#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM52	339456	hgsc.bcm.edu	37	1	1850654	1850654	+	Silent	SNP	G	G	C			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr1:1850654G>C	ENST00000310991.3	-	1	58	c.51C>G	c.(49-51)ctC>ctG	p.L17L	TMEM52_ENST00000378602.3_5'Flank	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	17						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ggagcggcaggagcggcagca	0.771																																					p.L17L		Atlas-SNP	.											TMEM52,NS,carcinoma,0,1	TMEM52	21	.	0			c.C51G						PASS	.						1.0	2.0	1.0					1																	1850654		671	1684	2355	SO:0001819	synonymous_variant	339456	exon1			CGGCAGGAGCGGC	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.51C>G	chr1.hg19:g.1850654G>C		9.0	1.0	.		10.0	2.0	.	NM_178545	Q4VXS6|Q6UX25	Silent	SNP	ENST00000310991.3	hg19	CCDS35.1	.	.	.	.	.	.	.	.	.	.	.	4.530	0.098402	0.08681	.	.	ENSG00000178821	ENST00000378598	.	.	.	0.149	0.149	0.14863	.	.	.	.	.	T	0.39489	0.1080	.	.	.	0.22446	N	0.999091	.	.	.	.	.	.	T	0.39035	-0.9633	4	0.87932	D	0	.	.	.	.	.	.	.	.	C	15	.	ENSP00000367861:S15C	S	-	2	0	TMEM52	1840514	0.001000	0.12720	0.009000	0.14445	0.010000	0.07245	0.286000	0.18902	0.192000	0.20272	0.195000	0.17529	TCC	.	.	.	none		0.771	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002781.1	NM_178545	
PTCH2	8643	hgsc.bcm.edu	37	1	45295617	45295617	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr1:45295617C>T	ENST00000372192.3	-	7	1029	c.899G>A	c.(898-900)gGa>gAa	p.G300E	PTCH2_ENST00000447098.2_Missense_Mutation_p.G300E	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	300					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					GGCCATGCCTCCCAGCAGCAA	0.587									Basal Cell Nevus syndrome																												p.G300E		Atlas-SNP	.											.	PTCH2	96	.	0			c.G899A						PASS	.						37.0	37.0	37.0					1																	45295617		2203	4300	6503	SO:0001583	missense	8643	exon7	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	ATGCCTCCCAGCA	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.899G>A	chr1.hg19:g.45295617C>T	ENSP00000361266:p.Gly300Glu	102.0	0.0	.		95.0	42.0	.	NM_001166292	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	hg19	CCDS516.1	.	.	.	.	.	.	.	.	.	.	C	31	5.096188	0.94197	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.97731	-4.44;-4.51	4.78	4.78	0.61160	.	0.000000	0.51477	D	0.000084	D	0.98845	0.9610	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99701	1.1004	10	0.87932	D	0	-14.0582	16.7386	0.85454	0.0:1.0:0.0:0.0	.	300	Q9Y6C5	PTC2_HUMAN	E	300	ENSP00000389703:G300E;ENSP00000361266:G300E	ENSP00000361266:G300E	G	-	2	0	PTCH2	45068204	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.071000	0.76770	2.480000	0.83734	0.561000	0.74099	GGA	.	.	.	none		0.587	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738	
C8A	731	hgsc.bcm.edu	37	1	57372456	57372456	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr1:57372456G>A	ENST00000361249.3	+	8	1309	c.1213G>A	c.(1213-1215)Ggc>Agc	p.G405S		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	405	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						ATTTGGAGGTGGCAAAACTGG	0.403																																					p.G405S		Atlas-SNP	.											.	C8A	103	.	0			c.G1213A						PASS	.						108.0	108.0	108.0					1																	57372456		2203	4300	6503	SO:0001583	missense	731	exon8			GGAGGTGGCAAAA	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1213G>A	chr1.hg19:g.57372456G>A	ENSP00000354458:p.Gly405Ser	153.0	0.0	.		139.0	56.0	.	NM_000562	A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	hg19	CCDS606.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398516	0.25205	.	.	ENSG00000157131	ENST00000361249	D	0.83250	-1.7	4.87	4.87	0.63330	Membrane attack complex component/perforin (MACPF) domain (3);	0.711573	0.14889	N	0.292511	T	0.78748	0.4332	L	0.58302	1.8	0.19575	N	0.999965	P	0.35527	0.507	B	0.37550	0.253	T	0.66991	-0.5783	10	0.06494	T	0.89	-25.6441	13.709	0.62656	0.0:0.0:1.0:0.0	.	405	P07357	CO8A_HUMAN	S	405	ENSP00000354458:G405S	ENSP00000354458:G405S	G	+	1	0	C8A	57145044	0.061000	0.20836	0.154000	0.22540	0.399000	0.30720	2.056000	0.41355	2.711000	0.92665	0.561000	0.74099	GGC	.	.	.	none		0.403	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	
TCHH	7062	hgsc.bcm.edu	37	1	152084174	152084174	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr1:152084174G>C	ENST00000368804.1	-	2	1518	c.1519C>G	c.(1519-1521)Cta>Gta	p.L507V		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	507	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCCGCCTTAGTTGCTGCTCG	0.652																																					p.L507V		Atlas-SNP	.											.	TCHH	275	.	0			c.C1519G						PASS	.						63.0	70.0	67.0					1																	152084174		2062	4193	6255	SO:0001583	missense	7062	exon3			GCCTTAGTTGCTG	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1519C>G	chr1.hg19:g.152084174G>C	ENSP00000357794:p.Leu507Val	30.0	0.0	.		37.0	6.0	.	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	g	7.583	0.669162	0.14776	.	.	ENSG00000159450	ENST00000368804	T	0.06528	3.29	1.93	0.956	0.19608	.	.	.	.	.	T	0.01061	0.0035	N	0.08118	0	0.09310	N	1	B	0.25904	0.137	B	0.29440	0.102	T	0.48305	-0.9047	9	0.29301	T	0.29	.	7.6375	0.28274	0.0:0.0:0.7453:0.2547	.	507	Q07283	TRHY_HUMAN	V	507	ENSP00000357794:L507V	ENSP00000357794:L507V	L	-	1	2	TCHH	150350798	0.000000	0.05858	0.002000	0.10522	0.099000	0.18886	0.376000	0.20535	0.398000	0.25338	0.109000	0.15622	CTA	.	.	.	none		0.652	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
TCHH	7062	hgsc.bcm.edu	37	1	152084221	152084221	+	Missense_Mutation	SNP	A	A	C	rs202112040		TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr1:152084221A>C	ENST00000368804.1	-	2	1471	c.1472T>G	c.(1471-1473)cTc>cGc	p.L491R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	491	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTCCTCGAGCTTCAGCCA	0.672																																					p.L491R		Atlas-SNP	.											.	TCHH	275	.	0			c.T1472G						PASS	.						63.0	70.0	68.0					1																	152084221		2106	4220	6326	SO:0001583	missense	7062	exon3			TCCTCGAGCTTCA	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1472T>G	chr1.hg19:g.152084221A>C	ENSP00000357794:p.Leu491Arg	22.0	0.0	.		42.0	8.0	.	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	a	0.064	-1.216147	0.01542	.	.	ENSG00000159450	ENST00000368804	T	0.04603	3.59	2.11	-4.23	0.03789	.	.	.	.	.	T	0.00524	0.0017	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43491	-0.9388	9	0.12430	T	0.62	.	7.0185	0.24900	0.2982:0.5613:0.0:0.1406	.	491	Q07283	TRHY_HUMAN	R	491	ENSP00000357794:L491R	ENSP00000357794:L491R	L	-	2	0	TCHH	150350845	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-1.154000	0.03166	-2.764000	0.00368	-1.533000	0.00918	CTC	.	.	.	weak		0.672	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
SEMA4A	64218	hgsc.bcm.edu	37	1	156130786	156130786	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr1:156130786G>C	ENST00000368285.3	+	8	1043	c.776G>C	c.(775-777)aGg>aCg	p.R259T	SEMA4A_ENST00000355014.2_Missense_Mutation_p.R259T|SEMA4A_ENST00000368284.1_Missense_Mutation_p.R127T|SEMA4A_ENST00000368282.1_Missense_Mutation_p.R259T|SEMA4A_ENST00000487358.1_3'UTR|SEMA4A_ENST00000368286.2_Missense_Mutation_p.R127T	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	259	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					TTCTTTGAGAGGCTCCACACA	0.622																																					p.R259T		Atlas-SNP	.											.	SEMA4A	75	.	0			c.G776C						PASS	.						112.0	126.0	121.0					1																	156130786		2203	4300	6503	SO:0001583	missense	64218	exon8			TTGAGAGGCTCCA	AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.776G>C	chr1.hg19:g.156130786G>C	ENSP00000357268:p.Arg259Thr	37.0	0.0	.		57.0	17.0	.	NM_001193300	B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Missense_Mutation	SNP	ENST00000368285.3	hg19	CCDS1132.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.798929	0.50208	.	.	ENSG00000196189	ENST00000435124;ENST00000414683;ENST00000355014;ENST00000368285;ENST00000368284;ENST00000368283;ENST00000544376;ENST00000368286;ENST00000438830;ENST00000368282	T;T;T;T;T;T;T;T	0.10763	2.84;2.84;2.84;2.84;2.84;2.84;2.84;2.84	5.65	-0.876	0.10624	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.435314	0.24776	N	0.035696	T	0.02571	0.0078	L	0.39898	1.24	0.25989	N	0.982277	B;B	0.27264	0.041;0.173	B;B	0.29440	0.065;0.102	T	0.38929	-0.9638	10	0.48119	T	0.1	.	5.6603	0.17664	0.5503:0.1361:0.3136:0.0	.	127;259	Q5TCJ6;Q9H3S1	.;SEM4A_HUMAN	T	259;160;259;259;127;221;221;127;226;259	ENSP00000401391:R259T;ENSP00000399230:R160T;ENSP00000347117:R259T;ENSP00000357268:R259T;ENSP00000357267:R127T;ENSP00000357269:R127T;ENSP00000392865:R226T;ENSP00000357265:R259T	ENSP00000347117:R259T	R	+	2	0	SEMA4A	154397410	0.916000	0.31088	0.889000	0.34880	0.729000	0.41735	1.624000	0.37018	-0.096000	0.12329	-0.391000	0.06502	AGG	.	.	.	none		0.622	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039484.2	NM_022367	
CNTN2	6900	hgsc.bcm.edu	37	1	205033767	205033767	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr1:205033767G>C	ENST00000331830.4	+	12	1692	c.1408G>C	c.(1408-1410)Gat>Cat	p.D470H	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	470	Ig-like C2-type 5.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TGTAACTCCAGATGGCACCTT	0.517																																					p.D470H	Melanoma(183;2548 2817 37099 41192)	Atlas-SNP	.											.	CNTN2	116	.	0			c.G1408C						PASS	.						128.0	109.0	115.0					1																	205033767		2203	4300	6503	SO:0001583	missense	6900	exon12			ACTCCAGATGGCA	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1408G>C	chr1.hg19:g.205033767G>C	ENSP00000330633:p.Asp470His	95.0	0.0	.		114.0	44.0	.	NM_005076	P78432|Q5T054	Missense_Mutation	SNP	ENST00000331830.4	hg19	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641312	0.67244	.	.	ENSG00000184144	ENST00000331830	T	0.79554	-1.28	5.47	4.56	0.56223	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.248655	0.28047	N	0.016801	D	0.89822	0.6826	M	0.90595	3.13	0.46317	D	0.998986	D;D	0.76494	0.983;0.999	D;D	0.78314	0.965;0.991	D	0.90037	0.4139	10	0.72032	D	0.01	.	8.2648	0.31808	0.239:0.0:0.761:0.0	.	470;361	Q02246;Q68DA2	CNTN2_HUMAN;.	H	470	ENSP00000330633:D470H	ENSP00000330633:D470H	D	+	1	0	CNTN2	203300390	1.000000	0.71417	0.678000	0.29963	0.959000	0.62525	5.421000	0.66447	1.316000	0.45131	0.561000	0.74099	GAT	.	.	.	none		0.517	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
CEP68	23177	hgsc.bcm.edu	37	2	65299543	65299543	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr2:65299543T>G	ENST00000377990.2	+	3	1516	c.1313T>G	c.(1312-1314)cTa>cGa	p.L438R	CEP68_ENST00000537589.1_Missense_Mutation_p.L50R|RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000546106.1_Missense_Mutation_p.L438R|CEP68_ENST00000497039.1_3'UTR|CEP68_ENST00000260569.4_Missense_Mutation_p.L438R	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	438					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						TCTCCCCAGCTAAGGACACGG	0.637																																					p.L438R		Atlas-SNP	.											.	CEP68	69	.	0			c.T1313G						PASS	.						46.0	49.0	48.0					2																	65299543		2203	4300	6503	SO:0001583	missense	23177	exon3			CCCAGCTAAGGAC	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.1313T>G	chr2.hg19:g.65299543T>G	ENSP00000367229:p.Leu438Arg	61.0	0.0	.		70.0	29.0	.	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	hg19	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	T	16.41	3.115090	0.56505	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000537589;ENST00000260569;ENST00000545501	T;T;T;T	0.26067	2.39;2.38;1.76;2.39	5.78	-1.46	0.08800	.	1.328540	0.05425	N	0.544888	T	0.38878	0.1057	M	0.62723	1.935	0.09310	N	1	B;B;D;D;B	0.76494	0.102;0.102;0.98;0.999;0.102	B;B;P;D;B	0.67548	0.051;0.051;0.804;0.952;0.051	T	0.28964	-1.0027	10	0.45353	T	0.12	0.0022	0.6239	0.00783	0.3256:0.1216:0.2231:0.3297	.	426;438;438;438;438	F5H3N9;F5H2Y2;Q76N32;Q76N32-2;Q05C09	.;.;CEP68_HUMAN;.;.	R	438;438;50;438;426	ENSP00000367229:L438R;ENSP00000438306:L438R;ENSP00000443357:L50R;ENSP00000260569:L438R	ENSP00000260569:L438R	L	+	2	0	CEP68	65153047	0.000000	0.05858	0.002000	0.10522	0.086000	0.17979	0.206000	0.17375	-0.173000	0.10761	-0.468000	0.05107	CTA	.	.	.	none		0.637	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
SPEG	10290	hgsc.bcm.edu	37	2	220342166	220342166	+	Splice_Site	SNP	A	A	G			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr2:220342166A>G	ENST00000312358.7	+	20	4860	c.4728A>G	c.(4726-4728)tcA>tcG	p.S1576S	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1576					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CTGTGCATTCAGGTAGGCAGG	0.622																																					p.S1576S		Atlas-SNP	.											.	SPEG	272	.	0			c.A4728G						PASS	.						32.0	37.0	35.0					2																	220342166		2094	4215	6309	SO:0001630	splice_region_variant	10290	exon20			GCATTCAGGTAGG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4729+1A>G	chr2.hg19:g.220342166A>G		78.0	0.0	.		65.0	24.0	.	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	hg19	CCDS42824.1																																																																																			.	.	.	none		0.622	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	Silent
TRMT44	152992	hgsc.bcm.edu	37	4	8470057	8470057	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr4:8470057G>T	ENST00000389737.4	+	9	1911	c.1911G>T	c.(1909-1911)aaG>aaT	p.K637N	TRMT44_ENST00000513449.2_Missense_Mutation_p.K396N	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	637					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										GGAGTTTGAAGACCTGGAATG	0.473																																					p.K637N		Atlas-SNP	.											.	TRMT44	7	.	0			c.G1911T						PASS	.						60.0	69.0	66.0					4																	8470057		2203	4300	6503	SO:0001583	missense	152992	exon9			TTTGAAGACCTGG	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1911G>T	chr4.hg19:g.8470057G>T	ENSP00000374387:p.Lys637Asn	79.0	0.0	.		101.0	41.0	.	NM_152544	Q8NA95	Missense_Mutation	SNP	ENST00000389737.4	hg19	CCDS3402.2	.	.	.	.	.	.	.	.	.	.	G	10.35	1.325276	0.24080	.	.	ENSG00000155275	ENST00000513449;ENST00000389737;ENST00000285635	T;T	0.18657	2.21;2.2	4.05	3.2	0.36748	.	1.211260	0.05647	N	0.584554	T	0.19604	0.0471	L	0.45137	1.4	0.09310	N	1	B;B	0.18461	0.026;0.028	B;B	0.24701	0.028;0.055	T	0.21177	-1.0253	10	0.40728	T	0.16	-4.6458	4.3664	0.11227	0.093:0.1435:0.5957:0.1679	.	637;396	Q8IYL2;Q8IYL2-2	TRM44_HUMAN;.	N	396;637;245	ENSP00000424643:K396N;ENSP00000374387:K637N	ENSP00000285635:K245N	K	+	3	2	METTL19	8520957	0.088000	0.21588	0.029000	0.17559	0.088000	0.18126	0.592000	0.23984	2.274000	0.75844	0.462000	0.41574	AAG	.	.	.	none		0.473	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544	
CC2D2A	57545	hgsc.bcm.edu	37	4	15539635	15539635	+	Silent	SNP	T	T	C			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr4:15539635T>C	ENST00000503292.1	+	17	2058	c.1878T>C	c.(1876-1878)gaT>gaC	p.D626D	CC2D2A_ENST00000424120.1_Silent_p.D626D|CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000413206.1_Silent_p.D626D|CC2D2A_ENST00000389652.5_Silent_p.D577D	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	626					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						AGCCCACTGATCGGGCAGTGA	0.607																																					p.D626D		Atlas-SNP	.											.	CC2D2A	158	.	0			c.T1878C						PASS	.						44.0	53.0	50.0					4																	15539635		2098	4229	6327	SO:0001819	synonymous_variant	57545	exon17			CACTGATCGGGCA	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.1878T>C	chr4.hg19:g.15539635T>C		165.0	0.0	.		143.0	49.0	.	NM_001080522	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Silent	SNP	ENST00000503292.1	hg19	CCDS47026.1																																																																																			.	.	.	none		0.607	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
DNAJC21	134218	hgsc.bcm.edu	37	5	34945005	34945005	+	Silent	SNP	G	G	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr5:34945005G>A	ENST00000342382.4	+	8	1244	c.1017G>A	c.(1015-1017)cgG>cgA	p.R339R	DNAJC21_ENST00000303525.7_Silent_p.R339R|DNAJC21_ENST00000382021.2_Silent_p.R339R			Q5F1R6	DJC21_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 21	339	Glu-rich.				protein folding (GO:0006457)	ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			AGAAGCATCGGGAAATGGTGG	0.418																																					p.R339R		Atlas-SNP	.											.	DNAJC21	54	.	0			c.G1017A						PASS	.						142.0	143.0	143.0					5																	34945005		2203	4300	6503	SO:0001819	synonymous_variant	134218	exon8			GCATCGGGAAATG		CCDS3907.2, CCDS34144.1	5p13-p12	2012-10-05			ENSG00000168724	ENSG00000168724		"""Heat shock proteins / DNAJ (HSP40)"""	27030	protein-coding gene	gene with protein product	"""JJJ1 DnaJ domain protein homolog (S. cerevisiae)"""					15067379	Standard	XM_005248250		Approved	GS3, DNAJA5, JJJ1	uc003jjc.3	Q5F1R6	OTTHUMG00000074103	ENST00000342382.4:c.1017G>A	chr5.hg19:g.34945005G>A		603.0	0.0	.		564.0	206.0	.	NM_001012339	Q3B7J9|Q6P086|Q6ZS43|Q86VC6	Silent	SNP	ENST00000342382.4	hg19	CCDS34144.1																																																																																			.	.	.	none		0.418	DNAJC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157337.1	NM_194283	
C6orf52	347744	hgsc.bcm.edu	37	6	10687259	10687259	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr6:10687259C>A	ENST00000426700.2	-	2	209	c.210G>T	c.(208-210)aaG>aaT	p.K70N	C6orf52_ENST00000503680.1_De_novo_Start_OutOfFrame|C6orf52_ENST00000460742.2_De_novo_Start_OutOfFrame|C6orf52_ENST00000467832.2_Intron|C6orf52_ENST00000379586.1_De_novo_Start_OutOfFrame|C6orf52_ENST00000259983.3_Missense_Mutation_p.K70N			Q5T4I8	CF052_HUMAN	chromosome 6 open reading frame 52	70										endometrium(1)|prostate(1)	2						AAAAACAGTCCTTTCCATTTC	0.507																																					p.K70N		Atlas-SNP	.											.	C6orf52	9	.	0			c.G210T						PASS	.						135.0	116.0	121.0					6																	10687259		692	1591	2283	SO:0001583	missense	347744	exon3			ACAGTCCTTTCCA	BC016820	CCDS47371.1	6p24.2	2009-09-22	2007-06-07	2007-06-07	ENSG00000137434	ENSG00000137434			20881	protein-coding gene	gene with protein product						12477932	Standard	NM_001145020		Approved		uc011dij.2	Q5T4I8	OTTHUMG00000014240	ENST00000426700.2:c.210G>T	chr6.hg19:g.10687259C>A	ENSP00000410749:p.Lys70Asn	158.0	0.0	.		107.0	8.0	.	NM_001145020	Q5T4I7|Q96AS6	Missense_Mutation	SNP	ENST00000426700.2	hg19	CCDS47371.1	.	.	.	.	.	.	.	.	.	.	C	6.881	0.531935	0.13127	.	.	ENSG00000137434	ENST00000259983;ENST00000426700	T;T	0.44482	0.92;0.92	3.13	0.274	0.15654	.	4.821730	0.01150	N	0.006390	T	0.08582	0.0213	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12630	-1.0540	10	0.35671	T	0.21	4.5491	1.6304	0.02731	0.1301:0.2445:0.4308:0.1946	.	70	Q5T4I8	CF052_HUMAN	N	70	ENSP00000259983:K70N;ENSP00000410749:K70N	ENSP00000259983:K70N	K	-	3	2	C6orf52	10795245	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.175000	0.16762	0.035000	0.15519	0.467000	0.42956	AAG	.	.	.	none		0.507	C6orf52-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039825.2	NM_001145020	
CAPN11	11131	hgsc.bcm.edu	37	6	44137019	44137019	+	Splice_Site	SNP	G	G	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr6:44137019G>A	ENST00000398776.1	+	3	128	c.90G>A	c.(88-90)gaG>gaA	p.E30E	CAPN11_ENST00000542245.1_Splice_Site_p.E30E	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	30					proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTTAAGCAGAGCCCACTTTTA	0.483																																					p.E30E		Atlas-SNP	.											.	CAPN11	66	.	0			c.G90A						PASS	.						24.0	24.0	24.0					6																	44137019		1861	4093	5954	SO:0001630	splice_region_variant	11131	exon3			AGCAGAGCCCACT	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.89-1G>A	chr6.hg19:g.44137019G>A		194.0	0.0	.		200.0	75.0	.	NM_007058	B2RA64|Q5T3G1|Q8N4R5	Silent	SNP	ENST00000398776.1	hg19	CCDS47436.1																																																																																			.	.	.	none		0.483	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		Silent
EGFR	1956	hgsc.bcm.edu	37	7	55221781	55221781	+	Silent	SNP	C	C	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr7:55221781C>T	ENST00000275493.2	+	7	1002	c.825C>T	c.(823-825)taC>taT	p.Y275Y	EGFR_ENST00000454757.2_Silent_p.Y222Y|EGFR_ENST00000344576.2_Silent_p.Y275Y|EGFR_ENST00000420316.2_Silent_p.Y275Y|EGFR_ENST00000455089.1_Silent_p.Y230Y|EGFR_ENST00000342916.3_Silent_p.Y275Y|EGFR_ENST00000442591.1_Silent_p.Y275Y	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	275			Missing (variant EGFR vIII; found in a lung cancer sample; somatic mutation; induces lung cancer when exogenously expressed). {ECO:0000269|PubMed:16672372}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CCACCACGTACCAGATGGATG	0.587		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.Y275Y		Atlas-SNP	.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	EGFR	20426	.	0			c.C825T						PASS	.						198.0	156.0	170.0					7																	55221781		2203	4300	6503	SO:0001819	synonymous_variant	1956	exon7	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	CACGTACCAGATG		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.825C>T	chr7.hg19:g.55221781C>T		118.0	0.0	.		327.0	94.0	.	NM_201283	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	ENST00000275493.2	hg19	CCDS5514.1																																																																																			.	.	.	none		0.587	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
DLX6	1750	hgsc.bcm.edu	37	7	96635450	96635450	+	Missense_Mutation	SNP	A	A	C	rs563784519	byFrequency	TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr7:96635450A>C	ENST00000518156.2	+	1	591	c.161A>C	c.(160-162)cAg>cCg	p.Q54P	DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS1_ENST00000431497.2_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6_ENST00000007660.5_Intron|DLX6_ENST00000555308.1_5'Flank|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000430404.2_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	0					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					ccgccgccgcagccgcACTCG	0.736													A|||	29	0.00579073	0.0015	0.0058	5008	,	,		5002	0.001		0.006	False		,,,				2504	0.0164				p.Q54P		Atlas-SNP	.											.	DLX6	37	.	0			c.A161C						PASS	.						2.0	2.0	2.0					7																	96635450		849	2293	3142	SO:0001583	missense	1750	exon1			CGCCGCAGCCGCA		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.161A>C	chr7.hg19:g.96635450A>C	ENSP00000428480:p.Gln54Pro	45.0	0.0	.		89.0	5.0	.	NM_005222	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Missense_Mutation	SNP	ENST00000518156.2	hg19	CCDS47647.2	.	.	.	.	.	.	.	.	.	.	a	0.105	-1.146361	0.01714	.	.	ENSG00000006377	ENST00000518156	T	0.20200	2.09	3.38	0.713	0.18173	.	.	.	.	.	T	0.24586	0.0596	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.03673	-1.1014	6	0.34782	T	0.22	.	8.4116	0.32646	0.3776:0.6224:0.0:0.0	.	.	.	.	P	54	ENSP00000428480:Q54P	ENSP00000428480:Q54P	Q	+	2	0	DLX6	96473386	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	1.464000	0.35288	0.377000	0.24735	0.414000	0.27820	CAG	.	.	.	none		0.736	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334373.4	NM_005222	
CDHR3	222256	hgsc.bcm.edu	37	7	105624700	105624700	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr7:105624700G>A	ENST00000317716.9	+	4	558	c.478G>A	c.(478-480)Gat>Aat	p.D160N	CDHR3_ENST00000542731.1_Missense_Mutation_p.D160N|CDHR3_ENST00000541203.1_Intron|CDHR3_ENST00000478080.1_Missense_Mutation_p.D72N|CDHR3_ENST00000470188.1_3'UTR|CDHR3_ENST00000343407.5_5'UTR	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	160	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						TGAGGCCTTCGATCCAGAAGA	0.458																																					p.D160N		Atlas-SNP	.											.	CDHR3	153	.	0			c.G478A						PASS	.						63.0	64.0	64.0					7																	105624700		1907	4124	6031	SO:0001583	missense	222256	exon4			GCCTTCGATCCAG	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.478G>A	chr7.hg19:g.105624700G>A	ENSP00000325954:p.Asp160Asn	118.0	0.0	.		293.0	40.0	.	NM_152750	Q8TCI7	Missense_Mutation	SNP	ENST00000317716.9	hg19	CCDS47684.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.417404	0.62622	.	.	ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080	T;T;T	0.78003	-1.14;-1.14;-1.14	4.56	4.56	0.56223	Cadherin (4);Cadherin-like (1);	0.137563	0.47455	D	0.000228	D	0.89150	0.6633	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88819	0.3297	10	0.33940	T	0.23	-25.4541	12.9987	0.58662	0.0:0.0:1.0:0.0	.	147;160	B3KYA0;Q6ZTQ4	.;CDHR3_HUMAN	N	160;160;72	ENSP00000439766:D160N;ENSP00000325954:D160N;ENSP00000417771:D72N	ENSP00000325954:D160N	D	+	1	0	CDHR3	105411936	1.000000	0.71417	0.963000	0.40424	0.334000	0.28698	4.753000	0.62183	2.522000	0.85027	0.655000	0.94253	GAT	.	.	.	none		0.458	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750	
C7orf33	202865	hgsc.bcm.edu	37	7	148311173	148311173	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr7:148311173T>C	ENST00000307003.2	+	2	605	c.244T>C	c.(244-246)Ttt>Ctt	p.F82L		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	82										central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GGGGATGGAATTTATTGCTCC	0.478																																					p.F82L		Atlas-SNP	.											.	C7orf33	28	.	0			c.T244C						PASS	.						90.0	88.0	88.0					7																	148311173		2203	4300	6503	SO:0001583	missense	202865	exon2			ATGGAATTTATTG	BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.244T>C	chr7.hg19:g.148311173T>C	ENSP00000304071:p.Phe82Leu	42.0	0.0	.		113.0	74.0	.	NM_145304		Missense_Mutation	SNP	ENST00000307003.2	hg19	CCDS5890.1	.	.	.	.	.	.	.	.	.	.	T	3.680	-0.065801	0.07273	.	.	ENSG00000170279	ENST00000307003	.	.	.	1.06	1.06	0.20224	.	.	.	.	.	T	0.20577	0.0495	N	0.19112	0.55	0.09310	N	1	B	0.23185	0.081	B	0.17433	0.018	T	0.21827	-1.0234	8	0.87932	D	0	.	4.3208	0.11016	0.0:0.0:0.0:1.0	.	82	Q8WU49	CG033_HUMAN	L	82	.	ENSP00000304071:F82L	F	+	1	0	C7orf33	147942106	0.002000	0.14202	0.002000	0.10522	0.003000	0.03518	0.586000	0.23894	0.718000	0.32166	0.368000	0.22195	TTT	.	.	.	none		0.478	C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327684.1	NM_145304	
DNAJB6	10049	hgsc.bcm.edu	37	7	157160104	157160104	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr7:157160104C>A	ENST00000262177.4	+	5	478	c.273C>A	c.(271-273)ttC>ttA	p.F91L	DNAJB6_ENST00000429029.2_Missense_Mutation_p.F91L|DNAJB6_ENST00000452797.2_Missense_Mutation_p.F42L|DNAJB6_ENST00000443280.1_Missense_Mutation_p.F91L	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	91	Gly/Phe-rich.|Interaction with HSP70.				intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AATTTGGCTTCACATTCCGTA	0.388																																					p.F91L	Esophageal Squamous(46;195 967 1350 20350 43814)	Atlas-SNP	.											.	DNAJB6	39	.	0			c.C273A						PASS	.						160.0	149.0	153.0					7																	157160104		2203	4299	6502	SO:0001583	missense	10049	exon5			TGGCTTCACATTC	AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.273C>A	chr7.hg19:g.157160104C>A	ENSP00000262177:p.Phe91Leu	91.0	0.0	.		101.0	6.0	.	NM_058246	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Missense_Mutation	SNP	ENST00000262177.4	hg19	CCDS5946.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.046573	0.55110	.	.	ENSG00000105993	ENST00000441561;ENST00000429029;ENST00000262177;ENST00000417758;ENST00000452797;ENST00000443280;ENST00000421417;ENST00000412557;ENST00000453383	T;T;T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27	4.58	0.533	0.17121	Heat shock protein DnaJ, N-terminal (1);	0.131004	0.32190	U	0.006450	D	0.83959	0.5367	M	0.71296	2.17	0.51767	D	0.999933	B;D;P;P;D	0.71674	0.427;0.998;0.589;0.942;0.996	B;D;B;P;D	0.80764	0.235;0.994;0.347;0.816;0.98	T	0.81400	-0.0950	10	0.66056	D	0.02	.	9.0446	0.36338	0.0:0.3955:0.0:0.6045	.	91;42;91;91;91	E9PH18;B4DN73;A8KAG0;O75190;O75190-2	.;.;.;DNJB6_HUMAN;.	L	91;91;91;91;42;91;91;91;91	ENSP00000410643:F91L;ENSP00000397556:F91L;ENSP00000262177:F91L;ENSP00000400665:F91L;ENSP00000402270:F42L;ENSP00000396267:F91L;ENSP00000403407:F91L;ENSP00000396240:F91L	ENSP00000262177:F91L	F	+	3	2	DNAJB6	156852865	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	1.038000	0.30254	-0.130000	0.11599	-0.137000	0.14449	TTC	.	.	.	none		0.388	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2		
MTSS1	9788	hgsc.bcm.edu	37	8	125580765	125580765	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr8:125580765A>G	ENST00000518547.1	-	7	946	c.473T>C	c.(472-474)aTc>aCc	p.I158T	MTSS1_ENST00000378017.3_Missense_Mutation_p.I158T|MTSS1_ENST00000325064.5_Missense_Mutation_p.I162T|MTSS1_ENST00000395508.2_5'Flank|MTSS1_ENST00000431961.2_5'UTR|MTSS1_ENST00000354184.4_5'UTR|MTSS1_ENST00000524090.1_Missense_Mutation_p.I48T	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	158	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CTGAGGCTGGATATCACCTCT	0.493																																					p.I158T	Esophageal Squamous(160;622 1893 3862 8546 12509)	Atlas-SNP	.											.	MTSS1	79	.	0			c.T473C						PASS	.						69.0	65.0	67.0					8																	125580765		2203	4300	6503	SO:0001583	missense	9788	exon7			GGCTGGATATCAC	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.473T>C	chr8.hg19:g.125580765A>G	ENSP00000429064:p.Ile158Thr	75.0	0.0	.		88.0	7.0	.	NM_014751	J3KNK6|Q8TCA2|Q96RX2	Missense_Mutation	SNP	ENST00000518547.1	hg19	CCDS6353.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.12|17.12	3.306988|3.306988	0.60305|0.60305	.|.	.|.	ENSG00000170873|ENSG00000170873	ENST00000378017;ENST00000518547;ENST00000325064;ENST00000524090|ENST00000522162	T;T;T;T|.	0.33216|.	1.51;1.5;1.51;1.42|.	5.45|5.45	5.45|5.45	0.79879|0.79879	IRSp53/MIM homology domain (IMD) (3);|.	0.055995|.	0.64402|.	D|.	0.000001|.	T|T	0.60130|0.60130	0.2245|0.2245	L|L	0.39898|0.39898	1.24|1.24	0.80722|0.80722	D|D	1|1	D;P;B;P|.	0.61697|.	0.99;0.523;0.021;0.731|.	P;B;B;P|.	0.60236|.	0.871;0.391;0.248;0.486|.	T|T	0.56691|0.56691	-0.7937|-0.7937	10|5	0.14252|.	T|.	0.57|.	-27.9499|-27.9499	15.806|15.806	0.78513|0.78513	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	48;158;158;158|.	E7EWW5;A5YM41;O43312;O43312-4|.	.;.;MTSS1_HUMAN;.|.	T|P	158;158;162;48|153	ENSP00000367256:I158T;ENSP00000429064:I158T;ENSP00000322804:I162T;ENSP00000428319:I48T|.	ENSP00000322804:I162T|.	I|S	-|-	2|1	0|0	MTSS1|MTSS1	125649946|125649946	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	9.181000|9.181000	0.94874|0.94874	2.196000|2.196000	0.70406|0.70406	0.533000|0.533000	0.62120|0.62120	ATC|TCC	.	.	.	none		0.493	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
MFSD3	113655	hgsc.bcm.edu	37	8	145736222	145736222	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr8:145736222T>A	ENST00000301327.4	+	4	1261	c.1001T>A	c.(1000-1002)cTg>cAg	p.L334Q	RECQL4_ENST00000532237.1_5'Flank|CTD-2517M22.17_ENST00000580385.1_RNA	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3	334	Leu-rich.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TTGGGAGGCCTGGTCACCACA	0.627																																					p.L334Q		Atlas-SNP	.											.	MFSD3	17	.	0			c.T1001A						PASS	.						53.0	52.0	52.0					8																	145736222		2202	4297	6499	SO:0001583	missense	113655	exon4			GAGGCCTGGTCAC		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177	ENST00000301327.4:c.1001T>A	chr8.hg19:g.145736222T>A	ENSP00000301327:p.Leu334Gln	35.0	0.0	.		22.0	9.0	.	NM_138431		Missense_Mutation	SNP	ENST00000301327.4	hg19	CCDS6431.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.987542	0.74589	.	.	ENSG00000167700	ENST00000301327	T	0.59083	0.29	5.25	3.88	0.44766	Major facilitator superfamily domain, general substrate transporter (1);	0.328159	0.28549	N	0.014948	T	0.69142	0.3078	M	0.72894	2.215	0.32062	N	0.595635	D	0.56746	0.977	D	0.64321	0.924	T	0.73742	-0.3887	10	0.48119	T	0.1	.	9.3368	0.38056	0.0:0.1009:0.0:0.8991	.	334	Q96ES6	MFSD3_HUMAN	Q	334	ENSP00000301327:L334Q	ENSP00000301327:L334Q	L	+	2	0	MFSD3	145707030	0.856000	0.29760	1.000000	0.80357	0.936000	0.57629	1.128000	0.31369	1.986000	0.57962	0.379000	0.24179	CTG	.	.	.	none		0.627	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
DPP7	29952	hgsc.bcm.edu	37	9	140006480	140006481	+	Splice_Site	DNP	GC	GC	TA			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr9:140006480_140006481GC>TA	ENST00000371579.2	-	10	1055_1056	c.1051_1052GC>TA	c.(1051-1053)GCc>TAc	p.A351Y		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	351						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		CTCGGTGCAGGCCTGCAGGTGC	0.658																																					p.A351D|p.A351S		Atlas-SNP	.											.	DPP7	22	.	0			c.C1052A|c.G1051T						PASS	.																																			SO:0001630	splice_region_variant	29952	exon10			GTGCAGGCCTGCA|TGCAGGCCTGCAG	AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.1051_1052delinsTA	chr9.hg19:g.140006480_140006481delinsTA		118.0|119.0	0.0	.		96.0|97.0	38.0	.	NM_013379	A8K7U7|Q5VSF1|Q969X4	Missense_Mutation	SNP	ENST00000371579.2	hg19	CCDS7030.1																																																																																			.	.	.	none		0.658	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055279.1	NM_013379	Missense_Mutation
ITGB1	3688	hgsc.bcm.edu	37	10	33199326	33199326	+	Silent	SNP	C	C	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr10:33199326C>T	ENST00000396033.2	-	14	2124	c.1989G>A	c.(1987-1989)caG>caA	p.Q663Q	ITGB1_ENST00000374956.4_Silent_p.Q663Q|ITGB1_ENST00000423113.1_Silent_p.Q663Q|ITGB1_ENST00000302278.3_Silent_p.Q663Q	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	663					axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	AGGAACATTCCTGTGTGCATG	0.378																																					p.Q663Q		Atlas-SNP	.											.	ITGB1	156	.	0			c.G1989A						PASS	.						49.0	50.0	49.0					10																	33199326		2203	4297	6500	SO:0001819	synonymous_variant	3688	exon14			ACATTCCTGTGTG	BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.1989G>A	chr10.hg19:g.33199326C>T		497.0	0.0	.		549.0	211.0	.	NM_002211	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Silent	SNP	ENST00000396033.2	hg19	CCDS7174.1																																																																																			.	.	.	none		0.378	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211	
FAM175B	23172	hgsc.bcm.edu	37	10	126515171	126515171	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr10:126515171T>G	ENST00000298492.5	+	5	320	c.275T>G	c.(274-276)aTt>aGt	p.I92S		NM_032182.3	NP_115558.3	Q15018	F175B_HUMAN	family with sequence similarity 175, member B	92	MPN-like.				cellular response to freezing (GO:0071497)	BRISC complex (GO:0070552)|cytoplasm (GO:0005737)	polyubiquitin binding (GO:0031593)			NS(1)	1						CAGAAAGTCATTGGGTGGTAC	0.453																																					p.I92S		Atlas-SNP	.											.	FAM175B	39	.	0			c.T275G						PASS	.						108.0	103.0	105.0					10																	126515171		2203	4300	6503	SO:0001583	missense	23172	exon5			AAGTCATTGGGTG	D63877	CCDS31308.2	10q26.2	2013-01-24	2008-07-02	2008-07-02	ENSG00000165660	ENSG00000165660			28975	protein-coding gene	gene with protein product	"""Abraxas brother"""	611144	"""KIAA0157"""	KIAA0157		8590280	Standard	NM_032182		Approved	Em:AC068896.4, ABRO1	uc001lib.4	Q15018	OTTHUMG00000019218	ENST00000298492.5:c.275T>G	chr10.hg19:g.126515171T>G	ENSP00000298492:p.Ile92Ser	98.0	0.0	.		80.0	20.0	.	NM_032182	B4DKR2|Q96H11	Missense_Mutation	SNP	ENST00000298492.5	hg19	CCDS31308.2	.	.	.	.	.	.	.	.	.	.	T	25.4	4.630040	0.87660	.	.	ENSG00000165660	ENST00000298492	T	0.44881	0.91	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69731	-0.5066	10	0.87932	D	0	-36.1308	16.1986	0.82053	0.0:0.0:0.0:1.0	.	92	Q15018	F175B_HUMAN	S	92	ENSP00000298492:I92S	ENSP00000298492:I92S	I	+	2	0	FAM175B	126505161	1.000000	0.71417	0.373000	0.26003	0.829000	0.46940	8.027000	0.88791	2.227000	0.72691	0.455000	0.32223	ATT	.	.	.	none		0.453	FAM175B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050891.2	NM_032182	
PCF11	51585	hgsc.bcm.edu	37	11	82877690	82877690	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr11:82877690A>G	ENST00000298281.4	+	5	2203	c.1751A>G	c.(1750-1752)aAt>aGt	p.N584S		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	584					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						CCAAAGGAGAATGTAGAAAAC	0.393																																					p.N584S		Atlas-SNP	.											PCF11_ENST00000298281,NS,carcinoma,0,4	PCF11	220	.	0			c.A1751G						PASS	.						66.0	66.0	66.0					11																	82877690		1824	4044	5868	SO:0001583	missense	51585	exon5			AGGAGAATGTAGA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1751A>G	chr11.hg19:g.82877690A>G	ENSP00000298281:p.Asn584Ser	339.0	1.0	.		312.0	126.0	.	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	hg19	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.172383	0.38315	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.50813	1.68;0.74;0.73	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000005	T	0.34483	0.0899	N	0.19112	0.55	0.29519	N	0.853609	P;P	0.43788	0.473;0.817	B;B	0.38500	0.091;0.275	T	0.25433	-1.0132	9	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	584;584	E9PQ01;O94913	.;PCF11_HUMAN	S	584	ENSP00000298281:N584S;ENSP00000434540:N584S;ENSP00000431567:N584S	.	N	+	2	0	PCF11	82555338	1.000000	0.71417	0.991000	0.47740	0.967000	0.64934	3.827000	0.55745	2.326000	0.78906	0.533000	0.62120	AAT	.	.	.	none		0.393	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
SORL1	6653	hgsc.bcm.edu	37	11	121498410	121498410	+	Missense_Mutation	SNP	G	G	A	rs146742626		TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr11:121498410G>A	ENST00000260197.7	+	47	6640	c.6511G>A	c.(6511-6513)Gcc>Acc	p.A2171T	SORL1_ENST00000534286.1_Missense_Mutation_p.A1081T|SORL1_ENST00000525532.1_Missense_Mutation_p.A1115T|SORL1_ENST00000532694.1_Missense_Mutation_p.A1017T|SORL1_ENST00000527934.1_Missense_Mutation_p.A786T	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	2171					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CAGCTTCACCGCCTTCGCCAA	0.607																																					p.A2171T		Atlas-SNP	.											.	SORL1	218	.	0			c.G6511A						PASS	.	G	THR/ALA	0,4404		0,0,2202	59.0	52.0	54.0		6511	6.0	0.2	11	dbSNP_134	54	1,8597	1.2+/-3.3	0,1,4298	no	missense	SORL1	NM_003105.5	58	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	2171/2215	121498410	1,13001	2202	4299	6501	SO:0001583	missense	6653	exon47			TTCACCGCCTTCG	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.6511G>A	chr11.hg19:g.121498410G>A	ENSP00000260197:p.Ala2171Thr	63.0	0.0	.		80.0	34.0	.	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	hg19	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610245	0.87258	0.0	1.16E-4	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	D;D;D;D;D	0.91464	-2.85;-2.59;-2.23;-2.26;-2.13	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.93058	0.7790	L	0.59436	1.845	0.58432	D	0.99999	D;D	0.62365	0.983;0.991	B;P	0.54629	0.397;0.757	D	0.91897	0.5528	10	0.44086	T	0.13	.	20.4008	0.98991	0.0:0.0:1.0:0.0	.	786;2171	E9PKB0;Q92673	.;SORL_HUMAN	T	2171;1115;1017;1081;786	ENSP00000260197:A2171T;ENSP00000434634:A1115T;ENSP00000432131:A1017T;ENSP00000436447:A1081T;ENSP00000435405:A786T	ENSP00000260197:A2171T	A	+	1	0	SORL1	121003620	1.000000	0.71417	0.204000	0.23530	0.947000	0.59692	5.412000	0.66392	2.826000	0.97356	0.655000	0.94253	GCC	.	G|1.000;A|0.000	0.000	weak		0.607	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
OR10G7	390265	hgsc.bcm.edu	37	11	123909026	123909026	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr11:123909026C>T	ENST00000330487.5	-	1	691	c.683G>A	c.(682-684)cGc>cAc	p.R228H		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CTCTGAGGTGCGGATCCGCAG	0.537																																					p.R228H		Atlas-SNP	.											.	OR10G7	103	.	0			c.G683A						PASS	.						138.0	119.0	126.0					11																	123909026		2201	4299	6500	SO:0001583	missense	390265	exon1			GAGGTGCGGATCC	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.683G>A	chr11.hg19:g.123909026C>T	ENSP00000329689:p.Arg228His	173.0	0.0	.		192.0	15.0	.	NM_001004463	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	hg19	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	C	3.124	-0.179813	0.06380	.	.	ENSG00000182634	ENST00000330487	T	0.39229	1.09	3.38	1.49	0.22878	GPCR, rhodopsin-like superfamily (1);	0.566427	0.16064	N	0.231343	T	0.25568	0.0622	L	0.28556	0.865	0.20074	N	0.999935	B	0.09022	0.002	B	0.17979	0.02	T	0.20042	-1.0287	10	0.20046	T	0.44	.	5.6004	0.17351	0.0:0.5333:0.2729:0.1938	.	228	Q8NGN6	O10G7_HUMAN	H	228	ENSP00000329689:R228H	ENSP00000329689:R228H	R	-	2	0	OR10G7	123414236	0.000000	0.05858	0.974000	0.42286	0.400000	0.30750	-1.370000	0.02575	0.271000	0.22005	-0.232000	0.12228	CGC	.	.	.	weak		0.537	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
KRT1	3848	hgsc.bcm.edu	37	12	53069229	53069229	+	Silent	SNP	G	G	A	rs540699806|rs267607656	byFrequency	TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr12:53069229G>A	ENST00000252244.3	-	9	1741	c.1683C>T	c.(1681-1683)tcC>tcT	p.S561S		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	561	Gly/Ser-rich.|Tail.		Missing (in allele 1B). {ECO:0000269|PubMed:1281859}.		complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						tgccacctccggagccgtagc	0.692																																					p.S561S		Atlas-SNP	.											.	KRT1	110	.	0			c.C1683T						PASS	.						4.0	4.0	4.0					12																	53069229		1797	3656	5453	SO:0001819	synonymous_variant	3848	exon9			ACCTCCGGAGCCG	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1683C>T	chr12.hg19:g.53069229G>A		21.0	0.0	.		41.0	6.0	.	NM_006121	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	ENST00000252244.3	hg19	CCDS8836.1																																																																																			.	.	.	none		0.692	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
KRT3	3850	hgsc.bcm.edu	37	12	53183951	53183951	+	Missense_Mutation	SNP	C	C	T	rs570613061|rs60125653	byFrequency	TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr12:53183951C>T	ENST00000417996.2	-	9	1836	c.1762G>A	c.(1762-1764)Ggc>Agc	p.G588S	KRT3_ENST00000309505.3_Missense_Mutation_p.G589S	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	588	Gly-rich.|Tail.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GAGCCAAAgccgctgccaccg	0.697																																					p.G588S		Atlas-SNP	.											KRT3,rectum,carcinoma,0,2	KRT3	65	.	0			c.G1762A						PASS	.						14.0	31.0	25.0					12																	53183951		1574	3123	4697	SO:0001583	missense	3850	exon9			CAAAGCCGCTGCC		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1762G>A	chr12.hg19:g.53183951C>T	ENSP00000413479:p.Gly588Ser	86.0	1.0	.		105.0	19.0	.	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	hg19	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307617	0.40795	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	D;D	0.91351	-2.83;-2.83	3.4	-1.34	0.09143	.	0.507655	0.14827	N	0.296110	T	0.80149	0.4570	N	0.22421	0.69	0.09310	N	1	B	0.18166	0.026	B	0.08055	0.003	T	0.65302	-0.6201	10	0.34782	T	0.22	.	7.4497	0.27231	0.0:0.4872:0.0:0.5128	.	588	P12035	K2C3_HUMAN	S	588;589	ENSP00000413479:G588S;ENSP00000312206:G589S	ENSP00000312206:G589S	G	-	1	0	KRT3	51470218	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-1.682000	0.01935	-0.284000	0.09102	-0.258000	0.10820	GGC	.	.	.	none		0.697	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
KRT3	3850	hgsc.bcm.edu	37	12	53183979	53183979	+	Silent	SNP	G	G	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr12:53183979G>A	ENST00000417996.2	-	9	1808	c.1734C>T	c.(1732-1734)ggC>ggT	p.G578G	KRT3_ENST00000309505.3_Silent_p.G579G	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	578	Gly-rich.|Tail.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						cgctgctgccgccgccaaatc	0.701																																					p.G578G		Atlas-SNP	.											.	KRT3	65	.	0			c.C1734T						PASS	.						12.0	28.0	22.0					12																	53183979		1691	3337	5028	SO:0001819	synonymous_variant	3850	exon9			GCTGCCGCCGCCA		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1734C>T	chr12.hg19:g.53183979G>A		98.0	0.0	.		124.0	9.0	.	NM_057088	A6NIS2|Q701L8	Silent	SNP	ENST00000417996.2	hg19	CCDS44895.1																																																																																			.	.	.	none		0.701	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
UHRF1BP1L	23074	hgsc.bcm.edu	37	12	100453755	100453755	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr12:100453755A>G	ENST00000279907.7	-	13	1828	c.1616T>C	c.(1615-1617)cTa>cCa	p.L539P	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.L189P	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	539										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						ATTTAACCATAGAATGCTTCT	0.348																																					p.L539P		Atlas-SNP	.											.	UHRF1BP1L	144	.	0			c.T1616C						PASS	.						89.0	85.0	87.0					12																	100453755		2203	4300	6503	SO:0001583	missense	23074	exon13			AACCATAGAATGC		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1616T>C	chr12.hg19:g.100453755A>G	ENSP00000279907:p.Leu539Pro	146.0	0.0	.		150.0	53.0	.	NM_015054	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	hg19	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	A	17.24	3.339180	0.60963	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.22743	2.13;1.94	5.49	5.49	0.81192	.	0.071978	0.56097	D	0.000025	T	0.47021	0.1423	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.48937	-0.8990	10	0.87932	D	0	-5.8001	15.5763	0.76392	1.0:0.0:0.0:0.0	.	539	A0JNW5	UH1BL_HUMAN	P	539;189	ENSP00000279907:L539P;ENSP00000444824:L189P	ENSP00000279907:L539P	L	-	2	0	UHRF1BP1L	98977886	1.000000	0.71417	0.988000	0.46212	0.913000	0.54294	9.339000	0.96797	2.091000	0.63221	0.477000	0.44152	CTA	.	.	.	none		0.348	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	
MTUS2	23281	hgsc.bcm.edu	37	13	29674966	29674967	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr13:29674966_29674967GG>TT	ENST00000431530.3	+	3	2591_2592	c.2533_2534GG>TT	c.(2533-2535)GGt>TTt	p.G845F		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	835	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.|Sufficient for interaction with KIF2C.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CCCGAAATCTGGTCTCCGTCCT	0.475																																					p.G845C|p.G845V		Atlas-SNP	.											.	MTUS2	279	.	0			c.G2533T|c.G2534T						PASS	.																																			SO:0001583	missense	23281	exon3			AAATCTGGTCTCC|AATCTGGTCTCCG	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	Exception_encountered	chr13.hg19:g.29674966_29674967delinsTT	ENSP00000392057:p.Gly845Phe	219.0|221.0	0.0	.		232.0|233.0	71.0|72.0	.	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	hg19	CCDS45022.1																																																																																			.	.	.	none		0.475	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
MYH7	4625	hgsc.bcm.edu	37	14	23886164	23886164	+	Missense_Mutation	SNP	G	G	T	rs150552664		TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr14:23886164G>T	ENST00000355349.3	-	33	4719	c.4557C>A	c.(4555-4557)agC>agA	p.S1519R	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1519			S -> C. {ECO:0000269|PubMed:15858117}.		adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.S1519S(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TAGTCTTTCCGCTGGAACCCA	0.587																																					p.S1519R		Atlas-SNP	.											MYH7,NS,carcinoma,0,1	MYH7	349	.	1	Substitution - coding silent(1)	endometrium(1)	c.C4557A						PASS	.						118.0	106.0	110.0					14																	23886164		2203	4300	6503	SO:0001583	missense	4625	exon33			CTTTCCGCTGGAA	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4557C>A	chr14.hg19:g.23886164G>T	ENSP00000347507:p.Ser1519Arg	63.0	0.0	.		60.0	3.0	.	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	G	10.59	1.391880	0.25118	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.82619	-1.63	5.01	-6.56	0.01848	Myosin tail (1);	.	.	.	.	D	0.87083	0.6089	M	0.86573	2.825	0.23893	N	0.996541	B	0.24882	0.113	P	0.47864	0.559	D	0.84711	0.0734	9	0.72032	D	0.01	.	3.7721	0.08646	0.3606:0.1824:0.3674:0.0896	.	1519	P12883	MYH7_HUMAN	R	1519;1524	ENSP00000347507:S1519R	ENSP00000347507:S1519R	S	-	3	2	MYH7	22956004	0.000000	0.05858	0.023000	0.16930	0.057000	0.15508	-4.112000	0.00292	-0.848000	0.04163	-1.405000	0.01134	AGC	.	G|1.000;A|0.000	.	alt		0.587	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
PPP1R13B	23368	hgsc.bcm.edu	37	14	104219447	104219447	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr14:104219447G>T	ENST00000202556.9	-	7	1000	c.718C>A	c.(718-720)Cag>Aag	p.Q240K		NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	240	Gln-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				TCCAATTGCTGACTAAGCTGA	0.423																																					p.Q240K		Atlas-SNP	.											.	PPP1R13B	72	.	0			c.C718A						PASS	.						156.0	141.0	145.0					14																	104219447		1859	4097	5956	SO:0001583	missense	23368	exon7			ATTGCTGACTAAG	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.718C>A	chr14.hg19:g.104219447G>T	ENSP00000202556:p.Gln240Lys	119.0	0.0	.		93.0	30.0	.	NM_015316	B2RMX5|O94870	Missense_Mutation	SNP	ENST00000202556.9	hg19	CCDS41997.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250172	0.59212	.	.	ENSG00000088808	ENST00000202556;ENST00000380023	T	0.28454	1.61	5.74	5.74	0.90152	.	0.168163	0.52532	D	0.000063	T	0.29817	0.0745	L	0.32530	0.975	0.80722	D	1	B	0.24618	0.107	B	0.27076	0.076	T	0.02975	-1.1087	10	0.38643	T	0.18	.	19.9238	0.97097	0.0:0.0:1.0:0.0	.	240	Q96KQ4	ASPP1_HUMAN	K	240;107	ENSP00000202556:Q240K	ENSP00000202556:Q240K	Q	-	1	0	PPP1R13B	103289200	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	5.915000	0.69973	2.712000	0.92718	0.650000	0.86243	CAG	.	.	.	none		0.423	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316	
HERC2	8924	hgsc.bcm.edu	37	15	28377879	28377879	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr15:28377879C>T	ENST00000261609.7	-	80	12436	c.12328G>A	c.(12328-12330)Ggg>Agg	p.G4110R		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TAGAGGTCCCCGGCTGCTGTG	0.642																																					p.G4110R		Atlas-SNP	.											.	HERC2	501	.	0			c.G12328A						PASS	.						66.0	72.0	70.0					15																	28377879		2203	4300	6503	SO:0001583	missense	8924	exon80			GGTCCCCGGCTGC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12328G>A	chr15.hg19:g.28377879C>T	ENSP00000261609:p.Gly4110Arg	181.0	0.0	.		215.0	77.0	.	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	34	5.370568	0.95900	.	.	ENSG00000128731	ENST00000261609	D	0.98060	-4.69	4.86	4.86	0.63082	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.99281	0.9749	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.98643	1.0676	10	0.87932	D	0	.	18.3848	0.90463	0.0:1.0:0.0:0.0	.	4110	O95714	HERC2_HUMAN	R	4110	ENSP00000261609:G4110R	ENSP00000261609:G4110R	G	-	1	0	HERC2	26051474	1.000000	0.71417	0.978000	0.43139	0.966000	0.64601	7.765000	0.85310	2.418000	0.82041	0.555000	0.69702	GGG	.	.	.	none		0.642	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
CAPN3	825	hgsc.bcm.edu	37	15	42678446	42678446	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr15:42678446G>C	ENST00000397163.3	+	3	680	c.461G>C	c.(460-462)aGt>aCt	p.S154T	CAPN3_ENST00000357568.3_Missense_Mutation_p.S154T|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000349748.3_Missense_Mutation_p.S154T|CAPN3_ENST00000356316.3_Missense_Mutation_p.S67T|CAPN3_ENST00000318023.7_Missense_Mutation_p.S154T	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	154	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		CATGATCAAAGTTTCATCGAA	0.567											OREG0023085	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S154T		Atlas-SNP	.											.	CAPN3	172	.	0			c.G461C						PASS	.						127.0	106.0	113.0					15																	42678446		2203	4299	6502	SO:0001583	missense	825	exon3			ATCAAAGTTTCAT	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.461G>C	chr15.hg19:g.42678446G>C	ENSP00000380349:p.Ser154Thr	110.0	0.0	.	910	95.0	43.0	.	NM_000070	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	hg19	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.976764	0.53720	.	.	ENSG00000092529	ENST00000356316;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023	D;D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47;-2.47	6.07	5.14	0.70334	Peptidase C2, calpain, catalytic domain (3);	0.233701	0.41396	U	0.000881	D	0.87962	0.6310	M	0.81112	2.525	0.53005	D	0.999969	B;B;B;B;B;B	0.12013	0.001;0.005;0.001;0.003;0.004;0.001	B;B;B;B;B;B	0.17722	0.01;0.01;0.006;0.011;0.019;0.005	D	0.84491	0.0611	10	0.59425	D	0.04	.	8.4683	0.32969	0.0892:0.2647:0.6461:0.0	.	67;67;154;154;154;67	C6EVS4;C6EVS3;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;CAN3_HUMAN;.	T	67;154;154;154;154	ENSP00000348667:S67T;ENSP00000380349:S154T;ENSP00000350181:S154T;ENSP00000183936:S154T;ENSP00000326281:S154T	ENSP00000326281:S154T	S	+	2	0	CAPN3	40465738	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.094000	0.64523	2.890000	0.99128	0.650000	0.86243	AGT	.	.	.	none		0.567	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1		
MAP1A	4130	hgsc.bcm.edu	37	15	43816966	43816966	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr15:43816966G>C	ENST00000300231.5	+	4	3745	c.3295G>C	c.(3295-3297)Gtc>Ctc	p.V1099L	MAP1A_ENST00000399453.1_Missense_Mutation_p.V1099L|MAP1A_ENST00000382031.1_Missense_Mutation_p.V1337L			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1099					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TAAAGCAATAGTCTTTGAGAT	0.547																																					p.V1099L		Atlas-SNP	.											MAP1A,caecum,carcinoma,0,1	MAP1A	189	.	0			c.G3295C						PASS	.						84.0	87.0	86.0					15																	43816966		1940	4122	6062	SO:0001583	missense	4130	exon4			GCAATAGTCTTTG	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.3295G>C	chr15.hg19:g.43816966G>C	ENSP00000300231:p.Val1099Leu	99.0	0.0	.		113.0	38.0	.	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	hg19	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.551496	0.27739	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01685	4.69;4.7;4.7	5.22	4.31	0.51392	.	0.000000	0.31145	N	0.008170	T	0.02767	0.0083	M	0.75447	2.3	0.28523	N	0.912969	B	0.32101	0.356	B	0.31290	0.127	T	0.16958	-1.0385	10	0.32370	T	0.25	-17.6786	6.9319	0.24445	0.1487:0.0:0.8513:0.0	.	1099	P78559	MAP1A_HUMAN	L	1337;1099;1099	ENSP00000371462:V1337L;ENSP00000382380:V1099L;ENSP00000300231:V1099L	ENSP00000300231:V1099L	V	+	1	0	MAP1A	41604258	0.744000	0.28250	0.999000	0.59377	0.576000	0.36127	1.627000	0.37050	2.894000	0.99253	0.655000	0.94253	GTC	.	.	.	none		0.547	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
TM4SF5	9032	hgsc.bcm.edu	37	17	4686223	4686223	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr17:4686223C>T	ENST00000270560.3	+	4	501	c.470C>T	c.(469-471)aCg>aTg	p.T157M		NM_003963.2	NP_003954.2	O14894	T4S5_HUMAN	transmembrane 4 L six family member 5	157						integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(3)|ovary(1)	6						TGGAATGTGACGCTCTTCTCG	0.637																																					p.T157M		Atlas-SNP	.											.	TM4SF5	26	.	0			c.C470T						PASS	.						76.0	72.0	73.0					17																	4686223		2203	4300	6503	SO:0001583	missense	9032	exon4			ATGTGACGCTCTT	AF027204	CCDS11054.1	17p13.3	2007-01-06	2005-03-21		ENSG00000142484	ENSG00000142484			11857	protein-coding gene	gene with protein product		604657	"""transmembrane 4 superfamily member 5"""			9479038	Standard	NM_003963		Approved		uc002fyw.1	O14894	OTTHUMG00000090776	ENST00000270560.3:c.470C>T	chr17.hg19:g.4686223C>T	ENSP00000270560:p.Thr157Met	97.0	0.0	.		148.0	83.0	.	NM_003963	Q17RW9|Q6IB79	Missense_Mutation	SNP	ENST00000270560.3	hg19	CCDS11054.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698656	0.48307	.	.	ENSG00000142484	ENST00000270560	T	0.33865	1.39	5.71	2.51	0.30379	.	0.225720	0.44902	D	0.000418	T	0.51618	0.1685	M	0.82823	2.61	0.29698	N	0.840385	D	0.64830	0.994	P	0.60886	0.88	T	0.51888	-0.8648	10	0.72032	D	0.01	-3.5111	4.4304	0.11524	0.0:0.5775:0.1699:0.2526	.	157	O14894	T4S5_HUMAN	M	157	ENSP00000270560:T157M	ENSP00000270560:T157M	T	+	2	0	TM4SF5	4632970	0.833000	0.29383	0.764000	0.31436	0.125000	0.20455	1.159000	0.31749	1.413000	0.46997	0.655000	0.94253	ACG	.	.	.	none		0.637	TM4SF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207558.2		
PFAS	5198	hgsc.bcm.edu	37	17	8170960	8170960	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr17:8170960C>A	ENST00000314666.6	+	26	3492	c.3359C>A	c.(3358-3360)gCa>gAa	p.A1120E	PFAS_ENST00000545834.1_Missense_Mutation_p.A696E	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1120	Glutamine amidotransferase type-1.				'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TTCAGCTATGCAGATGTCCTG	0.607																																					p.A1120E		Atlas-SNP	.											.	PFAS	91	.	0			c.C3359A						PASS	.						121.0	108.0	112.0					17																	8170960		2203	4300	6503	SO:0001583	missense	5198	exon26			GCTATGCAGATGT	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.3359C>A	chr17.hg19:g.8170960C>A	ENSP00000313490:p.Ala1120Glu	94.0	0.0	.		114.0	33.0	.	NM_012393	A6H8V8	Missense_Mutation	SNP	ENST00000314666.6	hg19	CCDS11136.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719074	0.68844	.	.	ENSG00000178921	ENST00000545834;ENST00000314666;ENST00000546020	T;T	0.30448	1.53;2.26	5.68	5.68	0.88126	Glutamine amidotransferase type 1 (1);	0.000000	0.85682	D	0.000000	T	0.60805	0.2297	M	0.82923	2.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.65134	-0.6242	10	0.87932	D	0	-12.8738	17.2855	0.87140	0.0:1.0:0.0:0.0	.	1120;1120	A8K8N7;O15067	.;PUR4_HUMAN	E	696;1120;529	ENSP00000441706:A696E;ENSP00000313490:A1120E	ENSP00000313490:A1120E	A	+	2	0	PFAS	8111685	1.000000	0.71417	0.784000	0.31847	0.066000	0.16364	5.285000	0.65633	2.688000	0.91661	0.563000	0.77884	GCA	.	.	.	none		0.607	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2		
PGS1	9489	hgsc.bcm.edu	37	17	76411070	76411070	+	Missense_Mutation	SNP	G	G	T	rs372229822		TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr17:76411070G>T	ENST00000262764.6	+	8	1539	c.1513G>T	c.(1513-1515)Gtg>Ttg	p.V505L	PGS1_ENST00000588281.1_3'UTR|PGS1_ENST00000329897.7_Missense_Mutation_p.V370L	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	505					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			GATTGCGATCGTGACGGAGAA	0.627																																					p.V505L	Esophageal Squamous(45;182 1126 10685 43198)	Atlas-SNP	.											.	PGS1	30	.	0			c.G1513T						PASS	.						53.0	56.0	55.0					17																	76411070		2050	4218	6268	SO:0001583	missense	9489	exon8			GCGATCGTGACGG		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.1513G>T	chr17.hg19:g.76411070G>T	ENSP00000262764:p.Val505Leu	97.0	0.0	.		87.0	23.0	.	NM_024419	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	ENST00000262764.6	hg19	CCDS42391.1	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569404	0.65765	.	.	ENSG00000087157	ENST00000262764;ENST00000329897	T;T	0.12984	2.63;2.63	4.52	4.52	0.55395	.	32.001500	0.00769	N	0.001196	T	0.23532	0.0569	L	0.60845	1.875	0.80722	D	1	P	0.48694	0.914	B	0.39935	0.314	T	0.45571	-0.9252	10	0.59425	D	0.04	-16.446	17.458	0.87612	0.0:0.0:1.0:0.0	.	505	Q32NB8	PGPS1_HUMAN	L	505;370	ENSP00000262764:V505L;ENSP00000330039:V370L	ENSP00000262764:V505L	V	+	1	0	PGS1	73922665	1.000000	0.71417	1.000000	0.80357	0.563000	0.35712	9.112000	0.94314	2.337000	0.79520	0.561000	0.74099	GTG	.	.	.	alt		0.627	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558373	11558373	+	Silent	SNP	A	A	G			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr19:11558373A>G	ENST00000589838.1	+	10	969	c.969A>G	c.(967-969)gaA>gaG	p.E323E	PRKCSH_ENST00000592741.1_Silent_p.E323E|PRKCSH_ENST00000587327.1_Silent_p.E323E|PRKCSH_ENST00000252455.2_Silent_p.E323E|PRKCSH_ENST00000591462.1_Silent_p.E323E|PRKCSH_ENST00000412601.1_Silent_p.E323E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	323	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaagaagaggctg	0.642																																					p.E323E		Atlas-SNP	.											PRKCSH,colon,carcinoma,0,1	PRKCSH	55	.	0			c.A969G						PASS	.																																			SO:0001819	synonymous_variant	5589	exon11			GGAGGAAGAAGAG		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.969A>G	chr19.hg19:g.11558373A>G		93.0	0.0	.		106.0	7.0	.	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	hg19	CCDS32911.1																																																																																			.	.	.	none		0.642	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
RNASEH2A	10535	hgsc.bcm.edu	37	19	12921202	12921202	+	Silent	SNP	C	C	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr19:12921202C>A	ENST00000221486.4	+	6	715	c.621C>A	c.(619-621)ggC>ggA	p.G207G		NM_006397.2	NP_006388.2	O75792	RNH2A_HUMAN	ribonuclease H2, subunit A	207					DNA replication (GO:0006260)|mismatch repair (GO:0006298)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)	metal ion binding (GO:0046872)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	14						CTGATTATGGCTCAGGCTACC	0.512																																					p.G207G		Atlas-SNP	.											.	RNASEH2A	25	.	0			c.C621A						PASS	.						98.0	90.0	93.0					19																	12921202		2203	4300	6503	SO:0001819	synonymous_variant	10535	exon6			TTATGGCTCAGGC	Z97029	CCDS12282.1	19p13.13	2014-09-17	2006-08-17			ENSG00000104889	3.1.26.-		18518	protein-coding gene	gene with protein product		606034	"""ribonuclease H2, large subunit"", ""Aicardi-Goutieres syndrome 4"""			9789007, 16845400	Standard	NM_006397		Approved	RNASEHI, RNHIA, RNHL, AGS4	uc002mvg.1	O75792		ENST00000221486.4:c.621C>A	chr19.hg19:g.12921202C>A		96.0	0.0	.		121.0	49.0	.	NM_006397	B2RCY1|Q96F11	Silent	SNP	ENST00000221486.4	hg19	CCDS12282.1																																																																																			.	.	.	none		0.512	RNASEH2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451507.1	NM_006397	
PTPRH	5794	hgsc.bcm.edu	37	19	55710166	55710166	+	Nonsense_Mutation	SNP	C	C	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr19:55710166C>T	ENST00000376350.3	-	8	1557	c.1535G>A	c.(1534-1536)tGg>tAg	p.W512*	PTPRH_ENST00000588559.1_5'UTR|PTPRH_ENST00000263434.5_Nonsense_Mutation_p.W334*	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	512	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TTCCCTGACCCATGAGACCCA	0.587																																					p.W512X		Atlas-SNP	.											.	PTPRH	139	.	0			c.G1535A						PASS	.						130.0	110.0	116.0					19																	55710166		2203	4300	6503	SO:0001587	stop_gained	5794	exon8			CTGACCCATGAGA		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.1535G>A	chr19.hg19:g.55710166C>T	ENSP00000365528:p.Trp512*	40.0	0.0	.		55.0	23.0	.	NM_002842	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Nonsense_Mutation	SNP	ENST00000376350.3	hg19	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.511395	0.64522	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	.	.	.	3.19	2.14	0.27477	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	7.8788	0.29610	0.2465:0.7535:0.0:0.0	.	.	.	.	X	512;334	.	ENSP00000263434:W334X	W	-	2	0	PTPRH	60401978	0.001000	0.12720	0.001000	0.08648	0.009000	0.06853	0.767000	0.26575	0.935000	0.37341	-0.219000	0.12488	TGG	.	.	.	none		0.587	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
AR	367	hgsc.bcm.edu	37	X	66765152	66765152	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chrX:66765152T>A	ENST00000374690.3	+	1	688	c.164T>A	c.(163-165)cTg>cAg	p.L55Q	AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Missense_Mutation_p.L55Q|AR_ENST00000396044.3_Missense_Mutation_p.L55Q	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	55	Modulating.|Poly-Leu.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GCCAGTTTGCTGCTGCTgcag	0.662									Androgen Insensitivity Syndrome																												p.L55Q		Atlas-SNP	.											.	AR	249	.	0			c.T164A						PASS	.						11.0	14.0	13.0					X																	66765152		2169	4252	6421	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	GTTTGCTGCTGCT	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.164T>A	chrX.hg19:g.66765152T>A	ENSP00000363822:p.Leu55Gln	244.0	0.0	.		249.0	13.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	N	7.392	0.630975	0.14322	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.58797	0.31;0.31;0.31	.	.	.	.	0.268702	0.26919	N	0.021823	T	0.26666	0.0652	N	0.08118	0	0.09310	N	0.999996	B;B	0.17852	0.006;0.024	B;B	0.04013	0.0;0.001	T	0.17107	-1.0380	8	0.10111	T	0.7	.	.	.	.	.	55;55	E7EVX6;D3YPQ2	.;.	Q	55	ENSP00000363822:L55Q;ENSP00000421155:L55Q;ENSP00000379359:L55Q	ENSP00000363822:L55Q	L	+	2	0	AR	66681877	0.998000	0.40836	0.922000	0.36590	0.480000	0.33159	0.009000	0.13219	0.000000	0.14550	0.000000	0.15137	CTG	.	.	.	none		0.662	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
GPR50	9248	hgsc.bcm.edu	37	X	150349201	150349201	+	Silent	SNP	C	C	T			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chrX:150349201C>T	ENST00000218316.3	+	2	1215	c.1146C>T	c.(1144-1146)gcC>gcT	p.A382A	GPR50-AS1_ENST00000454196.1_RNA|AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	382	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CCGACCGTGCCTCTGGCCACC	0.582																																					p.A382A		Atlas-SNP	.											.	GPR50	195	.	0			c.C1146T						PASS	.						94.0	106.0	102.0					X																	150349201		2140	4224	6364	SO:0001819	synonymous_variant	9248	exon2			CCGTGCCTCTGGC	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1146C>T	chrX.hg19:g.150349201C>T		109.0	0.0	.		85.0	29.0	.	NM_004224	Q0VGG3|Q3ZAR0	Silent	SNP	ENST00000218316.3	hg19	CCDS44012.1																																																																																			.	.	.	none		0.582	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224	
MT-CO3	4514	hgsc.bcm.edu	37	M	9247	9247	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chrM:9247G>A	ENST00000362079.2	+	1	41	c.41G>A	c.(40-42)aGc>aAc	p.S14N	MT-TS1_ENST00000387416.2_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS2_ENST00000387449.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	14					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						AGTAAAACCCAGCCCATGACC	0.498																																					p.S14N		Atlas-SNP	.											.	.	.	.	0			c.G41A						PASS	.																																			SO:0001583	missense	5742	exon1			AACCCAGCCCATG			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.41G>A	chrM.hg19:g.9247G>A	ENSP00000354982:p.Ser14Asn	27.0	0.0	.		85.0	79.0	.	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.	.	none		0.498	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
OR2A1	346528	hgsc.bcm.edu	37	7	144015742	144015744	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr7:144015742_144015744delCTT	ENST00000408951.1	+	1	525_527	c.525_527delCTT	c.(523-528)cacttc>cac	p.F177del	OR2A1-AS1_ENST00000475089.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|OR2A1-AS1_ENST00000478925.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000488041.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|OR2A1-AS1_ENST00000486094.1_RNA|OR2A1-AS1_ENST00000493539.1_RNA|OR2A1-AS1_ENST00000496968.1_RNA|OR2A1-AS1_ENST00000467944.1_RNA	NM_001005287.1	NP_001005287.1	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A, member 1	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(3)|skin(2)	6	Melanoma(164;0.14)					AAATCAACCACTTCTTCTGTGAA	0.581																																					p.175_176del		Atlas-INDEL	.											.	OR2A1	10	.	0			c.524_526del						PASS	.																																			SO:0001651	inframe_deletion	346528	exon1			.		CCDS43673.1	7q35	2013-09-20			ENSG00000221970	ENSG00000221970		"""GPCR / Class A : Olfactory receptors"""	8229	protein-coding gene	gene with protein product							Standard	NM_001005287		Approved		uc011kub.2	Q8NGT9	OTTHUMG00000158005	ENST00000408951.1:c.525_527delCTT	chr7.hg19:g.144015745_144015747delCTT	ENSP00000386175:p.Phe177del	400.0	0.0	0		594.0	68.0	0.114478	NM_001005287	Q6IF44|Q96R46	In_Frame_Del	DEL	ENST00000408951.1	hg19	CCDS43673.1																																																																																			.	.	.	none		0.581	OR2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349985.1		
OR2A42	402317	hgsc.bcm.edu	37	7	143929405	143929407	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr7:143929405_143929407delAGA	ENST00000391496.1	-	1	529_531	c.530_532delTCT	c.(529-534)ttctgt>tgt	p.F177del	RP4-545C24.1_ENST00000460955.1_RNA|RP4-545C24.1_ENST00000489077.1_RNA|RP4-545C24.1_ENST00000493248.1_RNA|RP4-545C24.1_ENST00000464929.1_RNA|ARHGEF35_ENST00000543357.1_Intron|RP4-545C24.1_ENST00000477797.1_RNA|RP4-545C24.1_ENST00000498693.1_RNA|RP4-545C24.1_ENST00000480074.1_RNA	NM_001001802.2	NP_001001802.2	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A, member 42	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|skin(1)	4	Melanoma(164;0.14)					AGGATTTCACAGAAGAAGTGGTT	0.581																																					p.177_178del		Atlas-INDEL	.											.	OR2A1	10	.	0			c.531_533del						PASS	.																																			SO:0001651	inframe_deletion	346528	exon1			.		CCDS56515.1	7q35	2013-09-20			ENSG00000212807	ENSG00000212807		"""GPCR / Class A : Olfactory receptors"""	31230	protein-coding gene	gene with protein product							Standard	NM_001001802		Approved			Q8NGT9	OTTHUMG00000157995	ENST00000391496.1:c.530_532delTCT	chr7.hg19:g.143929408_143929410delAGA	ENSP00000375334:p.Phe177del	361.0	0.0	0		503.0	44.0	0.0874752	NM_001005287	Q6IF44|Q96R46	In_Frame_Del	DEL	ENST00000391496.1	hg19	CCDS56515.1																																																																																			.	.	.	none		0.581	OR2A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349968.1		
FAM71F1	84691	hgsc.bcm.edu	37	7	128363339	128363339	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr7:128363339delT	ENST00000315184.5	+	4	829	c.776delT	c.(775-777)attfs	p.I259fs	FAM71F1_ENST00000485070.1_Frame_Shift_Del_p.I160fs|FAM71F1_ENST00000469348.1_3'UTR	NM_001282788.1|NM_032599.2	NP_001269717.1|NP_115988.1	Q96KD3	F71F1_HUMAN	family with sequence similarity 71, member F1	259										NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18						CTGTCTCAGATTTTTGCCGAC	0.498																																					p.I259fs		Atlas-Indel,Pindel	.											.	FAM71F1	42	.	0			c.775delA						PASS	.						121.0	119.0	120.0					7																	128363339		2203	4300	6503	SO:0001589	frameshift_variant	84691	exon4			.	AF367470	CCDS5804.1, CCDS64763.1	7q32.1	2007-11-20	2007-11-20	2007-11-20	ENSG00000135248	ENSG00000135248			30704	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member A"""	FAM137A		12477932	Standard	XM_005250645		Approved	NYD-SP18	uc003vno.1	Q96KD3	OTTHUMG00000158276	ENST00000315184.5:c.776delT	chr7.hg19:g.128363339delT	ENSP00000326652:p.Ile259fs	131.0	0.0	0		96.0	33.0	0.34375	NM_032599	Q8IY75|Q8NA48	Frame_Shift_Del	DEL	ENST00000315184.5	hg19	CCDS5804.1																																																																																			.	.	.	none		0.498	FAM71F1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350544.2	NM_032599	
ATG2A	23130	hgsc.bcm.edu	37	11	64677319	64677320	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr11:64677319_64677320insAA	ENST00000377264.3	-	14	2052_2053	c.1940_1941insTT	c.(1939-1941)ttcfs	p.F647fs	ATG2A_ENST00000421419.2_Frame_Shift_Ins_p.F647fs	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	647					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CGGCAATGGGGAAGCGCAGCCG	0.703																																					p.F647fs		Atlas-Indel,Pindel	.											.	ATG2A	133	.	0			c.1941_1942insTT						PASS	.																																			SO:0001589	frameshift_variant	23130	exon14			.		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.1939_1940dupTT	chr11.hg19:g.64677320_64677321dupAA	ENSP00000366475:p.Phe647fs	74.0	0.0	0		96.0	37.0	0.385417	NM_015104	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Frame_Shift_Ins	INS	ENST00000377264.3	hg19	CCDS31602.1																																																																																			.	.	.	none		0.703	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
SMAP1	60682	hgsc.bcm.edu	37	6	71567632	71567633	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr6:71567632_71567633delTA	ENST00000370455.3	+	10	1217_1218	c.969_970delTA	c.(967-972)tttatgfs	p.M324fs	SMAP1_ENST00000370452.3_Frame_Shift_Del_p.M297fs|SMAP1_ENST00000316999.5_Frame_Shift_Del_p.M297fs|B3GAT2_ENST00000230053.6_3'UTR	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	324					positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						CAGGTGTATTTATGGGACCCAC	0.45																																					p.323_323del		Atlas-Indel,Pindel	.											.	SMAP1	77	.	0			c.968_969del						PASS	.																																			SO:0001589	frameshift_variant	60682	exon10			.	AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.969_970delTA	chr6.hg19:g.71567632_71567633delTA	ENSP00000359484:p.Met324fs	64.0	0.0	0		60.0	23.0	0.383333	NM_001044305	Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Frame_Shift_Del	DEL	ENST00000370455.3	hg19	CCDS43478.1																																																																																			.	.	.	none		0.450	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041149.1	NM_001044305	
SF3A1	10291	hgsc.bcm.edu	37	22	30731504	30731513	+	Frame_Shift_Del	DEL	AATCTTCACC	AATCTTCACC	-			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	AATCTTCACC	AATCTTCACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr22:30731504_30731513delAATCTTCACC	ENST00000215793.8	-	15	2377_2386	c.2223_2232delGGTGAAGATT	c.(2221-2232)aaggtgaagattfs	p.KVKI741fs	SF3A1_ENST00000439242.1_Frame_Shift_Del_p.KVKI676fs	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	741	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						TGGCTTCATGAATCTTCACCTTAATGACAG	0.514																																					p.742_745del		Atlas-Indel,Pindel	.											.	SF3A1	61	.	0			c.2224_2233del						PASS	.																																			SO:0001589	frameshift_variant	10291	exon15			.	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.2223_2232delGGTGAAGATT	chr22.hg19:g.30731504_30731513delAATCTTCACC	ENSP00000215793:p.Lys741fs	105.0	0.0	0		103.0	29.0	0.281553	NM_005877	E9PAW1	Frame_Shift_Del	DEL	ENST00000215793.8	hg19	CCDS13875.1																																																																																			.	.	.	none		0.514	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877	
ANKRD20A2	441430	hgsc.bcm.edu	37	9	42368494	42368500	+	Frame_Shift_Del	DEL	ACCGAAT	ACCGAAT	-			TCGA-5P-A9JZ-01A-11D-A42J-10	TCGA-5P-A9JZ-10A-01D-A42M-10	ACCGAAT	ACCGAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52e2c3e0-b7fa-491c-b9ab-525d210a1837	b000234d-c290-4ae5-9ce1-305e268770ab	g.chr9:42368494_42368500delACCGAAT	ENST00000377601.2	+	1	192_198	c.80_86delACCGAAT	c.(79-87)taccgaatcfs	p.YRI27fs	RP11-216M21.7_ENST00000450520.1_RNA	NM_001012421.1	NP_001012421.1	Q5SQ80	A20A2_HUMAN	ankyrin repeat domain 20 family, member A2	27										large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	4						GGTTCCGGATACCGAATCCGGGACTCC	0.628																																					p.27_29del		Pindel	.											.	.	.	.	0			c.79_85del						PASS	.																																			SO:0001589	frameshift_variant	441425	exon1			.		CCDS35028.1	9p12	2013-01-10			ENSG00000183148	ENSG00000183148		"""Ankyrin repeat domain containing"""	31979	protein-coding gene	gene with protein product							Standard	XM_005272519		Approved			Q5SQ80	OTTHUMG00000058641	ENST00000377601.2:c.80_86delACCGAAT	chr9.hg19:g.42368494_42368500delACCGAAT	ENSP00000366826:p.Tyr27fs	223.0	0.0	.		253.0	28.0	0.111	NM_001012419		Frame_Shift_Del	DEL	ENST00000377601.2	hg19	CCDS35028.1																																																																																			.	.	.	none		0.628	ANKRD20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129794.1	NM_001012421	
