#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PIK3CD	5293	hgsc.bcm.edu	37	1	9781589	9781589	+	Silent	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr1:9781589G>A	ENST00000377346.4	+	15	2094	c.1899G>A	c.(1897-1899)ctG>ctA	p.L633L	PIK3CD_ENST00000361110.2_Silent_p.L657L|PIK3CD_ENST00000536656.1_Silent_p.L657L|PIK3CD_ENST00000543390.1_Silent_p.L300L	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	633	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	CCAAATTCCTGCTGGACCGGG	0.617											OREG0013082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L633L		Atlas-SNP	.											.	PIK3CD	86	.	0			c.G1899A						PASS	.						58.0	59.0	59.0					1																	9781589		2203	4300	6503	SO:0001819	synonymous_variant	5293	exon15			ATTCCTGCTGGAC		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.1899G>A	chr1.hg19:g.9781589G>A		54.0	0.0	.	659	39.0	19.0	.	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Silent	SNP	ENST00000377346.4	hg19	CCDS104.1																																																																																			.	.	.	none		0.617	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
ECM1	1893	hgsc.bcm.edu	37	1	150483676	150483676	+	Splice_Site	SNP	T	T	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr1:150483676T>A	ENST00000369047.4	+	6	833		c.e6+2		ECM1_ENST00000470432.1_3'UTR|ECM1_ENST00000369049.4_Splice_Site|ECM1_ENST00000346569.6_Splice_Site	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1						angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			AAACTTGTGGTAAGGTTGGGT	0.547																																					.	Melanoma(156;1696 2560 11093 19685)	Atlas-SNP	.											.	ECM1	96	.	0			c.708+2T>A						PASS	.						74.0	79.0	77.0					1																	150483676		2203	4300	6503	SO:0001630	splice_region_variant	1893	exon6			TTGTGGTAAGGTT	U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.708+2T>A	chr1.hg19:g.150483676T>A		46.0	0.0	.		31.0	11.0	.	NM_004425	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Splice_Site	SNP	ENST00000369047.4	hg19	CCDS953.1	.	.	.	.	.	.	.	.	.	.	T	10.52	1.374014	0.24857	.	.	ENSG00000143369	ENST00000369049;ENST00000369047;ENST00000346569	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7152	0.46008	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ECM1	148750300	1.000000	0.71417	0.999000	0.59377	0.164000	0.22412	3.764000	0.55264	2.046000	0.60703	0.533000	0.62120	.	.	.	.	none		0.547	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035832.2	NM_004425	Intron
OR14C36	127066	hgsc.bcm.edu	37	1	248512735	248512735	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr1:248512735T>G	ENST00000317861.1	+	1	659	c.659T>G	c.(658-660)tTt>tGt	p.F220C		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						ATTCACATCTTTTCGACCGTG	0.502																																					p.F220C		Atlas-SNP	.											.	OR14C36	113	.	0			c.T659G						PASS	.						189.0	156.0	167.0					1																	248512735		2203	4300	6503	SO:0001583	missense	127066	exon1			ACATCTTTTCGAC	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.659T>G	chr1.hg19:g.248512735T>G	ENSP00000324534:p.Phe220Cys	81.0	0.0	.		68.0	26.0	.	NM_001001918	Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	hg19	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	T	10.62	1.400474	0.25291	.	.	ENSG00000177174	ENST00000317861	T	0.00211	8.54	3.91	3.91	0.45181	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000198	T	0.00468	0.0015	M	0.78456	2.415	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.41016	-0.9532	10	0.66056	D	0.02	.	7.653	0.28358	0.0:0.0991:0.0:0.9009	.	220	Q8NHC7	O14CZ_HUMAN	C	220	ENSP00000324534:F220C	ENSP00000324534:F220C	F	+	2	0	OR14C36	246579358	0.003000	0.15002	0.981000	0.43875	0.279000	0.26890	1.430000	0.34914	1.654000	0.50703	0.324000	0.21423	TTT	.	.	.	none		0.502	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918	
HNRNPLL	92906	hgsc.bcm.edu	37	2	38812955	38812955	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr2:38812955T>C	ENST00000449105.3	-	3	716	c.377A>G	c.(376-378)gAa>gGa	p.E126G	HNRNPLL_ENST00000608859.1_Missense_Mutation_p.E126G|HNRNPLL_ENST00000409636.1_Missense_Mutation_p.E121G|HNRNPLL_ENST00000378915.3_Missense_Mutation_p.E126G|HNRNPLL_ENST00000409328.1_Missense_Mutation_p.E126G|HNRNPLL_ENST00000410076.1_Missense_Mutation_p.E121G|HNRNPLL_ENST00000358367.4_Missense_Mutation_p.E126G			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	126	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										TGTCACACATTCTTTGGCACT	0.408																																					p.E126G		Atlas-SNP	.											.	HNRPLL	19	.	0			c.A377G						PASS	.						165.0	148.0	153.0					2																	38812955		2203	4300	6503	SO:0001583	missense	92906	exon3			ACACATTCTTTGG	BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.377A>G	chr2.hg19:g.38812955T>C	ENSP00000390625:p.Glu126Gly	64.0	0.0	.		47.0	23.0	.	NM_138394	Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Missense_Mutation	SNP	ENST00000449105.3	hg19		.	.	.	.	.	.	.	.	.	.	T	13.11	2.138987	0.37728	.	.	ENSG00000143889	ENST00000449105;ENST00000409636;ENST00000378915;ENST00000409328;ENST00000358367;ENST00000410076;ENST00000425682	T;T;T;T;T;T;T	0.08720	3.06;3.06;3.06;3.06;3.06;3.06;3.06	5.99	4.84	0.62591	.	0.378699	0.30602	N	0.009261	T	0.10078	0.0247	L	0.56280	1.765	0.32157	N	0.58347	B;B	0.14012	0.009;0.009	B;B	0.14023	0.01;0.01	T	0.04005	-1.0985	10	0.30854	T	0.27	.	11.8201	0.52235	0.0:0.0677:0.0:0.9323	.	121;126	C9J9G0;D6W592	.;.	G	126;121;126;126;126;121;65	ENSP00000390625:E126G;ENSP00000387088:E121G;ENSP00000368195:E126G;ENSP00000386575:E126G;ENSP00000351136:E126G;ENSP00000386695:E121G;ENSP00000396669:E65G	ENSP00000351136:E126G	E	-	2	0	HNRPLL	38666459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.046000	0.57376	1.100000	0.41517	0.533000	0.62120	GAA	.	.	.	none		0.408	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000219887.2	NM_138394	
OXER1	165140	hgsc.bcm.edu	37	2	42990746	42990746	+	Silent	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr2:42990746G>A	ENST00000378661.2	-	1	655	c.574C>T	c.(574-576)Ctg>Ttg	p.L192L		NM_148962.4	NP_683765.1	Q8TDS5	OXER1_HUMAN	oxoeicosanoid (OXE) receptor 1	192					G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cAMP biosynthetic process (GO:0030817)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050648)|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050647)|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050646)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10						ACCACCTTCAGGTAGCGGTTG	0.657																																					p.L192L		Atlas-SNP	.											.	OXER1	33	.	0			c.C574T						PASS	.						47.0	38.0	42.0					2																	42990746		2203	4300	6503	SO:0001819	synonymous_variant	165140	exon1			CCTTCAGGTAGCG	AB083055	CCDS1810.1	2p22.1	2012-08-10			ENSG00000162881	ENSG00000162881		"""GPCR / Class A : Leukotriene receptors"""	24884	protein-coding gene	gene with protein product	"""5-oxo-ETE acid G-protein-coupled receptor 1"""					12065583, 15001665	Standard	NM_148962		Approved	GPCR, TG1019, GPR170	uc002rss.3	Q8TDS5	OTTHUMG00000128643	ENST00000378661.2:c.574C>T	chr2.hg19:g.42990746G>A		57.0	0.0	.		48.0	12.0	.	NM_148962	Q86WP7|Q8NGW4	Silent	SNP	ENST00000378661.2	hg19	CCDS1810.1																																																																																			.	.	.	none		0.657	OXER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250514.1	NM_148962	
ATP6V1E2	90423	hgsc.bcm.edu	37	2	46739823	46739824	+	Missense_Mutation	DNP	TT	TT	GA			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr2:46739823_46739824TT>GA	ENST00000306448.4	-	2	1140_1141	c.27_28AA>TC	c.(25-30)aaAAag>aaTCag	p.9_10KK>NQ	ATP6V1E2_ENST00000522587.1_Missense_Mutation_p.9_10KK>NQ	NM_080653.3	NP_542384.1	Q96A05	VATE2_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2	9					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.151)			TTAATCTGCTTTTTCACATCGA	0.49																																					p.K10Q|p.K9N		Atlas-SNP	.											.	ATP6V1E2	25	.	0			c.A28C|c.A27T						PASS	.																																			SO:0001583	missense	90423	exon2			TCTGCTTTTTCAC|CTGCTTTTTCACA	BC008981	CCDS1826.1	2p21	2011-02-10	2006-01-13	2002-06-21	ENSG00000250565	ENSG00000250565		"""ATPases / V-type"""	18125	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD-like 2"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 2"""	ATP6EL2, ATP6V1EL2		12036578	Standard	NM_080653		Approved	MGC9341, VMA4, ATP6E1	uc002ruy.3	Q96A05	OTTHUMG00000128819	ENST00000306448.4:c.27_28delinsGA	chr2.hg19:g.46739823_46739824delinsGA	ENSP00000304891:p.K9_K10delinsNQ	43.0	0.0	.		29.0	10.0|9.0	.	NM_080653		Missense_Mutation	SNP	ENST00000306448.4	hg19	CCDS1826.1																																																																																			.	.	.	none		0.490	ATP6V1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250753.1	NM_080653	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125204404	125204404	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr2:125204404C>G	ENST00000431078.1	+	6	1172	c.808C>G	c.(808-810)Cac>Gac	p.H270D		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	270	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.H270N(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CCAGCACTGGCACTCGGTCCT	0.607																																					p.H270D		Atlas-SNP	.											CNTNAP5,NS,carcinoma,0,1	CNTNAP5	405	.	1	Substitution - Missense(1)	lung(1)	c.C808G						PASS	.						73.0	77.0	76.0					2																	125204404		2165	4283	6448	SO:0001583	missense	129684	exon6			CACTGGCACTCGG	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.808C>G	chr2.hg19:g.125204404C>G	ENSP00000399013:p.His270Asp	119.0	0.0	.		85.0	29.0	.	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607383	0.87157	.	.	ENSG00000155052	ENST00000431078	D	0.86956	-2.19	5.87	5.87	0.94306	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.53938	D	0.000053	D	0.96034	0.8708	H	0.96518	3.835	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96573	0.9424	10	0.87932	D	0	.	19.5705	0.95413	0.0:1.0:0.0:0.0	.	270	Q8WYK1	CNTP5_HUMAN	D	270	ENSP00000399013:H270D	ENSP00000399013:H270D	H	+	1	0	CNTNAP5	124920874	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	7.666000	0.83877	2.941000	0.99782	0.655000	0.94253	CAC	.	.	.	none		0.607	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
SF3B1	23451	hgsc.bcm.edu	37	2	198272752	198272752	+	Silent	SNP	T	T	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr2:198272752T>C	ENST00000335508.6	-	9	1300	c.1209A>G	c.(1207-1209)gaA>gaG	p.E403E		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	403	Interaction with PPP1R8.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TAGCATCTAATTCCTCATCAG	0.363			Mis		myelodysplastic syndrome																																p.E403E		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	1038	.	0			c.A1209G						PASS	.						92.0	90.0	91.0					2																	198272752		2203	4300	6503	SO:0001819	synonymous_variant	23451	exon9			ATCTAATTCCTCA	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1209A>G	chr2.hg19:g.198272752T>C		55.0	0.0	.		47.0	11.0	.	NM_012433	E9PCH3	Silent	SNP	ENST00000335508.6	hg19	CCDS33356.1																																																																																			.	.	.	none		0.363	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
TNS1	7145	hgsc.bcm.edu	37	2	218683236	218683236	+	Silent	SNP	A	A	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr2:218683236A>G	ENST00000171887.4	-	24	3959	c.3507T>C	c.(3505-3507)gcT>gcC	p.A1169A	TNS1_ENST00000430930.1_Silent_p.A1148A|TNS1_ENST00000419504.1_Silent_p.A1156A	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1169					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGTGGACGCCAGCCACACTGA	0.632																																					p.A1169A		Atlas-SNP	.											.	TNS1	251	.	0			c.T3507C						PASS	.						51.0	55.0	54.0					2																	218683236		2203	4300	6503	SO:0001819	synonymous_variant	7145	exon24			GACGCCAGCCACA	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.3507T>C	chr2.hg19:g.218683236A>G		58.0	0.0	.		71.0	22.0	.	NM_022648	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	hg19	CCDS2407.1																																																																																			.	.	.	none		0.632	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	chr2.hg19:g.241696843C>A		106.0	0.0	.		88.0	4.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	hg19	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
CRTAP	10491	hgsc.bcm.edu	37	3	33155650	33155650	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:33155650A>C	ENST00000320954.6	+	1	180	c.81A>C	c.(79-81)caA>caC	p.Q27H	CRTAP_ENST00000449224.1_Missense_Mutation_p.Q27H	NM_006371.4	NP_006362.1	O75718	CRTAP_HUMAN	cartilage associated protein	27					chaperone-mediated protein folding (GO:0061077)|extracellular matrix organization (GO:0030198)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation to 3-hydroxy-L-proline (GO:0018400)|protein stabilization (GO:0050821)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|macromolecular complex (GO:0032991)|proteinaceous extracellular matrix (GO:0005578)	protein complex binding (GO:0032403)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9						GGCGCGCCCAATACGAACGCT	0.736																																					p.Q27H		Atlas-SNP	.											.	CRTAP	16	.	0			c.A81C						PASS	.						9.0	9.0	9.0					3																	33155650		2106	4146	6252	SO:0001583	missense	10491	exon1			CGCCCAATACGAA	AJ006470	CCDS2657.1	3p22	2014-09-17			ENSG00000170275	ENSG00000170275			2379	protein-coding gene	gene with protein product	"""leprecan-like 3"""	605497				9217321, 10429950	Standard	NM_006371		Approved	CASP, LEPREL3	uc003cfl.4	O75718	OTTHUMG00000130746	ENST00000320954.6:c.81A>C	chr3.hg19:g.33155650A>C	ENSP00000323696:p.Gln27His	580.0	0.0	.		556.0	254.0	.	NM_006371	B2RBL6	Missense_Mutation	SNP	ENST00000320954.6	hg19	CCDS2657.1	.	.	.	.	.	.	.	.	.	.	A	18.07	3.540586	0.65085	.	.	ENSG00000170275	ENST00000320954;ENST00000509775;ENST00000539684;ENST00000449224;ENST00000423366	T;T	0.76968	-1.06;-1.06	4.13	2.28	0.28536	.	0.000000	0.85682	D	0.000000	D	0.86167	0.5868	M	0.81497	2.545	0.52099	D	0.99994	D;D	0.64830	0.994;0.994	D;D	0.78314	0.991;0.991	D	0.86505	0.1806	10	0.87932	D	0	-0.1463	10.1	0.42499	0.2355:0.0:0.7645:0.0	.	27;27	C9JP16;O75718	.;CRTAP_HUMAN	H	27	ENSP00000323696:Q27H;ENSP00000409997:Q27H	ENSP00000323696:Q27H	Q	+	3	2	CRTAP	33130654	1.000000	0.71417	1.000000	0.80357	0.327000	0.28475	2.883000	0.48554	0.946000	0.37632	-0.407000	0.06327	CAA	.	.	.	none		0.736	CRTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253246.3		
ACAA1	30	hgsc.bcm.edu	37	3	38167691	38167691	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:38167691C>G	ENST00000333167.8	-	9	1131	c.959G>C	c.(958-960)gGa>gCa	p.G320A	ACAA1_ENST00000450296.1_Missense_Mutation_p.G279A|ACAA1_ENST00000301810.7_Intron|Y_RNA_ENST00000365095.1_RNA|ACAA1_ENST00000544624.1_3'UTR|ACAA1_ENST00000480865.1_5'UTR	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1	320					alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		ATAGGCAGGTCCAATGCCCAT	0.572																																					p.G320A		Atlas-SNP	.											.	ACAA1	32	.	0			c.G959C						PASS	.						89.0	71.0	77.0					3																	38167691		2203	4300	6503	SO:0001583	missense	30	exon9			GCAGGTCCAATGC	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087	ENST00000333167.8:c.959G>C	chr3.hg19:g.38167691C>G	ENSP00000333664:p.Gly320Ala	116.0	0.0	.		106.0	49.0	.	NM_001607	G5E935|Q96CA6	Missense_Mutation	SNP	ENST00000333167.8	hg19	CCDS2673.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.6|29.6	5.017968|5.017968	0.93404|0.93404	.|.	.|.	ENSG00000060971|ENSG00000060971	ENST00000421218|ENST00000333167;ENST00000450296;ENST00000358122	.|D;D	.|0.92805	.|-3.11;-3.11	5.11|5.11	5.11|5.11	0.69529|0.69529	.|Thiolase-like, subgroup (1);Thiolase-like (1);Thiolase, C-terminal (1);	.|0.053952	.|0.64402	.|D	.|0.000001	D|D	0.95452|0.95452	0.8523|0.8523	M|M	0.68728|0.68728	2.09|2.09	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.65815	.|0.991;0.995;0.993	.|D;D;D	.|0.69142	.|0.92;0.962;0.952	D|D	0.95909|0.95909	0.8921|0.8921	5|10	.|0.87932	.|D	.|0	-17.279|-17.279	18.5603|18.5603	0.91097|0.91097	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|252;279;320	.|F5GXL8;C9JDE9;P09110	.|.;.;THIK_HUMAN	H|A	210|320;279;252	.|ENSP00000333664:G320A;ENSP00000395183:G279A	.|ENSP00000333664:G320A	D|G	-|-	1|2	0|0	ACAA1|ACAA1	38142695|38142695	1.000000|1.000000	0.71417|0.71417	0.953000|0.953000	0.39169|0.39169	0.935000|0.935000	0.57460|0.57460	7.320000|7.320000	0.79064|0.79064	2.371000|2.371000	0.80710|0.80710	0.650000|0.650000	0.86243|0.86243	GAC|GGA	.	.	.	none		0.572	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
USP4	7375	hgsc.bcm.edu	37	3	49338037	49338037	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:49338037A>C	ENST00000265560.4	-	11	1421	c.1375T>G	c.(1375-1377)Ttg>Gtg	p.L459V	USP4_ENST00000351842.4_Missense_Mutation_p.L412V|USP4_ENST00000488520.1_5'UTR	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	459	Necessary for interaction with RB1 and RBL2. {ECO:0000250}.|USP.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		GGGCAAACCAAAGTAGATTTG	0.463																																					p.L459V		Atlas-SNP	.											.	USP4	72	.	0			c.T1375G						PASS	.						126.0	108.0	114.0					3																	49338037		2203	4300	6503	SO:0001583	missense	7375	exon11			AAACCAAAGTAGA	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.1375T>G	chr3.hg19:g.49338037A>C	ENSP00000265560:p.Leu459Val	123.0	0.0	.		114.0	48.0	.	NM_003363	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	hg19	CCDS2793.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.14|19.14	3.769182|3.769182	0.69992|0.69992	.|.	.|.	ENSG00000114316|ENSG00000114316	ENST00000431357|ENST00000351842;ENST00000265560	.|T;T	.|0.35048	.|1.33;1.33	5.93|5.93	2.34|2.34	0.29019|0.29019	.|Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46870|0.46870	0.1415|0.1415	L|L	0.46614|0.46614	1.455|1.455	0.80722|0.80722	D|D	1|1	.|P;B;D	.|0.76494	.|0.939;0.218;0.999	.|P;P;D	.|0.87578	.|0.714;0.489;0.998	T|T	0.33214|0.33214	-0.9877|-0.9877	5|10	.|0.52906	.|T	.|0.07	-15.2249|-15.2249	7.059|7.059	0.25115|0.25115	0.6063:0.0:0.3937:0.0|0.6063:0.0:0.3937:0.0	.|.	.|412;459;459	.|Q13107-2;Q13107;Q08AK7	.|.;UBP4_HUMAN;.	C|V	197|412;459	.|ENSP00000341028:L412V;ENSP00000265560:L459V	.|ENSP00000265560:L459V	F|L	-|-	2|1	0|2	USP4|USP4	49313041|49313041	0.942000|0.942000	0.31987|0.31987	0.976000|0.976000	0.42696|0.42696	0.954000|0.954000	0.61252|0.61252	1.828000|1.828000	0.39111|0.39111	0.501000|0.501000	0.28013|0.28013	0.459000|0.459000	0.35465|0.35465	TTT|TTG	.	.	.	none		0.463	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
RBM15B	29890	hgsc.bcm.edu	37	3	51431290	51431290	+	Silent	SNP	T	T	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:51431290T>C	ENST00000323686.4	+	1	2560	c.2460T>C	c.(2458-2460)ctT>ctC	p.L820L		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	820	Interaction with Epstein-Barr virus BMLF1.|SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGAGGCGGCTTCTCAGGAACC	0.637																																					p.L820L		Atlas-SNP	.											.	RBM15B	47	.	0			c.T2460C						PASS	.						26.0	30.0	29.0					3																	51431290		2203	4300	6503	SO:0001819	synonymous_variant	29890	exon1			GCGGCTTCTCAGG	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.2460T>C	chr3.hg19:g.51431290T>C		64.0	0.0	.		63.0	22.0	.	NM_013286	A4QPG7|Q6QE19|Q9BV96	Silent	SNP	ENST00000323686.4	hg19	CCDS33764.1																																																																																			.	.	.	none		0.637	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286	
PRR23A	729627	hgsc.bcm.edu	37	3	138724832	138724832	+	Silent	SNP	A	A	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:138724832A>G	ENST00000383163.2	-	1	278	c.279T>C	c.(277-279)gaT>gaC	p.D93D	MRPS22_ENST00000495075.1_5'UTR	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	93										endometrium(3)|kidney(1)|lung(7)	11						GGGTGTGTCCATCGAGAGACA	0.642																																					p.D93D		Atlas-SNP	.											.	PRR23A	35	.	0			c.T279C						PASS	.						25.0	25.0	25.0					3																	138724832		692	1591	2283	SO:0001819	synonymous_variant	729627	exon1			GTGTCCATCGAGA		CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.279T>C	chr3.hg19:g.138724832A>G		196.0	0.0	.		142.0	59.0	.	NM_001134659		Silent	SNP	ENST00000383163.2	hg19	CCDS46923.1																																																																																			.	.	.	none		0.642	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361503.1	NM_001134659	
SLITRK3	22865	hgsc.bcm.edu	37	3	164906764	164906764	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:164906764G>T	ENST00000475390.1	-	2	2298	c.1855C>A	c.(1855-1857)Cca>Aca	p.P619T	SLITRK3_ENST00000241274.3_Missense_Mutation_p.P619T			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	619					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TCTCCAGCTGGTGCAACGTGC	0.567										HNSCC(40;0.11)																											p.P619T		Atlas-SNP	.											.	SLITRK3	263	.	0			c.C1855A						PASS	.						42.0	42.0	42.0					3																	164906764		2203	4300	6503	SO:0001583	missense	22865	exon2			CAGCTGGTGCAAC	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.1855C>A	chr3.hg19:g.164906764G>T	ENSP00000420091:p.Pro619Thr	71.0	0.0	.		59.0	15.0	.	NM_014926	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	hg19	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	4.489	0.090753	0.08632	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.54866	0.55;0.55	5.23	5.23	0.72850	.	0.211812	0.23924	N	0.043211	T	0.37073	0.0990	N	0.17082	0.46	0.30130	N	0.804861	B	0.14012	0.009	B	0.10450	0.005	T	0.26052	-1.0114	10	0.38643	T	0.18	-4.1785	13.2744	0.60180	0.0:0.2728:0.7272:0.0	.	619	O94933	SLIK3_HUMAN	T	619	ENSP00000420091:P619T;ENSP00000241274:P619T	ENSP00000241274:P619T	P	-	1	0	SLITRK3	166389458	0.975000	0.34042	0.589000	0.28718	0.655000	0.38815	2.147000	0.42226	2.871000	0.98454	0.655000	0.94253	CCA	.	.	.	none		0.567	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
ZBBX	79740	hgsc.bcm.edu	37	3	167086364	167086364	+	Splice_Site	SNP	T	T	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:167086364T>A	ENST00000392766.2	-	5	409		c.e5-2		ZBBX_ENST00000469220.1_Intron|ZBBX_ENST00000392764.1_Splice_Site|ZBBX_ENST00000392767.2_Splice_Site|ZBBX_ENST00000307529.5_Splice_Site|ZBBX_ENST00000455345.2_Splice_Site	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing							intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TGAGCATTTCTGAAGACATAA	0.318																																					.		Atlas-SNP	.											.	ZBBX	299	.	0			c.69-2A>T						PASS	.						113.0	97.0	102.0					3																	167086364		1801	4061	5862	SO:0001630	splice_region_variant	79740	exon6			CATTTCTGAAGAC	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.69-2A>T	chr3.hg19:g.167086364T>A		27.0	0.0	.		37.0	17.0	.	NM_024687	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Splice_Site	SNP	ENST00000392766.2	hg19	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	T	12.73	2.026562	0.35797	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000474464	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4867	0.50358	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZBBX	168569058	1.000000	0.71417	0.937000	0.37676	0.328000	0.28507	5.110000	0.64622	1.972000	0.57404	0.477000	0.44152	.	.	.	.	none		0.318	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	Intron
SEC62	7095	hgsc.bcm.edu	37	3	169701000	169701000	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:169701000C>G	ENST00000337002.4	+	5	566	c.508C>G	c.(508-510)Ctt>Gtt	p.L170V	SEC62_ENST00000480708.1_Missense_Mutation_p.L170V|SEC62-AS1_ENST00000479626.1_RNA	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)	170					cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						AAAATTCAAACTTGAGCCACA	0.348																																					p.L170V		Atlas-SNP	.											.	SEC62	27	.	0			c.C508G						PASS	.						71.0	76.0	74.0					3																	169701000		2203	4298	6501	SO:0001583	missense	7095	exon5			TTCAAACTTGAGC	D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753	ENST00000337002.4:c.508C>G	chr3.hg19:g.169701000C>G	ENSP00000337688:p.Leu170Val	333.0	0.0	.		261.0	81.0	.	NM_003262	D3DNQ0|O00682|O00729	Missense_Mutation	SNP	ENST00000337002.4	hg19	CCDS3210.1	.	.	.	.	.	.	.	.	.	.	C	31	5.072916	0.93950	.	.	ENSG00000008952	ENST00000337002;ENST00000480708	T;T	0.02421	4.3;4.3	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.18509	0.0444	M	0.79693	2.465	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.00021	-1.2347	10	0.54805	T	0.06	-9.9639	20.3431	0.98773	0.0:1.0:0.0:0.0	.	170	Q99442	SEC62_HUMAN	V	170	ENSP00000337688:L170V;ENSP00000420331:L170V	ENSP00000337688:L170V	L	+	1	0	SEC62	171183694	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.411000	0.66386	2.880000	0.98712	0.650000	0.86243	CTT	.	.	.	none		0.348	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352043.1		
DVL3	1857	hgsc.bcm.edu	37	3	183887831	183887831	+	Silent	SNP	C	C	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:183887831C>T	ENST00000313143.3	+	14	1784	c.1536C>T	c.(1534-1536)tcC>tcT	p.S512S	DVL3_ENST00000431765.1_Silent_p.S495S|EIF2B5_ENST00000444495.1_Intron	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	512					canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			ACGATGGCTCCAGTGGCGCCT	0.662																																					p.S512S		Atlas-SNP	.											.	DVL3	68	.	0			c.C1536T						PASS	.						73.0	63.0	66.0					3																	183887831		2203	4300	6503	SO:0001819	synonymous_variant	1857	exon14			TGGCTCCAGTGGC	D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.1536C>T	chr3.hg19:g.183887831C>T		121.0	0.0	.		112.0	48.0	.	NM_004423	B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Silent	SNP	ENST00000313143.3	hg19	CCDS3253.1																																																																																			.	.	.	none		0.662	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	NM_004423	
VPS8	23355	hgsc.bcm.edu	37	3	184654055	184654055	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:184654055T>C	ENST00000437079.3	+	35	3091	c.2920T>C	c.(2920-2922)Tgt>Cgt	p.C974R	VPS8_ENST00000436792.2_Missense_Mutation_p.C972R|VPS8_ENST00000287546.4_Missense_Mutation_p.C974R|VPS8_ENST00000446204.2_Missense_Mutation_p.C882R	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	974							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			CCTGAAGCCTTGTAAAGCTGC	0.413																																					p.C974R		Atlas-SNP	.											.	VPS8	109	.	0			c.T2920C						PASS	.						63.0	60.0	61.0					3																	184654055		1870	4103	5973	SO:0001583	missense	23355	exon34			AAGCCTTGTAAAG	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.2920T>C	chr3.hg19:g.184654055T>C	ENSP00000397879:p.Cys974Arg	66.0	0.0	.		55.0	24.0	.	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	hg19	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	T	5.373	0.254065	0.10185	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	5.11	5.11	0.69529	Quinonprotein alcohol dehydrogenase-like (1);	0.373852	0.29225	N	0.012776	T	0.08492	0.0211	N	0.11427	0.14	0.54753	D	0.999988	B;B;B	0.21381	0.002;0.055;0.003	B;B;B	0.22753	0.002;0.041;0.004	T	0.27971	-1.0058	10	0.12766	T	0.61	-10.8263	9.6614	0.39958	0.1556:0.0:0.0:0.8444	.	974;882;972	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	R	974;974;972;882	ENSP00000287546:C974R;ENSP00000397879:C974R;ENSP00000404704:C972R;ENSP00000405483:C882R	ENSP00000287546:C974R	C	+	1	0	VPS8	186136749	0.826000	0.29277	0.998000	0.56505	0.560000	0.35617	1.018000	0.30002	2.265000	0.75225	0.533000	0.62120	TGT	.	.	.	none		0.413	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
MASP1	5648	hgsc.bcm.edu	37	3	186961355	186961355	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:186961355G>A	ENST00000337774.5	-	9	1534	c.1145C>T	c.(1144-1146)aCa>aTa	p.T382I	MASP1_ENST00000296280.6_Missense_Mutation_p.T382I|MASP1_ENST00000392472.2_Missense_Mutation_p.T269I|MASP1_ENST00000495249.1_Intron	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	382	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GTTGTTCCTTGTAGAGAAGGT	0.478																																					p.T382I		Atlas-SNP	.											.	MASP1	240	.	0			c.C1145T						PASS	.						237.0	216.0	223.0					3																	186961355		2203	4300	6503	SO:0001583	missense	5648	exon9			TTCCTTGTAGAGA	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1145C>T	chr3.hg19:g.186961355G>A	ENSP00000336792:p.Thr382Ile	72.0	0.0	.		69.0	23.0	.	NM_139125	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	hg19	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089268	0.55968	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000392472;ENST00000541896	T;T;T	0.64803	0.76;-0.12;-0.12	5.56	4.66	0.58398	Complement control module (2);Sushi/SCR/CCP (3);	0.308438	0.38436	N	0.001698	T	0.72078	0.3416	M	0.85462	2.755	0.80722	D	1	B;P;P	0.39964	0.139;0.697;0.48	B;P;B	0.44860	0.16;0.462;0.331	T	0.76719	-0.2856	10	0.59425	D	0.04	.	15.3089	0.74016	0.0:0.1404:0.8596:0.0	.	269;382;382	P48740-4;P48740-2;P48740	.;.;MASP1_HUMAN	I	382;382;269;269	ENSP00000336792:T382I;ENSP00000296280:T382I;ENSP00000376264:T269I	ENSP00000296280:T382I	T	-	2	0	MASP1	188444049	1.000000	0.71417	0.956000	0.39512	0.993000	0.82548	4.068000	0.57534	1.311000	0.45024	0.561000	0.74099	ACA	.	.	.	none		0.478	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
LRRC66	339977	hgsc.bcm.edu	37	4	52861896	52861896	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr4:52861896G>T	ENST00000343457.3	-	4	1298	c.1292C>A	c.(1291-1293)gCt>gAt	p.A431D		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	431						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GTGCCCCGCAGCTTCCATGTC	0.537																																					p.A431D		Atlas-SNP	.											.	LRRC66	128	.	0			c.C1292A						PASS	.						117.0	124.0	121.0					4																	52861896		2046	4191	6237	SO:0001583	missense	339977	exon4			CCCGCAGCTTCCA	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1292C>A	chr4.hg19:g.52861896G>T	ENSP00000341944:p.Ala431Asp	42.0	0.0	.		55.0	26.0	.	NM_001024611		Missense_Mutation	SNP	ENST00000343457.3	hg19	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596364	0.46318	.	.	ENSG00000188993	ENST00000343457	T	0.47177	0.85	4.03	1.23	0.21249	.	0.494819	0.17140	N	0.185495	T	0.49490	0.1560	L	0.43152	1.355	0.09310	N	1	D	0.69078	0.997	P	0.59221	0.854	T	0.32481	-0.9905	10	0.72032	D	0.01	-1.8392	5.792	0.18365	0.1098:0.387:0.5031:0.0	.	431	Q68CR7	LRC66_HUMAN	D	431	ENSP00000341944:A431D	ENSP00000341944:A431D	A	-	2	0	LRRC66	52556653	0.000000	0.05858	0.015000	0.15790	0.002000	0.02628	-0.287000	0.08388	0.428000	0.26173	0.467000	0.42956	GCT	.	.	.	none		0.537	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
EPHA5	2044	hgsc.bcm.edu	37	4	66230806	66230806	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr4:66230806A>T	ENST00000273854.3	-	12	2765	c.2165T>A	c.(2164-2166)cTa>cAa	p.L722Q	EPHA5_ENST00000354839.4_Missense_Mutation_p.L700Q|EPHA5_ENST00000432638.2_Missense_Mutation_p.L559Q|EPHA5_ENST00000511294.1_Missense_Mutation_p.L723Q	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	722	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TGCTTCACCTAGGAAATCTCT	0.388										TSP Lung(17;0.13)																											p.L722Q		Atlas-SNP	.											.	EPHA5	315	.	0			c.T2165A						PASS	.						231.0	221.0	224.0					4																	66230806		2203	4300	6503	SO:0001583	missense	2044	exon12			TCACCTAGGAAAT	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2165T>A	chr4.hg19:g.66230806A>T	ENSP00000273854:p.Leu722Gln	83.0	0.0	.		81.0	25.0	.	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	hg19	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.663442	0.88251	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82	5.76	5.76	0.90799	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45126	D	0.000384	D	0.91891	0.7433	M	0.75264	2.295	0.58432	D	0.999999	D;D;D;D	0.89917	0.993;1.0;0.992;0.998	D;D;D;D	0.72625	0.95;0.978;0.917;0.935	D	0.92786	0.6244	10	0.87932	D	0	.	16.0723	0.80943	1.0:0.0:0.0:0.0	.	701;723;700;722	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	Q	722;559;700;723	ENSP00000273854:L722Q;ENSP00000389208:L559Q;ENSP00000346899:L700Q;ENSP00000427638:L723Q	ENSP00000273854:L722Q	L	-	2	0	EPHA5	65913401	1.000000	0.71417	0.992000	0.48379	0.953000	0.61014	9.297000	0.96120	2.199000	0.70637	0.528000	0.53228	CTA	.	.	.	none		0.388	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
SLC9A3	6550	hgsc.bcm.edu	37	5	483552	483552	+	Silent	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr5:483552G>A	ENST00000264938.3	-	6	987	c.978C>T	c.(976-978)aaC>aaT	p.N326N	CTD-2228K2.7_ENST00000606288.1_RNA|SLC9A3_ENST00000514375.1_Silent_p.N326N|CTD-2228K2.7_ENST00000607286.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	326					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GCTCCGAGATGTTGGCCTTCA	0.622																																					p.N326N		Atlas-SNP	.											.	SLC9A3	89	.	0			c.C978T						PASS	.						47.0	34.0	38.0					5																	483552		2195	4296	6491	SO:0001819	synonymous_variant	6550	exon6			CGAGATGTTGGCC		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.978C>T	chr5.hg19:g.483552G>A		147.0	0.0	.		119.0	36.0	.	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Silent	SNP	ENST00000264938.3	hg19	CCDS3855.1																																																																																			.	.	.	none		0.622	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
C5orf42	65250	hgsc.bcm.edu	37	5	37226992	37226993	+	Missense_Mutation	DNP	GT	GT	TC			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr5:37226992_37226993GT>TC	ENST00000508244.1	-	11	1797_1798	c.1704_1705AC>GA	c.(1702-1707)gaACtg>gaGAtg	p.L569M	C5orf42_ENST00000274258.7_De_novo_Start_InFrame|C5orf42_ENST00000425232.2_Missense_Mutation_p.L569M			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	569						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ATAGAATGCAGTTCTGTAATGG	0.337																																					p.L569M|p.E568E		Atlas-SNP	.											.	C5orf42	422	.	0			c.C1705A|c.A1704G						PASS	.																																			SO:0001583	missense	65250	exon12			AATGCAGTTCTGT|ATGCAGTTCTGTA		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.1704_1705delinsTC	chr5.hg19:g.37226992_37226993delinsTC	ENSP00000421690:p.Leu569Met	132.0	0.0	.		102.0|101.0	45.0|44.0	.	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation|Silent	SNP	ENST00000508244.1	hg19	CCDS34146.2																																																																																			.	.	.	none		0.337	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
ANKRD55	79722	hgsc.bcm.edu	37	5	55439741	55439741	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr5:55439741G>A	ENST00000341048.4	-	7	650	c.499C>T	c.(499-501)Cac>Tac	p.H167Y	ANKRD55_ENST00000504958.2_Intron|ANKRD55_ENST00000513241.2_Missense_Mutation_p.H138Y|RNA5SP184_ENST00000411071.1_RNA|ANKRD55_ENST00000505970.2_5'UTR	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	167										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				GCCGCCCAGTGGAGTGGTGTC	0.532																																					p.H167Y		Atlas-SNP	.											.	ANKRD55	70	.	0			c.C499T						PASS	.						220.0	219.0	219.0					5																	55439741		2203	4300	6503	SO:0001583	missense	79722	exon7			CCCAGTGGAGTGG	AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.499C>T	chr5.hg19:g.55439741G>A	ENSP00000342295:p.His167Tyr	57.0	0.0	.		33.0	14.0	.	NM_024669	B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	hg19	CCDS34161.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743502	0.69418	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000513241	D;D	0.87179	-2.22;-2.22	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.94128	0.8117	M	0.84948	2.725	0.58432	D	0.999992	D	0.89917	1.0	D	0.87578	0.998	D	0.93582	0.6913	10	0.41790	T	0.15	.	18.7597	0.91845	0.0:0.0:1.0:0.0	.	167	B3KVT8	.	Y	167;167;138	ENSP00000342295:H167Y;ENSP00000423507:H138Y	ENSP00000342295:H167Y	H	-	1	0	ANKRD55	55475498	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.934000	0.87649	2.518000	0.84900	0.650000	0.86243	CAC	.	.	.	none		0.532	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669	
CDC23	8697	hgsc.bcm.edu	37	5	137527594	137527594	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr5:137527594C>G	ENST00000394886.2	-	12	1349	c.1319G>C	c.(1318-1320)gGa>gCa	p.G440A		NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23	440					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GTAACATTCTCCTAAAGCAAC	0.408																																					p.G440A		Atlas-SNP	.											.	CDC23	46	.	0			c.G1319C						PASS	.						121.0	120.0	120.0					5																	137527594		2203	4300	6503	SO:0001583	missense	8697	exon12			CATTCTCCTAAAG	AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.1319G>C	chr5.hg19:g.137527594C>G	ENSP00000378350:p.Gly440Ala	110.0	0.0	.		111.0	39.0	.	NM_004661	A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Missense_Mutation	SNP	ENST00000394886.2	hg19	CCDS4200.2	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563709	0.86335	.	.	ENSG00000094880	ENST00000394886	T	0.79653	-1.29	5.9	5.9	0.94986	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.89167	0.6638	M	0.72353	2.195	0.80722	D	1	D	0.55800	0.973	D	0.67382	0.951	D	0.86877	0.2039	10	0.38643	T	0.18	-13.154	20.275	0.98485	0.0:1.0:0.0:0.0	.	440	Q9UJX2	CDC23_HUMAN	A	440	ENSP00000378350:G440A	ENSP00000378350:G440A	G	-	2	0	CDC23	137555493	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.711000	0.68400	2.800000	0.96347	0.455000	0.32223	GGA	.	.	.	none		0.408	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251275.2		
PXDC1	221749	hgsc.bcm.edu	37	6	3723879	3723879	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr6:3723879G>T	ENST00000380283.4	-	5	1164	c.670C>A	c.(670-672)Ccc>Acc	p.P224T	PXDC1_ENST00000477592.2_5'UTR	NM_183373.3	NP_899229.2	Q5TGL8	PXDC1_HUMAN	PX domain containing 1	224							phosphatidylinositol binding (GO:0035091)										GTCTCGAAGGGGACCAGGTGG	0.557																																					p.P224T		Atlas-SNP	.											.	.	.	.	0			c.C670A						PASS	.						180.0	151.0	161.0					6																	3723879		2203	4300	6503	SO:0001583	missense	221749	exon5			CGAAGGGGACCAG	AJ420534	CCDS4486.1	6p25.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000168994	ENSG00000168994			21361	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 145"""	C6orf145			Standard	NM_183373		Approved		uc003mvt.2	Q5TGL8	OTTHUMG00000014146	ENST00000380283.4:c.670C>A	chr6.hg19:g.3723879G>T	ENSP00000369636:p.Pro224Thr	80.0	0.0	.		97.0	40.0	.	NM_183373	A8K0N3|Q6PGP0|Q86XB7	Missense_Mutation	SNP	ENST00000380283.4	hg19	CCDS4486.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687792	0.88639	.	.	ENSG00000168994	ENST00000380283	T	0.50001	0.76	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.66406	0.2786	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69423	-0.5149	9	0.72032	D	0.01	-31.499	18.5146	0.90931	0.0:0.0:1.0:0.0	.	224	Q5TGL8	CF145_HUMAN	T	224	ENSP00000369636:P224T	ENSP00000369636:P224T	P	-	1	0	C6orf145	3668878	1.000000	0.71417	0.898000	0.35279	0.956000	0.61745	8.431000	0.90285	2.662000	0.90505	0.555000	0.69702	CCC	.	.	.	none		0.557	PXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039688.1	NM_183373	
NHLRC1	378884	hgsc.bcm.edu	37	6	18121925	18121925	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr6:18121925C>T	ENST00000340650.3	-	1	926	c.913G>A	c.(913-915)Ggc>Agc	p.G305S		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	305					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			TCCACTTGGCCGACAAGCTGC	0.557																																					p.G305S		Atlas-SNP	.											.	NHLRC1	42	.	0			c.G913A						PASS	.						67.0	64.0	65.0					6																	18121925		2203	4300	6503	SO:0001583	missense	378884	exon1			CTTGGCCGACAAG	AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.913G>A	chr6.hg19:g.18121925C>T	ENSP00000345464:p.Gly305Ser	52.0	0.0	.		49.0	21.0	.	NM_198586	Q3SYB1|Q5VUK7|Q6IMH1	Missense_Mutation	SNP	ENST00000340650.3	hg19	CCDS4542.1	.	.	.	.	.	.	.	.	.	.	C	1.321	-0.599467	0.03744	.	.	ENSG00000187566	ENST00000340650	D	0.97114	-4.25	5.67	0.632	0.17705	Six-bladed beta-propeller, TolB-like (1);	0.324151	0.34088	N	0.004275	D	0.89567	0.6752	M	0.71581	2.175	0.24490	N	0.994308	B	0.20671	0.047	B	0.13407	0.009	T	0.80946	-0.1155	10	0.22109	T	0.4	-14.9657	5.8977	0.18949	0.0:0.5163:0.1219:0.3618	.	305	Q6VVB1	NHLC1_HUMAN	S	305	ENSP00000345464:G305S	ENSP00000345464:G305S	G	-	1	0	NHLRC1	18229904	0.001000	0.12720	0.219000	0.23793	0.057000	0.15508	-0.025000	0.12413	-0.195000	0.10382	-0.794000	0.03295	GGC	.	.	.	none		0.557	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039958.1		
ABT1	29777	hgsc.bcm.edu	37	6	26597296	26597296	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr6:26597296A>C	ENST00000274849.1	+	1	117	c.86A>C	c.(85-87)cAg>cCg	p.Q29P		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	29					regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						GAGGAGGAGCAGGAGGAATCC	0.607																																					p.Q29P		Atlas-SNP	.											.	ABT1	39	.	0			c.A86C						PASS	.						75.0	84.0	81.0					6																	26597296		2203	4300	6503	SO:0001583	missense	29777	exon1			AGGAGCAGGAGGA	AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.86A>C	chr6.hg19:g.26597296A>C	ENSP00000274849:p.Gln29Pro	148.0	0.0	.		134.0	57.0	.	NM_013375		Missense_Mutation	SNP	ENST00000274849.1	hg19	CCDS4616.1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.421177	0.42918	.	.	ENSG00000146109	ENST00000274849	.	.	.	4.27	3.09	0.35607	.	0.579965	0.17698	N	0.165036	T	0.11537	0.0281	N	0.25647	0.755	0.24539	N	0.994079	B	0.02656	0.0	B	0.01281	0.0	T	0.21008	-1.0258	9	0.29301	T	0.29	-11.7293	8.6559	0.34062	0.6171:0.3829:0.0:0.0	.	29	Q9ULW3	ABT1_HUMAN	P	29	.	ENSP00000274849:Q29P	Q	+	2	0	ABT1	26705275	0.002000	0.14202	0.989000	0.46669	0.697000	0.40408	-0.309000	0.08145	0.959000	0.37980	-0.313000	0.08912	CAG	.	.	.	none		0.607	ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043698.1		
PGC	5225	hgsc.bcm.edu	37	6	41704737	41704737	+	Silent	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr6:41704737G>A	ENST00000373025.3	-	9	1082	c.1020C>T	c.(1018-1020)aaC>aaT	p.N340N	RP11-298J23.5_ENST00000438967.1_RNA|TFEB_ENST00000230323.4_5'Flank|TFEB_ENST00000420312.1_5'Flank|TFEB_ENST00000373033.1_5'Flank|TFEB_ENST00000358871.2_5'Flank|TFEB_ENST00000403298.4_5'Flank	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	340					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			TGCAGTAGCCGTTGTTCTGCT	0.587																																					p.N340N		Atlas-SNP	.											.	PGC	56	.	0			c.C1020T						PASS	.						53.0	52.0	52.0					6																	41704737		2203	4300	6503	SO:0001819	synonymous_variant	5225	exon9			GTAGCCGTTGTTC		CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.1020C>T	chr6.hg19:g.41704737G>A		76.0	0.0	.		65.0	21.0	.	NM_002630	B4DVZ3|Q5T3D7|Q5T3D8	Silent	SNP	ENST00000373025.3	hg19	CCDS4859.1																																																																																			.	.	.	none		0.587	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040521.2		
HEBP2	23593	hgsc.bcm.edu	37	6	138727155	138727155	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr6:138727155G>T	ENST00000607197.1	+	3	563	c.286G>T	c.(286-288)Ggt>Tgt	p.G96C	HEBP2_ENST00000448741.1_Missense_Mutation_p.G107C|HEBP2_ENST00000367697.3_Missense_Mutation_p.G96C	NM_014320.2	NP_055135.1	Q9Y5Z4	HEBP2_HUMAN	heme binding protein 2	96					negative regulation of mitochondrial membrane potential (GO:0010917)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of necrotic cell death (GO:0010940)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)		CGTGGAGCCTGGTTCAGGTCC	0.393																																					p.G96C		Atlas-SNP	.											HEBP2,NS,malignant_melanoma,0,1	HEBP2	12	.	0			c.G286T						PASS	.						136.0	126.0	129.0					6																	138727155		2203	4300	6503	SO:0001583	missense	23593	exon3			GAGCCTGGTTCAG	AF117616	CCDS5191.1	6q24	2008-08-29	2002-09-23	2002-09-27	ENSG00000051620	ENSG00000051620			15716	protein-coding gene	gene with protein product		605825	"""chromosome 6 open reading frame 34"""	C6orf34		10640688, 17098234	Standard	NM_014320		Approved	SOUL	uc003qhw.1	Q9Y5Z4	OTTHUMG00000015671	ENST00000607197.1:c.286G>T	chr6.hg19:g.138727155G>T	ENSP00000475750:p.Gly96Cys	124.0	0.0	.		111.0	36.0	.	NM_014320	Q96P57	Missense_Mutation	SNP	ENST00000607197.1	hg19	CCDS5191.1	.	.	.	.	.	.	.	.	.	.	G	10.22	1.291247	0.23564	.	.	ENSG00000051620	ENST00000448741;ENST00000058691;ENST00000367697	T;T;T	0.22539	1.95;1.95;1.95	5.55	5.55	0.83447	Regulatory factor, effector, bacterial (1);	0.142267	0.64402	D	0.000005	T	0.44685	0.1305	M	0.86268	2.805	0.54753	D	0.999988	D	0.89917	1.0	D	0.97110	1.0	T	0.46512	-0.9186	10	0.56958	D	0.05	.	16.3966	0.83607	0.0:0.0:1.0:0.0	.	96	Q9Y5Z4	HEBP2_HUMAN	C	107;96;96	ENSP00000392101:G107C;ENSP00000058691:G96C;ENSP00000356670:G96C	ENSP00000058691:G96C	G	+	1	0	HEBP2	138768848	1.000000	0.71417	0.140000	0.22221	0.541000	0.35023	6.709000	0.74665	2.615000	0.88500	0.491000	0.48974	GGT	.	.	.	none		0.393	HEBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042426.2		
IQCE	23288	hgsc.bcm.edu	37	7	2617955	2617955	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr7:2617955A>T	ENST00000402050.2	+	7	729	c.545A>T	c.(544-546)gAc>gTc	p.D182V	IQCE_ENST00000438376.2_Missense_Mutation_p.D166V|IQCE_ENST00000404984.1_Missense_Mutation_p.D131V|IQCE_ENST00000325979.7_Missense_Mutation_p.D117V	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	182						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		AGCAGGAAGGACCGGCAGATA	0.622																																					p.D182V		Atlas-SNP	.											.	IQCE	66	.	0			c.A545T						PASS	.						59.0	68.0	65.0					7																	2617955		2086	4217	6303	SO:0001583	missense	23288	exon7			GGAAGGACCGGCA	AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.545A>T	chr7.hg19:g.2617955A>T	ENSP00000385597:p.Asp182Val	65.0	0.0	.		82.0	40.0	.	NM_152558	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	ENST00000402050.2	hg19	CCDS43542.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.107831	0.77096	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000415271;ENST00000438376;ENST00000325979;ENST00000423395;ENST00000422276	T;T;T;T;T;T	0.10960	2.82;2.82;2.82;2.82;2.82;2.82	5.5	4.33	0.51752	.	0.050251	0.85682	D	0.000000	T	0.30823	0.0777	M	0.75264	2.295	0.58432	D	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.997;0.999;0.999	T	0.01488	-1.1342	10	0.52906	T	0.07	-18.5907	11.0308	0.47772	0.8605:0.0:0.0:0.1395	.	117;166;117;182;182;166	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	V	182;131;218;166;117;117;117	ENSP00000385597:D182V;ENSP00000385945:D131V;ENSP00000404643:D218V;ENSP00000396178:D166V;ENSP00000313772:D117V;ENSP00000413570:D117V	ENSP00000313772:D117V	D	+	2	0	IQCE	2584481	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	6.359000	0.73060	0.893000	0.36288	0.460000	0.39030	GAC	.	.	.	none		0.622	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2	NM_152558	
KIAA1429	25962	hgsc.bcm.edu	37	8	95539042	95539042	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr8:95539042A>C	ENST00000297591.5	-	8	1505	c.1430T>G	c.(1429-1431)cTg>cGg	p.L477R	KIAA1429_ENST00000437199.1_Missense_Mutation_p.L477R|KIAA1429_ENST00000421249.2_Missense_Mutation_p.L477R	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	477					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TGCTTGTAGCAGTCCTGTAAC	0.443																																					p.L477R		Atlas-SNP	.											.	KIAA1429	176	.	0			c.T1430G						PASS	.						98.0	96.0	96.0					8																	95539042		2203	4300	6503	SO:0001583	missense	25962	exon8			TGTAGCAGTCCTG	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.1430T>G	chr8.hg19:g.95539042A>C	ENSP00000297591:p.Leu477Arg	54.0	0.0	.		62.0	22.0	.	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	hg19	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	A	15.11	2.736385	0.49045	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.57595	0.4;0.41;0.39	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.70780	0.3263	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.73600	-0.3931	10	0.87932	D	0	-6.7927	16.2285	0.82315	1.0:0.0:0.0:0.0	.	477;477	Q69YN4-4;Q69YN4	.;VIR_HUMAN	R	477	ENSP00000297591:L477R;ENSP00000395600:L477R;ENSP00000398390:L477R	ENSP00000297591:L477R	L	-	2	0	KIAA1429	95608218	1.000000	0.71417	0.930000	0.37139	0.300000	0.27592	8.962000	0.93254	2.235000	0.73313	0.460000	0.39030	CTG	.	.	.	none		0.443	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
CCDC171	203238	hgsc.bcm.edu	37	9	15666301	15666301	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr9:15666301G>C	ENST00000380701.3	+	9	1384	c.1056G>C	c.(1054-1056)gaG>gaC	p.E352D	CCDC171_ENST00000297641.3_Missense_Mutation_p.E352D	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	352	Glu-rich.																ATGCACAAGAGAGCTTTGCAA	0.294																																					p.E352D		Atlas-SNP	.											.	.	.	.	0			c.G1056C						PASS	.						51.0	52.0	52.0					9																	15666301		2203	4300	6503	SO:0001583	missense	203238	exon9			ACAAGAGAGCTTT	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.1056G>C	chr9.hg19:g.15666301G>C	ENSP00000370077:p.Glu352Asp	75.0	0.0	.		43.0	18.0	.	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	hg19	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.421902	0.62622	.	.	ENSG00000164989	ENST00000297641;ENST00000380701	T;T	0.14893	2.47;2.47	4.98	4.08	0.47627	.	0.323937	0.32357	N	0.006202	T	0.22898	0.0553	L	0.27053	0.805	0.80722	D	1	D;D;D	0.64830	0.994;0.994;0.99	P;P;P	0.60789	0.879;0.831;0.717	T	0.02226	-1.1192	10	0.21540	T	0.41	-13.6304	13.1746	0.59619	0.0778:0.0:0.9222:0.0	.	352;352;352	B7ZM22;Q6TFL3-3;Q6TFL3	.;.;CI093_HUMAN	D	352	ENSP00000297641:E352D;ENSP00000370077:E352D	ENSP00000297641:E352D	E	+	3	2	C9orf93	15656301	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	0.815000	0.27253	1.217000	0.43442	0.591000	0.81541	GAG	.	.	.	none		0.294	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
EGFL7	51162	hgsc.bcm.edu	37	9	139566407	139566407	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr9:139566407C>A	ENST00000371699.1	+	9	1577	c.666C>A	c.(664-666)caC>caA	p.H222Q	MIR126_ENST00000362291.1_RNA|EGFL7_ENST00000406555.3_Missense_Mutation_p.H222Q|EGFL7_ENST00000308874.7_Missense_Mutation_p.H222Q|EGFL7_ENST00000371698.3_Missense_Mutation_p.H222Q|EGFL7_ENST00000492002.1_3'UTR			Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	222					angiogenesis (GO:0001525)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|negative regulation of cell migration (GO:0030336)|negative regulation of Notch signaling pathway (GO:0045746)|positive regulation of endothelial cell proliferation (GO:0001938)|vasculogenesis (GO:0001570)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)			kidney(2)|ovary(1)|prostate(2)|urinary_tract(1)	6	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		CCCCACTGCACAGCCTGGCCT	0.706											OREG0019619	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H222Q		Atlas-SNP	.											.	EGFL7	11	.	0			c.C666A						PASS	.						6.0	7.0	7.0					9																	139566407		1851	3602	5453	SO:0001583	missense	51162	exon10			ACTGCACAGCCTG	AF186111	CCDS7002.1	9q34.3	2008-02-05			ENSG00000172889	ENSG00000172889			20594	protein-coding gene	gene with protein product		608582					Standard	NM_016215		Approved	ZNEU1	uc004cih.3	Q9UHF1	OTTHUMG00000020938	ENST00000371699.1:c.666C>A	chr9.hg19:g.139566407C>A	ENSP00000360764:p.His222Gln	34.0	0.0	.	1649	33.0	7.0	.	NM_016215	B3KRP0|M9VTX9|Q5M7Y5|Q5VUD5|Q96EG0	Missense_Mutation	SNP	ENST00000371699.1	hg19	CCDS7002.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.276313	0.40294	.	.	ENSG00000172889	ENST00000371699;ENST00000308874;ENST00000406555;ENST00000371698	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	4.15	1.18	0.20946	.	0.475986	0.22547	N	0.058656	T	0.66597	0.2805	L	0.32530	0.975	0.31471	N	0.668321	B	0.29988	0.264	B	0.23150	0.044	T	0.57871	-0.7736	10	0.20519	T	0.43	-26.4872	4.9643	0.14082	0.0:0.5813:0.1503:0.2684	.	222	Q9UHF1	EGFL7_HUMAN	Q	222	ENSP00000360764:H222Q;ENSP00000307843:H222Q;ENSP00000385639:H222Q;ENSP00000360763:H222Q	ENSP00000307843:H222Q	H	+	3	2	EGFL7	138686228	0.647000	0.27304	1.000000	0.80357	0.832000	0.47134	-0.224000	0.09164	0.236000	0.21180	0.561000	0.74099	CAC	.	.	.	none		0.706	EGFL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055094.1	NM_016215	
TBATA	219793	hgsc.bcm.edu	37	10	72534001	72534001	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr10:72534001T>G	ENST00000299290.1	-	9	1274	c.885A>C	c.(883-885)gaA>gaC	p.E295D	TBATA_ENST00000394982.2_5'Flank|TBATA_ENST00000456372.2_3'UTR	NM_152710.2	NP_689923	Q96M53	TBATA_HUMAN	thymus, brain and testes associated	295					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|nucleus (GO:0005634)											CTTGAGGAGGTTCATGCACTT	0.622																																					p.E295D		Atlas-SNP	.											.	.	.	.	0			c.A885C						PASS	.						70.0	67.0	68.0					10																	72534001		2203	4300	6503	SO:0001583	missense	219793	exon9			AGGAGGTTCATGC	AK057382	CCDS7308.1	10q22.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166220	ENSG00000166220			23511	protein-coding gene	gene with protein product		612640	"""chromosome 10 open reading frame 27"""	C10orf27		20937703	Standard	NM_152710		Approved	FLJ32820, spatial	uc001jrj.1	Q96M53	OTTHUMG00000018413	ENST00000299290.1:c.885A>C	chr10.hg19:g.72534001T>G	ENSP00000299290:p.Glu295Asp	59.0	0.0	.		56.0	23.0	.	NM_152710	A4QPA8|B2RPQ2|Q5T4G2	Missense_Mutation	SNP	ENST00000299290.1	hg19	CCDS7308.1	.	.	.	.	.	.	.	.	.	.	T	8.123	0.781331	0.16120	.	.	ENSG00000166220	ENST00000299290	T	0.45668	0.89	4.19	-8.38	0.00973	.	1.349240	0.04739	N	0.422520	T	0.20210	0.0486	L	0.31207	0.915	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.002;0.002	T	0.16453	-1.0402	10	0.16420	T	0.52	-0.0633	0.5239	0.00616	0.3677:0.2095:0.2498:0.173	.	294;296;295	B7ZMN4;B7ZMN5;Q96M53	.;.;SPATL_HUMAN	D	295	ENSP00000299290:E295D	ENSP00000299290:E295D	E	-	3	2	C10orf27	72204007	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-3.090000	0.00609	-1.149000	0.02843	0.482000	0.46254	GAA	.	.	.	none		0.622	TBATA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048519.1	NM_152710	
MINPP1	9562	hgsc.bcm.edu	37	10	89311958	89311958	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr10:89311958A>G	ENST00000371996.4	+	5	1228	c.1187A>G	c.(1186-1188)aAa>aGa	p.K396R	MINPP1_ENST00000536010.1_Missense_Mutation_p.K195R|MINPP1_ENST00000371994.4_3'UTR|MINPP1_ENST00000472891.1_3'UTR	NM_004897.4	NP_004888.2	Q9UNW1	MINP1_HUMAN	multiple inositol-polyphosphate phosphatase 1	396					bone mineralization (GO:0030282)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|ossification (GO:0001503)|polyphosphate metabolic process (GO:0006797)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|bisphosphoglycerate 3-phosphatase activity (GO:0034417)|inositol hexakisphosphate 2-phosphatase activity (GO:0052826)|phosphohistidine phosphatase activity (GO:0008969)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|urinary_tract(2)	5		Colorectal(252;0.122)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00123)		TACAATTACAAAAAACAAATG	0.433																																					p.K396R		Atlas-SNP	.											.	MINPP1	22	.	0			c.A1187G						PASS	.						132.0	124.0	127.0					10																	89311958		2203	4300	6503	SO:0001583	missense	9562	exon5			ATTACAAAAAACA	AF046915	CCDS7384.1, CCDS53551.1, CCDS53552.1	10q23	2010-05-04	2010-05-04		ENSG00000107789	ENSG00000107789	3.1.3.62		7102	protein-coding gene	gene with protein product		605391	"""multiple inositol polyphosphate histidine phosphatase, 1"""			10087200	Standard	NM_004897		Approved	MIPP	uc001keu.3	Q9UNW1	OTTHUMG00000018678	ENST00000371996.4:c.1187A>G	chr10.hg19:g.89311958A>G	ENSP00000361064:p.Lys396Arg	104.0	0.0	.		85.0	26.0	.	NM_004897	F5H683|O95172|O95286|Q59EJ2|Q9UGA3	Missense_Mutation	SNP	ENST00000371996.4	hg19	CCDS7384.1	.	.	.	.	.	.	.	.	.	.	A	8.904	0.957056	0.18507	.	.	ENSG00000107789	ENST00000371996;ENST00000546140;ENST00000536010	T;T	0.76448	-1.02;-1.02	6.08	4.94	0.65067	.	0.679605	0.15713	N	0.248324	T	0.59074	0.2167	N	0.25890	0.77	0.22866	N	0.998632	B	0.06786	0.001	B	0.14578	0.011	T	0.38779	-0.9645	10	0.15499	T	0.54	-10.4064	2.702	0.05152	0.5775:0.1255:0.0718:0.2253	.	396	Q9UNW1	MINP1_HUMAN	R	396;255;195	ENSP00000361064:K396R;ENSP00000437823:K195R	ENSP00000361064:K396R	K	+	2	0	MINPP1	89301938	0.010000	0.17322	0.995000	0.50966	0.760000	0.43138	2.185000	0.42584	2.333000	0.79357	0.482000	0.46254	AAA	.	.	.	none		0.433	MINPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049221.1		
FAM160B1	57700	hgsc.bcm.edu	37	10	116615097	116615097	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr10:116615097C>A	ENST00000369248.4	+	14	2280	c.1945C>A	c.(1945-1947)Cag>Aag	p.Q649K	FAM160B1_ENST00000369250.3_Missense_Mutation_p.Q649K	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	649										NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						AATTCTTGATCAGGTAATACA	0.318																																					p.Q649K		Atlas-SNP	.											.	FAM160B1	107	.	0			c.C1945A						PASS	.						61.0	63.0	62.0					10																	116615097		2203	4300	6503	SO:0001583	missense	57700	exon14			CTTGATCAGGTAA	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.1945C>A	chr10.hg19:g.116615097C>A	ENSP00000358251:p.Gln649Lys	53.0	0.0	.		37.0	11.0	.	NM_020940	Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	hg19	CCDS31290.1	.	.	.	.	.	.	.	.	.	.	C	33	5.231626	0.95207	.	.	ENSG00000151553	ENST00000369248;ENST00000369250	T;T	0.62498	0.02;0.02	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.79482	0.4453	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.74318	-0.3704	10	0.26408	T	0.33	-21.742	20.1076	0.97898	0.0:1.0:0.0:0.0	.	649;649	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	K	649	ENSP00000358251:Q649K;ENSP00000358253:Q649K	ENSP00000358251:Q649K	Q	+	1	0	FAM160B1	116605087	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.612000	0.82975	2.823000	0.97156	0.650000	0.86243	CAG	.	.	.	none		0.318	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	XM_049351	
NANOS1	340719	hgsc.bcm.edu	37	10	120789990	120789990	+	Missense_Mutation	SNP	T	T	A	rs137998752		TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr10:120789990T>A	ENST00000425699.1	+	1	763	c.677T>A	c.(676-678)cTc>cAc	p.L226H		NM_199461.2	NP_955631.1	Q8WY41	NANO1_HUMAN	nanos homolog 1 (Drosophila)	226					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			lung(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0193)		GCGATGGCGCTCTACACCACC	0.721																																					p.L226H		Atlas-SNP	.											.	NANOS1	1	.	0			c.T677A						PASS	.						25.0	21.0	22.0					10																	120789990		2130	4209	6339	SO:0001583	missense	340719	exon1			TGGCGCTCTACAC	AF275269	CCDS7607.1	10q26.13	2003-12-01			ENSG00000188613	ENSG00000188613			23044	protein-coding gene	gene with protein product		608226				12690449	Standard	NM_199461		Approved	NOS1	uc009xzf.1	Q8WY41	OTTHUMG00000019141	ENST00000425699.1:c.677T>A	chr10.hg19:g.120789990T>A	ENSP00000393275:p.Leu226His	11.0	0.0	.		13.0	10.0	.	NM_199461		Missense_Mutation	SNP	ENST00000425699.1	hg19	CCDS7607.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.131880	0.56828	.	.	ENSG00000188613	ENST00000425699;ENST00000340087	T;T	0.46451	0.87;0.87	5.08	5.08	0.68730	Zinc finger, nanos-type (2);	0.090635	0.46145	D	0.000318	T	0.47838	0.1467	N	0.17474	0.49	0.53688	D	0.999973	D	0.65815	0.995	D	0.69824	0.966	T	0.53330	-0.8454	10	0.56958	D	0.05	-16.2297	14.4916	0.67654	0.0:0.0:0.0:1.0	.	226	Q8WY41	NANO1_HUMAN	H	226;18	ENSP00000393275:L226H;ENSP00000345924:L18H	ENSP00000345924:L18H	L	+	2	0	NANOS1	120779980	1.000000	0.71417	0.998000	0.56505	0.377000	0.30045	5.891000	0.69782	1.902000	0.55061	0.402000	0.26972	CTC	.	T|1.000;G|0.000	.	alt		0.721	NANOS1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000110794.1		
KNDC1	85442	hgsc.bcm.edu	37	10	135013101	135013101	+	Silent	SNP	C	C	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr10:135013101C>T	ENST00000304613.3	+	15	2919	c.2898C>T	c.(2896-2898)tcC>tcT	p.S966S	KNDC1_ENST00000368571.2_Silent_p.S901S|KNDC1_ENST00000368572.2_Silent_p.S968S			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	966					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CGTCACCCTCCCCAAGGTGGG	0.627																																					p.S966S		Atlas-SNP	.											.	KNDC1	155	.	0			c.C2898T						PASS	.						91.0	88.0	89.0					10																	135013101		2203	4300	6503	SO:0001819	synonymous_variant	85442	exon15			ACCCTCCCCAAGG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2898C>T	chr10.hg19:g.135013101C>T		63.0	0.0	.		73.0	37.0	.	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	hg19	CCDS7674.1																																																																																			.	.	.	none		0.627	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
FAM160A2	84067	hgsc.bcm.edu	37	11	6238643	6238643	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr11:6238643G>T	ENST00000449352.2	-	9	2436	c.2173C>A	c.(2173-2175)Cct>Act	p.P725T	FAM160A2_ENST00000529360.1_5'Flank|FAM160A2_ENST00000265978.4_Missense_Mutation_p.P739T|FAM160A2_ENST00000524416.1_Missense_Mutation_p.P725T			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	725					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTCCGCAAAGGGCTGCTGAGG	0.587																																					p.P739T		Atlas-SNP	.											.	FAM160A2	100	.	0			c.C2215A						PASS	.						55.0	56.0	56.0					11																	6238643		2201	4296	6497	SO:0001583	missense	84067	exon9			GCAAAGGGCTGCT		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.2173C>A	chr11.hg19:g.6238643G>T	ENSP00000416918:p.Pro725Thr	32.0	0.0	.		28.0	11.0	.	NM_032127	Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	ENST00000449352.2	hg19	CCDS44530.1	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271449	0.59649	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.71817	-0.6;-0.6;-0.6	5.11	5.11	0.69529	.	0.102616	0.64402	D	0.000002	T	0.80221	0.4583	L	0.57536	1.79	0.36080	D	0.842696	D;D;D	0.76494	0.999;0.983;0.965	D;P;P	0.78314	0.991;0.637;0.719	T	0.80254	-0.1459	10	0.25751	T	0.34	-25.4407	15.3805	0.74651	0.0:0.0:1.0:0.0	.	725;725;739	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	T	725;650;739;725	ENSP00000416918:P725T;ENSP00000265978:P739T;ENSP00000431773:P725T	ENSP00000265978:P739T	P	-	1	0	FAM160A2	6195219	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.027000	0.76463	2.663000	0.90544	0.561000	0.74099	CCT	.	.	.	none		0.587	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	NM_032127	
NRXN2	9379	hgsc.bcm.edu	37	11	64410176	64410176	+	Intron	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr11:64410176G>A	ENST00000377551.1	-	16	3615				NRXN2_ENST00000409571.1_Intron|NRXN2_ENST00000265459.6_Intron|NRXN2_ENST00000301894.2_Silent_p.L34L|NRXN2_ENST00000377559.3_Intron			Q9P2S2	NRX2A_HUMAN	neurexin 2						adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						aacagcggcagcagAggtggc	0.786																																					p.L34L		Atlas-SNP	.											.	NRXN2	247	.	0			c.C100T						PASS	.						8.0	9.0	9.0					11																	64410176		2086	4108	6194	SO:0001627	intron_variant	9379	exon1			GCGGCAGCAGAGG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.3403+5514C>T	chr11.hg19:g.64410176G>A		19.0	0.0	.		29.0	10.0	.	NM_138734	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	hg19	CCDS8077.1																																																																																			.	.	.	none		0.786	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
C1RL	51279	hgsc.bcm.edu	37	12	7261763	7261763	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr12:7261763C>T	ENST00000266542.4	-	1	106	c.14G>A	c.(13-15)aGa>aAa	p.R5K	C1RL-AS1_ENST00000536679.1_RNA|C1RL_ENST00000545280.1_Missense_Mutation_p.R5K|C1RL_ENST00000545337.1_Missense_Mutation_p.R5K|C1RL-AS1_ENST00000541775.1_RNA|C1RL_ENST00000544702.1_Missense_Mutation_p.R5K|C1RL-AS1_ENST00000382215.3_RNA|C1RL-AS1_ENST00000435921.2_RNA	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	5					complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCCCCACACTCTGGGTCCAGG	0.602											OREG0021648	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R5K		Atlas-SNP	.											.	C1RL	39	.	0			c.G14A						PASS	.						40.0	33.0	35.0					12																	7261763		2203	4300	6503	SO:0001583	missense	51279	exon1			CACACTCTGGGTC	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.14G>A	chr12.hg19:g.7261763C>T	ENSP00000266542:p.Arg5Lys	59.0	0.0	.	640	55.0	9.0	.	NM_016546	Q53GX9	Missense_Mutation	SNP	ENST00000266542.4	hg19	CCDS8573.1	.	.	.	.	.	.	.	.	.	.	C	9.654	1.142312	0.21205	.	.	ENSG00000139178	ENST00000545280;ENST00000266542;ENST00000396661;ENST00000544702;ENST00000543933;ENST00000545337	D;T;T;T	0.86694	-2.16;1.37;1.94;1.64	3.69	0.697	0.18081	.	0.188541	0.27023	N	0.021317	T	0.75451	0.3851	L	0.29908	0.895	0.09310	N	1	B;B;B	0.19331	0.035;0.035;0.002	B;B;B	0.17098	0.017;0.017;0.003	T	0.60606	-0.7230	10	0.32370	T	0.25	.	6.2753	0.20977	0.0:0.491:0.4009:0.1081	.	5;5;5	F5GWF3;F5H7C8;Q9NZP8	.;.;C1RL_HUMAN	K	5	ENSP00000266542:R5K;ENSP00000441885:R5K;ENSP00000437398:R5K;ENSP00000442611:R5K	ENSP00000266542:R5K	R	-	2	0	C1RL	7153039	0.000000	0.05858	0.017000	0.16124	0.149000	0.21700	-0.454000	0.06770	0.143000	0.18926	0.400000	0.26472	AGA	.	.	.	none		0.602	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	NM_016546	
COL2A1	1280	hgsc.bcm.edu	37	12	48379569	48379569	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr12:48379569G>C	ENST00000380518.3	-	25	1786	c.1622C>G	c.(1621-1623)cCc>cGc	p.P541R	COL2A1_ENST00000493991.1_5'UTR|COL2A1_ENST00000337299.6_Missense_Mutation_p.P472R	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	541	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GGCTCCCTTGGGGCCAGCAAG	0.632																																					p.P541R		Atlas-SNP	.											.	COL2A1	368	.	0			c.C1622G						PASS	.						44.0	45.0	45.0					12																	48379569		2203	4300	6503	SO:0001583	missense	1280	exon25			CCCTTGGGGCCAG	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.1622C>G	chr12.hg19:g.48379569G>C	ENSP00000369889:p.Pro541Arg	61.0	0.0	.		78.0	49.0	.	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	hg19	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964237	0.74131	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.98684	-5.07;-5.07	5.48	4.58	0.56647	.	0.064020	0.64402	D	0.000007	D	0.98670	0.9554	M	0.62209	1.925	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.79784	0.993;0.985	D	0.98492	1.0610	10	0.62326	D	0.03	.	12.6214	0.56605	0.0814:0.0:0.9186:0.0	.	472;541	P02458-1;P02458	.;CO2A1_HUMAN	R	541;472;472	ENSP00000369889:P541R;ENSP00000338213:P472R	ENSP00000338213:P472R	P	-	2	0	COL2A1	46665836	1.000000	0.71417	0.998000	0.56505	0.711000	0.40976	6.740000	0.74832	2.572000	0.86782	0.609000	0.83330	CCC	.	.	.	none		0.632	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
CEP290	80184	hgsc.bcm.edu	37	12	88512304	88512304	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr12:88512304A>T	ENST00000552810.1	-	17	2010	c.1667T>A	c.(1666-1668)aTt>aAt	p.I556N	CEP290_ENST00000309041.7_Missense_Mutation_p.I558N|CEP290_ENST00000397838.3_5'UTR	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	556					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.I558fs*20(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CATTTGACGAATTTTTTTTTT	0.308																																					p.I556N		Atlas-SNP	.											CEP290,NS,carcinoma,0,1	CEP290	195	.	1	Insertion - Frameshift(1)	central_nervous_system(1)	c.T1667A						PASS	.						61.0	54.0	56.0					12																	88512304		1798	4051	5849	SO:0001583	missense	80184	exon17			TGACGAATTTTTT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.1667T>A	chr12.hg19:g.88512304A>T	ENSP00000448012:p.Ile556Asn	81.0	0.0	.		83.0	4.0	.	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	hg19	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.415852	0.83449	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139	T;T	0.68479	-0.23;-0.33	5.53	5.53	0.82687	.	0.132706	0.49916	D	0.000133	T	0.72382	0.3453	L	0.45581	1.43	0.80722	D	1	D;D	0.63880	0.993;0.96	P;P	0.59487	0.858;0.657	T	0.68142	-0.5487	10	0.19590	T	0.45	.	15.6828	0.77385	1.0:0.0:0.0:0.0	.	556;556	Q05BJ6;O15078	.;CE290_HUMAN	N	556;558;556;458	ENSP00000448012:I556N;ENSP00000308021:I558N	ENSP00000308021:I558N	I	-	2	0	CEP290	87036435	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.523000	0.90576	2.103000	0.63969	0.477000	0.44152	ATT	.	.	.	none		0.308	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
FAM71C	196472	hgsc.bcm.edu	37	12	100042138	100042138	+	Silent	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr12:100042138G>T	ENST00000324341.1	+	1	608	c.186G>T	c.(184-186)gtG>gtT	p.V62V	ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547776.2_Intron|ANKS1B_ENST00000547010.1_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	62										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		TGATTGACGTGCACAACCGTG	0.522																																					p.V62V		Atlas-SNP	.											.	FAM71C	48	.	0			c.G186T						PASS	.						151.0	129.0	136.0					12																	100042138		2203	4300	6503	SO:0001819	synonymous_variant	196472	exon1			TGACGTGCACAAC		CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.186G>T	chr12.hg19:g.100042138G>T		71.0	0.0	.		99.0	26.0	.	NM_153364	B2R6Y6	Silent	SNP	ENST00000324341.1	hg19	CCDS9072.1																																																																																			.	.	.	none		0.522	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1	NM_153364	
IFT88	8100	hgsc.bcm.edu	37	13	21217615	21217615	+	Silent	SNP	C	C	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr13:21217615C>G	ENST00000319980.6	+	21	2058	c.1731C>G	c.(1729-1731)ccC>ccG	p.P577P	IFT88_ENST00000351808.5_Silent_p.P568P|IFT88_ENST00000382778.4_Silent_p.P577P|IFT88_ENST00000537103.1_Silent_p.P549P	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	577					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		TGGAAAATCCCAGTCAAGCTA	0.328																																					p.P577P		Atlas-SNP	.											.	IFT88	83	.	0			c.C1731G						PASS	.						108.0	106.0	106.0					13																	21217615		2203	4300	6503	SO:0001819	synonymous_variant	8100	exon21			AAATCCCAGTCAA	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1731C>G	chr13.hg19:g.21217615C>G		81.0	0.0	.		57.0	21.0	.	NM_175605	A2A491|B4DUS2|Q5SZJ6|Q8N719	Silent	SNP	ENST00000319980.6	hg19	CCDS31944.1																																																																																			.	.	.	none		0.328	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
PAN3	255967	hgsc.bcm.edu	37	13	28830508	28830508	+	Missense_Mutation	SNP	A	A	T	rs372499998		TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr13:28830508A>T	ENST00000380958.3	+	7	1232	c.1080A>T	c.(1078-1080)agA>agT	p.R360S	PAN3_ENST00000483842.1_3'UTR|PAN3_ENST00000282391.5_Missense_Mutation_p.R48S|PAN3_ENST00000399613.1_Missense_Mutation_p.R160S	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		CCAGAAGAAGAAGTCACACTC	0.458																																					p.R360S		Atlas-SNP	.											.	PAN3	123	.	0			c.A1080T						PASS	.	A	SER/ARG	0,4406		0,0,2203	196.0	176.0	183.0		1080	4.6	1.0	13		183	1,8599	1.2+/-3.3	0,1,4299	no	missense	PAN3	NM_175854.7	110	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	probably-damaging	360/888	28830508	1,13005	2203	4300	6503	SO:0001583	missense	255967	exon7			AAGAAGAAGTCAC	AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.1080A>T	chr13.hg19:g.28830508A>T	ENSP00000370345:p.Arg360Ser	66.0	0.0	.		57.0	22.0	.	NM_175854		Missense_Mutation	SNP	ENST00000380958.3	hg19	CCDS9329.2	.	.	.	.	.	.	.	.	.	.	A	18.98	3.736859	0.69304	0.0	1.16E-4	ENSG00000152520	ENST00000380958;ENST00000399613;ENST00000282391	T;T;T	0.42131	0.98;1.0;0.98	5.8	4.63	0.57726	.	0.043039	0.85682	D	0.000000	T	0.41190	0.1148	N	0.24115	0.695	0.58432	D	0.999999	D;D;D;D	0.67145	0.991;0.996;0.981;0.981	P;D;D;D	0.77557	0.64;0.99;0.943;0.943	T	0.43589	-0.9382	10	0.05436	T	0.98	-15.7444	8.7714	0.34735	0.8559:0.0:0.1441:0.0	.	360;360;48;306	Q58A45-4;Q58A45;Q58A45-2;Q58A45-3	.;PAN3_HUMAN;.;.	S	360;160;48	ENSP00000370345:R360S;ENSP00000382522:R160S;ENSP00000282391:R48S	ENSP00000282391:R48S	R	+	3	2	PAN3	27728508	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.930000	0.40124	1.028000	0.39785	0.528000	0.53228	AGA	.	.	.	weak		0.458	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854	
ZC3H13	23091	hgsc.bcm.edu	37	13	46554017	46554017	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr13:46554017C>A	ENST00000242848.4	-	11	2191	c.1843G>T	c.(1843-1845)Gat>Tat	p.D615Y	ZC3H13_ENST00000282007.3_Missense_Mutation_p.D615Y			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	615	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		CTTGCTTGATCTCTGTTGTCT	0.398																																					p.D615Y	Esophageal Squamous(187;747 2077 11056 31291 44172)	Atlas-SNP	.											.	ZC3H13	197	.	0			c.G1843T						PASS	.						192.0	169.0	177.0					13																	46554017		2203	4300	6503	SO:0001583	missense	23091	exon11			CTTGATCTCTGTT	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1843G>T	chr13.hg19:g.46554017C>A	ENSP00000242848:p.Asp615Tyr	65.0	0.0	.		70.0	22.0	.	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	hg19		.	.	.	.	.	.	.	.	.	.	C	14.81	2.646156	0.47258	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	T;T	0.32988	2.41;1.43	5.73	5.73	0.89815	.	0.180213	0.38663	N	0.001610	T	0.42404	0.1201	L	0.29908	0.895	0.80722	D	1	D;D	0.63046	0.986;0.992	P;P	0.59761	0.733;0.863	T	0.08597	-1.0714	10	0.38643	T	0.18	.	19.9162	0.97063	0.0:1.0:0.0:0.0	.	615;615	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	Y	615;615;431	ENSP00000242848:D615Y;ENSP00000282007:D615Y	ENSP00000242848:D615Y	D	-	1	0	ZC3H13	45452018	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.104000	0.71498	2.710000	0.92621	0.650000	0.86243	GAT	.	.	.	none		0.398	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
TPP2	7174	hgsc.bcm.edu	37	13	103301430	103301430	+	Silent	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr13:103301430G>A	ENST00000376065.4	+	22	2838	c.2802G>A	c.(2800-2802)aaG>aaA	p.K934K	TPP2_ENST00000376052.3_Silent_p.K934K	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	934					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TAGGGAAGAAGAAATCAAGCA	0.333																																					p.K934K		Atlas-SNP	.											.	TPP2	124	.	0			c.G2802A						PASS	.						145.0	140.0	141.0					13																	103301430		2203	4300	6503	SO:0001819	synonymous_variant	7174	exon22			GAAGAAGAAATCA	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2802G>A	chr13.hg19:g.103301430G>A		81.0	0.0	.		49.0	16.0	.	NM_003291	Q5VZU8	Silent	SNP	ENST00000376065.4	hg19	CCDS9502.1																																																																																			.	.	.	none		0.333	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
FANCM	57697	hgsc.bcm.edu	37	14	45628482	45628482	+	Splice_Site	SNP	A	A	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr14:45628482A>G	ENST00000267430.5	+	9	1665	c.1580A>G	c.(1579-1581)gAg>gGg	p.E527G	FANCM_ENST00000542564.2_Splice_Site_p.E501G|FANCM_ENST00000556036.1_Splice_Site_p.E527G	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	527	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GAGCAACTGGAGGTAATTATT	0.353								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.E527G		Atlas-SNP	.											.	FANCM	225	.	0			c.A1580G						PASS	.						34.0	35.0	34.0					14																	45628482		2203	4299	6502	SO:0001630	splice_region_variant	57697	exon9	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AACTGGAGGTAAT	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1581+1A>G	chr14.hg19:g.45628482A>G		90.0	0.0	.		101.0	23.0	.	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	hg19	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.144462	0.57044	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564;ENST00000556250	T;T;T;T	0.77877	-1.13;-1.13;-1.13;3.42	5.28	4.1	0.47936	Helicase, C-terminal (3);	0.243934	0.40640	N	0.001051	T	0.77274	0.4106	L	0.35341	1.055	0.44439	D	0.997363	P;P;P	0.51240	0.943;0.943;0.907	P;P;P	0.55508	0.777;0.698;0.586	T	0.77507	-0.2562	10	0.66056	D	0.02	.	10.9842	0.47513	0.9244:0.0:0.0756:0.0	.	501;527;527	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	G	527;527;501;112	ENSP00000450596:E527G;ENSP00000267430:E527G;ENSP00000442493:E501G;ENSP00000452033:E112G	ENSP00000267430:E527G	E	+	2	0	FANCM	44698232	1.000000	0.71417	0.995000	0.50966	0.600000	0.36913	7.179000	0.77665	0.798000	0.33994	0.460000	0.39030	GAG	.	.	.	none		0.353	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	Missense_Mutation
SIX6	4990	hgsc.bcm.edu	37	14	60976418	60976418	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr14:60976418A>G	ENST00000327720.5	+	1	750	c.302A>G	c.(301-303)aAg>aGg	p.K101R		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	101					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		GAGGCTGAGAAGCTGCGTGGA	0.577																																					p.K101R		Atlas-SNP	.											.	SIX6	27	.	0			c.A302G						PASS	.						48.0	51.0	50.0					14																	60976418		2203	4300	6503	SO:0001583	missense	4990	exon1			CTGAGAAGCTGCG	AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.302A>G	chr14.hg19:g.60976418A>G	ENSP00000328596:p.Lys101Arg	348.0	0.0	.		335.0	120.0	.	NM_007374	Q6NT42|Q9P1X8	Missense_Mutation	SNP	ENST00000327720.5	hg19	CCDS9747.1	.	.	.	.	.	.	.	.	.	.	A	9.599	1.128074	0.20959	.	.	ENSG00000184302	ENST00000327720	D	0.97232	-4.3	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.93729	0.7996	L	0.27975	0.815	0.80722	D	1	B	0.17038	0.02	B	0.16722	0.016	D	0.90866	0.4742	10	0.48119	T	0.1	.	14.7304	0.69377	1.0:0.0:0.0:0.0	.	101	O95475	SIX6_HUMAN	R	101	ENSP00000328596:K101R	ENSP00000328596:K101R	K	+	2	0	SIX6	60046171	1.000000	0.71417	1.000000	0.80357	0.226000	0.24999	9.139000	0.94554	2.263000	0.75096	0.379000	0.24179	AAG	.	.	.	none		0.577	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276952.2		
MYO5A	4644	hgsc.bcm.edu	37	15	52699526	52699526	+	Silent	SNP	C	C	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr15:52699526C>T	ENST00000399231.3	-	8	1152	c.909G>A	c.(907-909)aaG>aaA	p.K303K	MYO5A_ENST00000399233.2_Silent_p.K303K|MYO5A_ENST00000553916.1_Silent_p.K303K|MYO5A_ENST00000356338.6_Silent_p.K303K|MYO5A_ENST00000358212.6_Silent_p.K303K	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	303	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GTGCCATCTCCTTTGCATCAT	0.378																																					p.K303K		Atlas-SNP	.											.	MYO5A	145	.	0			c.G909A						PASS	.						142.0	130.0	134.0					15																	52699526		1968	4156	6124	SO:0001819	synonymous_variant	4644	exon8			CATCTCCTTTGCA		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.909G>A	chr15.hg19:g.52699526C>T		65.0	0.0	.		69.0	23.0	.	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Silent	SNP	ENST00000399231.3	hg19	CCDS42037.1																																																																																			.	.	.	none		0.378	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
PARP16	54956	hgsc.bcm.edu	37	15	65563347	65563347	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr15:65563347T>C	ENST00000261888.6	-	2	683	c.238A>G	c.(238-240)Aaa>Gaa	p.K80E	PARP16_ENST00000558873.1_5'UTR|PARP16_ENST00000444347.2_Intron	NM_017851.4	NP_060321.3	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16	80	PARP alpha-helical.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell death (GO:0060548)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum tubular network (GO:0071782)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	kinase binding (GO:0019900)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|protein serine/threonine kinase activator activity (GO:0043539)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	9						CAGGCCCGTTTGTGGTTGTCT	0.522																																					p.K80E	NSCLC(50;885 1163 13509 21242 41978)	Atlas-SNP	.											.	PARP16	23	.	0			c.A238G						PASS	.						165.0	161.0	162.0					15																	65563347		2201	4299	6500	SO:0001583	missense	54956	exon2			CCCGTTTGTGGTT	AK000516	CCDS10204.1	15q22.2	2010-02-16	2004-08-25	2004-08-25	ENSG00000138617	ENSG00000138617		"""Poly (ADP-ribose) polymerases"""	26040	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 30"""	C15orf30		15273990	Standard	NM_017851		Approved	FLJ20509, FLJ25281, pART15	uc002aoq.3	Q8N5Y8	OTTHUMG00000133138	ENST00000261888.6:c.238A>G	chr15.hg19:g.65563347T>C	ENSP00000261888:p.Lys80Glu	96.0	0.0	.		93.0	38.0	.	NM_017851	Q6PK64|Q9NX03	Missense_Mutation	SNP	ENST00000261888.6	hg19	CCDS10204.1	.	.	.	.	.	.	.	.	.	.	T	0.539	-0.854339	0.02630	.	.	ENSG00000138617	ENST00000261888	T	0.44482	0.92	5.8	-1.38	0.09027	Poly(ADP-ribose) polymerase, catalytic domain (1);	0.766439	0.13541	N	0.380223	T	0.23370	0.0565	N	0.14661	0.345	0.09310	N	0.999995	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20042	-1.0287	10	0.21014	T	0.42	0.0022	12.9664	0.58485	0.0:0.0646:0.633:0.3023	.	80;80	Q8N5Y8-3;Q8N5Y8	.;PAR16_HUMAN	E	80	ENSP00000261888:K80E	ENSP00000261888:K80E	K	-	1	0	PARP16	63350400	0.006000	0.16342	0.023000	0.16930	0.334000	0.28698	-0.018000	0.12568	-0.153000	0.11137	0.533000	0.62120	AAA	.	.	.	none		0.522	PARP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256827.2	NM_017851	
ITGA11	22801	hgsc.bcm.edu	37	15	68620582	68620582	+	Silent	SNP	C	C	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr15:68620582C>T	ENST00000315757.7	-	16	2006	c.1920G>A	c.(1918-1920)caG>caA	p.Q640Q	ITGA11_ENST00000423218.2_Silent_p.Q640Q	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	640					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TGGCATTGATCTGAACCACTG	0.612																																					p.Q640Q		Atlas-SNP	.											.	ITGA11	110	.	0			c.G1920A						PASS	.						86.0	92.0	90.0					15																	68620582		2021	4166	6187	SO:0001819	synonymous_variant	22801	exon16			ATTGATCTGAACC	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1920G>A	chr15.hg19:g.68620582C>T		55.0	0.0	.		53.0	25.0	.	NM_001004439	J3KQM2|Q8WYI8|Q9UKQ1	Silent	SNP	ENST00000315757.7	hg19	CCDS45291.1																																																																																			.	.	.	none		0.612	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_012211	
GRIN2A	2903	hgsc.bcm.edu	37	16	10274246	10274246	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr16:10274246G>T	ENST00000396573.2	-	3	332	c.23C>A	c.(22-24)aCc>aAc	p.T8N	GRIN2A_ENST00000562109.1_Missense_Mutation_p.T8N|GRIN2A_ENST00000404927.2_Missense_Mutation_p.T8N|GRIN2A_ENST00000330684.3_Missense_Mutation_p.T8N|GRIN2A_ENST00000396575.2_Missense_Mutation_p.T8N	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	8					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CACCAGCAGGGTCCAATAGCC	0.662																																					p.T8N		Atlas-SNP	.											.	GRIN2A	366	.	0			c.C23A						PASS	.						13.0	15.0	14.0					16																	10274246		2191	4288	6479	SO:0001583	missense	2903	exon3			AGCAGGGTCCAAT		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.23C>A	chr16.hg19:g.10274246G>T	ENSP00000379818:p.Thr8Asn	28.0	0.0	.		35.0	11.0	.	NM_000833	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	hg19	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840531	0.71488	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	T;T;T;T	0.11712	2.76;2.75;2.76;2.76	4.54	4.54	0.55810	.	0.328981	0.24520	N	0.037803	T	0.13713	0.0332	N	0.22421	0.69	0.80722	D	1	D;B;B	0.57899	0.981;0.149;0.149	P;B;B	0.52109	0.69;0.065;0.065	T	0.12993	-1.0526	9	.	.	.	.	16.2901	0.82747	0.0:0.0:1.0:0.0	.	8;8;8	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	N	8	ENSP00000379818:T8N;ENSP00000385872:T8N;ENSP00000332549:T8N;ENSP00000379820:T8N	.	T	-	2	0	GRIN2A	10181747	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.990000	0.63876	2.088000	0.63022	0.561000	0.74099	ACC	.	.	.	none		0.662	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
NLRC5	84166	hgsc.bcm.edu	37	16	57099127	57099127	+	Silent	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr16:57099127G>A	ENST00000262510.6	+	33	4383	c.4158G>A	c.(4156-4158)gtG>gtA	p.V1386V	NLRC5_ENST00000308149.7_Silent_p.V1357V|NLRC5_ENST00000436936.1_Silent_p.V1386V|NLRC5_ENST00000539144.1_Silent_p.V1357V	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1386					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GTGACAGGGTGCAGGAGCCGT	0.617																																					p.V1386V		Atlas-SNP	.											.	NLRC5	186	.	0			c.G4158A						PASS	.						27.0	28.0	27.0					16																	57099127		2198	4300	6498	SO:0001819	synonymous_variant	84166	exon32			CAGGGTGCAGGAG	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4158G>A	chr16.hg19:g.57099127G>A		30.0	0.0	.		28.0	15.0	.	NM_032206	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Silent	SNP	ENST00000262510.6	hg19	CCDS10773.1																																																																																			.	.	.	none		0.617	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
MAP2K4	6416	hgsc.bcm.edu	37	17	12028658	12028658	+	Silent	SNP	C	C	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr17:12028658C>T	ENST00000353533.5	+	8	924	c.861C>T	c.(859-861)cgC>cgT	p.R287R	MAP2K4_ENST00000415385.3_Silent_p.R298R	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	287	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(3)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		ATGATGTCCGCTCTGATGTCT	0.393			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.R287R		Atlas-SNP	.		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	MAP2K4	176	.	13	Whole gene deletion(10)|Unknown(3)	breast(4)|ovary(4)|lung(2)|biliary_tract(1)|large_intestine(1)|pancreas(1)	c.C861T						PASS	.						251.0	196.0	214.0					17																	12028658		2203	4300	6503	SO:0001819	synonymous_variant	6416	exon8			TGTCCGCTCTGAT	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.861C>T	chr17.hg19:g.12028658C>T		70.0	0.0	.		82.0	42.0	.	NM_003010	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Silent	SNP	ENST00000353533.5	hg19	CCDS11162.1																																																																																			.	.	.	none		0.393	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
WSB1	26118	hgsc.bcm.edu	37	17	25639388	25639388	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr17:25639388G>A	ENST00000262394.2	+	9	1575	c.1259G>A	c.(1258-1260)cGt>cAt	p.R420H	WSB1_ENST00000348811.2_Missense_Mutation_p.R274H|RP11-173M1.8_ENST00000578929.1_lincRNA	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1	420	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CTCTCGTATCGTATTTAGAAG	0.423																																					p.R420H		Atlas-SNP	.											.	WSB1	29	.	0			c.G1259A						PASS	.						217.0	204.0	208.0					17																	25639388		2203	4300	6503	SO:0001583	missense	26118	exon9			CGTATCGTATTTA	AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.1259G>A	chr17.hg19:g.25639388G>A	ENSP00000262394:p.Arg420His	78.0	0.0	.		107.0	5.0	.	NM_015626	Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	Missense_Mutation	SNP	ENST00000262394.2	hg19	CCDS11220.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609183	0.28623	.	.	ENSG00000109046	ENST00000262394;ENST00000348811	T;T	0.45668	0.89;0.89	5.61	-0.349	0.12609	SOCS protein, C-terminal (4);	0.380726	0.25467	N	0.030468	T	0.37348	0.1000	M	0.77103	2.36	0.25069	N	0.991007	P;P	0.47409	0.895;0.808	B;B	0.39258	0.289;0.295	T	0.36696	-0.9737	10	0.59425	D	0.04	-0.7374	7.4606	0.27294	0.5866:0.0:0.4134:0.0	.	274;420	Q9Y6I7-2;Q9Y6I7	.;WSB1_HUMAN	H	420;274	ENSP00000262394:R420H;ENSP00000327055:R274H	ENSP00000262394:R420H	R	+	2	0	WSB1	22663515	0.713000	0.27926	0.021000	0.16686	0.394000	0.30568	0.916000	0.28651	0.129000	0.18514	-0.812000	0.03155	CGT	.	.	.	none		0.423	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255391.4	NM_015626	
KRT23	25984	hgsc.bcm.edu	37	17	39084730	39084730	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr17:39084730G>A	ENST00000209718.3	-	5	1190	c.766C>T	c.(766-768)Cat>Tat	p.H256Y	KRT23_ENST00000436344.3_Missense_Mutation_p.H119Y|AC004231.2_ENST00000418393.1_RNA	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	256	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				AAGTCTCGATGCTTCTTCTTT	0.423																																					p.H256Y		Atlas-SNP	.											.	KRT23	59	.	0			c.C766T						PASS	.						238.0	237.0	238.0					17																	39084730		2203	4300	6503	SO:0001583	missense	25984	exon5			CTCGATGCTTCTT	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.766C>T	chr17.hg19:g.39084730G>A	ENSP00000209718:p.His256Tyr	55.0	0.0	.		50.0	9.0	.	NM_015515	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Missense_Mutation	SNP	ENST00000209718.3	hg19	CCDS11380.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410931	0.83340	.	.	ENSG00000108244	ENST00000209718;ENST00000436344	D;D	0.88664	-2.41;-2.41	5.82	4.83	0.62350	Filament (1);	0.236010	0.29932	N	0.010825	D	0.88175	0.6366	L	0.40543	1.245	0.36524	D	0.870343	P	0.48911	0.917	P	0.48166	0.569	D	0.91444	0.5176	10	0.87932	D	0	.	16.0906	0.81088	0.0:0.0:0.8649:0.1351	.	256	Q9C075	K1C23_HUMAN	Y	256;119	ENSP00000209718:H256Y;ENSP00000414056:H119Y	ENSP00000209718:H256Y	H	-	1	0	KRT23	36338256	1.000000	0.71417	0.976000	0.42696	0.947000	0.59692	6.419000	0.73345	1.417000	0.47077	0.655000	0.94253	CAT	.	.	.	none		0.423	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257223.1		
TANC2	26115	hgsc.bcm.edu	37	17	61498264	61498264	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr17:61498264G>T	ENST00000424789.2	+	25	4925	c.4921G>T	c.(4921-4923)Gcc>Tcc	p.A1641S	TANC2_ENST00000389520.4_Missense_Mutation_p.A1651S|RP11-269G24.3_ENST00000583552.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1641					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						CCATTCAATGGCCAGTAAATA	0.547																																					p.A1641S		Atlas-SNP	.											.	TANC2	266	.	0			c.G4921T						PASS	.						76.0	82.0	80.0					17																	61498264		2162	4277	6439	SO:0001583	missense	26115	exon25			TCAATGGCCAGTA	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.4921G>T	chr17.hg19:g.61498264G>T	ENSP00000387593:p.Ala1641Ser	67.0	0.0	.		94.0	16.0	.	NM_025185	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	ENST00000424789.2	hg19	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	G	4.811	0.150774	0.09185	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.65364	-0.15;-0.15	5.2	5.2	0.72013	.	0.139271	0.48767	D	0.000169	T	0.39226	0.1070	N	0.04508	-0.205	0.37296	D	0.908467	B	0.29766	0.256	B	0.23419	0.046	T	0.42032	-0.9475	10	0.11485	T	0.65	.	19.093	0.93235	0.0:0.0:1.0:0.0	.	1641	Q9HCD6	TANC2_HUMAN	S	1651;1641	ENSP00000374171:A1651S;ENSP00000387593:A1641S	ENSP00000374171:A1651S	A	+	1	0	TANC2	58851996	1.000000	0.71417	0.998000	0.56505	0.337000	0.28794	5.335000	0.65929	2.600000	0.87896	0.561000	0.74099	GCC	.	.	.	none		0.547	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		
NOL11	25926	hgsc.bcm.edu	37	17	65720229	65720229	+	Nonsense_Mutation	SNP	T	T	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr17:65720229T>G	ENST00000253247.4	+	6	699	c.584T>G	c.(583-585)tTa>tGa	p.L195*	NOL11_ENST00000535137.1_Nonsense_Mutation_p.L13*	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	195					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			TATACACTCTTACTTGGACAA	0.299																																					p.L195X		Atlas-SNP	.											.	NOL11	48	.	0			c.T584G						PASS	.						94.0	95.0	95.0					17																	65720229		2203	4299	6502	SO:0001587	stop_gained	25926	exon6			CACTCTTACTTGG	AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.584T>G	chr17.hg19:g.65720229T>G	ENSP00000253247:p.Leu195*	27.0	0.0	.		55.0	28.0	.	NM_015462	B7Z5V9|Q7L5S1|Q9UG18	Nonsense_Mutation	SNP	ENST00000253247.4	hg19	CCDS11671.1	.	.	.	.	.	.	.	.	.	.	T	18.68	3.675567	0.67928	.	.	ENSG00000130935	ENST00000253247;ENST00000535137	.	.	.	4.54	3.46	0.39613	.	0.551131	0.17882	N	0.158838	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.4969	6.8539	0.24030	0.0:0.1084:0.0:0.8916	.	.	.	.	X	195;13	.	ENSP00000253247:L195X	L	+	2	0	NOL11	63150691	0.411000	0.25384	0.967000	0.41034	0.223000	0.24884	1.047000	0.30367	0.710000	0.31997	0.377000	0.23210	TTA	.	.	.	none		0.299	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448074.1	NM_015462	
KPNA2	3838	hgsc.bcm.edu	37	17	66039316	66039316	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr17:66039316T>C	ENST00000537025.2	+	7	1387	c.767T>C	c.(766-768)tTa>tCa	p.L256S	KPNA2_ENST00000330459.3_Missense_Mutation_p.L256S			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	256					cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTTCCTACCTTAGTTCGGCTC	0.458																																					p.L256S		Atlas-SNP	.											.	KPNA2	55	.	0			c.T767C						PASS	.						178.0	185.0	183.0					17																	66039316		2203	4300	6503	SO:0001583	missense	3838	exon7			CTACCTTAGTTCG	U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.767T>C	chr17.hg19:g.66039316T>C	ENSP00000438483:p.Leu256Ser	55.0	0.0	.		86.0	46.0	.	NM_002266	B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	ENST00000537025.2	hg19	CCDS32713.1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.173143	0.57584	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	D;D	0.89746	-2.56;-2.56	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	U	0.000013	D	0.96012	0.8701	H	0.94183	3.505	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	D	0.97172	0.9845	10	0.87932	D	0	.	15.7143	0.77655	0.0:0.0:0.0:1.0	.	256	P52292	IMA2_HUMAN	S	256	ENSP00000332455:L256S;ENSP00000438483:L256S	ENSP00000332455:L256S	L	+	2	0	KPNA2	63469778	1.000000	0.71417	0.762000	0.31397	0.036000	0.12997	7.857000	0.86963	2.105000	0.64084	0.455000	0.32223	TTA	.	.	.	none		0.458	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448111.1	NM_002266	
NEDD4L	23327	hgsc.bcm.edu	37	18	55992364	55992364	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr18:55992364G>T	ENST00000400345.3	+	9	933	c.650G>T	c.(649-651)cGg>cTg	p.R217L	NEDD4L_ENST00000456173.2_Missense_Mutation_p.R96L|NEDD4L_ENST00000431212.2_Missense_Mutation_p.R96L|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000586263.1_Missense_Mutation_p.R209L|NEDD4L_ENST00000356462.6_Missense_Mutation_p.R217L|NEDD4L_ENST00000382850.4_Missense_Mutation_p.R217L|NEDD4L_ENST00000456986.1_Missense_Mutation_p.R96L|NEDD4L_ENST00000256832.7_Missense_Mutation_p.R96L|NEDD4L_ENST00000256830.9_Missense_Mutation_p.R217L|NEDD4L_ENST00000357895.5_Missense_Mutation_p.R209L|NEDD4L_ENST00000435432.2_Missense_Mutation_p.R96L	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	217	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						CACAACAACCGGACCACTCAG	0.542																																					p.R217L		Atlas-SNP	.											.	NEDD4L	126	.	0			c.G650T						PASS	.						176.0	176.0	176.0					18																	55992364		2061	4196	6257	SO:0001583	missense	23327	exon9			ACAACCGGACCAC	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.650G>T	chr18.hg19:g.55992364G>T	ENSP00000383199:p.Arg217Leu	84.0	0.0	.		48.0	4.0	.	NM_015277	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	hg19	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.972477	0.92919	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	D;D;D;D;D;D;D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85;-1.85;-1.85;-1.85;-1.85;-1.85;-1.85	5.51	5.51	0.81932	WW/Rsp5/WWP (6);	0.107321	0.64402	D	0.000014	D	0.94437	0.8210	H	0.96576	3.845	0.58432	D	0.999999	P;D;D;P;P;D;D	0.67145	0.872;0.996;0.996;0.722;0.493;0.986;0.996	B;D;D;B;B;D;D	0.68621	0.441;0.959;0.959;0.369;0.196;0.941;0.959	D	0.95496	0.8573	10	0.72032	D	0.01	.	12.7259	0.57170	0.0748:0.0:0.9252:0.0	.	217;209;209;96;217;217;217	Q96PU5-3;Q96PU5-6;Q96PU5-7;Q3LSM7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;.;.;NED4L_HUMAN;.	L	217;217;217;217;96;96;209;96;96;96	ENSP00000383199:R217L;ENSP00000372301:R217L;ENSP00000348847:R217L;ENSP00000256830:R217L;ENSP00000256832:R96L;ENSP00000411947:R96L;ENSP00000350569:R209L;ENSP00000393395:R96L;ENSP00000405440:R96L;ENSP00000389406:R96L	ENSP00000256830:R217L	R	+	2	0	NEDD4L	54143344	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.623000	0.83113	2.600000	0.87896	0.655000	0.94253	CGG	.	.	.	none		0.542	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
CDH20	28316	hgsc.bcm.edu	37	18	59221635	59221635	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr18:59221635A>C	ENST00000262717.4	+	12	2511	c.2113A>C	c.(2113-2115)Atc>Ctc	p.I705L	CDH20_ENST00000538374.1_Missense_Mutation_p.I705L|CDH20_ENST00000536675.2_Missense_Mutation_p.I705L			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	705					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				GCTGCCCGAGATCGAGAGCCT	0.677																																					p.I705L		Atlas-SNP	.											.	CDH20	117	.	0			c.A2113C						PASS	.						39.0	39.0	39.0					18																	59221635		2203	4300	6503	SO:0001583	missense	28316	exon11			CCCGAGATCGAGA	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.2113A>C	chr18.hg19:g.59221635A>C	ENSP00000262717:p.Ile705Leu	65.0	0.0	.		67.0	27.0	.	NM_031891	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	hg19	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	A	16.35	3.098802	0.56183	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.76186	-1.0;-1.0;-1.0	5.78	5.78	0.91487	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	L	0.28274	0.84	0.51767	D	0.999931	P	0.39376	0.67	B	0.43194	0.411	T	0.62310	-0.6881	10	0.10111	T	0.7	.	16.3979	0.83621	1.0:0.0:0.0:0.0	.	705	Q9HBT6	CAD20_HUMAN	L	705	ENSP00000444767:I705L;ENSP00000442226:I705L;ENSP00000262717:I705L	ENSP00000262717:I705L	I	+	1	0	CDH20	57372615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.218000	0.65257	2.333000	0.79357	0.533000	0.62120	ATC	.	.	.	none		0.677	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
TJP3	27134	hgsc.bcm.edu	37	19	3740744	3740744	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr19:3740744G>A	ENST00000541714.2	+	14	2288	c.1826G>A	c.(1825-1827)cGa>cAa	p.R609Q	TJP3_ENST00000589378.1_Missense_Mutation_p.R618Q|TJP3_ENST00000539908.2_Missense_Mutation_p.R573Q|TJP3_ENST00000382008.3_Missense_Mutation_p.R623Q|TJP3_ENST00000587686.1_Missense_Mutation_p.R628Q|TJP3_ENST00000262968.9_Missense_Mutation_p.R642Q	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	609	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCTACGAACGAGTGGTGTTG	0.642																																					p.R618Q		Atlas-SNP	.											.	TJP3	79	.	0			c.G1853A						PASS	.						17.0	19.0	18.0					19																	3740744		2201	4298	6499	SO:0001583	missense	27134	exon14			ACGAACGAGTGGT	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.1826G>A	chr19.hg19:g.3740744G>A	ENSP00000439278:p.Arg609Gln	113.0	0.0	.		97.0	41.0	.	NM_001267561	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	ENST00000541714.2	hg19	CCDS32873.2	.	.	.	.	.	.	.	.	.	.	G	20.2	3.944565	0.73672	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.11385	2.78;2.97;2.78;2.87	5.0	5.0	0.66597	Guanylate kinase/L-type calcium channel (1);	0.000000	0.85682	D	0.000000	T	0.38558	0.1045	M	0.86268	2.805	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;P	0.80764	0.988;0.994;0.977;0.889	T	0.41431	-0.9509	10	0.87932	D	0	.	16.8553	0.86004	0.0:0.0:1.0:0.0	.	628;642;623;609	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	Q	609;573;623;642	ENSP00000439278:R609Q;ENSP00000439991:R573Q;ENSP00000371438:R623Q;ENSP00000262968:R642Q	ENSP00000262968:R642Q	R	+	2	0	TJP3	3691744	1.000000	0.71417	0.527000	0.27925	0.131000	0.20780	5.430000	0.66501	2.286000	0.76751	0.655000	0.94253	CGA	.	.	.	none		0.642	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453434.1		
MPND	84954	hgsc.bcm.edu	37	19	4343749	4343749	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr19:4343749C>A	ENST00000262966.8	+	2	119	c.52C>A	c.(52-54)Ccg>Acg	p.P18T	AC007292.7_ENST00000598582.1_RNA|MPND_ENST00000359935.4_Missense_Mutation_p.P18T|MPND_ENST00000599840.1_Missense_Mutation_p.P18T	NM_032868.4	NP_116257.2	Q8N594	MPND_HUMAN	MPN domain containing	18							peptidase activity (GO:0008233)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		CGAGGAGGCGCCGGAGGAGGA	0.776																																					p.P18T		Atlas-SNP	.											.	MPND	28	.	0			c.C52A						PASS	.						2.0	3.0	2.0					19																	4343749		1012	2236	3248	SO:0001583	missense	84954	exon2			GAGGCGCCGGAGG		CCDS42470.1, CCDS54200.1, CCDS74261.1	19p13.3	2014-08-12			ENSG00000008382				25934	protein-coding gene	gene with protein product							Standard	XM_005259663		Approved	FLJ14981	uc002mae.3	Q8N594	OTTHUMG00000181914	ENST00000262966.8:c.52C>A	chr19.hg19:g.4343749C>A	ENSP00000262966:p.Pro18Thr	26.0	0.0	.		27.0	14.0	.	NM_032868	Q96SJ0|Q9Y2P1|Q9Y2P2	Missense_Mutation	SNP	ENST00000262966.8	hg19	CCDS42470.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962778	0.53507	.	.	ENSG00000008382	ENST00000262966;ENST00000359935	T;T	0.46819	0.86;0.86	3.52	2.46	0.29980	.	0.228377	0.26079	N	0.026463	T	0.36386	0.0965	L	0.56769	1.78	0.26945	N	0.96617	P;B;B	0.35982	0.531;0.244;0.244	B;B;B	0.29785	0.107;0.05;0.05	T	0.41822	-0.9487	10	0.87932	D	0	-21.8679	5.8373	0.18615	0.0:0.8489:0.0:0.1511	.	18;18;18	Q8N594-2;A6NI36;Q8N594	.;.;MPND_HUMAN	T	18	ENSP00000262966:P18T;ENSP00000353015:P18T	ENSP00000262966:P18T	P	+	1	0	MPND	4294749	0.575000	0.26692	0.970000	0.41538	0.979000	0.70002	0.457000	0.21875	1.493000	0.48517	0.455000	0.32223	CCG	.	.	.	none		0.776	MPND-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458292.1	NM_032868	
SLC5A5	6528	hgsc.bcm.edu	37	19	17986910	17986910	+	Silent	SNP	C	C	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr19:17986910C>A	ENST00000222248.3	+	5	1040	c.693C>A	c.(691-693)ctC>ctA	p.L231L		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	231					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GGATCAACCTCATGGAGTGAG	0.622																																					p.L231L	Melanoma(65;1008 1708 7910 46650)	Atlas-SNP	.											SLC5A5,right_upper_lobe,carcinoma,0,1	SLC5A5	67	.	0			c.C693A						PASS	.						139.0	115.0	123.0					19																	17986910		2203	4300	6503	SO:0001819	synonymous_variant	6528	exon5			CAACCTCATGGAG		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.693C>A	chr19.hg19:g.17986910C>A		41.0	0.0	.		48.0	27.0	.	NM_000453	O43702|Q2M335|Q9NYB6	Silent	SNP	ENST00000222248.3	hg19	CCDS12368.1																																																																																			.	.	.	none		0.622	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
RAB3A	5864	hgsc.bcm.edu	37	19	18309591	18309591	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr19:18309591A>C	ENST00000222256.4	-	4	594	c.416T>G	c.(415-417)aTg>aGg	p.M139R	RAB3A_ENST00000464076.3_Missense_Mutation_p.M44R	NM_002866.4	NP_002857.1	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family	139					axonogenesis (GO:0007409)|constitutive secretory pathway (GO:0045054)|glutamate secretion (GO:0014047)|GTP catabolic process (GO:0006184)|lung development (GO:0030324)|maintenance of presynaptic active zone structure (GO:0048790)|mitochondrion organization (GO:0007005)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|positive regulation of exocytosis (GO:0045921)|post-embryonic development (GO:0009791)|protein transport (GO:0015031)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|respiratory system process (GO:0003016)|response to electrical stimulus (GO:0051602)|sensory perception of touch (GO:0050975)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle recycling (GO:0036465)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			NS(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	8						CTCATCCTCCATGTCACACTT	0.577																																					p.M139R		Atlas-SNP	.											.	RAB3A	23	.	0			c.T416G						PASS	.						148.0	113.0	125.0					19																	18309591		2203	4300	6503	SO:0001583	missense	5864	exon4			TCCTCCATGTCAC		CCDS12372.1	19p13.2	2008-07-17			ENSG00000105649	ENSG00000105649		"""RAB, member RAS oncogene"""	9777	protein-coding gene	gene with protein product	"""RAS-associated protein RAB3A"""	179490				2687157, 7532276	Standard	NM_002866		Approved		uc002nie.2	P20336	OTTHUMG00000137378	ENST00000222256.4:c.416T>G	chr19.hg19:g.18309591A>C	ENSP00000222256:p.Met139Arg	51.0	0.0	.		40.0	22.0	.	NM_002866	A8K0J4|Q9NYE1	Missense_Mutation	SNP	ENST00000222256.4	hg19	CCDS12372.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.812370	0.50527	.	.	ENSG00000105649	ENST00000222256	T	0.79454	-1.27	5.24	4.23	0.50019	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.67599	0.2910	L	0.38838	1.175	0.80722	D	1	B	0.09022	0.002	B	0.15484	0.013	T	0.63134	-0.6705	10	0.72032	D	0.01	-41.6067	9.0893	0.36601	0.9116:0.0:0.0884:0.0	.	139	P20336	RAB3A_HUMAN	R	139	ENSP00000222256:M139R	ENSP00000222256:M139R	M	-	2	0	RAB3A	18170591	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.115000	0.94336	0.831000	0.34780	0.459000	0.35465	ATG	.	.	.	none		0.577	RAB3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268056.2	NM_002866	
ZNF726	730087	hgsc.bcm.edu	37	19	24115870	24115870	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr19:24115870T>G	ENST00000594466.1	+	4	1057	c.952T>G	c.(952-954)Tgt>Ggt	p.C318G	ZNF726_ENST00000322487.7_Missense_Mutation_p.C318G|CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000575986.1_Intron|ZNF726_ENST00000334589.5_Intron	NM_001244038.1	NP_001230967.1	A6NNF4	ZN726_HUMAN	zinc finger protein 726	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ATGTGAAGAATGTGGCAAAGC	0.428																																					p.C318G		Atlas-SNP	.											.	.	.	.	0			c.T952G						PASS	.																																			SO:0001583	missense	730087	exon4			GAAGAATGTGGCA	DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000594466.1:c.952T>G	chr19.hg19:g.24115870T>G	ENSP00000471516:p.Cys318Gly	20.0	0.0	.		22.0	7.0	.	NM_001244038	M0R0X8|Q86Y87	Missense_Mutation	SNP	ENST00000594466.1	hg19	CCDS59372.1	.	.	.	.	.	.	.	.	.	.	t	9.720	1.159534	0.21454	.	.	ENSG00000213967	ENST00000322487	D	0.85861	-2.04	0.814	0.814	0.18756	.	.	.	.	.	T	0.82222	0.4990	.	.	.	0.27356	N	0.956095	.	.	.	.	.	.	T	0.73978	-0.3812	6	0.87932	D	0	.	5.4337	0.16469	0.0:0.0:0.0:1.0	.	.	.	.	G	318	ENSP00000317125:C318G	ENSP00000317125:C318G	C	+	1	0	ZNF726	23907710	1.000000	0.71417	0.421000	0.26609	0.423000	0.31445	5.455000	0.66658	0.158000	0.19367	0.156000	0.16432	TGT	.	.	.	none		0.428	ZNF726-005	PUTATIVE	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466443.1	XM_001715134	
RSPH6A	81492	hgsc.bcm.edu	37	19	46308112	46308112	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr19:46308112T>G	ENST00000221538.3	-	3	1193	c.1051A>C	c.(1051-1053)Atc>Ctc	p.I351L	RSPH6A_ENST00000597055.1_Missense_Mutation_p.I351L|RSPH6A_ENST00000600188.1_Missense_Mutation_p.I87L	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	351						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						CTGCGTTTGATTCCCAGGATC	0.612																																					p.I351L		Atlas-SNP	.											.	RSPH6A	70	.	0			c.A1051C						PASS	.						79.0	63.0	69.0					19																	46308112		2203	4300	6503	SO:0001583	missense	81492	exon3			GTTTGATTCCCAG	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1051A>C	chr19.hg19:g.46308112T>G	ENSP00000221538:p.Ile351Leu	53.0	0.0	.		44.0	16.0	.	NM_030785	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	ENST00000221538.3	hg19	CCDS12675.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.539158	0.00942	.	.	ENSG00000104941	ENST00000221538	T	0.15718	2.4	4.08	0.585	0.17428	.	0.639188	0.14459	N	0.318311	T	0.03871	0.0109	N	0.00980	-1.08	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43458	-0.9390	10	0.02654	T	1	-1.7801	7.385	0.26878	0.0:0.1517:0.3433:0.505	.	351	Q9H0K4	RSH6A_HUMAN	L	351	ENSP00000221538:I351L	ENSP00000221538:I351L	I	-	1	0	RSPH6A	50999952	0.348000	0.24861	0.144000	0.22314	0.492000	0.33523	1.902000	0.39848	0.227000	0.20999	-0.666000	0.03841	ATC	.	.	.	none		0.612	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		
ZNF470	388566	hgsc.bcm.edu	37	19	57088479	57088479	+	Silent	SNP	T	T	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr19:57088479T>C	ENST00000330619.8	+	6	1368	c.682T>C	c.(682-684)Tta>Cta	p.L228L	ZNF470_ENST00000391709.3_Silent_p.L228L|ZNF470_ENST00000601902.1_Intron	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		AAAGAAACTTTTAAAATGTAA	0.318																																					p.L228L		Atlas-SNP	.											.	ZNF470	103	.	0			c.T682C						PASS	.						41.0	43.0	42.0					19																	57088479		2203	4298	6501	SO:0001819	synonymous_variant	388566	exon6			AAACTTTTAAAAT	AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.682T>C	chr19.hg19:g.57088479T>C		116.0	0.0	.		92.0	39.0	.	NM_001001668	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Silent	SNP	ENST00000330619.8	hg19	CCDS33122.1																																																																																			.	.	.	none		0.318	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459707.2	NM_001001668	
CENPB	1059	hgsc.bcm.edu	37	20	3766512	3766512	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr20:3766512G>T	ENST00000379751.4	-	1	825	c.619C>A	c.(619-621)Cag>Aag	p.Q207K	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	207					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						CCCGCGGCCTGGTCGGGCAGG	0.711																																					p.Q207K		Atlas-SNP	.											.	CENPB	24	.	0			c.C619A						PASS	.						38.0	42.0	41.0					20																	3766512		2053	3965	6018	SO:0001583	missense	1059	exon1			CGGCCTGGTCGGG	X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.619C>A	chr20.hg19:g.3766512G>T	ENSP00000369075:p.Gln207Lys	83.0	0.0	.		109.0	64.0	.	NM_001810	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	hg19	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	g	2.123	-0.400953	0.04865	.	.	ENSG00000125817	ENST00000379751	T	0.41065	1.01	4.04	3.06	0.35304	.	0.329002	0.17525	U	0.171098	T	0.18635	0.0447	N	0.05230	-0.09	0.29031	N	0.885727	B	0.20052	0.041	B	0.22880	0.042	T	0.25745	-1.0123	10	0.02654	T	1	-13.7175	10.5484	0.45072	0.0:0.0:0.8047:0.1952	.	207	P07199	CENPB_HUMAN	K	207	ENSP00000369075:Q207K	ENSP00000369075:Q207K	Q	-	1	0	CENPB	3714512	1.000000	0.71417	0.996000	0.52242	0.238000	0.25445	2.542000	0.45744	0.647000	0.30713	0.457000	0.33378	CAG	.	.	.	none		0.711	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2	NM_001810	
RPN2	6185	hgsc.bcm.edu	37	20	35864988	35864988	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr20:35864988C>A	ENST00000237530.6	+	16	2070	c.1759C>A	c.(1759-1761)Ctg>Atg	p.L587M	RPN2_ENST00000373622.5_Missense_Mutation_p.L555M|RPN2_ENST00000470352.1_3'UTR	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	587					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				TGCAGCTATGCTGGGACTCAT	0.463																																					p.L587M		Atlas-SNP	.											.	RPN2	45	.	0			c.C1759A						PASS	.						127.0	99.0	108.0					20																	35864988		2203	4300	6503	SO:0001583	missense	6185	exon16			GCTATGCTGGGAC	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.1759C>A	chr20.hg19:g.35864988C>A	ENSP00000237530:p.Leu587Met	42.0	0.0	.		35.0	11.0	.	NM_002951	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Missense_Mutation	SNP	ENST00000237530.6	hg19	CCDS13291.1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482967	0.63962	.	.	ENSG00000118705	ENST00000237530;ENST00000373622;ENST00000397161;ENST00000437329	T;T;T	0.61980	0.06;0.06;0.06	4.98	4.98	0.66077	.	0.080968	0.50627	D	0.000116	T	0.77850	0.4192	M	0.73962	2.25	0.51767	D	0.999932	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.987	T	0.76966	-0.2763	10	0.38643	T	0.18	-7.2993	15.8004	0.78450	0.0:1.0:0.0:0.0	.	555;587	Q5JYR6;P04844	.;RPN2_HUMAN	M	587;555;94;94	ENSP00000237530:L587M;ENSP00000362724:L555M;ENSP00000409580:L94M	ENSP00000237530:L587M	L	+	1	2	RPN2	35298402	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.846000	0.48262	2.584000	0.87258	0.561000	0.74099	CTG	.	.	.	none		0.463	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079076.2	NM_002951	
MORC3	23515	hgsc.bcm.edu	37	21	37741433	37741433	+	Silent	SNP	A	A	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr21:37741433A>C	ENST00000400485.1	+	15	1843	c.1767A>C	c.(1765-1767)gcA>gcC	p.A589A	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	589					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						CCAAACCTGCAGTAGATCATG	0.413																																					p.A589A		Atlas-SNP	.											.	MORC3	78	.	0			c.A1767C						PASS	.						205.0	197.0	199.0					21																	37741433		2108	4220	6328	SO:0001819	synonymous_variant	23515	exon15			ACCTGCAGTAGAT	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1767A>C	chr21.hg19:g.37741433A>C		130.0	0.0	.		126.0	62.0	.	NM_015358	A8KA92|Q9UEZ2	Silent	SNP	ENST00000400485.1	hg19	CCDS42924.1																																																																																			.	.	.	none		0.413	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
COMT	1312	hgsc.bcm.edu	37	22	19956092	19956092	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr22:19956092C>G	ENST00000361682.6	+	6	1031	c.649C>G	c.(649-651)Ctg>Gtg	p.L217V	COMT_ENST00000407537.1_Missense_Mutation_p.L167V|COMT_ENST00000449653.1_Missense_Mutation_p.L167V|COMT_ENST00000406520.3_Missense_Mutation_p.L217V|COMT_ENST00000403710.1_Missense_Mutation_p.L217V	NM_000754.3	NP_000745.1	P21964	COMT_HUMAN	catechol-O-methyltransferase	217					cellular response to phosphate starvation (GO:0016036)|dopamine catabolic process (GO:0042420)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|learning (GO:0007612)|methylation (GO:0032259)|multicellular organismal reproductive process (GO:0048609)|negative regulation of dopamine metabolic process (GO:0045963)|negative regulation of smooth muscle cell proliferation (GO:0048662)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|positive regulation of homocysteine metabolic process (GO:0050668)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	catechol O-methyltransferase activity (GO:0016206)|magnesium ion binding (GO:0000287)|O-methyltransferase activity (GO:0008171)			kidney(1)|lung(1)|ovary(1)|prostate(1)|stomach(1)	5	Colorectal(54;0.0993)				Conjugated Estrogens(DB00286)|Diethylstilbestrol(DB00255)|Dobutamine(DB00841)|Dopamine(DB00988)|Entacapone(DB00494)|Methyldopa(DB00968)|Micafungin(DB01141)|S-Adenosylmethionine(DB00118)|Testosterone Propionate(DB01420)|Tolcapone(DB00323)	GACAGTGCTACTGGCTGACAA	0.607																																					p.L217V		Atlas-SNP	.											.	COMT	10	.	0			c.C649G						PASS	.						85.0	66.0	73.0					22																	19956092		2203	4300	6503	SO:0001583	missense	1312	exon6			GTGCTACTGGCTG		CCDS13770.1, CCDS46663.1	22q11.21	2012-10-02			ENSG00000093010	ENSG00000093010	2.1.1.6		2228	protein-coding gene	gene with protein product		116790				1572656	Standard	NM_000754		Approved		uc002zqu.3	P21964	OTTHUMG00000150529	ENST00000361682.6:c.649C>G	chr22.hg19:g.19956092C>G	ENSP00000354511:p.Leu217Val	40.0	0.0	.		59.0	21.0	.	NM_000754	A8MPV9|Q6IB07|Q6ICE6|Q9BWC7	Missense_Mutation	SNP	ENST00000361682.6	hg19	CCDS13770.1	.	.	.	.	.	.	.	.	.	.	C	7.677	0.688266	0.14973	.	.	ENSG00000093010	ENST00000361682;ENST00000403710;ENST00000407537;ENST00000412786;ENST00000406520;ENST00000449653	T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	5.2	0.507	0.16967	.	0.078098	0.52532	N	0.000062	T	0.48589	0.1508	N	0.25380	0.74	0.48185	D	0.9996	B	0.33345	0.409	B	0.38225	0.268	T	0.14200	-1.0481	9	.	.	.	-4.4637	5.9261	0.19112	0.0:0.5177:0.2579:0.2243	.	217	P21964	COMT_HUMAN	V	217;217;167;217;217;167	ENSP00000354511:L217V;ENSP00000385917:L217V;ENSP00000384654:L167V;ENSP00000403958:L217V;ENSP00000385150:L217V;ENSP00000416778:L167V	.	L	+	1	2	COMT	18336092	0.931000	0.31567	0.061000	0.19648	0.053000	0.15095	0.873000	0.28052	0.009000	0.14813	0.491000	0.48974	CTG	.	.	.	none		0.607	COMT-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318936.2	NM_000754	
PPP1R3F	89801	hgsc.bcm.edu	37	X	49126754	49126754	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chrX:49126754T>A	ENST00000055335.6	+	1	438	c.422T>A	c.(421-423)cTg>cAg	p.L141Q	PPP1R3F_ENST00000495799.1_Intron|LL0XNC01-7P3.1_ENST00000602455.1_lincRNA|PPP1R3F_ENST00000438316.1_Intron|PPP1R3F_ENST00000466508.1_Intron	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	141	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					CTGGAGGCGCTGCTGCCGCCT	0.761																																					p.L141Q		Atlas-SNP	.											.	PPP1R3F	56	.	0			c.T422A						PASS	.						2.0	3.0	3.0					X																	49126754		1527	3160	4687	SO:0001583	missense	89801	exon1			AGGCGCTGCTGCC		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.422T>A	chrX.hg19:g.49126754T>A	ENSP00000055335:p.Leu141Gln	21.0	0.0	.		15.0	10.0	.	NM_033215	A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	ENST00000055335.6	hg19	CCDS35254.1	.	.	.	.	.	.	.	.	.	.	t	17.42	3.385987	0.61956	.	.	ENSG00000049769	ENST00000055335	T	0.60299	0.2	4.24	3.06	0.35304	Putative phosphatase regulatory subunit (1);	0.000000	0.30401	N	0.009707	T	0.55273	0.1910	L	0.33339	1.005	0.80722	D	1	D	0.65815	0.995	P	0.59115	0.852	T	0.57740	-0.7759	10	0.87932	D	0	-6.2371	4.6588	0.12632	0.0:0.2485:0.0:0.7515	.	141	Q6ZSY5	PPR3F_HUMAN	Q	141	ENSP00000055335:L141Q	ENSP00000055335:L141Q	L	+	2	0	PPP1R3F	49013698	0.963000	0.33076	1.000000	0.80357	0.994000	0.84299	0.866000	0.27954	1.504000	0.48704	0.419000	0.28159	CTG	.	.	.	none		0.761	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2	NM_033215	
HUWE1	10075	hgsc.bcm.edu	37	X	53619440	53619440	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chrX:53619440C>T	ENST00000342160.3	-	32	4347	c.3890G>A	c.(3889-3891)gGg>gAg	p.G1297E	HUWE1_ENST00000262854.6_Missense_Mutation_p.G1297E|HUWE1_ENST00000218328.8_Missense_Mutation_p.G1297E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1297					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TCCTCGAGACCCCTCCTTCTC	0.547																																					p.G1297E		Atlas-SNP	.											.	HUWE1	724	.	0			c.G3890A						PASS	.						244.0	192.0	210.0					X																	53619440		2203	4300	6503	SO:0001583	missense	10075	exon33			CGAGACCCCTCCT	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.3890G>A	chrX.hg19:g.53619440C>T	ENSP00000340648:p.Gly1297Glu	25.0	0.0	.		15.0	14.0	.	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430637	0.62844	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.44083	1.22;1.22;0.93	5.88	5.88	0.94601	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.38719	0.1051	L	0.33485	1.01	0.80722	D	1	B;B	0.29432	0.192;0.244	B;B	0.32211	0.142;0.097	T	0.21415	-1.0246	10	0.56958	D	0.05	.	17.8502	0.88744	0.0:1.0:0.0:0.0	.	1297;1297	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	E	1297	ENSP00000340648:G1297E;ENSP00000262854:G1297E;ENSP00000218328:G1297E	ENSP00000218328:G1297E	G	-	2	0	HUWE1	53636165	1.000000	0.71417	0.942000	0.38095	0.803000	0.45373	7.121000	0.77160	2.489000	0.83994	0.600000	0.82982	GGG	.	.	.	none		0.547	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
ATP1B4	23439	hgsc.bcm.edu	37	X	119500447	119500447	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chrX:119500447G>C	ENST00000218008.3	+	2	188	c.131G>C	c.(130-132)cGg>cCg	p.R44P	ATP1B4_ENST00000361319.3_Missense_Mutation_p.R44P|ATP1B4_ENST00000539306.1_Missense_Mutation_p.R44P	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	44	Glu-rich.				monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						GAAGAGGCTCGGGTGACGGTG	0.512																																					p.R44P		Atlas-SNP	.											.	ATP1B4	61	.	0			c.G131C						PASS	.						95.0	89.0	91.0					X																	119500447		2203	4300	6503	SO:0001583	missense	23439	exon2			AGGCTCGGGTGAC	AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.131G>C	chrX.hg19:g.119500447G>C	ENSP00000218008:p.Arg44Pro	173.0	0.0	.		145.0	115.0	.	NM_001142447	Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	hg19	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	G	5.008	0.187169	0.09547	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.09163	3.01;3.01;3.01	5.51	-9.66	0.00534	.	0.985232	0.08295	N	0.967802	T	0.05456	0.0144	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.44711	-0.9310	10	0.66056	D	0.02	-10.7869	10.5975	0.45347	0.6174:0.1732:0.2095:0.0	.	44;44;44;44	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	P	44	ENSP00000218008:R44P;ENSP00000355346:R44P;ENSP00000443334:R44P	ENSP00000218008:R44P	R	+	2	0	ATP1B4	119384475	0.022000	0.18835	0.001000	0.08648	0.175000	0.22909	-2.104000	0.01340	-2.816000	0.00345	-0.912000	0.02778	CGG	.	.	.	none		0.512	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447	
TNS1	7145	hgsc.bcm.edu	37	2	218712606	218712607	+	Frame_Shift_Ins	INS	-	-	A	rs1364641	byFrequency	TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr2:218712606_218712607insA	ENST00000171887.4	-	17	2710_2711	c.2258_2259insT	c.(2257-2259)tccfs	p.S753fs	TNS1_ENST00000480665.1_5'Flank|TNS1_ENST00000430930.1_Frame_Shift_Ins_p.S753fs|TNS1_ENST00000419504.1_Frame_Shift_Ins_p.S753fs	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	753					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGGACTGACGGGAGGATCCAGA	0.653																																					p.S753fs		Atlas-Indel,Pindel	.											.	TNS1	251	.	0			c.2259_2260insT						PASS	.																																			SO:0001589	frameshift_variant	7145	exon17			.	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.2258_2259insT	chr2.hg19:g.218712606_218712607insA	ENSP00000171887:p.Ser753fs	67.0	0.0	0		59.0	26.0	0.440678	NM_022648	Q4ZG71|Q6IPI5	Frame_Shift_Ins	INS	ENST00000171887.4	hg19	CCDS2407.1																																																																																			.	.	.	none		0.653	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
KRTAP8-1	337879	hgsc.bcm.edu	37	21	32185474	32185474	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr21:32185474delG	ENST00000329621.4	-	1	96	c.65delC	c.(64-66)ccgfs	p.P22fs		NM_175857.3	NP_787053.1	Q8IUC2	KRA81_HUMAN	keratin associated protein 8-1	22	12 X 2 AA repeats of G-[YCGS].					intermediate filament (GO:0005882)				central_nervous_system(1)|large_intestine(1)|lung(4)	6						ATATCCCAGCGGGTAGCCATA	0.597																																					p.P22fs		Atlas-Indel,Pindel	.											.	KRTAP8-1	20	.	0			c.66delG						PASS	.						83.0	71.0	75.0					21																	32185474		2203	4300	6503	SO:0001589	frameshift_variant	337879	exon1			.	AJ457064	CCDS13607.1	21q22.1	2006-03-13			ENSG00000183640	ENSG00000183640		"""Keratin associated proteins"""	18935	protein-coding gene	gene with protein product						12359730	Standard	NM_175857		Approved	KAP8.1	uc002you.3	Q8IUC2	OTTHUMG00000057771	ENST00000329621.4:c.65delC	chr21.hg19:g.32185474delG	ENSP00000332805:p.Pro22fs	96.0	0.0	0		94.0	34.0	0.361702	NM_175857	Q3LI57	Frame_Shift_Del	DEL	ENST00000329621.4	hg19	CCDS13607.1																																																																																			.	.	.	none		0.597	KRTAP8-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128223.1		
TECRL	253017	hgsc.bcm.edu	37	4	65274879	65274880	+	Frame_Shift_Ins	INS	-	-	T			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr4:65274879_65274880insT	ENST00000381210.3	-	1	300_301	c.190_191insA	c.(190-192)atafs	p.I64fs	TECRL_ENST00000507440.1_Frame_Shift_Ins_p.I64fs	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	64					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						AGCATCAAATATTTCAATCTCA	0.347																																					p.I64fs		Atlas-Indel,Pindel	.											.	TECRL	106	.	0			c.191_192insA						PASS	.																																			SO:0001589	frameshift_variant	253017	exon1			.	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.191dupA	chr4.hg19:g.65274882_65274882dupT	ENSP00000370607:p.Ile64fs	45.0	0.0	0		38.0	15.0	0.394737	NM_001010874		Frame_Shift_Ins	INS	ENST00000381210.3	hg19	CCDS33990.1																																																																																			.	.	.	none		0.347	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874	
GLUL	2752	hgsc.bcm.edu	37	1	182357774	182357774	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr1:182357774delG	ENST00000331872.6	-	2	639	c.99delC	c.(97-99)atcfs	p.I33fs	GLUL_ENST00000417584.2_Frame_Shift_Del_p.I33fs|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000339526.4_Frame_Shift_Del_p.I33fs|GLUL_ENST00000311223.5_Frame_Shift_Del_p.I33fs	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	33					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.I33I(1)		endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	CAGTACCATCGATCCAGATAT	0.537																																					p.D34fs		Atlas-Indel,Pindel	.											.	GLUL	38	.	1	Substitution - coding silent(1)	large_intestine(1)	c.100delG						PASS	.						164.0	146.0	152.0					1																	182357774		2203	4300	6503	SO:0001589	frameshift_variant	2752	exon2			.	AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.99delC	chr1.hg19:g.182357774delG	ENSP00000356537:p.Ile33fs	91.0	0.0	0		100.0	34.0	0.34	NM_001033056	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Frame_Shift_Del	DEL	ENST00000331872.6	hg19	CCDS1344.1																																																																																			.	.	.	none		0.537	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091043.1	NM_002065	
KDM6A	7403	hgsc.bcm.edu	37	X	44950075	44950075	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chrX:44950075delA	ENST00000377967.4	+	26	3885	c.3844delA	c.(3844-3846)aagfs	p.K1282fs	KDM6A_ENST00000543216.1_Frame_Shift_Del_p.K1203fs|KDM6A_ENST00000536777.1_Frame_Shift_Del_p.K1237fs|KDM6A_ENST00000382899.4_Frame_Shift_Del_p.K1289fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1282					canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						ACGAAATATCAAGGTCTCAGA	0.363			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.I1281fs	Colon(129;1273 1667 15230 27352 52914)	Atlas-Indel,Pindel	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A	274	.	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)	c.3843delC						PASS	.						179.0	155.0	163.0					X																	44950075		2203	4300	6503	SO:0001589	frameshift_variant	7403	exon26			.	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3844delA	chrX.hg19:g.44950075delA	ENSP00000367203:p.Lys1282fs	89.0	0.0	0		95.0	67.0	0.705263	NM_021140	Q52LL9|Q5JVQ7	Frame_Shift_Del	DEL	ENST00000377967.4	hg19	CCDS14265.1																																																																																			.	.	.	none		0.363	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
BCL9	607	hgsc.bcm.edu	37	1	147086326	147086331	+	In_Frame_Del	DEL	CCATGG	CCATGG	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	CCATGG	CCATGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr1:147086326_147086331delCCATGG	ENST00000234739.3	+	6	1211_1216	c.471_476delCCATGG	c.(469-477)tcccatggc>tcc	p.HG158del	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	158					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CTACCCCCTCCCATGGCCAAACTACT	0.51			T	"""IGH@, IGL@"""	B-ALL																																p.157_159del		Atlas-Indel,Pindel	.		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	BCL9	150	.	0			c.470_475del						PASS	.																																			SO:0001651	inframe_deletion	607	exon6			.	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.471_476delCCATGG	chr1.hg19:g.147086326_147086331delCCATGG	ENSP00000234739:p.His158_Gly159del	128.0	0.0	0		81.0	27.0	0.333333	NM_004326	Q5T489	In_Frame_Del	DEL	ENST00000234739.3	hg19	CCDS30833.1																																																																																			.	.	.	none		0.510	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
EPHA5	2044	hgsc.bcm.edu	37	4	66230803	66230803	+	Frame_Shift_Del	DEL	C	C	-	rs374393697		TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr4:66230803delC	ENST00000273854.3	-	12	2768	c.2168delG	c.(2167-2169)ggtfs	p.G723fs	EPHA5_ENST00000354839.4_Frame_Shift_Del_p.G701fs|EPHA5_ENST00000432638.2_Frame_Shift_Del_p.G560fs|EPHA5_ENST00000511294.1_Frame_Shift_Del_p.G724fs	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	723	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ACTTGCTTCACCTAGGAAATC	0.393										TSP Lung(17;0.13)																											p.G723fs		Atlas-INDEL	.											.	EPHA5	315	.	0			c.2169delT						PASS	.						235.0	224.0	228.0					4																	66230803		2203	4300	6503	SO:0001589	frameshift_variant	2044	exon12			.	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2168delG	chr4.hg19:g.66230803delC	ENSP00000273854:p.Gly723fs	83.0	0.0	0		80.0	24.0	0.3	NM_004439	Q7Z3F2	Frame_Shift_Del	DEL	ENST00000273854.3	hg19	CCDS3513.1																																																																																			.	.	.	none		0.393	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
GPSM2	29899	hgsc.bcm.edu	37	1	109440639	109440645	+	Frame_Shift_Del	DEL	GTTTTGG	GTTTTGG	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	GTTTTGG	GTTTTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr1:109440639_109440645delGTTTTGG	ENST00000406462.2	+	6	1246_1252	c.473_479delGTTTTGG	c.(472-480)agttttggtfs	p.SFG158fs	AKNAD1_ENST00000357393.4_Intron|GPSM2_ENST00000264126.3_Frame_Shift_Del_p.SFG158fs			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	158					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		AAAGGGAAAAGTTTTGGTTGCCCTGGT	0.449																																					p.158_160del		Atlas-Indel,Pindel	.											.	GPSM2	56	.	0			c.472_478del						PASS	.																																			SO:0001589	frameshift_variant	29899	exon5			.	AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.473_479delGTTTTGG	chr1.hg19:g.109440639_109440645delGTTTTGG	ENSP00000385510:p.Ser158fs	113.0	0.0	0		58.0	16.0	0.275862	NM_013296	Q5T1N8|Q6IBL7|Q8N0Z5	Frame_Shift_Del	DEL	ENST00000406462.2	hg19	CCDS792.2																																																																																			.	.	.	none		0.449	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032400.3	NM_013296	
SLC38A8	146167	hgsc.bcm.edu	37	16	84050195	84050197	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	AAC	AAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr16:84050195_84050197delAAC	ENST00000299709.3	-	8	1088_1090	c.1089_1091delGTT	c.(1087-1092)ctgttt>ctt	p.F364del		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	364					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						GTCAGGCATAAACAGCGCCATGG	0.631																																					p.364_364del		Atlas-Indel,Pindel	.											.	SLC38A8	60	.	0			c.1090_1092del						PASS	.																																			SO:0001651	inframe_deletion	146167	exon8			.		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.1089_1091delGTT	chr16.hg19:g.84050195_84050197delAAC	ENSP00000299709:p.Phe364del	69.0	0.0	0		66.0	28.0	0.424242	NM_001080442		In_Frame_Del	DEL	ENST00000299709.3	hg19	CCDS32495.1																																																																																			.	.	.	none		0.631	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432623.1	NM_001080442	
ZNF470	388566	hgsc.bcm.edu	37	19	57088481	57088481	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr19:57088481delA	ENST00000330619.8	+	6	1370	c.684delA	c.(682-684)ttafs	p.L228fs	ZNF470_ENST00000391709.3_Frame_Shift_Del_p.L228fs|ZNF470_ENST00000601902.1_Intron	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		AGAAACTTTTAAAATGTAATG	0.318																																					p.L228X		Atlas-Indel,Pindel	.											.	ZNF470	103	.	0			c.683delT						PASS	.						41.0	43.0	42.0					19																	57088481		2202	4298	6500	SO:0001589	frameshift_variant	388566	exon6			.	AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.684delA	chr19.hg19:g.57088481delA	ENSP00000333223:p.Leu228fs	114.0	0.0	0		91.0	37.0	0.406593	NM_001001668	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Frame_Shift_Del	DEL	ENST00000330619.8	hg19	CCDS33122.1																																																																																			.	.	.	none		0.318	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459707.2	NM_001001668	
TFRC	7037	hgsc.bcm.edu	37	3	195800989	195800990	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr3:195800989_195800990insAT	ENST00000360110.4	-	4	414_415	c.245_246insAT	c.(244-246)atgfs	p.M82fs	TFRC_ENST00000420415.1_Start_Codon_Ins|RNU7-18P_ENST00000516365.1_RNA|TFRC_ENST00000540528.1_Stop_Codon_Ins|TFRC_ENST00000535031.1_Intron|TFRC_ENST00000392396.3_Frame_Shift_Ins_p.M82fs	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	82					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	AGTAGCCAATCATAAATCCTAA	0.421			T	BCL6	NHL																																p.M82fs		Atlas-Indel,Pindel	.		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	.	TFRC	54	.	0			c.246_247insAT						PASS	.																																			SO:0001589	frameshift_variant	7037	exon4			.	X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.244_245dupAT	chr3.hg19:g.195800990_195800991dupAT	ENSP00000353224:p.Met82fs	83.0	0.0	0		73.0	20.0	0.273973	NM_001128148	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Frame_Shift_Ins	INS	ENST00000360110.4	hg19	CCDS3312.1																																																																																			.	.	.	none		0.421	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341346.1		
FAM184A	79632	hgsc.bcm.edu	37	6	119345322	119345322	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr6:119345322delA	ENST00000338891.7	-	2	1259	c.816delT	c.(814-816)tttfs	p.F272fs	FAM184A_ENST00000368475.4_Frame_Shift_Del_p.F152fs|FAM184A_ENST00000352896.5_Frame_Shift_Del_p.F152fs|FAM184A_ENST00000522284.1_Frame_Shift_Del_p.F152fs|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000521531.1_Frame_Shift_Del_p.F272fs	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	272						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TTTCTGCTGTAAAAAGCTGTG	0.358																																					p.T273fs		Atlas-Indel,Pindel	.											.	FAM184A	109	.	0			c.817delA						PASS	.						85.0	79.0	81.0					6																	119345322		1824	4081	5905	SO:0001589	frameshift_variant	79632	exon2			.	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.816delT	chr6.hg19:g.119345322delA	ENSP00000342604:p.Phe272fs	70.0	0.0	0		87.0	30.0	0.344828	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Frame_Shift_Del	DEL	ENST00000338891.7	hg19	CCDS43499.1																																																																																			.	.	.	none		0.358	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
TGFB1I1	7041	hgsc.bcm.edu	37	16	31486006	31486014	+	In_Frame_Del	DEL	CCTCAGCCG	CCTCAGCCG	-	rs199879867		TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	CCTCAGCCG	CCTCAGCCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr16:31486006_31486014delCCTCAGCCG	ENST00000394863.3	+	7	772_780	c.642_650delCCTCAGCCG	c.(640-651)gacctcagccgc>gac	p.LSR215del	TGFB1I1_ENST00000567607.1_In_Frame_Del_p.LSR198del|TGFB1I1_ENST00000394858.2_In_Frame_Del_p.LSR198del|TGFB1I1_ENST00000361773.3_In_Frame_Del_p.LSR198del	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	215	Interaction with PTK2B/PYK2.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						TGCAGTCCGACCTCAGCCGCCGGGGTGTT	0.622																																					p.214_217del		Atlas-Indel,Pindel	.											.	TGFB1I1	60	.	0			c.641_649del						PASS	.																																			SO:0001651	inframe_deletion	7041	exon7			.	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.642_650delCCTCAGCCG	chr16.hg19:g.31486006_31486014delCCTCAGCCG	ENSP00000378332:p.Leu215_Arg217del	40.0	0.0	0		65.0	27.0	0.415385	NM_001042454	B2R8D5|Q9BPW3|Q9Y2V5	In_Frame_Del	DEL	ENST00000394863.3	hg19	CCDS42156.1																																																																																			.	.	.	none		0.622	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3		
DST	667	hgsc.bcm.edu	37	6	56564500	56564500	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr6:56564500delT	ENST00000361203.3	-	5	372	c.365delA	c.(364-366)aatfs	p.N122fs	DST_ENST00000370754.5_Frame_Shift_Del_p.N300fs|DST_ENST00000370769.4_Frame_Shift_Del_p.N122fs|DST_ENST00000421834.2_Frame_Shift_Del_p.N122fs|DST_ENST00000312431.6_Frame_Shift_Del_p.N122fs|DST_ENST00000370788.2_Frame_Shift_Del_p.N122fs			Q03001	DYST_HUMAN	dystonin	122	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CAATTTGGGATTTCCATCTGT	0.328																																					.		Atlas-Indel,Pindel	.											.	.	.	.	0			.						PASS	.						74.0	73.0	73.0					6																	56564500		1800	4051	5851	SO:0001589	frameshift_variant	100873774	.			.	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.365delA	chr6.hg19:g.56564500delT	ENSP00000354508:p.Asn122fs	48.0	0.0	0		30.0	12.0	0.4	.	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	RNA	DEL	ENST00000361203.3	hg19																																																																																				.	.	.	none		0.328	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
ZNF575	284346	hgsc.bcm.edu	37	19	44039436	44039442	+	Frame_Shift_Del	DEL	CGCACAG	CGCACAG	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	CGCACAG	CGCACAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr19:44039436_44039442delCGCACAG	ENST00000314228.5	+	4	847_853	c.335_341delCGCACAG	c.(334-342)acgcacagcfs	p.THS112fs	ZNF575_ENST00000458714.2_Frame_Shift_Del_p.THS211fs|ZNF575_ENST00000601282.1_Frame_Shift_Del_p.THS112fs	NM_174945.2	NP_777605.1	Q86XF7	ZN575_HUMAN	zinc finger protein 575	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	4		Prostate(69;0.0199)				CACCGCCTCACGCACAGCGGCGCCCGC	0.72																																					p.112_114del		Atlas-Indel,Pindel	.											.	ZNF575	14	.	0			c.334_340del						PASS	.																																			SO:0001589	frameshift_variant	284346	exon4			.	BC043611	CCDS12623.1	19q13.31	2013-09-20			ENSG00000176472	ENSG00000176472		"""Zinc fingers, C2H2-type"""	27606	protein-coding gene	gene with protein product							Standard	NM_174945		Approved	FLJ32567	uc002ows.3	Q86XF7	OTTHUMG00000182698	ENST00000314228.5:c.335_341delCGCACAG	chr19.hg19:g.44039436_44039442delCGCACAG	ENSP00000315870:p.Thr112fs	110.0	0.0	0		81.0	22.0	0.271605	NM_174945	B4DX54	Frame_Shift_Del	DEL	ENST00000314228.5	hg19	CCDS12623.1																																																																																			.	.	.	none		0.720	ZNF575-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463191.1	NM_174945	
EPHA5	2044	hgsc.bcm.edu	37	4	66230804	66230806	+	In_Frame_Del	DEL	CTA	CTA	-			TCGA-5P-A9K0-01A-11D-A42J-10	TCGA-5P-A9K0-10A-01D-A42M-10	CTA	CTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a26d518a-50bf-4b8e-98cb-308952c4b675	35135c15-ac82-41b6-ad60-f04f92bf961f	g.chr4:66230804_66230806delCTA	ENST00000273854.3	-	12	2765_2767	c.2165_2167delTAG	c.(2164-2169)ctaggt>cgt	p.722_723LG>R	EPHA5_ENST00000354839.4_In_Frame_Del_p.700_701LG>R|EPHA5_ENST00000432638.2_In_Frame_Del_p.559_560LG>R|EPHA5_ENST00000511294.1_In_Frame_Del_p.723_724LG>R	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	722	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						CTTGCTTCACCTAGGAAATCTCT	0.389										TSP Lung(17;0.13)																											p.722_723del		Pindel	.											.	EPHA5	315	.	0			c.2166_2168del						PASS	.																																			SO:0001651	inframe_deletion	2044	exon12			.	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2165_2167delTAG	chr4.hg19:g.66230804_66230806delCTA	ENSP00000273854:p.Leu722_Gly723delinsArg	83.0	0.0	.		81.0	21.0	0.259	NM_004439	Q7Z3F2	In_Frame_Del	DEL	ENST00000273854.3	hg19	CCDS3513.1																																																																																			.	.	.	none		0.389	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
