#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF18	8784	hgsc.bcm.edu	37	1	1141898	1141898	+	Silent	SNP	C	C	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:1141898C>A	ENST00000379268.2	-	1	173	c.54G>T	c.(52-54)ctG>ctT	p.L18L	TNFRSF18_ENST00000328596.6_Silent_p.L18L|TNFRSF18_ENST00000379265.5_Silent_p.L18L|TNFRSF18_ENST00000486728.1_5'Flank	NM_004195.2|NM_148902.1	NP_004186.1|NP_683700.1	Q9Y5U5	TNR18_HUMAN	tumor necrosis factor receptor superfamily, member 18	18					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			lung(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GCGCGCACAGCAGCGCCAGGC	0.751																																					p.L18L	GBM(157;472 1934 13810 14591 35952)	Atlas-SNP	.											.	TNFRSF18	13	.	0			c.G54T						PASS	.						3.0	4.0	4.0					1																	1141898		1947	3834	5781	SO:0001819	synonymous_variant	8784	exon1			GCACAGCAGCGCC	AF125304	CCDS9.1, CCDS10.1, CCDS30552.1	1p36.3	2011-08-11			ENSG00000186891	ENSG00000186891		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11914	protein-coding gene	gene with protein product		603905				9177197, 10037686	Standard	NM_004195		Approved	AITR, GITR, CD357	uc001add.3	Q9Y5U5	OTTHUMG00000001414	ENST00000379268.2:c.54G>T	chr1.hg19:g.1141898C>A		106.0	0.0	.		98.0	48.0	.	NM_148902	B1AME1|O95851|Q5U0I4|Q9NYJ9	Silent	SNP	ENST00000379268.2	hg19	CCDS10.1																																																																																			.	.	.	none		0.751	TNFRSF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004083.2	NM_004195	
PTCHD2	57540	hgsc.bcm.edu	37	1	11562062	11562062	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:11562062C>T	ENST00000294484.6	+	2	1151	c.1013C>T	c.(1012-1014)tCg>tTg	p.S338L	PTCHD2_ENST00000389575.3_Missense_Mutation_p.S338L	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	338					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CCCCCCAGCTCGCTCATGACC	0.637																																					p.S338L		Atlas-SNP	.											.	PTCHD2	193	.	0			c.C1013T						PASS	.						36.0	40.0	39.0					1																	11562062		1956	4121	6077	SO:0001583	missense	57540	exon2			CCAGCTCGCTCAT	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1013C>T	chr1.hg19:g.11562062C>T	ENSP00000294484:p.Ser338Leu	133.0	0.0	.		102.0	45.0	.	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	hg19	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987294	0.93106	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	T;T	0.57752	0.38;0.38	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.63593	0.2524	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.66779	-0.5837	10	0.72032	D	0.01	-14.5988	18.2403	0.89966	0.0:1.0:0.0:0.0	.	338	Q9P2K9	PTHD2_HUMAN	L	338	ENSP00000294484:S338L;ENSP00000374226:S338L	ENSP00000294484:S338L	S	+	2	0	PTCHD2	11484649	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.494000	0.81503	2.542000	0.85734	0.655000	0.94253	TCG	.	.	.	none		0.637	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
PTCHD2	57540	hgsc.bcm.edu	37	1	11585336	11585336	+	Silent	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:11585336G>T	ENST00000294484.6	+	12	2718	c.2580G>T	c.(2578-2580)gtG>gtT	p.V860V	PTCHD2_ENST00000389575.3_Silent_p.V860V	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	860					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GGCAGGCTGTGTCGCCTGGGG	0.637																																					p.V860V		Atlas-SNP	.											.	PTCHD2	193	.	0			c.G2580T						PASS	.						75.0	76.0	75.0					1																	11585336		2021	4177	6198	SO:0001819	synonymous_variant	57540	exon12			GGCTGTGTCGCCT	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2580G>T	chr1.hg19:g.11585336G>T		95.0	0.0	.		84.0	30.0	.	NM_020780	Q5VTU9|Q9UJD6	Silent	SNP	ENST00000294484.6	hg19	CCDS41247.1																																																																																			.	.	.	none		0.637	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
VPS13D	55187	hgsc.bcm.edu	37	1	12318000	12318000	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:12318000A>T	ENST00000358136.3	+	10	1080	c.950A>T	c.(949-951)gAa>gTa	p.E317V	VPS13D_ENST00000356315.4_Missense_Mutation_p.E317V	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AGCTGCCGAGAATGGTGGTAT	0.448																																					p.E317V		Atlas-SNP	.											.	VPS13D	316	.	0			c.A950T						PASS	.						221.0	205.0	210.0					1																	12318000		2203	4300	6503	SO:0001583	missense	55187	exon10			GCCGAGAATGGTG	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.950A>T	chr1.hg19:g.12318000A>T	ENSP00000350854:p.Glu317Val	110.0	0.0	.		82.0	32.0	.	NM_015378		Missense_Mutation	SNP	ENST00000358136.3	hg19	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	A	16.77	3.214047	0.58452	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.48201	0.82;0.82	5.54	5.54	0.83059	.	0.053588	0.64402	D	0.000001	T	0.40595	0.1123	L	0.48642	1.525	0.80722	D	1	P;P	0.40731	0.655;0.728	B;B	0.35114	0.194;0.196	T	0.30995	-0.9959	10	0.34782	T	0.22	.	15.1606	0.72782	1.0:0.0:0.0:0.0	.	317;317	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	V	317	ENSP00000348666:E317V;ENSP00000350854:E317V	ENSP00000348666:E317V	E	+	2	0	VPS13D	12240587	0.997000	0.39634	0.969000	0.41365	0.948000	0.59901	3.680000	0.54641	2.230000	0.72887	0.528000	0.53228	GAA	.	.	.	none		0.448	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
MAP3K6	9064	hgsc.bcm.edu	37	1	27685320	27685320	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:27685320C>A	ENST00000493901.1	-	20	2702	c.2463G>T	c.(2461-2463)caG>caT	p.Q821H	MAP3K6_ENST00000374040.3_Missense_Mutation_p.Q813H|MAP3K6_ENST00000357582.2_Missense_Mutation_p.Q821H	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	821	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CGCGTGGGCCCTGGTCAATGA	0.587																																					p.Q821H		Atlas-SNP	.											.	MAP3K6	134	.	0			c.G2463T						PASS	.						82.0	74.0	77.0					1																	27685320		2203	4300	6503	SO:0001583	missense	9064	exon19			TGGGCCCTGGTCA	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.2463G>T	chr1.hg19:g.27685320C>A	ENSP00000419591:p.Gln821His	73.0	0.0	.		69.0	33.0	.	NM_004672	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	ENST00000493901.1	hg19	CCDS299.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.31|18.31	3.596728|3.596728	0.66332|0.66332	.|.	.|.	ENSG00000142733|ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582|ENST00000472410	T;T;T|.	0.25414|.	1.8;1.8;1.8|.	5.84|5.84	2.54|2.54	0.30619|0.30619	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.40979|0.40979	0.1139|0.1139	N|N	0.26162|0.26162	0.8|0.8	0.46798|0.46798	D|D	0.999201|0.999201	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.72982|.	0.964;0.979|.	T|T	0.10660|0.10660	-1.0620|-1.0620	9|5	0.42905|.	T|.	0.14|.	.|.	7.3605|7.3605	0.26744|0.26744	0.0:0.5545:0.0:0.4455|0.0:0.5545:0.0:0.4455	.|.	813;821|.	O95382-3;O95382|.	.;M3K6_HUMAN|.	H|M	813;821;544;821|545	ENSP00000363152:Q813H;ENSP00000419591:Q821H;ENSP00000350195:Q821H|.	ENSP00000350195:Q821H|.	Q|R	-|-	3|2	2|0	MAP3K6|MAP3K6	27557907|27557907	0.372000|0.372000	0.25064|0.25064	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	-0.312000|-0.312000	0.08113|0.08113	0.729000|0.729000	0.32403|0.32403	0.561000|0.561000	0.74099|0.74099	CAG|AGG	.	.	.	none		0.587	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	NM_004672	
SFPQ	6421	hgsc.bcm.edu	37	1	35657092	35657092	+	Silent	SNP	T	T	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:35657092T>C	ENST00000357214.5	-	2	965	c.867A>G	c.(865-867)ggA>ggG	p.G289G		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	289					alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				AAGTTTTCTCTCCAGGCCTCC	0.413			T	TFE3	papillary renal cell																																p.G289G		Atlas-SNP	.		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ	51	.	0			c.A867G						PASS	.						83.0	83.0	83.0					1																	35657092		2203	4300	6503	SO:0001819	synonymous_variant	6421	exon2			TTTCTCTCCAGGC	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.867A>G	chr1.hg19:g.35657092T>C		136.0	0.0	.		125.0	49.0	.	NM_005066	P30808|Q5SZ71	Silent	SNP	ENST00000357214.5	hg19	CCDS388.1																																																																																			.	.	.	none		0.413	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
AKIRIN1	79647	hgsc.bcm.edu	37	1	39469081	39469081	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:39469081C>A	ENST00000432648.3	+	4	717	c.559C>A	c.(559-561)Cca>Aca	p.P187T	AKIRIN1_ENST00000372984.4_Missense_Mutation_p.P140T|AKIRIN1_ENST00000446189.2_Missense_Mutation_p.P142T	NM_024595.2	NP_078871.1	Q9H9L7	AKIR1_HUMAN	akirin 1	187						nuclear membrane (GO:0031965)|nucleus (GO:0005634)				lung(1)|prostate(1)|skin(1)	3						TGGGACAAGGCCAACAAGCTG	0.373																																					p.P187T		Atlas-SNP	.											.	AKIRIN1	7	.	0			c.C559A						PASS	.						126.0	106.0	113.0					1																	39469081		2203	4300	6503	SO:0001583	missense	79647	exon4			ACAAGGCCAACAA	AK022728	CCDS433.1, CCDS44113.1	1p34.3	2013-10-11	2008-06-23	2008-06-23	ENSG00000174574	ENSG00000174574			25744	protein-coding gene	gene with protein product		615164	"""chromosome 1 open reading frame 108"""	C1orf108		19200367	Standard	NM_024595		Approved	FLJ12666	uc001ccw.3	Q9H9L7	OTTHUMG00000007496	ENST00000432648.3:c.559C>A	chr1.hg19:g.39469081C>A	ENSP00000392678:p.Pro187Thr	73.0	0.0	.		44.0	16.0	.	NM_024595	B4DZU6|Q0VDB3|Q53FK8	Missense_Mutation	SNP	ENST00000432648.3	hg19	CCDS433.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185740	0.78789	.	.	ENSG00000174574	ENST00000432648;ENST00000446189;ENST00000372984	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.78375	0.4273	M	0.71206	2.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.983	D;D;P	0.87578	0.996;0.998;0.755	T	0.78409	-0.2215	9	0.49607	T	0.09	-31.0616	16.9086	0.86134	0.0:1.0:0.0:0.0	.	140;142;187	B4DQP0;B4DZU6;Q9H9L7	.;.;AKIR1_HUMAN	T	187;142;140	.	ENSP00000362075:P140T	P	+	1	0	AKIRIN1	39241668	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.444000	0.66587	2.657000	0.90304	0.557000	0.71058	CCA	.	.	.	none		0.373	AKIRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019687.2	NM_024595	
USP24	23358	hgsc.bcm.edu	37	1	55604356	55604356	+	Silent	SNP	A	A	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:55604356A>G	ENST00000294383.6	-	26	2852	c.2853T>C	c.(2851-2853)caT>caC	p.H951H	USP24_ENST00000407756.1_Silent_p.H791H	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	951					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						ATGAGGCACCATGAGGTAGAA	0.368																																					p.H951H		Atlas-SNP	.											.	USP24	323	.	0			c.T2853C						PASS	.						76.0	72.0	73.0					1																	55604356		1901	4114	6015	SO:0001819	synonymous_variant	23358	exon26			GGCACCATGAGGT	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.2853T>C	chr1.hg19:g.55604356A>G		144.0	0.0	.		92.0	46.0	.	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	ENST00000294383.6	hg19	CCDS44154.2																																																																																			.	.	.	none		0.368	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
ZRANB2	9406	hgsc.bcm.edu	37	1	71532486	71532486	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:71532486C>G	ENST00000370920.3	-	9	1203	c.902G>C	c.(901-903)aGa>aCa	p.R301T	ZRANB2-AS1_ENST00000450461.1_RNA|MIR186_ENST00000384988.1_RNA|ZRANB2_ENST00000477096.1_5'UTR|ZRANB2-AS1_ENST00000426999.1_RNA|ZRANB2_ENST00000254821.6_Missense_Mutation_p.R301T	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2	301	Required for nuclear targeting.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						TCTTGTTCGTCTTTTTTTGCG	0.383																																					p.R301T		Atlas-SNP	.											.	ZRANB2	75	.	0			c.G902C						PASS	.						125.0	121.0	122.0					1																	71532486		2203	4300	6503	SO:0001583	missense	9406	exon9			GTTCGTCTTTTTT	AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.902G>C	chr1.hg19:g.71532486C>G	ENSP00000359958:p.Arg301Thr	139.0	0.0	.		176.0	59.0	.	NM_005455	D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	Missense_Mutation	SNP	ENST00000370920.3	hg19	CCDS659.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496632	0.44352	.	.	ENSG00000132485	ENST00000370920;ENST00000254821	T;T	0.65549	-0.09;-0.16	6.16	5.26	0.73747	.	.	.	.	.	T	0.32194	0.0821	N	0.19112	0.55	0.45097	D	0.998112	B;B	0.30281	0.18;0.275	B;B	0.30855	0.035;0.121	T	0.38866	-0.9641	9	0.56958	D	0.05	.	11.4336	0.50056	0.0:0.8636:0.0:0.1364	.	301;301	O95218;O95218-2	ZRAB2_HUMAN;.	T	301	ENSP00000359958:R301T;ENSP00000254821:R301T	ENSP00000254821:R301T	R	-	2	0	ZRANB2	71305074	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.684000	0.61686	1.623000	0.50342	0.650000	0.86243	AGA	.	.	.	none		0.383	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026636.1	NM_203350	
ATP8B2	57198	hgsc.bcm.edu	37	1	154315937	154315937	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:154315937C>G	ENST00000368489.3	+	17	1750	c.1750C>G	c.(1750-1752)Cca>Gca	p.P584A		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	570					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AGTGCGGAATCCAGAGGGGAA	0.517																																					p.P584A		Atlas-SNP	.											.	ATP8B2	158	.	0			c.C1750G						PASS	.						59.0	53.0	55.0					1																	154315937		2203	4300	6503	SO:0001583	missense	57198	exon17			CGGAATCCAGAGG	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1750C>G	chr1.hg19:g.154315937C>G	ENSP00000357475:p.Pro584Ala	64.0	0.0	.		66.0	28.0	.	NM_020452	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	hg19	CCDS1066.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.840063	0.71488	.	.	ENSG00000143515	ENST00000368489	T	0.61859	0.07	5.54	4.61	0.57282	.	0.057135	0.64402	D	0.000001	T	0.67011	0.2848	M	0.85462	2.755	0.80722	D	1	P	0.47191	0.891	P	0.54174	0.744	T	0.71062	-0.4701	10	0.62326	D	0.03	.	13.9576	0.64160	0.0:0.9264:0.0:0.0736	.	584	P98198-3	.	A	584	ENSP00000357475:P584A	ENSP00000357475:P584A	P	+	1	0	ATP8B2	152582561	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	4.739000	0.62080	2.884000	0.98904	0.655000	0.94253	CCA	.	.	.	none		0.517	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
ADI1	55256	hgsc.bcm.edu	37	2	3523139	3523139	+	Splice_Site	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr2:3523139C>T	ENST00000327435.6	-	1	368	c.120G>A	c.(118-120)aaG>aaA	p.K40K	ADI1_ENST00000382093.5_5'Flank|AC142528.1_ENST00000450917.1_RNA	NM_018269.3	NP_060739.2			acireductone dioxygenase 1											breast(2)|large_intestine(2)|lung(4)|ovary(1)|stomach(1)	10	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		GCTCGCGTACCTTCCAGTAGA	0.771																																					p.K40K		Atlas-SNP	.											.	ADI1	12	.	0			c.G120A						PASS	.						2.0	2.0	2.0					2																	3523139		1436	3148	4584	SO:0001630	splice_region_variant	55256	exon1			GCGTACCTTCCAG		CCDS1653.1	2p25.2	2013-05-29			ENSG00000182551	ENSG00000182551	1.13.11.54		30576	protein-coding gene	gene with protein product	"""membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1"""	613400				14718544, 15938715	Standard	NM_018269		Approved	SIPL, MTCBP-1, ARD, APL1, FLJ10913, HMFT1638, mtnD	uc002qxp.4	Q9BV57	OTTHUMG00000112441	ENST00000327435.6:c.120+1G>A	chr2.hg19:g.3523139C>T		51.0	0.0	.		59.0	28.0	.	NM_018269		Silent	SNP	ENST00000327435.6	hg19	CCDS1653.1																																																																																			.	.	.	none		0.771	ADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000231914.6	NM_018269	Silent
PPP1R21	129285	hgsc.bcm.edu	37	2	48738524	48738524	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr2:48738524A>C	ENST00000294952.8	+	21	2387	c.2230A>C	c.(2230-2232)Atg>Ctg	p.M744L	PPP1R21_ENST00000476199.1_3'UTR|PPP1R21_ENST00000449090.2_Missense_Mutation_p.M702L|PPP1R21_ENST00000281394.4_Missense_Mutation_p.M733L	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	744						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						TCAGTTAAGTATGATGAGTGA	0.418																																					p.M744L		Atlas-SNP	.											.	PPP1R21	47	.	0			c.A2230C						PASS	.						235.0	205.0	215.0					2																	48738524		2203	4300	6503	SO:0001583	missense	129285	exon21			TTAAGTATGATGA	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.2230A>C	chr2.hg19:g.48738524A>C	ENSP00000294952:p.Met744Leu	143.0	0.0	.		134.0	58.0	.	NM_001135629	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Missense_Mutation	SNP	ENST00000294952.8	hg19	CCDS46278.1	.	.	.	.	.	.	.	.	.	.	A	19.29	3.799274	0.70567	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.73225	0.3560	L	0.52266	1.64	0.58432	D	0.999995	P;P;P	0.49696	0.927;0.856;0.91	D;P;D	0.66602	0.945;0.881;0.909	T	0.68911	-0.5284	9	0.26408	T	0.33	-25.9975	16.4461	0.83932	1.0:0.0:0.0:0.0	.	702;744;733	E1B6W7;Q6ZMI0;Q6ZMI0-2	.;PPR21_HUMAN;.	L	733;744;702	.	ENSP00000281394:M733L	M	+	1	0	KLRAQ1	48592028	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	9.339000	0.96797	2.285000	0.76669	0.528000	0.53228	ATG	.	.	.	none		0.418	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251238.4	NM_152994	
USP34	9736	hgsc.bcm.edu	37	2	61417473	61417473	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr2:61417473T>G	ENST00000398571.2	-	78	9882	c.9806A>C	c.(9805-9807)tAt>tCt	p.Y3269S	AHSA2_ENST00000394457.3_3'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3269					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TAGGTTCTGATACTGGCTTAT	0.383																																					p.Y3269S		Atlas-SNP	.											.	USP34	334	.	0			c.A9806C						PASS	.						101.0	95.0	97.0					2																	61417473		1835	4096	5931	SO:0001583	missense	9736	exon78			TTCTGATACTGGC	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.9806A>C	chr2.hg19:g.61417473T>G	ENSP00000381577:p.Tyr3269Ser	137.0	0.0	.		143.0	63.0	.	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	hg19	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	T	16.74	3.206114	0.58234	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000436269	T	0.64260	-0.09	5.87	5.87	0.94306	.	0.109289	0.64402	D	0.000004	T	0.40862	0.1134	N	0.08118	0	0.52501	D	0.999958	B	0.33694	0.421	B	0.25405	0.06	T	0.38972	-0.9636	10	0.27785	T	0.31	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	3269	Q70CQ2	UBP34_HUMAN	S	3117;3034;3269;147	ENSP00000381577:Y3269S	ENSP00000263989:Y3117S	Y	-	2	0	USP34	61270977	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.483000	0.60264	2.371000	0.80710	0.533000	0.62120	TAT	.	.	.	none		0.383	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
TTN	7273	hgsc.bcm.edu	37	2	179391818	179391818	+	Missense_Mutation	SNP	C	C	A	rs281864933		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr2:179391818C>A	ENST00000591111.1	-	313	103198	c.102974G>T	c.(102973-102975)gGt>gTt	p.G34325V	TTN_ENST00000589042.1_Missense_Mutation_p.G35966V|TTN-AS1_ENST00000588804.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G33398V|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G27026V|TTN_ENST00000460472.2_Missense_Mutation_p.G26901V|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000592161.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000587576.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G27093V|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	34325	Ig-like 152.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAAAGTCCACCATCTTGTTT	0.433																																					p.G35966V		Atlas-SNP	.											.	TTN	18412	.	0			c.G107897T						PASS	.						192.0	177.0	182.0					2																	179391818		1948	4153	6101	SO:0001583	missense	7273	exon363			AGTCCACCATCTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.102974G>T	chr2.hg19:g.179391818C>A	ENSP00000465570:p.Gly34325Val	106.0	0.0	.		100.0	46.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	14.05	2.420858	0.42918	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	6.17	5.27	0.74061	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67325	0.2881	N	0.21324	0.655	0.80722	D	1	D;D;D;D;D	0.65815	0.987;0.987;0.987;0.987;0.995	P;P;P;P;P	0.55055	0.767;0.767;0.767;0.767;0.702	T	0.71174	-0.4670	9	0.87932	D	0	.	17.7197	0.88347	0.0:0.8781:0.1219:0.0	.	26901;27026;27093;34325;33398	D3DPF9;E7EQE6;E7ET18;Q8WZ42;A6NKB1	.;.;.;TITIN_HUMAN;.	V	33398;26901;27093;27026;26898	ENSP00000343764:G33398V;ENSP00000434586:G26901V;ENSP00000340554:G27093V;ENSP00000352154:G27026V	ENSP00000340554:G27093V	G	-	2	0	TTN	179100064	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.170000	0.64990	2.941000	0.99782	0.655000	0.94253	GGT	.	.	.	none		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SLC23A3	151295	hgsc.bcm.edu	37	2	220027074	220027074	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr2:220027074T>C	ENST00000409878.3	-	11	1516	c.1484A>G	c.(1483-1485)cAg>cGg	p.Q495R	SLC23A3_ENST00000396775.3_3'UTR|SLC23A3_ENST00000455516.2_Missense_Mutation_p.Q503R|NHEJ1_ENST00000356853.5_5'Flank|SLC23A3_ENST00000295738.7_Missense_Mutation_p.Q378R	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	495					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAAGATGGGCTGTGTCAGCAG	0.557																																					p.Q503R		Atlas-SNP	.											.	SLC23A3	60	.	0			c.A1508G						PASS	.						76.0	80.0	79.0					2																	220027074		2027	4185	6212	SO:0001583	missense	151295	exon11			ATGGGCTGTGTCA	BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.1484A>G	chr2.hg19:g.220027074T>C	ENSP00000386473:p.Gln495Arg	65.0	0.0	.		62.0	30.0	.	NM_001144890	B7Z512|Q2PYN6|Q96NA6	Missense_Mutation	SNP	ENST00000409878.3	hg19	CCDS46518.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.984557	0.35036	.	.	ENSG00000213901	ENST00000295738;ENST00000409878;ENST00000455516	T;T;T	0.42513	0.97;2.3;2.29	3.37	3.37	0.38596	.	0.403835	0.19974	N	0.101924	T	0.18593	0.0446	N	0.08118	0	0.80722	D	1	B;B;B	0.24092	0.097;0.097;0.034	B;B;B	0.19946	0.016;0.016;0.027	T	0.06356	-1.0831	9	.	.	.	.	6.0302	0.19677	0.2296:0.0:0.0:0.7704	.	495;503;378	Q6PIS1;B7Z512;Q6PIS1-2	S23A3_HUMAN;.;.	R	378;495;503	ENSP00000295738:Q378R;ENSP00000386473:Q495R;ENSP00000406546:Q503R	.	Q	-	2	0	SLC23A3	219735318	0.770000	0.28543	0.999000	0.59377	0.984000	0.73092	0.835000	0.27531	1.539000	0.49286	0.374000	0.22700	CAG	.	.	.	none		0.557	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336331.2	NM_144712	
PPARG	5468	hgsc.bcm.edu	37	3	12447494	12447494	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr3:12447494C>T	ENST00000287820.6	+	5	854	c.733C>T	c.(733-735)Cat>Tat	p.H245Y	PPARG_ENST00000539812.1_Missense_Mutation_p.H215Y|PPARG_ENST00000397010.2_Missense_Mutation_p.H217Y|PPARG_ENST00000397026.2_Missense_Mutation_p.H223Y|PPARG_ENST00000397012.2_Missense_Mutation_p.H217Y|PPARG_ENST00000397000.1_Missense_Mutation_p.H217Y|PPARG_ENST00000309576.6_Missense_Mutation_p.H217Y|PPARG_ENST00000397015.2_Missense_Mutation_p.H217Y	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	245	Interaction with FAM120B. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	CCTGGCAAAACATTTGTATGA	0.517			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																														p.H245Y		Atlas-SNP	.		Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	.	PPARG	49	.	0			c.C733T						PASS	.						70.0	71.0	71.0					3																	12447494		2203	4300	6503	SO:0001583	missense	5468	exon5			GCAAAACATTTGT	X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.733C>T	chr3.hg19:g.12447494C>T	ENSP00000287820:p.His245Tyr	126.0	0.0	.		137.0	32.0	.	NM_015869	A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	ENST00000287820.6	hg19	CCDS2609.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827607	0.71143	.	.	ENSG00000132170	ENST00000397010;ENST00000309576;ENST00000397015;ENST00000397012;ENST00000397026;ENST00000397000;ENST00000539812;ENST00000287820	T;T;T;T;T;D;D;T	0.90788	-0.45;-0.45;-0.45;-0.45;-0.45;-2.73;-2.73;-0.45	5.81	5.81	0.92471	Nuclear hormone receptor, ligand-binding (1);	0.153557	0.56097	D	0.000022	D	0.90270	0.6957	M	0.74258	2.255	0.58432	D	0.999999	P;B;P	0.44139	0.68;0.184;0.827	B;B;B	0.36418	0.224;0.099;0.149	D	0.91163	0.4962	10	0.59425	D	0.04	.	20.0896	0.97814	0.0:1.0:0.0:0.0	.	245;231;217	P37231;Q4W4C7;E9PFX5	PPARG_HUMAN;.;.	Y	217;217;217;217;223;217;215;245	ENSP00000380205:H217Y;ENSP00000312472:H217Y;ENSP00000380210:H217Y;ENSP00000380207:H217Y;ENSP00000380221:H223Y;ENSP00000380196:H217Y;ENSP00000438940:H215Y;ENSP00000287820:H245Y	ENSP00000287820:H245Y	H	+	1	0	PPARG	12422494	1.000000	0.71417	0.869000	0.34112	0.996000	0.88848	5.579000	0.67457	2.741000	0.93983	0.650000	0.86243	CAT	.	.	.	none		0.517	PPARG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251979.2	NM_005037	
ACAA1	30	hgsc.bcm.edu	37	3	38180443	38180443	+	5'Flank	SNP	C	C	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr3:38180443C>A	ENST00000333167.8	-	0	0				MYD88_ENST00000443433.2_Silent_p.A97A|ACAA1_ENST00000444607.2_5'Flank|ACAA1_ENST00000301810.7_5'Flank|MYD88_ENST00000495303.1_Silent_p.A97A|ACAA1_ENST00000544624.1_5'Flank|MYD88_ENST00000396334.3_Silent_p.A97A|ACAA1_ENST00000450296.1_5'Flank|MYD88_ENST00000424893.1_Silent_p.A97A|MYD88_ENST00000417037.2_Silent_p.A97A	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		GCCCTGGCGCCTCTGTAGGCC	0.652																																					p.A97A		Atlas-SNP	.											.	MYD88	900	.	0			c.C291A						PASS	.						37.0	43.0	41.0					3																	38180443		2203	4299	6502	SO:0001631	upstream_gene_variant	4615	exon1			TGGCGCCTCTGTA	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087		chr3.hg19:g.38180443C>A	Exception_encountered	54.0	0.0	.		98.0	24.0	.	NM_002468	G5E935|Q96CA6	Silent	SNP	ENST00000333167.8	hg19	CCDS2673.1																																																																																			.	.	.	none		0.652	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
TPRA1	131601	hgsc.bcm.edu	37	3	127298938	127298938	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr3:127298938G>A	ENST00000355552.3	-	2	428	c.52C>T	c.(52-54)Cca>Tca	p.P18S	TPRA1_ENST00000296210.7_Missense_Mutation_p.P18S|TPRA1_ENST00000450633.2_Missense_Mutation_p.P18S|TPRA1_ENST00000489960.1_Missense_Mutation_p.P18S	NM_001136053.1	NP_001129525.1	Q86W33	TPRA1_HUMAN	transmembrane protein, adipocyte asscociated 1	18					aging (GO:0007568)|G-protein coupled receptor signaling pathway (GO:0007186)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	9						GCCAGGGGTGGGGGTAGCGCT	0.647																																					p.P18S		Atlas-SNP	.											.	TPRA1	21	.	0			c.C52T						PASS	.						107.0	85.0	93.0					3																	127298938		2203	4300	6503	SO:0001583	missense	131601	exon2			GGGGTGGGGGTAG	AK056759	CCDS3042.1, CCDS46899.1	3q21.2	2012-08-22	2009-07-08	2009-07-08	ENSG00000163870	ENSG00000163870		"""GPCR / Unclassified : 7TM orphan receptors"""	30413	protein-coding gene	gene with protein product	"""transmembrane protein 227"""	608336	"""G protein-coupled receptor 175"""	GPR175		10342878	Standard	NM_001136053		Approved	TPRA40, FLJ32197, TMEM227	uc003ejn.3	Q86W33	OTTHUMG00000159639	ENST00000355552.3:c.52C>T	chr3.hg19:g.127298938G>A	ENSP00000347748:p.Pro18Ser	64.0	0.0	.		69.0	23.0	.	NM_001142646	A8MVB8|D3DNA9|Q8WZ24|Q96AJ6|Q9P2R4	Missense_Mutation	SNP	ENST00000355552.3	hg19	CCDS3042.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357003	0.61293	.	.	ENSG00000163870	ENST00000450633;ENST00000296210;ENST00000355552;ENST00000489960;ENST00000490290;ENST00000469111;ENST00000490643;ENST00000462228	.	.	.	5.05	3.18	0.36537	.	0.304279	0.35970	N	0.002879	T	0.32793	0.0841	L	0.27053	0.805	0.37281	D	0.907849	B;B	0.15473	0.013;0.003	B;B	0.12156	0.007;0.001	T	0.20672	-1.0268	9	0.48119	T	0.1	-4.4783	2.1346	0.03758	0.1559:0.1718:0.4957:0.1766	.	18;18	Q86W33-3;Q86W33	.;TPRA1_HUMAN	S	18	.	ENSP00000296210:P18S	P	-	1	0	TPRA1	128781628	0.880000	0.30214	0.033000	0.17914	0.792000	0.44763	1.076000	0.30729	0.576000	0.29452	0.655000	0.94253	CCA	.	.	.	none		0.647	TPRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356624.1	NM_016372	
HGFAC	3083	hgsc.bcm.edu	37	4	3443800	3443800	+	Silent	SNP	G	G	C	rs372137428		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr4:3443800G>C	ENST00000382774.3	+	1	187	c.72G>C	c.(70-72)ctG>ctC	p.L24L	HGFAC_ENST00000511533.1_Silent_p.L24L	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	24					proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TCCTCCTCCTGCTGCTGCTGC	0.716													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13355	0.0		0.0	False		,,,				2504	0.0				p.L24L		Atlas-SNP	.											.	HGFAC	69	.	0			c.G72C						PASS	.	G		5,3433		0,5,1714	13.0	16.0	15.0		72	0.1	1.0	4		15	0,7164		0,0,3582	no	coding-synonymous	HGFAC	NM_001528.2		0,5,5296	CC,CG,GG		0.0,0.1454,0.0472		24/656	3443800	5,10597	1719	3582	5301	SO:0001819	synonymous_variant	3083	exon1			CCTCCTGCTGCTG	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.72G>C	chr4.hg19:g.3443800G>C		56.0	0.0	.		54.0	4.0	.	NM_001528	Q14726|Q2M1W7|Q53X47	Silent	SNP	ENST00000382774.3	hg19	CCDS3369.1																																																																																			.	.	.	weak		0.716	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
AASDH	132949	hgsc.bcm.edu	37	4	57215435	57215435	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr4:57215435C>T	ENST00000205214.6	-	11	2662	c.2482G>A	c.(2482-2484)Gtg>Atg	p.V828M	AASDH_ENST00000502617.1_Missense_Mutation_p.V828M|AASDH_ENST00000513376.1_Missense_Mutation_p.V728M|AASDH_ENST00000451613.1_Missense_Mutation_p.V828M|AASDH_ENST00000434343.2_Missense_Mutation_p.V343M|AASDH_ENST00000602986.1_Missense_Mutation_p.V675M	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	828					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TTACCCACCACAATAAAGTTT	0.333																																					p.V828M		Atlas-SNP	.											.	AASDH	101	.	0			c.G2482A						PASS	.						55.0	56.0	56.0					4																	57215435		2203	4300	6503	SO:0001583	missense	132949	exon11			CCACCACAATAAA	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.2482G>A	chr4.hg19:g.57215435C>T	ENSP00000205214:p.Val828Met	122.0	0.0	.		91.0	43.0	.	NM_181806	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	ENST00000205214.6	hg19	CCDS3504.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.381731	0.61845	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000434343;ENST00000451613;ENST00000503808;ENST00000502617	T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26	5.9	-1.03	0.10102	Quinonprotein alcohol dehydrogenase-like (2);	0.658469	0.16385	N	0.216708	T	0.70325	0.3211	M	0.80183	2.485	0.19775	N	0.99995	D;D;D;D	0.63046	0.985;0.992;0.985;0.962	P;D;P;P	0.66196	0.822;0.942;0.853;0.882	T	0.61720	-0.7005	10	0.87932	D	0	-3.5325	8.749	0.34605	0.0:0.5572:0.1027:0.3402	.	675;828;828;828	E9PH98;Q4L235-4;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	M	828;728;343;828;675;828	ENSP00000205214:V828M;ENSP00000423760:V728M;ENSP00000392158:V343M;ENSP00000409656:V828M;ENSP00000421171:V828M	ENSP00000205214:V828M	V	-	1	0	AASDH	56910192	0.001000	0.12720	0.914000	0.36105	0.953000	0.61014	-0.115000	0.10741	-0.101000	0.12219	-0.355000	0.07637	GTG	.	.	.	none		0.333	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
NKX6-1	4825	hgsc.bcm.edu	37	4	85418816	85418816	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr4:85418816C>T	ENST00000295886.4	-	1	787	c.566G>A	c.(565-567)cGg>cAg	p.R189Q	NKX6-1_ENST00000515820.2_5'Flank	NM_006168.2	NP_006159.2	P78426	NKX61_HUMAN	NK6 homeobox 1	189	Repressor domain. {ECO:0000250}.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|cellular response to peptide hormone stimulus (GO:0071375)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|negative regulation of glial cell differentiation (GO:0045686)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|organ morphogenesis (GO:0009887)|pancreas development (GO:0031016)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of insulin secretion (GO:0032024)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of axon extension (GO:0030516)|regulation of neuron migration (GO:2001222)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to drug (GO:0042493)|response to nicotine (GO:0035094)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	15		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.0013)		CTTGGGGTACCGGCCCACGGC	0.751																																					p.R189Q		Atlas-SNP	.											.	NKX6-1	38	.	0			c.G566A						PASS	.						5.0	6.0	5.0					4																	85418816		1879	3711	5590	SO:0001583	missense	4825	exon1			GGGTACCGGCCCA	AH007313	CCDS3607.1	4q21.33	2012-03-09	2007-07-09	2002-10-04	ENSG00000163623	ENSG00000163623		"""Homeoboxes / ANTP class : NKL subclass"""	7839	protein-coding gene	gene with protein product		602563	"""NK homeobox (Drosophila), family 6, A"", ""NK6 transcription factor related, locus 1 (Drosophila)"""	NKX6A		9119408	Standard	NM_006168		Approved	Nkx6.1	uc003hpa.1	P78426	OTTHUMG00000130426	ENST00000295886.4:c.566G>A	chr4.hg19:g.85418816C>T	ENSP00000295886:p.Arg189Gln	82.0	0.0	.		80.0	34.0	.	NM_006168		Missense_Mutation	SNP	ENST00000295886.4	hg19	CCDS3607.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.463970	0.84425	.	.	ENSG00000163623	ENST00000295886	D	0.90563	-2.69	3.86	3.86	0.44501	.	0.000000	0.64402	D	0.000007	D	0.92770	0.7701	M	0.62723	1.935	0.80722	D	1	D	0.61697	0.99	D	0.67725	0.953	D	0.90310	0.4336	10	0.11485	T	0.65	-17.2863	14.7331	0.69397	0.0:1.0:0.0:0.0	.	189	P78426	NKX61_HUMAN	Q	189	ENSP00000295886:R189Q	ENSP00000295886:R189Q	R	-	2	0	NKX6-1	85637840	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.960000	0.63673	1.997000	0.58415	0.484000	0.47621	CGG	.	.	.	none		0.751	NKX6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252814.2	NM_006168	
EDIL3	10085	hgsc.bcm.edu	37	5	83402477	83402477	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr5:83402477G>A	ENST00000296591.5	-	6	1059	c.641C>T	c.(640-642)cCg>cTg	p.P214L	EDIL3_ENST00000380138.3_Missense_Mutation_p.P204L	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	214	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		CTGAATCCACGGCCATCTGTC	0.403																																					p.P214L		Atlas-SNP	.											.	EDIL3	94	.	0			c.C641T						PASS	.						152.0	140.0	144.0					5																	83402477		2203	4300	6503	SO:0001583	missense	10085	exon6			ATCCACGGCCATC	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.641C>T	chr5.hg19:g.83402477G>A	ENSP00000296591:p.Pro214Leu	113.0	0.0	.		93.0	39.0	.	NM_005711	B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	hg19	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	G	31	5.072698	0.93950	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.99032	-5.35;-5.35	5.37	5.37	0.77165	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.105630	0.64402	N	0.000003	D	0.99296	0.9754	M	0.81179	2.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.963;1.0	D	0.99556	1.0967	10	0.87932	D	0	-7.3862	19.114	0.93330	0.0:0.0:1.0:0.0	.	204;214	O43854-2;O43854	.;EDIL3_HUMAN	L	214;204	ENSP00000296591:P214L;ENSP00000369483:P204L	ENSP00000296591:P214L	P	-	2	0	EDIL3	83438233	1.000000	0.71417	0.994000	0.49952	0.954000	0.61252	9.209000	0.95087	2.528000	0.85240	0.650000	0.86243	CCG	.	.	.	none		0.403	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711	
COMMD10	51397	hgsc.bcm.edu	37	5	115428295	115428295	+	Silent	SNP	T	T	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr5:115428295T>A	ENST00000274458.4	+	4	359	c.297T>A	c.(295-297)atT>atA	p.I99I	COMMD10_ENST00000515539.1_Silent_p.I85I	NM_016144.2	NP_057228.1	Q9Y6G5	COMDA_HUMAN	COMM domain containing 10	99										endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(2)	9		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)		TAGAGAACATTCATCTTAGAC	0.393																																					p.I99I		Atlas-SNP	.											.	COMMD10	18	.	0			c.T297A						PASS	.						93.0	85.0	88.0					5																	115428295		2202	4300	6502	SO:0001819	synonymous_variant	51397	exon4			GAACATTCATCTT	AY542165	CCDS34215.1	5q23.1	2008-02-05				ENSG00000145781			30201	protein-coding gene	gene with protein product						15799966	Standard	NM_016144		Approved	PTD002	uc003krt.1	Q9Y6G5		ENST00000274458.4:c.297T>A	chr5.hg19:g.115428295T>A		67.0	0.0	.		85.0	42.0	.	NM_016144	D3DT07|Q9P077	Silent	SNP	ENST00000274458.4	hg19	CCDS34215.1																																																																																			.	.	.	none		0.393	COMMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371033.1	NM_016144	
PCDHGA2	56113	hgsc.bcm.edu	37	5	140719649	140719649	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr5:140719649G>A	ENST00000394576.2	+	1	1111	c.1111G>A	c.(1111-1113)Gta>Ata	p.V371I	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	371	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTTTTTAATGTACATGATAG	0.423																																					p.V371I		Atlas-SNP	.											.	PCDHGA2	205	.	0			c.G1111A						PASS	.						79.0	82.0	81.0					5																	140719649		2203	4300	6503	SO:0001583	missense	56113	exon1			TTTAATGTACATG	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1111G>A	chr5.hg19:g.140719649G>A	ENSP00000378077:p.Val371Ile	79.0	0.0	.		86.0	41.0	.	NM_018915	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	hg19	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	8.322	0.824576	0.16678	.	.	ENSG00000081853	ENST00000394576	T	0.53206	0.63	5.13	3.26	0.37387	Cadherin (4);Cadherin-like (1);	0.000000	0.37261	U	0.002174	T	0.45276	0.1334	L	0.51422	1.61	0.25788	N	0.98465	B;P	0.44044	0.373;0.825	B;P	0.44696	0.169;0.458	T	0.33163	-0.9879	10	0.46703	T	0.11	.	10.9284	0.47203	0.1626:0.0:0.8374:0.0	.	371;371	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	I	371	ENSP00000378077:V371I	ENSP00000378077:V371I	V	+	1	0	PCDHGA2	140699833	1.000000	0.71417	0.955000	0.39395	0.005000	0.04900	3.236000	0.51336	0.616000	0.30141	-1.165000	0.01757	GTA	.	.	.	none		0.423	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
SPARC	6678	hgsc.bcm.edu	37	5	151043688	151043688	+	Silent	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr5:151043688G>T	ENST00000231061.4	-	9	1156	c.843C>A	c.(841-843)atC>atA	p.I281I	SPARC_ENST00000537849.1_5'Flank	NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)	281	EF-hand.				blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)			central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		CATCCAGGGCGATGTACTTGT	0.592																																					p.I281I		Atlas-SNP	.											.	SPARC	38	.	0			c.C843A						PASS	.						114.0	102.0	106.0					5																	151043688		2203	4300	6503	SO:0001819	synonymous_variant	6678	exon9			CAGGGCGATGTAC		CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.843C>A	chr5.hg19:g.151043688G>T		87.0	0.0	.		84.0	4.0	.	NM_003118	D3DQH9|Q6IBK4	Silent	SNP	ENST00000231061.4	hg19	CCDS4318.1																																																																																			.	.	.	none		0.592	SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252430.1	NM_003118	
BTN2A1	11120	hgsc.bcm.edu	37	6	26459730	26459730	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr6:26459730C>A	ENST00000312541.5	+	3	352	c.104C>A	c.(103-105)cCc>cAc	p.P35H	BTN2A1_ENST00000541522.1_5'UTR|BTN2A1_ENST00000429381.1_Missense_Mutation_p.P35H|BTN2A1_ENST00000469185.1_Missense_Mutation_p.P35H	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	35	Ig-like V-type.				lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						GTCGTGGGGCCCACTGATCCC	0.512																																					p.P35H		Atlas-SNP	.											.	BTN2A1	118	.	0			c.C104A						PASS	.						89.0	80.0	83.0					6																	26459730		2203	4300	6503	SO:0001583	missense	11120	exon3			TGGGGCCCACTGA	U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.104C>A	chr6.hg19:g.26459730C>A	ENSP00000312158:p.Pro35His	132.0	0.0	.		87.0	39.0	.	NM_001197234	B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Missense_Mutation	SNP	ENST00000312541.5	hg19	CCDS4613.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.742052	0.30865	.	.	ENSG00000112763	ENST00000312541;ENST00000429381;ENST00000265424;ENST00000469185	T;T;T	0.67523	-0.27;-0.27;-0.27	3.12	3.12	0.35913	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000090	T	0.77452	0.4132	M	0.88105	2.93	0.80722	D	1	D;D	0.65815	0.995;0.965	P;P	0.61940	0.896;0.824	T	0.81765	-0.0783	10	0.66056	D	0.02	.	12.4734	0.55799	0.0:1.0:0.0:0.0	.	35;35	Q96AV7;Q7KYR7	.;BT2A1_HUMAN	H	35	ENSP00000312158:P35H;ENSP00000416945:P35H;ENSP00000419043:P35H	ENSP00000265424:P35H	P	+	2	0	BTN2A1	26567709	0.955000	0.32602	0.117000	0.21633	0.002000	0.02628	4.989000	0.63870	2.055000	0.61198	0.561000	0.74099	CCC	.	.	.	none		0.512	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040122.2	NM_007049	
TREML1	340205	hgsc.bcm.edu	37	6	41119115	41119115	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr6:41119115T>A	ENST00000426005.2	-	3	427	c.384A>T	c.(382-384)gaA>gaT	p.E128D	TREML1_ENST00000373127.4_Missense_Mutation_p.E128D|TREML1_ENST00000437044.2_Missense_Mutation_p.E17D	NM_178174.2	NP_835468.1	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid cells-like 1	128	Poly-Glu.				calcium-mediated signaling (GO:0019722)|innate immune response (GO:0045087)|platelet activation (GO:0030168)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGGTCTCTTCTTCTTCCTCTG	0.512																																					p.E128D		Atlas-SNP	.											.	TREML1	20	.	0			c.A384T						PASS	.						101.0	91.0	94.0					6																	41119115		2203	4300	6503	SO:0001583	missense	340205	exon3			CTCTTCTTCTTCC	AF534822	CCDS4851.1, CCDS64420.1, CCDS64421.1	6p21.1	2013-01-11			ENSG00000161911	ENSG00000161911		"""Immunoglobulin superfamily / V-set domain containing"""	20434	protein-coding gene	gene with protein product	"""TREM-like transcript 1"""	609714				12393607, 12645956	Standard	NM_178174		Approved	TLT1, dJ238O23.3	uc011duc.3	Q86YW5	OTTHUMG00000016231	ENST00000426005.2:c.384A>T	chr6.hg19:g.41119115T>A	ENSP00000402855:p.Glu128Asp	87.0	0.0	.		75.0	35.0	.	NM_178174	Q496B3|Q8IWY1|Q8IWY2	Missense_Mutation	SNP	ENST00000426005.2	hg19	CCDS4851.1	.	.	.	.	.	.	.	.	.	.	T	4.222	0.040141	0.08148	.	.	ENSG00000161911	ENST00000373127;ENST00000437044;ENST00000426005	T;T;T	0.54479	1.55;0.57;1.69	3.39	-0.928	0.10448	.	0.826859	0.10677	N	0.646874	T	0.38746	0.1052	L	0.53249	1.67	0.09310	N	1	P;P;D	0.63880	0.476;0.608;0.993	B;B;P	0.60789	0.277;0.156;0.879	T	0.32134	-0.9918	10	0.19590	T	0.45	.	6.8523	0.24022	0.0:0.5548:0.0:0.4452	.	17;128;128	Q86YW5-3;Q86YW5;Q86YW5-2	.;TRML1_HUMAN;.	D	128;17;128	ENSP00000362219:E128D;ENSP00000400405:E17D;ENSP00000402855:E128D	ENSP00000362219:E128D	E	-	3	2	TREML1	41227093	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-1.599000	0.02085	-0.379000	0.07906	-0.924000	0.02725	GAA	.	.	.	none		0.512	TREML1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043538.2	NM_178174	
PKHD1	5314	hgsc.bcm.edu	37	6	51890829	51890829	+	Missense_Mutation	SNP	G	G	A	rs112182862		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr6:51890829G>A	ENST00000371117.3	-	32	4054	c.3779C>T	c.(3778-3780)gCg>gTg	p.A1260V	PKHD1_ENST00000340994.4_Missense_Mutation_p.A1260V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1260	IPT/TIG 7.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGGAGCGCCCGCATCGGGTAT	0.592																																					p.A1260V		Atlas-SNP	.											.	PKHD1	927	.	0			c.C3779T						PASS	.						40.0	42.0	41.0					6																	51890829		2203	4300	6503	SO:0001583	missense	5314	exon32			GCGCCCGCATCGG	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3779C>T	chr6.hg19:g.51890829G>A	ENSP00000360158:p.Ala1260Val	105.0	0.0	.		77.0	25.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239805	0.22711	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.77489	-1.1;-1.1	5.87	2.04	0.26737	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	1.171700	0.05986	N	0.645227	T	0.48223	0.1488	L	0.47716	1.5	0.09310	N	1	B;B	0.27316	0.145;0.175	B;B	0.19148	0.009;0.024	T	0.35919	-0.9769	10	0.38643	T	0.18	.	3.7884	0.08710	0.2374:0.0:0.452:0.3106	.	1260;1260	P08F94-2;P08F94	.;PKHD1_HUMAN	V	1260	ENSP00000360158:A1260V;ENSP00000341097:A1260V	ENSP00000341097:A1260V	A	-	2	0	PKHD1	51998788	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.611000	0.05622	0.361000	0.24292	0.655000	0.94253	GCG	.	G|0.500;A|0.500	0.500	weak		0.592	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PNRC1	10957	hgsc.bcm.edu	37	6	89793815	89793815	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr6:89793815A>T	ENST00000336032.3	+	2	1001	c.884A>T	c.(883-885)aAg>aTg	p.K295M	PNRC1_ENST00000354922.3_Missense_Mutation_p.K110M|PNRC1_ENST00000369472.1_Missense_Mutation_p.K110M	NM_006813.2	NP_006804.1	Q12796	PNRC1_HUMAN	proline-rich nuclear receptor coactivator 1	295					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(76;3.64e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.102)		GTTCTTCCAAAGCCTCCTAGT	0.423										Multiple Myeloma(7;0.094)																											p.K295M		Atlas-SNP	.											.	PNRC1	17	.	0			c.A884T						PASS	.						83.0	85.0	84.0					6																	89793815		2203	4300	6503	SO:0001583	missense	10957	exon2			TTCCAAAGCCTCC	U03105	CCDS5018.1	6q16.1	2008-02-05	2003-09-25	2003-09-26	ENSG00000146278	ENSG00000146278			17278	protein-coding gene	gene with protein product		606714	"""proline rich 2"""	PROL2		7578250	Standard	NM_006813		Approved	B4-2, PRR2	uc003pmv.3	Q12796	OTTHUMG00000015191	ENST00000336032.3:c.884A>T	chr6.hg19:g.89793815A>T	ENSP00000336931:p.Lys295Met	321.0	1.0	.		251.0	105.0	.	NM_006813	B2R6Q0|E1P515|Q5T7J6|Q7Z5N0	Missense_Mutation	SNP	ENST00000336032.3	hg19	CCDS5018.1	.	.	.	.	.	.	.	.	.	.	A	17.98	3.520456	0.64747	.	.	ENSG00000146278	ENST00000369472;ENST00000336032;ENST00000354922	T;T;T	0.63744	0.1;-0.06;0.1	5.64	5.64	0.86602	.	0.048020	0.85682	D	0.000000	T	0.74680	0.3748	M	0.75777	2.31	0.51012	D	0.9999	D	0.89917	1.0	D	0.91635	0.999	T	0.79052	-0.1961	10	0.87932	D	0	-11.794	15.8451	0.78883	1.0:0.0:0.0:0.0	.	295	Q12796	PNRC1_HUMAN	M	110;295;110	ENSP00000358484:K110M;ENSP00000336931:K295M;ENSP00000347000:K110M	ENSP00000336931:K295M	K	+	2	0	PNRC1	89850534	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.453000	0.73488	2.126000	0.65437	0.533000	0.62120	AAG	.	.	.	none		0.423	PNRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041471.1	NM_006813	
SESN1	27244	hgsc.bcm.edu	37	6	109315799	109315799	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr6:109315799A>G	ENST00000356644.7	-	6	903	c.809T>C	c.(808-810)tTc>tCc	p.F270S	SESN1_ENST00000436639.2_Missense_Mutation_p.F329S|SESN1_ENST00000302071.2_Missense_Mutation_p.F204S	NM_001199933.1	NP_001186862.1	Q9Y6P5	SESN1_HUMAN	sestrin 1	270					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of cell proliferation (GO:0008285)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)	nucleus (GO:0005634)				cervix(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	10		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		AACCTCAAAGAAAGAATCACT	0.343																																					p.F329S		Atlas-SNP	.											.	SESN1	29	.	0			c.T986C						PASS	.						79.0	65.0	70.0					6																	109315799		2203	4300	6503	SO:0001583	missense	27244	exon6			TCAAAGAAAGAAT	AF033120	CCDS5070.1, CCDS56444.1, CCDS56445.1	6q21	2008-10-23			ENSG00000080546	ENSG00000080546			21595	protein-coding gene	gene with protein product		606103				9926927, 7938006	Standard	NM_014454		Approved	SEST1, PA26	uc003psu.3	Q9Y6P5	OTTHUMG00000015338	ENST00000356644.7:c.809T>C	chr6.hg19:g.109315799A>G	ENSP00000349061:p.Phe270Ser	91.0	0.0	.		66.0	26.0	.	NM_014454	Q2M2B7|Q5T316|Q9NV00|Q9UPD5|Q9Y6P6	Missense_Mutation	SNP	ENST00000356644.7	hg19	CCDS56445.1	.	.	.	.	.	.	.	.	.	.	A	10.30	1.312418	0.23908	.	.	ENSG00000080546	ENST00000436639;ENST00000302071;ENST00000356644	T;T;T	0.20463	2.07;2.07;2.07	5.7	4.48	0.54585	.	0.284352	0.43579	D	0.000549	T	0.01765	0.0056	N	0.01576	-0.805	0.32805	D	0.500689	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.45056	-0.9287	10	0.07175	T	0.84	-19.8022	7.1186	0.25431	0.7777:0.1489:0.0734:0.0	.	329;270	Q9Y6P5-2;Q9Y6P5	.;SESN1_HUMAN	S	329;204;270	ENSP00000393762:F329S;ENSP00000306734:F204S;ENSP00000349061:F270S	ENSP00000306734:F204S	F	-	2	0	SESN1	109422492	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	2.829000	0.48128	2.161000	0.67846	0.482000	0.46254	TTC	.	.	.	none		0.343	SESN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041738.4	NM_014454	
KIAA1244	57221	hgsc.bcm.edu	37	6	138657620	138657620	+	Silent	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr6:138657620G>T	ENST00000251691.4	+	34	6697	c.6531G>T	c.(6529-6531)gtG>gtT	p.V2177V		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		ACATCATTGTGTAGCCGACTC	0.542																																					p.V2177V		Atlas-SNP	.											.	KIAA1244	236	.	0			c.G6531T						PASS	.						85.0	75.0	78.0					6																	138657620		2203	4300	6503	SO:0001819	synonymous_variant	57221	exon34			CATTGTGTAGCCG	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.6531G>T	chr6.hg19:g.138657620G>T		113.0	0.0	.		75.0	27.0	.	NM_020340		Silent	SNP	ENST00000251691.4	hg19	CCDS5189.2																																																																																			.	.	.	none		0.542	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
SP8	221833	hgsc.bcm.edu	37	7	20824956	20824956	+	Silent	SNP	C	C	G	rs201180283		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr7:20824956C>G	ENST00000361443.4	-	3	663	c.426G>C	c.(424-426)ggG>ggC	p.G142G	SP8_ENST00000418710.2_Silent_p.G160G	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	142					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						cgccgccgcccccgccgccgc	0.741																																					p.G160G		Atlas-SNP	.											.	SP8	43	.	0			c.G480C						PASS	.						2.0	2.0	2.0					7																	20824956		542	1367	1909	SO:0001819	synonymous_variant	221833	exon2			GCCGCCCCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.426G>C	chr7.hg19:g.20824956C>G		85.0	0.0	.		154.0	13.0	.	NM_182700	Q7Z615|Q7Z616|Q96MJ1	Silent	SNP	ENST00000361443.4	hg19	CCDS5372.1																																																																																			.	.	.	weak		0.741	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
CYP51A1	1595	hgsc.bcm.edu	37	7	91761140	91761140	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr7:91761140G>T	ENST00000003100.8	-	2	404	c.239C>A	c.(238-240)gCc>gAc	p.A80D	LRRD1_ENST00000422722.1_5'UTR|CTB-161K23.1_ENST00000453068.1_RNA|CYP51A1_ENST00000450723.1_5'UTR	NM_000786.3	NP_000777.1	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A, polypeptide 1	74					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via 24,25-dihydrolanosterol (GO:0033488)|demethylation (GO:0070988)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|sterol 14-demethylase activity (GO:0008398)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	10	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Itraconazole(DB01167)|Ketoconazole(DB01026)|Sertaconazole(DB01153)|Tioconazole(DB01007)	AAATGCTATGGCATGCCCAAG	0.323																																					p.A80D	GBM(70;1100 1190 11592 25836 51397)	Atlas-SNP	.											.	CYP51A1	30	.	0			c.C239A						PASS	.						46.0	47.0	47.0					7																	91761140		2203	4298	6501	SO:0001583	missense	1595	exon2			GCTATGGCATGCC	U51685	CCDS5623.1, CCDS55123.1	7q21.2	2012-10-10	2003-02-14	2003-02-28	ENSG00000001630	ENSG00000001630		"""Cytochrome P450s"""	2649	protein-coding gene	gene with protein product		601637	"""cytochrome P450, 51 (lanosterol 14-alpha-demethylase)"""	CYP51		8975714	Standard	NM_000786		Approved	CP51, CYPL1, P450L1, LDM, P450-14DM	uc003ulm.4	Q16850	OTTHUMG00000131131	ENST00000003100.8:c.239C>A	chr7.hg19:g.91761140G>T	ENSP00000003100:p.Ala80Asp	446.0	1.0	.		569.0	183.0	.	NM_000786	A4D1F8|B2RAI4|B4DJ55|O00770|O00772|Q16784|Q8N1A8|Q99868	Missense_Mutation	SNP	ENST00000003100.8	hg19	CCDS5623.1	.	.	.	.	.	.	.	.	.	.	G	33	5.213546	0.95069	.	.	ENSG00000001630	ENST00000003100;ENST00000496998;ENST00000435873	T	0.70399	-0.48	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.86356	0.5913	M	0.90198	3.095	0.80722	D	1	D;D	0.69078	0.996;0.997	P;P	0.62491	0.87;0.903	D	0.89062	0.3463	10	0.72032	D	0.01	.	19.1465	0.93471	0.0:0.0:1.0:0.0	.	20;74	B3KRC6;Q16850	.;CP51A_HUMAN	D	80;20;24	ENSP00000003100:A80D	ENSP00000003100:A80D	A	-	2	0	CYP51A1	91599076	1.000000	0.71417	0.973000	0.42090	0.998000	0.95712	9.062000	0.93920	2.584000	0.87258	0.650000	0.86243	GCC	.	.	.	none		0.323	CYP51A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253812.4		
LAMB4	22798	hgsc.bcm.edu	37	7	107746348	107746348	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr7:107746348G>A	ENST00000388781.3	-	8	867	c.784C>T	c.(784-786)Cgg>Tgg	p.R262W	LAMB4_ENST00000418464.1_Missense_Mutation_p.R262W|LAMB4_ENST00000388780.3_Missense_Mutation_p.R262W|LAMB4_ENST00000414450.2_Missense_Mutation_p.R262W|LAMB4_ENST00000205386.4_Missense_Mutation_p.R262W	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	262	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CAGCTTCCCCGAACAATCATC	0.468																																					p.R262W		Atlas-SNP	.											LAMB4,colon,carcinoma,0,3	LAMB4	253	.	0			c.C784T						PASS	.						128.0	111.0	117.0					7																	107746348		2203	4300	6503	SO:0001583	missense	22798	exon8			TTCCCCGAACAAT	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.784C>T	chr7.hg19:g.107746348G>A	ENSP00000373433:p.Arg262Trp	100.0	0.0	.		127.0	78.0	.	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	hg19	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393627	0.62066	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17	4.87	2.02	0.26589	Laminin, N-terminal (3);	0.488989	0.17139	N	0.185530	T	0.81772	0.4893	M	0.83384	2.64	0.39988	D	0.975007	D	0.65815	0.995	P	0.55011	0.766	T	0.78209	-0.2293	10	0.56958	D	0.05	.	3.4717	0.07570	0.1456:0.1338:0.5824:0.1382	.	262	A4D0S4	LAMB4_HUMAN	W	262	ENSP00000205386:R262W;ENSP00000373433:R262W;ENSP00000373432:R262W;ENSP00000402353:R262W;ENSP00000402265:R262W	ENSP00000205386:R262W	R	-	1	2	LAMB4	107533584	0.000000	0.05858	0.024000	0.17045	0.951000	0.60555	0.673000	0.25203	0.233000	0.21120	0.655000	0.94253	CGG	.	.	.	none		0.468	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
DNAJB9	4189	hgsc.bcm.edu	37	7	108213747	108213747	+	Nonsense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr7:108213747C>T	ENST00000249356.3	+	3	1168	c.622C>T	c.(622-624)Caa>Taa	p.Q208*	DNAJB9_ENST00000465725.1_Intron	NM_012328.2	NP_036460.1	Q9UBS3	DNJB9_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 9	208					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	misfolded protein binding (GO:0051787)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13						GACTGTCACTCAACGAAGAGG	0.378																																					p.Q208X		Atlas-SNP	.											.	DNAJB9	25	.	0			c.C622T						PASS	.						103.0	102.0	102.0					7																	108213747		2203	4300	6503	SO:0001587	stop_gained	4189	exon3			GTCACTCAACGAA	AB026908	CCDS5752.1	7q31	2011-09-02			ENSG00000128590	ENSG00000128590		"""Heat shock proteins / DNAJ (HSP40)"""	6968	protein-coding gene	gene with protein product		602634		MDG1		9533036, 11147971	Standard	NM_012328		Approved		uc003vfn.3	Q9UBS3	OTTHUMG00000154866	ENST00000249356.3:c.622C>T	chr7.hg19:g.108213747C>T	ENSP00000249356:p.Gln208*	62.0	0.0	.		83.0	20.0	.	NM_012328		Nonsense_Mutation	SNP	ENST00000249356.3	hg19	CCDS5752.1	.	.	.	.	.	.	.	.	.	.	C	41	8.877952	0.98988	.	.	ENSG00000128590	ENST00000249356	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1901	0.93663	0.0:1.0:0.0:0.0	.	.	.	.	X	208	.	.	Q	+	1	0	DNAJB9	108000983	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.377000	0.79668	2.776000	0.95493	0.655000	0.94253	CAA	.	.	.	none		0.378	DNAJB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337414.1		
C7orf55-LUC7L2	100996928	hgsc.bcm.edu	37	7	139056209	139056209	+	Splice_Site	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr7:139056209G>T	ENST00000541170.3	+	2	236	c.52G>T	c.(52-54)Gga>Tga	p.G18*	C7orf55-LUC7L2_ENST00000354926.4_Intron|C7orf55-LUC7L2_ENST00000263545.6_5'Flank|LUC7L2_ENST00000541515.3_Intron	NM_001244585.1	NP_001231514.1			C7orf55-LUC7L2 readthrough																		GGAGAGAATGGGTAAAGTAAA	0.388																																					p.G18X		Atlas-SNP	.											.	LUC7L2	49	.	0			c.G52T						PASS	.																																			SO:0001630	splice_region_variant	51631	exon2			AGAATGGGTAAAG		CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000541170.3:c.52+1G>T	chr7.hg19:g.139056209G>T		87.0	0.0	.		109.0	31.0	.	NM_001244585		Nonsense_Mutation	SNP	ENST00000541170.3	hg19	CCDS59085.1	.	.	.	.	.	.	.	.	.	.	G	31	5.099576	0.94197	.	.	ENSG00000146963	ENST00000448820;ENST00000541170	.	.	.	4.28	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.30907	N	0.729093	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	12.528	0.56098	0.0:0.0:1.0:0.0	.	.	.	.	X	18	.	ENSP00000393173:G18X	G	+	1	0	LUC7L2	138706749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.781000	0.55394	2.671000	0.90904	0.591000	0.81541	GGA	.	.	.	none		0.388	C7orf55-LUC7L2-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323625.2		Nonsense_Mutation
SLC10A5	347051	hgsc.bcm.edu	37	8	82606176	82606176	+	Silent	SNP	A	A	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr8:82606176A>G	ENST00000518568.1	-	1	2233	c.1032T>C	c.(1030-1032)ccT>ccC	p.P344P		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	344						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						AACCCAAAGCAGGAACTAAGA	0.363																																					p.P344P		Atlas-SNP	.											.	SLC10A5	35	.	0			c.T1032C						PASS	.						64.0	65.0	65.0					8																	82606176		2203	4300	6503	SO:0001819	synonymous_variant	347051	exon1			CAAAGCAGGAACT		CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.1032T>C	chr8.hg19:g.82606176A>G		112.0	0.0	.		68.0	36.0	.	NM_001010893	B2RN26	Silent	SNP	ENST00000518568.1	hg19	CCDS34915.1																																																																																			.	.	.	none		0.363	SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379736.1	XM_294493	
ZFAT	57623	hgsc.bcm.edu	37	8	135614212	135614212	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr8:135614212A>G	ENST00000377838.3	-	6	1924	c.1750T>C	c.(1750-1752)Tcc>Ccc	p.S584P	ZFAT_ENST00000520214.1_Missense_Mutation_p.S572P|ZFAT_ENST00000429442.2_Missense_Mutation_p.S572P|ZFAT_ENST00000523399.1_Missense_Mutation_p.S522P|ZFAT_ENST00000520356.1_Missense_Mutation_p.S572P|ZFAT_ENST00000520727.1_Missense_Mutation_p.S572P|ZFAT-AS1_ENST00000505776.1_RNA	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	584					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			AGGTCTGAGGAGGAGACCACG	0.587																																					p.S584P		Atlas-SNP	.											.	ZFAT	265	.	0			c.T1750C						PASS	.						30.0	31.0	31.0					8																	135614212		1926	4131	6057	SO:0001583	missense	57623	exon6			CTGAGGAGGAGAC	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.1750T>C	chr8.hg19:g.135614212A>G	ENSP00000367069:p.Ser584Pro	46.0	0.0	.		62.0	35.0	.	NM_020863	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	hg19	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	A	2.258	-0.369941	0.05069	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399;ENST00000398946	T;T;T;T;T;T	0.09723	3.02;2.95;2.96;2.95;2.95;2.96	5.28	0.00147	0.14046	.	0.688237	0.13587	N	0.376881	T	0.09905	0.0243	L	0.27053	0.805	0.09310	N	1	B;P;D;B	0.53151	0.393;0.901;0.958;0.165	B;P;P;B	0.51229	0.163;0.447;0.663;0.059	T	0.21245	-1.0251	10	0.44086	T	0.13	-0.6841	4.3929	0.11350	0.4893:0.3331:0.1776:0.0	.	522;572;572;584	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	P	572;572;572;584;572;471;522;572	ENSP00000427879:S572P;ENSP00000427831:S572P;ENSP00000394501:S572P;ENSP00000367069:S584P;ENSP00000428483:S572P;ENSP00000429091:S522P	ENSP00000326997:S471P	S	-	1	0	ZFAT	135683394	0.000000	0.05858	0.003000	0.11579	0.081000	0.17604	-1.550000	0.02180	-0.116000	0.11893	0.533000	0.62120	TCC	.	.	.	none		0.587	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
CCDC166	100130274	hgsc.bcm.edu	37	8	144790026	144790027	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr8:144790026_144790027TG>CT	ENST00000542437.1	-	1	252_253	c.253_254CA>AG	c.(253-255)CAg>AGg	p.Q85R	RP11-429J17.4_ENST00000527579.1_RNA	NM_001162914.1	NP_001156386.1	P0CW27	CC166_HUMAN	coiled-coil domain containing 166	85																	GGCGCAGCGCTGGGCGCGCGCG	0.698																																					p.Q85R|p.Q85K		Atlas-SNP	.											.	CCDC166	1	.	0			c.A254G|c.C253A						PASS	.																																			SO:0001583	missense	100130274	exon1			CAGCGCTGGGCGC|AGCGCTGGGCGCG		CCDS55280.1	8q24.3	2011-06-20			ENSG00000255181	ENSG00000255181			41910	protein-coding gene	gene with protein product							Standard	NM_001162914		Approved		uc011lkr.2	P0CW27	OTTHUMG00000165148	ENST00000542437.1:c.253_254delinsCT	chr8.hg19:g.144790026_144790027delinsCT	ENSP00000437468:p.Gln85Arg	51.0|50.0	0.0	.		30.0|31.0	15.0|16.0	.	NM_001162914		Missense_Mutation	SNP	ENST00000542437.1	hg19	CCDS55280.1																																																																																			.	.	.	none		0.698	CCDC166-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001162914	
EPPK1	83481	hgsc.bcm.edu	37	8	144947044	144947044	+	Nonsense_Mutation	SNP	G	G	T	rs377574983	byFrequency	TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr8:144947044G>T	ENST00000525985.1	-	2	449	c.378C>A	c.(376-378)taC>taA	p.Y126*				P58107	EPIPL_HUMAN	epiplakin 1	126						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCTCACCGCCGTAGGGGTCAG	0.667																																					p.Y126X		Atlas-SNP	.											EPPK1,bladder,carcinoma,0,1	EPPK1	199	.	0			c.C378A						PASS	.						28.0	33.0	31.0					8																	144947044		2024	4180	6204	SO:0001587	stop_gained	83481	exon1			ACCGCCGTAGGGG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.378C>A	chr8.hg19:g.144947044G>T	ENSP00000436337:p.Tyr126*	136.0	0.0	.		139.0	60.0	.	NM_031308	Q76E58|Q9NSU9	Nonsense_Mutation	SNP	ENST00000525985.1	hg19		.	.	.	.	.	.	.	.	.	.	G	12.45	1.940545	0.34283	.	.	ENSG00000227184	ENST00000525985	.	.	.	4.44	-7.55	0.01327	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0392	0.71774	0.2859:0.0:0.7141:0.0	.	.	.	.	X	126	.	ENSP00000436337:Y126X	Y	-	3	2	EPPK1	145019032	0.803000	0.28956	0.591000	0.28745	0.074000	0.17049	-0.097000	0.11042	-1.541000	0.01727	-0.481000	0.04817	TAC	.	.	.	alt		0.667	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
DDX58	23586	hgsc.bcm.edu	37	9	32467857	32467857	+	Silent	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr9:32467857G>A	ENST00000379883.2	-	15	2245	c.2088C>T	c.(2086-2088)gcC>gcT	p.A696A	DDX58_ENST00000542096.1_Silent_p.A625A|DDX58_ENST00000379868.1_Silent_p.A493A|DDX58_ENST00000545044.1_Silent_p.A493A|DDX58_ENST00000379882.1_Silent_p.A651A	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	696	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		CAACTGAGGTGGCAATCAGAA	0.438																																					p.A696A		Atlas-SNP	.											.	DDX58	82	.	0			c.C2088T						PASS	.						178.0	151.0	160.0					9																	32467857		2203	4300	6503	SO:0001819	synonymous_variant	23586	exon15			TGAGGTGGCAATC	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2088C>T	chr9.hg19:g.32467857G>A		107.0	0.0	.		136.0	61.0	.	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Silent	SNP	ENST00000379883.2	hg19	CCDS6526.1																																																																																			.	.	.	none		0.438	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
RUSC2	9853	hgsc.bcm.edu	37	9	35548396	35548396	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr9:35548396C>A	ENST00000455600.1	+	2	2447	c.1878C>A	c.(1876-1878)caC>caA	p.H626Q		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	626						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			AGGGACCCCACTCCAGTGAGA	0.647																																					p.H626Q		Atlas-SNP	.											.	RUSC2	88	.	0			c.C1878A						PASS	.						52.0	49.0	50.0					9																	35548396		2203	4300	6503	SO:0001583	missense	9853	exon2			ACCCCACTCCAGT	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.1878C>A	chr9.hg19:g.35548396C>A	ENSP00000393922:p.His626Gln	57.0	0.0	.		47.0	17.0	.	NM_014806	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	hg19	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.294418	0.23564	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	T;T	0.20200	2.09;2.09	5.86	1.69	0.24217	.	0.421346	0.23941	N	0.043043	T	0.04679	0.0127	N	0.01874	-0.695	0.21782	N	0.999545	B	0.02656	0.0	B	0.01281	0.0	T	0.38134	-0.9675	10	0.02654	T	1	-3.2088	1.9507	0.03366	0.2064:0.1172:0.4682:0.2082	.	626	Q8N2Y8	RUSC2_HUMAN	Q	626	ENSP00000355177:H626Q;ENSP00000393922:H626Q	ENSP00000355177:H626Q	H	+	3	2	RUSC2	35538396	0.024000	0.19004	1.000000	0.80357	0.905000	0.53344	0.124000	0.15728	0.823000	0.34589	-0.165000	0.13383	CAC	.	.	.	none		0.647	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
CEL	1056	hgsc.bcm.edu	37	9	135939799	135939799	+	Silent	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr9:135939799C>T	ENST00000372080.4	+	2	100	c.84C>T	c.(82-84)gcC>gcT	p.A28A	CEL_ENST00000351304.7_Silent_p.A25A	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	25	Heparin-binding.				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		AGCTGGGCGCCGTGTACACAG	0.647																																					p.A28A		Atlas-SNP	.											.	CEL	71	.	0			c.C84T						PASS	.						60.0	69.0	66.0					9																	135939799		2074	4198	6272	SO:0001819	synonymous_variant	1056	exon2			GGGCGCCGTGTAC	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.84C>T	chr9.hg19:g.135939799C>T		66.0	0.0	.		74.0	5.0	.	NM_001807	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Silent	SNP	ENST00000372080.4	hg19	CCDS43896.1																																																																																			.	.	.	none		0.647	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1		
CACNA1B	774	hgsc.bcm.edu	37	9	141016005	141016005	+	Nonsense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr9:141016005C>T	ENST00000371372.1	+	47	6719	c.6574C>T	c.(6574-6576)Cag>Tag	p.Q2192*	CACNA1B_ENST00000371355.4_Nonsense_Mutation_p.Q2193*|CACNA1B_ENST00000277549.5_Nonsense_Mutation_p.Q1386*|CACNA1B_ENST00000277551.2_Intron|CACNA1B_ENST00000371357.1_Nonsense_Mutation_p.Q2191*|CACNA1B_ENST00000371363.1_Nonsense_Mutation_p.Q2190*	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	2192					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GCAGCTCCCCCAGACGCCCCT	0.657																																					p.Q2192X		Atlas-SNP	.											.	CACNA1B	266	.	0			c.C6574T						PASS	.						29.0	34.0	32.0					9																	141016005		1959	4128	6087	SO:0001587	stop_gained	774	exon46			CTCCCCCAGACGC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.6574C>T	chr9.hg19:g.141016005C>T	ENSP00000360423:p.Gln2192*	93.0	0.0	.		73.0	34.0	.	NM_000718	B1AQK5	Nonsense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	C	56	26.872562	0.99970	.	.	ENSG00000148408	ENST00000371372;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	18.2603	0.90033	0.0:1.0:0.0:0.0	.	.	.	.	X	2192;1386;2190;2191;2193	.	ENSP00000277549:Q1386X	Q	+	1	0	CACNA1B	140135826	1.000000	0.71417	1.000000	0.80357	0.490000	0.33462	7.220000	0.78008	2.315000	0.78130	0.555000	0.69702	CAG	.	.	.	none		0.657	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
PITRM1	10531	hgsc.bcm.edu	37	10	3193438	3193438	+	Splice_Site	SNP	C	C	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:3193438C>G	ENST00000224949.4	-	15	1773		c.e15+1		PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Splice_Site|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000451104.2_Splice_Site|PITRM1_ENST00000380994.1_Splice_Site|PITRM1_ENST00000464395.1_5'Flank			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1						positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						TTCACAGTGACCTGTCAGGAC	0.502																																					.		Atlas-SNP	.											.	PITRM1	109	.	0			c.1738+1G>C						PASS	.						53.0	51.0	52.0					10																	3193438		1924	4123	6047	SO:0001630	splice_region_variant	10531	exon16			CAGTGACCTGTCA	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.1738+1G>C	chr10.hg19:g.3193438C>G		145.0	0.0	.		121.0	60.0	.	NM_014889	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Splice_Site	SNP	ENST00000224949.4	hg19	CCDS59208.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	14.12|14.12	2.441743|2.441743	0.43326|0.43326	.|.	.|.	ENSG00000107959|ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000380994;ENST00000451104|ENST00000430362	.|.	.|.	.|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|.	.|.	.|.	.|.	.|T	.|0.76543	.|0.4002	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74581	.|-0.3618	.|4	.|.	.|.	.|.	.|.	19.7539|19.7539	0.96283|0.96283	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|S	-1|216	.|.	.|.	.|R	-|-	.|3	.|2	PITRM1|PITRM1	3183438|3183438	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.152000|0.152000	0.21847|0.21847	5.524000|5.524000	0.67105|0.67105	2.668000|2.668000	0.90789|0.90789	0.561000|0.561000	0.74099|0.74099	.|AGG	.	.	.	none		0.502	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		Intron
CCDC7	79741	hgsc.bcm.edu	37	10	33017895	33017895	+	Missense_Mutation	SNP	C	C	G	rs202220321	byFrequency	TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:33017895C>G	ENST00000375030.2	+	12	1312	c.694C>G	c.(694-696)Caa>Gaa	p.Q232E	C10orf68_ENST00000375028.3_Missense_Mutation_p.Q200E|C10orf68_ENST00000375025.4_Missense_Mutation_p.Q224E			Q9H943	CJ068_HUMAN		224										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						AGAAAAGAAACAAATAAATTC	0.294																																					p.Q224E		Atlas-SNP	.											.	C10orf68	75	.	0			c.C670G						PASS	.						57.0	57.0	57.0					10																	33017895		2202	4296	6498	SO:0001583	missense	79741	exon9			AAGAAACAAATAA																												ENST00000375030.2:c.694C>G	chr10.hg19:g.33017895C>G	ENSP00000364170:p.Gln232Glu	348.0	0.0	.		304.0	31.0	.	NM_024688	B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	ENST00000375030.2	hg19		.	.	.	.	.	.	.	.	.	.	.	10.24	1.294784	0.23564	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.27720	1.68;1.65;1.67;1.67	2.21	0.181	0.15073	.	.	.	.	.	T	0.29256	0.0728	L	0.44542	1.39	0.09310	N	1	P;B;P;B	0.43578	0.811;0.039;0.811;0.039	P;B;P;B	0.54924	0.764;0.058;0.764;0.058	T	0.18681	-1.0329	9	0.02654	T	1	.	4.3059	0.10947	0.2495:0.4698:0.2806:0.0	.	141;224;200;232	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	E	224;232;200;224;172	ENSP00000303710:Q224E;ENSP00000364170:Q232E;ENSP00000364168:Q200E;ENSP00000364165:Q224E	ENSP00000303710:Q224E	Q	+	1	0	C10orf68	33057901	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.391000	0.07323	0.028000	0.15324	-0.324000	0.08512	CAA	.	.	.	none		0.294	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000313999.2		
FAM21C	253725	hgsc.bcm.edu	37	10	46264959	46264959	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:46264959A>T	ENST00000336378.4	+	20	2044	c.1926A>T	c.(1924-1926)gaA>gaT	p.E642D	FAM21C_ENST00000537517.1_Missense_Mutation_p.E620D|FAM21C_ENST00000540872.1_Missense_Mutation_p.E644D|FAM21C_ENST00000374362.2_Missense_Mutation_p.E644D|FAM21C_ENST00000359860.4_Missense_Mutation_p.E586D	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	642					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CTAAAGGAGAACCCAGGGATT	0.458																																					p.E644D		Atlas-SNP	.											FAM21C,NS,carcinoma,0,1	FAM21C	68	.	0			c.A1932T						PASS	.						14.0	14.0	14.0					10																	46264959		1412	3417	4829	SO:0001583	missense	253725	exon20			AGGAGAACCCAGG		CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1926A>T	chr10.hg19:g.46264959A>T	ENSP00000337541:p.Glu642Asp	546.0	0.0	.		474.0	168.0	.	NM_015262	B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	ENST00000336378.4	hg19		.	.	.	.	.	.	.	.	.	.	A	5.187	0.220030	0.09863	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.08	0.225	0.15325	.	0.636826	0.15981	N	0.235294	T	0.24774	0.0601	L	0.41824	1.3	0.09310	N	0.999993	P;B;B;B	0.43169	0.8;0.013;0.013;0.099	B;B;B;B	0.43331	0.416;0.014;0.014;0.041	T	0.16928	-1.0386	9	0.12766	T	0.61	-5.5005	4.9224	0.13876	0.5671:0.0:0.4329:0.0	.	620;644;642;587	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	D	642;644;620;644;644;586;556	.	ENSP00000337541:E642D	E	+	3	2	FAM21C	45584965	0.420000	0.25457	0.108000	0.21378	0.396000	0.30629	0.238000	0.18004	-0.046000	0.13446	0.448000	0.29417	GAA	.	.	.	none		0.458	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
CDK1	983	hgsc.bcm.edu	37	10	62551998	62551998	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:62551998T>C	ENST00000395284.3	+	7	888	c.746T>C	c.(745-747)cTa>cCa	p.L249P	CDK1_ENST00000316629.4_Missense_Mutation_p.L192P|CDK1_ENST00000373809.2_Missense_Mutation_p.L192P|CDK1_ENST00000448257.2_Missense_Mutation_p.L249P	NM_001786.4	NP_001777.1	P06493	CDK1_HUMAN	cyclin-dependent kinase 1	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell aging (GO:0007569)|cell migration (GO:0016477)|cellular response to hydrogen peroxide (GO:0070301)|centrosome cycle (GO:0007098)|chromosome condensation (GO:0030261)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|pronuclear fusion (GO:0007344)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|Ras protein signal transduction (GO:0007265)|regulation of embryonic development (GO:0045995)|regulation of Schwann cell differentiation (GO:0014038)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to activity (GO:0014823)|response to amine (GO:0014075)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organic cyclic compound (GO:0014070)|response to toxic substance (GO:0009636)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|histone kinase activity (GO:0035173)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			ovary(1)	1						CCAGGAAGCCTAGCATCCCAT	0.393																																					p.L249P		Atlas-SNP	.											.	CDK1	24	.	0			c.T746C						PASS	.						90.0	89.0	89.0					10																	62551998		2203	4300	6503	SO:0001583	missense	983	exon7			GAAGCCTAGCATC	BC014563	CCDS7260.1, CCDS44408.1	10q21.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000170312	ENSG00000170312		"""Cyclin-dependent kinases"""	1722	protein-coding gene	gene with protein product		116940	"""cell division cycle 2, G1 to S and G2 to M"""	CDC2		3553962, 19884882	Standard	NM_001786		Approved	CDC28A	uc001jld.3	P06493	OTTHUMG00000018290	ENST00000395284.3:c.746T>C	chr10.hg19:g.62551998T>C	ENSP00000378699:p.Leu249Pro	107.0	0.0	.		103.0	39.0	.	NM_001786	A8K7C4|C9J497|O60764	Missense_Mutation	SNP	ENST00000395284.3	hg19	CCDS44408.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.231155	0.79688	.	.	ENSG00000170312	ENST00000395284;ENST00000316629;ENST00000448257;ENST00000373809	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	6.02	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66867	0.2833	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.986;0.992;0.988	T	0.70648	-0.4814	10	0.72032	D	0.01	-9.4912	12.7155	0.57113	0.1229:0.0:0.0:0.8771	.	192;255;249	P06493-2;Q5H9N4;P06493	.;.;CDK1_HUMAN	P	249;192;249;192	ENSP00000378699:L249P;ENSP00000325970:L192P;ENSP00000397973:L249P;ENSP00000362915:L192P	ENSP00000325970:L192P	L	+	2	0	CDK1	62222004	1.000000	0.71417	0.636000	0.29352	0.988000	0.76386	6.281000	0.72632	2.311000	0.77944	0.533000	0.62120	CTA	.	.	.	none		0.393	CDK1-007	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048211.2	NM_001786	
NEUROG3	50674	hgsc.bcm.edu	37	10	71332599	71332599	+	Silent	SNP	T	T	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:71332599T>C	ENST00000242462.4	-	2	230	c.201A>G	c.(199-201)ggA>ggG	p.G67G	RP11-343J3.2_ENST00000428753.1_RNA	NM_020999.3	NP_066279.2	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	67					central nervous system development (GO:0007417)|endocrine pancreas development (GO:0031018)|epithelial cell differentiation (GO:0030855)|forebrain development (GO:0030900)|hindbrain development (GO:0030902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|peripheral nervous system development (GO:0007422)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of dendrite morphogenesis (GO:0048814)|spinal cord development (GO:0021510)|transdifferentiation (GO:0060290)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription coactivator activity (GO:0003713)			endometrium(4)|large_intestine(2)|lung(6)|prostate(1)	13						GCCGGCTGCGTCCCCCGCGCC	0.697																																					p.G67G		Atlas-SNP	.											.	NEUROG3	33	.	0			c.A201G						PASS	.						35.0	23.0	27.0					10																	71332599		2200	4298	6498	SO:0001819	synonymous_variant	50674	exon2			GCTGCGTCCCCCG	AJ133776	CCDS31212.1	10q21.3	2013-05-21			ENSG00000122859	ENSG00000122859		"""Basic helix-loop-helix proteins"""	13806	protein-coding gene	gene with protein product		604882				9000438, 10677506	Standard	NM_020999		Approved	Atoh5, Math4B, ngn3, bHLHa7	uc001jpp.3	Q9Y4Z2	OTTHUMG00000018391	ENST00000242462.4:c.201A>G	chr10.hg19:g.71332599T>C		57.0	0.0	.		78.0	4.0	.	NM_020999	Q5VVI0|Q6DJX6|Q9BY24	Silent	SNP	ENST00000242462.4	hg19	CCDS31212.1																																																																																			.	.	.	none		0.697	NEUROG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048464.1	NM_020999	
PHRF1	57661	hgsc.bcm.edu	37	11	605692	605692	+	Silent	SNP	C	C	T	rs374393458		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr11:605692C>T	ENST00000264555.5	+	12	1550	c.1422C>T	c.(1420-1422)ccC>ccT	p.P474P	PHRF1_ENST00000533464.1_Silent_p.P470P|PHRF1_ENST00000413872.2_Silent_p.P472P|PHRF1_ENST00000416188.2_Silent_p.P473P	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	474					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						CCCACCAGCCCGTGGCCAGGC	0.637																																					p.P473P		Atlas-SNP	.											.	PHRF1	188	.	0			c.C1419T						PASS	.	C		1,3837		0,1,1918	47.0	53.0	51.0		1419	-9.6	0.8	11		51	0,8238		0,0,4119	no	coding-synonymous	PHRF1	NM_020901.2		0,1,6037	TT,TC,CC		0.0,0.0261,0.0083		473/1649	605692	1,12075	1919	4119	6038	SO:0001819	synonymous_variant	57661	exon12			CCAGCCCGTGGCC	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.1422C>T	chr11.hg19:g.605692C>T		37.0	0.0	.		51.0	21.0	.	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	ENST00000264555.5	hg19																																																																																				.	.	.	weak		0.637	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
OSBPL5	114879	hgsc.bcm.edu	37	11	3111822	3111822	+	Silent	SNP	G	G	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr11:3111822G>C	ENST00000263650.7	-	20	2523	c.2364C>G	c.(2362-2364)ctC>ctG	p.L788L	OSBPL5_ENST00000525498.1_Silent_p.L699L|OSBPL5_ENST00000478260.1_Silent_p.L242L|OSBPL5_ENST00000348039.5_Silent_p.L720L|OSBPL5_ENST00000542243.1_Silent_p.L419L|OSBPL5_ENST00000389989.3_Silent_p.L720L	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	788					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		CCTCGTCTGAGAGCTCTGGGC	0.677																																					p.L788L		Atlas-SNP	.											.	OSBPL5	78	.	0			c.C2364G						PASS	.						67.0	65.0	66.0					11																	3111822		2202	4298	6500	SO:0001819	synonymous_variant	114879	exon20			GTCTGAGAGCTCT	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.2364C>G	chr11.hg19:g.3111822G>C		178.0	0.0	.		204.0	109.0	.	NM_020896	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Silent	SNP	ENST00000263650.7	hg19	CCDS31344.1																																																																																			.	.	.	none		0.677	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2		
MRGPRG	386746	hgsc.bcm.edu	37	11	3239681	3239681	+	Silent	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr11:3239681G>A	ENST00000332314.3	-	1	362	c.363C>T	c.(361-363)gcC>gcT	p.A121A	MRGPRG-AS1_ENST00000420873.2_RNA|MRGPRG-AS1_ENST00000434798.1_RNA	NM_001164377.1	NP_001157849.1	Q86SM5	MRGRG_HUMAN	MAS-related GPR, member G	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)										GGACGGCCGAGGCGTGTCTGG	0.756																																					p.A121A		Atlas-SNP	.											.	MRGPRG	6	.	0			c.C363T						PASS	.						8.0	13.0	11.0					11																	3239681		674	1562	2236	SO:0001819	synonymous_variant	386746	exon1			GGCCGAGGCGTGT	AY255583	CCDS44520.1	11p15.4	2012-08-21	2004-03-25		ENSG00000182170	ENSG00000182170		"""GPCR / Class A : Orphans"""	24829	protein-coding gene	gene with protein product		607234	"""G protein-coupled receptor 169"""	GPR169		12679517	Standard	NM_001164377		Approved	mrgG	uc001lxp.2	Q86SM5	OTTHUMG00000011709	ENST00000332314.3:c.363C>T	chr11.hg19:g.3239681G>A		76.0	0.0	.		80.0	38.0	.	NM_001164377		Silent	SNP	ENST00000332314.3	hg19	CCDS44520.1																																																																																			.	.	.	none		0.756	MRGPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032347.1		
RRM1	6240	hgsc.bcm.edu	37	11	4143450	4143450	+	Splice_Site	SNP	G	G	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr11:4143450G>C	ENST00000300738.5	+	11	1322	c.1118G>C	c.(1117-1119)aGt>aCt	p.S373T	RRM1_ENST00000423050.2_Splice_Site_p.S276T|RRM1_ENST00000537197.1_Splice_Site_p.S35T|RRM1_ENST00000534285.1_Splice_Site_p.S151T|RRM1_ENST00000528470.1_3'UTR	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	373					cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	CTATATGCAAGGTATGGGAAA	0.353																																					p.S373T	NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)	Atlas-SNP	.											.	RRM1	31	.	0			c.G1118C						PASS	.						143.0	136.0	138.0					11																	4143450		2201	4298	6499	SO:0001630	splice_region_variant	6240	exon11			ATGCAAGGTATGG	X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.1118+1G>C	chr11.hg19:g.4143450G>C		79.0	0.0	.		72.0	28.0	.	NM_001033	Q9UNN2	Missense_Mutation	SNP	ENST00000300738.5	hg19	CCDS7750.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307194	0.40795	.	.	ENSG00000167325	ENST00000300738;ENST00000423050;ENST00000536894;ENST00000534285;ENST00000543838;ENST00000537197	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.7	4.79	0.61399	Ribonucleoside-diphosphate reductase, alpha subunit (1);Ribonucleotide reductase large subunit, C-terminal (1);	0.340623	0.37530	N	0.002041	T	0.33089	0.0851	L	0.34521	1.04	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11084	-1.0602	10	0.59425	D	0.04	-3.1579	11.9367	0.52878	0.0801:0.0:0.9199:0.0	.	373	P23921	RIR1_HUMAN	T	373;276;286;151;151;35	ENSP00000300738:S373T;ENSP00000390539:S276T;ENSP00000431464:S151T;ENSP00000442148:S35T	ENSP00000300738:S373T	S	+	2	0	RRM1	4100026	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	4.984000	0.63838	1.409000	0.46915	0.557000	0.71058	AGT	.	.	.	none		0.353	RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257197.1	NM_001033	Missense_Mutation
TCP11L1	55346	hgsc.bcm.edu	37	11	33083259	33083259	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr11:33083259G>T	ENST00000334274.4	+	7	1359	c.959G>T	c.(958-960)aGg>aTg	p.R320M	TCP11L1_ENST00000432887.1_Missense_Mutation_p.R320M|TCP11L1_ENST00000531632.2_Missense_Mutation_p.R320M|TCP11L1_ENST00000324357.9_Missense_Mutation_p.R99M	NM_018393.3	NP_060863.3	Q9NUJ3	T11L1_HUMAN	t-complex 11, testis-specific-like 1	320						microtubule (GO:0005874)				kidney(1)|liver(2)|lung(2)|skin(1)	6						CACCTCCAGAGGCCGTTCCCC	0.532																																					p.R320M		Atlas-SNP	.											.	TCP11L1	40	.	0			c.G959T						PASS	.						32.0	30.0	31.0					11																	33083259		2202	4298	6500	SO:0001583	missense	55346	exon7			TCCAGAGGCCGTT	BC041696	CCDS7882.1	11p13	2014-08-12	2012-09-20		ENSG00000176148	ENSG00000176148			25655	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 1"""				Standard	NM_001145541		Approved	FLJ11336	uc010rei.2	Q9NUJ3	OTTHUMG00000165303	ENST00000334274.4:c.959G>T	chr11.hg19:g.33083259G>T	ENSP00000335595:p.Arg320Met	151.0	0.0	.		155.0	68.0	.	NM_001145541	D3DR01|Q8IVX4	Missense_Mutation	SNP	ENST00000334274.4	hg19	CCDS7882.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.295641	0.23564	.	.	ENSG00000176148	ENST00000334274;ENST00000531632;ENST00000432887;ENST00000324357	T;T;T;T	0.11821	2.74;2.74;2.74;2.74	5.42	1.52	0.23074	.	0.300219	0.42548	D	0.000689	T	0.17831	0.0428	M	0.64997	1.995	0.09310	N	1	P	0.42941	0.794	P	0.45377	0.478	T	0.06144	-1.0843	10	0.72032	D	0.01	-4.844	8.6816	0.34212	0.4363:0.0:0.5637:0.0	.	320	Q9NUJ3	T11L1_HUMAN	M	320;320;320;99	ENSP00000335595:R320M;ENSP00000433067:R320M;ENSP00000395070:R320M;ENSP00000316279:R99M	ENSP00000316279:R99M	R	+	2	0	TCP11L1	33039835	0.995000	0.38212	0.002000	0.10522	0.003000	0.03518	1.522000	0.35921	0.275000	0.22094	-0.143000	0.13931	AGG	.	.	.	none		0.532	TCP11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383377.4	NM_018393	
MMP27	64066	hgsc.bcm.edu	37	11	102562558	102562558	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr11:102562558C>G	ENST00000260229.4	-	10	1572	c.1481G>C	c.(1480-1482)aGt>aCt	p.S494T		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	494	Required for retention in the endoplasmic reticulum. {ECO:0000269|PubMed:24548619}.				collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	CAAGCTTAAACTCTTATGATA	0.299																																					p.S494T		Atlas-SNP	.											.	MMP27	84	.	0			c.G1481C						PASS	.						114.0	113.0	113.0					11																	102562558		2203	4295	6498	SO:0001583	missense	64066	exon10			CTTAAACTCTTAT	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.1481G>C	chr11.hg19:g.102562558C>G	ENSP00000260229:p.Ser494Thr	136.0	0.0	.		107.0	17.0	.	NM_022122	Q6UWK6	Missense_Mutation	SNP	ENST00000260229.4	hg19	CCDS8319.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.456849	0.26161	.	.	ENSG00000137675	ENST00000260229	T	0.13538	2.58	5.83	1.67	0.24075	.	0.496244	0.18873	N	0.128791	T	0.07638	0.0192	L	0.34521	1.04	0.09310	N	1	B	0.27498	0.18	B	0.22601	0.04	T	0.41016	-0.9532	10	0.02654	T	1	.	8.7498	0.34609	0.0:0.6807:0.0:0.3193	.	494	Q9H306	MMP27_HUMAN	T	494	ENSP00000260229:S494T	ENSP00000260229:S494T	S	-	2	0	MMP27	102067768	0.001000	0.12720	0.045000	0.18777	0.845000	0.48019	0.104000	0.15313	0.026000	0.15269	0.563000	0.77884	AGT	.	.	.	none		0.299	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122	
IFT46	56912	hgsc.bcm.edu	37	11	118416523	118416523	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr11:118416523T>G	ENST00000264021.3	-	10	1136	c.718A>C	c.(718-720)Att>Ctt	p.I240L	IFT46_ENST00000530872.1_Missense_Mutation_p.I291L|TMEM25_ENST00000354284.4_Intron|IFT46_ENST00000264020.2_Missense_Mutation_p.I291L|TMEM25_ENST00000442938.2_Intron	NM_001168618.1	NP_001162089.1	Q9NQC8	IFT46_HUMAN	intraflagellar transport 46	240					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|protein stabilization (GO:0050821)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)	protein C-terminus binding (GO:0008022)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9						ATCATGTCAATGTACTCTGCC	0.507																																					p.I291L		Atlas-SNP	.											.	IFT46	19	.	0			c.A871C						PASS	.						179.0	148.0	158.0					11																	118416523		2200	4295	6495	SO:0001583	missense	56912	exon11			TGTCAATGTACTC	AL136934	CCDS8399.1, CCDS53718.1	11q23.3	2014-07-18	2014-07-03	2010-04-22	ENSG00000118096	ENSG00000118096		"""Intraflagellar transport homologs"""	26146	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 32"""		"""chromosome 11 open reading frame 60"", ""intraflagellar transport 46 homolog (Chlamydomonas)"""	C11orf60		10873569, 19253336	Standard	NM_020153		Approved	C11orf2, FLJ21827, CFAP32	uc001pto.2	Q9NQC8	OTTHUMG00000166408	ENST00000264021.3:c.718A>C	chr11.hg19:g.118416523T>G	ENSP00000264021:p.Ile240Leu	125.0	0.0	.		112.0	8.0	.	NM_020153	A8K0F6|Q9H6V5	Missense_Mutation	SNP	ENST00000264021.3	hg19	CCDS53718.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.180313	0.57800	.	.	ENSG00000118096	ENST00000264021;ENST00000264020;ENST00000530872	T;T;T	0.46819	0.87;0.86;0.86	6.03	3.76	0.43208	.	0.364645	0.29335	N	0.012458	T	0.43277	0.1240	M	0.65975	2.015	0.37231	D	0.905678	B;P;B	0.34462	0.139;0.454;0.114	B;B;B	0.31016	0.06;0.123;0.078	T	0.53078	-0.8489	10	0.62326	D	0.03	-8.0521	9.6786	0.40056	0.0:0.1401:0.0:0.8599	.	291;240;291	E9PR06;Q9NQC8;Q9NQC8-2	.;IFT46_HUMAN;.	L	240;291;291	ENSP00000264021:I240L;ENSP00000264020:I291L;ENSP00000432384:I291L	ENSP00000264020:I291L	I	-	1	0	IFT46	117921733	1.000000	0.71417	0.997000	0.53966	0.835000	0.47333	1.106000	0.31098	1.109000	0.41680	0.533000	0.62120	ATT	.	.	.	none		0.507	IFT46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389627.1	NM_020153	
CAND1	55832	hgsc.bcm.edu	37	12	67696393	67696393	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr12:67696393C>A	ENST00000545606.1	+	8	1728	c.1291C>A	c.(1291-1293)Cag>Aag	p.Q431K		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	431					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		GCTTCAGAGTCAGGTGGGTTT	0.363																																					p.Q431K		Atlas-SNP	.											.	CAND1	100	.	0			c.C1291A						PASS	.						88.0	78.0	81.0					12																	67696393		2203	4300	6503	SO:0001583	missense	55832	exon8			CAGAGTCAGGTGG		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1291C>A	chr12.hg19:g.67696393C>A	ENSP00000442318:p.Gln431Lys	119.0	0.0	.		99.0	39.0	.	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	hg19	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	C	30	5.051857	0.93793	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047;ENST00000544619	T;T	0.65364	-0.15;-0.15	5.4	5.4	0.78164	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80555	0.4645	M	0.85630	2.765	0.80722	D	1	P;D	0.61697	0.593;0.99	P;P	0.61397	0.828;0.888	T	0.82116	-0.0616	9	.	.	.	-6.9157	19.547	0.95302	0.0:1.0:0.0:0.0	.	431;431	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	K	431;431;273;139	ENSP00000442318:Q431K;ENSP00000444089:Q139K	.	Q	+	1	0	CAND1	65982660	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	7.719000	0.84751	2.699000	0.92147	0.555000	0.69702	CAG	.	.	.	none		0.363	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
NAV3	89795	hgsc.bcm.edu	37	12	78593299	78593299	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr12:78593299G>T	ENST00000397909.2	+	37	6876	c.6703G>T	c.(6703-6705)Gac>Tac	p.D2235Y	NAV3_ENST00000541270.1_Missense_Mutation_p.D65Y|NAV3_ENST00000266692.7_Missense_Mutation_p.D2036Y|NAV3_ENST00000228327.6_Missense_Mutation_p.D2213Y|NAV3_ENST00000536525.2_Missense_Mutation_p.D2213Y			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2235						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CAGTTCTTCTGACGTTACCAT	0.383										HNSCC(70;0.22)																											p.D2213Y		Atlas-SNP	.											.	NAV3	506	.	0			c.G6637T						PASS	.						80.0	78.0	79.0					12																	78593299		1863	4091	5954	SO:0001583	missense	89795	exon36			TCTTCTGACGTTA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6703G>T	chr12.hg19:g.78593299G>T	ENSP00000381007:p.Asp2235Tyr	178.0	0.0	.		128.0	47.0	.	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.985795|3.985795	0.74589|0.74589	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000541270|ENST00000552895;ENST00000551162	T;T;T;T;T|.	0.53206|.	1.3;1.31;1.3;1.28;0.63|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.41396|.	U|.	0.000895|.	D|.	0.84593|.	0.5506|.	M|M	0.87900|0.87900	2.915|2.915	0.80722|0.80722	D|D	1|1	D;D;P;D|.	0.89917|.	0.974;1.0;0.911;1.0|.	P;D;P;D|.	0.91635|.	0.829;0.998;0.504;0.999|.	D|.	0.85408|.	0.1135|.	10|.	0.87932|.	D|.	0|.	-21.054|-21.054	20.2245|20.2245	0.98337|0.98337	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2213;2036;2235;2213|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	Y|L	2213;2235;2213;2036;65|1107;102	ENSP00000446132:D2213Y;ENSP00000381007:D2235Y;ENSP00000228327:D2213Y;ENSP00000266692:D2036Y;ENSP00000444918:D65Y|.	ENSP00000228327:D2213Y|.	D|X	+|+	1|2	0|2	NAV3|NAV3	77117430|77117430	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.813000|9.813000	0.99286|0.99286	2.861000|2.861000	0.98227|0.98227	0.650000|0.650000	0.86243|0.86243	GAC|TGA	.	.	.	none		0.383	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
RBM19	9904	hgsc.bcm.edu	37	12	114377884	114377884	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr12:114377884A>T	ENST00000545145.2	-	15	1897	c.1819T>A	c.(1819-1821)Ttc>Atc	p.F607I	RBM19_ENST00000392561.3_Missense_Mutation_p.F607I|RP11-780K2.1_ENST00000550206.1_RNA|RBM19_ENST00000261741.5_Missense_Mutation_p.F607I	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	607	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					AAATGGCCGAAGGTCTCCTGC	0.637																																					p.F607I		Atlas-SNP	.											.	RBM19	117	.	0			c.T1819A						PASS	.						66.0	71.0	69.0					12																	114377884		2203	4300	6503	SO:0001583	missense	9904	exon15			GGCCGAAGGTCTC	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1819T>A	chr12.hg19:g.114377884A>T	ENSP00000442053:p.Phe607Ile	86.0	0.0	.		78.0	11.0	.	NM_001146699	A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	ENST00000545145.2	hg19	CCDS9172.1	.	.	.	.	.	.	.	.	.	.	A	17.41	3.382304	0.61845	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.15139	2.45;2.45;2.45	4.3	4.3	0.51218	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71695	-0.4515	10	0.87932	D	0	-14.4911	13.458	0.61210	1.0:0.0:0.0:0.0	.	607	Q9Y4C8	RBM19_HUMAN	I	607	ENSP00000442053:F607I;ENSP00000376344:F607I;ENSP00000261741:F607I	ENSP00000261741:F607I	F	-	1	0	RBM19	112862267	1.000000	0.71417	0.249000	0.24280	0.148000	0.21650	8.500000	0.90498	1.600000	0.50102	0.459000	0.35465	TTC	.	.	.	none		0.637	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196	
KNTC1	9735	hgsc.bcm.edu	37	12	123052914	123052914	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr12:123052914C>T	ENST00000333479.7	+	21	1888	c.1711C>T	c.(1711-1713)Cat>Tat	p.H571Y	KNTC1_ENST00000450485.2_Missense_Mutation_p.H534Y	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	571					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTGGCTTCGACATCGGGTAAC	0.343																																					p.H571Y		Atlas-SNP	.											.	KNTC1	182	.	0			c.C1711T						PASS	.						150.0	145.0	147.0					12																	123052914		1859	4093	5952	SO:0001583	missense	9735	exon21			CTTCGACATCGGG		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.1711C>T	chr12.hg19:g.123052914C>T	ENSP00000328236:p.His571Tyr	212.0	0.0	.		158.0	73.0	.	NM_014708	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	hg19	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.370581	0.42003	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.32272	1.46;1.9	5.36	5.36	0.76844	.	0.178872	0.50627	D	0.000105	T	0.33381	0.0861	L	0.55103	1.725	0.80722	D	1	B;B	0.32071	0.068;0.355	B;B	0.29267	0.009;0.1	T	0.12016	-1.0564	10	0.51188	T	0.08	-13.3748	19.0977	0.93260	0.0:1.0:0.0:0.0	.	534;571	E7ES84;P50748	.;KNTC1_HUMAN	Y	534;571	ENSP00000397992:H534Y;ENSP00000328236:H571Y	ENSP00000328236:H571Y	H	+	1	0	KNTC1	121618867	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.016000	0.40971	2.516000	0.84829	0.460000	0.39030	CAT	.	.	.	none		0.343	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
HSPH1	10808	hgsc.bcm.edu	37	13	31728852	31728852	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr13:31728852T>C	ENST00000320027.5	-	4	691	c.347A>G	c.(346-348)cAg>cGg	p.Q116R	HSPH1_ENST00000380406.5_Intron|HSPH1_ENST00000380405.4_Missense_Mutation_p.Q116R|HSPH1_ENST00000429785.2_Missense_Mutation_p.Q13R|HSPH1_ENST00000445273.2_Missense_Mutation_p.Q118R	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	116					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		GGCTGTTATCTGCTCCACACT	0.343																																					p.Q116R		Atlas-SNP	.											.	HSPH1	65	.	0			c.A347G						PASS	.						157.0	137.0	144.0					13																	31728852		2203	4300	6503	SO:0001583	missense	10808	exon4			GTTATCTGCTCCA	AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.347A>G	chr13.hg19:g.31728852T>C	ENSP00000318687:p.Gln116Arg	92.0	0.0	.		77.0	37.0	.	NM_006644	B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	ENST00000320027.5	hg19	CCDS9340.1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.235880	0.39498	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000445273;ENST00000429785;ENST00000438061	T;T;T;T	0.05717	5.3;5.3;5.3;3.4	6.08	6.08	0.98989	.	0.134584	0.50627	D	0.000112	T	0.27697	0.0681	M	0.77103	2.36	0.32658	N	0.518415	D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.992;1.0;1.0;1.0;1.0;1.0	T	0.30621	-0.9972	10	0.66056	D	0.02	-17.9521	16.643	0.85134	0.0:0.0:0.0:1.0	.	13;167;167;118;116;116	B4DY72;E7EUG1;B4DZB4;B4DYH1;Q92598-2;Q92598	.;.;.;.;.;HS105_HUMAN	R	116;116;118;13;167	ENSP00000318687:Q116R;ENSP00000369768:Q116R;ENSP00000396090:Q118R;ENSP00000388778:Q13R	ENSP00000318687:Q116R	Q	-	2	0	HSPH1	30626852	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	7.698000	0.84413	2.330000	0.79161	0.533000	0.62120	CAG	.	.	.	none		0.343	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044384.1		
HNRNPC	3183	hgsc.bcm.edu	37	14	21679430	21679430	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr14:21679430C>A	ENST00000320084.7	-	8	1112	c.873G>T	c.(871-873)gaG>gaT	p.E291D	HNRNPC_ENST00000554455.1_Missense_Mutation_p.E291D|HNRNPC_ENST00000420743.2_Missense_Mutation_p.E291D|HNRNPC_ENST00000336053.6_3'UTR|HNRNPC_ENST00000555914.1_Missense_Mutation_p.E277D|HNRNPC_ENST00000556628.1_Missense_Mutation_p.E211D|HNRNPC_ENST00000449098.1_Missense_Mutation_p.E278D|HNRNPC_ENST00000553753.1_3'UTR|HNRNPC_ENST00000555883.1_Missense_Mutation_p.E235D|HNRNPC_ENST00000430246.2_Missense_Mutation_p.E278D|HNRNPC_ENST00000556142.1_3'UTR|HNRNPC_ENST00000555309.1_Missense_Mutation_p.E290D|HNRNPC_ENST00000556897.1_Missense_Mutation_p.E278D|HNRNPC_ENST00000556513.1_3'UTR|HNRNPC_ENST00000554969.1_Missense_Mutation_p.E278D|HNRNPC_ENST00000553300.1_Missense_Mutation_p.E278D|HNRNPC_ENST00000557201.1_Missense_Mutation_p.E291D	NM_001077442.1	NP_001070910.1	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C (C1/C2)	291	Asp/Glu-rich (acidic).				3'-UTR-mediated mRNA stabilization (GO:0070935)|ATP-dependent chromatin remodeling (GO:0043044)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|spliceosomal complex (GO:0005681)	identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleosomal DNA binding (GO:0031492)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|liver(1)|lung(6)|skin(1)	9	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		CCTCTCCTTCCTCAGCCTCTT	0.488																																					p.E291D	NSCLC(108;607 2244 12726 38757)	Atlas-SNP	.											.	HNRNPC	31	.	0			c.G873T						PASS	.						124.0	134.0	131.0					14																	21679430		2138	4253	6391	SO:0001583	missense	3183	exon9			TCCTTCCTCAGCC		CCDS41915.1, CCDS45079.1	14q11.2	2013-06-12		2007-08-16	ENSG00000092199	ENSG00000092199		"""RNA binding motif (RRM) containing"""	5035	protein-coding gene	gene with protein product		164020		HNRPC		3457372	Standard	NM_031314		Approved	hnRNPC	uc001waa.3	P07910	OTTHUMG00000170757	ENST00000320084.7:c.873G>T	chr14.hg19:g.21679430C>A	ENSP00000319690:p.Glu291Asp	124.0	0.0	.		102.0	42.0	.	NM_031314	D3DS19|D3DS22|P22628|Q53EX2|Q59FD3|Q5FWE8|Q86SF8|Q86U45|Q96HK7|Q96HM4|Q96IY5|Q9BTS3	Missense_Mutation	SNP	ENST00000320084.7	hg19	CCDS41915.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377766	0.61735	.	.	ENSG00000092199	ENST00000320084;ENST00000449098;ENST00000554969;ENST00000554455;ENST00000430246;ENST00000400042;ENST00000555914;ENST00000555309;ENST00000556628;ENST00000555883;ENST00000557201;ENST00000553300;ENST00000556897;ENST00000420743;ENST00000557157;ENST00000445284;ENST00000554539	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.15603	3.0;2.83;2.83;3.0;2.83;2.83;3.0;2.41;2.57;3.0;2.83;2.83;3.0;2.65;2.41	5.85	4.78	0.61160	.	0.170959	0.35179	U	0.003390	T	0.35098	0.0920	M	0.66939	2.045	0.39716	D	0.971396	D;D;D;P;D	0.71674	0.992;0.998;0.974;0.956;0.974	D;D;D;D;D	0.80764	0.986;0.994;0.969;0.931;0.969	T	0.07385	-1.0775	10	0.56958	D	0.05	.	7.8423	0.29406	0.0:0.7836:0.0:0.2164	.	211;235;277;291;278	P07910-3;P07910-4;G3V4C1;P07910;P07910-2	.;.;.;HNRPC_HUMAN;.	D	291;278;278;291;278;87;277;290;211;235;291;278;278;291;199;291;175	ENSP00000319690:E291D;ENSP00000404559:E278D;ENSP00000450725:E278D;ENSP00000451291:E291D;ENSP00000442816:E278D;ENSP00000451708:E277D;ENSP00000450790:E290D;ENSP00000451652:E211D;ENSP00000450629:E235D;ENSP00000452276:E291D;ENSP00000450544:E278D;ENSP00000451176:E278D;ENSP00000404848:E291D;ENSP00000450601:E199D;ENSP00000452545:E175D	ENSP00000319690:E291D	E	-	3	2	HNRNPC	20749270	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.775000	0.38584	2.755000	0.94549	0.655000	0.94253	GAG	.	.	.	none		0.488	HNRNPC-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410235.1		
WDR20	91833	hgsc.bcm.edu	37	14	102675867	102675867	+	Missense_Mutation	SNP	A	A	G	rs374240865		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr14:102675867A>G	ENST00000342702.3	+	3	1391	c.1360A>G	c.(1360-1362)Att>Gtt	p.I454V	WDR20_ENST00000499851.2_Missense_Mutation_p.I197V|WDR20_ENST00000322340.5_Intron|WDR20_ENST00000335263.5_Missense_Mutation_p.I454V|WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000545563.1_Missense_Mutation_p.I281V|WDR20_ENST00000556807.1_Missense_Mutation_p.I393V|WDR20_ENST00000556511.2_Missense_Mutation_p.I393V|WDR20_ENST00000424963.2_Missense_Mutation_p.I330V|WDR20_ENST00000454394.2_Missense_Mutation_p.I485V	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	454										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						GGACGGGGCCATTGCTTCTGG	0.532											OREG0022939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I485V		Atlas-SNP	.											.	WDR20	35	.	0			c.A1453G						PASS	.	A	,,VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE	1,4405	2.1+/-5.4	0,1,2202	102.0	101.0	102.0		,,1177,1453,1396,1360,1360,1177	-0.9	0.9	14		102	0,8600		0,0,4300	no	utr-3,intron,missense,missense,missense,missense,missense,missense	WDR20	NM_001242414.1,NM_001242415.1,NM_001242416.1,NM_001242417.1,NM_001242418.1,NM_144574.3,NM_181291.2,NM_181308.2	,,29,29,29,29,29,29	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	,,benign,benign,benign,benign,benign,benign	,,393/521,485/601,466/582,454/570,454/582,393/509	102675867	1,13005	2203	4300	6503	SO:0001583	missense	91833	exon4			GGGGCCATTGCTT	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.1360A>G	chr14.hg19:g.102675867A>G	ENSP00000341037:p.Ile454Val	134.0	0.0	.	1368	126.0	70.0	.	NM_001242417	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Missense_Mutation	SNP	ENST00000342702.3	hg19	CCDS9969.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.973|0.973	-0.699494|-0.699494	0.03279|0.03279	2.27E-4|2.27E-4	0.0|0.0	ENSG00000140153|ENSG00000140153	ENST00000556511|ENST00000335263;ENST00000299135;ENST00000424963;ENST00000342702;ENST00000556807;ENST00000499851;ENST00000454394;ENST00000401892;ENST00000545563	.|T;T;T;T;T;T;T	.|0.57107	.|0.42;0.42;0.42;0.42;0.42;0.42;0.42	5.73|5.73	-0.897|-0.897	0.10553|0.10553	.|.	.|0.202343	.|0.51477	.|N	.|0.000097	T|T	0.31358|0.31358	0.0794|0.0794	L|L	0.34521|0.34521	1.04|1.04	0.45883|0.45883	D|D	0.998733|0.998733	.|B;B;B;B;B;B;B	.|0.06786	.|0.0;0.0;0.0;0.0;0.0;0.001;0.0	.|B;B;B;B;B;B;B	.|0.04013	.|0.001;0.0;0.001;0.001;0.001;0.0;0.0	T|T	0.10222|0.10222	-1.0639|-1.0639	5|10	.|0.12430	.|T	.|0.62	.|.	6.2989|6.2989	0.21101|0.21101	0.6201:0.1198:0.2601:0.0|0.6201:0.1198:0.2601:0.0	.|.	.|485;466;393;454;393;330;454	.|E7EUY8;Q5JPH5;G3V2F8;Q8TBZ3-2;F8W9S4;B3KR43;Q8TBZ3	.|.;.;.;.;.;.;WDR20_HUMAN	R|V	384|454;393;330;454;393;197;485;384;281	.|ENSP00000335434:I454V;ENSP00000395793:I330V;ENSP00000341037:I454V;ENSP00000450636:I393V;ENSP00000443641:I197V;ENSP00000406084:I485V;ENSP00000437927:I281V	.|ENSP00000299135:I393V	H|I	+|+	2|1	0|0	WDR20|WDR20	101745620|101745620	1.000000|1.000000	0.71417|0.71417	0.860000|0.860000	0.33809|0.33809	0.999000|0.999000	0.98932|0.98932	1.243000|1.243000	0.32767|0.32767	-0.385000|-0.385000	0.07833|0.07833	0.533000|0.533000	0.62120|0.62120	CAT|ATT	.	.	.	weak		0.532	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414963.1	NM_181291	
AQR	9716	hgsc.bcm.edu	37	15	35196623	35196623	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr15:35196623T>G	ENST00000156471.5	-	19	2140	c.1915A>C	c.(1915-1917)Acc>Ccc	p.T639P		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	639					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		ATAGTATTGGTCATATCTTGT	0.348																																					p.T639P		Atlas-SNP	.											.	AQR	139	.	0			c.A1915C						PASS	.						111.0	101.0	104.0					15																	35196623		1810	4073	5883	SO:0001583	missense	9716	exon19			TATTGGTCATATC	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1915A>C	chr15.hg19:g.35196623T>G	ENSP00000156471:p.Thr639Pro	181.0	0.0	.		138.0	70.0	.	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	hg19	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.328239	0.41197	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93763	-3.28	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.91226	0.7235	M	0.61703	1.905	0.48975	D	0.999738	P	0.46706	0.883	B	0.38458	0.274	D	0.91292	0.5060	10	0.42905	T	0.14	-16.3603	15.4615	0.75359	0.0:0.0:0.0:1.0	.	639	O60306	AQR_HUMAN	P	639	ENSP00000156471:T639P	ENSP00000156471:T639P	T	-	1	0	AQR	32983915	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.608000	0.82898	2.117000	0.64856	0.533000	0.62120	ACC	.	.	.	none		0.348	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
RTF1	23168	hgsc.bcm.edu	37	15	41709461	41709461	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr15:41709461G>C	ENST00000389629.4	+	1	160	c.148G>C	c.(148-150)Gtg>Ctg	p.V50L	RTF1_ENST00000462276.1_3'UTR	NM_015138.4	NP_055953.3	Q92541	RTF1_HUMAN	Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	50					DNA-templated transcription, initiation (GO:0006352)|endodermal cell fate commitment (GO:0001711)|histone H3-K4 trimethylation (GO:0080182)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	18		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		AGGCCGCGTCGTGATCGACTC	0.721																																					p.V50L		Atlas-SNP	.											.	RTF1	76	.	0			c.G148C						PASS	.						18.0	22.0	21.0					15																	41709461		692	1591	2283	SO:0001583	missense	23168	exon1			CGCGTCGTGATCG	D87440	CCDS32200.2	15q14	2004-03-03	2005-07-20	2005-07-20	ENSG00000137815	ENSG00000137815			28996	protein-coding gene	gene with protein product		611633	"""KIAA0252"""	KIAA0252		15632063	Standard	NM_015138		Approved		uc001zny.3	Q92541	OTTHUMG00000133744	ENST00000389629.4:c.148G>C	chr15.hg19:g.41709461G>C	ENSP00000374280:p.Val50Leu	243.0	0.0	.		172.0	78.0	.	NM_015138	Q96BX6	Missense_Mutation	SNP	ENST00000389629.4	hg19	CCDS32200.2	.	.	.	.	.	.	.	.	.	.	G	14.44	2.537417	0.45176	.	.	ENSG00000137815	ENST00000389629	.	.	.	4.06	4.06	0.47325	.	0.093110	0.41500	U	0.000876	T	0.39462	0.1079	N	0.16790	0.44	0.37411	D	0.913231	B	0.06786	0.001	B	0.04013	0.001	T	0.36286	-0.9754	9	0.26408	T	0.33	-1.56	12.7087	0.57078	0.0:0.2172:0.7828:0.0	.	50	Q92541	RTF1_HUMAN	L	50	.	ENSP00000374280:V50L	V	+	1	0	RTF1	39496753	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	5.349000	0.66010	2.252000	0.74401	0.462000	0.41574	GTG	.	.	.	none		0.721	RTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258111.1	NM_015138	
CA12	771	hgsc.bcm.edu	37	15	63632589	63632589	+	Silent	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr15:63632589G>A	ENST00000178638.3	-	7	1085	c.645C>T	c.(643-645)acC>acT	p.T215T	CA12_ENST00000344366.3_Silent_p.T215T|CA12_ENST00000422263.2_Silent_p.T155T	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	215					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	AATATTCAGCGGTCCTCTCCG	0.567																																					p.T215T		Atlas-SNP	.											CA12,NS,carcinoma,0,1	CA12	33	.	0			c.C645T						PASS	.						90.0	79.0	83.0					15																	63632589		2203	4300	6503	SO:0001819	synonymous_variant	771	exon7			TTCAGCGGTCCTC	AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.645C>T	chr15.hg19:g.63632589G>A		160.0	0.0	.		138.0	33.0	.	NM_206925	B2RE24|Q53YE5|Q9BWG2	Silent	SNP	ENST00000178638.3	hg19	CCDS10185.1																																																																																			.	.	.	none		0.567	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256370.1	NM_001218	
SLC24A1	9187	hgsc.bcm.edu	37	15	65943145	65943145	+	Silent	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr15:65943145G>A	ENST00000261892.6	+	7	2945	c.2658G>A	c.(2656-2658)gaG>gaA	p.E886E	SLC24A1_ENST00000339868.6_Silent_p.E868E|SLC24A1_ENST00000544319.2_Silent_p.E772E|SLC24A1_ENST00000537259.1_Silent_p.E868E|SLC24A1_ENST00000399033.4_Silent_p.E886E|SLC24A1_ENST00000546330.1_Silent_p.E868E|SLC24A1_ENST00000449142.2_3'UTR	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	886	Poly-Glu.				calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						aggaggaggaggaagaggagg	0.567																																					p.E886E		Atlas-SNP	.											.	SLC24A1	58	.	0			c.G2658A						PASS	.						44.0	49.0	48.0					15																	65943145		2194	4289	6483	SO:0001819	synonymous_variant	9187	exon7			GGAGGAGGAAGAG	AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.2658G>A	chr15.hg19:g.65943145G>A		77.0	0.0	.		84.0	4.0	.	NM_004727	O43485|O75184|Q17RM9	Silent	SNP	ENST00000261892.6	hg19	CCDS45284.1																																																																																			.	.	.	none		0.567	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727	
GNG13	51764	hgsc.bcm.edu	37	16	849062	849062	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr16:849062C>T	ENST00000248150.4	-	2	117	c.16G>A	c.(16-18)Gtg>Atg	p.V6M		NM_016541.2	NP_057625.1	Q9P2W3	GBG13_HUMAN	guanine nucleotide binding protein (G protein), gamma 13	6					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|sensory perception of taste (GO:0050909)|small molecule metabolic process (GO:0044281)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|signal transducer activity (GO:0004871)			ovary(1)	1		Hepatocellular(780;0.00335)				ATCTGTGGCACGTCCCACTCC	0.647																																					p.V6M		Atlas-SNP	.											.	GNG13	8	.	0			c.G16A						PASS	.						111.0	88.0	96.0					16																	849062		2198	4298	6496	SO:0001583	missense	51764	exon2			GTGGCACGTCCCA	AB030207	CCDS10427.1	16p13.3	2008-08-01			ENSG00000127588	ENSG00000127588			14131	protein-coding gene	gene with protein product	"""G gamma subunit, clone:h2-35"""	607298				10570481	Standard	NM_016541		Approved	h2-35, G(gamma)13	uc002ckh.4	Q9P2W3	OTTHUMG00000047839	ENST00000248150.4:c.16G>A	chr16.hg19:g.849062C>T	ENSP00000248150:p.Val6Met	30.0	0.0	.		58.0	33.0	.	NM_016541	B2R5C8|Q52LX0|Q9UJJ3	Missense_Mutation	SNP	ENST00000248150.4	hg19	CCDS10427.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.857389	0.32791	.	.	ENSG00000127588	ENST00000248150	T	0.24723	1.84	5.57	3.63	0.41609	G-protein gamma domain (4);	0.498697	0.22298	N	0.061909	T	0.14570	0.0352	.	.	.	0.23632	N	0.997248	P	0.43412	0.806	B	0.32090	0.14	T	0.17471	-1.0368	9	0.56958	D	0.05	-22.0611	7.2617	0.26207	0.0:0.701:0.1418:0.1572	.	6	Q9P2W3	GBG13_HUMAN	M	6	ENSP00000248150:V6M	ENSP00000248150:V6M	V	-	1	0	GNG13	789063	0.135000	0.22499	0.674000	0.29902	0.804000	0.45430	1.921000	0.40035	1.369000	0.46134	-0.221000	0.12465	GTG	.	.	.	none		0.647	GNG13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109062.3	NM_016541	
NLRC3	197358	hgsc.bcm.edu	37	16	3594306	3594306	+	RNA	SNP	T	T	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr16:3594306T>C	ENST00000301749.7	-	0	3200				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|LA16c-390H2.4_ENST00000573820.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CGCTCCGTCATCCCCGATGGC	0.592																																					p.D932G		Atlas-SNP	.											.	NLRC3	103	.	0			c.A2795G						PASS	.						71.0	76.0	74.0					16																	3594306		2092	4224	6316			197358	exon17			CCGTCATCCCCGA	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		chr16.hg19:g.3594306T>C		87.0	0.0	.		113.0	69.0	.	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	hg19		.	.	.	.	.	.	.	.	.	.	T	16.86	3.238733	0.58995	.	.	ENSG00000167984	ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.70516	-0.49;-0.49;-0.49	5.28	5.28	0.74379	.	0.062992	0.64402	D	0.000007	T	0.81098	0.4752	M	0.82323	2.585	0.27170	N	0.960946	D	0.56521	0.976	P	0.57152	0.814	T	0.77216	-0.2669	10	0.72032	D	0.01	.	11.5799	0.50885	0.0:0.0:0.0:1.0	.	978	C9JLH9	.	G	932;903;978	ENSP00000301749:D932G;ENSP00000352039:D903G;ENSP00000414415:D978G	ENSP00000301749:D932G	D	-	2	0	NLRC3	3534307	1.000000	0.71417	0.993000	0.49108	0.342000	0.28953	5.519000	0.67074	2.235000	0.73313	0.524000	0.50904	GAT	.	.	.	none		0.592	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
C16orf96	342346	hgsc.bcm.edu	37	16	4637082	4637082	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr16:4637082A>T	ENST00000444310.4	+	8	2395	c.2395A>T	c.(2395-2397)Aat>Tat	p.N799Y		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GAACAAGGTGAATAAGAGCAC	0.517																																					p.N799Y		Atlas-SNP	.											.	C16orf96	28	.	0			c.A2395T						PASS	.						141.0	144.0	143.0					16																	4637082		692	1591	2283	SO:0001583	missense	342346	exon8			AAGGTGAATAAGA		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2395A>T	chr16.hg19:g.4637082A>T	ENSP00000415027:p.Asn799Tyr	101.0	0.0	.		144.0	91.0	.	NM_001145011		Missense_Mutation	SNP	ENST00000444310.4	hg19	CCDS53986.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.328631	0.24167	.	.	ENSG00000205832	ENST00000444310	.	.	.	5.17	3.11	0.35812	.	.	.	.	.	T	0.31231	0.0790	N	0.08118	0	0.09310	N	1	D	0.60160	0.987	P	0.58391	0.838	T	0.09662	-1.0664	8	0.87932	D	0	.	6.8327	0.23919	0.2045:0.0:0.7955:0.0	.	799	A6NNT2	CP096_HUMAN	Y	799	.	ENSP00000415027:N799Y	N	+	1	0	C16orf96	4577083	0.995000	0.38212	0.016000	0.15963	0.011000	0.07611	2.441000	0.44864	0.544000	0.28883	0.459000	0.35465	AAT	.	.	.	none		0.517	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
C16orf72	29035	hgsc.bcm.edu	37	16	9196862	9196862	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr16:9196862G>A	ENST00000327827.7	+	3	726	c.329G>A	c.(328-330)cGa>cAa	p.R110Q	RP11-473I1.5_ENST00000565648.1_RNA|RP11-473I1.9_ENST00000574285.1_RNA	NM_014117.2	NP_054836.2	Q14CZ0	CP072_HUMAN	chromosome 16 open reading frame 72	110										endometrium(4)|large_intestine(2)|lung(2)	8						ACCCATCAACGAAGTTTTGAT	0.373																																					p.R110Q		Atlas-SNP	.											.	C16orf72	26	.	0			c.G329A						PASS	.						91.0	91.0	91.0					16																	9196862		2197	4300	6497	SO:0001583	missense	29035	exon3			ATCAACGAAGTTT	AK123266	CCDS10538.1	16p13.2	2012-11-19			ENSG00000182831	ENSG00000182831			30103	protein-coding gene	gene with protein product						8889548	Standard	NM_014117		Approved	FLJ41272, PRO0149	uc002czm.3	Q14CZ0	OTTHUMG00000178147	ENST00000327827.7:c.329G>A	chr16.hg19:g.9196862G>A	ENSP00000331720:p.Arg110Gln	86.0	0.0	.		153.0	51.0	.	NM_014117		Missense_Mutation	SNP	ENST00000327827.7	hg19	CCDS10538.1	.	.	.	.	.	.	.	.	.	.	G	32	5.171478	0.94807	.	.	ENSG00000182831	ENST00000327827	T	0.50277	0.75	5.98	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.65995	0.2745	M	0.78801	2.425	0.58432	D	0.999999	D	0.76494	0.999	P	0.57425	0.82	T	0.71852	-0.4467	10	0.62326	D	0.03	-1.7932	17.2125	0.86935	0.0:0.1261:0.8739:0.0	.	110	Q14CZ0	CP072_HUMAN	Q	110	ENSP00000331720:R110Q	ENSP00000331720:R110Q	R	+	2	0	C16orf72	9104363	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.751000	0.98889	1.514000	0.48869	0.591000	0.81541	CGA	.	.	.	none		0.373	C16orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440760.2	NM_014117	
SNX29	92017	hgsc.bcm.edu	37	16	12571579	12571579	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr16:12571579T>A	ENST00000566228.1	+	19	2110	c.2041T>A	c.(2041-2043)Tac>Aac	p.Y681N	SNX29_ENST00000323433.4_Missense_Mutation_p.Y296N|SNX29_ENST00000306030.3_Missense_Mutation_p.Y296N	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	681	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						TTGACAGGTCTACATCCGGAT	0.413																																					p.Y681N		Atlas-SNP	.											.	SNX29	60	.	0			c.T2041A						PASS	.						78.0	72.0	74.0					16																	12571579		1851	4094	5945	SO:0001583	missense	92017	exon19			CAGGTCTACATCC	AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2041T>A	chr16.hg19:g.12571579T>A	ENSP00000456480:p.Tyr681Asn	273.0	1.0	.		295.0	173.0	.	NM_032167	B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	ENST00000566228.1	hg19	CCDS10553.2	.	.	.	.	.	.	.	.	.	.	T	17.14	3.312908	0.60414	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	T;T	0.38240	1.15;1.15	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.41119	0.1145	L	0.37850	1.14	0.38631	D	0.951388	.	.	.	.	.	.	T	0.37079	-0.9721	8	0.45353	T	0.12	-15.4993	13.9674	0.64218	0.0:0.0:0.0:1.0	.	.	.	.	N	296	ENSP00000306940:Y296N;ENSP00000322226:Y296N	ENSP00000306940:Y296N	Y	+	1	0	SNX29	12479080	1.000000	0.71417	1.000000	0.80357	0.236000	0.25371	7.508000	0.81686	2.180000	0.69256	0.533000	0.62120	TAC	.	.	.	none		0.413	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422622.1		
APOBR	55911	hgsc.bcm.edu	37	16	28507402	28507402	+	Missense_Mutation	SNP	C	C	T	rs148114931|rs62034314		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr16:28507402C>T	ENST00000431282.1	+	2	1050	c.1040C>T	c.(1039-1041)aCa>aTa	p.T347I	CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000328423.5_Missense_Mutation_p.T347I|APOBR_ENST00000564831.1_Missense_Mutation_p.T347I|CLN3_ENST00000569430.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	347	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GAGGCTGGGACAGCCTCAGGA	0.711																																					p.T347I		Atlas-SNP	.											.	APOBR	89	.	0			c.C1040T						PASS	.						9.0	11.0	10.0					16																	28507402		1844	3986	5830	SO:0001583	missense	55911	exon2			CTGGGACAGCCTC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1040C>T	chr16.hg19:g.28507402C>T	ENSP00000416094:p.Thr347Ile	27.0	0.0	.		40.0	6.0	.	NM_018690	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	ENST00000431282.1	hg19		.	.	.	.	.	.	.	.	.	.	c	13.05	2.120378	0.37436	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.60424	0.19;0.19	3.61	-7.21	0.01490	.	.	.	.	.	T	0.34513	0.0900	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.35724	-0.9777	7	0.38643	T	0.18	.	3.7838	0.08692	0.2212:0.2578:0.4267:0.0943	rs62034314	.	.	.	I	347	ENSP00000327669:T347I;ENSP00000416094:T347I	ENSP00000327669:T347I	T	+	2	0	APOBR	28414903	0.002000	0.14202	0.000000	0.03702	0.006000	0.05464	-0.337000	0.07852	-0.824000	0.04295	0.455000	0.32223	ACA	.	C|0.500;T|0.500	0.500	weak		0.711	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
SPAG7	9552	hgsc.bcm.edu	37	17	4871090	4871090	+	Silent	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr17:4871090G>A	ENST00000206020.3	-	1	77	c.10C>T	c.(10-12)Cta>Tta	p.L4L	RP5-1050D4.3_ENST00000576752.1_RNA|SPAG7_ENST00000575142.1_5'Flank|SPAG7_ENST00000573366.1_5'Flank|SPAG7_ENST00000571023.1_5'UTR	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	4						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						GAGCCCAGTAGGTCCGCCATC	0.617																																					p.L4L		Atlas-SNP	.											.	SPAG7	22	.	0			c.C10T						PASS	.						70.0	76.0	74.0					17																	4871090		1970	4148	6118	SO:0001819	synonymous_variant	9552	exon1			CCAGTAGGTCCGC	AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.10C>T	chr17.hg19:g.4871090G>A		45.0	0.0	.		74.0	20.0	.	NM_004890	Q96EU5	Silent	SNP	ENST00000206020.3	hg19	CCDS42240.1																																																																																			.	.	.	none		0.617	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438747.1	NM_004890	
MYH10	4628	hgsc.bcm.edu	37	17	8404183	8404183	+	Silent	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr17:8404183G>T	ENST00000269243.4	-	27	3750	c.3612C>A	c.(3610-3612)gcC>gcA	p.A1204A	MYH10_ENST00000360416.3_Silent_p.A1235A|MYH10_ENST00000396239.1_Silent_p.A1225A|MYH10_ENST00000379980.4_Silent_p.A1220A	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1204					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						GCTCCTCCAGGGCTGTTGCGT	0.547																																					p.A1235A		Atlas-SNP	.											.	MYH10	148	.	0			c.C3705A						PASS	.						176.0	158.0	164.0					17																	8404183		2203	4300	6503	SO:0001819	synonymous_variant	4628	exon29			CTCCAGGGCTGTT	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.3612C>A	chr17.hg19:g.8404183G>T		39.0	0.0	.		42.0	15.0	.	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Silent	SNP	ENST00000269243.4	hg19	CCDS11144.1																																																																																			.	.	.	none		0.547	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
DNAH9	1770	hgsc.bcm.edu	37	17	11672607	11672607	+	Missense_Mutation	SNP	G	G	C	rs61744697	byFrequency	TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr17:11672607G>C	ENST00000262442.4	+	38	7581	c.7513G>C	c.(7513-7515)Gtg>Ctg	p.V2505L	DNAH9_ENST00000454412.2_Missense_Mutation_p.V2505L	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2505	AAA 3. {ECO:0000250}.			V -> L (in Ref. 1; AAF69004). {ECO:0000305}.	cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGTGAAAAACGTGCCATTCAA	0.627																																					p.V2505L		Atlas-SNP	.											.	DNAH9	695	.	0			c.G7513C						PASS	.						61.0	53.0	56.0					17																	11672607		2203	4300	6503	SO:0001583	missense	1770	exon38			AAAAACGTGCCAT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.7513G>C	chr17.hg19:g.11672607G>C	ENSP00000262442:p.Val2505Leu	74.0	0.0	.		98.0	58.0	.	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782584	0.90282	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.46063	0.88;0.88	5.41	4.42	0.53409	ATPase, AAA+ type, core (1);	0.072443	0.53938	D	0.000045	T	0.53449	0.1797	L	0.50847	1.595	0.80722	D	1	D	0.56521	0.976	P	0.60173	0.87	T	0.47289	-0.9129	10	0.37606	T	0.19	.	15.0436	0.71811	0.0722:0.0:0.9278:0.0	.	2505	Q9NYC9	DYH9_HUMAN	L	2505;2505;1087	ENSP00000262442:V2505L;ENSP00000414874:V2505L	ENSP00000262442:V2505L	V	+	1	0	DNAH9	11613332	1.000000	0.71417	0.998000	0.56505	0.899000	0.52679	6.624000	0.74243	2.696000	0.92011	0.655000	0.94253	GTG	.	G|0.901;T|0.099	.	alt		0.627	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
NF1	4763	hgsc.bcm.edu	37	17	29654742	29654742	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr17:29654742G>A	ENST00000358273.4	+	38	5877	c.5494G>A	c.(5494-5496)Gaa>Aaa	p.E1832K	NF1_ENST00000581113.2_3'UTR|NF1_ENST00000356175.3_Missense_Mutation_p.E1811K	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1832	Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GACCCGCTGGGAACTGTCACA	0.512			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.E1832K		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.G5494A						PASS	.						122.0	117.0	119.0					17																	29654742		2203	4300	6503	SO:0001583	missense	4763	exon38	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	CGCTGGGAACTGT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5494G>A	chr17.hg19:g.29654742G>A	ENSP00000351015:p.Glu1832Lys	159.0	0.0	.		262.0	70.0	.	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	hg19	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829086	0.90955	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.96427	-4.01;-4.01;-4.01	5.8	5.8	0.92144	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.96371	0.8816	L	0.33137	0.985	0.80722	D	1	B;D;P	0.54964	0.001;0.969;0.939	B;D;P	0.64321	0.001;0.924;0.657	D	0.94673	0.7858	10	0.21014	T	0.42	.	19.049	0.93034	0.0:0.0:1.0:0.0	.	861;1811;1832	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	K	1832;1811;1477	ENSP00000351015:E1832K;ENSP00000348498:E1811K;ENSP00000389907:E1477K	ENSP00000348498:E1811K	E	+	1	0	NF1	26678868	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.434000	0.97515	2.733000	0.93635	0.650000	0.86243	GAA	.	.	.	none		0.512	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324382	39324382	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr17:39324382A>T	ENST00000391356.2	-	1	42	c.43T>A	c.(43-45)Tgt>Agt	p.C15S		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	15					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CCTTGACCACAGCTCTGGTCA	0.627																																					p.C15S		Atlas-SNP	.											KRTAP4-3,colon,carcinoma,0,1	KRTAP4-3	40	.	0			c.T43A						PASS	.						30.0	32.0	31.0					17																	39324382		2201	4293	6494	SO:0001583	missense	85290	exon1			GACCACAGCTCTG	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.43T>A	chr17.hg19:g.39324382A>T	ENSP00000375151:p.Cys15Ser	109.0	0.0	.		152.0	106.0	.	NM_033187		Missense_Mutation	SNP	ENST00000391356.2	hg19	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	12.59	1.983700	0.35036	.	.	ENSG00000196156	ENST00000391356	T	0.00619	6.18	4.74	4.74	0.60224	.	.	.	.	.	T	0.03477	0.0100	M	0.81341	2.54	0.34605	D	0.716949	D	0.89917	1.0	D	0.83275	0.996	T	0.27365	-1.0076	9	0.62326	D	0.03	.	12.478	0.55825	1.0:0.0:0.0:0.0	.	15	Q9BYR4	KRA43_HUMAN	S	15	ENSP00000375151:C15S	ENSP00000375151:C15S	C	-	1	0	KRTAP4-3	36577908	0.986000	0.35501	1.000000	0.80357	0.191000	0.23601	0.183000	0.16919	1.867000	0.54127	0.533000	0.62120	TGT	.	.	.	none		0.627	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
ATP6V0A1	535	hgsc.bcm.edu	37	17	40629677	40629677	+	Splice_Site	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr17:40629677G>T	ENST00000343619.4	+	6	546		c.e6-1		ATP6V0A1_ENST00000393829.2_Splice_Site|ATP6V0A1_ENST00000537728.1_Splice_Site|ATP6V0A1_ENST00000585525.1_Splice_Site|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.Q148H|ATP6V0A1_ENST00000546249.1_Splice_Site|ATP6V0A1_ENST00000544137.1_Intron	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1						ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		ATCATCAGCAGATGGCGGATC	0.458																																					p.Q148H		Atlas-SNP	.											.	ATP6V0A1	67	.	0			c.G444T						PASS	.						134.0	117.0	123.0					17																	40629677		2203	4300	6503	SO:0001630	splice_region_variant	535	exon6			TCAGCAGATGGCG	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.424-1G>T	chr17.hg19:g.40629677G>T		98.0	0.0	.		139.0	77.0	.	NM_001130020	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	hg19	CCDS45684.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.3|28.3	4.909417|4.909417	0.92107|0.92107	.|.	.|.	ENSG00000033627|ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000537728|ENST00000264649	.|D	.|0.86297	.|-2.1	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.382752	.|0.15363	.|U	.|0.266279	.|D	.|0.83972	.|0.5370	N|N	0.12502|0.12502	0.225|0.225	0.80722|0.80722	D|D	1|1	.|P	.|0.37176	.|0.586	.|P	.|0.45506	.|0.483	.|T	.|0.82705	.|-0.0325	.|10	.|0.39692	.|T	.|0.17	.|-2.6871	20.0498|20.0498	0.97621|0.97621	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|148	.|B7Z3B7	.|.	.|H	-1|148	.|ENSP00000264649:Q148H	.|ENSP00000264649:Q148H	.|Q	+|+	.|3	.|2	ATP6V0A1|ATP6V0A1	37883203|37883203	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.820000|9.820000	0.99359|0.99359	2.753000|2.753000	0.94483|0.94483	0.557000|0.557000	0.71058|0.71058	.|CAG	.	.	.	none		0.458	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	Intron
RNF213	57674	hgsc.bcm.edu	37	17	78356798	78356798	+	Silent	SNP	A	A	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr17:78356798A>G	ENST00000582970.1	+	58	14141	c.13998A>G	c.(13996-13998)acA>acG	p.T4666T	CTD-2047H16.4_ENST00000573394.1_RNA|RNF213_ENST00000336301.6_Silent_p.T2739T|RNF213_ENST00000508628.2_Silent_p.T4715T|RNF213_ENST00000427003.3_3'UTR|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4666					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ATTTTGACACAGAATTGTCAA	0.403																																					p.T4666T		Atlas-SNP	.											.	RNF213	766	.	0			c.A13998G						PASS	.						96.0	91.0	92.0					17																	78356798		2203	4300	6503	SO:0001819	synonymous_variant	57674	exon58			TGACACAGAATTG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13998A>G	chr17.hg19:g.78356798A>G		97.0	0.0	.		161.0	99.0	.	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	hg19	CCDS58606.1																																																																																			.	.	.	none		0.403	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
SERPINB3	6317	hgsc.bcm.edu	37	18	61324647	61324647	+	Splice_Site	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr18:61324647C>T	ENST00000283752.5	-	6	613		c.e6-1		SERPINB3_ENST00000332821.8_Splice_Site|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3						negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						TTAATTTTTTCTGCAAGGGAA	0.368																																					.		Atlas-SNP	.											.	SERPINB3	90	.	0			c.470-1G>A						PASS	.						79.0	82.0	81.0					18																	61324647		2203	4300	6503	SO:0001630	splice_region_variant	6317	exon7			TTTTTTCTGCAAG	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.470-1G>A	chr18.hg19:g.61324647C>T		359.0	0.0	.		291.0	105.0	.	NM_006919	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Splice_Site	SNP	ENST00000283752.5	hg19	CCDS11987.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.549363	0.45383	.	.	ENSG00000057149	ENST00000283752;ENST00000332821	.	.	.	2.74	2.74	0.32292	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6068	0.62052	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SERPINB3	59475627	1.000000	0.71417	0.463000	0.27130	0.269000	0.26545	6.973000	0.76116	1.841000	0.53522	0.455000	0.32223	.	.	.	.	none		0.368	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919	Intron
ARID3A	1820	hgsc.bcm.edu	37	19	932539	932539	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:932539C>T	ENST00000263620.3	+	3	817	c.490C>T	c.(490-492)Cct>Tct	p.P164S		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	164						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCCCAGGCCCTGCCAGCTT	0.697																																					p.P164S	Pancreas(29;54 1022 32760 50921)	Atlas-SNP	.											.	ARID3A	35	.	0			c.C490T						PASS	.						11.0	7.0	8.0					19																	932539		2071	4150	6221	SO:0001583	missense	1820	exon3			CCAGGCCCTGCCA	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.490C>T	chr19.hg19:g.932539C>T	ENSP00000263620:p.Pro164Ser	114.0	0.0	.		128.0	62.0	.	NM_005224	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	ENST00000263620.3	hg19	CCDS12050.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.619291	0.00828	.	.	ENSG00000116017	ENST00000263620	T	0.36157	1.27	3.79	-3.67	0.04476	.	6.078050	0.01060	U	0.004623	T	0.12178	0.0296	N	0.01576	-0.805	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.18053	-1.0349	10	0.10377	T	0.69	-3.8161	5.4637	0.16632	0.0:0.1949:0.4491:0.356	.	164	Q99856	ARI3A_HUMAN	S	164	ENSP00000263620:P164S	ENSP00000263620:P164S	P	+	1	0	ARID3A	883539	0.005000	0.15991	0.000000	0.03702	0.384000	0.30261	0.223000	0.17719	-0.955000	0.03636	0.443000	0.29094	CCT	.	.	.	none		0.697	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
TLE2	7089	hgsc.bcm.edu	37	19	3019295	3019295	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:3019295G>T	ENST00000262953.6	-	7	798	c.536C>A	c.(535-537)gCc>gAc	p.A179D	TLE2_ENST00000591529.1_Missense_Mutation_p.A193D|TLE2_ENST00000443826.3_Intron|TLE2_ENST00000586422.1_Intron|TLE2_ENST00000590536.1_Missense_Mutation_p.A180D|TLE2_ENST00000587217.1_5'UTR|TLE2_ENST00000455444.2_Intron|TLE2_ENST00000447365.2_5'UTR|TLE2_ENST00000426948.2_Missense_Mutation_p.A193D	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	179	Gly/Pro-rich.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACCCCTCGGCCTCCACGCC	0.697																																					p.A193D		Atlas-SNP	.											.	TLE2	35	.	0			c.C578A						PASS	.						6.0	8.0	7.0					19																	3019295		2030	4111	6141	SO:0001583	missense	7089	exon8			CCCTCGGCCTCCA	M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.536C>A	chr19.hg19:g.3019295G>T	ENSP00000262953:p.Ala179Asp	66.0	0.0	.		43.0	19.0	.	NM_001144761	B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Missense_Mutation	SNP	ENST00000262953.6	hg19	CCDS45911.1	.	.	.	.	.	.	.	.	.	.	G	6.782	0.513219	0.12944	.	.	ENSG00000065717	ENST00000262953;ENST00000450017;ENST00000426948	T;T	0.55234	0.53;0.76	4.43	4.43	0.53597	.	0.274149	0.32884	N	0.005534	T	0.37705	0.1013	N	0.19112	0.55	0.09310	N	1	B;B	0.23058	0.076;0.079	B;B	0.23574	0.047;0.023	T	0.27400	-1.0075	10	0.37606	T	0.19	-19.2454	12.9084	0.58166	0.0:0.0:1.0:0.0	.	193;179	F8WCH2;Q04725	.;TLE2_HUMAN	D	179;173;193	ENSP00000262953:A179D;ENSP00000392869:A193D	ENSP00000262953:A179D	A	-	2	0	TLE2	2970295	0.045000	0.20229	0.939000	0.37840	0.212000	0.24457	1.274000	0.33132	2.177000	0.69029	0.491000	0.48974	GCC	.	.	.	none		0.697	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452194.2	NM_003260	
DPP9	91039	hgsc.bcm.edu	37	19	4700253	4700253	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:4700253T>G	ENST00000598800.1	-	11	1467	c.962A>C	c.(961-963)gAg>gCg	p.E321A	DPP9_ENST00000262960.9_Missense_Mutation_p.E350A|DPP9_ENST00000597849.1_Missense_Mutation_p.E350A|DPP9_ENST00000594671.1_Missense_Mutation_p.E321A			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9	321						cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		AGTCTGGAACTCAGCCAGTTT	0.577																																					p.E350A		Atlas-SNP	.											.	DPP9	59	.	0			c.A1049C						PASS	.						43.0	45.0	44.0					19																	4700253		1931	4135	6066	SO:0001583	missense	91039	exon10			TGGAACTCAGCCA	AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.962A>C	chr19.hg19:g.4700253T>G	ENSP00000469603:p.Glu321Ala	87.0	0.0	.		67.0	32.0	.	NM_139159	O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Missense_Mutation	SNP	ENST00000598800.1	hg19		.	.	.	.	.	.	.	.	.	.	T	14.87	2.665127	0.47677	.	.	ENSG00000142002	ENST00000357909;ENST00000381797;ENST00000262960	T	0.30182	1.54	4.5	4.5	0.54988	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.052580	0.64402	D	0.000001	T	0.49609	0.1567	L	0.58583	1.82	0.80722	D	1	P;D	0.89917	0.943;1.0	P;D	0.83275	0.854;0.996	T	0.44802	-0.9304	10	0.39692	T	0.17	-24.9386	13.1304	0.59377	0.0:0.0:0.0:1.0	.	321;350	Q86TI2;Q1ZZB8	DPP9_HUMAN;.	A	429;291;350	ENSP00000262960:E350A	ENSP00000262960:E350A	E	-	2	0	DPP9	4651253	1.000000	0.71417	0.144000	0.22314	0.018000	0.09664	7.573000	0.82421	1.891000	0.54761	0.459000	0.35465	GAG	.	.	.	none		0.577	DPP9-026	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000459343.2		
MYO1F	4542	hgsc.bcm.edu	37	19	8615148	8615148	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:8615148G>C	ENST00000338257.8	-	10	1264	c.997C>G	c.(997-999)Cgc>Ggc	p.R333G	AC092316.1_ENST00000598703.1_RNA	NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	333	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						GACTCGCTGCGCCCGCCCCAG	0.647																																					p.R333G		Atlas-SNP	.											MYO1F,NS,carcinoma,0,1	MYO1F	128	.	0			c.C997G						PASS	.						27.0	32.0	30.0					19																	8615148		2056	4215	6271	SO:0001583	missense	4542	exon10			CGCTGCGCCCGCC	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.997C>G	chr19.hg19:g.8615148G>C	ENSP00000344871:p.Arg333Gly	90.0	2.0	.		87.0	36.0	.	NM_012335	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	hg19	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.701939	0.48307	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.88431	-2.38	4.82	4.82	0.62117	Myosin head, motor domain (2);	0.229852	0.37623	N	0.002016	D	0.89280	0.6670	L	0.48986	1.54	0.50632	D	0.999883	P;P	0.37594	0.601;0.601	B;P	0.44597	0.339;0.454	D	0.90617	0.4556	10	0.87932	D	0	.	16.9171	0.86154	0.0:0.0:1.0:0.0	.	333;333	B0I1T1;O00160	.;MYO1F_HUMAN	G	378;333	ENSP00000344871:R333G	ENSP00000304899:R378G	R	-	1	0	MYO1F	8521148	1.000000	0.71417	0.671000	0.29857	0.673000	0.39480	4.746000	0.62133	2.227000	0.72691	0.563000	0.77884	CGC	.	.	.	none		0.647	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
FCHO1	23149	hgsc.bcm.edu	37	19	17881335	17881335	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:17881335G>C	ENST00000596536.1	+	8	721	c.438G>C	c.(436-438)atG>atC	p.M146I	FCHO1_ENST00000595033.1_Missense_Mutation_p.M96I|FCHO1_ENST00000596951.1_Missense_Mutation_p.M146I|FCHO1_ENST00000597512.1_Missense_Mutation_p.M153I|FCHO1_ENST00000252771.7_Missense_Mutation_p.M146I|FCHO1_ENST00000600676.1_Missense_Mutation_p.M146I|FCHO1_ENST00000539407.1_Missense_Mutation_p.M146I|FCHO1_ENST00000389133.4_Missense_Mutation_p.M146I|FCHO1_ENST00000594202.1_Missense_Mutation_p.M146I	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	146	Mediates membrane-binding.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						ACCGTTGCATGGACCAGGAGC	0.632																																					p.M146I		Atlas-SNP	.											.	FCHO1	69	.	0			c.G438C						PASS	.						49.0	48.0	48.0					19																	17881335		2203	4300	6503	SO:0001583	missense	23149	exon7			TTGCATGGACCAG	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.438G>C	chr19.hg19:g.17881335G>C	ENSP00000470731:p.Met146Ile	78.0	0.0	.		68.0	28.0	.	NM_001161358	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	ENST00000596536.1	hg19	CCDS32955.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.888439	0.33348	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.41400	1.0;1.0;1.0	4.56	3.53	0.40419	.	0.470084	0.24165	N	0.040958	T	0.28532	0.0706	L	0.29908	0.895	0.37133	D	0.901365	B;B;B	0.11235	0.001;0.001;0.004	B;B;B	0.15052	0.005;0.002;0.012	T	0.15521	-1.0434	10	0.37606	T	0.19	-18.5905	7.9831	0.30196	0.1112:0.0:0.8888:0.0	.	96;146;146	B4E120;O14526;O14526-2	.;FCHO1_HUMAN;.	I	146	ENSP00000252771:M146I;ENSP00000373785:M146I;ENSP00000437978:M146I	ENSP00000252771:M146I	M	+	3	0	FCHO1	17742335	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.314000	0.59166	1.148000	0.42385	0.491000	0.48974	ATG	.	.	.	none		0.632	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122	
ZNF146	7705	hgsc.bcm.edu	37	19	36727964	36727964	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:36727964G>T	ENST00000443387.2	+	4	1614	c.622G>T	c.(622-624)Ggt>Tgt	p.G208C	ZNF565_ENST00000355114.5_Intron|ZNF146_ENST00000456324.1_Missense_Mutation_p.G208C	NM_007145.2	NP_009076.2	Q15072	OZF_HUMAN	zinc finger protein 146	208					regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11	Esophageal squamous(110;0.162)					GATTCATTCAGGTGATAAACC	0.438																																					p.G208C		Atlas-SNP	.											.	ZNF146	32	.	0			c.G622T						PASS	.						196.0	162.0	173.0					19																	36727964		2203	4300	6503	SO:0001583	missense	7705	exon3			CATTCAGGTGATA	X70394	CCDS12492.1	19q13.1	2013-01-08				ENSG00000167635		"""Zinc fingers, C2H2-type"""	12931	protein-coding gene	gene with protein product		601505				10449921, 8641144	Standard	NM_001099639		Approved	OZF	uc010eeu.3	Q15072		ENST00000443387.2:c.622G>T	chr19.hg19:g.36727964G>T	ENSP00000392095:p.Gly208Cys	94.0	0.0	.		90.0	32.0	.	NM_001099638	Q2TB94	Missense_Mutation	SNP	ENST00000443387.2	hg19	CCDS12492.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400015	0.62177	.	.	ENSG00000167635	ENST00000443387;ENST00000456324	T;T	0.42900	0.96;0.96	4.48	4.48	0.54585	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41001	D	0.000980	T	0.71854	0.3389	M	0.91663	3.23	0.50039	D	0.999848	D	0.89917	1.0	D	0.97110	1.0	T	0.79027	-0.1971	10	0.87932	D	0	-7.7826	17.1134	0.86682	0.0:0.0:1.0:0.0	.	208	Q15072	OZF_HUMAN	C	208	ENSP00000392095:G208C;ENSP00000400391:G208C	ENSP00000392095:G208C	G	+	1	0	ZNF146	41419804	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	8.947000	0.93000	2.780000	0.95670	0.561000	0.74099	GGT	.	.	.	none		0.438	ZNF146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451706.1	NM_007145	
BTBD3	22903	hgsc.bcm.edu	37	20	11898938	11898938	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr20:11898938G>T	ENST00000405977.1	+	2	640	c.15G>T	c.(13-15)aaG>aaT	p.K5N	BTBD3_ENST00000399006.2_Intron|BTBD3_ENST00000254977.3_Intron|BTBD3_ENST00000378226.2_Missense_Mutation_p.K5N|RP4-742J24.2_ENST00000439529.1_RNA	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	5					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						TAGATGACAAGGAAAAGAACA	0.413																																					p.K5N		Atlas-SNP	.											.	BTBD3	92	.	0			c.G15T						PASS	.						193.0	201.0	199.0					20																	11898938		2203	4300	6503	SO:0001583	missense	22903	exon1			TGACAAGGAAAAG	AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.15G>T	chr20.hg19:g.11898938G>T	ENSP00000384545:p.Lys5Asn	42.0	0.0	.		64.0	9.0	.	NM_014962	D3DW19|Q5JY73	Missense_Mutation	SNP	ENST00000405977.1	hg19	CCDS13113.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.997866	0.35226	.	.	ENSG00000132640	ENST00000405977;ENST00000378226	T;T	0.80653	-1.4;-1.4	6.17	5.22	0.72569	.	0.052693	0.64402	D	0.000001	T	0.66137	0.2759	N	0.14661	0.345	0.48762	D	0.9997	B	0.02656	0.0	B	0.01281	0.0	T	0.63462	-0.6632	10	0.66056	D	0.02	.	10.1626	0.42860	0.1676:0.0:0.8324:0.0	.	5	Q9Y2F9	BTBD3_HUMAN	N	5	ENSP00000384545:K5N;ENSP00000367471:K5N	ENSP00000367471:K5N	K	+	3	2	BTBD3	11846938	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.552000	0.53705	1.598000	0.50083	0.655000	0.94253	AAG	.	.	.	none		0.413	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078021.3		
KCNQ2	3785	hgsc.bcm.edu	37	20	62038497	62038497	+	Missense_Mutation	SNP	C	C	T	rs543477138		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr20:62038497C>T	ENST00000359125.2	-	17	2293	c.2119G>A	c.(2119-2121)Gcg>Acg	p.A707T	KCNQ2_ENST00000357249.2_Missense_Mutation_p.A689T|KCNQ2_ENST00000344462.4_Missense_Mutation_p.A676T|KCNQ2_ENST00000354587.3_Missense_Mutation_p.A715T|KCNQ2_ENST00000359689.1_Missense_Mutation_p.A707T|KCNQ2_ENST00000370224.1_Missense_Mutation_p.A715T|KCNQ2_ENST00000360480.3_Missense_Mutation_p.A679T	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	707					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	ACAgggggcgcggccgggggc	0.711																																					p.A707T		Atlas-SNP	.											KCNQ2,colon,carcinoma,0,2	KCNQ2	201	.	0			c.G2119A						PASS	.						5.0	6.0	5.0					20																	62038497		2041	4078	6119	SO:0001583	missense	3785	exon17			GGGGCGCGGCCGG	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.2119G>A	chr20.hg19:g.62038497C>T	ENSP00000352035:p.Ala707Thr	280.0	0.0	.		372.0	45.0	.	NM_172107	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	hg19	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	C	3.761	-0.049564	0.07407	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224	D;D;D;D;D;D;D;D;D	0.99005	-5.17;-5.32;-5.32;-5.11;-5.32;-5.17;-5.17;-5.26;-5.11	4.5	0.844	0.18943	.	0.510450	0.17649	U	0.166750	D	0.92948	0.7756	N	0.02539	-0.55	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.0	D	0.87991	0.2749	10	0.15066	T	0.55	-18.663	8.3989	0.32574	0.0:0.5829:0.0:0.4171	.	679;689;676;707	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	T	689;707;677;715;707;676;679;703;715	ENSP00000349789:A689T;ENSP00000352035:A707T;ENSP00000359246:A677T;ENSP00000346601:A715T;ENSP00000352718:A707T;ENSP00000399612:A676T;ENSP00000353668:A679T;ENSP00000339611:A703T;ENSP00000359244:A715T	ENSP00000339611:A703T	A	-	1	0	KCNQ2	61508941	0.000000	0.05858	0.004000	0.12327	0.148000	0.21650	0.648000	0.24828	0.331000	0.23511	0.491000	0.48974	GCG	.	.	.	none		0.711	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
KRTAP10-7	386675	hgsc.bcm.edu	37	21	46021419	46021419	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr21:46021419C>T	ENST00000380102.2	+	1	923	c.898C>T	c.(898-900)Ccg>Tcg	p.P300S	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	300	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						TAGCTGCCAGCCGGCTTGCTG	0.672																																					p.P295S		Atlas-SNP	.											.	KRTAP10-7	41	.	0			c.C883T						PASS	.						89.0	82.0	84.0					21																	46021419		2203	4296	6499	SO:0001583	missense	386675	exon2			TGCCAGCCGGCTT	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.898C>T	chr21.hg19:g.46021419C>T	ENSP00000369445:p.Pro300Ser	46.0	0.0	.		23.0	14.0	.	NM_198689	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	hg19		.	.	.	.	.	.	.	.	.	.	c	8.469	0.857149	0.17106	.	.	ENSG00000205441	ENST00000380102	T	0.01887	4.58	3.25	2.34	0.29019	.	.	.	.	.	T	0.03136	0.0092	L	0.55481	1.735	0.21290	N	0.99973	B	0.25312	0.123	B	0.25759	0.063	T	0.41484	-0.9506	9	0.24483	T	0.36	.	10.1685	0.42895	0.0:0.777:0.223:0.0	.	295	P60409-2	.	S	300	ENSP00000369445:P300S	ENSP00000369445:P300S	P	+	1	0	KRTAP10-7	44845847	0.101000	0.21875	0.244000	0.24202	0.501000	0.33797	2.782000	0.47758	0.445000	0.26639	0.467000	0.42956	CCG	.	.	.	none		0.672	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
LZTR1	8216	hgsc.bcm.edu	37	22	21348913	21348913	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr22:21348913G>A	ENST00000215739.8	+	15	2041	c.1682G>A	c.(1681-1683)cGc>cAc	p.R561H	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Missense_Mutation_p.R542H	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	561					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CAGTTGTGCCGCCTGGAGCAG	0.632																																					p.R561H		Atlas-SNP	.											.	LZTR1	99	.	0			c.G1682A						PASS	.						63.0	49.0	54.0					22																	21348913		2202	4300	6502	SO:0001583	missense	8216	exon15			TGTGCCGCCTGGA	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.1682G>A	chr22.hg19:g.21348913G>A	ENSP00000215739:p.Arg561His	42.0	0.0	.		29.0	6.0	.	NM_006767	Q14776|Q20WK0	Missense_Mutation	SNP	ENST00000215739.8	hg19	CCDS33606.1	.	.	.	.	.	.	.	.	.	.	g	32	5.180499	0.94846	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.67523	-0.27;-0.27	4.72	4.72	0.59763	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	T	0.81054	0.4743	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.989;0.996	D	0.83385	0.0014	10	0.72032	D	0.01	-35.0718	15.2289	0.73372	0.0:0.0:1.0:0.0	.	542;561;520	B7Z3T9;Q8N653;F5GXU8	.;LZTR1_HUMAN;.	H	520;561;542	ENSP00000215739:R561H;ENSP00000374006:R542H	ENSP00000215739:R561H	R	+	2	0	LZTR1	19678913	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.743000	0.85020	2.444000	0.82710	0.457000	0.33378	CGC	.	.	.	none		0.632	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	
KDELR3	11015	hgsc.bcm.edu	37	22	38877266	38877267	+	Missense_Mutation	DNP	AG	AG	TA			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr22:38877266_38877267AG>TA	ENST00000216014.4	+	4	573_574	c.401_402AG>TA	c.(400-402)cAG>cTA	p.Q134L	KDELR3_ENST00000471268.1_3'UTR|KDELR3_ENST00000409006.3_Missense_Mutation_p.Q134L	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	134					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					ATCCTGCCCCAGCTCTTCATGA	0.505																																					p.Q134L|p.Q134Q	Ovarian(11;103 529 24120 28493 32980)	Atlas-SNP	.											.	KDELR3	39	.	0			c.A401T|c.G402A						PASS	.																																			SO:0001583	missense	11015	exon4			TGCCCCAGCTCTT|GCCCCAGCTCTTC	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	Exception_encountered	chr22.hg19:g.38877266_38877267delinsTA	ENSP00000216014:p.Gln134Leu	118.0|117.0	0.0	.		83.0	49.0	.	NM_016657	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense_Mutation|Silent	SNP	ENST00000216014.4	hg19	CCDS13972.1																																																																																			.	.	.	none		0.505	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
MED14	9282	hgsc.bcm.edu	37	X	40526005	40526005	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chrX:40526005T>C	ENST00000324817.1	-	24	3350	c.3232A>G	c.(3232-3234)Ata>Gta	p.I1078V		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1078	Pro-rich.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCTGGTCCTATTGAGATTCCA	0.478																																					p.I1078V		Atlas-SNP	.											.	MED14	108	.	0			c.A3232G						PASS	.						48.0	41.0	43.0					X																	40526005		2203	4300	6503	SO:0001583	missense	9282	exon24			GTCCTATTGAGAT	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.3232A>G	chrX.hg19:g.40526005T>C	ENSP00000323720:p.Ile1078Val	195.0	0.0	.		138.0	14.0	.	NM_004229	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	hg19	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	T	12.03	1.817087	0.32145	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.75	4.59	0.56863	.	0.041131	0.85682	D	0.000000	T	0.25531	0.0621	N	0.08118	0	0.34054	D	0.656508	B	0.02656	0.0	B	0.01281	0.0	T	0.23940	-1.0174	9	0.17369	T	0.5	.	10.6482	0.45632	0.0:0.0753:0.0:0.9247	.	1078	O60244	MED14_HUMAN	V	1078	.	ENSP00000323720:I1078V	I	-	1	0	MED14	40410949	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.496000	0.81526	0.810000	0.34279	0.402000	0.26972	ATA	.	.	.	none		0.478	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229	
PCGF2	7703	hgsc.bcm.edu	37	17	36891478	36891482	+	Stop_Codon_Del	DEL	AAGTT	AAGTT	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	AAGTT	AAGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr17:36891478_36891482delAAGTT	ENST00000580830.1	-	0	1730_1734				PCGF2_ENST00000360797.2_Stop_Codon_Del|PCGF2_ENST00000579882.1_3'UTR|PCGF2_ENST00000578109.1_3'UTR|PCGF2_ENST00000581345.1_Stop_Codon_Del|PCGF2_ENST00000585100.1_3'UTR			P35227	PCGF2_HUMAN	polycomb group ring finger 2						anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					CCCTGGCCTCAAGTTAAGGGGGGCA	0.595											OREG0024367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.344_345del		Atlas-Indel,Pindel	.											.	PCGF2	24	.	0			c.1030_1034del						PASS	.																																			SO:0001567	stop_retained_variant	7703	exon11			.	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		Exception_encountered	chr17.hg19:g.36891478_36891482delAAGTT	Exception_encountered	137.0	0.0	0	866	225.0	54.0	0.24	NM_007144	A6NGD8	Frame_Shift_Del	DEL	ENST00000580830.1	hg19	CCDS32638.1																																																																																			.	.	.	none		0.595	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144	
DMC1	11144	hgsc.bcm.edu	37	22	38958351	38958351	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr22:38958351delA	ENST00000216024.2	-	5	543	c.267delT	c.(265-267)tttfs	p.F89fs	DMC1_ENST00000428462.2_Frame_Shift_Del_p.F89fs	NM_007068.2	NP_008999.2	Q14565	DMC1_HUMAN	DNA meiotic recombinase 1	89					female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome (GO:0005694)|chromosome, telomeric region (GO:0000781)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11	Melanoma(58;0.0286)					CACTATACTCAAATGCAGTCA	0.328								Homologous recombination																													p.E90fs		Atlas-Indel,Pindel	.											.	DMC1	33	.	0			c.268delG						PASS	.						114.0	112.0	113.0					22																	38958351		2203	4300	6503	SO:0001589	frameshift_variant	11144	exon5			.	D63882	CCDS13973.1, CCDS63477.1	22q13.1	2013-05-02	2013-05-02		ENSG00000100206	ENSG00000100206			2927	protein-coding gene	gene with protein product		602721	"""DMC1 (dosage suppressor of mck1, yeast homolog) meiosis-specific homologous recombination"", ""DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)"""			8602360, 8590282, 17541404	Standard	NM_007068		Approved	LIM15	uc003avz.2	Q14565	OTTHUMG00000151088	ENST00000216024.2:c.267delT	chr22.hg19:g.38958351delA	ENSP00000216024:p.Phe89fs	116.0	0.0	0		122.0	54.0	0.442623	NM_007068	A8K9A2|B4DMW6|Q08AI1|Q99498|Q9UH11	Frame_Shift_Del	DEL	ENST00000216024.2	hg19	CCDS13973.1																																																																																			.	.	.	none		0.328	DMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321246.2	NM_007068	
CYP2C18	1562	hgsc.bcm.edu	37	10	96447962	96447962	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:96447962delA	ENST00000285979.6	+	3	611	c.412delA	c.(412-414)aagfs	p.K138fs	CYP2C18_ENST00000339022.5_Frame_Shift_Del_p.K138fs|CYP2C19_ENST00000464755.1_3'UTR	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	138					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	TGGGATGGGGAAGAGGAGCAT	0.473																																					p.G137fs		Atlas-INDEL	.											.	CYP2C18	79	.	0			c.411delG						PASS	.						124.0	116.0	119.0					10																	96447962		2203	4300	6503	SO:0001589	frameshift_variant	1562	exon3			.	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.412delA	chr10.hg19:g.96447962delA	ENSP00000285979:p.Lys138fs	202.0	0.0	0		182.0	70.0	0.384615	NM_000772	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Frame_Shift_Del	DEL	ENST00000285979.6	hg19	CCDS7435.1																																																																																			.	.	.	none		0.473	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049486.1	NM_000772	
YTHDC2	64848	hgsc.bcm.edu	37	5	112851004	112851005	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr5:112851004_112851005delAG	ENST00000161863.4	+	2	436_437	c.223_224delAG	c.(223-225)agafs	p.R75fs	YTHDC2_ENST00000515883.1_Frame_Shift_Del_p.R75fs	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	75	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		CAGTACTGAAAGAGCCTTTATT	0.327																																					p.74_75del		Atlas-Indel,Pindel	.											.	YTHDC2	118	.	0			c.222_223del						PASS	.																																			SO:0001589	frameshift_variant	64848	exon2			.	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.223_224delAG	chr5.hg19:g.112851006_112851007delAG	ENSP00000161863:p.Arg75fs	137.0	0.0	0		99.0	45.0	0.454545	NM_022828	B2RP66	Frame_Shift_Del	DEL	ENST00000161863.4	hg19	CCDS4113.1																																																																																			.	.	.	none		0.327	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
HELQ	113510	hgsc.bcm.edu	37	4	84376623	84376624	+	Frame_Shift_Ins	INS	-	-	G			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr4:84376623_84376624insG	ENST00000295488.3	-	1	385_386	c.223_224insC	c.(223-225)ctcfs	p.L75fs	MRPS18C_ENST00000295491.4_5'Flank|MRPS18C_ENST00000507349.1_5'Flank|MRPS18C_ENST00000507019.1_5'Flank|HELQ_ENST00000510985.1_Frame_Shift_Ins_p.L75fs|HELQ_ENST00000440639.2_5'UTR	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	75					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						TCCAAGGACGAGACATTCCGGG	0.574								Other identified genes with known or suspected DNA repair function																													p.L75fs		Atlas-Indel,Pindel	.											.	HELQ	95	.	0			c.224_225insC						PASS	.																																			SO:0001589	frameshift_variant	113510	exon1			.	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.224dupC	chr4.hg19:g.84376624_84376624dupG	ENSP00000295488:p.Leu75fs	165.0	0.0	0		146.0	61.0	0.417808	NM_133636	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Frame_Shift_Ins	INS	ENST00000295488.3	hg19	CCDS3603.1																																																																																			.	.	.	none		0.574	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636	
TRPM8	79054	hgsc.bcm.edu	37	2	234890560	234890561	+	Splice_Site	INS	-	-	TTT			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr2:234890560_234890561insTTT	ENST00000324695.4	+	19	2629		c.e19+1		TRPM8_ENST00000433712.2_Splice_Site	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8						calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GCAGAGGATGGTAAGAGTCAAG	0.376																																					.		Atlas-Indel,Pindel	.											.	TRPM8	146	.	0			c.2589+1->TTT						PASS	.																																			SO:0001630	splice_region_variant	79054	exon19			.	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.2589+1->TTT	chr2.hg19:g.234890560_234890561insTTT		122.0	0.0	0		111.0	54.0	0.486486	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Splice_Site	INS	ENST00000324695.4	hg19	CCDS33407.1																																																																																			.	.	.	none		0.376	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	Intron
ACTR8	93973	hgsc.bcm.edu	37	3	53914042	53914049	+	Frame_Shift_Del	DEL	TGAGGAAT	TGAGGAAT	-	rs560149594		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	TGAGGAAT	TGAGGAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr3:53914042_53914049delTGAGGAAT	ENST00000335754.3	-	2	311_318	c.211_218delATTCCTCA	c.(211-219)attcctcacfs	p.IPH71fs	ACTR8_ENST00000231909.7_5'Flank|ACTR8_ENST00000482349.1_5'UTR|AC012467.1_ENST00000410956.1_RNA	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	71					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		GGCAATGACGTGAGGAATGCTGGCAGGA	0.466																																					p.71_73del		Atlas-INDEL	.											.	ACTR8	56	.	0			c.212_219del						PASS	.																																			SO:0001589	frameshift_variant	93973	exon2			.		CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.211_218delATTCCTCA	chr3.hg19:g.53914042_53914049delTGAGGAAT	ENSP00000336842:p.Ile71fs	118.0	0.0	0		161.0	33.0	0.204969	NM_022899	B3KSW7|Q8N566|Q9H663	Frame_Shift_Del	DEL	ENST00000335754.3	hg19	CCDS2875.1																																																																																			.	.	.	none		0.466	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2	NM_022899	
NOP2	4839	hgsc.bcm.edu	37	12	6672800	6672803	+	Frame_Shift_Del	DEL	GGGG	GGGG	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	GGGG	GGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr12:6672800_6672803delGGGG	ENST00000322166.5	-	7	786_789	c.665_668delCCCC	c.(664-669)ccccctfs	p.PP222fs	NOP2_ENST00000545200.1_Frame_Shift_Del_p.PP218fs|NOP2_ENST00000537442.1_Frame_Shift_Del_p.PP222fs|NOP2_ENST00000541778.1_Frame_Shift_Del_p.PP218fs|NOP2_ENST00000542015.1_Intron|NOP2_ENST00000382421.3_Frame_Shift_Del_p.PP255fs|NOP2_ENST00000399466.2_Frame_Shift_Del_p.PP218fs	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	222					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						CTCCCCAGCAGGGGGCAGCACAAA	0.559											OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.255_256del		Atlas-Indel,Pindel	.											.	NOP2	44	.	0			c.765_768del						PASS	.																																			SO:0001589	frameshift_variant	4839	exon8			.		CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.665_668delCCCC	chr12.hg19:g.6672800_6672803delGGGG	ENSP00000313272:p.Pro222fs	81.0	0.0	0	635	79.0	33.0	0.417722	NM_001258309	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Frame_Shift_Del	DEL	ENST00000322166.5	hg19	CCDS58203.1																																																																																			.	.	.	none		0.559	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	NM_006170	
CCSER1	401145	hgsc.bcm.edu	37	4	91229870	91229871	+	Frame_Shift_Ins	INS	-	-	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr4:91229870_91229871insA	ENST00000509176.1	+	2	723_724	c.435_436insA	c.(436-438)aatfs	p.N146fs	CCSER1_ENST00000432775.2_Frame_Shift_Ins_p.N146fs|CCSER1_ENST00000333691.8_Frame_Shift_Ins_p.N146fs	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	146								p.K145N(1)									CAACTAACAAGAATGTCTTTAT	0.376																																					p.K145fs		Atlas-Indel,Pindel	.											FAM190A_ENST00000509176,rectum,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.435_436insA						PASS	.																																			SO:0001589	frameshift_variant	401145	exon2			.		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.437dupA	chr4.hg19:g.91229872_91229872dupA	ENSP00000425040:p.Asn146fs	197.0	0.0	0		157.0	63.0	0.401274	NM_207491	Q4W5M0|Q86V57	Frame_Shift_Ins	INS	ENST00000509176.1	hg19	CCDS47099.1																																																																																			.	.	.	none		0.376	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
CNNM2	54805	hgsc.bcm.edu	37	10	104679232	104679232	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:104679232delT	ENST00000369878.4	+	1	1183	c.995delT	c.(994-996)atcfs	p.I332fs	CNNM2_ENST00000433628.2_Frame_Shift_Del_p.I332fs|CNNM2_ENST00000369875.3_Frame_Shift_Del_p.I332fs	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	332	DUF21.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		ACGCTCACCATCCTGCTCGAC	0.627																																					p.I332fs		Atlas-Indel,Pindel	.											.	CNNM2	119	.	0			c.994delA						PASS	.						70.0	60.0	63.0					10																	104679232		2203	4299	6502	SO:0001589	frameshift_variant	54805	exon1			.	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.995delT	chr10.hg19:g.104679232delT	ENSP00000358894:p.Ile332fs	36.0	0.0	0		40.0	20.0	0.5	NM_199076	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Frame_Shift_Del	DEL	ENST00000369878.4	hg19	CCDS44474.1																																																																																			.	.	.	none		0.627	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
RD3	343035	hgsc.bcm.edu	37	1	211654560	211654576	+	Frame_Shift_Del	DEL	TGTGCTGGCCAGCCAGC	TGTGCTGGCCAGCCAGC	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	TGTGCTGGCCAGCCAGC	TGTGCTGGCCAGCCAGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:211654560_211654576delTGTGCTGGCCAGCCAGC	ENST00000367002.4	-	2	1345_1361	c.182_198delGCTGGCTGGCCAGCACA	c.(181-198)agctggctggccagcacafs	p.SWLAST61fs	RD3_ENST00000484910.1_Intron	NM_001164688.1|NM_183059.2	NP_001158160.1|NP_898882.1	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3	61					response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)			p.W62L(1)		central_nervous_system(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		TGGACCGGGGTGTGCTGGCCAGCCAGCTGTAGTCCAC	0.599																																					p.61_67del		Atlas-Indel,Pindel	.											.	RD3	26	.	1	Substitution - Missense(1)	lung(1)	c.183_199del						PASS	.																																			SO:0001589	frameshift_variant	343035	exon2			.	AY191519	CCDS1498.1	1q32.3	2008-02-05	2006-11-13	2006-11-13	ENSG00000198570	ENSG00000198570			19689	protein-coding gene	gene with protein product		180040	"""chromosome 1 open reading frame 36"""	C1orf36		12914764	Standard	NM_183059		Approved	LCA12	uc001hin.2	Q7Z3Z2	OTTHUMG00000037002	ENST00000367002.4:c.182_198delGCTGGCTGGCCAGCACA	chr1.hg19:g.211654560_211654576delTGTGCTGGCCAGCCAGC	ENSP00000355969:p.Ser61fs	154.0	0.0	0		154.0	43.0	0.279221	NM_183059	A8K595	Frame_Shift_Del	DEL	ENST00000367002.4	hg19	CCDS1498.1																																																																																			.	.	.	none		0.599	RD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089837.1	NM_183059	
ACTR8	93973	hgsc.bcm.edu	37	3	53914039	53914040	+	Frame_Shift_Del	DEL	AC	AC	-	rs149728050	byFrequency	TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr3:53914039_53914040delAC	ENST00000335754.3	-	2	320_321	c.220_221delGT	c.(220-222)gtcfs	p.V74fs	ACTR8_ENST00000231909.7_5'Flank|ACTR8_ENST00000482349.1_5'UTR|AC012467.1_ENST00000410956.1_RNA	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	74					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		TCGGGCAATGACGTGAGGAATG	0.475																																					p.74_74del		Atlas-INDEL	.											.	ACTR8	56	.	0			c.221_222del						PASS	.																																			SO:0001589	frameshift_variant	93973	exon2			.		CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.220_221delGT	chr3.hg19:g.53914039_53914040delAC	ENSP00000336842:p.Val74fs	122.0	0.0	0		161.0	33.0	0.204969	NM_022899	B3KSW7|Q8N566|Q9H663	Frame_Shift_Del	DEL	ENST00000335754.3	hg19	CCDS2875.1																																																																																			.	.	.	none		0.475	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2	NM_022899	
BRE	9577	hgsc.bcm.edu	37	2	28460154	28460155	+	In_Frame_Ins	INS	-	-	TGCTCACCA	rs139141828		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr2:28460154_28460155insTGCTCACCA	ENST00000342045.2	+	9	907_908	c.766_767insTGCTCACCA	c.(766-768)ctg>cTGCTCACCAtg	p.256_257insLTM	BRE_ENST00000379624.1_In_Frame_Ins_p.256_257insLTM|BRE_ENST00000344773.2_In_Frame_Ins_p.256_257insLTM|BRE_ENST00000379632.2_In_Frame_Ins_p.256_257insLTM|BRE_ENST00000361704.2_In_Frame_Ins_p.256_257insLTM	NM_199194.2	NP_954664.1			brain and reproductive organ-expressed (TNFRSF1A modulator)											NS(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(2)	23	Acute lymphoblastic leukemia(172;0.155)					AGTATGCCACCTGCTCACCAAC	0.49																																					p.L256delinsLLTM		Atlas-Indel,Pindel	.											.	BRE	164	.	0			c.766_767insTGCTCACCA						PASS	.																																			SO:0001652	inframe_insertion	9577	exon8			.	AF015767	CCDS1763.1, CCDS1764.1, CCDS1765.1	2p23	2008-02-05			ENSG00000158019	ENSG00000158019			1106	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 4"""	610497				9737713, 7826398	Standard	NM_004899		Approved	BRCC45, BRCC4	uc002rls.3	Q9NXR7	OTTHUMG00000097831	ENST00000342045.2:c.767_775dupTGCTCACCA	chr2.hg19:g.28460155_28460163dupTGCTCACCA	ENSP00000339371:p.Leu256_Leu257insLeuThrMet	29.0	0.0	0		29.0	11.0	0.37931	NM_199191		In_Frame_Ins	INS	ENST00000342045.2	hg19	CCDS1763.1																																																																																			.	.	.	none		0.490	BRE-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215114.1		
MAN1B1	11253	hgsc.bcm.edu	37	9	139996055	139996055	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr9:139996055delG	ENST00000371589.4	+	8	1258	c.1185delG	c.(1183-1185)gtgfs	p.V395fs	MAN1B1_ENST00000474902.1_Frame_Shift_Del_p.V98fs	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	395					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		ACAGCACTGTGGCCGAGGTGA	0.577																																					p.V395fs		Atlas-Indel,Pindel	.											.	MAN1B1	40	.	0			c.1184delT						PASS	.						53.0	49.0	50.0					9																	139996055		2203	4300	6503	SO:0001589	frameshift_variant	11253	exon8			.	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1185delG	chr9.hg19:g.139996055delG	ENSP00000360645:p.Val395fs	87.0	0.0	0		81.0	32.0	0.395062	NM_016219	Q5VSG3|Q9BRS9|Q9Y5K7	Frame_Shift_Del	DEL	ENST00000371589.4	hg19	CCDS7029.1																																																																																			.	.	.	none		0.577	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	NM_016219	
UBN1	29855	hgsc.bcm.edu	37	16	4927063	4927068	+	In_Frame_Del	DEL	CATCGT	CATCGT	-	rs141880836|rs191007074		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	CATCGT	CATCGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr16:4927063_4927068delCATCGT	ENST00000396658.4	+	15	3919_3924	c.3216_3221delCATCGT	c.(3214-3222)gccatcgtc>gcc	p.IV1073del	UBN1_ENST00000545171.1_In_Frame_Del_p.IV1073del|UBN1_ENST00000590769.1_In_Frame_Del_p.IV1073del|UBN1_ENST00000262376.6_In_Frame_Del_p.IV1073del	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	1073					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						CCAAGGATGCCATCGTCACAGGCCCT	0.578																																					p.1072_1074del		Atlas-Indel,Pindel	.											.	UBN1	88	.	0			c.3215_3220del						PASS	.																																			SO:0001651	inframe_deletion	29855	exon16			.	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.3216_3221delCATCGT	chr16.hg19:g.4927063_4927068delCATCGT	ENSP00000379894:p.Ile1073_Val1074del	73.0	0.0	0		82.0	35.0	0.426829	NM_001079514	B7Z6D3|D3DUE8|Q13079|Q9P1P7	In_Frame_Del	DEL	ENST00000396658.4	hg19	CCDS10525.1																																																																																			.	.	.	none		0.578	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
MPND	84954	hgsc.bcm.edu	37	19	4357350	4357351	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:4357350_4357351delAG	ENST00000262966.8	+	9	1164_1165	c.1097_1098delAG	c.(1096-1098)cagfs	p.Q366fs	MPND_ENST00000359935.4_Frame_Shift_Del_p.Q316fs|AC007292.3_ENST00000593524.1_RNA|MPND_ENST00000599840.1_Frame_Shift_Del_p.Q366fs	NM_032868.4	NP_116257.2	Q8N594	MPND_HUMAN	MPN domain containing	366	MPN.						peptidase activity (GO:0008233)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCGACGCACAGATGGACTACC	0.663																																					p.366_366del		Atlas-INDEL	.											.	MPND	28	.	0			c.1096_1097del						PASS	.																																			SO:0001589	frameshift_variant	84954	exon9			.		CCDS42470.1, CCDS54200.1, CCDS74261.1	19p13.3	2014-08-12			ENSG00000008382				25934	protein-coding gene	gene with protein product							Standard	XM_005259663		Approved	FLJ14981	uc002mae.3	Q8N594	OTTHUMG00000181914	ENST00000262966.8:c.1097_1098delAG	chr19.hg19:g.4357350_4357351delAG	ENSP00000262966:p.Gln366fs	76.0	0.0	0		92.0	33.0	0.358696	NM_032868	Q96SJ0|Q9Y2P1|Q9Y2P2	Frame_Shift_Del	DEL	ENST00000262966.8	hg19	CCDS42470.1																																																																																			.	.	.	none		0.663	MPND-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458292.1	NM_032868	
CPNE2	221184	hgsc.bcm.edu	37	16	57147302	57147317	+	Frame_Shift_Del	DEL	CTCTTTGACCAGGACA	CTCTTTGACCAGGACA	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	CTCTTTGACCAGGACA	CTCTTTGACCAGGACA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr16:57147302_57147317delCTCTTTGACCAGGACA	ENST00000535318.2	+	4	644_659	c.283_298delCTCTTTGACCAGGACA	c.(283-300)ctctttgaccaggacaagfs	p.LFDQDK95fs	CPNE2_ENST00000537605.1_5'UTR|CPNE2_ENST00000565874.1_Frame_Shift_Del_p.LFDQDK95fs|CPNE2_ENST00000290776.8_Frame_Shift_Del_p.LFDQDK95fs			Q96FN4	CPNE2_HUMAN	copine II	95	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				CAAGTTCGCGCTCTTTGACCAGGACAAGTCCAGTAT	0.593																																					p.94_99del		Atlas-Indel,Pindel	.											.	CPNE2	48	.	0			c.282_297del						PASS	.																																			SO:0001589	frameshift_variant	221184	exon3			.		CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.283_298delCTCTTTGACCAGGACA	chr16.hg19:g.57147302_57147317delCTCTTTGACCAGGACA	ENSP00000439018:p.Leu95fs	99.0	0.0	0		126.0	15.0	0.119048	NM_152727	Q68D19|Q719H8|Q86XP9	Frame_Shift_Del	DEL	ENST00000535318.2	hg19	CCDS10774.1																																																																																			.	.	.	none		0.593	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432986.2	NM_152727	
CHST2	9435	hgsc.bcm.edu	37	3	142840750	142840750	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr3:142840750delC	ENST00000309575.3	+	2	2476	c.1092delC	c.(1090-1092)cacfs	p.H364fs		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	364					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						CGCGAGCTCACCGCATGCCCT	0.697																																					p.H364fs		Atlas-Indel,Pindel	.											.	CHST2	67	.	0			c.1091delA						PASS	.						20.0	25.0	23.0					3																	142840750		2201	4293	6494	SO:0001589	frameshift_variant	9435	exon2			.	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1092delC	chr3.hg19:g.142840750delC	ENSP00000307911:p.His364fs	72.0	0.0	0		120.0	38.0	0.316667	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Frame_Shift_Del	DEL	ENST00000309575.3	hg19	CCDS3129.1																																																																																			.	.	.	none		0.697	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
TRIP12	9320	hgsc.bcm.edu	37	2	230656737	230656737	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr2:230656737delC	ENST00000283943.5	-	28	4213	c.4035delG	c.(4033-4035)cagfs	p.Q1345fs	TRIP12_ENST00000389044.4_Frame_Shift_Del_p.Q1393fs|TRIP12_ENST00000389045.3_Frame_Shift_Del_p.Q1075fs	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1345					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CAATATAAAACTGCAGCCTGT	0.403																																					p.F1346fs		Atlas-Indel,Pindel	.											.	TRIP12	207	.	0			c.4036delT						PASS	.						128.0	126.0	127.0					2																	230656737		2203	4300	6503	SO:0001589	frameshift_variant	9320	exon28			.	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4035delG	chr2.hg19:g.230656737delC	ENSP00000283943:p.Gln1345fs	235.0	0.0	0		205.0	79.0	0.385366	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Frame_Shift_Del	DEL	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.	.	none		0.403	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
PER3	8863	hgsc.bcm.edu	37	1	7845028	7845028	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:7845028delT	ENST00000361923.2	+	1	266	c.91delT	c.(91-93)ttcfs	p.F31fs	PER3_ENST00000377541.1_Frame_Shift_Del_p.F31fs|PER3_ENST00000377532.3_Frame_Shift_Del_p.F31fs	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	31					circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		GAGCCCCGAGTTCCATCTGCA	0.672																																					p.E30fs		Atlas-Indel,Pindel	.											.	PER3	95	.	0			c.90delG						PASS	.						28.0	32.0	30.0					1																	7845028		2202	4300	6502	SO:0001589	frameshift_variant	8863	exon1			.	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.91delT	chr1.hg19:g.7845028delT	ENSP00000355031:p.Phe31fs	221.0	0.0	0		209.0	96.0	0.45933	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Frame_Shift_Del	DEL	ENST00000361923.2	hg19	CCDS89.1																																																																																			.	.	.	none		0.672	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
KCNJ15	3772	hgsc.bcm.edu	37	21	39671467	39671468	+	Frame_Shift_Ins	INS	-	-	A			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr21:39671467_39671468insA	ENST00000328656.4	+	4	587_588	c.284_285insA	c.(283-288)ttagaafs	p.E96fs	KCNJ15_ENST00000398930.1_Frame_Shift_Ins_p.E96fs|KCNJ15_ENST00000398938.2_Frame_Shift_Ins_p.E96fs|KCNJ15_ENST00000398932.1_Frame_Shift_Ins_p.E96fs|KCNJ15_ENST00000398934.1_Frame_Shift_Ins_p.E96fs	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	96					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	CATGGGGACTTAGAACCCGGTG	0.48																																					p.I95fs		Atlas-Indel,Pindel	.											.	KCNJ15	43	.	0			c.284_285insA						PASS	.																																			SO:0001589	frameshift_variant	3772	exon3			.	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.285dupA	chr21.hg19:g.39671468_39671468dupA	ENSP00000331698:p.Glu96fs	90.0	0.0	0		50.0	30.0	0.6	NM_170736	D3DSH5|O00564|Q96L28|Q99446	Frame_Shift_Ins	INS	ENST00000328656.4	hg19	CCDS13656.1																																																																																			.	.	.	none		0.480	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243	
C10orf71	118461	hgsc.bcm.edu	37	10	50532215	50532217	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	TCA	TCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:50532215_50532217delTCA	ENST00000374144.3	+	3	1913_1915	c.1625_1627delTCA	c.(1624-1629)gtcatc>gtc	p.I543del	C10orf71_ENST00000323868.4_In_Frame_Del_p.I543del			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	543										endometrium(1)	1						AGCAACGGTGTCATCCTCCCCAA	0.498																																					p.542_542del		Atlas-Indel,Pindel	.											.	C10orf71	179	.	0			c.1624_1626del						PASS	.																																			SO:0001651	inframe_deletion	118461	exon3			.	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.1625_1627delTCA	chr10.hg19:g.50532215_50532217delTCA	ENSP00000363259:p.Ile543del	150.0	0.0	0		109.0	41.0	0.376147	NM_001135196	A0AVL8	In_Frame_Del	DEL	ENST00000374144.3	hg19	CCDS44387.1																																																																																			.	.	.	none		0.498	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
PPCDC	60490	hgsc.bcm.edu	37	15	75341008	75341009	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr15:75341008_75341009delTT	ENST00000342932.3	+	5	619_620	c.475_476delTT	c.(475-477)tttfs	p.F159fs	PPCDC_ENST00000563393.1_Frame_Shift_Del_p.F36fs|PPCDC_ENST00000568649.1_Frame_Shift_Del_p.F116fs|PPCDC_ENST00000564923.1_Frame_Shift_Del_p.F84fs|PPCDC_ENST00000567336.1_Frame_Shift_Del_p.F127fs	NM_021823.3	NP_068595.3	Q96CD2	COAC_HUMAN	phosphopantothenoylcysteine decarboxylase	159					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	phosphopantothenoylcysteine decarboxylase activity (GO:0004633)			breast(1)|cervix(1)	2						GCTCAAGGCCTTTGGCTATGTC	0.619																																					p.158_159del		Atlas-Indel,Pindel	.											.	PPCDC	12	.	0			c.474_475del						PASS	.																																			SO:0001589	frameshift_variant	60490	exon5			.	AK027491	CCDS10275.1, CCDS73761.1, CCDS73759.1, CCDS73760.1	15q24.2	2005-08-16			ENSG00000138621	ENSG00000138621	4.1.1.36		28107	protein-coding gene	gene with protein product		609854				12975309, 11923312	Standard	XM_005254579		Approved	MDS018, FLJ14585	uc002azo.3	Q96CD2	OTTHUMG00000142824	ENST00000342932.3:c.475_476delTT	chr15.hg19:g.75341008_75341009delTT	ENSP00000343190:p.Phe159fs	129.0	0.0	0		62.0	22.0	0.354839	NM_021823	Q96SX0|Q9HC17	Frame_Shift_Del	DEL	ENST00000342932.3	hg19	CCDS10275.1																																																																																			.	.	.	none		0.619	PPCDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286416.1	NM_021823	
CYP2C18	1562	hgsc.bcm.edu	37	10	96447965	96447965	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:96447965delA	ENST00000285979.6	+	3	614	c.415delA	c.(415-417)aggfs	p.R139fs	CYP2C18_ENST00000339022.5_Frame_Shift_Del_p.R139fs|CYP2C19_ENST00000464755.1_3'UTR	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	139					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.R139G(2)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	GATGGGGAAGAGGAGCATCGA	0.468																																					p.K138fs		Atlas-INDEL	.											.	CYP2C18	79	.	2	Substitution - Missense(2)	lung(2)	c.414delG						PASS	.						124.0	117.0	120.0					10																	96447965		2203	4300	6503	SO:0001589	frameshift_variant	1562	exon3			.	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.415delA	chr10.hg19:g.96447965delA	ENSP00000285979:p.Arg139fs	206.0	0.0	0		180.0	71.0	0.394444	NM_000772	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Frame_Shift_Del	DEL	ENST00000285979.6	hg19	CCDS7435.1																																																																																			.	.	.	none		0.468	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049486.1	NM_000772	
MPND	84954	hgsc.bcm.edu	37	19	4357354	4357354	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:4357354delG	ENST00000262966.8	+	9	1168	c.1101delG	c.(1099-1101)atgfs	p.M367fs	MPND_ENST00000359935.4_Frame_Shift_Del_p.M317fs|AC007292.3_ENST00000593524.1_RNA|MPND_ENST00000599840.1_Frame_Shift_Del_p.M367fs	NM_032868.4	NP_116257.2	Q8N594	MPND_HUMAN	MPN domain containing	367	MPN.						peptidase activity (GO:0008233)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGCACAGATGGACTACCAGC	0.677																																					p.M367fs		Atlas-INDEL	.											.	MPND	28	.	0			c.1100delT						PASS	.						21.0	23.0	23.0					19																	4357354		2017	4181	6198	SO:0001589	frameshift_variant	84954	exon9			.		CCDS42470.1, CCDS54200.1, CCDS74261.1	19p13.3	2014-08-12			ENSG00000008382				25934	protein-coding gene	gene with protein product							Standard	XM_005259663		Approved	FLJ14981	uc002mae.3	Q8N594	OTTHUMG00000181914	ENST00000262966.8:c.1101delG	chr19.hg19:g.4357354delG	ENSP00000262966:p.Met367fs	77.0	0.0	0		88.0	34.0	0.386364	NM_032868	Q96SJ0|Q9Y2P1|Q9Y2P2	Frame_Shift_Del	DEL	ENST00000262966.8	hg19	CCDS42470.1																																																																																			.	.	.	none		0.677	MPND-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458292.1	NM_032868	
IKBKAP	8518	hgsc.bcm.edu	37	9	111642434	111642434	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr9:111642434delA	ENST00000374647.5	-	32	3665	c.3358delT	c.(3358-3360)tatfs	p.Y1120fs	IKBKAP_ENST00000467959.1_5'UTR|IKBKAP_ENST00000537196.1_Frame_Shift_Del_p.Y771fs	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	1120					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AATGCCATATAATTTTTCTGG	0.453																																					p.Y1120fs		Atlas-Indel,Pindel	.											.	IKBKAP	122	.	0			c.3359delA						PASS	.						100.0	99.0	99.0					9																	111642434		2203	4300	6503	SO:0001589	frameshift_variant	8518	exon32			.	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.3358delT	chr9.hg19:g.111642434delA	ENSP00000363779:p.Tyr1120fs	110.0	0.0	0		105.0	49.0	0.466667	NM_003640	Q5JSV2|Q9H327|Q9UG87	Frame_Shift_Del	DEL	ENST00000374647.5	hg19	CCDS6773.1																																																																																			.	.	.	none		0.453	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1		
MPND	84954	hgsc.bcm.edu	37	19	4357351	4357354	+	Frame_Shift_Del	DEL	GATG	GATG	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	GATG	GATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:4357351_4357354delGATG	ENST00000262966.8	+	9	1165_1168	c.1098_1101delGATG	c.(1096-1101)cagatgfs	p.QM366fs	MPND_ENST00000359935.4_Frame_Shift_Del_p.QM316fs|AC007292.3_ENST00000593524.1_RNA|MPND_ENST00000599840.1_Frame_Shift_Del_p.QM366fs	NM_032868.4	NP_116257.2	Q8N594	MPND_HUMAN	MPN domain containing	366	MPN.						peptidase activity (GO:0008233)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGACGCACAGATGGACTACCAGC	0.672																																					p.366_367del		Pindel	.											.	MPND	28	.	0			c.1097_1100del						PASS	.																																			SO:0001589	frameshift_variant	84954	exon9			.		CCDS42470.1, CCDS54200.1, CCDS74261.1	19p13.3	2014-08-12			ENSG00000008382				25934	protein-coding gene	gene with protein product							Standard	XM_005259663		Approved	FLJ14981	uc002mae.3	Q8N594	OTTHUMG00000181914	ENST00000262966.8:c.1098_1101delGATG	chr19.hg19:g.4357351_4357354delGATG	ENSP00000262966:p.Gln366fs	77.0	0.0	.		92.0	25.0	0.272	NM_032868	Q96SJ0|Q9Y2P1|Q9Y2P2	Frame_Shift_Del	DEL	ENST00000262966.8	hg19	CCDS42470.1																																																																																			.	.	.	none		0.672	MPND-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458292.1	NM_032868	
CYP2C18	1562	hgsc.bcm.edu	37	10	96447963	96447965	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr10:96447963_96447965delAGA	ENST00000285979.6	+	3	612_614	c.413_415delAGA	c.(412-417)aagagg>agg	p.K138del	CYP2C18_ENST00000339022.5_In_Frame_Del_p.K138del|CYP2C19_ENST00000464755.1_3'UTR	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	138					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.R139G(2)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	GGGATGGGGAAGAGGAGCATCGA	0.468																																					p.138_138del		Pindel	.											.	CYP2C18	79	.	2	Substitution - Missense(2)	lung(2)	c.412_414del						PASS	.																																			SO:0001651	inframe_deletion	1562	exon3			.	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.413_415delAGA	chr10.hg19:g.96447963_96447965delAGA	ENSP00000285979:p.Lys138del	207.0	0.0	.		182.0	54.0	0.297	NM_000772	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	In_Frame_Del	DEL	ENST00000285979.6	hg19	CCDS7435.1																																																																																			.	.	.	none		0.468	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049486.1	NM_000772	
TMEM242	729515	hgsc.bcm.edu	37	6	157739882	157739887	+	In_Frame_Del	DEL	AGCCCC	AGCCCC	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	AGCCCC	AGCCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr6:157739882_157739887delAGCCCC	ENST00000400788.4	-	3	355_360	c.254_259delGGGGCT	c.(253-261)tggggctcc>tcc	p.WG85del	TMEM242_ENST00000367144.4_In_Frame_Del_p.WG85del	NM_018452.4	NP_060922.2	Q9NWH2	TM242_HUMAN	transmembrane protein 242	85						integral component of membrane (GO:0016021)											GCATACAGGGAGCCCCAGCCCAGAGC	0.495																																					p.85_87del		Pindel	.											.	.	.	.	0			c.255_260del						PASS	.																																			SO:0001651	inframe_deletion	729515	exon3			.	AF217510	CCDS43519.1	6q25.3	2011-11-25	2011-11-25	2011-11-25	ENSG00000215712	ENSG00000215712			17206	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 35"""	C6orf35			Standard	NM_018452		Approved	BM033	uc003sih.4	Q9NWH2	OTTHUMG00000015893	ENST00000400788.4:c.254_259delGGGGCT	chr6.hg19:g.157739882_157739887delAGCCCC	ENSP00000383594:p.Trp85_Gly86del	237.0	0.0	.		228.0	67.0	0.294	NM_018452	B9EJD0|Q9NZ88|Q9P094	In_Frame_Del	DEL	ENST00000400788.4	hg19	CCDS43519.1																																																																																			.	.	.	none		0.495	TMEM242-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042837.2		
ABCC5	10057	hgsc.bcm.edu	37	3	183695342	183695342	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr3:183695342delG	ENST00000334444.6	-	10	1607	c.1367delC	c.(1366-1368)tccfs	p.S456fs	ABCC5_ENST00000492216.1_5'UTR|ABCC5_ENST00000265586.6_Frame_Shift_Del_p.S456fs	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	456	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	TTCTGAGAGGGACTTTACTGA	0.488																																					p.S456fs		Pindel	.											.	ABCC5	142	.	0			c.1368delC						PASS	.						82.0	79.0	80.0					3																	183695342		1906	4131	6037	SO:0001589	frameshift_variant	10057	exon10			.	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.1367delC	chr3.hg19:g.183695342delG	ENSP00000333926:p.Ser456fs	134.0	0.0	.		163.0	21.0	0.129	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Frame_Shift_Del	DEL	ENST00000334444.6	hg19	CCDS43176.1																																																																																			.	.	.	none		0.488	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
CMBL	134147	hgsc.bcm.edu	37	5	10286542	10286543	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr5:10286542_10286543delTC	ENST00000296658.3	-	4	809_810	c.389_390delGA	c.(388-390)ggafs	p.G130fs	CMBL_ENST00000510532.1_5'UTR	NM_138809.3	NP_620164.1	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase homolog (Pseudomonas)	130						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(9)|skin(1)|stomach(1)	13						CCCAGCAGAATCCCACGATGCC	0.421																																					p.130_131del		Pindel	.											.	CMBL	24	.	0			c.390_391del						PASS	.																																			SO:0001589	frameshift_variant	134147	exon4			.		CCDS3878.1	5p15.2	2010-06-25	2006-09-12		ENSG00000164237	ENSG00000164237	3.1.-.-		25090	protein-coding gene	gene with protein product		613379	"""carboxymethylenebutenolidase-like (Pseudomonas)"""			3804974, 20177059	Standard	NM_138809		Approved	FLJ23617	uc003jes.3	Q96DG6	OTTHUMG00000131043	ENST00000296658.3:c.389_390delGA	chr5.hg19:g.10286542_10286543delTC	ENSP00000296658:p.Gly130fs	91.0	0.0	.		63.0	23.0	0.365	NM_138809	D3DTC7|Q8TED6	Frame_Shift_Del	DEL	ENST00000296658.3	hg19	CCDS3878.1																																																																																			.	.	.	none		0.421	CMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253689.1	NM_138809	
ANO8	57719	hgsc.bcm.edu	37	19	17440636	17440637	+	Frame_Shift_Del	DEL	TG	TG	-	rs377317921		TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr19:17440636_17440637delTG	ENST00000159087.4	-	12	1491_1492	c.1333_1334delCA	c.(1333-1335)cagfs	p.Q445fs		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	445	Leu-rich.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GTTGACAAACTGGAACTGCAGG	0.604																																					p.445_445del		Pindel	.											.	ANO8	67	.	0			c.1334_1335del						PASS	.																																			SO:0001589	frameshift_variant	57719	exon12			.	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.1333_1334delCA	chr19.hg19:g.17440636_17440637delTG	ENSP00000159087:p.Gln445fs	133.0	0.0	.		129.0	36.0	0.279	NM_020959	A6NIJ0	Frame_Shift_Del	DEL	ENST00000159087.4	hg19	CCDS32949.1																																																																																			.	.	.	none		0.604	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644	
SNX7	51375	hgsc.bcm.edu	37	1	99127306	99127307	+	Frame_Shift_Ins	INS	-	-	C			TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr1:99127306_99127307insC	ENST00000306121.3	+	1	28_29	c.19_20insC	c.(19-21)gcafs	p.A7fs	SNX7_ENST00000529992.1_Frame_Shift_Ins_p.A7fs|SNX7_ENST00000370189.5_5'UTR	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	0					apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		CGAGCGCCGGGCATCGCAGGCG	0.802																																					p.A7fs		Pindel	.											.	SNX7	76	.	0			c.19_20insC						PASS	.																																			SO:0001589	frameshift_variant	51375	exon1			.	AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.20dupC	chr1.hg19:g.99127307_99127307dupC	ENSP00000304429:p.Ala7fs	36.0	0.0	.		35.0	10.0	0.286	NM_015976	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Frame_Shift_Ins	INS	ENST00000306121.3	hg19	CCDS755.2																																																																																			.	.	.	none		0.802	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2		
RIMBP3B	440804	hgsc.bcm.edu	37	22	21741340	21741341	+	In_Frame_Ins	INS	-	-	TGCAGG	rs555102406	byFrequency	TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr22:21741340_21741341insTGCAGG	ENST00000434111.1	+	1	3678_3679	c.3193_3194insTGCAGG	c.(3193-3195)ctg>cTGCAGGtg	p.1067_1068insQV	SCARNA17_ENST00000516211.1_RNA|RN7SKP63_ENST00000363187.1_RNA|SCARNA18_ENST00000516505.1_RNA	NM_001128635.1	NP_001122107.1	A6NNM3	RIM3B_HUMAN	RIMS binding protein 3B	1067	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.																ATGGGACTTGCTGCAGGTGTAT	0.663																																					p.L1065delinsLQV		Pindel	.											.	RIMBP3C	6	.	0			c.3193_3194insTGCAGG						PASS	.			6,24		3,0,12						-2.0	0.0			1	7,131		3,1,65	no	coding	RIMBP3B	NM_001128635.1		6,1,77	A1A1,A1R,RR		5.0725,20.0,7.7381				13,155				SO:0001652	inframe_insertion	150221	exon1			.		CCDS46668.1	22q11.21	2008-10-23			ENSG00000196934	ENSG00000274600			33891	protein-coding gene	gene with protein product		612700				17855024	Standard	NM_001128635		Approved			A6NNM3	OTTHUMG00000150819	ENST00000434111.1:c.3194_3199dupTGCAGG	chr22.hg19:g.21741341_21741346dupTGCAGG	ENSP00000407925:p.Gln1066_Val1067dup	0.0	0.0	.		19.0	19.0	1.000	NM_001128633		In_Frame_Ins	INS	ENST00000434111.1	hg19	CCDS46668.1																																																																																			.	.	.	none		0.663	RIMBP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320196.2	XM_036936	
ACTR8	93973	hgsc.bcm.edu	37	3	53914039	53914049	+	Frame_Shift_Del	DEL	ACGTGAGGAAT	ACGTGAGGAAT	-	rs560149594|rs149728050	byFrequency	TCGA-5P-A9JY-01A-11D-A42J-10	TCGA-5P-A9JY-10A-01D-A42M-10	ACGTGAGGAAT	ACGTGAGGAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d3702abb-947d-4b7c-93d3-30102121f09b	f6bea4da-a48b-4082-b9aa-e19d3af1ac5c	g.chr3:53914039_53914049delACGTGAGGAAT	ENST00000335754.3	-	2	311_321	c.211_221delATTCCTCACGT	c.(211-222)attcctcacgtcfs	p.IPHV71fs	ACTR8_ENST00000231909.7_5'Flank|ACTR8_ENST00000482349.1_5'UTR|AC012467.1_ENST00000410956.1_RNA	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	71					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		TCGGGCAATGACGTGAGGAATGCTGGCAGGA	0.46																																					p.71_74del		Pindel	.											.	ACTR8	56	.	0			c.212_222del						PASS	.																																			SO:0001589	frameshift_variant	93973	exon2			.		CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.211_221delATTCCTCACGT	chr3.hg19:g.53914039_53914049delACGTGAGGAAT	ENSP00000336842:p.Ile71fs	121.0	0.0	.		170.0	31.0	0.182	NM_022899	B3KSW7|Q8N566|Q9H663	Frame_Shift_Del	DEL	ENST00000335754.3	hg19	CCDS2875.1																																																																																			.	.	.	none		0.460	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2	NM_022899	
