#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF14	8764	hgsc.bcm.edu	37	1	2491291	2491291	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr1:2491291T>C	ENST00000355716.4	+	4	633	c.334T>C	c.(334-336)Tcc>Ccc	p.S112P	RP3-395M20.8_ENST00000416860.2_RNA|RP3-395M20.8_ENST00000452793.1_RNA|TNFRSF14_ENST00000409119.1_Missense_Mutation_p.S112P	NM_003820.2	NP_003811.2	Q92956	TNR14_HUMAN	tumor necrosis factor receptor superfamily, member 14	112					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell migration (GO:2000406)|T cell costimulation (GO:0031295)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			kidney(1)	1	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;1.11e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		CCGGAACTGCTCCAGGACAGA	0.687			"""Mis, N, F"""		follicular lymphoma																																p.S112P		Atlas-SNP	.		Rec	yes		1	1p36.32	8764	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""		L	.	TNFRSF14	89	.	0			c.T334C						PASS	.						32.0	34.0	33.0					1																	2491291		2198	4295	6493	SO:0001583	missense	8764	exon4			AACTGCTCCAGGA	U70321	CCDS44046.1	1p36.32	2012-02-27	2011-08-11		ENSG00000157873	ENSG00000157873		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11912	protein-coding gene	gene with protein product	"""herpesvirus entry mediator"""	602746	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""			8898196, 9162061	Standard	XM_006711018		Approved	HVEM, ATAR, TR2, LIGHTR, HVEA, CD270	uc001ajt.1	Q92956	OTTHUMG00000000792	ENST00000355716.4:c.334T>C	chr1.hg19:g.2491291T>C	ENSP00000347948:p.Ser112Pro	63.0	0.0	.		119.0	52.0	.	NM_003820	B3KW30|B9DI89|Q6IB95|Q8N634|Q8WXR1|Q96J31|Q9UM65	Missense_Mutation	SNP	ENST00000355716.4	hg19	CCDS44046.1	.	.	.	.	.	.	.	.	.	.	T	11.61	1.689551	0.29962	.	.	ENSG00000157873	ENST00000426449;ENST00000434817;ENST00000435221;ENST00000451778;ENST00000409119;ENST00000355716	D;D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78;-2.78	3.04	1.9	0.25705	TNFR/CD27/30/40/95 cysteine-rich region (4);	.	.	.	.	D	0.93556	0.7943	M	0.77486	2.375	0.25545	N	0.987142	D	0.69078	0.997	D	0.79784	0.993	D	0.84151	0.0423	9	0.72032	D	0.01	-17.456	4.8629	0.13592	0.0:0.1455:0.0:0.8545	.	112	Q92956	TNR14_HUMAN	P	112	ENSP00000411854:S112P;ENSP00000415254:S112P;ENSP00000399292:S112P;ENSP00000399533:S112P;ENSP00000386859:S112P;ENSP00000347948:S112P	ENSP00000347948:S112P	S	+	1	0	TNFRSF14	2483127	0.821000	0.29204	0.619000	0.29118	0.023000	0.10783	0.787000	0.26858	0.572000	0.29383	0.379000	0.24179	TCC	.	.	.	none		0.687	TNFRSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002088.1		
BAI2	576	hgsc.bcm.edu	37	1	32198684	32198684	+	Silent	SNP	G	G	A	rs140842802		TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr1:32198684G>A	ENST00000373658.3	-	26	3854	c.3513C>T	c.(3511-3513)gcC>gcT	p.A1171A	BAI2_ENST00000373655.2_Silent_p.A1171A|BAI2_ENST00000398556.3_Silent_p.A1086A|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000398542.1_Silent_p.A1071A|BAI2_ENST00000527361.1_Silent_p.A1138A|BAI2_ENST00000398547.1_Silent_p.A1104A|BAI2_ENST00000398538.1_Silent_p.A1159A|BAI2_ENST00000257070.4_Silent_p.A1138A|BAI2_ENST00000440175.2_Silent_p.A780A	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1171					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TAGCCAGGACGGCAGACATCC	0.627																																					p.A1171A		Atlas-SNP	.											.	BAI2	128	.	0			c.C3513T						PASS	.	G		1,4393		0,1,2196	57.0	42.0	47.0		3513	-4.8	0.9	1	dbSNP_134	47	0,8588		0,0,4294	no	coding-synonymous	BAI2	NM_001703.2		0,1,6490	AA,AG,GG		0.0,0.0228,0.0077		1171/1586	32198684	1,12981	2197	4294	6491	SO:0001819	synonymous_variant	576	exon26			CAGGACGGCAGAC	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.3513C>T	chr1.hg19:g.32198684G>A		101.0	0.0	.		146.0	12.0	.	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Silent	SNP	ENST00000373658.3	hg19	CCDS346.2																																																																																			.	G|1.000;A|0.000	0.000	weak		0.627	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
THRAP3	9967	hgsc.bcm.edu	37	1	36751972	36751972	+	Silent	SNP	T	T	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr1:36751972T>G	ENST00000354618.5	+	4	365	c.141T>G	c.(139-141)tcT>tcG	p.S47S	THRAP3_ENST00000469141.2_Silent_p.S47S	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	47	Arg-rich.|Required for mRNA splicing activation.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ATTCCAGTTCTAGGTCTCGTT	0.388			T	USP6	aneurysmal bone cysts																																p.S47S	Pancreas(129;785 1795 20938 23278 32581)	Atlas-SNP	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	THRAP3	93	.	0			c.T141G						PASS	.						77.0	80.0	79.0					1																	36751972		2202	4300	6502	SO:0001819	synonymous_variant	9967	exon4			CAGTTCTAGGTCT	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.141T>G	chr1.hg19:g.36751972T>G		55.0	0.0	.		62.0	26.0	.	NM_005119	D3DPS5|Q5VTK6	Silent	SNP	ENST00000354618.5	hg19	CCDS405.1																																																																																			.	.	.	none		0.388	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
MTF1	4520	hgsc.bcm.edu	37	1	38288019	38288019	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr1:38288019G>A	ENST00000373036.4	-	9	1681	c.1541C>T	c.(1540-1542)tCa>tTa	p.S514L		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	514					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TGCCACAGCTGATGCCACTGC	0.567																																					p.S514L		Atlas-SNP	.											.	MTF1	67	.	0			c.C1541T						PASS	.						44.0	42.0	42.0					1																	38288019		2203	4300	6503	SO:0001583	missense	4520	exon9			ACAGCTGATGCCA	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.1541C>T	chr1.hg19:g.38288019G>A	ENSP00000362127:p.Ser514Leu	85.0	0.0	.		104.0	49.0	.	NM_005955	B2RAK6|Q96CB1	Missense_Mutation	SNP	ENST00000373036.4	hg19	CCDS30676.1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743385	0.30865	.	.	ENSG00000188786	ENST00000373036	T	0.38722	1.12	4.65	4.65	0.58169	.	0.806293	0.10166	N	0.707756	T	0.34454	0.0898	L	0.29908	0.895	0.09310	N	1	B	0.13594	0.008	B	0.16722	0.016	T	0.07712	-1.0758	10	0.37606	T	0.19	.	13.3481	0.60587	0.0:0.0:1.0:0.0	.	514	Q14872	MTF1_HUMAN	L	514	ENSP00000362127:S514L	ENSP00000362127:S514L	S	-	2	0	MTF1	38060606	0.049000	0.20398	0.028000	0.17463	0.994000	0.84299	2.507000	0.45442	2.873000	0.98535	0.561000	0.74099	TCA	.	.	.	none		0.567	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	
ASH1L	55870	hgsc.bcm.edu	37	1	155451901	155451901	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr1:155451901T>C	ENST00000368346.3	-	3	1399	c.760A>G	c.(760-762)Atc>Gtc	p.I254V	ASH1L_ENST00000392403.3_Missense_Mutation_p.I254V|ASH1L_ENST00000548830.1_3'UTR			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	254					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GCTTTCCTGATCAAATCCTTG	0.443																																					p.I254V		Atlas-SNP	.											ASH1L,NS,carcinoma,0,1	ASH1L	279	.	0			c.A760G						PASS	.						125.0	118.0	120.0					1																	155451901		2203	4300	6503	SO:0001583	missense	55870	exon3			TCCTGATCAAATC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.760A>G	chr1.hg19:g.155451901T>C	ENSP00000357330:p.Ile254Val	74.0	0.0	.		121.0	43.0	.	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	hg19		.	.	.	.	.	.	.	.	.	.	T	11.90	1.777686	0.31502	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.88975	-2.45;-2.45	4.44	4.44	0.53790	.	0.373475	0.24940	N	0.034388	T	0.69405	0.3107	N	0.19112	0.55	0.80722	D	1	B;B	0.24651	0.066;0.108	B;B	0.20955	0.014;0.032	T	0.69075	-0.5241	10	0.33141	T	0.24	.	10.2656	0.43453	0.0:0.0:0.0:1.0	.	254;254	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	V	254	ENSP00000357330:I254V;ENSP00000376204:I254V	ENSP00000357330:I254V	I	-	1	0	ASH1L	153718525	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.002000	0.40835	2.003000	0.58678	0.460000	0.39030	ATC	.	.	.	none		0.443	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
IARS2	55699	hgsc.bcm.edu	37	1	220267813	220267813	+	Silent	SNP	G	G	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr1:220267813G>T	ENST00000302637.5	+	1	359	c.255G>T	c.(253-255)ctG>ctT	p.L85L	IARS2_ENST00000366922.1_Silent_p.L13L	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	85					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	ACACGGAGCTGGAGATCCAGC	0.711																																					p.L85L		Atlas-SNP	.											.	IARS2	106	.	0			c.G255T						PASS	.						7.0	10.0	9.0					1																	220267813		2113	4210	6323	SO:0001819	synonymous_variant	55699	exon1			GGAGCTGGAGATC	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.255G>T	chr1.hg19:g.220267813G>T		44.0	0.0	.		59.0	21.0	.	NM_018060	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Silent	SNP	ENST00000302637.5	hg19	CCDS1523.1																																																																																			.	.	.	none		0.711	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
CAD	790	hgsc.bcm.edu	37	2	27463149	27463149	+	Missense_Mutation	SNP	G	G	T	rs199572743		TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr2:27463149G>T	ENST00000403525.1	+	34	5468	c.5324G>T	c.(5323-5325)cGc>cTc	p.R1775L	CAD_ENST00000264705.4_Missense_Mutation_p.R1838L			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAAGACCCCGCCGTGGCATC	0.567																																					p.R1838L		Atlas-SNP	.											.	CAD	199	.	0			c.G5513T						PASS	.						103.0	115.0	111.0					2																	27463149		2203	4300	6503	SO:0001583	missense	790	exon35			GACCCCGCCGTGG	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.5324G>T	chr2.hg19:g.27463149G>T	ENSP00000384510:p.Arg1775Leu	66.0	0.0	.		86.0	33.0	.	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	hg19		.	.	.	.	.	.	.	.	.	.	G	16.79	3.220193	0.58560	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.98313	-4.86;-4.8	5.28	5.28	0.74379	.	0.120124	0.53938	D	0.000045	D	0.95915	0.8670	L	0.39898	1.24	0.53005	D	0.999967	B;B	0.11235	0.004;0.001	B;B	0.12156	0.007;0.002	D	0.93894	0.7182	10	0.19590	T	0.45	-6.6265	16.4322	0.83853	0.0:0.0:1.0:0.0	.	1775;1838	F8VPD4;P27708	.;PYR1_HUMAN	L	1838;1775	ENSP00000264705:R1838L;ENSP00000384510:R1775L	ENSP00000264705:R1838L	R	+	2	0	CAD	27316653	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	4.863000	0.62983	2.474000	0.83562	0.555000	0.69702	CGC	.	.	.	alt		0.567	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
BAZ2B	29994	hgsc.bcm.edu	37	2	160289719	160289719	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr2:160289719G>C	ENST00000392783.2	-	9	1944	c.1449C>G	c.(1447-1449)ttC>ttG	p.F483L	BAZ2B_ENST00000392782.1_Missense_Mutation_p.F481L|BAZ2B_ENST00000355831.2_Missense_Mutation_p.F483L|BAZ2B_ENST00000343439.5_Missense_Mutation_p.F481L	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CATTTGTCAAGAATGGATTTG	0.383																																					p.F483L		Atlas-SNP	.											.	BAZ2B	196	.	0			c.C1449G						PASS	.						320.0	294.0	302.0					2																	160289719		1859	4096	5955	SO:0001583	missense	29994	exon9			TGTCAAGAATGGA	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.1449C>G	chr2.hg19:g.160289719G>C	ENSP00000376534:p.Phe483Leu	83.0	0.0	.		88.0	43.0	.	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775924	0.49786	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335	D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34	5.78	0.8	0.18672	.	0.000000	0.38720	U	0.001589	D	0.89188	0.6644	L	0.60455	1.87	0.42787	D	0.993881	D;P;P;P;P	0.58268	0.982;0.936;0.762;0.936;0.894	D;P;B;P;B	0.68943	0.961;0.64;0.391;0.64;0.437	D	0.84632	0.0690	10	0.22109	T	0.4	-9.1949	10.1708	0.42908	0.3245:0.0:0.6755:0.0	.	483;287;481;481;483	Q9UIF8-3;Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;.;BAZ2B_HUMAN	L	481;483;483;481;420	ENSP00000376533:F481L;ENSP00000376534:F483L;ENSP00000348087:F483L;ENSP00000339670:F481L	ENSP00000339670:F481L	F	-	3	2	BAZ2B	159997965	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.715000	0.47210	0.086000	0.17137	0.655000	0.94253	TTC	.	.	.	none		0.383	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
CD302	9936	hgsc.bcm.edu	37	2	160634461	160634461	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr2:160634461T>C	ENST00000259053.4	-	5	527	c.484A>G	c.(484-486)Aaa>Gaa	p.K162E	LY75-CD302_ENST00000505052.1_Missense_Mutation_p.K1747E|LY75_ENST00000554112.1_Missense_Mutation_p.K1803E|CD302_ENST00000429078.2_Missense_Mutation_p.K104E|CD302_ENST00000480212.1_5'UTR|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.K1803E|LY75_ENST00000553424.1_Missense_Mutation_p.K1747E	NM_001198764.1|NM_014880.4	NP_001185693.1|NP_055695.2	Q8IX05	CD302_HUMAN	CD302 molecule	162					phagocytosis (GO:0006909)	cell cortex (GO:0005938)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						GATAAATATTTCCTTTTGTAT	0.219																																					p.K1803E		Atlas-SNP	.											.	.	.	.	0			c.A5407G						PASS	.						9.0	10.0	10.0					2																	160634461		1861	3919	5780	SO:0001583	missense	100526664	exon38			AATATTTCCTTTT	AY314007	CCDS33308.1, CCDS56139.1, CCDS74595.1	2q24.2	2011-08-30	2006-03-28		ENSG00000241399	ENSG00000241399		"""CD molecules"", ""C-type lectin domain containing"""	30843	protein-coding gene	gene with protein product	"""C-type lectin domain family 13, member A"""	612246	"""CD302 antigen"""			7584026, 7584028	Standard	NM_014880		Approved	DCL-1, KIAA0022, BIMLEC, CLEC13A		Q8IX05	OTTHUMG00000154080	ENST00000259053.4:c.484A>G	chr2.hg19:g.160634461T>C	ENSP00000259053:p.Lys162Glu	401.0	0.0	.		481.0	199.0	.	NM_001198759	A8K5G4|B4E2T9|Q15009	Missense_Mutation	SNP	ENST00000259053.4	hg19	CCDS33308.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.329012	0.60743	.	.	ENSG00000241399;ENSG00000241399;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000259053;ENST00000429078;ENST00000554112;ENST00000553424;ENST00000504764;ENST00000505052	T;T;T;T;T;T	0.19105	3.24;2.17;3.01;3.0;3.01;3.0	5.39	5.39	0.77823	.	0.403394	0.25305	N	0.031623	T	0.19725	0.0474	L	0.27053	0.805	0.24410	N	0.994667	D;P;P;B	0.55172	0.97;0.884;0.932;0.172	P;P;P;B	0.48571	0.543;0.503;0.582;0.05	T	0.10019	-1.0648	10	0.27082	T	0.32	-0.1735	12.084	0.53688	0.0:0.0:0.0:1.0	.	104;1747;1803;162	B4E2T9;O60449-3;O60449-2;Q8IX05	.;.;.;CD302_HUMAN	E	162;104;1803;1747;1803;1747	ENSP00000259053:K162E;ENSP00000394301:K104E;ENSP00000451511:K1803E;ENSP00000451446:K1747E;ENSP00000423463:K1803E;ENSP00000421035:K1747E	ENSP00000259053:K162E	K	-	1	0	LY75;CD302;LY75-CD302	160342707	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	1.390000	0.34464	2.174000	0.68829	0.454000	0.30748	AAA	.	.	.	none		0.219	CD302-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333760.1	NM_014880	
ITGAV	3685	hgsc.bcm.edu	37	2	187466865	187466865	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr2:187466865A>C	ENST00000261023.3	+	2	577	c.303A>C	c.(301-303)gaA>gaC	p.E101D	ITGAV_ENST00000374907.3_Missense_Mutation_p.E101D|ITGAV_ENST00000433736.2_Missense_Mutation_p.E55D	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	101					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	AGCCAATTGAATTTGATGCAA	0.408																																					p.E101D	Melanoma(58;108 1995 6081)	Atlas-SNP	.											.	ITGAV	124	.	0			c.A303C						PASS	.						51.0	52.0	52.0					2																	187466865		2203	4300	6503	SO:0001583	missense	3685	exon2			AATTGAATTTGAT		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.303A>C	chr2.hg19:g.187466865A>C	ENSP00000261023:p.Glu101Asp	44.0	0.0	.		69.0	21.0	.	NM_001145000	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	ENST00000261023.3	hg19	CCDS2292.1	.	.	.	.	.	.	.	.	.	.	A	11.75	1.731766	0.30684	.	.	ENSG00000138448	ENST00000544640;ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.02916	4.11;4.11;4.11	5.15	-1.41	0.08941	.	0.638947	0.16335	N	0.218968	T	0.01765	0.0056	N	0.25201	0.72	0.30054	N	0.811519	B;B;B	0.31125	0.201;0.037;0.309	B;B;B	0.23852	0.049;0.033;0.049	T	0.46775	-0.9167	10	0.18710	T	0.47	.	9.1659	0.37052	0.5777:0.0:0.4223:0.0	.	55;101;101	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	D	101;101;101;55	ENSP00000261023:E101D;ENSP00000364042:E101D;ENSP00000404291:E55D	ENSP00000261023:E101D	E	+	3	2	ITGAV	187175110	0.924000	0.31332	0.996000	0.52242	0.992000	0.81027	-0.040000	0.12104	-0.253000	0.09514	0.533000	0.62120	GAA	.	.	.	none		0.408	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
SF3B1	23451	hgsc.bcm.edu	37	2	198270054	198270054	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr2:198270054G>T	ENST00000335508.6	-	10	1473	c.1382C>A	c.(1381-1383)tCt>tAt	p.S461Y	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	461	Interaction with PPP1R8.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			AAGATTTCCAGATGGCTGGTC	0.363			Mis		myelodysplastic syndrome																																p.S461Y		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	1038	.	0			c.C1382A						PASS	.						56.0	58.0	57.0					2																	198270054		2203	4300	6503	SO:0001583	missense	23451	exon10			TTTCCAGATGGCT	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1382C>A	chr2.hg19:g.198270054G>T	ENSP00000335321:p.Ser461Tyr	173.0	0.0	.		222.0	100.0	.	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	hg19	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311427	0.60414	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.34308	0.0893	N	0.02011	-0.69	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.17592	-1.0364	9	0.24483	T	0.36	.	19.6287	0.95691	0.0:0.0:1.0:0.0	.	461	O75533	SF3B1_HUMAN	Y	461	.	ENSP00000335321:S461Y	S	-	2	0	SF3B1	197978299	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.665000	0.98609	2.710000	0.92621	0.655000	0.94253	TCT	.	.	.	none		0.363	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
AGFG1	3267	hgsc.bcm.edu	37	2	228356286	228356286	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr2:228356286G>T	ENST00000310078.8	+	2	451	c.191G>T	c.(190-192)aGg>aTg	p.R64M	AGFG1_ENST00000373671.3_Missense_Mutation_p.R64M|AGFG1_ENST00000409315.1_Missense_Mutation_p.R64M|AGFG1_ENST00000409171.1_Missense_Mutation_p.R64M|AGFG1_ENST00000409979.2_Missense_Mutation_p.R64M	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	64	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						CCACCACACAGGGTGAAATCT	0.279																																					p.R64M		Atlas-SNP	.											.	AGFG1	80	.	0			c.G191T						PASS	.						87.0	96.0	93.0					2																	228356286		2202	4297	6499	SO:0001583	missense	3267	exon2			CACACAGGGTGAA		CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.191G>T	chr2.hg19:g.228356286G>T	ENSP00000312059:p.Arg64Met	416.0	0.0	.		528.0	223.0	.	NM_004504	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Missense_Mutation	SNP	ENST00000310078.8	hg19	CCDS2467.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918260	0.92249	.	.	ENSG00000173744	ENST00000409979;ENST00000542592;ENST00000310078;ENST00000409315;ENST00000373671;ENST00000409171	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.74935	0.3782	M	0.93939	3.475	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.996;1.0	D;D;D;D	0.79784	0.993;0.958;0.938;0.985	T	0.80892	-0.1179	10	0.87932	D	0	.	19.1077	0.93303	0.0:0.0:1.0:0.0	.	64;64;64;64	P52594-2;P52594-3;E9PHX7;P52594	.;.;.;AGFG1_HUMAN	M	64;49;64;64;64;64	ENSP00000387282:R64M;ENSP00000312059:R64M;ENSP00000387154:R64M;ENSP00000362775:R64M;ENSP00000387218:R64M	ENSP00000312059:R64M	R	+	2	0	AGFG1	228064530	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.011000	0.93618	2.814000	0.96858	0.563000	0.77884	AGG	.	.	.	none		0.279	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2	NM_004504	
IP6K2	51447	hgsc.bcm.edu	37	3	48727116	48727116	+	Missense_Mutation	SNP	C	C	T	rs372776558		TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr3:48727116C>T	ENST00000328631.5	-	5	858	c.635G>A	c.(634-636)cGc>cAc	p.R212H		NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	212					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						CACCTCGTAGCGGGAAGTCAG	0.478																																					p.R212H		Atlas-SNP	.											.	IP6K2	63	.	0			c.G635A						PASS	.						126.0	107.0	113.0					3																	48727116		2203	4300	6503	SO:0001583	missense	51447	exon5			TCGTAGCGGGAAG	AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.635G>A	chr3.hg19:g.48727116C>T	ENSP00000331103:p.Arg212His	48.0	0.0	.		91.0	26.0	.	NM_016291	A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Missense_Mutation	SNP	ENST00000328631.5	hg19	CCDS2777.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951641	0.53186	.	.	ENSG00000068745	ENST00000328631	T	0.14144	2.53	5.73	5.73	0.89815	.	0.262087	0.43260	D	0.000582	T	0.25457	0.0619	L	0.31157	0.91	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	T	0.02625	-1.1132	10	0.14656	T	0.56	-22.2326	19.8966	0.96963	0.0:1.0:0.0:0.0	.	212	Q9UHH9	IP6K2_HUMAN	H	212	ENSP00000331103:R212H	ENSP00000331103:R212H	R	-	2	0	IP6K2	48702120	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.285000	0.51716	2.700000	0.92200	0.655000	0.94253	CGC	.	.	.	alt		0.478	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257521.2	NM_016291	
DOCK3	1795	hgsc.bcm.edu	37	3	51251577	51251577	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr3:51251577T>C	ENST00000266037.9	+	14	1174	c.1151T>C	c.(1150-1152)cTt>cCt	p.L384P		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	384					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CTGCAGCTTCTTCGTGGAGAC	0.373																																					p.L384P		Atlas-SNP	.											.	DOCK3	397	.	0			c.T1151C						PASS	.						97.0	93.0	94.0					3																	51251577		1868	4127	5995	SO:0001583	missense	1795	exon14			AGCTTCTTCGTGG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1151T>C	chr3.hg19:g.51251577T>C	ENSP00000266037:p.Leu384Pro	68.0	0.0	.		142.0	6.0	.	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	hg19	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.353420	0.82243	.	.	ENSG00000088538	ENST00000266037	T	0.08896	3.04	5.35	5.35	0.76521	.	0.059841	0.64402	D	0.000003	T	0.37919	0.1021	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48948	-0.8989	10	0.87932	D	0	.	15.6362	0.76953	0.0:0.0:0.0:1.0	.	384	Q8IZD9	DOCK3_HUMAN	P	384	ENSP00000266037:L384P	ENSP00000266037:L384P	L	+	2	0	DOCK3	51226617	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.483000	0.81158	2.155000	0.67459	0.533000	0.62120	CTT	.	.	.	none		0.373	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
EFCC1	79825	hgsc.bcm.edu	37	3	128720759	128720759	+	Silent	SNP	C	C	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr3:128720759C>A	ENST00000480450.1	+	1	288	c.288C>A	c.(286-288)gcC>gcA	p.A96A	KIAA1257_ENST00000510149.1_Intron|EFCC1_ENST00000436022.2_5'UTR			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	96							calcium ion binding (GO:0005509)										CCACCACGGCCGGGCAGGCAG	0.731																																					p.A96A		Atlas-SNP	.											.	.	.	.	0			c.C288A						PASS	.						4.0	9.0	7.0					3																	128720759		615	1457	2072	SO:0001819	synonymous_variant	79825	exon1			CACGGCCGGGCAG	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.288C>A	chr3.hg19:g.128720759C>A		63.0	0.0	.		170.0	47.0	.	NM_024768	A8MYE2	Silent	SNP	ENST00000480450.1	hg19	CCDS3054.2																																																																																			.	.	.	none		0.731	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352832.1	NM_024768	
IGSF10	285313	hgsc.bcm.edu	37	3	151163860	151163860	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr3:151163860G>T	ENST00000282466.3	-	4	3908	c.3909C>A	c.(3907-3909)agC>agA	p.S1303R		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1303					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTGAGTCTTTGCTTATAATAC	0.438																																					p.S1303R		Atlas-SNP	.											.	IGSF10	279	.	0			c.C3909A						PASS	.						280.0	258.0	266.0					3																	151163860		2203	4300	6503	SO:0001583	missense	285313	exon4			GTCTTTGCTTATA	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.3909C>A	chr3.hg19:g.151163860G>T	ENSP00000282466:p.Ser1303Arg	87.0	0.0	.		121.0	5.0	.	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	hg19	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	G	8.227	0.803834	0.16467	.	.	ENSG00000152580	ENST00000282466	T	0.69561	-0.41	4.62	2.79	0.32731	.	0.256644	0.26879	N	0.022028	T	0.48040	0.1478	N	0.20986	0.625	0.09310	N	1	B	0.18013	0.025	B	0.17722	0.019	T	0.27872	-1.0061	10	0.23891	T	0.37	.	9.3524	0.38147	0.0777:0.0:0.7791:0.1432	.	1303	Q6WRI0	IGS10_HUMAN	R	1303	ENSP00000282466:S1303R	ENSP00000282466:S1303R	S	-	3	2	IGSF10	152646550	0.000000	0.05858	0.047000	0.18901	0.016000	0.09150	0.760000	0.26475	0.477000	0.27464	0.591000	0.81541	AGC	.	.	.	none		0.438	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
MUC4	4585	hgsc.bcm.edu	37	3	195511828	195511828	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr3:195511828G>C	ENST00000463781.3	-	2	7082	c.6623C>G	c.(6622-6624)cCt>cGt	p.P2208R	MUC4_ENST00000475231.1_Missense_Mutation_p.P2208R|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	997					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAGGAAGAGGGGTGGCCTG	0.592																																					p.P2208R		Atlas-SNP	.											.	MUC4	1505	.	0			c.C6623G						PASS	.						32.0	26.0	28.0					3																	195511828		689	1590	2279	SO:0001583	missense	4585	exon2			GGAAGAGGGGTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6623C>G	chr3.hg19:g.195511828G>C	ENSP00000417498:p.Pro2208Arg	127.0	0.0	.		260.0	15.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	5.430	0.264472	0.10294	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33438	1.41;1.41	.	.	.	.	.	.	.	.	T	0.23330	0.0564	N	0.19112	0.55	0.22017	N	0.99942	D	0.57257	0.979	P	0.52957	0.714	T	0.09930	-1.0652	7	.	.	.	.	2.8356	0.05513	3.0E-4:2.0E-4:0.5012:0.4983	.	2208	E7ESK3	.	R	2208	ENSP00000417498:P2208R;ENSP00000420243:P2208R	.	P	-	2	0	MUC4	196996223	0.000000	0.05858	0.054000	0.19295	0.030000	0.12068	-1.796000	0.01750	0.064000	0.16427	0.064000	0.15345	CCT	.	.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
FRYL	285527	hgsc.bcm.edu	37	4	48581047	48581047	+	Missense_Mutation	SNP	T	T	C	rs544935208		TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr4:48581047T>C	ENST00000503238.1	-	20	2470	c.2471A>G	c.(2470-2472)tAt>tGt	p.Y824C	FRYL_ENST00000537810.1_Missense_Mutation_p.Y824C|FRYL_ENST00000507711.1_Missense_Mutation_p.Y824C|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000358350.4_Missense_Mutation_p.Y824C			O94915	FRYL_HUMAN	FRY-like	824					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CATCCAAGCATAGCTCACAGC	0.378													T|||	1	0.000199681	0.0	0.0014	5008	,	,		18848	0.0		0.0	False		,,,				2504	0.0				p.Y824C		Atlas-SNP	.											.	FRYL	242	.	0			c.A2471G						PASS	.						115.0	106.0	109.0					4																	48581047		1846	4094	5940	SO:0001583	missense	285527	exon23			CAAGCATAGCTCA	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2471A>G	chr4.hg19:g.48581047T>C	ENSP00000426064:p.Tyr824Cys	80.0	0.0	.		129.0	54.0	.	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	hg19	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.239029	0.79800	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.46451	1.86;1.86;1.86;0.87	6.05	6.05	0.98169	.	0.000000	0.64402	U	0.000002	T	0.64148	0.2572	M	0.71036	2.16	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.975	T	0.63699	-0.6578	10	0.44086	T	0.13	.	16.5993	0.84807	0.0:0.0:0.0:1.0	.	824;824	F2Z2S2;O94915	.;FRYL_HUMAN	C	824	ENSP00000426064:Y824C;ENSP00000351113:Y824C;ENSP00000441114:Y824C;ENSP00000421584:Y824C	ENSP00000351113:Y824C	Y	-	2	0	FRYL	48275804	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	5.949000	0.70257	2.311000	0.77944	0.528000	0.53228	TAT	.	.	.	none		0.378	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
FIP1L1	81608	hgsc.bcm.edu	37	4	54248495	54248495	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr4:54248495C>G	ENST00000337488.6	+	4	415	c.221C>G	c.(220-222)cCa>cGa	p.P74R	FIP1L1_ENST00000507922.1_Missense_Mutation_p.P59R|FIP1L1_ENST00000507166.1_Missense_Mutation_p.P74R|FIP1L1_ENST00000358575.5_Missense_Mutation_p.P59R|FIP1L1_ENST00000306932.6_Missense_Mutation_p.P59R|FIP1L1_ENST00000510668.1_3'UTR	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	74	Necessary for stimulating PAPOLA activity.|Sufficient for interaction with PAPOLA.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AATGGTGTACCAAAACCGGTA	0.358			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.P74R		Atlas-SNP	.		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	FIP1L1	60	.	0			c.C221G						PASS	.						154.0	140.0	145.0					4																	54248495		2203	4300	6503	SO:0001583	missense	81608	exon4			GTGTACCAAAACC	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.221C>G	chr4.hg19:g.54248495C>G	ENSP00000336752:p.Pro74Arg	63.0	0.0	.		86.0	29.0	.	NM_030917	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Missense_Mutation	SNP	ENST00000337488.6	hg19	CCDS3491.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.494563	0.26774	.	.	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000507922;ENST00000306932;ENST00000507166	T	0.76968	-1.06	5.48	4.63	0.57726	.	0.519843	0.18037	N	0.153726	T	0.55816	0.1944	N	0.08118	0	0.25163	N	0.990332	B;B;B;P	0.36282	0.071;0.018;0.083;0.546	B;B;B;B	0.38954	0.285;0.034;0.027;0.286	T	0.46470	-0.9189	10	0.16420	T	0.52	-2.5771	5.3271	0.15913	0.1739:0.672:0.0:0.1541	.	59;59;74;59	G3XAD6;Q6UN15-3;Q6UN15;Q6UN15-4	.;.;FIP1_HUMAN;.	R	74;59;59;59;74	ENSP00000423325:P74R	ENSP00000302993:P59R	P	+	2	0	FIP1L1	53943252	0.926000	0.31397	0.995000	0.50966	0.989000	0.77384	1.814000	0.38972	1.279000	0.44446	0.655000	0.94253	CCA	.	.	.	none		0.358	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
PRDM5	11107	hgsc.bcm.edu	37	4	121828665	121828665	+	Silent	SNP	G	G	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr4:121828665G>A	ENST00000264808.3	-	2	381	c.141C>T	c.(139-141)gaC>gaT	p.D47D	PRDM5_ENST00000515109.1_Silent_p.D47D|PRDM5_ENST00000394435.2_Silent_p.D47D|PRDM5_ENST00000428209.2_Silent_p.D47D	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	47	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TTTCATCCAAGTCTTCAGGCA	0.328																																					p.D47D		Atlas-SNP	.											.	PRDM5	76	.	0			c.C141T						PASS	.						153.0	152.0	152.0					4																	121828665		2203	4300	6503	SO:0001819	synonymous_variant	11107	exon2			ATCCAAGTCTTCA	AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.141C>T	chr4.hg19:g.121828665G>A		159.0	0.0	.		162.0	74.0	.	NM_018699	Q0VAI9|Q0VAJ0|Q6NXQ7	Silent	SNP	ENST00000264808.3	hg19	CCDS3716.1																																																																																			.	.	.	none		0.328	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256528.2		
TRPC3	7222	hgsc.bcm.edu	37	4	122825529	122825529	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr4:122825529A>T	ENST00000379645.3	-	8	2274	c.2201T>A	c.(2200-2202)gTt>gAt	p.V734D	TRPC3_ENST00000513531.1_Missense_Mutation_p.V606D|TRPC3_ENST00000264811.5_Missense_Mutation_p.V661D	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	649					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GTTGAGTAAAACGACCACCAT	0.328																																					p.V734D		Atlas-SNP	.											.	TRPC3	201	.	0			c.T2201A						PASS	.						100.0	96.0	97.0					4																	122825529		2203	4299	6502	SO:0001583	missense	7222	exon8			AGTAAAACGACCA	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.2201T>A	chr4.hg19:g.122825529A>T	ENSP00000368966:p.Val734Asp	183.0	0.0	.		218.0	64.0	.	NM_001130698	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	hg19	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.668125	0.88348	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.98849	-5.18;-5.18;-5.18	5.52	5.52	0.82312	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99378	0.9781	H	0.94698	3.57	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.98652	1.0680	10	0.87932	D	0	-35.6827	15.9239	0.79597	1.0:0.0:0.0:0.0	.	649;606;734	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	D	661;734;606	ENSP00000264811:V661D;ENSP00000368966:V734D;ENSP00000426899:V606D	ENSP00000264811:V661D	V	-	2	0	TRPC3	123044979	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	9.174000	0.94824	2.207000	0.71202	0.533000	0.62120	GTT	.	.	.	none		0.328	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
TRPC3	7222	hgsc.bcm.edu	37	4	122825544	122825544	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr4:122825544A>T	ENST00000379645.3	-	8	2259	c.2186T>A	c.(2185-2187)gTa>gAa	p.V729E	TRPC3_ENST00000513531.1_Missense_Mutation_p.V601E|TRPC3_ENST00000264811.5_Missense_Mutation_p.V656E	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	644					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CACCATAGTTACATTGTATAT	0.328																																					p.V729E		Atlas-SNP	.											.	TRPC3	201	.	0			c.T2186A						PASS	.						96.0	92.0	93.0					4																	122825544		2203	4299	6502	SO:0001583	missense	7222	exon8			ATAGTTACATTGT	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.2186T>A	chr4.hg19:g.122825544A>T	ENSP00000368966:p.Val729Glu	200.0	0.0	.		217.0	68.0	.	NM_001130698	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	hg19	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.677827	0.88445	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.98762	-5.12;-5.12;-5.12	5.52	5.52	0.82312	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99312	0.9759	M	0.92555	3.32	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.80764	0.968;0.981;0.994	D	0.98934	1.0788	10	0.87932	D	0	-23.7439	15.9239	0.79597	1.0:0.0:0.0:0.0	.	644;601;729	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	E	656;729;601	ENSP00000264811:V656E;ENSP00000368966:V729E;ENSP00000426899:V601E	ENSP00000264811:V656E	V	-	2	0	TRPC3	123044994	1.000000	0.71417	0.988000	0.46212	0.941000	0.58515	9.174000	0.94824	2.207000	0.71202	0.533000	0.62120	GTA	.	.	.	none		0.328	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
FAM198B	51313	hgsc.bcm.edu	37	4	159092466	159092466	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr4:159092466G>A	ENST00000296530.8	-	2	683	c.62C>T	c.(61-63)cCg>cTg	p.P21L	FAM198B_ENST00000592057.1_Missense_Mutation_p.P21L|RP11-597D13.9_ENST00000503611.1_RNA|FAM198B_ENST00000589306.1_Intron|RP11-597D13.9_ENST00000505532.1_RNA|FAM198B_ENST00000393807.5_Missense_Mutation_p.P21L|RP11-597D13.9_ENST00000509463.1_RNA|RP11-597D13.9_ENST00000514381.1_RNA|FAM198B_ENST00000585682.1_Missense_Mutation_p.P21L	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	21						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						ACGCACCCGCGGGACGCACAG	0.587																																					p.P21L		Atlas-SNP	.											.	FAM198B	134	.	0			c.C62T						PASS	.						41.0	41.0	41.0					4																	159092466		2201	4299	6500	SO:0001583	missense	51313	exon2			ACCCGCGGGACGC		CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.62C>T	chr4.hg19:g.159092466G>A	ENSP00000296530:p.Pro21Leu	61.0	0.0	.		52.0	23.0	.	NM_016613	Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Missense_Mutation	SNP	ENST00000296530.8	hg19	CCDS3798.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055019	0.36277	.	.	ENSG00000164125	ENST00000337222;ENST00000296530;ENST00000393807;ENST00000417442	T;T	0.31510	1.5;1.49	5.31	3.57	0.40892	.	0.540389	0.20073	N	0.099828	T	0.25457	0.0619	L	0.54323	1.7	0.21967	N	0.999447	B;B;B	0.32968	0.392;0.068;0.028	B;B;B	0.28232	0.087;0.012;0.012	T	0.24548	-1.0157	10	0.87932	D	0	-0.7468	6.6971	0.23205	0.1449:0.0:0.71:0.145	.	21;21;21	Q6UWH4-3;Q6UWH4-2;Q6UWH4	.;.;F198B_HUMAN	L	21	ENSP00000296530:P21L;ENSP00000377396:P21L	ENSP00000296530:P21L	P	-	2	0	FAM198B	159311916	0.990000	0.36364	0.275000	0.24674	0.855000	0.48748	2.335000	0.43929	0.799000	0.34018	0.655000	0.94253	CCG	.	.	.	none		0.587	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365230.1	NM_001031700, NM_016613	
FAM81B	153643	hgsc.bcm.edu	37	5	94783981	94783981	+	Silent	SNP	T	T	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr5:94783981T>C	ENST00000283357.5	+	9	1084	c.1038T>C	c.(1036-1038)tcT>tcC	p.S346S		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	346						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		AGGAAAAGTCTGAAAATAAAA	0.294																																					p.S346S		Atlas-SNP	.											.	FAM81B	51	.	0			c.T1038C						PASS	.						44.0	40.0	41.0					5																	94783981		1799	4069	5868	SO:0001819	synonymous_variant	153643	exon9			AAAGTCTGAAAAT		CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.1038T>C	chr5.hg19:g.94783981T>C		309.0	0.0	.		386.0	167.0	.	NM_152548		Silent	SNP	ENST00000283357.5	hg19	CCDS43341.1																																																																																			.	.	.	none		0.294	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370690.1	NM_152548	
GRAMD3	65983	hgsc.bcm.edu	37	5	125808993	125808993	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr5:125808993A>G	ENST00000285689.3	+	5	880	c.419A>G	c.(418-420)cAa>cGa	p.Q140R	GRAMD3_ENST00000542322.1_Missense_Mutation_p.Q148R|GRAMD3_ENST00000513040.1_Missense_Mutation_p.Q155R|GRAMD3_ENST00000543198.1_Missense_Mutation_p.Q117R|GRAMD3_ENST00000544396.1_Missense_Mutation_p.Q36R|GRAMD3_ENST00000511134.1_Missense_Mutation_p.Q124R|GRAMD3_ENST00000502348.1_Missense_Mutation_p.Q31R|GRAMD3_ENST00000515200.1_Missense_Mutation_p.Q117R|RP11-517I3.1_ENST00000515808.1_RNA	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	140	GRAM.					cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		ATACTATACCAAGGAAAGCTC	0.328																																					p.Q155R		Atlas-SNP	.											.	GRAMD3	30	.	0			c.A464G						PASS	.						54.0	59.0	57.0					5																	125808993		2202	4299	6501	SO:0001583	missense	65983	exon5			TATACCAAGGAAA	BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.419A>G	chr5.hg19:g.125808993A>G	ENSP00000285689:p.Gln140Arg	173.0	0.0	.		216.0	90.0	.	NM_001146319	B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Missense_Mutation	SNP	ENST00000285689.3	hg19	CCDS4136.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.989266	0.93106	.	.	ENSG00000155324	ENST00000513040;ENST00000506445;ENST00000543367;ENST00000285689;ENST00000515200;ENST00000542322;ENST00000544396;ENST00000543198;ENST00000502348;ENST00000511134	D;D;D;D;D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29	6.04	6.04	0.98038	GRAM (2);	0.047859	0.85682	D	0.000000	D	0.95608	0.8572	H	0.95679	3.705	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;1.0	D;D;D;D;D	0.97110	0.998;1.0;1.0;0.994;0.998	D	0.96686	0.9507	10	0.72032	D	0.01	.	16.2378	0.82389	1.0:0.0:0.0:0.0	.	124;36;148;155;140	B7Z8T2;B7Z1F2;B7Z3R1;B7Z6D8;Q96HH9	.;.;.;.;GRAM3_HUMAN	R	155;154;124;140;117;148;36;117;31;124	ENSP00000426120:Q155R;ENSP00000424985:Q154R;ENSP00000285689:Q140R;ENSP00000426143:Q117R;ENSP00000441876:Q148R;ENSP00000444049:Q36R;ENSP00000442902:Q117R;ENSP00000427596:Q31R;ENSP00000426088:Q124R	ENSP00000285689:Q140R	Q	+	2	0	GRAMD3	125836892	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.224000	0.95209	2.317000	0.78254	0.459000	0.35465	CAA	.	.	.	none		0.328	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250922.2	NM_023927	
ZNF184	7738	hgsc.bcm.edu	37	6	27420389	27420389	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr6:27420389G>T	ENST00000211936.6	-	6	1233	c.949C>A	c.(949-951)Cag>Aag	p.Q317K	ZNF184_ENST00000377419.1_Missense_Mutation_p.Q317K	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	317					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TGGGTCCTCTGACTAAAGGCT	0.413																																					p.Q317K		Atlas-SNP	.											.	ZNF184	89	.	0			c.C949A						PASS	.						52.0	53.0	53.0					6																	27420389		2203	4300	6503	SO:0001583	missense	7738	exon6			TCCTCTGACTAAA	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.949C>A	chr6.hg19:g.27420389G>T	ENSP00000211936:p.Gln317Lys	55.0	0.0	.		63.0	22.0	.	NM_007149	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	hg19	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.566236	0.45694	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087;ENST00000538681	T;T	0.07327	3.2;3.2	4.99	4.1	0.47936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44902	D	0.000405	T	0.01387	0.0045	N	0.12637	0.245	0.32231	N	0.574014	P	0.50710	0.938	B	0.34590	0.186	T	0.52449	-0.8574	10	0.24483	T	0.36	.	9.5393	0.39242	0.0989:0.0:0.9011:0.0	.	317	Q99676	ZN184_HUMAN	K	317;317;317;5	ENSP00000211936:Q317K;ENSP00000366636:Q317K	ENSP00000211936:Q317K	Q	-	1	0	ZNF184	27528368	0.000000	0.05858	1.000000	0.80357	0.976000	0.68499	-0.289000	0.08365	2.591000	0.87537	0.455000	0.32223	CAG	.	.	.	none		0.413	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149	
HLA-C	3107	hgsc.bcm.edu	37	6	31239839	31239839	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr6:31239839T>C	ENST00000376228.5	-	1	24	c.10A>G	c.(10-12)Atg>Gtg	p.M4V	HLA-C_ENST00000383329.3_Missense_Mutation_p.M4V	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	4					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CGGGGCGCCATGACCCGCATC	0.667																																					p.M4V		Atlas-SNP	.											.	HLA-C	92	.	0			c.A10G						PASS	.						18.0	19.0	19.0					6																	31239839		1511	2709	4220	SO:0001583	missense	3107	exon1			GCGCCATGACCCG	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.10A>G	chr6.hg19:g.31239839T>C	ENSP00000365402:p.Met4Val	69.0	0.0	.		84.0	30.0	.	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	hg19	CCDS34393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	3.391|3.391	-0.124293|-0.124293	0.06795|0.06795	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.00730	.|5.78;5.77	2.38|2.38	-0.236|-0.236	0.13067|0.13067	.|.	.|.	.|.	.|.	.|.	T|T	0.00440|0.00440	0.0014|0.0014	M|M	0.78456|0.78456	2.415|2.415	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.11235	.|0.003;0.001;0.003;0.004	.|B;B;B;B	.|0.19391	.|0.019;0.011;0.011;0.025	T|T	0.42189|0.42189	-0.9466|-0.9466	5|9	.|0.66056	.|D	.|0.02	.|.	2.6949|2.6949	0.05132|0.05132	0.0:0.1644:0.2772:0.5584|0.0:0.1644:0.2772:0.5584	.|.	.|4;4;4;4	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	R|V	3|4	.|ENSP00000365402:M4V;ENSP00000372819:M4V	.|ENSP00000365402:M4V	H|M	-|-	2|1	0|0	HLA-C|HLA-C	31347818|31347818	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	-0.065000|-0.065000	0.11617|0.11617	-0.041000|-0.041000	0.13558|0.13558	0.254000|0.254000	0.18369|0.18369	CAT|ATG	.	.	.	none		0.667	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
KLC4	89953	hgsc.bcm.edu	37	6	43039962	43039962	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr6:43039962T>A	ENST00000394056.2	+	13	1952	c.1457T>A	c.(1456-1458)cTg>cAg	p.L486Q	KLC4_ENST00000347162.5_Missense_Mutation_p.L486Q|KLC4_ENST00000259708.3_Missense_Mutation_p.L504Q|KLC4_ENST00000394058.1_Missense_Mutation_p.L486Q|KLC4_ENST00000453940.2_Missense_Mutation_p.L409Q|KLC4_ENST00000479388.1_Missense_Mutation_p.L486Q|RP11-387M24.5_ENST00000606123.1_RNA			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	486						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			GCTGAGACCCTGGAGGAATGT	0.602																																					p.L504Q		Atlas-SNP	.											.	KLC4	89	.	0			c.T1511A						PASS	.						62.0	68.0	66.0					6																	43039962		2203	4300	6503	SO:0001583	missense	89953	exon12			AGACCCTGGAGGA	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1457T>A	chr6.hg19:g.43039962T>A	ENSP00000377620:p.Leu486Gln	38.0	0.0	.		53.0	22.0	.	NM_201523	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	hg19	CCDS4883.1	.	.	.	.	.	.	.	.	.	.	T	32	5.142869	0.94560	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	D;T;D;D;D;D	0.83506	-1.73;1.13;-1.73;-1.73;-1.73;-1.73	6.04	6.04	0.98038	Tetratricopeptide-like helical (1);	0.000000	0.47852	D	0.000205	D	0.90573	0.7045	M	0.84326	2.69	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.997;0.998	D	0.91944	0.5565	10	0.87932	D	0	-20.1899	16.5763	0.84648	0.0:0.0:0.0:1.0	.	409;504;486	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	Q	486;409;504;486;486;486	ENSP00000340221:L486Q;ENSP00000395806:L409Q;ENSP00000259708:L504Q;ENSP00000418031:L486Q;ENSP00000377620:L486Q;ENSP00000377622:L486Q	ENSP00000259708:L504Q	L	+	2	0	KLC4	43147940	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	8.040000	0.89188	2.317000	0.78254	0.459000	0.35465	CTG	.	.	.	none		0.602	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
RIMS1	22999	hgsc.bcm.edu	37	6	72892828	72892828	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr6:72892828G>C	ENST00000521978.1	+	6	1654	c.1654G>C	c.(1654-1656)Gag>Cag	p.E552Q	RIMS1_ENST00000491071.2_Missense_Mutation_p.E552Q|RIMS1_ENST00000264839.7_Missense_Mutation_p.E552Q|RIMS1_ENST00000517960.1_Missense_Mutation_p.E552Q|RIMS1_ENST00000348717.5_Missense_Mutation_p.E552Q|RIMS1_ENST00000520567.1_Missense_Mutation_p.E552Q|RIMS1_ENST00000518273.1_Missense_Mutation_p.E552Q|RIMS1_ENST00000522291.1_Missense_Mutation_p.E552Q	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	552					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CGTGGAGCTGGAGAGCGAGAG	0.657																																					p.E552Q		Atlas-SNP	.											.	RIMS1	278	.	0			c.G1654C						PASS	.						8.0	9.0	8.0					6																	72892828		2004	4128	6132	SO:0001583	missense	22999	exon6			GAGCTGGAGAGCG	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.1654G>C	chr6.hg19:g.72892828G>C	ENSP00000428417:p.Glu552Gln	80.0	0.0	.		87.0	29.0	.	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	hg19	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.33|16.33	3.092994|3.092994	0.56075|0.56075	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978|ENST00000517433	T;T;T;T;T;T;T;T|.	0.18016|.	2.24;2.37;2.3;2.38;2.36;2.37;2.37;2.29|.	4.05|4.05	3.15|3.15	0.36227|0.36227	.|.	0.000000|.	0.64402|.	D|.	0.000013|.	T|T	0.59514|0.59514	0.2199|0.2199	M|M	0.69358|0.69358	2.11|2.11	0.80722|0.80722	D|D	1|1	B;B;B|.	0.30114|.	0.269;0.062;0.22|.	B;B;B|.	0.30105|.	0.111;0.029;0.05|.	T|T	0.60419|0.60419	-0.7267|-0.7267	10|5	0.72032|.	D|.	0.01|.	0.0102|0.0102	13.3578|13.3578	0.60638|0.60638	0.0:0.1599:0.8401:0.0|0.0:0.1599:0.8401:0.0	.|.	552;552;552|.	E9PHR1;C9JNW6;Q86UR5|.	.;.;RIMS1_HUMAN|.	Q|A	552|125	ENSP00000430101:E552Q;ENSP00000275037:E552Q;ENSP00000264839:E552Q;ENSP00000429959:E552Q;ENSP00000430408:E552Q;ENSP00000430502:E552Q;ENSP00000430932:E552Q;ENSP00000428417:E552Q|.	ENSP00000264839:E552Q|.	E|G	+|+	1|2	0|0	RIMS1|RIMS1	72949549|72949549	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	9.414000|9.414000	0.97362|0.97362	0.633000|0.633000	0.30452|0.30452	0.455000|0.455000	0.32223|0.32223	GAG|GGA	.	.	.	none		0.657	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
POU3F2	5454	hgsc.bcm.edu	37	6	99283832	99283832	+	Silent	SNP	C	C	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr6:99283832C>A	ENST00000328345.5	+	1	1253	c.1083C>A	c.(1081-1083)atC>atA	p.I361I		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	361					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		GGACCTCCATCGAGGTGAGCG	0.617																																					p.I361I		Atlas-SNP	.											.	POU3F2	33	.	0			c.C1083A						PASS	.						65.0	73.0	70.0					6																	99283832		2203	4300	6503	SO:0001819	synonymous_variant	5454	exon1			CTCCATCGAGGTG	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.1083C>A	chr6.hg19:g.99283832C>A		70.0	0.0	.		96.0	30.0	.	NM_005604	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	hg19	CCDS5040.1																																																																																			.	.	.	none		0.617	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
SYNE1	23345	hgsc.bcm.edu	37	6	152470766	152470766	+	Missense_Mutation	SNP	A	A	C	rs139643725		TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr6:152470766A>C	ENST00000367255.5	-	136	25089	c.24488T>G	c.(24487-24489)aTt>aGt	p.I8163S	SYNE1_ENST00000354674.4_Missense_Mutation_p.I318S|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000448038.1_Missense_Mutation_p.I8092S|SYNE1_ENST00000341594.5_Missense_Mutation_p.I7775S|SYNE1_ENST00000265368.4_Missense_Mutation_p.I8163S|SYNE1_ENST00000423061.1_Missense_Mutation_p.I8092S|SYNE1_ENST00000539504.1_Missense_Mutation_p.I318S|SYNE1_ENST00000356820.4_Missense_Mutation_p.I2687S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8163					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TATCTGCTCAATCTTATTGTG	0.433										HNSCC(10;0.0054)																											p.I8163S		Atlas-SNP	.											.	SYNE1	3227	.	0			c.T24488G						PASS	.						103.0	102.0	102.0					6																	152470766		2203	4300	6503	SO:0001583	missense	23345	exon136			TGCTCAATCTTAT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24488T>G	chr6.hg19:g.152470766A>C	ENSP00000356224:p.Ile8163Ser	25.0	0.0	.		38.0	16.0	.	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	A	28.0	4.878417	0.91740	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55	5.86	5.86	0.93980	.	0.000000	0.64402	D	0.000013	T	0.63450	0.2512	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.994	D;D;D;D;D	0.77004	0.984;0.989;0.982;0.989;0.965	T	0.67952	-0.5537	10	0.87932	D	0	.	16.2453	0.82441	1.0:0.0:0.0:0.0	.	8163;8163;8092;8092;365	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	S	8163;318;809;8092;8163;8092;7775;2687;325;320;1085;318	ENSP00000356224:I8163S;ENSP00000441052:I318S;ENSP00000356226:I809S;ENSP00000396024:I8092S;ENSP00000265368:I8163S;ENSP00000390975:I8092S;ENSP00000341887:I7775S;ENSP00000349276:I2687S;ENSP00000356220:I1085S;ENSP00000346701:I318S	ENSP00000265368:I8163S	I	-	2	0	SYNE1	152512459	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	9.108000	0.94275	2.241000	0.73720	0.533000	0.62120	ATT	.	A|1.000;G|0.000	.	alt		0.433	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						PASS	.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		50.0	0.0	.		29.0	5.0	.	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.	.	none		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
DDC	1644	hgsc.bcm.edu	37	7	50544331	50544331	+	Silent	SNP	A	A	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr7:50544331A>G	ENST00000444124.2	-	11	1232	c.1032T>C	c.(1030-1032)acT>acC	p.T344T	DDC_ENST00000431062.1_Silent_p.T251T|DDC_ENST00000357936.5_Silent_p.T344T|DDC_ENST00000426377.1_Silent_p.T266T	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	344					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	CCCGGTAGTCAGTGATAAGCC	0.448																																					p.T344T		Atlas-SNP	.											.	DDC	100	.	0			c.T1032C						PASS	.						66.0	63.0	64.0					7																	50544331		2203	4300	6503	SO:0001819	synonymous_variant	1644	exon11			GTAGTCAGTGATA		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.1032T>C	chr7.hg19:g.50544331A>G		25.0	0.0	.		35.0	18.0	.	NM_001082971	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Silent	SNP	ENST00000444124.2	hg19	CCDS5511.1	.	.	.	.	.	.	.	.	.	.	A	7.728	0.698663	0.15106	.	.	ENSG00000132437	ENST00000430300	.	.	.	5.4	-1.93	0.07594	.	.	.	.	.	T	0.40040	0.1101	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29427	-1.0012	4	.	.	.	-0.6052	2.1317	0.03752	0.3061:0.4032:0.16:0.1307	.	.	.	.	P	225	.	.	L	-	2	0	DDC	50511825	0.242000	0.23868	0.997000	0.53966	0.675000	0.39556	-0.925000	0.03992	-0.142000	0.11354	0.528000	0.53228	CTG	.	.	.	none		0.448	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1		
ZNF394	84124	hgsc.bcm.edu	37	7	99092213	99092213	+	Nonsense_Mutation	SNP	G	G	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr7:99092213G>A	ENST00000337673.6	-	3	828	c.625C>T	c.(625-627)Caa>Taa	p.Q209*	ZNF789_ENST00000494186.1_Intron|ZNF394_ENST00000394177.3_5'UTR|ZNF789_ENST00000493485.1_Intron|ZNF394_ENST00000426306.2_3'UTR	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	209	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					AAAATTTGTTGCATTGGAATC	0.473																																					p.Q209X	Ovarian(24;589 697 9939 12704 40742)	Atlas-SNP	.											.	ZNF394	48	.	0			c.C625T						PASS	.						70.0	73.0	72.0					7																	99092213		2200	4300	6500	SO:0001587	stop_gained	84124	exon3			TTTGTTGCATTGG	BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.625C>T	chr7.hg19:g.99092213G>A	ENSP00000337363:p.Gln209*	26.0	0.0	.		23.0	14.0	.	NM_032164	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Nonsense_Mutation	SNP	ENST00000337673.6	hg19	CCDS5666.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796123	0.50208	.	.	ENSG00000160908	ENST00000337673	.	.	.	4.15	1.19	0.21007	.	0.713278	0.12205	N	0.489912	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	7.4057	0.26989	0.0:0.346:0.4733:0.1808	.	.	.	.	X	209	.	ENSP00000337363:Q209X	Q	-	1	0	ZNF394	98930149	0.061000	0.20836	0.486000	0.27416	0.517000	0.34286	0.594000	0.24014	0.246000	0.21394	0.655000	0.94253	CAA	.	.	.	none		0.473	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336498.1	NM_032164	
ZC3HAV1	56829	hgsc.bcm.edu	37	7	138738235	138738235	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr7:138738235C>G	ENST00000242351.5	-	12	2727	c.2411G>C	c.(2410-2412)aGt>aCt	p.S804T	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.S926T	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	804	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						ATGTAGGAAACTGTCAAAATT	0.388																																					p.S804T		Atlas-SNP	.											.	ZC3HAV1	75	.	0			c.G2411C						PASS	.						143.0	144.0	143.0					7																	138738235		2203	4300	6503	SO:0001583	missense	56829	exon12			AGGAAACTGTCAA	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.2411G>C	chr7.hg19:g.138738235C>G	ENSP00000242351:p.Ser804Thr	56.0	0.0	.		102.0	47.0	.	NM_020119	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	hg19	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.772816	0.31411	.	.	ENSG00000105939	ENST00000242351;ENST00000464606	T;T	0.13420	2.59;2.59	5.2	3.36	0.38483	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.612362	0.14791	N	0.298256	T	0.08088	0.0202	N	0.14661	0.345	0.58432	D	0.999993	B	0.06786	0.001	B	0.11329	0.006	T	0.18398	-1.0338	10	0.34782	T	0.22	.	8.3898	0.32522	0.0:0.8094:0.0:0.1906	.	804	Q7Z2W4	ZCCHV_HUMAN	T	804;926	ENSP00000242351:S804T;ENSP00000418385:S926T	ENSP00000242351:S804T	S	-	2	0	ZC3HAV1	138388775	0.999000	0.42202	0.028000	0.17463	0.004000	0.04260	2.248000	0.43160	1.323000	0.45263	0.563000	0.77884	AGT	.	.	.	none		0.388	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
HIPK2	28996	hgsc.bcm.edu	37	7	139316430	139316430	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr7:139316430A>G	ENST00000406875.3	-	3	1239	c.1145T>C	c.(1144-1146)aTt>aCt	p.I382T	HIPK2_ENST00000428878.2_Missense_Mutation_p.I382T|HIPK2_ENST00000342645.6_Missense_Mutation_p.I382T	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	382	Interaction with DAXX.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					CCACATGTCAATTGCCTCACA	0.468																																					p.I382T		Atlas-SNP	.											.	HIPK2	192	.	0			c.T1145C						PASS	.						99.0	95.0	96.0					7																	139316430		1992	4197	6189	SO:0001583	missense	28996	exon3			ATGTCAATTGCCT	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.1145T>C	chr7.hg19:g.139316430A>G	ENSP00000385571:p.Ile382Thr	53.0	0.0	.		95.0	55.0	.	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	hg19		.	.	.	.	.	.	.	.	.	.	A	23.1	4.378002	0.82682	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.20200	2.09;2.09;2.09	5.18	5.18	0.71444	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.47985	0.1475	.	.	.	0.58432	D	0.999998	P;D	0.61080	0.946;0.989	P;D	0.75020	0.659;0.985	T	0.52518	-0.8565	8	0.87932	D	0	.	15.2032	0.73157	1.0:0.0:0.0:0.0	.	382;382	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	T	382	ENSP00000385571:I382T;ENSP00000413724:I382T;ENSP00000343108:I382T	ENSP00000343108:I382T	I	-	2	0	HIPK2	138966970	1.000000	0.71417	0.903000	0.35520	0.964000	0.63967	8.974000	0.93433	2.180000	0.69256	0.383000	0.25322	ATT	.	.	.	none		0.468	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
EPHB6	2051	hgsc.bcm.edu	37	7	142562074	142562074	+	Silent	SNP	C	C	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr7:142562074C>T	ENST00000392957.2	+	7	1303	c.516C>T	c.(514-516)tcC>tcT	p.S172S	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Silent_p.S172S	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	172	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					cctcctcctcctcttcttcct	0.622																																					p.S172S		Atlas-SNP	.											.	EPHB6	168	.	0			c.C516T						PASS	.						83.0	98.0	93.0					7																	142562074		2200	4299	6499	SO:0001819	synonymous_variant	2051	exon7			CTCCTCCTCTTCT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.516C>T	chr7.hg19:g.142562074C>T		52.0	0.0	.		87.0	4.0	.	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	hg19	CCDS5873.2																																																																																			.	.	.	none		0.622	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
RGS3	5998	hgsc.bcm.edu	37	9	116276826	116276826	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr9:116276826C>A	ENST00000374140.2	+	16	1775	c.1566C>A	c.(1564-1566)caC>caA	p.H522Q	RGS3_ENST00000317613.6_Missense_Mutation_p.H410Q|RGS3_ENST00000394646.3_Missense_Mutation_p.H241Q|RGS3_ENST00000374136.1_Missense_Mutation_p.H148Q|RGS3_ENST00000343817.5_Missense_Mutation_p.H241Q|RGS3_ENST00000350696.5_Missense_Mutation_p.H522Q	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	522					inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						TGAAGGGCCACGGGAACTACC	0.572																																					p.H522Q		Atlas-SNP	.											.	RGS3	251	.	0			c.C1566A						PASS	.						128.0	99.0	109.0					9																	116276826		2203	4300	6503	SO:0001583	missense	5998	exon16			GGGCCACGGGAAC	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.1566C>A	chr9.hg19:g.116276826C>A	ENSP00000363255:p.His522Gln	68.0	0.0	.		97.0	38.0	.	NM_144488	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	ENST00000374140.2	hg19	CCDS43869.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487145	0.44249	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000317613;ENST00000343817;ENST00000394646;ENST00000374136	T;T;T;T;T	0.64438	0.83;0.83;1.21;0.34;-0.1	5.08	-10.2	0.00374	.	0.175530	0.51477	D	0.000089	T	0.36908	0.0984	N	0.14661	0.345	0.37206	D	0.904586	B;B;P;P;P;P	0.41673	0.026;0.302;0.754;0.64;0.759;0.729	B;B;B;B;B;B	0.40940	0.012;0.059;0.344;0.186;0.237;0.318	T	0.68788	-0.5316	10	0.72032	D	0.01	.	12.3146	0.54948	0.0997:0.6511:0.0:0.2493	.	241;148;241;412;410;522	B3KUB2;Q5VXC0;P49796-4;B3KWG8;P49796-5;P49796	.;.;.;.;.;RGS3_HUMAN	Q	522;522;410;241;241;148	ENSP00000363255:H522Q;ENSP00000259406:H522Q;ENSP00000312844:H410Q;ENSP00000340284:H241Q;ENSP00000378141:H241Q	ENSP00000312844:H410Q	H	+	3	2	RGS3	115316647	0.003000	0.15002	0.040000	0.18447	0.978000	0.69477	-1.926000	0.01562	-2.740000	0.00379	-0.340000	0.08031	CAC	.	.	.	none		0.572	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790	
PAPPA	5069	hgsc.bcm.edu	37	9	118969802	118969802	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr9:118969802T>A	ENST00000328252.3	+	3	1915	c.1546T>A	c.(1546-1548)Ttc>Atc	p.F516I	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	516	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TCTCAATATTTTCTTTGCAAA	0.423																																					p.F516I		Atlas-SNP	.											.	PAPPA	243	.	0			c.T1546A						PASS	.						78.0	77.0	77.0					9																	118969802		2203	4300	6503	SO:0001583	missense	5069	exon3			AATATTTTCTTTG		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1546T>A	chr9.hg19:g.118969802T>A	ENSP00000330658:p.Phe516Ile	40.0	0.0	.		56.0	27.0	.	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	hg19	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	T	36	5.692924	0.96793	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.02345	4.33	6.17	6.17	0.99709	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.15998	0.0385	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.999;0.984	D;P	0.68943	0.961;0.844	T	0.00036	-1.2256	10	0.87932	D	0	-24.8985	16.8222	0.85835	0.0:0.0:0.0:1.0	.	58;516	E7EMD3;Q13219	.;PAPP1_HUMAN	I	516;58	ENSP00000330658:F516I	ENSP00000330658:F516I	F	+	1	0	PAPPA	118009623	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.008000	0.88588	2.371000	0.80710	0.533000	0.62120	TTC	.	.	.	none		0.423	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
GLT6D1	360203	hgsc.bcm.edu	37	9	138516059	138516059	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr9:138516059T>C	ENST00000371763.1	-	5	968	c.715A>G	c.(715-717)Att>Gtt	p.I239V		NM_182974.2	NP_892019.2	Q7Z4J2	GL6D1_HUMAN	glycosyltransferase 6 domain containing 1	239					carbohydrate metabolic process (GO:0005975)	integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	15		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)		AAGTCTAAAATATTATGGGGT	0.403																																					p.I239V		Atlas-SNP	.											.	GLT6D1	56	.	0			c.A715G						PASS	.						122.0	120.0	121.0					9																	138516059		1857	4098	5955	SO:0001583	missense	360203	exon5			CTAAAATATTATG	AY336054	CCDS43900.1	9q34.3	2013-02-22	2004-09-16	2004-09-17	ENSG00000204007	ENSG00000204007		"""Glycosyltransferase family 6 domain containing"""	23671	protein-coding gene	gene with protein product		613699	"""galactosyltransferase family 6 domain containing 1"""	GLTDC1			Standard	NM_182974		Approved		uc010nbd.1	Q7Z4J2	OTTHUMG00000020911	ENST00000371763.1:c.715A>G	chr9.hg19:g.138516059T>C	ENSP00000360829:p.Ile239Val	56.0	0.0	.		64.0	25.0	.	NM_182974		Missense_Mutation	SNP	ENST00000371763.1	hg19	CCDS43900.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.711905	0.00712	.	.	ENSG00000204007	ENST00000371763	T	0.00949	5.51	3.49	-4.46	0.03536	.	1.290870	0.05318	N	0.526126	T	0.00300	0.0009	N	0.00252	-1.77	0.09310	N	1	B	0.14438	0.01	B	0.15870	0.014	T	0.46148	-0.9212	10	0.02654	T	1	-13.1181	6.5445	0.22398	0.132:0.229:0.0:0.639	.	239	Q7Z4J2	GL6D1_HUMAN	V	239	ENSP00000360829:I239V	ENSP00000360829:I239V	I	-	1	0	GLT6D1	137655880	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.867000	0.04241	-1.120000	0.02953	-0.912000	0.02778	ATT	.	.	.	none		0.403	GLT6D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055005.2	NM_182974	
TET1	80312	hgsc.bcm.edu	37	10	70404540	70404540	+	Nonsense_Mutation	SNP	T	T	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr10:70404540T>A	ENST00000373644.4	+	4	2263	c.2054T>A	c.(2053-2055)tTg>tAg	p.L685*		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	685					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GAACAAAAATTGGAATTGAAC	0.393																																					p.L685X		Atlas-SNP	.											.	TET1	255	.	0			c.T2054A						PASS	.						64.0	60.0	62.0					10																	70404540		2203	4300	6503	SO:0001587	stop_gained	80312	exon4			AAAAATTGGAATT	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2054T>A	chr10.hg19:g.70404540T>A	ENSP00000362748:p.Leu685*	229.0	0.0	.		260.0	104.0	.	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Nonsense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	T	39	7.512099	0.98329	.	.	ENSG00000138336	ENST00000373644	.	.	.	5.93	2.37	0.29283	.	0.975799	0.08385	N	0.953916	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8223	0.40889	0.0:0.1927:0.0:0.8073	.	.	.	.	X	685	.	ENSP00000362748:L685X	L	+	2	0	TET1	70074546	1.000000	0.71417	0.927000	0.36925	0.820000	0.46376	2.257000	0.43240	0.161000	0.19458	-1.054000	0.02325	TTG	.	.	.	none		0.393	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
CTR9	9646	hgsc.bcm.edu	37	11	10789494	10789494	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr11:10789494G>A	ENST00000361367.2	+	14	2254	c.1828G>A	c.(1828-1830)Gtg>Atg	p.V610M		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	610					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CCTTGGCAACGTGTGGCTCCA	0.428																																					p.V610M		Atlas-SNP	.											.	CTR9	94	.	0			c.G1828A						PASS	.						186.0	174.0	178.0					11																	10789494		2201	4294	6495	SO:0001583	missense	9646	exon14			GGCAACGTGTGGC	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.1828G>A	chr11.hg19:g.10789494G>A	ENSP00000355013:p.Val610Met	77.0	0.0	.		105.0	32.0	.	NM_014633	D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	hg19	CCDS7805.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559522	0.65538	.	.	ENSG00000198730	ENST00000361367	T	0.47528	0.84	5.56	5.56	0.83823	Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.47116	0.1428	M	0.64404	1.975	0.80722	D	1	B	0.32526	0.374	B	0.20955	0.032	T	0.49360	-0.8948	10	0.54805	T	0.06	-10.6378	19.5083	0.95130	0.0:0.0:1.0:0.0	.	610	Q6PD62	CTR9_HUMAN	M	610	ENSP00000355013:V610M	ENSP00000355013:V610M	V	+	1	0	CTR9	10746070	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	9.792000	0.99085	2.620000	0.88729	0.467000	0.42956	GTG	.	.	.	none		0.428	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633	
EHBP1L1	254102	hgsc.bcm.edu	37	11	65349066	65349066	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr11:65349066A>G	ENST00000309295.4	+	9	1188	c.923A>G	c.(922-924)aAa>aGa	p.K308R		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	308						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						CGGCTCCGGAAAGGCTCTGAT	0.682																																					p.K308R		Atlas-SNP	.											.	EHBP1L1	64	.	0			c.A923G						PASS	.						8.0	9.0	8.0					11																	65349066		1828	4032	5860	SO:0001583	missense	254102	exon9			TCCGGAAAGGCTC	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.923A>G	chr11.hg19:g.65349066A>G	ENSP00000312671:p.Lys308Arg	62.0	0.0	.		89.0	41.0	.	NM_001099409	Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	hg19	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.396496	0.62177	.	.	ENSG00000173442	ENST00000309295;ENST00000533237	T;D	0.82255	-0.41;-1.59	4.13	2.98	0.34508	.	0.537435	0.17622	N	0.167700	D	0.83170	0.5196	L	0.36672	1.1	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.81538	-0.0887	10	0.54805	T	0.06	.	4.8457	0.13512	0.855:0.0:0.145:0.0	.	308	Q8N3D4	EH1L1_HUMAN	R	308	ENSP00000312671:K308R;ENSP00000431996:K308R	ENSP00000312671:K308R	K	+	2	0	EHBP1L1	65105642	0.996000	0.38824	1.000000	0.80357	0.736000	0.42039	0.565000	0.23578	1.744000	0.51775	0.459000	0.35465	AAA	.	.	.	none		0.682	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658	
BIRC2	329	hgsc.bcm.edu	37	11	102221170	102221170	+	Silent	SNP	A	A	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr11:102221170A>G	ENST00000227758.2	+	2	1984	c.585A>G	c.(583-585)ccA>ccG	p.P195P	BIRC2_ENST00000532672.1_Silent_p.P174P|BIRC2_ENST00000530675.1_Silent_p.P146P|BIRC2_ENST00000527910.1_3'UTR	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	195					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		ATATGTGGCCATTAACTTTTT	0.428																																					p.P195P		Atlas-SNP	.											.	BIRC2	51	.	0			c.A585G						PASS	.						114.0	115.0	115.0					11																	102221170		2203	4299	6502	SO:0001819	synonymous_variant	329	exon2			GTGGCCATTAACT	L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.585A>G	chr11.hg19:g.102221170A>G		55.0	0.0	.		54.0	18.0	.	NM_001256163	B4E026|Q16516|Q4TTG0	Silent	SNP	ENST00000227758.2	hg19	CCDS8316.1																																																																																			.	.	.	none		0.428	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	NM_001166	
SLC4A8	9498	hgsc.bcm.edu	37	12	51844689	51844689	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr12:51844689A>G	ENST00000453097.2	+	3	377	c.160A>G	c.(160-162)Atg>Gtg	p.M54V	SLC4A8_ENST00000394856.1_Start_Codon_SNP_p.M1V|SLC4A8_ENST00000535225.2_Start_Codon_SNP_p.M1V|SLC4A8_ENST00000358657.3_Missense_Mutation_p.M81V|SLC4A8_ENST00000514353.3_Start_Codon_SNP_p.M1V	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		GGGAGTTCGGATGCCGCTTGG	0.552																																					p.M54V		Atlas-SNP	.											.	SLC4A8	292	.	0			c.A160G						PASS	.						28.0	28.0	28.0					12																	51844689		2203	4299	6502	SO:0001583	missense	9498	exon3			GTTCGGATGCCGC	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.160A>G	chr12.hg19:g.51844689A>G	ENSP00000405812:p.Met54Val	124.0	0.0	.		158.0	67.0	.	NM_001039960		Missense_Mutation	SNP	ENST00000453097.2	hg19	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	A	14.95	2.687601	0.48097	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000547697;ENST00000551071	T;T;T;T;T	0.73681	-0.25;-0.77;-0.76;-0.23;-0.23	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.50905	0.1643	N	0.05510	-0.035	0.80722	D	1	B;B;B;B;B;B;B	0.09022	0.002;0.0;0.0;0.0;0.0;0.0;0.002	B;B;B;B;B;B;B	0.06405	0.001;0.002;0.001;0.001;0.002;0.002;0.002	T	0.51244	-0.8730	10	0.02654	T	1	.	14.0718	0.64865	1.0:0.0:0.0:0.0	.	1;81;1;54;54;54;1	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6;F8VSA8	.;.;.;S4A8_HUMAN;.;.;.	V	1;81;54;1;54;1;1;1	ENSP00000441520:M1V;ENSP00000351483:M81V;ENSP00000405812:M54V;ENSP00000378325:M1V;ENSP00000442561:M1V	ENSP00000315789:M54V	M	+	1	0	SLC4A8	50130956	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.797000	0.75150	2.039000	0.60335	0.379000	0.24179	ATG	.	.	.	none		0.552	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	
ANKLE2	23141	hgsc.bcm.edu	37	12	133331516	133331516	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr12:133331516C>T	ENST00000357997.5	-	2	474	c.385G>A	c.(385-387)Gct>Act	p.A129T	ANKLE2_ENST00000337516.5_Missense_Mutation_p.A129T|ANKLE2_ENST00000539605.1_Missense_Mutation_p.A67T	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	129					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		TGGCTGAGAGCTGTGACACCT	0.468																																					p.A129T		Atlas-SNP	.											.	ANKLE2	76	.	0			c.G385A						PASS	.						62.0	63.0	62.0					12																	133331516		1925	4138	6063	SO:0001583	missense	23141	exon2			TGAGAGCTGTGAC	AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.385G>A	chr12.hg19:g.133331516C>T	ENSP00000350686:p.Ala129Thr	64.0	0.0	.		98.0	35.0	.	NM_015114	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	ENST00000357997.5	hg19	CCDS41869.1	.	.	.	.	.	.	.	.	.	.	c	10.97	1.501322	0.26861	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000337516	T;T;T	0.31769	1.91;1.89;1.48	5.27	-1.39	0.08997	.	0.968721	0.08558	N	0.927956	T	0.18130	0.0435	L	0.37561	1.115	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.30736	-0.9968	10	0.20519	T	0.43	-4.831	1.7839	0.03038	0.2934:0.4018:0.096:0.2088	.	129;129	Q86XL3-2;Q86XL3	.;ANKL2_HUMAN	T	67;129;129	ENSP00000446268:A67T;ENSP00000350686:A129T;ENSP00000337651:A129T	ENSP00000337651:A129T	A	-	1	0	ANKLE2	131841589	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.313000	0.02718	-1.011000	0.03391	-2.167000	0.00324	GCT	.	.	.	none		0.468	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397712.1		
USP12	219333	hgsc.bcm.edu	37	13	27669947	27669947	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr13:27669947G>T	ENST00000282344.6	-	4	620	c.364C>A	c.(364-366)Caa>Aaa	p.Q122K		NM_182488.3	NP_872294.2	O75317	UBP12_HUMAN	ubiquitin specific peptidase 12	122	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Lung SC(185;0.0161)		all cancers(112;0.0508)|GBM - Glioblastoma multiforme(144;0.168)|Epithelial(112;0.244)|OV - Ovarian serous cystadenocarcinoma(117;0.246)		GCATCTTGTTGCATGTAGTTG	0.264																																					p.Q122K	Ovarian(37;808 911 7590 44442 44991)	Atlas-SNP	.											.	USP12	35	.	0			c.C364A						PASS	.						39.0	41.0	40.0					13																	27669947		2201	4295	6496	SO:0001583	missense	219333	exon4			CTTGTTGCATGTA	AL049221	CCDS31952.1	13q12.13	2010-05-12	2005-08-08	2003-10-08	ENSG00000152484	ENSG00000152484		"""Ubiquitin-specific peptidases"""	20485	protein-coding gene	gene with protein product			"""ubiquitin specific protease 12 like 1"", ""ubiquitin specific protease 12"""	USP12L1		12838346	Standard	NM_182488		Approved		uc001uqy.3	O75317	OTTHUMG00000016626	ENST00000282344.6:c.364C>A	chr13.hg19:g.27669947G>T	ENSP00000282344:p.Gln122Lys	51.0	0.0	.		51.0	12.0	.	NM_182488	A8K0X0|Q5VZV3|Q8TC49	Missense_Mutation	SNP	ENST00000282344.6	hg19	CCDS31952.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992997	0.93167	.	.	ENSG00000152484	ENST00000282344	T	0.56776	0.44	5.54	5.54	0.83059	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.85566	0.5726	H	0.99535	4.615	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.91509	0.5225	10	0.72032	D	0.01	-19.9417	19.8379	0.96666	0.0:0.0:1.0:0.0	.	122	O75317	UBP12_HUMAN	K	122	ENSP00000282344:Q122K	ENSP00000282344:Q122K	Q	-	1	0	USP12	26567947	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.700000	0.98707	2.765000	0.95021	0.655000	0.94253	CAA	.	.	.	none		0.264	USP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044264.1	NM_182488	
FLRT2	23768	hgsc.bcm.edu	37	14	86088353	86088353	+	Silent	SNP	T	T	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr14:86088353T>C	ENST00000330753.4	+	2	1262	c.495T>C	c.(493-495)ttT>ttC	p.F165F	FLRT2_ENST00000554746.1_Silent_p.F165F	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	165					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		AATTGTTGTTTTTGTCTAAGA	0.498																																					p.F165F		Atlas-SNP	.											.	FLRT2	168	.	0			c.T495C						PASS	.						59.0	61.0	61.0					14																	86088353		2203	4300	6503	SO:0001819	synonymous_variant	23768	exon2			GTTGTTTTTGTCT	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.495T>C	chr14.hg19:g.86088353T>C		44.0	0.0	.		62.0	20.0	.	NM_013231	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	hg19	CCDS9877.1																																																																																			.	.	.	none		0.498	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
WDR25	79446	hgsc.bcm.edu	37	14	100996202	100996202	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr14:100996202T>A	ENST00000335290.6	+	7	1685	c.1459T>A	c.(1459-1461)Ttg>Atg	p.L487M	WDR25_ENST00000554998.1_Missense_Mutation_p.L487M|WDR25_ENST00000542471.2_Missense_Mutation_p.L230M|WDR25_ENST00000557502.1_3'UTR|WDR25_ENST00000402312.3_Missense_Mutation_p.L487M	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	487										central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				AGGCGGTGACTTGCTGGTGAC	0.662																																					p.L487M		Atlas-SNP	.											.	WDR25	37	.	0			c.T1459A						PASS	.						63.0	60.0	61.0					14																	100996202		2203	4300	6503	SO:0001583	missense	79446	exon7			GGTGACTTGCTGG	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.1459T>A	chr14.hg19:g.100996202T>A	ENSP00000334148:p.Leu487Met	36.0	0.0	.		53.0	19.0	.	NM_001161476	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Missense_Mutation	SNP	ENST00000335290.6	hg19	CCDS32157.1	.	.	.	.	.	.	.	.	.	.	T	12.17	1.858302	0.32791	.	.	ENSG00000176473	ENST00000554998;ENST00000402312;ENST00000335290;ENST00000542471	T;T;T;T	0.01455	4.87;4.87;4.87;4.87	4.83	0.608	0.17569	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.375063	0.24571	N	0.037382	T	0.03959	0.0111	L	0.49350	1.555	0.26397	N	0.97649	P;D	0.54964	0.655;0.969	B;P	0.60541	0.269;0.876	T	0.32428	-0.9907	10	0.49607	T	0.09	-14.2158	3.7184	0.08446	0.136:0.5689:0.1327:0.1624	.	230;487	Q64LD2-2;Q64LD2	.;WDR25_HUMAN	M	487;487;487;230	ENSP00000450661:L487M;ENSP00000385540:L487M;ENSP00000334148:L487M;ENSP00000441903:L230M	ENSP00000334148:L487M	L	+	1	2	WDR25	100065955	0.519000	0.26242	0.987000	0.45799	0.242000	0.25591	1.074000	0.30703	0.547000	0.28938	-0.132000	0.14878	TTG	.	.	.	none		0.662	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515	
CYFIP1	23191	hgsc.bcm.edu	37	15	22991163	22991163	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr15:22991163C>T	ENST00000313077.7	+	25	2977	c.2852C>T	c.(2851-2853)aCg>aTg	p.T951M	CYFIP1_ENST00000435939.2_Missense_Mutation_p.T520M|CYFIP1_ENST00000560848.1_Missense_Mutation_p.T951M	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TACGTGAAGACGCTGATGGAG	0.652																																					p.T951M		Atlas-SNP	.											.	CYFIP1	159	.	0			c.C2852T						PASS	.						70.0	51.0	58.0					15																	22991163		2203	4300	6503	SO:0001583	missense	23191	exon25			TGAAGACGCTGAT	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2852C>T	chr15.hg19:g.22991163C>T	ENSP00000324549:p.Thr951Met	11.0	0.0	.		24.0	13.0	.	NM_014608		Missense_Mutation	SNP	ENST00000313077.7	hg19	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	C	34	5.373132	0.95923	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.24151	1.87;1.87	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000001	T	0.53626	0.1808	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.953;0.946	T	0.52260	-0.8599	10	0.62326	D	0.03	-26.4779	19.9018	0.96988	0.0:1.0:0.0:0.0	.	979;520;951	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	M	951;979;520	ENSP00000324549:T951M;ENSP00000405956:T520M	ENSP00000324549:T951M	T	+	2	0	CYFIP1	20542604	1.000000	0.71417	0.983000	0.44433	0.994000	0.84299	7.645000	0.83430	2.787000	0.95880	0.555000	0.69702	ACG	.	.	.	none		0.652	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
PARN	5073	hgsc.bcm.edu	37	16	14704668	14704668	+	Splice_Site	SNP	T	T	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr16:14704668T>G	ENST00000437198.2	-	7	530		c.e7-2		PARN_ENST00000341484.7_Splice_Site|PARN_ENST00000566021.1_Splice_Site|PARN_ENST00000539279.1_Intron|PARN_ENST00000420015.2_Splice_Site	NM_001134477.2|NM_002582.3	NP_001127949.1|NP_002573.1	O95453	PARN_HUMAN	poly(A)-specific ribonuclease						female gamete generation (GO:0007292)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA metabolic process (GO:0016070)|RNA modification (GO:0009451)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|nuclease activity (GO:0004518)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(A)-specific ribonuclease activity (GO:0004535)|protein kinase binding (GO:0019901)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|urinary_tract(1)	21						ATGGAATTCCTAAACACGATT	0.338																																					.		Atlas-SNP	.											.	PARN	72	.	0			c.251-2A>C						PASS	.						135.0	130.0	131.0					16																	14704668		1838	4100	5938	SO:0001630	splice_region_variant	5073	exon7			AATTCCTAAACAC	AJ005698	CCDS45419.1, CCDS45420.1, CCDS58425.1	16p13	2014-08-08	2011-07-07		ENSG00000140694	ENSG00000140694	3.1.13.4		8609	protein-coding gene	gene with protein product	"""deadenylation nuclease"""	604212	"""poly(A)-specific ribonuclease (deadenylation nuclease)"""			10640832	Standard	NM_002582		Approved	DAN	uc010uzd.2	O95453	OTTHUMG00000173199	ENST00000437198.2:c.389-2A>C	chr16.hg19:g.14704668T>G		32.0	0.0	.		62.0	21.0	.	NM_001242992	B2RCB3|B4DDG8|B4DWR4|B4E1H6	Splice_Site	SNP	ENST00000437198.2	hg19	CCDS45419.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.015177	0.54468	.	.	ENSG00000140694	ENST00000437198;ENST00000341484;ENST00000420015;ENST00000538472	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1186	0.72423	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PARN	14612169	1.000000	0.71417	0.986000	0.45419	0.714000	0.41099	6.526000	0.73799	2.222000	0.72286	0.533000	0.62120	.	.	.	.	none		0.338	PARN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422383.1	NM_002582	Intron
ACSM1	116285	hgsc.bcm.edu	37	16	20651870	20651870	+	Silent	SNP	G	G	A	rs377637288	byFrequency	TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr16:20651870G>A	ENST00000307493.4	-	7	1096	c.1029C>T	c.(1027-1029)ggC>ggT	p.G343G	ACSM1_ENST00000520010.1_Silent_p.G343G|ACSM1_ENST00000219151.4_5'UTR	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	343					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						CGACCTCCCCGCCAGTATAGC	0.572													G|||	3	0.000599042	0.0	0.0	5008	,	,		18070	0.0		0.0	False		,,,				2504	0.0031				p.G343G		Atlas-SNP	.											ACSM1,caecum,carcinoma,0,1	ACSM1	118	.	0			c.C1029T						PASS	.	G		0,4402		0,0,2201	94.0	77.0	83.0		1029	-8.5	0.0	16		83	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ACSM1	NM_052956.2		0,1,6500	AA,AG,GG		0.0116,0.0,0.0077		343/578	20651870	1,13001	2201	4300	6501	SO:0001819	synonymous_variant	116285	exon7			CTCCCCGCCAGTA	AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.1029C>T	chr16.hg19:g.20651870G>A		70.0	0.0	.		119.0	69.0	.	NM_052956	Q08AH2|Q96A20	Silent	SNP	ENST00000307493.4	hg19	CCDS10587.1	.	.	.	.	.	.	.	.	.	.	G	3.898	-0.022674	0.07634	0.0	1.16E-4	ENSG00000166743	ENST00000524149	.	.	.	4.83	-8.51	0.00923	.	.	.	.	.	T	0.36082	0.0954	.	.	.	0.30763	N	0.743914	.	.	.	.	.	.	T	0.42103	-0.9471	4	.	.	.	.	11.4682	0.50252	0.6558:0.0947:0.2495:0.0	.	.	.	.	V	49	.	.	A	-	2	0	ACSM1	20559371	0.000000	0.05858	0.013000	0.15412	0.000000	0.00434	-3.438000	0.00471	-2.125000	0.00821	-1.821000	0.00599	GCG	.	.	.	weak		0.572	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956	
TAT	6898	hgsc.bcm.edu	37	16	71607494	71607494	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr16:71607494C>T	ENST00000355962.4	-	4	489	c.356G>A	c.(355-357)cGg>cAg	p.R119Q	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	119					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	AATCTCCTCCCGACTGGATAG	0.473																																					p.R119Q	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	Atlas-SNP	.											.	TAT	80	.	0			c.G356A						PASS	.						60.0	55.0	56.0					16																	71607494		2187	4269	6456	SO:0001583	missense	6898	exon4			TCCTCCCGACTGG		CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.356G>A	chr16.hg19:g.71607494C>T	ENSP00000348234:p.Arg119Gln	59.0	0.0	.		95.0	32.0	.	NM_000353	B2R8I1|D3DWS2	Missense_Mutation	SNP	ENST00000355962.4	hg19	CCDS10903.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454470	0.84209	.	.	ENSG00000198650	ENST00000355962	D	0.91686	-2.89	6.01	6.01	0.97437	Tyrosine aminotransferase (1);Aminotransferase, class I/classII (1);Tyrosine/nicotianamine aminotransferase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.97589	0.9210	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98231	1.0483	10	0.87932	D	0	-18.9801	18.7017	0.91623	0.0:1.0:0.0:0.0	.	119	P17735	ATTY_HUMAN	Q	119	ENSP00000348234:R119Q	ENSP00000348234:R119Q	R	-	2	0	TAT	70164995	1.000000	0.71417	0.995000	0.50966	0.491000	0.33493	5.645000	0.67909	2.861000	0.98227	0.650000	0.86243	CGG	.	.	.	none		0.473	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1		
ZCCHC14	23174	hgsc.bcm.edu	37	16	87445572	87445572	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr16:87445572G>A	ENST00000268616.4	-	12	2561	c.2344C>T	c.(2344-2346)Ccg>Tcg	p.P782S		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	782	Poly-Pro.						nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		CAGCCTGGCGGGGGTGGGGCG	0.672																																					p.P782S		Atlas-SNP	.											.	ZCCHC14	87	.	0			c.C2344T						PASS	.						5.0	7.0	6.0					16																	87445572		1877	3794	5671	SO:0001583	missense	23174	exon12			CTGGCGGGGGTGG	AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.2344C>T	chr16.hg19:g.87445572G>A	ENSP00000268616:p.Pro782Ser	35.0	0.0	.		64.0	39.0	.	NM_015144	D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	hg19	CCDS10961.1	.	.	.	.	.	.	.	.	.	.	G	0.776	-0.763986	0.02996	.	.	ENSG00000140948	ENST00000268616	T	0.17213	2.29	5.55	4.57	0.56435	.	0.199338	0.43110	D	0.000616	T	0.14700	0.0355	N	0.08118	0	0.09310	N	1	P;D	0.53151	0.939;0.958	P;P	0.52758	0.708;0.609	T	0.11251	-1.0595	10	0.34782	T	0.22	-26.68	12.1873	0.54247	0.0:0.1722:0.8278:0.0	.	782;782	Q8WYQ9-2;Q8WYQ9	.;ZCH14_HUMAN	S	782	ENSP00000268616:P782S	ENSP00000268616:P782S	P	-	1	0	ZCCHC14	86003073	1.000000	0.71417	0.038000	0.18304	0.006000	0.05464	4.357000	0.59436	1.290000	0.44636	0.643000	0.83706	CCG	.	.	.	none		0.672	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144	
SLC25A11	8402	hgsc.bcm.edu	37	17	4841167	4841167	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr17:4841167A>T	ENST00000225665.7	-	8	1154	c.814T>A	c.(814-816)Tac>Aac	p.Y272N	RNF167_ENST00000575111.1_5'Flank|RNF167_ENST00000572430.1_5'Flank|SLC25A11_ENST00000544061.2_Missense_Mutation_p.Y221N|RNF167_ENST00000576229.1_5'Flank|RNF167_ENST00000262482.6_5'Flank|RNF167_ENST00000571816.1_5'Flank	NM_001165417.1|NM_003562.4	NP_001158889.1|NP_003553.2	Q02978	M2OM_HUMAN	solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11	272					alpha-ketoglutarate transport (GO:0015742)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxoglutarate:malate antiporter activity (GO:0015367)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	10						AAGCCCTCGTAGCGGACAACT	0.597																																					p.Y272N	Esophageal Squamous(144;1178 2388 18010 48797)	Atlas-SNP	.											.	SLC25A11	22	.	0			c.T814A						PASS	.						79.0	87.0	84.0					17																	4841167		2203	4300	6503	SO:0001583	missense	8402	exon8			CCTCGTAGCGGAC	X66114	CCDS11059.1, CCDS54069.1	17p13.3	2013-05-22			ENSG00000108528	ENSG00000108528		"""Solute carriers"""	10981	protein-coding gene	gene with protein product		604165		SLC20A4		10072597, 1457818	Standard	NM_003562		Approved	OGC	uc002fzo.2	Q02978	OTTHUMG00000099395	ENST00000225665.7:c.814T>A	chr17.hg19:g.4841167A>T	ENSP00000225665:p.Tyr272Asn	37.0	0.0	.		92.0	23.0	.	NM_003562	F5GY65|O75537|Q969P7	Missense_Mutation	SNP	ENST00000225665.7	hg19	CCDS11059.1	.	.	.	.	.	.	.	.	.	.	A	0.781	-0.762405	0.02996	.	.	ENSG00000108528	ENST00000225665;ENST00000544061	T;T	0.77358	-1.09;-1.09	5.16	5.16	0.70880	Mitochondrial carrier domain (2);	0.206543	0.41712	D	0.000829	T	0.36690	0.0976	N	0.00102	-2.13	0.38778	D	0.954692	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56565	-0.7958	10	0.02654	T	1	-5.1413	12.9924	0.58627	1.0:0.0:0.0:0.0	.	272;272	Q6IBH0;Q02978	.;M2OM_HUMAN	N	272;221	ENSP00000225665:Y272N;ENSP00000440804:Y221N	ENSP00000225665:Y272N	Y	-	1	0	SLC25A11	4781912	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.939000	0.56591	2.164000	0.68074	0.533000	0.62120	TAC	.	.	.	none		0.597	SLC25A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216852.4	NM_003562	
CCDC144A	9720	hgsc.bcm.edu	37	17	16667486	16667487	+	Missense_Mutation	DNP	GA	GA	AG			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr17:16667486_16667487GA>AG	ENST00000360524.8	+	15	4171_4172	c.4095_4096GA>AG	c.(4093-4098)ttGAag>ttAGag	p.K1366E	CCDC144A_ENST00000456009.1_Missense_Mutation_p.K1132E|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.K1366E|CCDC144A_ENST00000443444.2_Missense_Mutation_p.K1366E|CCDC144A_ENST00000399273.1_Missense_Mutation_p.K1366E	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	1366																	GCTACTTGTTGAAGGTTAGCTA	0.351																																					p.L1365L|p.K1366E		Atlas-SNP	.											.	CCDC144A	53	.	0			c.G4095A|c.A4096G						PASS	.																																			SO:0001583	missense	9720	exon15			CTTGTTGAAGGTT|TTGTTGAAGGTTA	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	Exception_encountered	chr17.hg19:g.16667486_16667487delinsAG	ENSP00000353717:p.Lys1366Glu	116.0|113.0	0.0	.		179.0|173.0	37.0|36.0	.	NM_014695	O60311|Q6ZU57	Silent|Missense_Mutation	SNP	ENST00000360524.8	hg19	CCDS45621.1																																																																																			.	.	.	none		0.351	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1		
ZNF207	7756	hgsc.bcm.edu	37	17	30696690	30696690	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr17:30696690C>T	ENST00000321233.6	+	11	1503	c.1349C>T	c.(1348-1350)cCg>cTg	p.P450L	ZNF207_ENST00000394673.2_Missense_Mutation_p.P435L|ZNF207_ENST00000394670.4_Missense_Mutation_p.P466L|ZNF207_ENST00000577908.1_Missense_Mutation_p.P466L|ZNF207_ENST00000342555.6_Missense_Mutation_p.P469L|ZNF207_ENST00000341711.6_Missense_Mutation_p.P367L	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207	450					attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			GGGCAGGGACCGCCAATGGTG	0.522																																					p.P466L		Atlas-SNP	.											ZNF207,NS,malignant_melanoma,0,1	ZNF207	32	.	0			c.C1397T						PASS	.						73.0	65.0	68.0					17																	30696690		2203	4300	6503	SO:0001583	missense	7756	exon12			AGGGACCGCCAAT	AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810	ENST00000321233.6:c.1349C>T	chr17.hg19:g.30696690C>T	ENSP00000322777:p.Pro450Leu	41.0	0.0	.		67.0	18.0	.	NM_001098507	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	Missense_Mutation	SNP	ENST00000321233.6	hg19	CCDS11271.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.711425	0.48517	.	.	ENSG00000010244	ENST00000394670;ENST00000394673;ENST00000394679;ENST00000321233;ENST00000341711;ENST00000342555	T;T	0.49720	0.83;0.77	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.39911	0.1096	N	0.24115	0.695	0.80722	D	1	B;B;B;B;B	0.21688	0.059;0.012;0.012;0.012;0.012	B;B;B;B;B	0.15870	0.014;0.009;0.009;0.009;0.003	T	0.20140	-1.0284	10	0.72032	D	0.01	.	20.1322	0.98003	0.0:1.0:0.0:0.0	.	419;469;466;435;450	A8MTG3;Q59G94;E1P660;O43670-2;O43670	.;.;.;.;ZN207_HUMAN	L	466;419;469;435;367;450	ENSP00000378165:P466L;ENSP00000344913:P367L	ENSP00000322777:P435L	P	+	2	0	ZNF207	27720803	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.640000	0.61368	2.765000	0.95021	0.484000	0.47621	CCG	.	.	.	none		0.522	ZNF207-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256251.2		
PSMD11	5717	hgsc.bcm.edu	37	17	30806379	30806379	+	Silent	SNP	T	T	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr17:30806379T>C	ENST00000261712.3	+	10	1286	c.1023T>C	c.(1021-1023)ccT>ccC	p.P341P	PSMD11_ENST00000457654.2_Silent_p.P341P	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	341	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TCATTGAGCCTTTTTCCAGAG	0.507																																					p.P341P	Ovarian(130;1038 1716 9294 11987 19279)	Atlas-SNP	.											.	PSMD11	41	.	0			c.T1023C						PASS	.						121.0	117.0	118.0					17																	30806379		2203	4300	6503	SO:0001819	synonymous_variant	5717	exon10			TGAGCCTTTTTCC	AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.1023T>C	chr17.hg19:g.30806379T>C		57.0	0.0	.		75.0	4.0	.	NM_002815	A8K3I7|E1P663|O00495|Q53FT5	Silent	SNP	ENST00000261712.3	hg19	CCDS11272.1	.	.	.	.	.	.	.	.	.	.	T	9.740	1.164650	0.21538	.	.	ENSG00000108671	ENST00000457654	.	.	.	5.41	0.333	0.15943	.	.	.	.	.	T	0.50257	0.1605	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35500	-0.9786	4	.	.	.	-8.2709	4.7365	0.12991	0.1519:0.3938:0.0:0.4542	.	.	.	.	L	79	.	.	F	+	1	0	PSMD11	27830492	0.938000	0.31826	0.999000	0.59377	0.989000	0.77384	0.064000	0.14437	0.101000	0.17610	0.459000	0.35465	TTT	.	.	.	none		0.507	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256252.2	NM_002815	
RSAD1	55316	hgsc.bcm.edu	37	17	48557272	48557272	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr17:48557272C>A	ENST00000258955.2	+	3	386	c.301C>A	c.(301-303)Ccc>Acc	p.P101T		NM_018346.1	NP_060816.1	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing 1	101					porphyrin-containing compound biosynthetic process (GO:0006779)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|coproporphyrinogen oxidase activity (GO:0004109)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TGGGGGGACCCCCAGTCTAGC	0.612											OREG0024566	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P101T		Atlas-SNP	.											.	RSAD1	36	.	0			c.C301A						PASS	.						42.0	53.0	49.0					17																	48557272		2203	4300	6503	SO:0001583	missense	55316	exon3			GGGACCCCCAGTC	AK002026	CCDS11569.1	17q21.33	2004-11-08			ENSG00000136444	ENSG00000136444			25634	protein-coding gene	gene with protein product						12477932	Standard	NM_018346		Approved	FLJ11164	uc002iqw.1	Q9HA92	OTTHUMG00000162126	ENST00000258955.2:c.301C>A	chr17.hg19:g.48557272C>A	ENSP00000258955:p.Pro101Thr	57.0	0.0	.	955	118.0	68.0	.	NM_018346	B4DMW0|Q53HV8|Q86VC4|Q9BRY7|Q9NUS7	Missense_Mutation	SNP	ENST00000258955.2	hg19	CCDS11569.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.899032	0.91962	.	.	ENSG00000136444	ENST00000258955;ENST00000510554	D	0.87179	-2.22	4.64	4.64	0.57946	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	D	0.96436	0.8837	H	0.98738	4.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98372	1.0554	10	0.87932	D	0	-27.8023	17.2877	0.87146	0.0:1.0:0.0:0.0	.	101;101	B4DEV9;Q9HA92	.;RSAD1_HUMAN	T	101;31	ENSP00000258955:P101T	ENSP00000258955:P101T	P	+	1	0	RSAD1	45912271	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.345000	0.79337	2.397000	0.81536	0.491000	0.48974	CCC	.	.	.	none		0.612	RSAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367413.1	NM_018346	
AXIN2	8313	hgsc.bcm.edu	37	17	63533850	63533850	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr17:63533850G>T	ENST00000375702.5	-	5	1412	c.1304C>A	c.(1303-1305)cCg>cAg	p.P435Q	AXIN2_ENST00000307078.5_Missense_Mutation_p.P435Q			Q9Y2T1	AXIN2_HUMAN	axin 2	435	Interaction with beta-catenin. {ECO:0000250}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						TATCGTCTGCGGGTCTTCCTC	0.672									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.P435Q		Atlas-SNP	.											AXIN2,colon,carcinoma,0,1	AXIN2	92	.	0			c.C1304A						PASS	.						16.0	18.0	17.0					17																	63533850		2175	4255	6430	SO:0001583	missense	8313	exon6	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	GTCTGCGGGTCTT	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1304C>A	chr17.hg19:g.63533850G>T	ENSP00000364854:p.Pro435Gln	22.0	0.0	.		42.0	2.0	.	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000375702.5	hg19		.	.	.	.	.	.	.	.	.	.	G	20.9	4.071338	0.76301	.	.	ENSG00000168646	ENST00000307078;ENST00000375702	T;T	0.69306	-0.39;-0.38	4.93	3.96	0.45880	Axin beta-catenin binding (1);	0.055629	0.85682	D	0.000000	T	0.79701	0.4491	M	0.71036	2.16	0.53688	D	0.999974	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81693	-0.0817	10	0.87932	D	0	-8.8725	12.9793	0.58554	0.0796:0.0:0.9204:0.0	.	435;435	Q9Y2T1;E7ES00	AXIN2_HUMAN;.	Q	435	ENSP00000302625:P435Q;ENSP00000364854:P435Q	ENSP00000302625:P435Q	P	-	2	0	AXIN2	60964312	1.000000	0.71417	0.977000	0.42913	0.948000	0.59901	7.269000	0.78482	1.093000	0.41377	0.650000	0.86243	CCG	.	.	.	none		0.672	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	
ZNF407	55628	hgsc.bcm.edu	37	18	72776216	72776216	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr18:72776216A>G	ENST00000299687.5	+	8	6539	c.6539A>G	c.(6538-6540)cAg>cGg	p.Q2180R		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CCAGGGGTGCAGGACGAGCCG	0.692																																					p.Q2180R		Atlas-SNP	.											.	ZNF407	231	.	0			c.A6539G						PASS	.						17.0	23.0	21.0					18																	72776216		2088	4212	6300	SO:0001583	missense	55628	exon8			GGGTGCAGGACGA	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6539A>G	chr18.hg19:g.72776216A>G	ENSP00000299687:p.Gln2180Arg	29.0	0.0	.		35.0	16.0	.	NM_017757	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	hg19	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	a	6.142	0.394484	0.11638	.	.	ENSG00000215421	ENST00000299687	T	0.12147	2.71	4.63	-1.48	0.08745	.	.	.	.	.	T	0.16981	0.0408	M	0.61703	1.905	0.24952	N	0.99179	B	0.10296	0.003	B	0.12156	0.007	T	0.42666	-0.9438	9	0.72032	D	0.01	.	14.9676	0.71208	0.3463:0.6537:0.0:0.0	.	2180	Q9C0G0	ZN407_HUMAN	R	2180	ENSP00000299687:Q2180R	ENSP00000299687:Q2180R	Q	+	2	0	ZNF407	70905204	0.994000	0.37717	0.013000	0.15412	0.036000	0.12997	2.459000	0.45023	0.362000	0.24319	0.457000	0.33378	CAG	.	.	.	none		0.692	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
ZNF407	55628	hgsc.bcm.edu	37	18	72776240	72776240	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr18:72776240A>G	ENST00000299687.5	+	8	6563	c.6563A>G	c.(6562-6564)cAc>cGc	p.H2188R		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CTGTACTCCCACACCGTGCTG	0.692																																					p.H2188R		Atlas-SNP	.											.	ZNF407	231	.	0			c.A6563G						PASS	.						14.0	19.0	17.0					18																	72776240		2039	4186	6225	SO:0001583	missense	55628	exon8			ACTCCCACACCGT	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6563A>G	chr18.hg19:g.72776240A>G	ENSP00000299687:p.His2188Arg	29.0	0.0	.		34.0	13.0	.	NM_017757	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	hg19	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	a	14.35	2.510614	0.44660	.	.	ENSG00000215421	ENST00000299687	T	0.13538	2.58	4.77	4.77	0.60923	.	.	.	.	.	T	0.36524	0.0970	M	0.71581	2.175	0.80722	D	1	D	0.71674	0.998	D	0.83275	0.996	T	0.15752	-1.0426	9	0.87932	D	0	.	14.3168	0.66457	1.0:0.0:0.0:0.0	.	2188	Q9C0G0	ZN407_HUMAN	R	2188	ENSP00000299687:H2188R	ENSP00000299687:H2188R	H	+	2	0	ZNF407	70905228	1.000000	0.71417	0.841000	0.33234	0.047000	0.14425	4.479000	0.60236	2.194000	0.70268	0.457000	0.33378	CAC	.	.	.	none		0.692	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
SAFB2	9667	hgsc.bcm.edu	37	19	5587272	5587272	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr19:5587272G>T	ENST00000252542.4	-	21	3108	c.2844C>A	c.(2842-2844)caC>caA	p.H948Q		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	948	Interacts with SAFB1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		GGCGGGTGAAgtgggggtacg	0.647																																					p.H948Q	Ovarian(127;888 1728 23957 44128 52668)	Atlas-SNP	.											.	SAFB2	90	.	0			c.C2844A						PASS	.						21.0	23.0	22.0					19																	5587272		2203	4299	6502	SO:0001583	missense	9667	exon21			GGTGAAGTGGGGG	D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.2844C>A	chr19.hg19:g.5587272G>T	ENSP00000252542:p.His948Gln	95.0	0.0	.		114.0	46.0	.	NM_014649	B4DKG3|Q8TB13	Missense_Mutation	SNP	ENST00000252542.4	hg19	CCDS32879.1	.	.	.	.	.	.	.	.	.	.	g	13.86	2.363959	0.41902	.	.	ENSG00000130254	ENST00000252542	T	0.08282	3.11	3.73	3.73	0.42828	.	0.618569	0.14577	N	0.311114	T	0.07143	0.0181	L	0.36672	1.1	0.30505	N	0.769985	B	0.30482	0.281	B	0.26517	0.07	T	0.07121	-1.0789	10	0.59425	D	0.04	-9.5501	7.3079	0.26457	0.1263:0.0:0.8737:0.0	.	948	Q14151	SAFB2_HUMAN	Q	948	ENSP00000252542:H948Q	ENSP00000252542:H948Q	H	-	3	2	SAFB2	5538272	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	0.856000	0.27818	1.614000	0.50241	0.561000	0.74099	CAC	.	.	.	none		0.647	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451016.1	NM_014649	
ZNF709	163051	hgsc.bcm.edu	37	19	12575957	12575957	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr19:12575957G>C	ENST00000397732.3	-	4	950	c.779C>G	c.(778-780)gCt>gGt	p.A260G	CTD-3105H18.18_ENST00000598753.1_Intron|ZNF709_ENST00000428311.1_Missense_Mutation_p.A260G	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						ATATCTGAAAGCTTTTCCACA	0.388																																					p.A260G	GBM(33;565 669 12371 29134 51667)	Atlas-SNP	.											.	ZNF709	80	.	0			c.C779G						PASS	.						50.0	52.0	52.0					19																	12575957		2158	4284	6442	SO:0001583	missense	163051	exon4			CTGAAAGCTTTTC	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.779C>G	chr19.hg19:g.12575957G>C	ENSP00000380840:p.Ala260Gly	72.0	0.0	.		63.0	23.0	.	NM_152601	A8K4E6	Missense_Mutation	SNP	ENST00000397732.3	hg19	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506577	0.64410	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	T;T	0.19669	2.13;2.13	2.8	0.387	0.16259	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.011620	0.07961	N	0.982440	T	0.12433	0.0302	N	0.13098	0.295	0.09310	N	1	B	0.15719	0.014	B	0.15052	0.012	T	0.33420	-0.9869	10	0.59425	D	0.04	.	6.852	0.24020	0.0:0.4983:0.3262:0.1756	.	260	Q8N972	ZN709_HUMAN	G	260	ENSP00000380840:A260G;ENSP00000404127:A260G	ENSP00000404127:A260G	A	-	2	0	ZNF709;CTD-2192J16.17	12436957	0.000000	0.05858	0.007000	0.13788	0.904000	0.53231	-0.765000	0.04730	0.198000	0.20407	0.467000	0.42956	GCT	.	.	.	none		0.388	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601	
ERF	2077	hgsc.bcm.edu	37	19	42754700	42754700	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr19:42754700A>G	ENST00000222329.4	-	2	197	c.40T>C	c.(40-42)Tgg>Cgg	p.W14R	ERF_ENST00000440177.2_5'UTR|AC006486.9_ENST00000594664.1_Intron|ERF_ENST00000595941.1_5'UTR	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	14					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				TTGTAGGCCCAATCCGGGAAG	0.647																																					p.W14R		Atlas-SNP	.											.	ERF	47	.	0			c.T40C						PASS	.						38.0	33.0	35.0					19																	42754700		2202	4300	6502	SO:0001583	missense	2077	exon2			AGGCCCAATCCGG	U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.40T>C	chr19.hg19:g.42754700A>G	ENSP00000222329:p.Trp14Arg	65.0	0.0	.		94.0	35.0	.	NM_006494	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	Missense_Mutation	SNP	ENST00000222329.4	hg19	CCDS12600.1	.	.	.	.	.	.	.	.	.	.	A	18.88	3.716679	0.68844	.	.	ENSG00000105722	ENST00000222329	T	0.08896	3.04	5.37	5.37	0.77165	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.26991	0.0661	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00715	-1.1597	10	0.87932	D	0	.	13.6266	0.62168	1.0:0.0:0.0:0.0	.	14	P50548	ERF_HUMAN	R	14	ENSP00000222329:W14R	ENSP00000222329:W14R	W	-	1	0	ERF	47446540	1.000000	0.71417	0.980000	0.43619	0.992000	0.81027	7.293000	0.78740	2.170000	0.68504	0.533000	0.62120	TGG	.	.	.	none		0.647	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463684.1	NM_006494	
ZNF221	7638	hgsc.bcm.edu	37	19	44466901	44466901	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr19:44466901T>G	ENST00000251269.5	+	3	351	c.23T>G	c.(22-24)cTg>cGg	p.L8R	ZNF221_ENST00000592350.1_Missense_Mutation_p.L8R|ZNF221_ENST00000587682.1_Missense_Mutation_p.L8R	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	8					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TCACTTGAACTGCTTCATTCA	0.428																																					p.L8R		Atlas-SNP	.											.	ZNF221	59	.	0			c.T23G						PASS	.						145.0	124.0	131.0					19																	44466901		2203	4300	6503	SO:0001583	missense	7638	exon3			TTGAACTGCTTCA	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.23T>G	chr19.hg19:g.44466901T>G	ENSP00000251269:p.Leu8Arg	40.0	0.0	.		62.0	19.0	.	NM_013359	B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	ENST00000251269.5	hg19	CCDS12633.1	.	.	.	.	.	.	.	.	.	.	T	11.42	1.634816	0.29068	.	.	ENSG00000159905	ENST00000251269	T	0.07444	3.19	2.04	2.04	0.26737	.	.	.	.	.	T	0.06416	0.0165	N	0.22421	0.69	0.09310	N	1	D	0.58620	0.983	B	0.43838	0.433	T	0.32613	-0.9900	9	0.72032	D	0.01	.	6.0601	0.19832	0.0:0.0:0.0:1.0	.	8	Q9UK13	ZN221_HUMAN	R	8	ENSP00000251269:L8R	ENSP00000251269:L8R	L	+	2	0	ZNF221	49158741	0.066000	0.20996	0.002000	0.10522	0.002000	0.02628	1.349000	0.33998	1.167000	0.42706	0.379000	0.24179	CTG	.	.	.	none		0.428	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1		
GLTSCR2	29997	hgsc.bcm.edu	37	19	48248919	48248919	+	Silent	SNP	A	A	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr19:48248919A>C	ENST00000246802.5	+	1	141	c.103A>C	c.(103-105)Agg>Cgg	p.R35R	GLTSCR2_ENST00000598681.1_3'UTR	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	35						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		CCCAGCGCTGAGGCGGCGGCG	0.677																																					p.R35R	Colon(58;613 1041 9473 10089 15241)	Atlas-SNP	.											.	GLTSCR2	45	.	0			c.A103C						PASS	.						39.0	48.0	45.0					19																	48248919		2203	4300	6503	SO:0001819	synonymous_variant	29997	exon1			GCGCTGAGGCGGC	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.103A>C	chr19.hg19:g.48248919A>C		103.0	0.0	.		172.0	70.0	.	NM_015710	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Silent	SNP	ENST00000246802.5	hg19	CCDS12705.1																																																																																			.	.	.	none		0.677	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
CNOT3	4849	hgsc.bcm.edu	37	19	54652449	54652449	+	Silent	SNP	C	C	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr19:54652449C>G	ENST00000406403.1	+	11	2980	c.1377C>G	c.(1375-1377)tcC>tcG	p.S459S	CNOT3_ENST00000358389.3_Silent_p.S278S|CNOT3_ENST00000221232.5_Silent_p.S459S			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	459	Pro-rich.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCCCCCCTTCCGGCCCCCACA	0.652																																					p.S459S		Atlas-SNP	.											.	CNOT3	133	.	0			c.C1377G						PASS	.						20.0	23.0	22.0					19																	54652449		2203	4299	6502	SO:0001819	synonymous_variant	4849	exon12			CCCTTCCGGCCCC	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.1377C>G	chr19.hg19:g.54652449C>G		107.0	0.0	.		155.0	61.0	.	NM_014516	Q9NZN7|Q9UF76	Silent	SNP	ENST00000406403.1	hg19	CCDS12880.1																																																																																			.	.	.	none		0.652	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516	
TTYH1	57348	hgsc.bcm.edu	37	19	54930303	54930303	+	Splice_Site	SNP	C	C	A			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr19:54930303C>A	ENST00000376530.3	+	2	231	c.128C>A	c.(127-129)gCc>gAc	p.A43D	TTYH1_ENST00000301194.4_Splice_Site_p.A43D|TTYH1_ENST00000376531.3_Splice_Site_p.A43D|TTYH1_ENST00000391739.3_Splice_Site_p.A92D	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	43					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		CTTCCCCAGGCCTTGTTGCTG	0.662																																					p.A43D		Atlas-SNP	.											.	TTYH1	78	.	0			c.C128A						PASS	.						77.0	81.0	80.0					19																	54930303		2203	4299	6502	SO:0001630	splice_region_variant	57348	exon2			CCCAGGCCTTGTT	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.127-1C>A	chr19.hg19:g.54930303C>A		35.0	0.0	.		56.0	19.0	.	NM_020659	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Missense_Mutation	SNP	ENST00000376530.3	hg19	CCDS12893.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560585	0.65538	.	.	ENSG00000167614	ENST00000444661;ENST00000423529;ENST00000301194;ENST00000376530;ENST00000445095;ENST00000391739;ENST00000376531	T;T;T;T;T;T	0.14022	2.54;2.54;2.54;2.54;2.54;2.54	3.5	2.45	0.29901	.	0.078315	0.51477	D	0.000087	T	0.28001	0.0690	L	0.55990	1.75	0.42190	D	0.99172	D;D;D;D	0.89917	0.995;1.0;1.0;0.999	D;D;D;D	0.87578	0.912;0.998;0.998;0.997	T	0.01566	-1.1323	10	0.72032	D	0.01	-17.3171	8.7249	0.34463	0.0:0.8838:0.0:0.1162	.	92;43;43;43	B7Z1H9;Q9H313-2;Q9H313-3;Q9H313	.;.;.;TTYH1_HUMAN	D	15;39;43;43;92;92;43	ENSP00000391282:A39D;ENSP00000301194:A43D;ENSP00000365713:A43D;ENSP00000393592:A92D;ENSP00000375619:A92D;ENSP00000365714:A43D	ENSP00000301194:A43D	A	+	2	0	TTYH1	59622115	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	5.153000	0.64888	0.818000	0.34468	0.555000	0.69702	GCC	.	.	.	none		0.662	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140498.1		Missense_Mutation
GZF1	64412	hgsc.bcm.edu	37	20	23345062	23345062	+	Silent	SNP	A	A	C			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr20:23345062A>C	ENST00000338121.5	+	2	119	c.42A>C	c.(40-42)ccA>ccC	p.P14P	GZF1_ENST00000544236.1_Intron|GZF1_ENST00000542987.1_Intron|GZF1_ENST00000377051.2_Silent_p.P14P			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	14					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					AATCCTCCCCATTTAACCTAC	0.478																																					p.P14P		Atlas-SNP	.											.	GZF1	61	.	0			c.A42C						PASS	.						86.0	89.0	88.0					20																	23345062		2203	4300	6503	SO:0001819	synonymous_variant	64412	exon1			CTCCCCATTTAAC	AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.42A>C	chr20.hg19:g.23345062A>C		33.0	0.0	.		40.0	29.0	.	NM_022482	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Silent	SNP	ENST00000338121.5	hg19	CCDS13151.1																																																																																			.	.	.	none		0.478	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078333.1	NM_022482	
ZGPAT	84619	hgsc.bcm.edu	37	20	62365029	62365029	+	Missense_Mutation	SNP	G	G	A	rs376773744		TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr20:62365029G>A	ENST00000328969.5	+	4	936	c.809G>A	c.(808-810)cGc>cAc	p.R270H	ZGPAT_ENST00000355969.6_Missense_Mutation_p.R270H|ZGPAT_ENST00000357119.4_Missense_Mutation_p.R270H|LIME1_ENST00000309546.3_5'Flank|ZGPAT_ENST00000369967.3_Missense_Mutation_p.R270H|ZGPAT_ENST00000448100.2_Missense_Mutation_p.R270H|RP4-583P15.15_ENST00000490623.2_Missense_Mutation_p.A176T|ZGPAT_ENST00000478385.1_3'UTR	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	270					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					CCCCCACTGCGCACAGAGGCC	0.637																																					p.R270H		Atlas-SNP	.											.	ZGPAT	57	.	0			c.G809A						PASS	.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	110.0	106.0	108.0		809,809,809,809,809	4.7	0.6	20		108	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	ZGPAT	NM_001083113.1,NM_001195653.1,NM_001195654.1,NM_032527.4,NM_181485.2	29,29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	270/512,270/512,270/503,270/532,270/512	62365029	1,13005	2203	4300	6503	SO:0001583	missense	84619	exon4			CACTGCGCACAGA	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.809G>A	chr20.hg19:g.62365029G>A	ENSP00000332013:p.Arg270His	40.0	0.0	.		73.0	48.0	.	NM_032527	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	hg19	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	G	37	6.080234	0.97267	0.0	1.16E-4	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000369967;ENST00000328969	T;T;T;T;T	0.24538	1.88;1.88;1.85;1.88;1.86	5.65	4.7	0.59300	.	0.050728	0.85682	N	0.000000	T	0.48750	0.1517	M	0.76328	2.33	0.46901	D	0.999241	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.44528	-0.9322	10	0.30854	T	0.27	-4.7504	12.8179	0.57675	0.0758:0.0:0.9242:0.0	.	270;270;270	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	H	270	ENSP00000391176:R270H;ENSP00000348242:R270H;ENSP00000349634:R270H;ENSP00000358984:R270H;ENSP00000332013:R270H	ENSP00000332013:R270H	R	+	2	0	ZGPAT	61835473	1.000000	0.71417	0.555000	0.28281	0.949000	0.60115	6.831000	0.75324	1.387000	0.46486	0.591000	0.81541	CGC	.	.	.	weak		0.637	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484	
ADARB1	104	hgsc.bcm.edu	37	21	46603314	46603314	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr21:46603314T>G	ENST00000360697.3	+	5	1300	c.1285T>G	c.(1285-1287)Tca>Gca	p.S429A	ADARB1_ENST00000348831.4_Missense_Mutation_p.S429A|ADARB1_ENST00000539173.1_Missense_Mutation_p.S429A|ADARB1_ENST00000437626.1_3'UTR|ADARB1_ENST00000389863.4_Missense_Mutation_p.S429A			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	429	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		CTTTCAGAAATCAGAGCGAGG	0.393																																					p.S429A		Atlas-SNP	.											.	ADARB1	81	.	0			c.T1285G						PASS	.						56.0	59.0	58.0					21																	46603314		2203	4300	6503	SO:0001583	missense	104	exon7			CAGAAATCAGAGC	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.1285T>G	chr21.hg19:g.46603314T>G	ENSP00000353920:p.Ser429Ala	51.0	0.0	.		43.0	19.0	.	NM_001160230	A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Missense_Mutation	SNP	ENST00000360697.3	hg19	CCDS33589.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.525933	0.44969	.	.	ENSG00000197381	ENST00000539173;ENST00000539917;ENST00000389863;ENST00000348831;ENST00000360697	D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2	5.63	5.63	0.86233	Adenosine deaminase/editase (3);	0.115843	0.64402	D	0.000012	D	0.84754	0.5542	N	0.11201	0.11	0.80722	D	1	B;B;B;B	0.18310	0.027;0.005;0.008;0.004	B;B;B;B	0.24269	0.038;0.052;0.045;0.022	T	0.79995	-0.1568	10	0.07325	T	0.83	-28.2484	14.0959	0.65021	0.0:0.0:0.0:1.0	.	429;429;457;429	P78563;Q4AE77;G5E9B4;P78563-3	RED1_HUMAN;.;.;.	A	429	ENSP00000441897:S429A;ENSP00000374513:S429A;ENSP00000015877:S429A;ENSP00000353920:S429A	ENSP00000015877:S429A	S	+	1	0	ADARB1	45427742	1.000000	0.71417	0.850000	0.33497	0.990000	0.78478	5.882000	0.69714	2.279000	0.76181	0.533000	0.62120	TCA	.	.	.	none		0.393	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	NM_015833	
CDKN2AIP	55602	hgsc.bcm.edu	37	4	184366090	184366090	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr4:184366090delC	ENST00000504169.1	+	1	347	c.140delC	c.(139-141)gccfs	p.A47fs	CDKN2AIP_ENST00000510928.1_Frame_Shift_Del_p.A47fs|CDKN2AIP_ENST00000302350.4_Frame_Shift_Del_p.A47fs	NM_017632.2	NP_060102.1	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	47					negative regulation of cell growth (GO:0030308)|positive regulation of signal transduction (GO:0009967)|regulation of protein stability (GO:0031647)	cytoplasm (GO:0005737)|granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	p53 binding (GO:0002039)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)	6		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		GGGGACCTGGCCCCCGCTGGC	0.687																																					p.A47fs		Atlas-Indel,Pindel	.											.	CDKN2AIP	31	.	0			c.139delG						PASS	.																																			SO:0001589	frameshift_variant	55602	exon1			.	AK000043	CCDS34110.1	4q35.1	2008-02-05			ENSG00000168564	ENSG00000168564			24325	protein-coding gene	gene with protein product	"""collaborates/cooperates with ARF (alternate reading frame) protein"""	615914				12154087, 16803988	Standard	NM_017632		Approved	FLJ20036, CARF	uc003ivp.1	Q9NXV6	OTTHUMG00000160626	ENST00000504169.1:c.140delC	chr4.hg19:g.184366090delC	ENSP00000427108:p.Ala47fs	83.0	0.0	0		150.0	60.0	0.4	NM_017632	Q8TBM5|Q9NYH0	Frame_Shift_Del	DEL	ENST00000504169.1	hg19	CCDS34110.1																																																																																			.	.	.	none		0.687	CDKN2AIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361488.1	NM_017632	
ABHD16B	140701	hgsc.bcm.edu	37	20	62494129	62494129	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr20:62494129delG	ENST00000369916.3	+	1	1564	c.1236delG	c.(1234-1236)gagfs	p.E413fs	C20ORF135_ENST00000601296.1_5'Flank|TPD52L2_ENST00000346249.4_5'Flank|TPD52L2_ENST00000369927.4_5'Flank|TPD52L2_ENST00000348257.5_5'Flank|TPD52L2_ENST00000351424.4_5'Flank|TPD52L2_ENST00000352482.4_5'Flank|TPD52L2_ENST00000358548.4_5'Flank|TPD52L2_ENST00000217121.5_5'Flank	NM_080622.3	NP_542189.1	Q9H3Z7	ABHGB_HUMAN	abhydrolase domain containing 16B	413							hydrolase activity (GO:0016787)			endometrium(2)|kidney(1)|lung(3)	6						TGGAGGGCGAGGAGGCCCTGG	0.721																																					p.E412fs		Atlas-Indel,Pindel	.											.	ABHD16B	22	.	0			c.1235delA						PASS	.						11.0	10.0	11.0					20																	62494129		1954	3816	5770	SO:0001589	frameshift_variant	140701	exon1			.		CCDS13539.1	20q13.33	2013-01-17	2010-12-09	2010-12-09	ENSG00000183260	ENSG00000183260		"""Abhydrolase domain containing"""	16128	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 135"""	C20orf135			Standard	NM_080622		Approved	dJ591C20.1	uc002ygx.1	Q9H3Z7	OTTHUMG00000033010	ENST00000369916.3:c.1236delG	chr20.hg19:g.62494129delG	ENSP00000358932:p.Glu413fs	26.0	0.0	0		39.0	17.0	0.435897	NM_080622		Frame_Shift_Del	DEL	ENST00000369916.3	hg19	CCDS13539.1																																																																																			.	.	.	none		0.721	ABHD16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080254.1		
WDR18	57418	hgsc.bcm.edu	37	19	994054	994056	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr19:994054_994056delGCT	ENST00000251289.5	+	9	1157_1159	c.1134_1136delGCT	c.(1132-1137)cagctg>cag	p.L379del	WDR18_ENST00000587001.2_Intron	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	379					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACGGAGCAGCTGCAGGCCGTC	0.7																																					p.378_379del		Atlas-Indel,Pindel	.											.	WDR18	20	.	0			c.1133_1135del						PASS	.																																			SO:0001651	inframe_deletion	57418	exon9			.		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.1134_1136delGCT	chr19.hg19:g.994054_994056delGCT	ENSP00000251289:p.Leu379del	60.0	0.0	0		53.0	24.0	0.45283	NM_024100	O60390|Q9BWR2	In_Frame_Del	DEL	ENST00000251289.5	hg19	CCDS12051.1																																																																																			.	.	.	none		0.700	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
DENND5A	23258	hgsc.bcm.edu	37	11	9165682	9165682	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr11:9165682delA	ENST00000328194.3	-	19	3586	c.3266delT	c.(3265-3267)atcfs	p.I1089fs	DENND5A_ENST00000527700.1_Frame_Shift_Del_p.I432fs|DENND5A_ENST00000530044.1_Frame_Shift_Del_p.I1089fs	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	1089					positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AAGCCTCCGGATGACACTGGG	0.607																																					p.I1089fs		Atlas-Indel,Pindel	.											.	DENND5A	84	.	0			c.3267delC						PASS	.						88.0	86.0	87.0					11																	9165682		2201	4296	6497	SO:0001589	frameshift_variant	23258	exon19			.	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.3266delT	chr11.hg19:g.9165682delA	ENSP00000328524:p.Ile1089fs	22.0	0.0	0		41.0	17.0	0.414634	NM_001243254	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Frame_Shift_Del	DEL	ENST00000328194.3	hg19	CCDS31423.1																																																																																			.	.	.	none		0.607	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
TAS1R3	83756	hgsc.bcm.edu	37	1	1268443	1268443	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr1:1268443delG	ENST00000339381.5	+	4	1450	c.1418delG	c.(1417-1419)aggfs	p.R473fs		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	473					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GACGTGGGCAGGTTCAACGGC	0.647																																					p.R473fs		Atlas-Indel,Pindel	.											.	TAS1R3	39	.	0			c.1417delA						PASS	.						52.0	48.0	49.0					1																	1268443		2200	4296	6496	SO:0001589	frameshift_variant	83756	exon4			.	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.1418delG	chr1.hg19:g.1268443delG	ENSP00000344411:p.Arg473fs	85.0	0.0	0		97.0	40.0	0.412371	NM_152228	Q5TA49|Q8NGW9	Frame_Shift_Del	DEL	ENST00000339381.5	hg19	CCDS30556.1																																																																																			.	.	.	none		0.647	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008493.1		
HELZ2	85441	hgsc.bcm.edu	37	20	62200744	62200744	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr20:62200744delT	ENST00000467148.1	-	4	914	c.845delA	c.(844-846)aatfs	p.N282fs	HELZ2_ENST00000479540.1_5'Flank|HELZ2_ENST00000427522.2_5'Flank	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	282					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GAGCGCCAGATTCCTGCAGGG	0.682																																					p.N282fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.846delT						PASS	.						19.0	23.0	22.0					20																	62200744		2190	4297	6487	SO:0001589	frameshift_variant	85441	exon5			.	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.845delA	chr20.hg19:g.62200744delT	ENSP00000417401:p.Asn282fs	51.0	0.0	0		80.0	44.0	0.55	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Frame_Shift_Del	DEL	ENST00000467148.1	hg19	CCDS33508.1																																																																																			.	.	.	none		0.682	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
RREB1	6239	hgsc.bcm.edu	37	6	7249194	7249198	+	Frame_Shift_Del	DEL	TGGAG	TGGAG	-			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	TGGAG	TGGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr6:7249194_7249198delTGGAG	ENST00000349384.6	+	12	5371_5375	c.5057_5061delTGGAG	c.(5056-5061)atggagfs	p.ME1686fs	RREB1_ENST00000334984.6_Frame_Shift_Del_p.ME1475fs|RREB1_ENST00000379938.2_Frame_Shift_Del_p.ME1741fs|RREB1_ENST00000379933.3_Frame_Shift_Del_p.ME1686fs	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1686					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTCGTGGGGATGGAGTGACAGCCTC	0.634																																					p.1741_1742del		Atlas-Indel,Pindel	.											.	RREB1	242	.	0			c.5221_5225del						PASS	.																																			SO:0001589	frameshift_variant	6239	exon13			.	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.5057_5061delTGGAG	chr6.hg19:g.7249194_7249198delTGGAG	ENSP00000305560:p.Met1686fs	22.0	0.0	0		30.0	10.0	0.333333	NM_001003699	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Frame_Shift_Del	DEL	ENST00000349384.6	hg19	CCDS34336.1																																																																																			.	.	.	none		0.634	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
LRRC36	55282	hgsc.bcm.edu	37	16	67405136	67405137	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr16:67405136_67405137delAG	ENST00000329956.6	+	9	1504_1505	c.1485_1486delAG	c.(1483-1488)acaggcfs	p.G496fs	LRRC36_ENST00000290940.7_Frame_Shift_Del_p.G228fs|LRRC36_ENST00000541146.1_Frame_Shift_Del_p.R20fs|LRRC36_ENST00000435835.3_Frame_Shift_Del_p.G375fs|LRRC36_ENST00000563189.1_Frame_Shift_Del_p.G375fs	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	496										endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		AAGATGCTACAGGCAGCGAGGC	0.47																																					p.495_495del		Atlas-Indel,Pindel	.											.	LRRC36	68	.	0			c.1484_1485del						PASS	.																																			SO:0001589	frameshift_variant	55282	exon9			.	BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.1485_1486delAG	chr16.hg19:g.67405136_67405137delAG	ENSP00000329943:p.Gly496fs	51.0	0.0	0		113.0	37.0	0.327434	NM_018296	A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Frame_Shift_Del	DEL	ENST00000329956.6	hg19	CCDS32467.1																																																																																			.	.	.	none		0.470	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421770.1	NM_018296	
ABCB11	8647	hgsc.bcm.edu	37	2	169787177	169787177	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9K2-01A-11D-A42J-10	TCGA-5P-A9K2-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13f52db0-17b0-499c-ab9f-dd9c49a5ee2d	59a2e838-4559-4580-8f5f-07db42390e4d	g.chr2:169787177delC	ENST00000263817.6	-	25	3533	c.3409delG	c.(3409-3411)gtgfs	p.V1137fs		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	1137	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TGGCTTACCACCTTCCCTTGA	0.463																																					p.V1137fs		Atlas-Indel,Pindel	.											.	ABCB11	136	.	0			c.3410delT						PASS	.						68.0	63.0	65.0					2																	169787177		1974	4152	6126	SO:0001589	frameshift_variant	8647	exon25			.	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.3409delG	chr2.hg19:g.169787177delC	ENSP00000263817:p.Val1137fs	49.0	0.0	0		64.0	18.0	0.28125	NM_003742	Q53TL2|Q9UNB2	Frame_Shift_Del	DEL	ENST00000263817.6	hg19	CCDS46444.1																																																																																			.	.	.	none		0.463	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742	
