c.(14227-14229)gtC>gtT	p.V4743V	PCLO_ENST00000426442.2_Intron|PCLO_ENST00000423517.2_Silent_p.V4743V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GGACAACCATGACTTGACTGC	0.373																																					p.V4743V		Atlas-SNP	.											.	PCLO	1506	.	0			c.C14229T						PASS	.						59.0	58.0	58.0					7																	82465003		1877	4123	6000	SO:0001819	synonymous_variant	27445	exon16			AACCATGACTTGA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14229C>T	chr7.hg19:g.82465003G>A		139.0	0.0	.		97.0	29.0	.	NM_014510		Silent	SNP	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.	.	none		0.373	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
TRPV6	55503	hgsc.bcm.edu	37	7	142574503	142574503	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr7:142574503T>A	ENST00000359396.3	-	5	820	c.575A>T	c.(574-576)cAg>cTg	p.Q192L	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	192					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CAGGGAGTCCTGGGCCCGGAT	0.612																																					p.Q192L		Atlas-SNP	.											.	TRPV6	108	.	0			c.A575T						PASS	.						95.0	85.0	88.0					7																	142574503		2203	4300	6503	SO:0001583	missense	55503	exon5			GAGTCCTGGGCCC	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.575A>T	chr7.hg19:g.142574503T>A	ENSP00000352358:p.Gln192Leu	84.0	0.0	.		92.0	27.0	.	NM_018646	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	hg19	CCDS5874.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.63|18.63	3.665013|3.665013	0.67700|0.67700	.|.	.|.	ENSG00000165125|ENSG00000165125	ENST00000311470|ENST00000359396	.|T	.|0.65364	.|-0.15	4.67|4.67	3.52|3.52	0.40303|0.40303	.|Ankyrin repeat-containing domain (4);	.|0.059353	.|0.64402	.|D	.|0.000001	.|T	.|0.71634	.|0.3363	L|L	0.53561|0.53561	1.675|1.675	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	.|T	.|0.70317	.|-0.4905	.|10	.|0.56958	.|D	.|0.05	.|-20.3379	9.2268|9.2268	0.37412|0.37412	0.0:0.0863:0.0:0.9137|0.0:0.0863:0.0:0.9137	.|.	.|192	.|Q9H1D0	.|TRPV6_HUMAN	.|L	-1|192	.|ENSP00000352358:Q192L	.|ENSP00000352358:Q192L	.|Q	-|-	.|2	.|0	TRPV6|TRPV6	142284625|142284625	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.535000|0.535000	0.34838|0.34838	7.799000|7.799000	0.85936|0.85936	0.661000|0.661000	0.30985|0.30985	0.533000|0.533000	0.62120|0.62120	.|CAG	.	.	.	none		0.612	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274	
AOC1	26	hgsc.bcm.edu	37	7	150554433	150554433	+	Missense_Mutation	SNP	C	C	A	rs532287637		TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr7:150554433C>A	ENST00000493429.1	+	4	1459	c.875C>A	c.(874-876)cCc>cAc	p.P292H	AOC1_ENST00000416793.2_Missense_Mutation_p.P292H|AOC1_ENST00000467291.1_Missense_Mutation_p.P292H|AOC1_ENST00000360937.4_Missense_Mutation_p.P292H			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	292					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)									Amiloride(DB00594)	GGGGACTTCCCCAGCCCCATC	0.701																																					p.P292H		Atlas-SNP	.											.	ABP1	92	.	0			c.C875A						PASS	.						12.0	15.0	14.0					7																	150554433		1987	4141	6128	SO:0001583	missense	26	exon2			ACTTCCCCAGCCC	AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.875C>A	chr7.hg19:g.150554433C>A	ENSP00000418614:p.Pro292His	60.0	0.0	.		63.0	16.0	.	NM_001091	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Missense_Mutation	SNP	ENST00000493429.1	hg19	CCDS43679.1	.	.	.	.	.	.	.	.	.	.	C	4.108	0.018074	0.07959	.	.	ENSG00000002726	ENST00000493429;ENST00000467291;ENST00000360937;ENST00000416793;ENST00000437714;ENST00000483043	T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2	5.01	3.15	0.36227	Copper amine oxidase, C-terminal (1);Copper amine oxidase, N-terminal (1);	0.511218	0.18147	N	0.150202	T	0.18800	0.0451	L	0.58101	1.795	0.09310	N	1	B;B	0.14012	0.009;0.006	B;B	0.09377	0.004;0.004	T	0.18713	-1.0328	10	0.39692	T	0.17	-36.7946	5.7513	0.18148	0.3563:0.5521:0.0:0.0915	.	292;292	C9J690;P19801	.;ABP1_HUMAN	H	292;292;292;292;168;292	ENSP00000418614:P292H;ENSP00000418328:P292H;ENSP00000354193:P292H;ENSP00000411613:P292H;ENSP00000417392:P292H	ENSP00000354193:P292H	P	+	2	0	ABP1	150185366	0.000000	0.05858	0.007000	0.13788	0.321000	0.28281	0.542000	0.23222	0.660000	0.30964	0.561000	0.74099	CCC	.	.	.	none		0.701	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1	NM_001091	
GFRA2	2675	hgsc.bcm.edu	37	8	21608372	21608372	+	Nonsense_Mutation	SNP	G	G	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr8:21608372G>T	ENST00000524240.1	-	4	1172	c.522C>A	c.(520-522)tgC>tgA	p.C174*	GFRA2_ENST00000517328.1_Nonsense_Mutation_p.C174*|GFRA2_ENST00000400782.4_Nonsense_Mutation_p.C69*|GFRA2_ENST00000518077.1_Nonsense_Mutation_p.C41*	NM_001495.4	NP_001486.4	O00451	GFRA2_HUMAN	GDNF family receptor alpha 2	174					negative regulation of protein autophosphorylation (GO:0031953)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|prostate(1)|skin(1)	7				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		GCAGCTTCTTGCAGTTGTCAT	0.617																																					p.C174X		Atlas-SNP	.											.	GFRA2	23	.	0			c.C522A						PASS	.						40.0	46.0	44.0					8																	21608372		2197	4297	6494	SO:0001587	stop_gained	2675	exon4			CTTCTTGCAGTTG	AF002700	CCDS47816.1, CCDS55207.1	8p21.3	2008-05-02			ENSG00000168546	ENSG00000168546			4244	protein-coding gene	gene with protein product		601956				9177201	Standard	NM_001165038		Approved	RETL2, GDNFRB, NTNRA, TRNR2	uc003wzu.1	O00451	OTTHUMG00000163897	ENST00000524240.1:c.522C>A	chr8.hg19:g.21608372G>T	ENSP00000428518:p.Cys174*	156.0	0.0	.		164.0	59.0	.	NM_001495	E9PD47|O15316|O15328|Q58J92|Q6GTR9|Q7Z5C2	Nonsense_Mutation	SNP	ENST00000524240.1	hg19	CCDS47816.1	.	.	.	.	.	.	.	.	.	.	G	36	5.723754	0.96847	.	.	ENSG00000168546	ENST00000524240;ENST00000400782;ENST00000517328;ENST00000518077;ENST00000517892;ENST00000522071;ENST00000520826	.	.	.	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.8511	10.9886	0.47537	0.0874:0.0:0.9126:0.0	.	.	.	.	X	174;69;174;41;69;174;166	.	ENSP00000383592:C69X	C	-	3	2	GFRA2	21652652	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	4.934000	0.63491	2.197000	0.70478	0.313000	0.20887	TGC	.	.	.	none		0.617	GFRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376254.3	NM_001495	
ENTPD4	9583	hgsc.bcm.edu	37	8	23294697	23294697	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr8:23294697T>C	ENST00000358689.4	-	10	1359	c.1124A>G	c.(1123-1125)gAt>gGt	p.D375G	ENTPD4_ENST00000356206.6_Missense_Mutation_p.D367G|ENTPD4_ENST00000417069.2_Missense_Mutation_p.D367G|ENTPD4_ENST00000521321.1_5'Flank	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	375					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		CTGGATTTCATCTTTAATGTC	0.458																																					p.D375G		Atlas-SNP	.											.	ENTPD4	56	.	0			c.A1124G						PASS	.						138.0	110.0	119.0					8																	23294697		2203	4300	6503	SO:0001583	missense	9583	exon10			ATTTCATCTTTAA	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1124A>G	chr8.hg19:g.23294697T>C	ENSP00000351520:p.Asp375Gly	136.0	0.0	.		155.0	49.0	.	NM_004901	D3DSS3|O15092	Missense_Mutation	SNP	ENST00000358689.4	hg19	CCDS6041.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.813208	0.70912	.	.	ENSG00000197217	ENST00000356206;ENST00000358689;ENST00000417069	T;T;T	0.10763	2.84;2.84;2.84	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.12987	0.0315	L	0.39245	1.2	0.80722	D	1	P;P;P	0.36354	0.549;0.494;0.549	B;B;B	0.40444	0.329;0.221;0.329	T	0.09271	-1.0682	10	0.31617	T	0.26	-26.8762	14.5422	0.68002	0.0:0.0:0.0:1.0	.	367;367;375	Q8NE73;Q9Y227-2;Q9Y227	.;.;ENTP4_HUMAN	G	367;375;367	ENSP00000348536:D367G;ENSP00000351520:D375G;ENSP00000408573:D367G	ENSP00000348536:D367G	D	-	2	0	ENTPD4	23350642	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	7.698000	0.84413	2.120000	0.65058	0.260000	0.18958	GAT	.	.	.	none		0.458	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	NM_004901	
NDUFB9	4715	hgsc.bcm.edu	37	8	125562081	125562081	+	Nonsense_Mutation	SNP	T	T	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr8:125562081T>A	ENST00000276689.3	+	4	572	c.488T>A	c.(487-489)tTg>tAg	p.L163*	NDUFB9_ENST00000517830.1_Intron|NDUFB9_ENST00000522532.1_Intron|NDUFB9_ENST00000517367.1_Nonsense_Mutation_p.L152*	NM_001278646.1|NM_005005.2	NP_001265575.1|NP_004996.1	Q9Y6M9	NDUB9_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa	163					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GAAGGTGATTTGCCCCCACTG	0.522																																					p.L163X		Atlas-SNP	.											NDUFB9,NS,carcinoma,0,1	NDUFB9	18	.	0			c.T488A						PASS	.						69.0	62.0	65.0					8																	125562081		2203	4300	6503	SO:0001587	stop_gained	4715	exon4			GTGATTTGCCCCC	AF044956	CCDS6352.1	8q24.13	2011-07-04	2002-08-29		ENSG00000147684	ENSG00000147684		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7704	protein-coding gene	gene with protein product	"""complex I B22 subunit"""	601445	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 (22kD, B22)"""			8661098	Standard	NM_005005		Approved	B22, UQOR22, LYRM3	uc003yrg.4	Q9Y6M9	OTTHUMG00000165054	ENST00000276689.3:c.488T>A	chr8.hg19:g.125562081T>A	ENSP00000276689:p.Leu163*	91.0	0.0	.		120.0	38.0	.	NM_005005	B2R8M6|Q9UQE8	Nonsense_Mutation	SNP	ENST00000276689.3	hg19	CCDS6352.1	.	.	.	.	.	.	.	.	.	.	T	36	5.696320	0.96802	.	.	ENSG00000147684	ENST00000276689;ENST00000517367	.	.	.	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.3291	15.004	0.71498	0.0:0.0:0.0:1.0	.	.	.	.	X	163;152	.	ENSP00000276689:L163X	L	+	2	0	NDUFB9	125631262	1.000000	0.71417	0.989000	0.46669	0.961000	0.63080	7.437000	0.80417	2.018000	0.59344	0.260000	0.18958	TTG	.	.	.	none		0.522	NDUFB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381606.1	NM_005005	
MROH6	642475	hgsc.bcm.edu	37	8	144657205	144657205	+	5'Flank	SNP	C	C	T	rs552997428		TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr8:144657205C>T	ENST00000398882.3	-	0	0				NAPRT1_ENST00000449291.2_Missense_Mutation_p.S502N|NAPRT1_ENST00000435154.3_3'UTR|RP11-661A12.9_ENST00000531730.1_RNA|NAPRT1_ENST00000460623.1_5'UTR|NAPRT1_ENST00000276844.7_Missense_Mutation_p.S502N|NAPRT1_ENST00000426292.3_Missense_Mutation_p.S489N	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6																		GCTGAGTCGGCTCAGGGACAG	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		17051	0.001		0.0	False		,,,				2504	0.0				p.S502N		Atlas-SNP	.											.	NAPRT1	47	.	0			c.G1505A						PASS	.						30.0	32.0	31.0					8																	144657205		692	1591	2283	SO:0001631	upstream_gene_variant	93100	exon12			AGTCGGCTCAGGG	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164		chr8.hg19:g.144657205C>T	Exception_encountered	146.0	0.0	.		198.0	63.0	.	NM_145201	A8MWB1	Missense_Mutation	SNP	ENST00000398882.3	hg19	CCDS47928.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.576030	0.45902	.	.	ENSG00000147813	ENST00000449291;ENST00000340490;ENST00000426292;ENST00000276844	T;T;T;T	0.43294	0.98;0.95;0.96;0.97	5.69	3.91	0.45181	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.431641	0.29791	N	0.011181	T	0.22003	0.0530	N	0.13168	0.305	0.27755	N	0.944011	B;B;B	0.13594	0.008;0.001;0.003	B;B;B	0.11329	0.006;0.002;0.001	T	0.19321	-1.0309	10	0.15066	T	0.55	-6.2117	7.5749	0.27931	0.0:0.7303:0.0:0.2697	.	502;489;502	G5E977;Q6XQN6-3;Q6XQN6	.;.;PNCB_HUMAN	N	502;502;489;502	ENSP00000401508:S502N;ENSP00000341136:S502N;ENSP00000390949:S489N;ENSP00000276844:S502N	ENSP00000276844:S502N	S	-	2	0	NAPRT1	144728348	0.049000	0.20398	0.756000	0.31282	0.644000	0.38419	0.196000	0.17176	0.764000	0.33197	0.655000	0.94253	AGC	.	.	.	none		0.662	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
PRSS3	5646	hgsc.bcm.edu	37	9	33797999	33797999	+	Missense_Mutation	SNP	A	A	G	rs142141488		TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr9:33797999A>G	ENST00000361005.5	+	3	544	c.544A>G	c.(544-546)Acc>Gcc	p.T182A	RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000342836.4_Missense_Mutation_p.T139A|PRSS3_ENST00000379405.3_Missense_Mutation_p.T125A|PRSS3_ENST00000429677.3_Missense_Mutation_p.T118A	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	182	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CCGCGTGTCCACCATCTCTCT	0.567																																					p.T182A		Atlas-SNP	.											.	PRSS3	79	.	0			c.A544G						PASS	.						206.0	156.0	173.0					9																	33797999		2203	4300	6503	SO:0001583	missense	5646	exon3			GTGTCCACCATCT		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.544A>G	chr9.hg19:g.33797999A>G	ENSP00000354280:p.Thr182Ala	106.0	0.0	.		120.0	5.0	.	NM_007343	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	hg19	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	A	11.10	1.538604	0.27475	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	T;T;D;T;D	0.92699	0.32;0.23;-3.09;0.32;-3.09	3.62	-7.24	0.01475	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.484707	0.25543	N	0.029949	T	0.73024	0.3534	N	0.04686	-0.185	0.24520	N	0.994162	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.11329	0.002;0.006;0.002	T	0.61242	-0.7102	10	0.44086	T	0.13	.	1.0734	0.01627	0.2023:0.3189:0.2612:0.2176	.	125;182;139	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	A	182;137;139;118;125	ENSP00000354280:T182A;ENSP00000401249:T137A;ENSP00000340889:T139A;ENSP00000401828:T118A;ENSP00000368715:T125A	ENSP00000340889:T139A	T	+	1	0	PRSS3	33787999	0.000000	0.05858	0.001000	0.08648	0.164000	0.22412	-0.041000	0.12084	-2.179000	0.00767	0.260000	0.18958	ACC	.	.	.	weak		0.567	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
C9orf170	401535	hgsc.bcm.edu	37	9	89763782	89763782	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr9:89763782C>G	ENST00000375941.2	+	1	224	c.137C>G	c.(136-138)tCc>tGc	p.S46C		NM_001001709.2	NP_001001709.1	A2RU37	CI170_HUMAN	chromosome 9 open reading frame 170	46										large_intestine(3)|lung(2)|prostate(1)	6						GGCCTGGCCTCCTGCTCAGTC	0.602																																					p.S46C		Atlas-SNP	.											.	C9orf170	17	.	0			c.C137G						PASS	.						31.0	34.0	33.0					9																	89763782		2202	4299	6501	SO:0001583	missense	401535	exon1			TGGCCTCCTGCTC	AK127445	CCDS35058.1	9q21.33	2009-02-11			ENSG00000204446	ENSG00000204446			33817	protein-coding gene	gene with protein product							Standard	NM_001001709		Approved	FLJ45537	uc004apa.1	A2RU37	OTTHUMG00000159587	ENST00000375941.2:c.137C>G	chr9.hg19:g.89763782C>G	ENSP00000365108:p.Ser46Cys	280.0	0.0	.		252.0	75.0	.	NM_001001709		Missense_Mutation	SNP	ENST00000375941.2	hg19	CCDS35058.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145880	0.37923	.	.	ENSG00000204446	ENST00000375941	.	.	.	4.38	0.178	0.15058	.	.	.	.	.	T	0.13543	0.0328	N	0.08118	0	0.09310	N	1	P	0.35844	0.524	B	0.35550	0.205	T	0.17349	-1.0372	8	0.87932	D	0	.	3.1347	0.06435	0.1702:0.4021:0.3314:0.0963	.	46	A2RU37	CI170_HUMAN	C	46	.	ENSP00000365108:S46C	S	+	2	0	C9orf170	88953602	0.000000	0.05858	0.000000	0.03702	0.274000	0.26718	0.031000	0.13710	0.038000	0.15604	-0.176000	0.13171	TCC	.	.	.	none		0.602	C9orf170-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356346.1	NM_001001709	
OGN	4969	hgsc.bcm.edu	37	9	95165578	95165578	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr9:95165578A>G	ENST00000262551.4	-	2	532	c.112T>C	c.(112-114)Ttt>Ctt	p.F38L	OGN_ENST00000375561.5_Missense_Mutation_p.F38L|CENPP_ENST00000375587.3_Intron	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	38					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						GATTCTTCAAAATTATCTGTT	0.358																																					p.F38L		Atlas-SNP	.											.	OGN	26	.	0			c.T112C						PASS	.						76.0	76.0	76.0					9																	95165578		2203	4300	6503	SO:0001583	missense	4969	exon2			CTTCAAAATTATC	AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.112T>C	chr9.hg19:g.95165578A>G	ENSP00000262551:p.Phe38Leu	107.0	0.0	.		118.0	35.0	.	NM_033014	Q6FIB0|Q9UF90|Q9UNK5	Missense_Mutation	SNP	ENST00000262551.4	hg19	CCDS6695.1	.	.	.	.	.	.	.	.	.	.	A	9.224	1.034153	0.19590	.	.	ENSG00000106809	ENST00000262551;ENST00000375561;ENST00000447356	T;T;T	0.59083	0.29;0.29;0.31	5.55	4.41	0.53225	.	0.508491	0.20017	N	0.100983	T	0.32852	0.0843	N	0.12182	0.205	0.19945	N	0.999942	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18808	-1.0325	10	0.11182	T	0.66	.	7.0374	0.25000	0.7748:0.1478:0.0774:0.0	.	96;38	B4DI63;P20774	.;MIME_HUMAN	L	38;38;96	ENSP00000262551:F38L;ENSP00000364711:F38L;ENSP00000396709:F96L	ENSP00000262551:F38L	F	-	1	0	OGN	94205399	0.011000	0.17503	0.869000	0.34112	0.689000	0.40095	0.790000	0.26900	1.058000	0.40530	0.533000	0.62120	TTT	.	.	.	none		0.358	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1	NM_024416	
LRRC8A	56262	hgsc.bcm.edu	37	9	131670150	131670150	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr9:131670150A>T	ENST00000259324.5	+	3	1230	c.707A>T	c.(706-708)gAg>gTg	p.E236V	LRRC8A_ENST00000372599.3_Missense_Mutation_p.E236V|LRRC8A_ENST00000372600.4_Missense_Mutation_p.E236V	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	236					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						GACAAGAAGGAGGGGGAGCAA	0.617																																					p.E236V		Atlas-SNP	.											.	LRRC8A	69	.	0			c.A707T						PASS	.						112.0	107.0	109.0					9																	131670150		2203	4300	6503	SO:0001583	missense	56262	exon3			AGAAGGAGGGGGA	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.707A>T	chr9.hg19:g.131670150A>T	ENSP00000259324:p.Glu236Val	157.0	0.0	.		158.0	14.0	.	NM_001127244	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	ENST00000259324.5	hg19	CCDS35155.1	.	.	.	.	.	.	.	.	.	.	A	15.88	2.964061	0.53507	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.37584	1.19;1.19;1.19	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.60650	0.2285	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65434	-0.6169	10	0.87932	D	0	.	14.6237	0.68605	1.0:0.0:0.0:0.0	.	236	Q8IWT6	LRC8A_HUMAN	V	236	ENSP00000361682:E236V;ENSP00000361680:E236V;ENSP00000259324:E236V	ENSP00000259324:E236V	E	+	2	0	LRRC8A	130709971	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	9.339000	0.96797	2.052000	0.61016	0.460000	0.39030	GAG	.	.	.	none		0.617	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594	
ZNF438	220929	hgsc.bcm.edu	37	10	31138561	31138561	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr10:31138561T>G	ENST00000361310.3	-	6	1102	c.773A>C	c.(772-774)aAa>aCa	p.K258T	ZNF438_ENST00000442986.1_Missense_Mutation_p.K258T|ZNF438_ENST00000452305.1_Missense_Mutation_p.K248T|ZNF438_ENST00000375311.1_Intron|ZNF438_ENST00000413025.1_Missense_Mutation_p.K258T|ZNF438_ENST00000444692.2_Missense_Mutation_p.K248T|ZNF438_ENST00000331737.6_Missense_Mutation_p.K248T|ZNF438_ENST00000538351.2_Missense_Mutation_p.K209T|ZNF438_ENST00000436087.2_Missense_Mutation_p.K258T			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	258					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				TTCTTTAAATTTTTCACTGGC	0.428																																					p.K258T		Atlas-SNP	.											.	ZNF438	90	.	0			c.A773C						PASS	.						179.0	176.0	177.0					10																	31138561		2203	4300	6503	SO:0001583	missense	220929	exon7			TTAAATTTTTCAC	AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.773A>C	chr10.hg19:g.31138561T>G	ENSP00000354663:p.Lys258Thr	84.0	0.0	.		96.0	31.0	.	NM_182755	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	ENST00000361310.3	hg19	CCDS7168.1	.	.	.	.	.	.	.	.	.	.	T	14.52	2.560611	0.45590	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351	T;T;T;T;T;T;T;T	0.13196	2.61;2.62;2.62;2.62;2.62;2.61;2.61;2.62	4.91	2.41	0.29592	.	0.419792	0.29956	N	0.010780	T	0.13927	0.0337	M	0.62723	1.935	0.09310	N	1	P;P	0.38922	0.651;0.557	B;B	0.39419	0.216;0.299	T	0.15065	-1.0450	10	0.72032	D	0.01	-4.3	4.4384	0.11561	0.0:0.1749:0.1693:0.6558	.	258;248	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	T	248;258;258;258;258;248;248;209	ENSP00000333571:K248T;ENSP00000354663:K258T;ENSP00000406934:K258T;ENSP00000412363:K258T;ENSP00000387546:K258T;ENSP00000413060:K248T;ENSP00000410898:K248T;ENSP00000445461:K209T	ENSP00000333571:K248T	K	-	2	0	ZNF438	31178567	0.118000	0.22208	0.001000	0.08648	0.032000	0.12392	2.262000	0.43285	0.744000	0.32741	0.533000	0.62120	AAA	.	.	.	none		0.428	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277006.1	NM_182755	
PANK1	53354	hgsc.bcm.edu	37	10	91404533	91404533	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr10:91404533G>A	ENST00000307534.4	-	1	682	c.527C>T	c.(526-528)cCa>cTa	p.P176L	PANK1_ENST00000322191.6_5'Flank|RP11-80H5.2_ENST00000454174.1_RNA|RP11-80H5.6_ENST00000428166.1_lincRNA|PANK1_ENST00000488482.1_5'Flank|PANK1_ENST00000342512.3_5'Flank|PANK1_ENST00000371774.2_5'Flank|RP11-80H5.2_ENST00000451733.1_RNA	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	176					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						CGGCTGGACTGGCGGCGGATG	0.766																																					p.P176L		Atlas-SNP	.											.	PANK1	35	.	0			c.C527T						PASS	.						1.0	2.0	2.0					10																	91404533		1059	2515	3574	SO:0001583	missense	53354	exon1			TGGACTGGCGGCG	AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.527C>T	chr10.hg19:g.91404533G>A	ENSP00000302108:p.Pro176Leu	34.0	0.0	.		30.0	10.0	.	NM_148977	A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Missense_Mutation	SNP	ENST00000307534.4	hg19	CCDS31244.1	.	.	.	.	.	.	.	.	.	.	G	8.772	0.926188	0.18056	.	.	ENSG00000152782	ENST00000307534;ENST00000371775	D	0.99527	-6.09	4.66	3.75	0.43078	.	0.812759	0.10685	N	0.645879	D	0.97436	0.9161	N	0.19112	0.55	0.52099	D	0.999943	B	0.06786	0.001	B	0.04013	0.001	D	0.94700	0.7882	10	0.54805	T	0.06	.	10.7307	0.46096	0.095:0.0:0.905:0.0	.	176	Q8TE04	PANK1_HUMAN	L	176;39	ENSP00000302108:P176L	ENSP00000302108:P176L	P	-	2	0	PANK1	91394513	0.564000	0.26602	0.018000	0.16275	0.029000	0.11900	1.493000	0.35605	0.953000	0.37825	0.561000	0.74099	CCA	.	.	.	none		0.766	PANK1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
MXI1	4601	hgsc.bcm.edu	37	10	112044605	112044605	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr10:112044605A>T	ENST00000239007.7	+	6	765	c.547A>T	c.(547-549)Agc>Tgc	p.S183C	MXI1_ENST00000393134.1_Missense_Mutation_p.S173C|MXI1_ENST00000332674.5_Missense_Mutation_p.S250C|MXI1_ENST00000485566.1_3'UTR|MXI1_ENST00000369612.1_Missense_Mutation_p.S147C|MXI1_ENST00000361248.4_Missense_Mutation_p.S137C	NM_005962.4	NP_005953.4	P50539	MXI1_HUMAN	MAX interactor 1, dimerization protein	183					cytoplasmic sequestering of transcription factor (GO:0042994)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(1)	10		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GGATGTTGAAAGCACAGAGTT	0.433																																					p.S250C		Atlas-SNP	.											.	MXI1	17	.	0			c.A748T						PASS	.						98.0	85.0	89.0					10																	112044605		2203	4300	6503	SO:0001583	missense	4601	exon6			GTTGAAAGCACAG	BC016678	CCDS7563.1, CCDS7564.2, CCDS31284.1	10q24-q25	2012-11-15	2012-11-15		ENSG00000119950	ENSG00000119950		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7534	protein-coding gene	gene with protein product		600020	"""MAX interacting protein 1"", ""MAX interactor 1"""			7959753	Standard	NM_130439		Approved	MXD2, MAD2, MXI, bHLHc11	uc001kyy.3	P50539	OTTHUMG00000019033	ENST00000239007.7:c.547A>T	chr10.hg19:g.112044605A>T	ENSP00000239007:p.Ser183Cys	79.0	0.0	.		87.0	27.0	.	NM_130439	B1ANN7|D3DR25|D3DRA9|Q15887|Q6FHW2|Q96E53	Missense_Mutation	SNP	ENST00000239007.7	hg19	CCDS7564.2	.	.	.	.	.	.	.	.	.	.	A	18.38	3.610744	0.66558	.	.	ENSG00000119950	ENST00000332674;ENST00000361248;ENST00000239007;ENST00000369619;ENST00000393134;ENST00000369614;ENST00000369613;ENST00000369612	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.56630	0.1998	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.87578	0.993;0.997;0.993;0.998	T	0.59369	-0.7467	10	0.72032	D	0.01	-12.6328	16.4439	0.83910	1.0:0.0:0.0:0.0	.	173;147;183;250	B1ANN8;P50539-2;P50539;P50539-3	.;.;MXI1_HUMAN;.	C	250;137;183;173;173;147;147;147	ENSP00000331152:S250C;ENSP00000354606:S137C;ENSP00000239007:S183C;ENSP00000376842:S173C;ENSP00000358625:S147C	ENSP00000239007:S183C	S	+	1	0	MXI1	112034595	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.138000	0.77305	2.282000	0.76494	0.533000	0.62120	AGC	.	.	.	none		0.433	MXI1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050316.1	NM_130439	
HSPA12A	259217	hgsc.bcm.edu	37	10	118440687	118440687	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr10:118440687G>T	ENST00000369209.3	-	9	1107	c.1003C>A	c.(1003-1005)Ctt>Att	p.L335I		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	335						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		AGTTCCTTAAGGTGTCCCTCC	0.488																																					p.L335I		Atlas-SNP	.											.	HSPA12A	81	.	0			c.C1003A						PASS	.						99.0	104.0	102.0					10																	118440687		1989	4169	6158	SO:0001583	missense	259217	exon9			CCTTAAGGTGTCC	AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1003C>A	chr10.hg19:g.118440687G>T	ENSP00000358211:p.Leu335Ile	79.0	0.0	.		66.0	4.0	.	NM_025015		Missense_Mutation	SNP	ENST00000369209.3	hg19	CCDS41569.1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441640	0.63067	.	.	ENSG00000165868	ENST00000369209	T	0.31510	1.49	5.78	4.86	0.63082	.	0.125530	0.53938	D	0.000050	T	0.37046	0.0989	L	0.37466	1.105	0.45930	D	0.998764	P	0.45396	0.857	P	0.49999	0.628	T	0.18493	-1.0335	10	0.62326	D	0.03	.	16.0591	0.80826	0.0:0.0:0.8648:0.1352	.	335	O43301	HS12A_HUMAN	I	335	ENSP00000358211:L335I	ENSP00000358211:L335I	L	-	1	0	HSPA12A	118430677	1.000000	0.71417	0.964000	0.40570	0.743000	0.42351	5.429000	0.66495	1.420000	0.47138	0.655000	0.94253	CTT	.	.	.	none		0.488	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050530.1	NM_025015	
NAP1L4	4676	hgsc.bcm.edu	37	11	2970489	2970489	+	Nonstop_Mutation	SNP	T	T	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr11:2970489T>G	ENST00000380542.4	-	15	1268	c.1128A>C	c.(1126-1128)taA>taC	p.*376Y	NAP1L4_ENST00000469089.1_5'UTR|NAP1L4_ENST00000526115.1_Intron	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4	0					nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		CAGACAAAAATTACACCTAAA	0.328																																					p.X376Y		Atlas-SNP	.											.	NAP1L4	39	.	0			c.A1128C						PASS	.						75.0	67.0	69.0					11																	2970489		1834	4086	5920	SO:0001578	stop_lost	4676	exon15			CAAAAATTACACC	AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.1128A>C	chr11.hg19:g.2970489T>G		603.0	0.0	.		560.0	166.0	.	NM_005969	B2R6J4|F5HFY4	Missense_Mutation	SNP	ENST00000380542.4	hg19	CCDS41599.1	.	.	.	.	.	.	.	.	.	.	T	11.54	1.669728	0.29693	.	.	ENSG00000205531	ENST00000380542	.	.	.	4.07	4.07	0.47477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7709	0.51958	0.0:0.0:0.0:1.0	.	.	.	.	Y	376	.	.	X	-	3	2	NAP1L4	2927065	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.761000	0.62243	1.717000	0.51406	0.533000	0.62120	TAA	.	.	.	none		0.328	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030273.3	NM_005969	
CLSTN3	9746	hgsc.bcm.edu	37	12	7303653	7303653	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr12:7303653A>T	ENST00000266546.6	+	16	2971	c.2521A>T	c.(2521-2523)Aac>Tac	p.N841Y	CLSTN3_ENST00000537408.1_Missense_Mutation_p.N853Y	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	841					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CTCCCACAGAAACTCCAGTAC	0.652																																					p.N841Y		Atlas-SNP	.											.	CLSTN3	84	.	0			c.A2521T						PASS	.						21.0	21.0	21.0					12																	7303653		2202	4300	6502	SO:0001583	missense	9746	exon16			CACAGAAACTCCA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2521A>T	chr12.hg19:g.7303653A>T	ENSP00000266546:p.Asn841Tyr	91.0	0.0	.		139.0	40.0	.	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	hg19	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	A	8.415	0.845014	0.16963	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.35789	1.29;1.29	5.52	5.52	0.82312	.	0.098878	0.64402	D	0.000002	T	0.36635	0.0974	L	0.29908	0.895	0.50632	D	0.999881	D;B	0.61080	0.989;0.263	P;B	0.50490	0.642;0.091	T	0.09530	-1.0670	10	0.40728	T	0.16	-42.2086	14.2234	0.65843	1.0:0.0:0.0:0.0	.	853;841	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	Y	841;853	ENSP00000266546:N841Y;ENSP00000440679:N853Y	ENSP00000266546:N841Y	N	+	1	0	CLSTN3	7194920	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	8.553000	0.90686	2.086000	0.62901	0.459000	0.35465	AAC	.	.	.	none		0.652	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
ACSM4	341392	hgsc.bcm.edu	37	12	7476144	7476144	+	Silent	SNP	C	C	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr12:7476144C>T	ENST00000399422.4	+	9	1344	c.1296C>T	c.(1294-1296)ttC>ttT	p.F432F		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	432					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						TCTGTTTCTTCTCTAAATAtg	0.413																																					p.F432F		Atlas-SNP	.											.	ACSM4	98	.	0			c.C1296T						PASS	.						62.0	60.0	61.0					12																	7476144		1832	4080	5912	SO:0001819	synonymous_variant	341392	exon9			TTTCTTCTCTAAA		CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.1296C>T	chr12.hg19:g.7476144C>T		79.0	0.0	.		66.0	16.0	.	NM_001080454	A8MTI6	Silent	SNP	ENST00000399422.4	hg19	CCDS44825.1																																																																																			.	.	.	none		0.413	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337866.2	NM_001080454	
KRT1	3848	hgsc.bcm.edu	37	12	53069229	53069229	+	Silent	SNP	G	G	A	rs540699806|rs267607656	byFrequency	TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr12:53069229G>A	ENST00000252244.3	-	9	1741	c.1683C>T	c.(1681-1683)tcC>tcT	p.S561S		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	561	Gly/Ser-rich.|Tail.		Missing (in allele 1B). {ECO:0000269|PubMed:1281859}.		complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						tgccacctccggagccgtagc	0.692																																					p.S561S		Atlas-SNP	.											.	KRT1	110	.	0			c.C1683T						PASS	.						4.0	4.0	4.0					12																	53069229		1797	3656	5453	SO:0001819	synonymous_variant	3848	exon9			ACCTCCGGAGCCG	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1683C>T	chr12.hg19:g.53069229G>A		4.0	0.0	.		36.0	16.0	.	NM_006121	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	ENST00000252244.3	hg19	CCDS8836.1																																																																																			.	.	.	none		0.692	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
EEA1	8411	hgsc.bcm.edu	37	12	93210107	93210107	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr12:93210107C>A	ENST00000322349.8	-	15	2062	c.1798G>T	c.(1798-1800)Gac>Tac	p.D600Y		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	600	Gln/Glu/Lys-rich.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						TGTACCTGGTCATGCAAATTC	0.388																																					p.D600Y		Atlas-SNP	.											.	EEA1	104	.	0			c.G1798T						PASS	.						251.0	218.0	229.0					12																	93210107		2203	4300	6503	SO:0001583	missense	8411	exon15			CCTGGTCATGCAA	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.1798G>T	chr12.hg19:g.93210107C>A	ENSP00000317955:p.Asp600Tyr	197.0	0.0	.		152.0	46.0	.	NM_003566	Q14221	Missense_Mutation	SNP	ENST00000322349.8	hg19	CCDS31874.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.422447	0.62622	.	.	ENSG00000102189	ENST00000322349	T	0.46819	0.86	5.27	5.27	0.74061	.	0.109285	0.39146	N	0.001443	T	0.44371	0.1290	N	0.14661	0.345	0.42441	D	0.992715	D	0.57257	0.979	P	0.50490	0.642	T	0.52939	-0.8508	10	0.72032	D	0.01	.	18.8732	0.92324	0.0:1.0:0.0:0.0	.	600	Q15075	EEA1_HUMAN	Y	600	ENSP00000317955:D600Y	ENSP00000317955:D600Y	D	-	1	0	EEA1	91734238	1.000000	0.71417	1.000000	0.80357	0.541000	0.35023	5.668000	0.68074	2.473000	0.83533	0.313000	0.20887	GAC	.	.	.	none		0.388	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
NCOR2	9612	hgsc.bcm.edu	37	12	124846815	124846815	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr12:124846815C>A	ENST00000405201.1	-	22	2957	c.2957G>T	c.(2956-2958)cGg>cTg	p.R986L	NCOR2_ENST00000404621.1_Missense_Mutation_p.R968L|NCOR2_ENST00000356219.3_Missense_Mutation_p.R985L|NCOR2_ENST00000397355.1_Missense_Mutation_p.R969L|NCOR2_ENST00000404121.2_Missense_Mutation_p.R539L|NCOR2_ENST00000429285.2_Missense_Mutation_p.R968L			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	986					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TGCGTCCTCCCGGGGGGGCTC	0.652																																					p.R986L		Atlas-SNP	.											.	NCOR2	475	.	0			c.G2957T						PASS	.						13.0	17.0	16.0					12																	124846815		2057	4192	6249	SO:0001583	missense	9612	exon24			TCCTCCCGGGGGG	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.2957G>T	chr12.hg19:g.124846815C>A	ENSP00000384018:p.Arg986Leu	35.0	0.0	.		26.0	11.0	.	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	hg19	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523460	0.27299	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234	T;T;T;T;T;T;T	0.28666	2.24;2.56;2.26;2.56;2.28;2.55;1.6	4.91	3.09	0.35607	.	0.443732	0.21379	N	0.075504	T	0.35970	0.0950	L	0.51422	1.61	0.28323	N	0.922137	D;D;D	0.57571	0.974;0.967;0.98	P;P;P	0.53861	0.628;0.549;0.736	T	0.13818	-1.0495	10	0.28530	T	0.3	-22.5278	8.6723	0.34159	0.0:0.8183:0.0:0.1817	.	968;969;986	C9J0Q5;C9J239;C9JFD3	.;.;.	L	986;968;985;969;985;539;968;986	ENSP00000384018:R986L;ENSP00000384202:R968L;ENSP00000348551:R985L;ENSP00000380513:R969L;ENSP00000385618:R539L;ENSP00000400281:R968L;ENSP00000402808:R986L	ENSP00000348551:R985L	R	-	2	0	NCOR2	123412768	1.000000	0.71417	0.992000	0.48379	0.124000	0.20399	1.273000	0.33121	0.504000	0.28082	-0.448000	0.05591	CGG	.	.	.	none		0.652	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
FBRSL1	57666	hgsc.bcm.edu	37	12	133146786	133146786	+	Silent	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr12:133146786G>A	ENST00000434748.2	+	7	1986	c.966G>A	c.(964-966)gcG>gcA	p.A322A	FBRSL1_ENST00000261673.6_Silent_p.A249A	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	322	Pro-rich.						poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						GCGCCTTCGCGGGCCACAGCC	0.771																																					p.A322A		Atlas-SNP	.											.	FBRSL1	47	.	0			c.G966A						PASS	.						1.0	2.0	2.0					12																	133146786		292	881	1173	SO:0001819	synonymous_variant	57666	exon7			CTTCGCGGGCCAC		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.966G>A	chr12.hg19:g.133146786G>A		8.0	0.0	.		23.0	6.0	.	NM_001142641	Q86XQ1	Silent	SNP	ENST00000434748.2	hg19	CCDS45010.1																																																																																			.	.	.	none		0.771	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		
METTL17	64745	hgsc.bcm.edu	37	14	21463350	21463350	+	Silent	SNP	T	T	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr14:21463350T>A	ENST00000339374.6	+	10	1136	c.903T>A	c.(901-903)gcT>gcA	p.A301A	METTL17_ENST00000556670.2_Silent_p.A301A|METTL17_ENST00000382985.4_Silent_p.A301A|RP11-84C10.4_ENST00000557335.1_RNA	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	301					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						GAACAAAAGCTGGGCACAGCC	0.458																																					p.A301A		Atlas-SNP	.											.	METTL17	46	.	0			c.T903A						PASS	.						214.0	191.0	199.0					14																	21463350		2203	4300	6503	SO:0001819	synonymous_variant	64745	exon10			AAAAGCTGGGCAC	AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.903T>A	chr14.hg19:g.21463350T>A		110.0	0.0	.		131.0	40.0	.	NM_022734	Q9BSH1|Q9BZH2|Q9BZH3	Silent	SNP	ENST00000339374.6	hg19	CCDS9562.1																																																																																			.	.	.	none		0.458	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073804.4	NM_022734	
CHD8	57680	hgsc.bcm.edu	37	14	21868201	21868202	+	Missense_Mutation	DNP	AG	AG	TA			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr14:21868201_21868202AG>TA	ENST00000557364.1	-	25	5018_5019	c.4755_4756CT>TA	c.(4753-4758)taCTac>taTAac	p.Y1586N	SNORD8_ENST00000363915.1_RNA|CHD8_ENST00000555962.1_5'UTR|CHD8_ENST00000430710.3_Missense_Mutation_p.Y1307N|CHD8_ENST00000399982.2_Missense_Mutation_p.Y1586N			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1586					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TGCCTCAGGTAGTATAGCATTC	0.441																																					p.Y1586N|p.Y1585Y		Atlas-SNP	.											.	CHD8	339	.	0			c.T4756A|c.C4755T						PASS	.																																			SO:0001583	missense	57680	exon24			TCAGGTAGTATAG|CAGGTAGTATAGC	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.4755_4756delinsTA	chr14.hg19:g.21868201_21868202delinsTA	ENSP00000451601:p.Tyr1586Asn	127.0|126.0	0.0	.		126.0	36.0|35.0	.	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation|Silent	SNP	ENST00000557364.1	hg19	CCDS53885.1																																																																																			.	.	.	none		0.441	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
WDHD1	11169	hgsc.bcm.edu	37	14	55451547	55451547	+	Silent	SNP	T	T	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr14:55451547T>C	ENST00000360586.3	-	15	1865	c.1800A>G	c.(1798-1800)ggA>ggG	p.G600G	WDHD1_ENST00000359167.4_Silent_p.G118G|WDHD1_ENST00000420358.2_Silent_p.G477G|WDHD1_ENST00000421192.1_Silent_p.G477G	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	600					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						GCAGTTGAACTCCAAGGCACT	0.383																																					p.G600G		Atlas-SNP	.											.	WDHD1	82	.	0			c.A1800G						PASS	.						53.0	55.0	55.0					14																	55451547		2203	4300	6503	SO:0001819	synonymous_variant	11169	exon15			TTGAACTCCAAGG	AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.1800A>G	chr14.hg19:g.55451547T>C		479.0	0.0	.		491.0	166.0	.	NM_007086	C9JW18|F6W0U7	Silent	SNP	ENST00000360586.3	hg19	CCDS9721.1																																																																																			.	.	.	none		0.383	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276897.2	NM_007086	
VRTN	55237	hgsc.bcm.edu	37	14	74825395	74825395	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr14:74825395G>A	ENST00000256362.4	+	2	2150	c.1909G>A	c.(1909-1911)Gat>Aat	p.D637N		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	637					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						GGGTGGCAGGGATGGCCGGAT	0.642																																					p.D637N		Atlas-SNP	.											.	VRTN	79	.	0			c.G1909A						PASS	.						45.0	39.0	41.0					14																	74825395		2203	4300	6503	SO:0001583	missense	55237	exon2			GGCAGGGATGGCC	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.1909G>A	chr14.hg19:g.74825395G>A	ENSP00000256362:p.Asp637Asn	92.0	0.0	.		105.0	30.0	.	NM_018228	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	hg19	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	G	9.465	1.094217	0.20471	.	.	ENSG00000133980	ENST00000256362	T	0.49139	0.79	4.28	3.29	0.37713	.	0.386356	0.25156	U	0.032704	T	0.18341	0.0440	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17653	-1.0362	10	0.10902	T	0.67	-8.3907	3.9842	0.09507	0.2604:0.0:0.7396:0.0	.	637	Q9H8Y1	VRTN_HUMAN	N	637	ENSP00000256362:D637N	ENSP00000256362:D637N	D	+	1	0	VRTN	73895148	0.904000	0.30761	0.463000	0.27130	0.242000	0.25591	4.484000	0.60271	2.233000	0.73108	0.485000	0.47835	GAT	.	.	.	none		0.642	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
TJP1	7082	hgsc.bcm.edu	37	15	30001031	30001031	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr15:30001031T>C	ENST00000346128.6	-	25	5056	c.4582A>G	c.(4582-4584)Aca>Gca	p.T1528A	TJP1_ENST00000356107.6_Missense_Mutation_p.T1528A|TJP1_ENST00000400011.2_Missense_Mutation_p.T1452A|TJP1_ENST00000545208.2_Missense_Mutation_p.T1448A	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1528					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GGTTTTGGTGTGAATCGATTG	0.413																																					p.T1528A	Melanoma(77;681 1843 6309 6570)	Atlas-SNP	.											.	TJP1	140	.	0			c.A4582G						PASS	.						306.0	282.0	289.0					15																	30001031		1911	4145	6056	SO:0001583	missense	7082	exon25			TTGGTGTGAATCG		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.4582A>G	chr15.hg19:g.30001031T>C	ENSP00000281537:p.Thr1528Ala	130.0	0.0	.		127.0	7.0	.	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	hg19	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	T	13.72	2.321717	0.41096	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.47869	0.83;0.83	5.65	4.48	0.54585	.	0.158020	0.56097	D	0.000023	T	0.39759	0.1090	L	0.48362	1.52	0.80722	D	1	B;B;B;B	0.32350	0.366;0.264;0.025;0.264	B;B;B;B	0.31101	0.118;0.124;0.021;0.085	T	0.37150	-0.9718	10	0.48119	T	0.1	.	11.3701	0.49694	0.2304:0.0:0.0:0.7696	.	1521;1448;1528;1452	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	A	1528;1452;1528;1448;1448	ENSP00000281537:T1528A;ENSP00000382890:T1452A	ENSP00000281537:T1528A	T	-	1	0	TJP1	27788323	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.604000	0.54081	2.371000	0.80710	0.533000	0.62120	ACA	.	.	.	none		0.413	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
PRTG	283659	hgsc.bcm.edu	37	15	55930800	55930800	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr15:55930800T>C	ENST00000389286.4	-	14	2446	c.2399A>G	c.(2398-2400)gAt>gGt	p.D800G		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		GGAAAGCTGATCCACATGTAA	0.373																																					p.D800G		Atlas-SNP	.											.	PRTG	110	.	0			c.A2399G						PASS	.						65.0	63.0	64.0					15																	55930800		1854	4105	5959	SO:0001583	missense	283659	exon14			AGCTGATCCACAT	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.2399A>G	chr15.hg19:g.55930800T>C	ENSP00000373937:p.Asp800Gly	151.0	0.0	.		133.0	47.0	.	NM_173814		Missense_Mutation	SNP	ENST00000389286.4	hg19	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	T	13.27	2.185993	0.38609	.	.	ENSG00000166450	ENST00000389286	T	0.51817	0.69	4.99	3.84	0.44239	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.061925	0.64402	D	0.000008	T	0.28962	0.0719	N	0.16708	0.43	0.80722	D	1	B	0.19331	0.035	B	0.12837	0.008	T	0.04991	-1.0913	10	0.22109	T	0.4	-13.4313	10.3573	0.43972	0.0:0.0789:0.0:0.9211	.	800	Q2VWP7	PRTG_HUMAN	G	800	ENSP00000373937:D800G	ENSP00000373937:D800G	D	-	2	0	PRTG	53718092	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.882000	0.48546	0.822000	0.34565	0.477000	0.44152	GAT	.	.	.	none		0.373	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814	
CCNB2	9133	hgsc.bcm.edu	37	15	59417066	59417066	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr15:59417066G>A	ENST00000288207.2	+	9	1378	c.1187G>A	c.(1186-1188)gGa>gAa	p.G396E	CCNB2_ENST00000559622.1_Missense_Mutation_p.G268E|RP11-59H7.3_ENST00000559026.1_RNA	NM_004701.3	NP_004692.1	O95067	CCNB2_HUMAN	cyclin B2	396					G2/M transition of mitotic cell cycle (GO:0000086)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				kidney(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9						CCACTGATAGGAAGGTCCTAG	0.478																																					p.G396E		Atlas-SNP	.											.	CCNB2	23	.	0			c.G1187A						PASS	.						74.0	58.0	63.0					15																	59417066		2191	4291	6482	SO:0001583	missense	9133	exon9			TGATAGGAAGGTC	AF002822	CCDS10170.1	15q21.3	2004-01-19			ENSG00000157456	ENSG00000157456			1580	protein-coding gene	gene with protein product		602755					Standard	NM_004701		Approved	HsT17299	uc002afz.3	O95067	OTTHUMG00000132715	ENST00000288207.2:c.1187G>A	chr15.hg19:g.59417066G>A	ENSP00000288207:p.Gly396Glu	84.0	0.0	.		105.0	35.0	.	NM_004701	B3KM93|Q6FI99	Missense_Mutation	SNP	ENST00000288207.2	hg19	CCDS10170.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.125044	0.37533	.	.	ENSG00000157456	ENST00000288207	T	0.14516	2.5	5.85	1.77	0.24775	.	0.708046	0.14437	N	0.319603	T	0.11324	0.0276	L	0.40543	1.245	0.21719	N	0.999575	B;B	0.24258	0.1;0.1	B;B	0.21151	0.033;0.014	T	0.22068	-1.0227	10	0.49607	T	0.09	.	8.4873	0.33078	0.1126:0.2451:0.6423:0.0	.	396;396	Q53HG9;O95067	.;CCNB2_HUMAN	E	396	ENSP00000288207:G396E	ENSP00000288207:G396E	G	+	2	0	CCNB2	57204358	0.464000	0.25807	0.005000	0.12908	0.017000	0.09413	0.702000	0.25631	0.076000	0.16826	0.561000	0.74099	GGA	.	.	.	none		0.478	CCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256016.1	NM_004701	
HERC1	8925	hgsc.bcm.edu	37	15	64047449	64047449	+	Nonsense_Mutation	SNP	C	C	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr15:64047449C>A	ENST00000443617.2	-	6	1696	c.1609G>T	c.(1609-1611)Gaa>Taa	p.E537*		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	537					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						AAGTCTCCTTCACCCCATGTG	0.378																																					p.E537X		Atlas-SNP	.											.	HERC1	624	.	0			c.G1609T						PASS	.						93.0	83.0	86.0					15																	64047449		1913	4119	6032	SO:0001587	stop_gained	8925	exon6			CTCCTTCACCCCA	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.1609G>T	chr15.hg19:g.64047449C>A	ENSP00000390158:p.Glu537*	128.0	0.0	.		90.0	20.0	.	NM_003922	Q8IW65	Nonsense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	39	7.360880	0.98235	.	.	ENSG00000103657	ENST00000443617	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	20.0492	0.97617	0.0:1.0:0.0:0.0	.	.	.	.	X	537	.	ENSP00000390158:E537X	E	-	1	0	HERC1	61834502	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.836000	0.97738	0.655000	0.94253	GAA	.	.	.	none		0.378	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
EME2	197342	hgsc.bcm.edu	37	16	1823724	1823724	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr16:1823724G>A	ENST00000568449.1	+	2	287	c.266G>A	c.(265-267)gGt>gAt	p.G89D	MRPS34_ENST00000177742.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank|NME3_ENST00000563498.1_5'Flank|EME2_ENST00000307394.7_Missense_Mutation_p.G89D|NME3_ENST00000219302.3_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	89					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						GAAGACGCCGGTGCCGACGTC	0.751								Direct reversal of damage;Homologous recombination																													p.G89D		Atlas-SNP	.											.	EME2	40	.	0			c.G266A						PASS	.						6.0	4.0	4.0					16																	1823724		1756	3568	5324	SO:0001583	missense	197342	exon2			ACGCCGGTGCCGA	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.266G>A	chr16.hg19:g.1823724G>A	ENSP00000457353:p.Gly89Asp	160.0	0.0	.		263.0	121.0	.	NM_001257370	Q8TEP2|Q96RY3	Missense_Mutation	SNP	ENST00000568449.1	hg19	CCDS58404.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223506	0.58668	.	.	ENSG00000197774	ENST00000307394;ENST00000454910	T	0.25749	1.78	3.56	3.56	0.40772	ERCC4 domain (2);	0.000000	0.42294	U	0.000733	T	0.49236	0.1545	.	.	.	0.54753	D	0.999982	D	0.89917	1.0	D	0.77004	0.989	T	0.53236	-0.8467	9	0.48119	T	0.1	-9.3726	14.1144	0.65144	0.0:0.0:1.0:0.0	.	89	A4GXA9	EME2_HUMAN	D	89	ENSP00000303779:G89D	ENSP00000303779:G89D	G	+	2	0	EME2	1763725	1.000000	0.71417	0.013000	0.15412	0.808000	0.45660	4.916000	0.63362	1.707000	0.51288	0.306000	0.20318	GGT	.	.	.	none		0.751	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
GSPT1	2935	hgsc.bcm.edu	37	16	11980375	11980375	+	Silent	SNP	A	A	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr16:11980375A>G	ENST00000563468.1	-	7	818	c.792T>C	c.(790-792)ctT>ctC	p.L264L	GSPT1_ENST00000439887.2_Silent_p.L401L|GSPT1_ENST00000420576.2_Silent_p.L264L|RP11-166B2.8_ENST00000574364.1_RNA|GSPT1_ENST00000434724.2_Silent_p.L402L|GSPT1_ENST00000564790.1_5'UTR			P15170	ERF3A_HUMAN	G1 to S phase transition 1	264	G5. {ECO:0000255|PROSITE- ProRule:PRU01059}.|tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)			breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						TTGCTCCAGTAAGTCCTGAGC	0.353																																					p.L402L		Atlas-SNP	.											.	GSPT1	71	.	0			c.T1206C						PASS	.						84.0	82.0	83.0					16																	11980375		1956	4168	6124	SO:0001819	synonymous_variant	2935	exon9			TCCAGTAAGTCCT	BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000563468.1:c.792T>C	chr16.hg19:g.11980375A>G		199.0	0.0	.		244.0	55.0	.	NM_002094	J3KQG6|Q96GF2	Silent	SNP	ENST00000563468.1	hg19	CCDS45414.1																																																																																			.	.	.	none		0.353	GSPT1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421513.1	NM_002094	
ACSM2B	348158	hgsc.bcm.edu	37	16	20570646	20570646	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr16:20570646A>G	ENST00000329697.6	-	3	469	c.301T>C	c.(301-303)Tgt>Cgt	p.C101R	ACSM2B_ENST00000567001.1_Missense_Mutation_p.C101R|ACSM2B_ENST00000565232.1_Missense_Mutation_p.C101R|ACSM2B_ENST00000414188.2_Missense_Mutation_p.C101R|ACSM2B_ENST00000565322.1_Missense_Mutation_p.C22R	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	101					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						TGCAGGCCACAGGCTCCCGAG	0.577																																					p.C101R		Atlas-SNP	.											ACSM2B,NS,carcinoma,0,1	ACSM2B	121	.	0			c.T301C						PASS	.						42.0	33.0	36.0					16																	20570646		2201	4300	6501	SO:0001583	missense	348158	exon4			GGCCACAGGCTCC	AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.301T>C	chr16.hg19:g.20570646A>G	ENSP00000327453:p.Cys101Arg	130.0	0.0	.		150.0	81.0	.	NM_182617	Q86YT1	Missense_Mutation	SNP	ENST00000329697.6	hg19	CCDS10586.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.455754	0.26161	.	.	ENSG00000066813	ENST00000329697;ENST00000414188	T;T	0.45668	0.89;0.89	3.51	2.38	0.29361	AMP-dependent synthetase/ligase (1);	0.000000	0.48286	D	0.000188	T	0.55178	0.1904	M	0.64170	1.965	0.48511	D	0.999664	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.49123	-0.8972	10	0.39692	T	0.17	-4.6887	7.8708	0.29565	0.8022:0.0:0.0:0.1978	.	101;101	A8K051;Q68CK6	.;ACS2B_HUMAN	R	101	ENSP00000327453:C101R;ENSP00000390378:C101R	ENSP00000327453:C101R	C	-	1	0	ACSM2B	20478147	0.985000	0.35326	0.002000	0.10522	0.012000	0.07955	4.017000	0.57167	0.406000	0.25560	0.496000	0.49642	TGT	.	.	.	none		0.577	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254417.2	NM_182617	
EFNA2	1943	hgsc.bcm.edu	37	19	1299934	1299934	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr19:1299934T>C	ENST00000215368.2	+	4	647	c.632T>C	c.(631-633)cTg>cCg	p.L211P	MUM1_ENST00000344663.3_Intron	NM_001405.3	NP_001396.2	O43921	EFNA2_HUMAN	ephrin-A2	211					axon guidance (GO:0007411)|bone remodeling (GO:0046849)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|olfactory bulb development (GO:0021772)|osteoclast differentiation (GO:0030316)	anchored component of membrane (GO:0031225)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			lung(2)	2		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGACCCTCCTGGGTTCCTAG	0.711																																					p.L211P		Atlas-SNP	.											.	EFNA2	8	.	0			c.T632C						PASS	.						32.0	30.0	31.0					19																	1299934		2203	4298	6501	SO:0001583	missense	1943	exon4			CCCTCCTGGGTTC		CCDS12061.1	19p13	2011-03-09			ENSG00000099617	ENSG00000099617		"""Ephrins"""	3222	protein-coding gene	gene with protein product		602756		EPLG6			Standard	NM_001405		Approved	ELF-1, LERK6	uc002lry.2	O43921		ENST00000215368.2:c.632T>C	chr19.hg19:g.1299934T>C	ENSP00000215368:p.Leu211Pro	23.0	0.0	.		36.0	7.0	.	NM_001405	O76020	Missense_Mutation	SNP	ENST00000215368.2	hg19	CCDS12061.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.871424	0.33069	.	.	ENSG00000099617	ENST00000215368	D	0.92446	-3.04	3.41	3.41	0.39046	.	0.534302	0.14986	U	0.286944	D	0.84804	0.5553	N	0.19112	0.55	0.54753	D	0.999985	B	0.12013	0.005	B	0.08055	0.003	T	0.81782	-0.0775	10	0.87932	D	0	.	9.6252	0.39746	0.0:0.0:0.0:1.0	.	211	O43921	EFNA2_HUMAN	P	211	ENSP00000215368:L211P	ENSP00000215368:L211P	L	+	2	0	EFNA2	1250934	0.992000	0.36948	0.998000	0.56505	0.592000	0.36648	2.449000	0.44935	1.557000	0.49525	0.402000	0.26972	CTG	.	.	.	none		0.711	EFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450016.1	NM_001405	
MUC16	94025	hgsc.bcm.edu	37	19	9082415	9082415	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr19:9082415T>A	ENST00000397910.4	-	1	9603	c.9400A>T	c.(9400-9402)Aca>Tca	p.T3134S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3135	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTCTGGCTGTGGGTTCTGTG	0.488																																					p.T3134S		Atlas-SNP	.											.	MUC16	4315	.	0			c.A9400T						PASS	.						194.0	200.0	198.0					19																	9082415		1930	4144	6074	SO:0001583	missense	94025	exon1			TGGCTGTGGGTTC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.9400A>T	chr19.hg19:g.9082415T>A	ENSP00000381008:p.Thr3134Ser	164.0	0.0	.		197.0	67.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	3.734	-0.054959	0.07362	.	.	ENSG00000181143	ENST00000397910	T	0.02369	4.32	0.235	0.235	0.15431	.	.	.	.	.	T	0.03434	0.0099	N	0.08118	0	.	.	.	P	0.49696	0.927	P	0.56563	0.801	T	0.45614	-0.9249	7	0.87932	D	0	.	.	.	.	.	3134	B5ME49	.	S	3134	ENSP00000381008:T3134S	ENSP00000381008:T3134S	T	-	1	0	MUC16	8943415	0.032000	0.19561	0.024000	0.17045	0.224000	0.24922	1.084000	0.30828	0.263000	0.21812	0.260000	0.18958	ACA	.	.	.	none		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ARRDC2	27106	hgsc.bcm.edu	37	19	18121498	18121498	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr19:18121498T>G	ENST00000222250.4	+	7	1273	c.1130T>G	c.(1129-1131)aTc>aGc	p.I377S	ARRDC2_ENST00000379656.3_Missense_Mutation_p.I372S	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	377					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						TTCGCCTACATCCAAGAGTTC	0.647																																					p.I377S		Atlas-SNP	.											.	ARRDC2	60	.	0			c.T1130G						PASS	.						58.0	56.0	56.0					19																	18121498		2203	4300	6503	SO:0001583	missense	27106	exon7			CCTACATCCAAGA		CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		ENST00000222250.4:c.1130T>G	chr19.hg19:g.18121498T>G	ENSP00000222250:p.Ile377Ser	47.0	0.0	.		49.0	16.0	.	NM_015683	B2RBG9|O95895|Q6ZRV9|Q8WYG6	Missense_Mutation	SNP	ENST00000222250.4	hg19	CCDS12370.1	.	.	.	.	.	.	.	.	.	.	T	16.42	3.119026	0.56505	.	.	ENSG00000105643	ENST00000379656;ENST00000222250	T;T	0.16196	2.36;2.36	4.25	4.25	0.50352	.	0.228959	0.44483	D	0.000445	T	0.20861	0.0502	L	0.56199	1.76	0.47905	D	0.999549	B;B	0.32507	0.257;0.373	B;B	0.36666	0.115;0.23	T	0.04900	-1.0919	10	0.72032	D	0.01	-14.6862	12.8566	0.57888	0.0:0.0:0.0:1.0	.	377;372	Q8TBH0;Q8TBH0-2	ARRD2_HUMAN;.	S	372;377	ENSP00000368977:I372S;ENSP00000222250:I377S	ENSP00000222250:I377S	I	+	2	0	ARRDC2	17982498	1.000000	0.71417	0.855000	0.33649	0.157000	0.22087	7.845000	0.86875	1.715000	0.51383	0.402000	0.26972	ATC	.	.	.	none		0.647	ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466845.1	NM_015683	
CAPN12	147968	hgsc.bcm.edu	37	19	39224978	39224978	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr19:39224978T>C	ENST00000328867.4	-	16	2104	c.1796A>G	c.(1795-1797)cAg>cGg	p.Q599R	CAPN12_ENST00000601953.1_Missense_Mutation_p.Q450R	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	599	Domain IV.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CTGCAGCAGCTGCTCACAGGT	0.602																																					p.Q599R		Atlas-SNP	.											.	CAPN12	43	.	0			c.A1796G						PASS	.						68.0	64.0	65.0					19																	39224978		2200	4296	6496	SO:0001583	missense	147968	exon16			AGCAGCTGCTCAC	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1796A>G	chr19.hg19:g.39224978T>C	ENSP00000331636:p.Gln599Arg	80.0	0.0	.		96.0	35.0	.	NM_144691		Missense_Mutation	SNP	ENST00000328867.4	hg19	CCDS12519.1	.	.	.	.	.	.	.	.	.	.	T	11.22	1.574581	0.28092	.	.	ENSG00000182472	ENST00000328867	T	0.28255	1.62	4.92	3.86	0.44501	EF-hand-like domain (1);	0.628804	0.15984	N	0.235145	T	0.24736	0.0600	L	0.42245	1.32	0.32013	N	0.601756	B	0.25105	0.118	B	0.21917	0.037	T	0.19943	-1.0290	10	0.44086	T	0.13	.	7.5877	0.28002	0.1901:0.0:0.0:0.8098	.	599	Q6ZSI9	CAN12_HUMAN	R	599	ENSP00000331636:Q599R	ENSP00000331636:Q599R	Q	-	2	0	CAPN12	43916818	0.998000	0.40836	0.996000	0.52242	0.908000	0.53690	1.294000	0.33365	0.671000	0.31185	0.379000	0.24179	CAG	.	.	.	none		0.602	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
ZNF135	7694	hgsc.bcm.edu	37	19	58574844	58574844	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr19:58574844C>G	ENST00000313434.5	+	4	292	c.191C>G	c.(190-192)tCc>tGc	p.S64C	ZNF135_ENST00000359978.6_Missense_Mutation_p.S76C|ZNF135_ENST00000506786.1_Missense_Mutation_p.S22C|ZNF135_ENST00000511556.1_Missense_Mutation_p.S64C|ZNF135_ENST00000439855.2_Missense_Mutation_p.S64C|ZNF135_ENST00000401053.4_Missense_Mutation_p.S76C	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	64	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		AATGTCATCTCCCTGCTGGAG	0.582																																					p.S76C		Atlas-SNP	.											ZNF135_ENST00000401053,NS,malignant_melanoma,0,2	ZNF135	159	.	0			c.C227G						PASS	.						110.0	95.0	100.0					19																	58574844		2203	4300	6503	SO:0001583	missense	7694	exon3			TCATCTCCCTGCT	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.191C>G	chr19.hg19:g.58574844C>G	ENSP00000321406:p.Ser64Cys	99.0	0.0	.		90.0	28.0	.	NM_007134	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	ENST00000313434.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.26|12.26	1.884823|1.884823	0.33255|0.33255	.|.	.|.	ENSG00000176293|ENSG00000176293	ENST00000391699|ENST00000504540;ENST00000401053;ENST00000359978;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786	.|T;T;T;T;T;T	.|0.26223	.|1.75;1.75;1.75;1.75;1.75;1.75	2.25|2.25	-1.15|-1.15	0.09709|0.09709	.|Krueppel-associated box (3);	.|.	.|.	.|.	.|.	T|T	0.26412|0.26412	0.0645|0.0645	M|M	0.72353|0.72353	2.195|2.195	0.09310|0.09310	N|N	1|1	.|P;P;P	.|0.52463	.|0.859;0.859;0.953	.|B;B;B	.|0.44044	.|0.439;0.439;0.431	T|T	0.16778|0.16778	-1.0391|-1.0391	5|9	.|0.56958	.|D	.|0.05	.|.	5.0601|5.0601	0.14553|0.14553	0.0:0.5165:0.0:0.4835|0.0:0.5165:0.0:0.4835	.|.	.|64;64;76	.|E9PEV2;P52742;Q8N1I7	.|.;ZN135_HUMAN;.	A|C	70|76;76;76;64;64;64;22	.|ENSP00000441410:S76C;ENSP00000369437:S76C;ENSP00000444828:S64C;ENSP00000321406:S64C;ENSP00000422074:S64C;ENSP00000427691:S22C	.|ENSP00000321406:S64C	P|S	+|+	1|2	0|0	ZNF135|ZNF135	63266656|63266656	0.116000|0.116000	0.22171|0.22171	0.002000|0.002000	0.10522|0.10522	0.185000|0.185000	0.23345|0.23345	1.256000|1.256000	0.32921|0.32921	-0.176000|-0.176000	0.10707|0.10707	0.563000|0.563000	0.77884|0.77884	CCC|TCC	.	.	.	none		0.582	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
MYBL2	4605	hgsc.bcm.edu	37	20	42315498	42315498	+	Nonsense_Mutation	SNP	G	G	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr20:42315498G>T	ENST00000217026.4	+	5	413	c.286G>T	c.(286-288)Gag>Tag	p.E96*	MYBL2_ENST00000396863.4_Nonsense_Mutation_p.E72*	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	96	HTH myb-type 2. {ECO:0000255|PROSITE- ProRule:PRU00625}.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TAAGGTCATCGAGCTGGTTAA	0.587																																					p.E96X		Atlas-SNP	.											.	MYBL2	82	.	0			c.G286T						PASS	.						58.0	52.0	54.0					20																	42315498		2203	4300	6503	SO:0001587	stop_gained	4605	exon5			GTCATCGAGCTGG		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.286G>T	chr20.hg19:g.42315498G>T	ENSP00000217026:p.Glu96*	79.0	0.0	.		72.0	27.0	.	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Nonsense_Mutation	SNP	ENST00000217026.4	hg19	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	G	34	5.362811	0.95877	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-40.0646	18.2387	0.89958	0.0:0.0:1.0:0.0	.	.	.	.	X	72;96	.	ENSP00000217026:E96X	E	+	1	0	MYBL2	41748912	1.000000	0.71417	0.996000	0.52242	0.368000	0.29767	9.726000	0.98782	2.687000	0.91594	0.462000	0.41574	GAG	.	.	.	none		0.587	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
ZNF831	128611	hgsc.bcm.edu	37	20	57767884	57767884	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr20:57767884G>A	ENST00000371030.2	+	1	1810	c.1810G>A	c.(1810-1812)Ggc>Agc	p.G604S		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	604							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CAGAGCGGGCGGCAGGAAGTG	0.612																																					p.G604S		Atlas-SNP	.											.	ZNF831	287	.	0			c.G1810A						PASS	.						39.0	45.0	43.0					20																	57767884		2064	4194	6258	SO:0001583	missense	128611	exon1			GCGGGCGGCAGGA	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1810G>A	chr20.hg19:g.57767884G>A	ENSP00000360069:p.Gly604Ser	195.0	0.0	.		168.0	59.0	.	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	hg19	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	4.418	0.077213	0.08485	.	.	ENSG00000124203	ENST00000371030	T	0.04275	3.66	5.52	-6.39	0.01951	.	1.361980	0.05276	N	0.518429	T	0.01730	0.0055	N	0.01576	-0.805	0.09310	N	1	B	0.25312	0.123	B	0.12837	0.008	T	0.47459	-0.9116	10	0.05620	T	0.96	1.2211	15.2673	0.73672	0.7034:0.0:0.2966:0.0	.	604	Q5JPB2	ZN831_HUMAN	S	604	ENSP00000360069:G604S	ENSP00000360069:G604S	G	+	1	0	ZNF831	57201279	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.216000	0.09266	-1.592000	0.01619	-1.074000	0.02243	GGC	.	.	.	none		0.612	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
AR	367	hgsc.bcm.edu	37	X	66765164	66765164	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chrX:66765164A>T	ENST00000374690.3	+	1	700	c.176A>T	c.(175-177)cAg>cTg	p.Q59L	AR_ENST00000504326.1_Missense_Mutation_p.Q59L|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q59L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	59	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTGCTgcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q59L		Atlas-SNP	.											.	AR	249	.	0			c.A176T						PASS	.						7.0	10.0	9.0					X																	66765164		2055	4063	6118	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	TGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.176A>T	chrX.hg19:g.66765164A>T	ENSP00000363822:p.Gln59Leu	56.0	0.0	.		119.0	6.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	12.32	1.901651	0.33535	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.69175	-0.38;-0.38;-0.38	.	.	.	.	1.117170	0.06949	N	0.814177	T	0.47060	0.1425	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.34313	0.448;0.448	B;B	0.36534	0.227;0.227	T	0.31724	-0.9933	8	0.13108	T	0.6	.	.	.	.	.	59;59	E7EVX6;D3YPQ2	.;.	L	59	ENSP00000363822:Q59L;ENSP00000421155:Q59L;ENSP00000379359:Q59L	ENSP00000363822:Q59L	Q	+	2	0	AR	66681889	0.995000	0.38212	0.864000	0.33941	0.503000	0.33858	0.245000	0.18142	0.000000	0.14550	0.000000	0.15137	CAG	.	.	.	none		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
AR	367	hgsc.bcm.edu	37	X	66765167	66765167	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chrX:66765167A>T	ENST00000374690.3	+	1	703	c.179A>T	c.(178-180)cAg>cTg	p.Q60L	AR_ENST00000504326.1_Missense_Mutation_p.Q60L|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q60L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	60	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTgcagcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q60L		Atlas-SNP	.											.	AR	249	.	0			c.A179T	GRCh37	CI994028	AR	I		PASS	.						6.0	9.0	8.0					X																	66765167		1971	3901	5872	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.179A>T	chrX.hg19:g.66765167A>T	ENSP00000363822:p.Gln60Leu	52.0	0.0	.		118.0	13.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.27	1.588228	0.28357	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.57436	0.4;0.4;0.4	.	.	.	.	1.241110	0.06210	N	0.684797	T	0.29288	0.0729	N	0.19112	0.55	0.09310	N	0.999999	P;P;.	0.36048	0.534;0.534;.	B;B;.	0.29862	0.08;0.108;.	T	0.11494	-1.0585	8	0.12103	T	0.63	.	.	.	.	.	60;60;58	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	60	ENSP00000363822:Q60L;ENSP00000421155:Q60L;ENSP00000379359:Q60L	ENSP00000363822:Q60L	Q	+	2	0	AR	66681892	0.997000	0.39634	0.860000	0.33809	0.513000	0.34164	1.220000	0.32491	0.000000	0.14550	0.000000	0.15137	CAG	.	.	.	none		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
STK26	51765	hgsc.bcm.edu	37	X	131207118	131207118	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chrX:131207118A>C	ENST00000354719.6	+	10	1367	c.1151A>C	c.(1150-1152)cAa>cCa	p.Q384P	MST4_ENST00000394334.2_Missense_Mutation_p.Q408P|MST4_ENST00000496850.1_Missense_Mutation_p.Q346P|MST4_ENST00000481105.1_Missense_Mutation_p.Q430P|MST4_ENST00000394335.2_Missense_Mutation_p.Q331P																endometrium(2)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(192;0.000127)					GAAAAATTTCAAAAGTAAGTT	0.328																																					p.Q408P		Atlas-SNP	.											.	MST4	61	.	0			c.A1223C						PASS	.						46.0	51.0	49.0					X																	131207118		2162	4248	6410	SO:0001583	missense	0	exon11			AATTTCAAAAGTA																												ENST00000354719.6:c.1151A>C	chrX.hg19:g.131207118A>C	ENSP00000346755:p.Gln384Pro	317.0	1.0	.		279.0	162.0	.	NM_016542		Missense_Mutation	SNP	ENST00000354719.6	hg19		.	.	.	.	.	.	.	.	.	.	a	16.71	3.199273	0.58126	.	.	ENSG00000134602	ENST00000394334;ENST00000481105;ENST00000354719;ENST00000394335;ENST00000496850	T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000008	T	0.60971	0.2310	M	0.80422	2.495	0.47949	D	0.999553	D;P;D;D;P	0.64830	0.967;0.91;0.994;0.98;0.91	P;P;D;P;P	0.65443	0.737;0.616;0.935;0.907;0.616	T	0.66838	-0.5822	10	0.72032	D	0.01	.	14.6026	0.68450	1.0:0.0:0.0:0.0	.	430;384;346;331;408	B4E0Y9;Q8NBY1;Q9P289-3;Q9P289-2;Q9P289	.;.;.;.;MST4_HUMAN	P	408;430;384;331;346	ENSP00000377867:Q408P;ENSP00000418753:Q430P;ENSP00000346755:Q384P;ENSP00000377868:Q331P;ENSP00000419702:Q346P	ENSP00000346755:Q384P	Q	+	2	0	AL109749.1	131034799	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	6.933000	0.75874	1.829000	0.53265	0.422000	0.28245	CAA	.	.	.	none		0.328	MST4-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000058308.2		
MT-CO3	4514	hgsc.bcm.edu	37	M	9301	9301	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chrM:9301C>A	ENST00000362079.2	+	1	95	c.95C>A	c.(94-96)gCc>gAc	p.A32D	MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	32					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						CTCCGGCCTAGCCATGTGATT	0.493																																					p.A32D		Atlas-SNP	.											.	.	.	.	0			c.C95A						PASS	.																																			SO:0001583	missense	5742	exon1			GCCTAGCCATGTG			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.95C>A	chrM.hg19:g.9301C>A	ENSP00000354982:p.Ala32Asp	21.0	0.0	.		232.0	13.0	.	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	G|1.000;|0.000	.	alt		0.493	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
NPBWR2	2832	hgsc.bcm.edu	37	20	62737462	62737473	+	In_Frame_Del	DEL	GGCCCGCAGCCT	GGCCCGCAGCCT	-	rs201687254|rs139565347|rs147787913	byFrequency	TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	GGCCCGCAGCCT	GGCCCGCAGCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr20:62737462_62737473delGGCCCGCAGCCT	ENST00000369768.1	-	1	1051_1062	c.712_723delAGGCTGCGGGCC	c.(712-723)aggctgcgggccdel	p.RLRA238del		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	238					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					GGAGCCGCACGGCCCGCAGCCTGCGCAGGAGG	0.665																																					p.238_242del		Atlas-Indel,Pindel	.											.	NPBWR2	36	.	0			c.713_724del						PASS	.																																			SO:0001651	inframe_deletion	2832	exon1			.	U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.712_723delAGGCTGCGGGCC	chr20.hg19:g.62737462_62737473delGGCCCGCAGCCT	ENSP00000358783:p.Arg238_Ala241del	57.0	0.0	0		65.0	14.0	0.215385	NM_005286	Q6NWQ6|Q9H4K3	In_Frame_Del	DEL	ENST00000369768.1	hg19	CCDS13557.1																																																																																			.	.	.	none		0.665	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080300.1	NM_005286	
STAB1	23166	hgsc.bcm.edu	37	3	52539392	52539395	+	Frame_Shift_Del	DEL	CTGG	CTGG	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	CTGG	CTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr3:52539392_52539395delCTGG	ENST00000321725.6	+	14	1652_1655	c.1576_1579delCTGG	c.(1576-1581)ctggagfs	p.LE526fs		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	526	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TGAAACCATCCTGGAGGTAAGCTC	0.593																																					p.525_526del		Atlas-INDEL	.											.	STAB1	178	.	0			c.1575_1578del						PASS	.																																			SO:0001589	frameshift_variant	23166	exon14			.	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.1576_1579delCTGG	chr3.hg19:g.52539392_52539395delCTGG	ENSP00000312946:p.Leu526fs	174.0	0.0	0		157.0	31.0	0.197452	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Frame_Shift_Del	DEL	ENST00000321725.6	hg19	CCDS33768.1																																																																																			.	.	.	none		0.593	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
GLB1L3	112937	hgsc.bcm.edu	37	11	134147653	134147653	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr11:134147653delC	ENST00000431683.2	+	3	209	c.209delC	c.(208-210)actfs	p.T70fs	GLB1L3_ENST00000389887.5_Frame_Shift_Del_p.T70fs	NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	70					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		GGACTTGGAACTGAAAGCACA	0.567																																					p.T70fs		Atlas-Indel,Pindel	.											.	GLB1L3	102	.	0			c.208delA						PASS	.						38.0	43.0	41.0					11																	134147653		2196	4296	6492	SO:0001589	frameshift_variant	112937	exon3			.		CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.209delC	chr11.hg19:g.134147653delC	ENSP00000396615:p.Thr70fs	126.0	0.0	0		139.0	52.0	0.374101	NM_001080407	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Frame_Shift_Del	DEL	ENST00000431683.2	hg19	CCDS44780.1																																																																																			.	.	.	none		0.567	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393625.1	NM_138416	
NR3C1	2908	hgsc.bcm.edu	37	5	142675051	142675052	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr5:142675051_142675052delAT	ENST00000343796.2	-	7	2989_2990	c.1996_1997delAT	c.(1996-1998)atgfs	p.M666fs	NR3C1_ENST00000504572.1_Frame_Shift_Del_p.M667fs|NR3C1_ENST00000231509.3_Frame_Shift_Del_p.M667fs|NR3C1_ENST00000415690.2_Frame_Shift_Del_p.M666fs|NR3C1_ENST00000503201.1_Frame_Shift_Del_p.M666fs|NR3C1_ENST00000394466.2_Frame_Shift_Del_p.M667fs|NR3C1_ENST00000424646.2_Frame_Shift_Del_p.M640fs|NR3C1_ENST00000394464.2_Frame_Shift_Del_p.M666fs|NR3C1_ENST00000416954.2_Frame_Shift_Del_p.M269fs	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	666	Interaction with CLOCK.|Interaction with CRY1.|Steroid-binding.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	TAAGGTTTTCATACAGAGATAC	0.381																																					p.667_667del		Atlas-Indel,Pindel	.											.	NR3C1	124	.	0			c.2000_2001del						PASS	.																																			SO:0001589	frameshift_variant	2908	exon7			.	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.1996_1997delAT	chr5.hg19:g.142675051_142675052delAT	ENSP00000343205:p.Met666fs	70.0	0.0	0		79.0	30.0	0.379747	NM_001024094	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Frame_Shift_Del	DEL	ENST00000343796.2	hg19	CCDS4278.1																																																																																			.	.	.	none		0.381	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1		
VPS13C	54832	hgsc.bcm.edu	37	15	62221902	62221902	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr15:62221902delA	ENST00000261517.5	-	51	6157	c.6084delT	c.(6082-6084)attfs	p.I2028fs	VPS13C_ENST00000395896.4_Frame_Shift_Del_p.I2028fs|VPS13C_ENST00000395898.3_Frame_Shift_Del_p.I1985fs|VPS13C_ENST00000249837.3_Frame_Shift_Del_p.I1985fs	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						AACTTATATCAATCATAGAAC	0.313																																					p.D2029fs		Atlas-Indel,Pindel	.											.	VPS13C	506	.	0			c.6085delG						PASS	.						166.0	143.0	151.0					15																	62221902		2203	4300	6503	SO:0001589	frameshift_variant	54832	exon51			.	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.6084delT	chr15.hg19:g.62221902delA	ENSP00000261517:p.Ile2028fs	84.0	0.0	0		91.0	33.0	0.362637	NM_020821		Frame_Shift_Del	DEL	ENST00000261517.5	hg19	CCDS32257.1																																																																																			.	.	.	none		0.313	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
LPL	4023	hgsc.bcm.edu	37	8	19809403	19809405	+	In_Frame_Del	DEL	GCG	GCG	-	rs199675233		TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	GCG	GCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr8:19809403_19809405delGCG	ENST00000311322.8	+	3	843_845	c.373_375delGCG	c.(373-375)gcgdel	p.A125del		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	125					chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)	p.A125T(1)|p.A125A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	CCCAGTGTCCGCGGGCTACACCA	0.532																																					p.124_125del		Atlas-Indel,Pindel	.											.	LPL	78	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)|prostate(1)	c.372_374del	GRCh37	HM971397	LPL	M		PASS	.																																			SO:0001651	inframe_deletion	4023	exon3			.		CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.373_375delGCG	chr8.hg19:g.19809403_19809405delGCG	ENSP00000309757:p.Ala125del	143.0	0.0	0		159.0	52.0	0.327044	NM_000237	B2R5T9|Q16282|Q16283|Q96FC4	In_Frame_Del	DEL	ENST00000311322.8	hg19	CCDS6012.1																																																																																			.	.	.	none		0.532	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089113.3		
TEFM	79736	hgsc.bcm.edu	37	17	29226569	29226570	+	Frame_Shift_Ins	INS	-	-	T			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr17:29226569_29226570insT	ENST00000581216.1	-	4	1321_1322	c.700_701insA	c.(700-702)acafs	p.T234fs	TEFM_ENST00000580840.1_3'UTR|TEFM_ENST00000579183.1_5'Flank	NM_024683.3	NP_078959.3	Q96QE5	TEFM_HUMAN	transcription elongation factor, mitochondrial	234					DNA metabolic process (GO:0006259)|oxidative phosphorylation (GO:0006119)|regulation of transcription, DNA-templated (GO:0006355)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	DNA polymerase processivity factor activity (GO:0030337)|poly(A) RNA binding (GO:0044822)										GGAAAGTCCTGTTTTTTCCAGA	0.317																																					p.T234fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.701_702insA						PASS	.																																			SO:0001589	frameshift_variant	79736	exon4			.		CCDS42291.1	17q11.2	2011-12-12	2011-12-12	2011-12-12	ENSG00000172171	ENSG00000172171			26223	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 42"""	C17orf42		11468690, 10843809, 21278163	Standard	NM_024683		Approved	FLJ22729	uc002hfu.2	Q96QE5		ENST00000581216.1:c.701dupA	chr17.hg19:g.29226575_29226575dupT	ENSP00000462963:p.Thr234fs	186.0	0.0	0		192.0	56.0	0.291667	NM_024683	E1P655|Q6GPG5|Q6PJ19|Q96H04|Q9H5Z9	Frame_Shift_Ins	INS	ENST00000581216.1	hg19	CCDS42291.1																																																																																			.	.	.	none		0.317	TEFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444498.1	NM_024683	
STAB1	23166	hgsc.bcm.edu	37	3	52539397	52539397	+	Splice_Site	DEL	G	G	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr3:52539397delG	ENST00000321725.6	+	14	1657	c.1581delG	c.(1579-1581)gag>ga	p.E527fs		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	527	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCATCCTGGAGGTAAGCTCGG	0.587																																					p.E527fs		Atlas-INDEL	.											.	STAB1	178	.	0			c.1580delA						PASS	.						36.0	38.0	37.0					3																	52539397		2202	4300	6502	SO:0001630	splice_region_variant	23166	exon14			.	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.1581+1G>-	chr3.hg19:g.52539397delG		171.0	0.0	0		151.0	31.0	0.205298	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Frame_Shift_Del	DEL	ENST00000321725.6	hg19	CCDS33768.1																																																																																			.	.	.	none		0.587	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	Frame_Shift_Del
AHCTF1	25909	hgsc.bcm.edu	37	1	247070993	247070993	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr1:247070993delC	ENST00000391829.2	-	5	747	c.624delG	c.(622-624)gggfs	p.G208fs	AHCTF1_ENST00000366508.1_Frame_Shift_Del_p.G243fs|AHCTF1_ENST00000326225.3_Frame_Shift_Del_p.G217fs			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	208	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ACAGATGGCGCCCTTGTCTCA	0.388																																					p.R218fs	Colon(145;197 1800 4745 15099 26333)	Atlas-Indel,Pindel	.											AHCTF1,colon,carcinoma,0,1	AHCTF1	187	.	0			c.652delC						PASS	.						134.0	126.0	129.0					1																	247070993		2203	4300	6503	SO:0001589	frameshift_variant	25909	exon5			.		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.624delG	chr1.hg19:g.247070993delC	ENSP00000375705:p.Gly208fs	231.0	0.0	0		229.0	55.0	0.240175	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Frame_Shift_Del	DEL	ENST00000391829.2	hg19																																																																																				.	.	.	none		0.388	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
NOS2	4843	hgsc.bcm.edu	37	17	26099337	26099346	+	Frame_Shift_Del	DEL	GGGGTTGAAG	GGGGTTGAAG	-	rs531708405		TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	GGGGTTGAAG	GGGGTTGAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr17:26099337_26099346delGGGGTTGAAG	ENST00000313735.6	-	14	1925_1934	c.1692_1701delCTTCAACCCC	c.(1690-1701)gccttcaaccccfs	p.AFNP564fs		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	564	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CCAGTACCTTGGGGTTGAAGGCACAGCTGA	0.538																																					p.565_568del		Atlas-Indel,Pindel	.											.	NOS2	113	.	0			c.1693_1702del						PASS	.																																			SO:0001589	frameshift_variant	4843	exon14			.	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1692_1701delCTTCAACCCC	chr17.hg19:g.26099337_26099346delGGGGTTGAAG	ENSP00000327251:p.Ala564fs	81.0	0.0	0		85.0	10.0	0.117647	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Frame_Shift_Del	DEL	ENST00000313735.6	hg19	CCDS11223.1																																																																																			.	.	.	none		0.538	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
PAN2	9924	hgsc.bcm.edu	37	12	56722345	56722360	+	Frame_Shift_Del	DEL	CTGCCGAATATCATCA	CTGCCGAATATCATCA	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	CTGCCGAATATCATCA	CTGCCGAATATCATCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr12:56722345_56722360delCTGCCGAATATCATCA	ENST00000425394.2	-	3	724_739	c.348_363delTGATGATATTCGGCAG	c.(346-363)agtgatgatattcggcagfs	p.SDDIRQ116fs	PAN2_ENST00000440411.3_Frame_Shift_Del_p.SDDIRQ116fs|PAN2_ENST00000548043.1_Frame_Shift_Del_p.SDDIRQ116fs|PAN2_ENST00000257931.5_Frame_Shift_Del_p.SDDIRQ116fs	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	GGCTCTGGATCTGCCGAATATCATCACTGCCATTGA	0.463																																					p.117_122del		Atlas-Indel,Pindel	.											.	PAN2	107	.	0			c.349_364del						PASS	.																																			SO:0001589	frameshift_variant	9924	exon3			.	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.348_363delTGATGATATTCGGCAG	chr12.hg19:g.56722345_56722360delCTGCCGAATATCATCA	ENSP00000401721:p.Ser116fs	86.0	0.0	0		97.0	17.0	0.175258	NM_001127460		Frame_Shift_Del	DEL	ENST00000425394.2	hg19	CCDS44922.1																																																																																			.	.	.	none		0.463	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
STK26	51765	hgsc.bcm.edu	37	X	131207114	131207114	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chrX:131207114delT	ENST00000354719.6	+	10	1363	c.1147delT	c.(1147-1149)tttfs	p.F383fs	MST4_ENST00000394334.2_Frame_Shift_Del_p.F407fs|MST4_ENST00000496850.1_Frame_Shift_Del_p.F345fs|MST4_ENST00000481105.1_Frame_Shift_Del_p.F429fs|MST4_ENST00000394335.2_Frame_Shift_Del_p.F330fs														p.F407I(1)		endometrium(2)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(192;0.000127)					AATTGAAAAATTTCAAAAGTA	0.343																																					p.K406fs		Atlas-Indel,Pindel	.											.	MST4	61	.	1	Substitution - Missense(1)	prostate(1)	c.1218delA						PASS	.						48.0	53.0	51.0					X																	131207114		2169	4256	6425	SO:0001589	frameshift_variant	0	exon11			.																												ENST00000354719.6:c.1147delT	chrX.hg19:g.131207114delT	ENSP00000346755:p.Phe383fs	326.0	0.0	0		290.0	160.0	0.551724	NM_016542		Frame_Shift_Del	DEL	ENST00000354719.6	hg19																																																																																				.	.	.	none		0.343	MST4-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000058308.2		
MAN2A1	4124	hgsc.bcm.edu	37	5	109183439	109183439	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr5:109183439delT	ENST00000261483.4	+	19	3976	c.2924delT	c.(2923-2925)attfs	p.I975fs		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	975					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		GATAACAAGATTACAGCTAAT	0.348																																					p.I975fs		Atlas-Indel,Pindel	.											.	MAN2A1	136	.	0			c.2923delA						PASS	.						107.0	101.0	103.0					5																	109183439		2200	4299	6499	SO:0001589	frameshift_variant	4124	exon19			.		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.2924delT	chr5.hg19:g.109183439delT	ENSP00000261483:p.Ile975fs	96.0	0.0	0		74.0	28.0	0.378378	NM_002372	Q16767	Frame_Shift_Del	DEL	ENST00000261483.4	hg19	CCDS34209.1																																																																																			.	.	.	none		0.348	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
ALKBH5	54890	hgsc.bcm.edu	37	17	18087657	18087680	+	In_Frame_Del	DEL	GCCGCAGCCGCCGTAGCCGCCGCA	GCCGCAGCCGCCGTAGCCGCCGCA	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	GCCGCAGCCGCCGTAGCCGCCGCA	GCCGCAGCCGCCGTAGCCGCCGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr17:18087657_18087680delGCCGCAGCCGCCGTAGCCGCCGCA	ENST00000399138.4	+	1	105_128	c.100_123delGCCGCAGCCGCCGTAGCCGCCGCA	c.(100-123)gccgcagccgccgtagccgccgcadel	p.AAAAVAAA34del	ALKBH5_ENST00000541285.1_Intron|RP11-258F1.1_ENST00000583062.1_RNA|RP11-258F1.1_ENST00000577847.1_RNA	NM_017758.3	NP_060228.3	Q6P6C2	ALKB5_HUMAN	AlkB family member 5, RNA demethylase	34	Ala-rich.				cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|oxidative single-stranded RNA demethylation (GO:0035553)|response to hypoxia (GO:0001666)|spermatogenesis (GO:0007283)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidative RNA demethylase activity (GO:0035515)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|skin(1)	10	all_neural(463;0.228)					cgccgccgctgccgcagccgccgtagccgccgcagccgcagccg	0.705																																					p.33_41del	Ovarian(166;154 1953 40235 46283 46309)	Pindel	.											.	ALKBH5	24	.	0			c.99_122del						PASS	.																																			SO:0001651	inframe_deletion	54890	exon1			.	AK000315	CCDS42272.1	17p11.2	2014-07-23	2014-07-23	2006-02-09	ENSG00000091542	ENSG00000091542	1.14.11.-	"""Alkylation repair homologs"""	25996	protein-coding gene	gene with protein product		613303	"""oxoglutarate and iron-dependent oxygenase domain containing"", ""alkB, alkylation repair homolog 5 (E. coli)"""	OFOXD1		11997338, 24778178	Standard	NM_017758		Approved	FLJ20308	uc010cpw.3	Q6P6C2	OTTHUMG00000059397	ENST00000399138.4:c.100_123delGCCGCAGCCGCCGTAGCCGCCGCA	chr17.hg19:g.18087657_18087680delGCCGCAGCCGCCGTAGCCGCCGCA	ENSP00000382091:p.Ala34_Ala41del	57.0	0.0	.		53.0	10.0	0.189	NM_017758	B4DVJ4|D3DXC6|Q9NXD6	In_Frame_Del	DEL	ENST00000399138.4	hg19	CCDS42272.1																																																																																			.	.	.	none		0.705	ALKBH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132069.3	NM_017758	
STAB1	23166	hgsc.bcm.edu	37	3	52539392	52539397	+	Splice_Site	DEL	CTGGAG	CTGGAG	-			TCGA-5P-A9JW-01A-11D-A42J-10	TCGA-5P-A9JW-10A-01D-A42M-10	CTGGAG	CTGGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	82cf23e0-e687-4cf2-b83f-732ce4279056	d59804af-3375-4351-a1ef-125b05396a6f	g.chr3:52539392_52539397delCTGGAG	ENST00000321725.6	+	14	1652_1657	c.1576_1581delCTGGAG	c.(1576-1581)ctggagdel	p.LE526del		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	526	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TGAAACCATCCTGGAGGTAAGCTCGG	0.587																																					p.525_527del		Pindel	.											.	STAB1	178	.	0			c.1575_1580del						PASS	.																																			SO:0001630	splice_region_variant	23166	exon14			.	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.1581+1CTGGAG>-	chr3.hg19:g.52539392_52539397delCTGGAG		175.0	0.0	.		157.0	27.0	0.172	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	In_Frame_Del	DEL	ENST00000321725.6	hg19	CCDS33768.1																																																																																			.	.	.	none		0.587	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	In_Frame_Del
