#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLEKHG5	57449	hgsc.bcm.edu	37	1	6529206	6529206	+	Silent	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr1:6529206C>T	ENST00000400915.3	-	20	2379	c.2313G>A	c.(2311-2313)gaG>gaA	p.E771E	PLEKHG5_ENST00000377725.1_Silent_p.E715E|PLEKHG5_ENST00000537245.1_Silent_p.E794E|PLEKHG5_ENST00000377740.3_Silent_p.E792E|TNFRSF25_ENST00000377782.3_5'Flank|PLEKHG5_ENST00000340850.5_Silent_p.E715E|PLEKHG5_ENST00000377732.1_Silent_p.E752E|PLEKHG5_ENST00000377748.1_Silent_p.E792E|PLEKHG5_ENST00000400913.1_Silent_p.E715E|PLEKHG5_ENST00000377728.3_Silent_p.E715E|PLEKHG5_ENST00000377737.2_Silent_p.E715E|PLEKHG5_ENST00000544978.1_Silent_p.E715E|TNFRSF25_ENST00000351959.5_5'Flank|TNFRSF25_ENST00000356876.3_5'Flank|PLEKHG5_ENST00000535355.1_Silent_p.E784E	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	771	Glu-rich.				apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		cctcctcctcctcttcctcct	0.637																																					p.E794E		Atlas-SNP	.											PLEKHG5_ENST00000377748,colon,carcinoma,0,1	PLEKHG5	66	.	0			c.G2382A						PASS	.						75.0	76.0	76.0					1																	6529206		2203	4300	6503	SO:0001819	synonymous_variant	57449	exon20			CTCCTCCTCTTCC	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.2313G>A	chr1.hg19:g.6529206C>T		30.0	1.0	.		28.0	5.0	.	NM_001265592	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Silent	SNP	ENST00000400915.3	hg19	CCDS41241.1																																																																																			.	.	.	none		0.637	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002631.1	NM_020631	
GBP2	2634	hgsc.bcm.edu	37	1	89587538	89587538	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr1:89587538C>G	ENST00000370466.3	-	2	380	c.112G>C	c.(112-114)Gtg>Ctg	p.V38L	GBP2_ENST00000463660.1_5'Flank	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	38	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		ACCACCACCACAGGCTGCGTA	0.522																																					p.V38L		Atlas-SNP	.											.	GBP2	58	.	0			c.G112C						PASS	.						162.0	146.0	151.0					1																	89587538		2203	4300	6503	SO:0001583	missense	2634	exon2			CCACCACAGGCTG	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.112G>C	chr1.hg19:g.89587538C>G	ENSP00000359497:p.Val38Leu	83.0	0.0	.		77.0	60.0	.	NM_004120	Q6GPH0|Q6IAU2|Q86TB0	Missense_Mutation	SNP	ENST00000370466.3	hg19	CCDS719.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075367	0.36662	.	.	ENSG00000162645	ENST00000370466	T	0.79033	-1.23	3.43	2.48	0.30137	Guanylate-binding protein, N-terminal (1);	0.099287	0.38837	U	0.001553	T	0.56001	0.1956	L	0.46670	1.46	0.25639	N	0.986223	B	0.27316	0.175	B	0.33339	0.162	T	0.53358	-0.8450	10	0.44086	T	0.13	-12.4763	10.4347	0.44428	0.0:0.7988:0.2012:0.0	.	38	P32456	GBP2_HUMAN	L	38	ENSP00000359497:V38L	ENSP00000359497:V38L	V	-	1	0	GBP2	89360126	0.602000	0.26916	0.012000	0.15200	0.166000	0.22503	1.376000	0.34306	0.730000	0.32425	0.491000	0.48974	GTG	.	.	.	none		0.522	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029406.2	NM_004120	
HMCN1	83872	hgsc.bcm.edu	37	1	186072734	186072734	+	Silent	SNP	C	C	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr1:186072734C>G	ENST00000271588.4	+	69	10933	c.10704C>G	c.(10702-10704)ccC>ccG	p.P3568P	HMCN1_ENST00000367492.2_Silent_p.P3568P	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3568	Ig-like C2-type 34.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATGGCCGGCCCCTTCCACAGA	0.428																																					p.P3568P		Atlas-SNP	.											.	HMCN1	797	.	0			c.C10704G						PASS	.						69.0	72.0	71.0					1																	186072734		2203	4299	6502	SO:0001819	synonymous_variant	83872	exon69			CCGGCCCCTTCCA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10704C>G	chr1.hg19:g.186072734C>G		103.0	0.0	.		133.0	66.0	.	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.	.	none		0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
KCNT2	343450	hgsc.bcm.edu	37	1	196448320	196448320	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr1:196448320G>C	ENST00000294725.9	-	5	1288	c.373C>G	c.(373-375)Ctt>Gtt	p.L125V	KCNT2_ENST00000367433.5_Missense_Mutation_p.L125V|KCNT2_ENST00000609185.1_Missense_Mutation_p.L125V|KCNT2_ENST00000367431.4_Missense_Mutation_p.L125V|KCNT2_ENST00000451324.2_De_novo_Start_OutOfFrame			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	125					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TTATAACTAAGATAACCAAGT	0.299																																					p.L125V		Atlas-SNP	.											KCNT2,NS,carcinoma,0,1	KCNT2	243	.	0			c.C373G						PASS	.						52.0	52.0	52.0					1																	196448320		2200	4299	6499	SO:0001583	missense	343450	exon5			AACTAAGATAACC	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.373C>G	chr1.hg19:g.196448320G>C	ENSP00000294725:p.Leu125Val	458.0	0.0	.		549.0	196.0	.	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	hg19	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.696345	0.48202	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.21191	2.02;2.08;2.28	5.06	4.14	0.48551	.	0.000000	0.53938	D	0.000047	T	0.35508	0.0934	M	0.79343	2.45	0.80722	D	1	P;P;P;P	0.45634	0.739;0.83;0.863;0.739	B;P;P;B	0.51324	0.443;0.646;0.666;0.443	T	0.03423	-1.1038	10	0.41790	T	0.15	-12.8857	11.2789	0.49181	0.0906:0.0:0.9094:0.0	.	125;125;125;125	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	V	125	ENSP00000356403:L125V;ENSP00000356401:L125V;ENSP00000294725:L125V	ENSP00000294725:L125V	L	-	1	0	KCNT2	194714943	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.775000	0.62346	2.791000	0.96007	0.591000	0.81541	CTT	.	.	.	none		0.299	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
BPNT1	10380	hgsc.bcm.edu	37	1	220232335	220232335	+	Splice_Site	SNP	C	C	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr1:220232335C>G	ENST00000469520.2	-	10	1228		c.e10-1		BPNT1_ENST00000322067.7_Splice_Site|BPNT1_ENST00000544404.1_Splice_Site|BPNT1_ENST00000414869.2_Splice_Site|BPNT1_ENST00000354807.3_Splice_Site			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)			breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		GTTAACTTGCCTATAGAAAAA	0.383																																					.		Atlas-SNP	.											.	BPNT1	29	.	0			c.779-1G>C						PASS	.						116.0	107.0	110.0					1																	220232335		1899	4122	6021	SO:0001630	splice_region_variant	10380	exon10			ACTTGCCTATAGA	AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.779-1G>C	chr1.hg19:g.220232335C>G		42.0	0.0	.		70.0	15.0	.	NM_006085	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	Splice_Site	SNP	ENST00000469520.2	hg19	CCDS41469.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621110	0.87460	.	.	ENSG00000162813	ENST00000322067;ENST00000469520;ENST00000354807;ENST00000302686;ENST00000544404;ENST00000414869	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.28	0.94050	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BPNT1	218298958	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	7.682000	0.84083	2.643000	0.89663	0.555000	0.69702	.	.	.	.	none		0.383	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091137.2	NM_006085	Intron
SETD2	29072	hgsc.bcm.edu	37	3	47079260	47079260	+	Nonsense_Mutation	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr3:47079260G>A	ENST00000409792.3	-	18	7288	c.7246C>T	c.(7246-7248)Cag>Tag	p.Q2416*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2416	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GGATCCCACTGAGTCTGCCTA	0.458			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.Q2416X		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	SETD2_ENST00000409792,NS,carcinoma,0,2	SETD2	721	.	0			c.C7246T						PASS	.						100.0	88.0	92.0					3																	47079260		2203	4300	6503	SO:0001587	stop_gained	29072	exon18			CCCACTGAGTCTG	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7246C>T	chr3.hg19:g.47079260G>A	ENSP00000386759:p.Gln2416*	63.0	0.0	.		31.0	18.0	.	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	48	14.016458	0.99775	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.93	5.93	0.95920	.	0.000000	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	.	.	.	X	2416	.	ENSP00000386759:Q2416X	Q	-	1	0	SETD2	47054264	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.717000	0.98755	2.826000	0.97356	0.655000	0.94253	CAG	.	.	.	none		0.458	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
COL6A6	131873	hgsc.bcm.edu	37	3	130290142	130290142	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr3:130290142G>A	ENST00000358511.6	+	6	2913	c.2882G>A	c.(2881-2883)gGa>gAa	p.G961E	COL6A6_ENST00000453409.2_Missense_Mutation_p.G961E	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	961	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GCCATGGCAGGATCAAGCGAC	0.498																																					p.G961E		Atlas-SNP	.											.	COL6A6	497	.	0			c.G2882A						PASS	.						52.0	50.0	51.0					3																	130290142		1978	4174	6152	SO:0001583	missense	131873	exon6			TGGCAGGATCAAG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2882G>A	chr3.hg19:g.130290142G>A	ENSP00000351310:p.Gly961Glu	146.0	0.0	.		177.0	63.0	.	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	hg19	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018725	0.54576	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78364	-1.17;-1.17	4.82	4.82	0.62117	von Willebrand factor, type A (3);	0.000000	0.53938	D	0.000046	T	0.78604	0.4309	M	0.80508	2.5	0.30392	N	0.780931	P	0.47484	0.896	P	0.44394	0.448	T	0.79662	-0.1710	10	0.41790	T	0.15	.	10.0767	0.42364	0.132:0.0:0.868:0.0	.	961	A6NMZ7	CO6A6_HUMAN	E	961	ENSP00000351310:G961E;ENSP00000399236:G961E	ENSP00000351310:G961E	G	+	2	0	COL6A6	131772832	1.000000	0.71417	0.763000	0.31416	0.909000	0.53808	4.785000	0.62418	2.403000	0.81681	0.561000	0.74099	GGA	.	.	.	none		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
PIK3CA	5290	hgsc.bcm.edu	37	3	178916725	178916725	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr3:178916725C>T	ENST00000263967.3	+	2	269	c.112C>T	c.(112-114)Cgt>Tgt	p.R38C		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	38	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.		R -> H (in CRC; likely involved in disease pathogenesis; shows an increase in lipid kinase activity; may disrupt the interaction between the PI3K-ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain).		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.R38G(1)|p.R38S(1)|p.R38C(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGAATGCCTCCGTGAGGCTAC	0.393		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.R38C	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,caecum,carcinoma,0,17	PIK3CA	8460	.	3	Substitution - Missense(3)	large_intestine(1)|stomach(1)|central_nervous_system(1)	c.C112T						PASS	.						76.0	74.0	75.0					3																	178916725		1845	4085	5930	SO:0001583	missense	5290	exon2			TGCCTCCGTGAGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.112C>T	chr3.hg19:g.178916725C>T	ENSP00000263967:p.Arg38Cys	158.0	0.0	.		265.0	137.0	.	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909863	0.72983	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.73363	-0.74;-0.74	5.44	5.44	0.79542	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.84019	0.5380	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.82665	-0.0345	9	.	.	.	-9.214	19.2635	0.93977	0.0:1.0:0.0:0.0	.	38	P42336	PK3CA_HUMAN	C	38	ENSP00000263967:R38C;ENSP00000417479:R38C	.	R	+	1	0	PIK3CA	180399419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.642000	0.67888	2.547000	0.85894	0.555000	0.69702	CGT	.	.	.	none		0.393	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PIK3CA	5290	hgsc.bcm.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E542K	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,carcinoma,0,2	PIK3CA	8460	.	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	c.G1624A						PASS	.						56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290	exon10			CTCTCTGAAATCA		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	chr3.hg19:g.178936082G>A	ENSP00000263967:p.Glu542Lys	360.0	1.0	.		542.0	259.0	.	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	.	.	.	weak		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
ADD1	118	hgsc.bcm.edu	37	4	2930015	2930015	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr4:2930015A>G	ENST00000398129.1	+	14	1999	c.1979A>G	c.(1978-1980)aAg>aGg	p.K660R	ADD1_ENST00000398125.1_3'UTR|ADD1_ENST00000503455.2_3'UTR|ADD1_ENST00000264758.7_Missense_Mutation_p.K691R|ADD1_ENST00000513328.2_3'UTR|ADD1_ENST00000355842.3_3'UTR|ADD1_ENST00000446856.1_Missense_Mutation_p.K660R|ADD1_ENST00000398123.2_3'UTR			P35611	ADDA_HUMAN	adducin 1 (alpha)	660					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ATGTTAGAGAAGGAGGAGGAA	0.607																																					p.K691R	Esophageal Squamous(71;505 1201 20414 34538 37449)	Atlas-SNP	.											.	ADD1	56	.	0			c.A2072G						PASS	.						96.0	113.0	107.0					4																	2930015		2203	4300	6503	SO:0001583	missense	118	exon15			TAGAGAAGGAGGA	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1979A>G	chr4.hg19:g.2930015A>G	ENSP00000381197:p.Lys660Arg	178.0	0.0	.		102.0	47.0	.	NM_014189	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	ENST00000398129.1	hg19	CCDS43205.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.319|4.319	0.058597|0.058597	0.08339|0.08339	.|.	.|.	ENSG00000087274|ENSG00000087274	ENST00000264758;ENST00000446856;ENST00000398129|ENST00000514940	T;T;T|.	0.06294|.	3.32;3.36;3.36|.	4.9|4.9	0.371|0.371	0.16168|0.16168	.|.	1.249810|.	0.05914|.	N|.	0.632241|.	T|T	0.23249|0.23249	0.0562|0.0562	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B|.	0.17038|.	0.012;0.02|.	B;B|.	0.16289|.	0.007;0.015|.	T|T	0.27706|0.27706	-1.0066|-1.0066	10|5	0.08837|.	T|.	0.75|.	-1.4542|-1.4542	6.947|6.947	0.24524|0.24524	0.6262:0.1198:0.0:0.254|0.6262:0.1198:0.0:0.254	.|.	660;691|.	P35611;P35611-3|.	ADDA_HUMAN;.|.	R|G	691;660;660|397	ENSP00000264758:K691R;ENSP00000399828:K660R;ENSP00000381197:K660R|.	ENSP00000264758:K691R|.	K|R	+|+	2|1	0|2	ADD1|ADD1	2899813|2899813	1.000000|1.000000	0.71417|0.71417	0.003000|0.003000	0.11579|0.11579	0.266000|0.266000	0.26442|0.26442	3.998000|3.998000	0.57024|0.57024	-0.114000|-0.114000	0.11936|0.11936	0.533000|0.533000	0.62120|0.62120	AAG|AGG	.	.	.	none		0.607	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189	
PKD2	5311	hgsc.bcm.edu	37	4	88929118	88929118	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr4:88929118C>T	ENST00000237596.2	+	1	299	c.233C>T	c.(232-234)cCg>cTg	p.P78L		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		CCTTCTCCTCCGCTCTCGTCG	0.731																																					p.P78L		Atlas-SNP	.											.	PKD2	82	.	0			c.C233T						PASS	.						1.0	1.0	1.0					4																	88929118		872	2057	2929	SO:0001583	missense	5311	exon1			CTCCTCCGCTCTC	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.233C>T	chr4.hg19:g.88929118C>T	ENSP00000237596:p.Pro78Leu	333.0	0.0	.		245.0	140.0	.	NM_000297	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000237596.2	hg19	CCDS3627.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130467	0.56828	.	.	ENSG00000118762	ENST00000237596	D	0.82167	-1.58	2.77	1.9	0.25705	.	0.000000	0.64402	U	0.000001	T	0.68137	0.2968	L	0.36672	1.1	0.80722	D	1	P	0.51240	0.943	B	0.32149	0.141	T	0.66960	-0.5791	10	0.87932	D	0	-7.5048	9.3789	0.38301	0.0:0.7799:0.2201:0.0	.	78	Q13563	PKD2_HUMAN	L	78	ENSP00000237596:P78L	ENSP00000237596:P78L	P	+	2	0	PKD2	89148142	1.000000	0.71417	0.333000	0.25482	0.349000	0.29174	3.011000	0.49567	0.331000	0.23511	0.313000	0.20887	CCG	.	.	.	none		0.731	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253042.4	NM_000297	
CASP6	839	hgsc.bcm.edu	37	4	110624544	110624544	+	Missense_Mutation	SNP	G	G	C	rs376919922		TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr4:110624544G>C	ENST00000265164.2	-	1	85	c.8C>G	c.(7-9)tCg>tGg	p.S3W	CASP6_ENST00000352981.3_Missense_Mutation_p.S3W|CASP6_ENST00000505486.1_Missense_Mutation_p.S3W	NM_001226.3	NP_001217.2	P55212	CASP6_HUMAN	caspase 6, apoptosis-related cysteine peptidase	3					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|epithelial cell differentiation (GO:0030855)|proteolysis (GO:0006508)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000171)		CCCCGAGGCCGAGCTCATTGC	0.726																																					p.S3W		Atlas-SNP	.											.	CASP6	25	.	0			c.C8G						PASS	.						24.0	30.0	28.0					4																	110624544		2201	4296	6497	SO:0001583	missense	839	exon1			GAGGCCGAGCTCA	U20536	CCDS3684.1, CCDS3685.1	4q25	2008-02-05	2005-08-17		ENSG00000138794	ENSG00000138794		"""Caspases"""	1507	protein-coding gene	gene with protein product		601532	"""caspase 6, apoptosis-related cysteine protease"""			8780721, 7796396	Standard	XM_005263271		Approved	MCH2	uc003hzn.1	P55212	OTTHUMG00000131914	ENST00000265164.2:c.8C>G	chr4.hg19:g.110624544G>C	ENSP00000265164:p.Ser3Trp	251.0	0.0	.		227.0	135.0	.	NM_001226	Q9BQE7	Missense_Mutation	SNP	ENST00000265164.2	hg19	CCDS3684.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533971	0.27387	.	.	ENSG00000138794	ENST00000352981;ENST00000265164;ENST00000505486	T;T;T	0.54071	3.64;4.26;0.59	2.22	1.36	0.22044	.	3.831530	0.01273	U	0.009503	T	0.40067	0.1102	L	0.29908	0.895	0.09310	N	0.999992	P;P	0.48640	0.913;0.627	B;B	0.38880	0.284;0.257	T	0.38714	-0.9648	10	0.66056	D	0.02	.	4.5637	0.12172	0.1898:0.0:0.8102:0.0	.	3;3	P55212-2;P55212	.;CASP6_HUMAN	W	3	ENSP00000285333:S3W;ENSP00000265164:S3W;ENSP00000424080:S3W	ENSP00000265164:S3W	S	-	2	0	CASP6	110843993	0.870000	0.30015	0.140000	0.22221	0.018000	0.09664	2.136000	0.42121	0.497000	0.27926	0.484000	0.47621	TCG	.	.	.	alt		0.726	CASP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254866.1	NM_001226	
GIN1	54826	hgsc.bcm.edu	37	5	102423700	102423700	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr5:102423700T>C	ENST00000399004.2	-	8	1565	c.1471A>G	c.(1471-1473)Acg>Gcg	p.T491A	GIN1_ENST00000508629.1_3'UTR	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	491					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		GAGATTTTCGTATTTCTATAT	0.343																																					p.T491A		Atlas-SNP	.											.	GIN1	53	.	0			c.A1471G						PASS	.						113.0	105.0	108.0					5																	102423700		1833	4086	5919	SO:0001583	missense	54826	exon8			TTTTCGTATTTCT	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.1471A>G	chr5.hg19:g.102423700T>C	ENSP00000381970:p.Thr491Ala	71.0	0.0	.		74.0	27.0	.	NM_017676	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	ENST00000399004.2	hg19	CCDS43349.1	.	.	.	.	.	.	.	.	.	.	T	3.219	-0.159979	0.06502	.	.	ENSG00000145723	ENST00000399004	T	0.15718	2.4	5.64	-3.05	0.05396	.	1.062550	0.07572	N	0.918705	T	0.04407	0.0121	N	0.03608	-0.345	0.48452	D	0.99965	B	0.02656	0.0	B	0.01281	0.0	T	0.51926	-0.8643	10	0.05351	T	0.99	-28.7686	1.0916	0.01664	0.2638:0.3554:0.1004:0.2803	.	491	Q9NXP7	GIN1_HUMAN	A	491	ENSP00000381970:T491A	ENSP00000381970:T491A	T	-	1	0	GIN1	102451599	0.005000	0.15991	0.872000	0.34217	0.230000	0.25150	-0.560000	0.05964	-0.199000	0.10317	-0.366000	0.07423	ACG	.	.	.	none		0.343	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
ANKS1A	23294	hgsc.bcm.edu	37	6	35047434	35047434	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr6:35047434G>A	ENST00000360359.3	+	15	2563	c.2425G>A	c.(2425-2427)Gag>Aag	p.E809K	ANKS1A_ENST00000535627.1_Intron|ANKS1A_ENST00000470698.1_3'UTR	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	809	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CTGGGAGCTAGAGCTCGTCAA	0.607																																					p.E809K		Atlas-SNP	.											.	ANKS1A	123	.	0			c.G2425A						PASS	.						72.0	69.0	70.0					6																	35047434		2203	4300	6503	SO:0001583	missense	23294	exon15			GAGCTAGAGCTCG	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.2425G>A	chr6.hg19:g.35047434G>A	ENSP00000353518:p.Glu809Lys	64.0	0.0	.		83.0	36.0	.	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	hg19	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	G	34	5.398429	0.96030	.	.	ENSG00000064999	ENST00000360359;ENST00000373990	T	0.52754	0.65	5.17	5.17	0.71159	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.49916	D	0.000138	T	0.65647	0.2711	M	0.76328	2.33	0.80722	D	1	P;D;D	0.76494	0.865;0.995;0.999	P;D;D	0.85130	0.541;0.976;0.997	T	0.69573	-0.5109	10	0.87932	D	0	-26.8262	19.1108	0.93315	0.0:0.0:1.0:0.0	.	135;135;809	Q49AR9;E7EM84;Q92625	.;.;ANS1A_HUMAN	K	809;135	ENSP00000353518:E809K	ENSP00000353518:E809K	E	+	1	0	ANKS1A	35155412	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	9.717000	0.98755	2.573000	0.86826	0.556000	0.70494	GAG	.	.	.	none		0.607	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
DNAH8	1769	hgsc.bcm.edu	37	6	38919137	38919137	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr6:38919137A>T	ENST00000359357.3	+	80	11895	c.11641A>T	c.(11641-11643)Att>Ttt	p.I3881F	RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000449981.2_Missense_Mutation_p.I4098F|DNAH8_ENST00000441566.1_Missense_Mutation_p.I3845F			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3881	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AAGAAAGTATATTGCAGATTC	0.378																																					p.I4098F		Atlas-SNP	.											.	DNAH8	1239	.	0			c.A12292T						PASS	.						134.0	142.0	139.0					6																	38919137		2203	4300	6503	SO:0001583	missense	1769	exon82			AAGTATATTGCAG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11641A>T	chr6.hg19:g.38919137A>T	ENSP00000352312:p.Ile3881Phe	120.0	0.0	.		131.0	55.0	.	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	A	20.3	3.970636	0.74246	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.12984	2.63;2.63;2.63	5.6	4.41	0.53225	Dynein heavy chain (1);	0.162449	0.52532	D	0.000067	T	0.43942	0.1270	H	0.98612	4.28	0.58432	D	0.999999	D;D	0.71674	0.997;0.998	D;D	0.72625	0.962;0.978	T	0.65100	-0.6250	10	0.87932	D	0	.	12.1872	0.54245	0.8718:0.0:0.0:0.1282	.	3845;3881	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	F	4086;4086;3881;3845	ENSP00000333363:I4086F;ENSP00000352312:I3881F;ENSP00000402294:I3845F	ENSP00000333363:I4086F	I	+	1	0	DNAH8	39027115	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	6.045000	0.71020	1.027000	0.39758	0.533000	0.62120	ATT	.	.	.	none		0.378	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
PKHD1	5314	hgsc.bcm.edu	37	6	51524419	51524419	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr6:51524419T>A	ENST00000371117.3	-	61	10780	c.10505A>T	c.(10504-10506)gAg>gTg	p.E3502V		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3502			E -> V (in ARPKD). {ECO:0000269|PubMed:12846734}.		cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GCTCTGGAGCTCATGGTAGAA	0.443																																					p.E3502V		Atlas-SNP	.											.	PKHD1	927	.	0			c.A10505T	GRCh37	CM032337	PKHD1	M		PASS	.						64.0	65.0	64.0					6																	51524419		2203	4300	6503	SO:0001583	missense	5314	exon61			TGGAGCTCATGGT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10505A>T	chr6.hg19:g.51524419T>A	ENSP00000360158:p.Glu3502Val	107.0	0.0	.		138.0	58.0	.	NM_138694	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	17.90	3.502052	0.64298	.	.	ENSG00000170927	ENST00000371117	D	0.86366	-2.11	5.72	5.72	0.89469	.	0.080901	0.52532	D	0.000070	D	0.84995	0.5596	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	D	0.84626	0.0687	10	0.30854	T	0.27	.	11.2211	0.48855	0.0:0.0:0.1531:0.8469	.	3502	P08F94	PKHD1_HUMAN	V	3502	ENSP00000360158:E3502V	ENSP00000360158:E3502V	E	-	2	0	PKHD1	51632378	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.238000	0.51352	2.177000	0.69029	0.533000	0.62120	GAG	.	.	.	none		0.443	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
ZNF92	168374	hgsc.bcm.edu	37	7	64863907	64863907	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr7:64863907T>A	ENST00000328747.7	+	4	1079	c.880T>A	c.(880-882)Ttt>Att	p.F294I	ZNF92_ENST00000450302.2_Missense_Mutation_p.F225I|ZNF92_ENST00000431504.1_Missense_Mutation_p.F218I|ZNF92_ENST00000357512.2_Missense_Mutation_p.F262I	NM_152626.2	NP_689839.1	Q03936	ZNF92_HUMAN	zinc finger protein 92	294					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|skin(1)|stomach(1)	13		Lung NSC(55;0.159)				TGGCAAGGCCTTTAACCAGTT	0.358																																					p.F294I		Atlas-SNP	.											.	ZNF92	68	.	0			c.T880A						PASS	.						33.0	37.0	36.0					7																	64863907		2198	4290	6488	SO:0001583	missense	168374	exon4			AAGGCCTTTAACC	M61872	CCDS34646.1, CCDS47596.1, CCDS75608.1, CCDS75609.1	7q11.21	2013-01-08	2006-05-12		ENSG00000146757	ENSG00000146757		"""Zinc fingers, C2H2-type"", ""-"""	13168	protein-coding gene	gene with protein product		603974	"""zinc finger protein 92 (HTF12)"""			8467795	Standard	NM_001287533		Approved	HPF12, TF12	uc003ttz.3	Q03936	OTTHUMG00000156557	ENST00000328747.7:c.880T>A	chr7.hg19:g.64863907T>A	ENSP00000332595:p.Phe294Ile	78.0	0.0	.		103.0	46.0	.	NM_152626	A6NNF9|Q8N492|Q8NB35	Missense_Mutation	SNP	ENST00000328747.7	hg19	CCDS34646.1	.	.	.	.	.	.	.	.	.	.	T	15.03	2.711240	0.48517	.	.	ENSG00000146757	ENST00000328747;ENST00000431504;ENST00000357512;ENST00000450302	T;T;T;T	0.47528	0.87;0.84;0.84;0.84	0.427	0.427	0.16489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.65091	0.2658	M	0.85373	2.75	0.34231	D	0.676527	D;D	0.89917	0.999;1.0	D;D	0.97110	0.932;1.0	T	0.69308	-0.5179	9	0.66056	D	0.02	.	5.1591	0.15050	0.0:1.0E-4:0.0:0.9999	.	262;294	Q03936-3;Q03936	.;ZNF92_HUMAN	I	294;218;262;225	ENSP00000332595:F294I;ENSP00000400495:F218I;ENSP00000350113:F262I;ENSP00000396126:F225I	ENSP00000332595:F294I	F	+	1	0	ZNF92	64501342	1.000000	0.71417	0.022000	0.16811	0.022000	0.10575	5.518000	0.67068	0.388000	0.25054	0.383000	0.25322	TTT	.	.	.	none		0.358	ZNF92-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344589.2	NM_152626	
CYP51A1	1595	hgsc.bcm.edu	37	7	91755569	91755569	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr7:91755569G>T	ENST00000003100.8	-	5	933	c.768C>A	c.(766-768)ttC>ttA	p.F256L	CYP51A1_ENST00000450723.1_Missense_Mutation_p.F151L|LRRD1_ENST00000422722.1_5'UTR	NM_000786.3	NP_000777.1	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A, polypeptide 1	250					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via 24,25-dihydrolanosterol (GO:0033488)|demethylation (GO:0070988)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|sterol 14-demethylase activity (GO:0008398)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	10	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Itraconazole(DB01167)|Ketoconazole(DB01026)|Sertaconazole(DB01153)|Tioconazole(DB01007)	ATCCATACCTGAAACTAGGCA	0.373																																					p.F256L	GBM(70;1100 1190 11592 25836 51397)	Atlas-SNP	.											.	CYP51A1	30	.	0			c.C768A						PASS	.						31.0	27.0	29.0					7																	91755569		2203	4299	6502	SO:0001583	missense	1595	exon5			ATACCTGAAACTA	U51685	CCDS5623.1, CCDS55123.1	7q21.2	2012-10-10	2003-02-14	2003-02-28	ENSG00000001630	ENSG00000001630		"""Cytochrome P450s"""	2649	protein-coding gene	gene with protein product		601637	"""cytochrome P450, 51 (lanosterol 14-alpha-demethylase)"""	CYP51		8975714	Standard	NM_000786		Approved	CP51, CYPL1, P450L1, LDM, P450-14DM	uc003ulm.4	Q16850	OTTHUMG00000131131	ENST00000003100.8:c.768C>A	chr7.hg19:g.91755569G>T	ENSP00000003100:p.Phe256Leu	60.0	0.0	.		97.0	29.0	.	NM_000786	A4D1F8|B2RAI4|B4DJ55|O00770|O00772|Q16784|Q8N1A8|Q99868	Missense_Mutation	SNP	ENST00000003100.8	hg19	CCDS5623.1	.	.	.	.	.	.	.	.	.	.	G	36	5.667382	0.96745	.	.	ENSG00000001630	ENST00000003100;ENST00000496998;ENST00000450723	T;T	0.68025	-0.3;-0.3	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.81767	0.4892	M	0.83118	2.625	0.80722	D	1	P;P	0.51240	0.929;0.943	P;P	0.57776	0.712;0.827	T	0.82989	-0.0183	10	0.54805	T	0.06	.	19.6188	0.95647	0.0:0.0:1.0:0.0	.	196;250	B3KRC6;Q16850	.;CP51A_HUMAN	L	256;196;151	ENSP00000003100:F256L;ENSP00000406757:F151L	ENSP00000003100:F256L	F	-	3	2	CYP51A1	91593505	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.788000	0.99064	2.699000	0.92147	0.650000	0.86243	TTC	.	.	.	none		0.373	CYP51A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253812.4		
TRIM4	89122	hgsc.bcm.edu	37	7	99516791	99516791	+	Silent	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr7:99516791G>A	ENST00000355947.2	-	1	363	c.234C>T	c.(232-234)cgC>cgT	p.R78R	TRIM4_ENST00000354241.5_Silent_p.R78R|TRIM4_ENST00000349062.2_Silent_p.R78R	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	78					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				CGGGGCCCAGGCGCCGGCGCT	0.751																																					p.R78R		Atlas-SNP	.											.	TRIM4	33	.	0			c.C234T						PASS	.						2.0	2.0	2.0					7																	99516791		1472	3021	4493	SO:0001819	synonymous_variant	89122	exon1			GCCCAGGCGCCGG	AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.234C>T	chr7.hg19:g.99516791G>A		45.0	0.0	.		57.0	24.0	.	NM_033017	A4D298|Q75MK1|Q96F06|Q9C036	Silent	SNP	ENST00000355947.2	hg19	CCDS5679.1																																																																																			.	.	.	none		0.751	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345050.1	NM_033017	
PARP12	64761	hgsc.bcm.edu	37	7	139762578	139762578	+	Missense_Mutation	SNP	G	G	C	rs201640031	byFrequency	TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr7:139762578G>C	ENST00000263549.3	-	1	943	c.70C>G	c.(70-72)Ccc>Gcc	p.P24A		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	24						nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					CGCAGCTCGGGCAACTCCAGG	0.786													G|||	11	0.00219649	0.0	0.0072	5008	,	,		7612	0.0		0.006	False		,,,				2504	0.0				p.P24A		Atlas-SNP	.											.	PARP12	59	.	0			c.C70G						PASS	.						1.0	2.0	1.0					7																	139762578		1047	2218	3265	SO:0001583	missense	64761	exon1			GCTCGGGCAACTC	AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.70C>G	chr7.hg19:g.139762578G>C	ENSP00000263549:p.Pro24Ala	0.0	0.0	.		5.0	4.0	.	NM_022750	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	ENST00000263549.3	hg19	CCDS5857.1	.	.	.	.	.	.	.	.	.	.	G	0.080	-1.186107	0.01620	.	.	ENSG00000059378	ENST00000263549	T	0.27720	1.65	3.29	-1.02	0.10135	.	0.997579	0.08113	N	0.995896	T	0.08582	0.0213	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35126	-0.9801	10	0.08599	T	0.76	.	6.7623	0.23548	0.0:0.5216:0.314:0.1644	.	24	Q9H0J9	PAR12_HUMAN	A	24	ENSP00000263549:P24A	ENSP00000263549:P24A	P	-	1	0	PARP12	139409047	0.008000	0.16893	0.000000	0.03702	0.001000	0.01503	0.832000	0.27490	-0.419000	0.07439	0.561000	0.74099	CCC	.	.	.	weak		0.786	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750	
RNF19A	25897	hgsc.bcm.edu	37	8	101300044	101300044	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr8:101300044G>C	ENST00000519449.1	-	3	675	c.359C>G	c.(358-360)aCt>aGt	p.T120S	RNF19A_ENST00000341084.2_Missense_Mutation_p.T120S	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	120					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			GCTGATGGAAGTTAATCCATT	0.378																																					p.T120S		Atlas-SNP	.											.	RNF19A	67	.	0			c.C359G						PASS	.						112.0	112.0	112.0					8																	101300044		2203	4300	6503	SO:0001583	missense	25897	exon3			ATGGAAGTTAATC	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.359C>G	chr8.hg19:g.101300044G>C	ENSP00000428968:p.Thr120Ser	63.0	0.0	.		85.0	29.0	.	NM_015435	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	hg19	CCDS6286.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145412	0.37825	.	.	ENSG00000034677	ENST00000519449;ENST00000341084;ENST00000519527;ENST00000523167	D;D	0.82984	-1.67;-1.67	5.57	5.57	0.84162	.	0.287283	0.38005	N	0.001857	T	0.70237	0.3201	N	0.16478	0.41	0.41573	D	0.988693	B	0.02656	0.0	B	0.01281	0.0	T	0.64997	-0.6275	10	0.14656	T	0.56	.	14.8593	0.70366	0.0:0.0:0.8558:0.1442	.	120	Q9NV58	RN19A_HUMAN	S	120	ENSP00000428968:T120S;ENSP00000342667:T120S	ENSP00000342667:T120S	T	-	2	0	RNF19A	101369220	1.000000	0.71417	0.984000	0.44739	0.975000	0.68041	3.867000	0.56047	2.606000	0.88127	0.650000	0.86243	ACT	.	.	.	none		0.378	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435	
ZC3H3	23144	hgsc.bcm.edu	37	8	144522390	144522390	+	Missense_Mutation	SNP	G	G	T	rs267601811		TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr8:144522390G>T	ENST00000262577.5	-	11	2667	c.2636C>A	c.(2635-2637)tCc>tAc	p.S879Y		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	879	Poly-Ser.				mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.S879F(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			aggggatgaggaggaggagga	0.657																																					p.S879Y		Atlas-SNP	.											ZC3H3,NS,malignant_melanoma,0,1	ZC3H3	75	.	1	Substitution - Missense(1)	skin(1)	c.C2636A						PASS	.						30.0	29.0	29.0					8																	144522390		2203	4298	6501	SO:0001583	missense	23144	exon11			GATGAGGAGGAGG	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2636C>A	chr8.hg19:g.144522390G>T	ENSP00000262577:p.Ser879Tyr	82.0	0.0	.		109.0	0.0	.	NM_015117	Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	hg19	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263668	0.59431	.	.	ENSG00000014164	ENST00000262577	T	0.58210	0.35	4.04	4.04	0.47022	.	0.788333	0.10701	N	0.643991	T	0.45716	0.1356	L	0.27053	0.805	0.09310	N	1	P	0.50943	0.94	P	0.44860	0.462	T	0.37244	-0.9714	10	0.66056	D	0.02	-3.2232	12.9046	0.58145	0.0:0.0:1.0:0.0	.	879	Q8IXZ2	ZC3H3_HUMAN	Y	879	ENSP00000262577:S879Y	ENSP00000262577:S879Y	S	-	2	0	ZC3H3	144593533	0.025000	0.19082	0.006000	0.13384	0.122000	0.20287	2.137000	0.42130	1.831000	0.53308	0.467000	0.42956	TCC	.	.	.	none		0.657	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117	
ZNF16	7564	hgsc.bcm.edu	37	8	146157588	146157588	+	Silent	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr8:146157588G>A	ENST00000276816.4	-	4	771	c.585C>T	c.(583-585)gaC>gaT	p.D195D	ZNF16_ENST00000394909.2_Silent_p.D195D	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	195	Necessary for transcription activation.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GACCAGTTAGGTCCACACTGT	0.493																																					p.D195D		Atlas-SNP	.											.	ZNF16	80	.	0			c.C585T						PASS	.						121.0	114.0	116.0					8																	146157588		2203	4300	6503	SO:0001819	synonymous_variant	7564	exon3			AGTTAGGTCCACA	X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.585C>T	chr8.hg19:g.146157588G>A		76.0	0.0	.		87.0	37.0	.	NM_006958	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Silent	SNP	ENST00000276816.4	hg19	CCDS6437.1																																																																																			.	.	.	none		0.493	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958	
C9orf172	389813	hgsc.bcm.edu	37	9	139741257	139741257	+	Silent	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr9:139741257C>T	ENST00000436881.1	+	1	2391	c.2391C>T	c.(2389-2391)cgC>cgT	p.R797R	PHPT1_ENST00000545326.1_5'Flank|PHPT1_ENST00000371661.1_5'Flank|PHPT1_ENST00000247665.10_5'Flank	NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	797										endometrium(2)|large_intestine(1)|lung(6)	9						GCTACGCGCGCGAGCTGGCGG	0.721																																					p.R797R		Atlas-SNP	.											.	C9orf172	23	.	0			c.C2391T						PASS	.						8.0	8.0	8.0					9																	139741257		1367	3002	4369	SO:0001819	synonymous_variant	389813	exon1			CGCGCGCGAGCTG		CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.2391C>T	chr9.hg19:g.139741257C>T		49.0	0.0	.		33.0	12.0	.	NM_001080482		Silent	SNP	ENST00000436881.1	hg19	CCDS48059.1																																																																																			.	.	.	none		0.721	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
IDE	3416	hgsc.bcm.edu	37	10	94250353	94250353	+	Splice_Site	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr10:94250353C>T	ENST00000265986.6	-	12	1487		c.e12-1		IDE_ENST00000496903.1_Splice_Site|IDE_ENST00000371581.5_Splice_Site	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme						beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TATGGCAACCCTAGAGATAGA	0.348																																					.		Atlas-SNP	.											IDE,colon,carcinoma,0,1	IDE	77	.	0			c.1431-1G>A						PASS	.						133.0	133.0	133.0					10																	94250353		2203	4300	6503	SO:0001630	splice_region_variant	3416	exon13			GCAACCCTAGAGA	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.1431-1G>A	chr10.hg19:g.94250353C>T		51.0	0.0	.		62.0	25.0	.	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Splice_Site	SNP	ENST00000265986.6	hg19	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.195005	0.78902	.	.	ENSG00000119912	ENST00000265986	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.803	0.88593	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IDE	94240333	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.272000	0.78516	2.616000	0.88540	0.655000	0.94253	.	.	.	.	none		0.348	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	Intron
CNNM2	54805	hgsc.bcm.edu	37	10	104678741	104678741	+	Silent	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr10:104678741C>T	ENST00000369878.4	+	1	692	c.504C>T	c.(502-504)cgC>cgT	p.R168R	CNNM2_ENST00000433628.2_Silent_p.R168R|CNNM2_ENST00000369875.3_Silent_p.R168R	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	168					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TCAACCGCCGCACCTCGGGCA	0.642																																					p.R168R		Atlas-SNP	.											.	CNNM2	119	.	0			c.C504T						PASS	.						130.0	141.0	137.0					10																	104678741		2199	4299	6498	SO:0001819	synonymous_variant	54805	exon1			CCGCCGCACCTCG	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.504C>T	chr10.hg19:g.104678741C>T		128.0	0.0	.		160.0	59.0	.	NM_199076	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Silent	SNP	ENST00000369878.4	hg19	CCDS44474.1																																																																																			.	.	.	none		0.642	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
PDZD8	118987	hgsc.bcm.edu	37	10	119044221	119044221	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr10:119044221C>T	ENST00000334464.5	-	5	2262	c.2023G>A	c.(2023-2025)Gac>Aac	p.D675N	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	675					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		GTTTGACGGTCGTCCGAACTG	0.428																																					p.D675N		Atlas-SNP	.											.	PDZD8	85	.	0			c.G2023A						PASS	.						98.0	96.0	97.0					10																	119044221		2203	4300	6503	SO:0001583	missense	118987	exon5			GACGGTCGTCCGA	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2023G>A	chr10.hg19:g.119044221C>T	ENSP00000334642:p.Asp675Asn	110.0	0.0	.		142.0	48.0	.	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	hg19	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156972	0.57259	.	.	ENSG00000165650	ENST00000334464	D	0.88975	-2.45	5.87	5.87	0.94306	.	0.100838	0.64402	D	0.000002	D	0.91168	0.7218	L	0.32530	0.975	0.54753	D	0.999988	D	0.76494	0.999	P	0.61275	0.886	D	0.91308	0.5072	10	0.59425	D	0.04	-20.2619	20.2043	0.98273	0.0:1.0:0.0:0.0	.	675	Q8NEN9	PDZD8_HUMAN	N	675	ENSP00000334642:D675N	ENSP00000334642:D675N	D	-	1	0	PDZD8	119034211	1.000000	0.71417	1.000000	0.80357	0.370000	0.29829	5.774000	0.68906	2.779000	0.95612	0.591000	0.81541	GAC	.	.	.	none		0.428	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
PRPF19	27339	hgsc.bcm.edu	37	11	60666069	60666069	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr11:60666069C>T	ENST00000227524.4	-	13	1289	c.1084G>A	c.(1084-1086)Gga>Aga	p.G362R		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19											haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						AAGATGAGTCCGTCAGGGTGG	0.562																																					p.G362R		Atlas-SNP	.											.	PRPF19	62	.	0			c.G1084A						PASS	.						95.0	84.0	88.0					11																	60666069		2203	4299	6502	SO:0001583	missense	27339	exon13			TGAGTCCGTCAGG	BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.1084G>A	chr11.hg19:g.60666069C>T	ENSP00000227524:p.Gly362Arg	91.0	0.0	.		91.0	4.0	.	NM_014502		Missense_Mutation	SNP	ENST00000227524.4	hg19	CCDS7995.1	.	.	.	.	.	.	.	.	.	.	C	33	5.267928	0.95429	.	.	ENSG00000110107	ENST00000227524;ENST00000535326	D;T	0.84873	-1.91;4.45	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);Ricin B lectin (1);	0.000000	0.85682	D	0.000000	D	0.94548	0.8244	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95597	0.8659	10	0.87932	D	0	-9.6313	18.4838	0.90821	0.0:1.0:0.0:0.0	.	362	Q9UMS4	PRP19_HUMAN	R	362;34	ENSP00000227524:G362R;ENSP00000445435:G34R	ENSP00000227524:G362R	G	-	1	0	PRPF19	60422645	1.000000	0.71417	0.991000	0.47740	0.950000	0.60333	7.296000	0.78790	2.683000	0.91414	0.655000	0.94253	GGA	.	.	.	none		0.562	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396334.1	NM_014502	
SART1	9092	hgsc.bcm.edu	37	11	65744127	65744127	+	Splice_Site	SNP	G	G	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr11:65744127G>C	ENST00000312397.5	+	14	1839	c.1747G>C	c.(1747-1749)Gac>Cac	p.D583H		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	583					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TGTGCCCCAGGACTTTGAACG	0.667																																					p.D583H		Atlas-SNP	.											.	SART1	41	.	0			c.G1747C						PASS	.						28.0	28.0	28.0					11																	65744127		2201	4296	6497	SO:0001630	splice_region_variant	9092	exon14			CCCCAGGACTTTG	AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.1747-1G>C	chr11.hg19:g.65744127G>C		86.0	0.0	.		104.0	34.0	.	NM_005146	A6NDN1|Q53GB5	Missense_Mutation	SNP	ENST00000312397.5	hg19	CCDS31611.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.123380	0.56613	.	.	ENSG00000175467	ENST00000312397;ENST00000542816	T	0.25250	1.81	4.11	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.49321	0.1550	M	0.74546	2.27	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.50849	-0.8779	9	.	.	.	-25.3255	13.9074	0.63845	0.0:0.0:1.0:0.0	.	583	O43290	SNUT1_HUMAN	H	583;425	ENSP00000310448:D583H	.	D	+	1	0	SART1	65500703	1.000000	0.71417	0.959000	0.39883	0.111000	0.19643	8.804000	0.91921	2.131000	0.65755	0.491000	0.48974	GAC	.	.	.	none		0.667	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391409.1		Missense_Mutation
LRFN4	78999	hgsc.bcm.edu	37	11	66627359	66627359	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr11:66627359C>G	ENST00000309602.4	+	2	1844	c.1601C>G	c.(1600-1602)aCt>aGt	p.T534S	PC_ENST00000393960.1_Intron|PC_ENST00000393955.2_Intron|LRFN4_ENST00000393952.3_Intron|PC_ENST00000393958.2_Intron	NM_024036.4	NP_076941.2	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III domain containing 4	534						integral component of membrane (GO:0016021)				breast(1)|lung(1)|prostate(1)	3						CTGGTCTTCACTGTGGCCTTG	0.716																																					p.T534S		Atlas-SNP	.											.	LRFN4	25	.	0			c.C1601G						PASS	.						36.0	29.0	31.0					11																	66627359		2190	4283	6473	SO:0001583	missense	78999	exon2			TCTTCACTGTGGC	BC007718	CCDS8153.1	11q13.1	2013-02-11				ENSG00000173621		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28456	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 6"""	612810				16495444, 16828986	Standard	NM_024036		Approved	MGC3103, SALM3., FIGLER6	uc001ojr.3	Q6PJG9		ENST00000309602.4:c.1601C>G	chr11.hg19:g.66627359C>G	ENSP00000312535:p.Thr534Ser	66.0	0.0	.		98.0	39.0	.	NM_024036	Q4VBZ3|Q59GV4|Q8N644|Q9BWJ0	Missense_Mutation	SNP	ENST00000309602.4	hg19	CCDS8153.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003128	0.74932	.	.	ENSG00000173621	ENST00000309602	T	0.49139	0.79	4.79	3.88	0.44766	.	0.399801	0.18584	N	0.136948	T	0.44052	0.1275	L	0.29908	0.895	0.80722	D	1	P	0.52170	0.951	P	0.52031	0.688	T	0.11891	-1.0569	10	0.23891	T	0.37	.	10.7673	0.46301	0.0:0.9054:0.0:0.0946	.	534	Q6PJG9	LRFN4_HUMAN	S	534	ENSP00000312535:T534S	ENSP00000312535:T534S	T	+	2	0	LRFN4	66383935	0.587000	0.26791	1.000000	0.80357	0.997000	0.91878	1.223000	0.32527	1.023000	0.39654	0.462000	0.41574	ACT	.	.	.	none		0.716	LRFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393127.1	NM_024036	
LRRC32	2615	hgsc.bcm.edu	37	11	76372150	76372150	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr11:76372150G>A	ENST00000407242.2	-	3	729	c.487C>T	c.(487-489)Cgc>Tgc	p.R163C	LRRC32_ENST00000464145.1_Intron|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000404995.1_Missense_Mutation_p.R163C|LRRC32_ENST00000260061.5_Missense_Mutation_p.R163C	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	163					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						CGGGTGAGGCGAGTCAGACTG	0.642																																					p.R163C		Atlas-SNP	.											LRRC32,brain,glioma,0,2	LRRC32	74	.	0			c.C487T						PASS	.						70.0	70.0	70.0					11																	76372150		2200	4292	6492	SO:0001583	missense	2615	exon3			TGAGGCGAGTCAG	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.487C>T	chr11.hg19:g.76372150G>A	ENSP00000384126:p.Arg163Cys	38.0	0.0	.		62.0	11.0	.	NM_005512	Q86V06	Missense_Mutation	SNP	ENST00000407242.2	hg19	CCDS8245.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.685814	0.47991	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995;ENST00000421973	T;T;T;T	0.80123	-1.34;-1.34;-1.34;0.34	4.43	4.43	0.53597	.	0.344997	0.29028	N	0.013367	D	0.82559	0.5063	L	0.58925	1.835	0.20196	N	0.999927	D;D	0.71674	0.996;0.998	P;P	0.57846	0.828;0.828	T	0.73717	-0.3895	10	0.45353	T	0.12	.	7.4961	0.27490	0.0:0.145:0.5544:0.3006	.	163;163	C9JYU3;Q14392	.;LRC32_HUMAN	C	163	ENSP00000260061:R163C;ENSP00000384126:R163C;ENSP00000385766:R163C;ENSP00000413331:R163C	ENSP00000260061:R163C	R	-	1	0	LRRC32	76049798	0.793000	0.28825	0.183000	0.23137	0.772000	0.43724	2.399000	0.44495	2.306000	0.77630	0.462000	0.41574	CGC	.	.	.	none		0.642	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
MYO7A	4647	hgsc.bcm.edu	37	11	76872079	76872079	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr11:76872079C>T	ENST00000409709.3	+	12	1533	c.1261C>T	c.(1261-1263)Cct>Tct	p.P421S	MYO7A_ENST00000409893.1_Missense_Mutation_p.P421S|MYO7A_ENST00000409619.2_Missense_Mutation_p.P410S|MYO7A_ENST00000458637.2_Missense_Mutation_p.P421S	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	421	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AATTTACAAGCCTCCCTCCCA	0.562																																					p.P421S		Atlas-SNP	.											.	MYO7A	164	.	0			c.C1261T						PASS	.						100.0	110.0	107.0					11																	76872079		2051	4183	6234	SO:0001583	missense	4647	exon12			TACAAGCCTCCCT	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1261C>T	chr11.hg19:g.76872079C>T	ENSP00000386331:p.Pro421Ser	88.0	0.0	.		120.0	47.0	.	NM_001127179	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	hg19	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965660	0.74131	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	5.34	5.34	0.76211	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.72716	0.3495	L	0.60957	1.885	0.80722	D	1	B;B;B	0.28128	0.201;0.107;0.197	B;B;B	0.35278	0.199;0.127;0.113	T	0.71237	-0.4652	10	0.48119	T	0.1	.	19.0292	0.92948	0.0:1.0:0.0:0.0	.	421;421;421	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	S	421;421;421;410;420;420;343;420	ENSP00000386331:P421S;ENSP00000386689:P421S;ENSP00000392185:P421S;ENSP00000386635:P410S	ENSP00000345075:P343S	P	+	1	0	MYO7A	76549727	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	6.006000	0.70724	2.486000	0.83907	0.585000	0.79938	CCT	.	.	.	none		0.562	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
CLEC1A	51267	hgsc.bcm.edu	37	12	10251426	10251426	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr12:10251426A>C	ENST00000315330.4	-	1	158	c.96T>G	c.(94-96)caT>caG	p.H32Q	CLEC1A_ENST00000457018.2_Missense_Mutation_p.H32Q|CLEC1A_ENST00000420265.2_Missense_Mutation_p.H32Q	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	32					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						GGGGCTCTGGATGCCGAGTTG	0.542																																					p.H32Q		Atlas-SNP	.											.	CLEC1A	48	.	0			c.T96G						PASS	.						82.0	71.0	75.0					12																	10251426		2203	4300	6503	SO:0001583	missense	51267	exon1			CTCTGGATGCCGA	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.96T>G	chr12.hg19:g.10251426A>C	ENSP00000326407:p.His32Gln	104.0	0.0	.		124.0	32.0	.	NM_016511	Q8IUW7|Q9NZH3	Missense_Mutation	SNP	ENST00000315330.4	hg19	CCDS8612.1	.	.	.	.	.	.	.	.	.	.	A	9.945	1.218431	0.22373	.	.	ENSG00000150048	ENST00000315330;ENST00000457018;ENST00000420265;ENST00000414501	T;T;T;T	0.41065	5.06;5.17;5.01;1.01	5.55	-5.06	0.02946	.	0.256382	0.26851	N	0.022167	T	0.11879	0.0289	N	0.04959	-0.14	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.17501	-1.0367	10	0.13853	T	0.58	.	0.9013	0.01274	0.2277:0.2131:0.3272:0.232	.	32;32;32	E7ESV9;E9PFB4;Q8NC01	.;.;CLC1A_HUMAN	Q	32	ENSP00000326407:H32Q;ENSP00000415048:H32Q;ENSP00000417010:H32Q;ENSP00000396272:H32Q	ENSP00000326407:H32Q	H	-	3	2	CLEC1A	10142693	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.426000	0.02443	-0.573000	0.05998	-0.173000	0.13275	CAT	.	.	.	none		0.542	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43896178	43896178	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr12:43896178A>C	ENST00000389420.3	-	4	643	c.644T>G	c.(643-645)tTt>tGt	p.F215C	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.F215C	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	215					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GTAGGTATGAAAGGGTAAACT	0.313																																					p.F215C		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.T644G						PASS	.						145.0	161.0	155.0					12																	43896178		2203	4299	6502	SO:0001583	missense	80070	exon4			GTATGAAAGGGTA	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.644T>G	chr12.hg19:g.43896178A>C	ENSP00000374071:p.Phe215Cys	56.0	0.0	.		82.0	24.0	.	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	hg19	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	A	9.204	1.029127	0.19512	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.61274	0.29;0.12	4.66	2.31	0.28768	.	0.677370	0.13497	N	0.383543	T	0.39545	0.1082	L	0.27053	0.805	0.21184	N	0.999766	B	0.06786	0.001	B	0.10450	0.005	T	0.23833	-1.0177	10	0.38643	T	0.18	.	4.8737	0.13646	0.6866:0.0:0.1669:0.1464	.	215	P59510	ATS20_HUMAN	C	215	ENSP00000374071:F215C;ENSP00000448341:F215C	ENSP00000374068:F215C	F	-	2	0	ADAMTS20	42182445	1.000000	0.71417	0.012000	0.15200	0.175000	0.22909	2.224000	0.42945	0.379000	0.24794	0.533000	0.62120	TTT	.	.	.	none		0.313	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
PPP1R12A	4659	hgsc.bcm.edu	37	12	80182551	80182551	+	Silent	SNP	A	A	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr12:80182551A>G	ENST00000450142.2	-	21	2945	c.2679T>C	c.(2677-2679)agT>agC	p.S893S	PPP1R12A_ENST00000437004.2_Silent_p.S893S|PPP1R12A_ENST00000550107.1_Silent_p.S837S|PPP1R12A_ENST00000546369.1_Silent_p.S806S|PPP1R12A_ENST00000261207.5_Silent_p.S893S	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	893					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						CTGATGTAGAACTGGTTTCAT	0.348																																					p.S893S		Atlas-SNP	.											.	PPP1R12A	76	.	0			c.T2679C						PASS	.						39.0	37.0	38.0					12																	80182551		1805	4080	5885	SO:0001819	synonymous_variant	4659	exon21			TGTAGAACTGGTT	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.2679T>C	chr12.hg19:g.80182551A>G		45.0	0.0	.		69.0	27.0	.	NM_002480	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Silent	SNP	ENST00000450142.2	hg19	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	A	9.444	1.088753	0.20390	.	.	ENSG00000058272	ENST00000550299	.	.	.	5.94	3.48	0.39840	.	.	.	.	.	T	0.55114	0.1900	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50457	-0.8826	4	.	.	.	.	6.2542	0.20864	0.7244:0.0:0.0767:0.1988	.	.	.	.	A	76	.	.	V	-	2	0	PPP1R12A	78706682	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.692000	0.47018	1.079000	0.41038	0.528000	0.53228	GTT	.	.	.	none		0.348	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
MYCBP2	23077	hgsc.bcm.edu	37	13	77742691	77742691	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr13:77742691T>C	ENST00000544440.2	-	40	5889	c.5872A>G	c.(5872-5874)Aat>Gat	p.N1958D	MYCBP2_ENST00000407578.2_Missense_Mutation_p.N1996D|MYCBP2_ENST00000357337.6_Missense_Mutation_p.N1958D|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GTCGACTGATTAGGGTTGAAG	0.498																																					p.N1996D		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.A5986G						PASS	.						226.0	195.0	205.0					13																	77742691		2203	4300	6503	SO:0001583	missense	23077	exon40			ACTGATTAGGGTT	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.5872A>G	chr13.hg19:g.77742691T>C	ENSP00000444596:p.Asn1958Asp	94.0	0.0	.		105.0	40.0	.	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	T	19.02	3.745961	0.69418	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.28454	1.62;1.61;1.62	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.42108	0.1188	L	0.29908	0.895	0.58432	D	0.999997	P	0.52842	0.956	D	0.65010	0.931	T	0.13150	-1.0520	10	0.29301	T	0.29	.	16.1459	0.81569	0.0:0.0:0.0:1.0	.	1958	O75592	MYCB2_HUMAN	D	1958;1996;1958	ENSP00000349892:N1958D;ENSP00000384288:N1996D;ENSP00000444596:N1958D	ENSP00000349892:N1958D	N	-	1	0	MYCBP2	76640692	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.221000	0.72209	0.528000	0.53228	AAT	.	.	.	none		0.498	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
ADCY4	196883	hgsc.bcm.edu	37	14	24787720	24787720	+	Silent	SNP	G	G	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr14:24787720G>T	ENST00000310677.4	-	26	3249	c.3136C>A	c.(3136-3138)Cgg>Agg	p.R1046R	ADCY4_ENST00000418030.2_Silent_p.R1046R|ADCY4_ENST00000554068.2_Silent_p.R1046R	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	1046					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		ATGACACCCCGGCTGTAGCAG	0.562																																					p.R1046R		Atlas-SNP	.											.	ADCY4	86	.	0			c.C3136A						PASS	.						113.0	102.0	106.0					14																	24787720		2203	4300	6503	SO:0001819	synonymous_variant	196883	exon26			CACCCCGGCTGTA	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.3136C>A	chr14.hg19:g.24787720G>T		78.0	0.0	.		95.0	4.0	.	NM_001198592	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Silent	SNP	ENST00000310677.4	hg19	CCDS9627.1																																																																																			.	.	.	none		0.562	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
NIN	51199	hgsc.bcm.edu	37	14	51208398	51208398	+	Silent	SNP	G	G	T	rs142213280		TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr14:51208398G>T	ENST00000382041.3	-	25	5540	c.5350C>A	c.(5350-5352)Cgg>Agg	p.R1784R	NIN_ENST00000389868.3_Silent_p.R1071R|NIN_ENST00000324330.9_Silent_p.R1784R|NIN_ENST00000530997.2_Silent_p.R1784R|NIN_ENST00000245441.5_Silent_p.R1784R|NIN_ENST00000382043.4_Silent_p.R1071R|NIN_ENST00000453196.1_Silent_p.R1784R	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1784					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					GATTTCATCCGGGACATTTGC	0.423			T	PDGFRB	MPD																																p.R1784R		Atlas-SNP	.		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	NIN	475	.	0			c.C5350A						PASS	.						194.0	183.0	187.0					14																	51208398		2203	4300	6503	SO:0001819	synonymous_variant	51199	exon25			TCATCCGGGACAT	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.5350C>A	chr14.hg19:g.51208398G>T		56.0	0.0	.		80.0	29.0	.	NM_020921	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Silent	SNP	ENST00000382041.3	hg19	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	G	3.994	-0.003957	0.07773	.	.	ENSG00000100503	ENST00000530997;ENST00000389869;ENST00000530853	.	.	.	5.38	4.48	0.54585	.	.	.	.	.	T	0.70954	0.3283	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70769	-0.4782	4	.	.	.	0.3126	15.3972	0.74805	0.0:0.1395:0.8605:0.0	.	.	.	.	Q	1274	.	.	P	-	2	0	NIN	50278148	0.565000	0.26610	0.240000	0.24138	0.475000	0.33008	1.835000	0.39181	1.404000	0.46819	0.563000	0.77884	CCG	.	G|1.000;A|0.000	.	alt		0.423	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
PLD4	122618	hgsc.bcm.edu	37	14	105395668	105395668	+	Nonsense_Mutation	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr14:105395668C>T	ENST00000392593.4	+	5	661	c.493C>T	c.(493-495)Cag>Tag	p.Q165*	PLD4_ENST00000553861.1_5'Flank|PLD4_ENST00000540372.1_Nonsense_Mutation_p.Q172*	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	165					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			GCAGAAGCTGCAGCAGCTGCT	0.647																																					p.Q165X		Atlas-SNP	.											.	PLD4	46	.	0			c.C493T						PASS	.						14.0	18.0	16.0					14																	105395668		2015	4160	6175	SO:0001587	stop_gained	122618	exon5			AAGCTGCAGCAGC		CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.493C>T	chr14.hg19:g.105395668C>T	ENSP00000376372:p.Gln165*	123.0	0.0	.		171.0	67.0	.	NM_138790	Q6UWD2	Nonsense_Mutation	SNP	ENST00000392593.4	hg19	CCDS9995.2	.	.	.	.	.	.	.	.	.	.	C	32	5.126145	0.94429	.	.	ENSG00000166428	ENST00000540372;ENST00000392593;ENST00000557573	.	.	.	4.16	0.899	0.19271	.	0.479596	0.20954	N	0.082696	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	0.003	12.7242	0.57162	0.0:0.305:0.695:0.0	.	.	.	.	X	172;165;163	.	ENSP00000376372:Q165X	Q	+	1	0	PLD4	104466713	0.000000	0.05858	0.992000	0.48379	0.986000	0.74619	-0.621000	0.05559	0.190000	0.20209	0.479000	0.44913	CAG	.	.	.	none		0.647	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000291348.2	NM_138790	
TRPM7	54822	hgsc.bcm.edu	37	15	50904942	50904942	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr15:50904942G>A	ENST00000313478.7	-	16	2136	c.1855C>T	c.(1855-1857)Cct>Tct	p.P619S	TRPM7_ENST00000560955.1_Missense_Mutation_p.P619S	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	619					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AGTGGATAAGGAAAGCGCTTG	0.383																																					p.P619S		Atlas-SNP	.											.	TRPM7	145	.	0			c.C1855T						PASS	.						193.0	195.0	194.0					15																	50904942		1842	4084	5926	SO:0001583	missense	54822	exon16			GATAAGGAAAGCG	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.1855C>T	chr15.hg19:g.50904942G>A	ENSP00000320239:p.Pro619Ser	59.0	0.0	.		79.0	30.0	.	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	hg19	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	G	9.636	1.137653	0.21123	.	.	ENSG00000092439	ENST00000313478	T	0.73681	-0.77	5.44	3.55	0.40652	.	0.000000	0.85682	D	0.000000	T	0.60560	0.2278	L	0.32530	0.975	0.49213	D	0.999769	P	0.35745	0.518	B	0.37650	0.255	T	0.51012	-0.8759	10	0.12430	T	0.62	-7.7048	9.4445	0.38688	0.134:0.1185:0.7475:0.0	.	619	Q96QT4	TRPM7_HUMAN	S	619	ENSP00000320239:P619S	ENSP00000320239:P619S	P	-	1	0	TRPM7	48692234	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	3.773000	0.55333	0.765000	0.33221	0.585000	0.79938	CCT	.	.	.	none		0.383	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
THSD4	79875	hgsc.bcm.edu	37	15	72037466	72037466	+	Missense_Mutation	SNP	G	G	A	rs374464107		TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr15:72037466G>A	ENST00000355327.3	+	12	2062	c.1928G>A	c.(1927-1929)cGc>cAc	p.R643H	THSD4_ENST00000357769.4_Missense_Mutation_p.R283H|THSD4_ENST00000261862.6_Missense_Mutation_p.R643H|THSD4_ENST00000567838.1_3'UTR			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	643					elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CCTATTTTCCGCTGTGTGCAC	0.542																																					p.R643H		Atlas-SNP	.											.	THSD4	75	.	0			c.G1928A						PASS	.	G	HIS/ARG	0,4006		0,0,2003	297.0	300.0	299.0		1928	2.9	1.0	15		299	1,8345		0,1,4172	no	missense	THSD4	NM_024817.2	29	0,1,6175	AA,AG,GG		0.012,0.0,0.0081	benign	643/1019	72037466	1,12351	2003	4173	6176	SO:0001583	missense	79875	exon11			TTTTCCGCTGTGT	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.1928G>A	chr15.hg19:g.72037466G>A	ENSP00000347484:p.Arg643His	52.0	0.0	.		64.0	18.0	.	NM_024817	B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	hg19	CCDS10238.2	.	.	.	.	.	.	.	.	.	.	G	7.907	0.735646	0.15574	0.0	1.2E-4	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.61040	0.14;0.14;0.14	4.96	2.87	0.33458	.	.	.	.	.	T	0.34077	0.0885	N	0.14661	0.345	0.37248	D	0.906434	B;B	0.19445	0.017;0.036	B;B	0.14023	0.004;0.01	T	0.17806	-1.0357	9	0.14252	T	0.57	.	8.2784	0.31885	0.2135:0.0:0.7865:0.0	.	283;643	B4DR13;Q6ZMP0	.;THSD4_HUMAN	H	643;643;283	ENSP00000347484:R643H;ENSP00000261862:R643H;ENSP00000350413:R283H	ENSP00000261862:R643H	R	+	2	0	THSD4	69824520	0.648000	0.27313	0.997000	0.53966	0.996000	0.88848	0.393000	0.20817	1.249000	0.43950	0.491000	0.48974	CGC	.	.	.	weak		0.542	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817	
KIAA0556	23247	hgsc.bcm.edu	37	16	27751558	27751558	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr16:27751558C>T	ENST00000261588.4	+	15	1959	c.1940C>T	c.(1939-1941)gCt>gTt	p.A647V		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	647						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CATGAGATGGCTGGTGCCAGC	0.537																																					p.A647V		Atlas-SNP	.											.	KIAA0556	348	.	0			c.C1940T						PASS	.						67.0	64.0	65.0					16																	27751558		2197	4300	6497	SO:0001583	missense	23247	exon15			AGATGGCTGGTGC	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.1940C>T	chr16.hg19:g.27751558C>T	ENSP00000261588:p.Ala647Val	98.0	0.0	.		106.0	6.0	.	NM_015202	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	hg19	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484756	0.44147	.	.	ENSG00000047578	ENST00000261588	T	0.10860	2.83	5.39	2.35	0.29111	.	0.712332	0.14666	N	0.305670	T	0.09512	0.0234	L	0.54323	1.7	0.09310	N	1	P	0.38078	0.617	B	0.34242	0.178	T	0.18999	-1.0319	10	0.41790	T	0.15	-6.6671	5.8366	0.18611	0.1594:0.6626:0.0:0.178	.	647	O60303	K0556_HUMAN	V	647	ENSP00000261588:A647V	ENSP00000261588:A647V	A	+	2	0	KIAA0556	27659059	0.000000	0.05858	0.014000	0.15608	0.110000	0.19582	0.116000	0.15561	1.269000	0.44280	0.655000	0.94253	GCT	.	.	.	none		0.537	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
CTCF	10664	hgsc.bcm.edu	37	16	67645250	67645250	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr16:67645250A>G	ENST00000264010.4	+	3	959	c.515A>G	c.(514-516)aAt>aGt	p.N172S	CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	172					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GTGGGGGCCAATGGAGAGGTG	0.493																																					p.N172S	Colon(175;1200 1966 6945 23069 27405)	Atlas-SNP	.											.	CTCF	193	.	0			c.A515G						PASS	.						54.0	57.0	56.0					16																	67645250		2198	4300	6498	SO:0001583	missense	10664	exon3			GGGCCAATGGAGA	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.515A>G	chr16.hg19:g.67645250A>G	ENSP00000264010:p.Asn172Ser	204.0	0.0	.		256.0	105.0	.	NM_006565	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	hg19	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.859178	0.51376	.	.	ENSG00000102974	ENST00000264010	T	0.09255	3.0	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.20292	0.0488	N	0.24115	0.695	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.01988	-1.1234	10	0.62326	D	0.03	-4.254	15.5629	0.76262	1.0:0.0:0.0:0.0	.	172	P49711	CTCF_HUMAN	S	172	ENSP00000264010:N172S	ENSP00000264010:N172S	N	+	2	0	CTCF	66202751	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.361000	0.66092	2.261000	0.74972	0.533000	0.62120	AAT	.	.	.	none		0.493	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
TP53	7157	hgsc.bcm.edu	37	17	7579355	7579355	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr17:7579355A>G	ENST00000269305.4	-	4	521	c.332T>C	c.(331-333)cTg>cCg	p.L111P	TP53_ENST00000455263.2_Missense_Mutation_p.L111P|TP53_ENST00000359597.4_Missense_Mutation_p.L111P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.L111P|TP53_ENST00000413465.2_Missense_Mutation_p.L111P|TP53_ENST00000445888.2_Missense_Mutation_p.L111P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	111	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> M (in a sporadic cancer; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> Q (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L111R(11)|p.0?(8)|p.L111Q(7)|p.L111P(6)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.L111fs*10(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAGAAGCCCAGACGGAAACC	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.L111P	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,carcinoma,0,38	TP53	33396	.	43	Substitution - Missense(24)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(2)|Deletion - In frame(1)|Complex - frameshift(1)	lung(9)|upper_aerodigestive_tract(7)|liver(6)|large_intestine(5)|central_nervous_system(4)|bone(4)|breast(4)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|urinary_tract(1)	c.T332C	GRCh37	CX942126	TP53	X		PASS	.						64.0	60.0	61.0					17																	7579355		2203	4300	6503	SO:0001583	missense	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AAGCCCAGACGGA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.332T>C	chr17.hg19:g.7579355A>G	ENSP00000269305:p.Leu111Pro	148.0	0.0	.		123.0	74.0	.	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.915273	0.73098	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99837	-7.06;-7.06;-7.06;-7.06;-7.06;-7.06;-7.06;-7.06	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.64402	D	0.000001	D	0.99760	0.9903	M	0.81942	2.565	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.994;0.992;1.0;0.997;1.0;1.0;0.996	D	0.96946	0.9691	10	0.87932	D	0	-10.3745	12.5363	0.56144	1.0:0.0:0.0:0.0	.	72;111;111;111;111;111;111	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	111	ENSP00000410739:L111P;ENSP00000352610:L111P;ENSP00000269305:L111P;ENSP00000398846:L111P;ENSP00000391127:L111P;ENSP00000391478:L111P;ENSP00000424104:L111P;ENSP00000426252:L111P	ENSP00000269305:L111P	L	-	2	0	TP53	7520080	0.739000	0.28196	0.244000	0.24202	0.958000	0.62258	7.389000	0.79806	2.125000	0.65367	0.533000	0.62120	CTG	.	.	.	none		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
FBXO47	494188	hgsc.bcm.edu	37	17	37099134	37099134	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr17:37099134A>T	ENST00000378079.2	-	9	1179	c.980T>A	c.(979-981)cTc>cAc	p.L327H		NM_001008777.2	NP_001008777.2	Q5MNV8	FBX47_HUMAN	F-box protein 47	327										NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	20						TAGCATTAGGAGACGTGCATT	0.403																																					p.L327H		Atlas-SNP	.											.	FBXO47	34	.	0			c.T980A						PASS	.						98.0	91.0	93.0					17																	37099134		2203	4300	6503	SO:0001583	missense	494188	exon9			ATTAGGAGACGTG		CCDS32639.1	17q12	2014-08-12			ENSG00000204952	ENSG00000204952		"""F-boxes /  ""other"""""	31969	protein-coding gene	gene with protein product		609498				15723337	Standard	NM_001008777		Approved		uc002hrc.2	Q5MNV8	OTTHUMG00000178945	ENST00000378079.2:c.980T>A	chr17.hg19:g.37099134A>T	ENSP00000367319:p.Leu327His	78.0	0.0	.		103.0	21.0	.	NM_001008777	B2RTZ4	Missense_Mutation	SNP	ENST00000378079.2	hg19	CCDS32639.1	.	.	.	.	.	.	.	.	.	.	A	18.14	3.558184	0.65538	.	.	ENSG00000204952	ENST00000378079	T	0.61158	0.13	5.9	4.8	0.61643	.	0.254055	0.40385	N	0.001113	T	0.71609	0.3360	M	0.66939	2.045	0.34792	D	0.735817	D	0.89917	1.0	D	0.67231	0.95	T	0.80763	-0.1237	10	0.87932	D	0	-13.2646	12.1337	0.53957	0.8566:0.1434:0.0:0.0	.	327	Q5MNV8	FBX47_HUMAN	H	327	ENSP00000367319:L327H	ENSP00000367319:L327H	L	-	2	0	FBXO47	34352660	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.161000	0.77505	1.013000	0.39391	0.482000	0.46254	CTC	.	.	.	none		0.403	FBXO47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444073.1	NM_001008777	
RAB40B	10966	hgsc.bcm.edu	37	17	80656364	80656364	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr17:80656364C>G	ENST00000571995.1	-	1	240	c.109G>C	c.(109-111)Ggc>Cgc	p.G37R	RAB40B_ENST00000269347.6_5'UTR|RAB40B_ENST00000538809.2_Missense_Mutation_p.G37R	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	37					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			TCGGCCGCGCCATCCTGCAGG	0.771																																					p.G37R		Atlas-SNP	.											.	RAB40B	24	.	0			c.G109C						PASS	.						20.0	20.0	20.0					17																	80656364		2193	4292	6485	SO:0001583	missense	10966	exon1			CCGCGCCATCCTG	U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.109G>C	chr17.hg19:g.80656364C>G	ENSP00000461785:p.Gly37Arg	86.0	0.0	.		92.0	22.0	.	NM_006822	Q8WVG3	Missense_Mutation	SNP	ENST00000571995.1	hg19	CCDS11816.1	.	.	.	.	.	.	.	.	.	.	c	22.0	4.225081	0.79576	.	.	ENSG00000141542	ENST00000269347;ENST00000538809	.	.	.	3.06	0.941	0.19519	Small GTP-binding protein domain (1);	0.086007	0.44902	U	0.000415	T	0.62648	0.2445	L	0.42581	1.335	0.50039	D	0.999846	D	0.71674	0.998	D	0.74674	0.984	T	0.60505	-0.7250	9	0.62326	D	0.03	.	7.9072	0.29769	0.0:0.7395:0.1633:0.0972	.	37	Q12829	RB40B_HUMAN	R	37;71	.	ENSP00000269347:G37R	G	-	1	0	RAB40B	78249653	1.000000	0.71417	0.997000	0.53966	0.886000	0.51366	3.169000	0.50809	0.312000	0.23038	-0.738000	0.03535	GGC	.	.	.	none		0.771	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439007.1		
LAMA3	3909	hgsc.bcm.edu	37	18	21530086	21530086	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr18:21530086C>T	ENST00000313654.9	+	72	9846	c.9605C>T	c.(9604-9606)cCc>cTc	p.P3202L	LAMA3_ENST00000587184.1_Missense_Mutation_p.P1537L|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Missense_Mutation_p.P1593L|LAMA3_ENST00000399516.3_Missense_Mutation_p.P3146L	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	3202	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GGAAGTCAGCCCGGGAAGCAC	0.498																																					p.P3202L		Atlas-SNP	.											.	LAMA3	397	.	0			c.C9605T						PASS	.						106.0	103.0	104.0					18																	21530086		2203	4300	6503	SO:0001583	missense	3909	exon72			GTCAGCCCGGGAA	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.9605C>T	chr18.hg19:g.21530086C>T	ENSP00000324532:p.Pro3202Leu	72.0	0.0	.		32.0	18.0	.	NM_198129	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	hg19	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208505	0.39003	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.79554	-1.28;-1.28;-1.28	5.7	1.77	0.24775	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.75781	0.3896	L	0.31294	0.92	0.09310	N	1	P;P;P;D	0.53462	0.822;0.734;0.849;0.96	B;B;B;P	0.54965	0.419;0.342;0.438;0.765	T	0.62525	-0.6836	9	0.36615	T	0.2	.	4.5329	0.12013	0.3242:0.3871:0.2215:0.0672	.	1537;1593;3146;3202	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	L	3202;3146;1593	ENSP00000324532:P3202L;ENSP00000382432:P3146L;ENSP00000269217:P1593L	ENSP00000269217:P1593L	P	+	2	0	LAMA3	19784084	0.000000	0.05858	0.000000	0.03702	0.299000	0.27559	-0.439000	0.06897	0.036000	0.15547	0.655000	0.94253	CCC	.	.	.	none		0.498	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
CALR	811	hgsc.bcm.edu	37	19	13050917	13050917	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr19:13050917T>C	ENST00000316448.5	+	4	521	c.448T>C	c.(448-450)Tac>Cac	p.Y150H		NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	150	N-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	CATCTTCAACTACAAGGGCAA	0.532																																					p.Y150H		Atlas-SNP	.											.	CALR	31	.	0			c.T448C						PASS	.						124.0	102.0	109.0					19																	13050917		2203	4300	6503	SO:0001583	missense	811	exon4			TTCAACTACAAGG	M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.448T>C	chr19.hg19:g.13050917T>C	ENSP00000320866:p.Tyr150His	105.0	0.0	.		155.0	10.0	.	NM_004343	Q6IAT4|Q9UDG2	Missense_Mutation	SNP	ENST00000316448.5	hg19	CCDS12288.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004029	0.74932	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	T	0.50277	0.75	5.7	5.7	0.88788	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.49253	0.1546	L	0.54323	1.7	0.80722	D	1	B	0.18310	0.027	B	0.32533	0.147	T	0.43605	-0.9381	10	0.37606	T	0.19	-30.8317	14.9384	0.70975	0.0:0.0:0.0:1.0	.	150	P27797	CALR_HUMAN	H	150;29	ENSP00000320866:Y150H	ENSP00000320866:Y150H	Y	+	1	0	CALR	12911917	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.875000	0.87205	2.173000	0.68751	0.459000	0.35465	TAC	.	.	.	none		0.532	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451952.1	NM_004343	
GADD45GIP1	90480	hgsc.bcm.edu	37	19	13065098	13065098	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr19:13065098T>G	ENST00000316939.1	-	2	616	c.593A>C	c.(592-594)aAg>aCg	p.K198T		NM_052850.3	NP_443082.2	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma interacting protein 1	198					cell cycle (GO:0007049)|viral process (GO:0016032)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				ovary(2)|prostate(1)|skin(1)	4						CGCCTCCTTCTTCCGTTTCTG	0.602																																					p.K198T		Atlas-SNP	.											.	GADD45GIP1	11	.	0			c.A593C						PASS	.						71.0	75.0	74.0					19																	13065098		2203	4300	6503	SO:0001583	missense	90480	exon2			TCCTTCTTCCGTT	AF479749	CCDS12290.1	19p13.2	2014-02-12				ENSG00000179271			29996	protein-coding gene	gene with protein product	"""papillomavirus L2 interacting nuclear protein 1"", ""CKII beta binding protein 2"", ""CR6 interacting factor 1"", ""p53-responsive gene 6"""	605162				10441517, 12482659	Standard	NM_052850		Approved	PLINP-1, MGC4667, MGC4758, CKBBP2, PRG6, Plinp1, CRIF1, CKbetaBP2	uc002mwb.4	Q8TAE8		ENST00000316939.1:c.593A>C	chr19.hg19:g.13065098T>G	ENSP00000323065:p.Lys198Thr	92.0	0.0	.		113.0	10.0	.	NM_052850	Q8IVM3|Q8TE51|Q969P9|Q9BSM6	Missense_Mutation	SNP	ENST00000316939.1	hg19	CCDS12290.1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.648449	0.47258	.	.	ENSG00000179271	ENST00000316939	.	.	.	5.04	4.01	0.46588	.	0.170944	0.48286	D	0.000189	T	0.68613	0.3020	M	0.75777	2.31	0.46701	D	0.999166	D	0.63880	0.993	D	0.63113	0.911	T	0.68557	-0.5377	9	0.72032	D	0.01	-0.2416	5.6027	0.17363	0.1536:0.0847:0.0:0.7617	.	198	Q8TAE8	G45IP_HUMAN	T	198	.	ENSP00000323065:K198T	K	-	2	0	GADD45GIP1	12926098	1.000000	0.71417	0.992000	0.48379	0.382000	0.30200	3.520000	0.53465	0.755000	0.32990	0.456000	0.33151	AAG	.	.	.	none		0.602	GADD45GIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452759.2	NM_052850	
PGLYRP2	114770	hgsc.bcm.edu	37	19	15586537	15586537	+	Missense_Mutation	SNP	C	C	A	rs145689498		TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr19:15586537C>A	ENST00000340880.4	-	2	1424	c.944G>T	c.(943-945)cGc>cTc	p.R315L	PGLYRP2_ENST00000292609.4_Missense_Mutation_p.R315L	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	315					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						GAAGTTGCTGCGGAACCCTGG	0.632																																					p.R315L		Atlas-SNP	.											.	PGLYRP2	116	.	0			c.G944T						PASS	.						41.0	41.0	41.0					19																	15586537		2203	4300	6503	SO:0001583	missense	114770	exon2			TTGCTGCGGAACC	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.944G>T	chr19.hg19:g.15586537C>A	ENSP00000345968:p.Arg315Leu	67.0	0.0	.		74.0	36.0	.	NM_052890	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	ENST00000340880.4	hg19	CCDS12330.2	.	.	.	.	.	.	.	.	.	.	C	18.78	3.696236	0.68386	.	.	ENSG00000161031	ENST00000340880;ENST00000292609	T;T	0.05925	3.39;3.37	5.46	4.41	0.53225	.	0.273852	0.32106	N	0.006569	T	0.14270	0.0345	M	0.69248	2.105	0.25310	N	0.989205	P;P	0.51240	0.943;0.827	P;B	0.53722	0.733;0.391	T	0.05146	-1.0903	10	0.38643	T	0.18	-17.4685	9.327	0.37999	0.0:0.8965:0.0:0.1035	.	315;315	Q96PD5-2;Q96PD5	.;PGRP2_HUMAN	L	315	ENSP00000345968:R315L;ENSP00000292609:R315L	ENSP00000292609:R315L	R	-	2	0	PGLYRP2	15447537	0.419000	0.25449	0.850000	0.33497	0.691000	0.40173	1.661000	0.37408	1.259000	0.44117	0.561000	0.74099	CGC	.	C|1.000;T|0.000	.	alt		0.632	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	NM_052890	
PRX	57716	hgsc.bcm.edu	37	19	40900916	40900916	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr19:40900916C>A	ENST00000324001.7	-	7	3613	c.3343G>T	c.(3343-3345)Gct>Tct	p.A1115S	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	1115	Glu-rich (acidic).				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACGGCCACAGCCCCCTCTGCC	0.672																																					p.A1115S		Atlas-SNP	.											.	PRX	151	.	0			c.G3343T						PASS	.						55.0	53.0	54.0					19																	40900916		2203	4300	6503	SO:0001583	missense	57716	exon7			CCACAGCCCCCTC	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.3343G>T	chr19.hg19:g.40900916C>A	ENSP00000326018:p.Ala1115Ser	31.0	0.0	.		35.0	10.0	.	NM_181882	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	hg19	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	C	0.137	-1.106788	0.01813	.	.	ENSG00000105227	ENST00000324001	T	0.01059	5.39	3.82	2.77	0.32553	.	0.669254	0.13016	N	0.420476	T	0.01189	0.0039	L	0.40543	1.245	0.22017	N	0.999411	B	0.18166	0.026	B	0.11329	0.006	T	0.47560	-0.9108	10	0.21540	T	0.41	-0.4464	5.8736	0.18816	0.0:0.7574:0.0:0.2426	.	1115	Q9BXM0	PRAX_HUMAN	S	1115	ENSP00000326018:A1115S	ENSP00000326018:A1115S	A	-	1	0	PRX	45592756	0.000000	0.05858	0.021000	0.16686	0.018000	0.09664	-1.062000	0.03468	0.812000	0.34326	0.491000	0.48974	GCT	.	.	.	none		0.672	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956	
NLRP7	199713	hgsc.bcm.edu	37	19	55450484	55450484	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr19:55450484A>T	ENST00000590030.1	-	3	1743	c.1703T>A	c.(1702-1704)cTg>cAg	p.L568Q	NLRP7_ENST00000588756.1_Missense_Mutation_p.L568Q|NLRP7_ENST00000446217.1_Missense_Mutation_p.L596Q|NLRP7_ENST00000328092.5_Missense_Mutation_p.L568Q|NLRP7_ENST00000592784.1_Missense_Mutation_p.L568Q|NLRP7_ENST00000448121.2_Missense_Mutation_p.L568Q|NLRP7_ENST00000340844.2_Missense_Mutation_p.L568Q			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	568							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		GACCTCCTTCAGGTCGGTCAC	0.517																																					p.L568Q		Atlas-SNP	.											.	NLRP7	411	.	0			c.T1703A						PASS	.						80.0	78.0	79.0					19																	55450484		2203	4300	6503	SO:0001583	missense	199713	exon4			TCCTTCAGGTCGG	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1703T>A	chr19.hg19:g.55450484A>T	ENSP00000465520:p.Leu568Gln	53.0	0.0	.		82.0	14.0	.	NM_001127255	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	hg19	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.329178	0.24167	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.75589	-0.89;-0.89;-0.95;-0.93	2.24	-4.48	0.03515	.	1.148190	0.06821	N	0.792301	T	0.73745	0.3626	L	0.44542	1.39	0.09310	N	1	D;D;D;D	0.65815	0.995;0.985;0.995;0.995	D;P;P;D	0.67900	0.931;0.901;0.901;0.954	T	0.63120	-0.6708	10	0.37606	T	0.19	.	1.4421	0.02357	0.4838:0.15:0.2155:0.1506	.	596;568;568;568	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	Q	568;568;568;596;335	ENSP00000329568:L568Q;ENSP00000409137:L568Q;ENSP00000339491:L568Q;ENSP00000414273:L596Q	ENSP00000329568:L568Q	L	-	2	0	NLRP7	60142296	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.087000	0.14958	-2.141000	0.00805	-0.464000	0.05259	CTG	.	.	.	none		0.517	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
ZNF583	147949	hgsc.bcm.edu	37	19	56935542	56935542	+	Silent	SNP	A	A	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr19:56935542A>T	ENST00000333201.9	+	5	1725	c.1515A>T	c.(1513-1515)ggA>ggT	p.G505G	ZNF583_ENST00000585612.1_Intron|ZNF583_ENST00000291598.7_Silent_p.G505G	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	505					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		GCTATAGTGGATCTCTTACTC	0.403																																					p.G505G		Atlas-SNP	.											.	ZNF583	83	.	0			c.A1515T						PASS	.						112.0	117.0	115.0					19																	56935542		2203	4300	6503	SO:0001819	synonymous_variant	147949	exon5			TAGTGGATCTCTT	AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.1515A>T	chr19.hg19:g.56935542A>T		43.0	0.0	.		55.0	24.0	.	NM_001159861	O14850|Q2NKK3	Silent	SNP	ENST00000333201.9	hg19	CCDS12943.1																																																																																			.	.	.	none		0.403	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478	
ADAM33	80332	hgsc.bcm.edu	37	20	3652297	3652297	+	Silent	SNP	G	G	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr20:3652297G>C	ENST00000356518.2	-	16	2077	c.1836C>G	c.(1834-1836)ctC>ctG	p.L612L	ADAM33_ENST00000379861.4_Silent_p.L612L|ADAM33_ENST00000350009.2_Silent_p.L612L|ADAM33_ENST00000466620.1_5'UTR	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	612	Cys-rich.		L -> H (in dbSNP:rs41453444). {ECO:0000269|Ref.4}.		proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						GGGCACTGGGGAGTGCCAAGG	0.642																																					p.L612L		Atlas-SNP	.											.	ADAM33	76	.	0			c.C1836G						PASS	.						29.0	23.0	25.0					20																	3652297		2197	4293	6490	SO:0001819	synonymous_variant	80332	exon16			ACTGGGGAGTGCC	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1836C>G	chr20.hg19:g.3652297G>C		44.0	0.0	.		47.0	19.0	.	NM_025220	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Silent	SNP	ENST00000356518.2	hg19	CCDS13058.1																																																																																			.	.	.	none		0.642	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220	
ESF1	51575	hgsc.bcm.edu	37	20	13763687	13763687	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr20:13763687T>A	ENST00000202816.1	-	2	207	c.100A>T	c.(100-102)Att>Ttt	p.I34F	NDUFAF5_ENST00000463598.1_5'Flank|NDUFAF5_ENST00000378106.5_5'Flank	NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	34					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						CTCTTGTCAATTTTGACTTTT	0.433																																					p.I34F		Atlas-SNP	.											.	ESF1	77	.	0			c.A100T						PASS	.						66.0	64.0	65.0					20																	13763687		2203	4300	6503	SO:0001583	missense	51575	exon2			TGTCAATTTTGAC		CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.100A>T	chr20.hg19:g.13763687T>A	ENSP00000202816:p.Ile34Phe	62.0	0.0	.		93.0	35.0	.	NM_001276380	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	ENST00000202816.1	hg19	CCDS13117.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.764628	0.89932	.	.	ENSG00000089048	ENST00000202816;ENST00000541185	T	0.36157	1.27	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.65460	0.2693	M	0.89478	3.035	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.73569	-0.3941	10	0.87932	D	0	.	13.9559	0.64147	0.0:0.0:0.0:1.0	.	34	Q9H501	ESF1_HUMAN	F	34	ENSP00000202816:I34F	ENSP00000202816:I34F	I	-	1	0	ESF1	13711687	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	1.765000	0.52091	0.383000	0.25322	ATT	.	.	.	none		0.433	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1	NM_016649	
TUBB1	81027	hgsc.bcm.edu	37	20	57599619	57599619	+	Silent	SNP	T	T	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr20:57599619T>C	ENST00000217133.1	+	4	1406	c.1137T>C	c.(1135-1137)aaT>aaC	p.N379N		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	379					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	AGATCTTTAATAGGGTCTCTG	0.522																																					p.N379N		Atlas-SNP	.											.	TUBB1	42	.	0			c.T1137C						PASS	.						46.0	43.0	44.0					20																	57599619		2203	4300	6503	SO:0001819	synonymous_variant	81027	exon4			CTTTAATAGGGTC	AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.1137T>C	chr20.hg19:g.57599619T>C		44.0	0.0	.		70.0	25.0	.	NM_030773		Silent	SNP	ENST00000217133.1	hg19	CCDS13475.1																																																																																			.	.	.	none		0.522	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079903.1	NM_030773	
TCP10L	140290	hgsc.bcm.edu	37	21	33956569	33956569	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr21:33956569G>A	ENST00000300258.3	-	2	159	c.46C>T	c.(46-48)Cac>Tac	p.H16Y	TCP10L_ENST00000472557.1_Intron|AP000275.65_ENST00000553001.1_Intron	NM_144659.5	NP_653260.1	Q8TDR4	TCP1L_HUMAN	t-complex 10-like	16					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	protein self-association (GO:0043621)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)			breast(1)|central_nervous_system(1)|liver(1)|skin(1)	4						TCCTCTGGGTGGGTGCCCTCT	0.632																																					p.H16Y		Atlas-SNP	.											.	TCP10L	24	.	0			c.C46T						PASS	.						52.0	49.0	50.0					21																	33956569		2203	4300	6503	SO:0001583	missense	140290	exon2			CTGGGTGGGTGCC	AF115967	CCDS13616.1	21p22.11	2012-09-20	2012-09-20		ENSG00000242220	ENSG00000242220			11657	protein-coding gene	gene with protein product		608365	"""t-complex 10 (a murine tcp homolog)-like"", ""t-complex 10 (mouse)-like"""			10830953	Standard	NM_144659		Approved	PRED77		Q8TDR4	OTTHUMG00000064901	ENST00000300258.3:c.46C>T	chr21.hg19:g.33956569G>A	ENSP00000300258:p.His16Tyr	58.0	0.0	.		72.0	21.0	.	NM_144659	Q53EW0|Q96LN5	Missense_Mutation	SNP	ENST00000300258.3	hg19	CCDS13616.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.495034	0.26774	.	.	ENSG00000242220	ENST00000300258	T	0.19669	2.13	0.468	0.468	0.16732	.	.	.	.	.	T	0.36771	0.0979	L	0.57536	1.79	0.09310	N	1	D	0.61080	0.989	D	0.70487	0.969	T	0.10800	-1.0614	8	0.87932	D	0	.	.	.	.	.	16	Q8TDR4	TCP1L_HUMAN	Y	16	ENSP00000300258:H16Y	ENSP00000300258:H16Y	H	-	1	0	TCP10L	32878440	0.003000	0.15002	0.033000	0.17914	0.051000	0.14879	-0.046000	0.11983	0.485000	0.27652	0.205000	0.17691	CAC	.	.	.	none		0.632	TCP10L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139350.1	NM_144659	
COL6A2	1292	hgsc.bcm.edu	37	21	47546102	47546102	+	Silent	SNP	C	C	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr21:47546102C>T	ENST00000300527.4	+	26	2477	c.2373C>T	c.(2371-2373)gaC>gaT	p.D791D	COL6A2_ENST00000357838.4_Silent_p.D791D|COL6A2_ENST00000310645.5_Silent_p.D791D|COL6A2_ENST00000397763.1_Silent_p.D791D|COL6A2_ENST00000409416.1_Silent_p.D791D	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	791	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TGTTCTCCGACCTGGTCGCTG	0.632																																					p.D791D		Atlas-SNP	.											.	COL6A2	351	.	0			c.C2373T						PASS	.						212.0	210.0	211.0					21																	47546102		2203	4300	6503	SO:0001819	synonymous_variant	1292	exon26			CTCCGACCTGGTC	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2373C>T	chr21.hg19:g.47546102C>T		26.0	0.0	.		34.0	10.0	.	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	ENST00000300527.4	hg19	CCDS13728.1																																																																																			.	.	.	none		0.632	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
EP300	2033	hgsc.bcm.edu	37	22	41527606	41527606	+	Silent	SNP	T	T	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr22:41527606T>C	ENST00000263253.7	+	6	2716	c.1497T>C	c.(1495-1497)tcT>tcC	p.S499S		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	499					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CTGGGCAGTCTCCCCAAGGCA	0.473			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.S499S		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.T1497C						PASS	.						84.0	82.0	83.0					22																	41527606		2203	4300	6503	SO:0001819	synonymous_variant	2033	exon6	Familial Cancer Database	Broad Thumb-Hallux syndrome	GCAGTCTCCCCAA	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.1497T>C	chr22.hg19:g.41527606T>C		78.0	0.0	.		97.0	16.0	.	NM_001429	B1AKC2	Silent	SNP	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.	.	none		0.473	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
MOV10L1	54456	hgsc.bcm.edu	37	22	50555698	50555698	+	Nonsense_Mutation	SNP	G	G	T			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr22:50555698G>T	ENST00000262794.5	+	9	1455	c.1372G>T	c.(1372-1374)Gaa>Taa	p.E458*	MOV10L1_ENST00000395858.3_Nonsense_Mutation_p.E458*|MOV10L1_ENST00000540615.1_Nonsense_Mutation_p.E438*|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000545383.1_Nonsense_Mutation_p.E458*	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	458					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.E458K(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TGCTGCGCGCGAACCATTTTC	0.423																																					p.E458X		Atlas-SNP	.											MOV10L1,rectum,carcinoma,0,1	MOV10L1	238	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1372T						PASS	.						80.0	76.0	77.0					22																	50555698		2203	4300	6503	SO:0001587	stop_gained	54456	exon9			GCGCGCGAACCAT	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1372G>T	chr22.hg19:g.50555698G>T	ENSP00000262794:p.Glu458*	113.0	2.0	.		110.0	36.0	.	NM_018995	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Nonsense_Mutation	SNP	ENST00000262794.5	hg19	CCDS14084.1	.	.	.	.	.	.	.	.	.	.	G	37	6.499084	0.97616	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	.	.	.	5.76	5.76	0.90799	.	0.237801	0.43260	D	0.000585	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-29.9369	18.7444	0.91787	0.0:0.0:1.0:0.0	.	.	.	.	X	458;458;458;438	.	ENSP00000262794:E458X	E	+	1	0	MOV10L1	48897825	0.426000	0.25506	0.468000	0.27192	0.010000	0.07245	2.329000	0.43876	2.716000	0.92895	0.650000	0.86243	GAA	.	.	.	none		0.423	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995	
FANCB	2187	hgsc.bcm.edu	37	X	14862799	14862799	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chrX:14862799G>A	ENST00000324138.3	-	8	2144	c.1991C>T	c.(1990-1992)tCa>tTa	p.S664L	FANCB_ENST00000398334.1_Missense_Mutation_p.S664L	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	664					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					ATAGCCGGGTGATGTGATTTG	0.368								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.S664L		Atlas-SNP	.											.	FANCB	78	.	0			c.C1991T						PASS	.						77.0	77.0	77.0					X																	14862799		2203	4299	6502	SO:0001583	missense	2187	exon8	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CCGGGTGATGTGA	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1991C>T	chrX.hg19:g.14862799G>A	ENSP00000326819:p.Ser664Leu	119.0	0.0	.		118.0	89.0	.	NM_152633	B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	ENST00000324138.3	hg19	CCDS14161.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780725	0.49891	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	5.5	5.5	0.81552	.	0.068421	0.64402	D	0.000011	T	0.73393	0.3581	L	0.59436	1.845	0.42896	D	0.994218	D	0.63046	0.992	P	0.56865	0.808	T	0.76974	-0.2760	9	0.87932	D	0	-6.2689	18.4174	0.90575	0.0:0.0:1.0:0.0	.	664	Q8NB91	FANCB_HUMAN	L	664	.	ENSP00000326819:S664L	S	-	2	0	FANCB	14772720	1.000000	0.71417	0.040000	0.18447	0.006000	0.05464	6.647000	0.74354	2.289000	0.77006	0.594000	0.82650	TCA	.	.	.	none		0.368	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633	
GPKOW	27238	hgsc.bcm.edu	37	X	48979991	48979991	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chrX:48979991C>A	ENST00000156109.5	-	1	160	c.82G>T	c.(82-84)Gca>Tca	p.A28S		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	28						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						CGCCTCCGTGCGGACGTGCGA	0.617																																					p.A28S		Atlas-SNP	.											.	GPKOW	38	.	0			c.G82T						PASS	.						26.0	23.0	24.0					X																	48979991		2202	4299	6501	SO:0001583	missense	27238	exon1			TCCGTGCGGACGT	U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.82G>T	chrX.hg19:g.48979991C>A	ENSP00000156109:p.Ala28Ser	169.0	0.0	.		222.0	172.0	.	NM_015698	Q59EK5|Q9BQA8	Missense_Mutation	SNP	ENST00000156109.5	hg19	CCDS35251.1	.	.	.	.	.	.	.	.	.	.	C	7.394	0.631345	0.14322	.	.	ENSG00000068394	ENST00000156109	.	.	.	5.39	-2.38	0.06622	.	0.722949	0.14213	N	0.333912	T	0.21962	0.0529	L	0.34521	1.04	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.31052	-0.9957	9	0.07990	T	0.79	.	5.6619	0.17674	0.4884:0.3358:0.0:0.1758	.	28	Q92917	GPKOW_HUMAN	S	28	.	ENSP00000156109:A28S	A	-	1	0	GPKOW	48866935	0.000000	0.05858	0.003000	0.11579	0.742000	0.42306	-0.802000	0.04545	-0.289000	0.09038	0.504000	0.49776	GCA	.	.	.	none		0.617	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056535.2	NM_015698	
SMARCA1	6594	hgsc.bcm.edu	37	X	128582334	128582334	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chrX:128582334C>G	ENST00000371122.4	-	24	3246	c.3117G>C	c.(3115-3117)aaG>aaC	p.K1039N	SMARCA1_ENST00000371121.3_Missense_Mutation_p.K1027N|SMARCA1_ENST00000371123.1_Missense_Mutation_p.K1027N	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	1039					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						TTGCCCGTTTCTTCTTTTCTG	0.313																																					p.K1039N		Atlas-SNP	.											.	SMARCA1	126	.	0			c.G3117C						PASS	.						148.0	136.0	140.0					X																	128582334		2203	4297	6500	SO:0001583	missense	6594	exon24			CCGTTTCTTCTTT	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.3117G>C	chrX.hg19:g.128582334C>G	ENSP00000360163:p.Lys1039Asn	54.0	0.0	.		66.0	46.0	.	NM_003069	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	hg19	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.663123	0.47572	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122	D;D;D	0.92299	-3.01;-3.01;-2.99	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000005	D	0.96667	0.8912	M	0.87758	2.905	0.80722	D	1	D;D;D;D	0.69078	0.981;0.997;0.989;0.981	D;D;D;D	0.77004	0.966;0.989;0.985;0.966	D	0.96323	0.9238	10	0.51188	T	0.08	-18.2877	19.3889	0.94570	0.0:1.0:0.0:0.0	.	1018;1039;1027;1039	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	N	1027;1027;1039	ENSP00000360162:K1027N;ENSP00000360164:K1027N;ENSP00000360163:K1039N	ENSP00000360162:K1027N	K	-	3	2	SMARCA1	128410015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.498000	0.53302	2.618000	0.88619	0.600000	0.82982	AAG	.	.	.	none		0.313	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
MT-CO1	4512	hgsc.bcm.edu	37	M	7236	7236	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chrM:7236G>A	ENST00000361624.2	+	1	1333	c.1333G>A	c.(1333-1335)Gat>Aat	p.D445N	MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-ATP8_ENST00000361851.1_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	445					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CGGACTACCCCGATGCATACA	0.408																																					p.D445N		Atlas-SNP	.											.	.	.	.	0			c.G1333A						PASS	.																																			SO:0001583	missense	5742	exon1			TACCCCGATGCAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1333G>A	chrM.hg19:g.7236G>A	ENSP00000354499:p.Asp445Asn	8.0	0.0	.		190.0	9.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	none		0.408	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
NEFH	4744	hgsc.bcm.edu	37	22	29885591	29885592	+	In_Frame_Ins	INS	-	-	CCTGAGAAGGCCAAGTCC	rs200984527|rs267607533		TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr22:29885591_29885592insCCTGAGAAGGCCAAGTCC	ENST00000310624.6	+	4	1995_1996	c.1962_1963insCCTGAGAAGGCCAAGTCC	c.(1963-1965)cca>CCTGAGAAGGCCAAGTCCcca	p.655_655P>PEKAKSP		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGCCAAGTCCCCAGAGAAGGA	0.559																																					p.S654delinsSPEKAKS		Atlas-INDEL	.											.,2	NEFH	178	.	0			c.1962_1963insCCTGAGAAGGCCAAGTCC						PASS	.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1945_1962dupCCTGAGAAGGCCAAGTCC	chr22.hg19:g.29885591_29885592insCCTGAGAAGGCCAAGTCC	ENSP00000311997:p.GluLysAlaLysSerPro655dup	179.0	0.0	0		270.0	55.0	0.203704	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.	.	none		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
DENND5A	23258	hgsc.bcm.edu	37	11	9187516	9187517	+	Splice_Site	INS	-	-	AGAA			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr11:9187516_9187517insAGAA	ENST00000328194.3	-	11	2472		c.e11-2		DENND5A_ENST00000527700.1_Splice_Site|DENND5A_ENST00000530044.1_Splice_Site	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A						positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GATGTACTTCTATATCAAACAG	0.45																																					.		Atlas-Indel,Pindel	.											.	DENND5A	84	.	0			c.2152-2->TTCT						PASS	.																																			SO:0001630	splice_region_variant	23258	exon12			.	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.2152-2->TTCT	chr11.hg19:g.9187516_9187517insAGAA		61.0	0.0	0		80.0	20.0	0.25	NM_001243254	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Splice_Site	INS	ENST00000328194.3	hg19	CCDS31423.1																																																																																			.	.	.	none		0.450	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	Intron
SECISBP2	79048	hgsc.bcm.edu	37	9	91961869	91961869	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr9:91961869delC	ENST00000375807.3	+	11	1579	c.1508delC	c.(1507-1509)accfs	p.T503fs	SECISBP2_ENST00000339901.4_Frame_Shift_Del_p.T430fs|SECISBP2_ENST00000534113.2_Frame_Shift_Del_p.T435fs	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	503					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						CAAATGAAGACCCCGCACAAT	0.552																																					p.T503fs		Atlas-Indel,Pindel	.											.	SECISBP2	64	.	0			c.1507delA						PASS	.						87.0	82.0	84.0					9																	91961869		2203	4300	6503	SO:0001589	frameshift_variant	79048	exon11			.	AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.1508delC	chr9.hg19:g.91961869delC	ENSP00000364965:p.Thr503fs	63.0	0.0	0		95.0	27.0	0.284211	NM_024077	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Frame_Shift_Del	DEL	ENST00000375807.3	hg19	CCDS6683.1																																																																																			.	.	.	none		0.552	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	
FKBP11	51303	hgsc.bcm.edu	37	12	49317595	49317596	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr12:49317595_49317596delCA	ENST00000550765.1	-	5	755_756	c.357_358delTG	c.(355-360)tatggafs	p.YG119fs	CCDC65_ENST00000266984.5_Intron|FKBP11_ENST00000444214.2_Frame_Shift_Del_p.YG17fs|AC073610.5_ENST00000537495.1_Intron|RP11-302B13.5_ENST00000398092.4_Intron|FKBP11_ENST00000552878.1_Frame_Shift_Del_p.YG119fs|FKBP11_ENST00000453172.2_Frame_Shift_Del_p.YG119fs	NM_016594.2	NP_057678.1	Q9NYL4	FKB11_HUMAN	FK506 binding protein 11, 19 kDa	119	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			kidney(1)|large_intestine(3)|lung(1)	5						CCCCGTTTTCCATAGGCCAAGT	0.51																																					p.120_120del		Atlas-Indel,Pindel	.											.	FKBP11	12	.	0			c.358_359del						PASS	.																																			SO:0001589	frameshift_variant	51303	exon5			.	AF238079	CCDS8773.1, CCDS44870.1, CCDS44871.1	12q13.12	2008-08-04	2002-08-29			ENSG00000134285			18624	protein-coding gene	gene with protein product		610571	"""FK506 binding protein 11 (19 kDa)"""			12036304, 16596453	Standard	NM_016594		Approved	FKBP19	uc001rsp.3	Q9NYL4		ENST00000550765.1:c.357_358delTG	chr12.hg19:g.49317595_49317596delCA	ENSP00000449751:p.Tyr119fs	103.0	0.0	0		107.0	41.0	0.383178	NM_016594	B4DWB7	Frame_Shift_Del	DEL	ENST00000550765.1	hg19	CCDS8773.1																																																																																			.	.	.	none		0.510	FKBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408927.1	NM_016594	
NLGN1	22871	hgsc.bcm.edu	37	3	173997169	173997169	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr3:173997169delT	ENST00000457714.1	+	6	1807	c.1378delT	c.(1378-1380)tttfs	p.F460fs	NLGN1_ENST00000361589.4_Frame_Shift_Del_p.F460fs|NLGN1_ENST00000401917.3_Frame_Shift_Del_p.F500fs|NLGN1_ENST00000545397.1_Frame_Shift_Del_p.F460fs	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	477					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ACTGGCTTTGTTTACGGACCA	0.448																																					p.L459fs		Atlas-Indel,Pindel	.											NLGN1,NS,carcinoma,0,1	NLGN1	209	.	0			c.1377delG						PASS	.						97.0	93.0	95.0					3																	173997169		2203	4300	6503	SO:0001589	frameshift_variant	22871	exon6			.	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1378delT	chr3.hg19:g.173997169delT	ENSP00000392500:p.Phe460fs	153.0	0.0	0		180.0	50.0	0.277778	NM_014932	Q9UPT2	Frame_Shift_Del	DEL	ENST00000457714.1	hg19	CCDS3222.1																																																																																			.	.	.	none		0.448	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
BTG2	7832	hgsc.bcm.edu	37	1	203276494	203276495	+	Frame_Shift_Ins	INS	-	-	A			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr1:203276494_203276495insA	ENST00000290551.4	+	2	476_477	c.405_406insA	c.(406-408)accfs	p.T136fs	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	136					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			GTGGGCTCCTCACCTGCAAGAA	0.668																																					p.L135fs		Atlas-Indel,Pindel	.											.	BTG2	16	.	0			c.405_406insA						PASS	.																																			SO:0001589	frameshift_variant	7832	exon2			.		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.406dupA	chr1.hg19:g.203276495_203276495dupA	ENSP00000290551:p.Thr136fs	55.0	0.0	0		85.0	22.0	0.258824	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Frame_Shift_Ins	INS	ENST00000290551.4	hg19	CCDS1437.1																																																																																			.	.	.	none		0.668	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
TCF25	22980	hgsc.bcm.edu	37	16	89940088	89940089	+	Frame_Shift_Ins	INS	-	-	C			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr16:89940088_89940089insC	ENST00000263346.8	+	1	69_70	c.13_14insC	c.(13-15)gccfs	p.A5fs		NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	5					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		GTCGCGCCGGGCCCTCCGGAGG	0.678																																					p.A5fs		Atlas-Indel,Pindel	.											.	TCF25	61	.	0			c.13_14insC						PASS	.																																			SO:0001589	frameshift_variant	22980	exon1			.	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.16dupC	chr16.hg19:g.89940091_89940091dupC	ENSP00000263346:p.Ala5fs	88.0	0.0	0		93.0	36.0	0.387097	NM_014972	Q2MK75|Q9UPV3	Frame_Shift_Ins	INS	ENST00000263346.8	hg19	CCDS10987.1																																																																																			.	.	.	none		0.678	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2	NM_014972	
DUOX2	50506	hgsc.bcm.edu	37	15	45402911	45402913	+	Intron	DEL	GAG	GAG	-			TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr15:45402911_45402913delGAG	ENST00000603300.1	-	8	1085				DUOX2_ENST00000389039.6_Intron	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2						adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GCGATGTTCTGAGGGGCAGAGAG	0.611																																					.		Atlas-Indel,Pindel	.											.	DUOX2	137	.	0			.						PASS	.																																			SO:0001627	intron_variant	50506	.			.	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.883-3CTC>-	chr15.hg19:g.45402911_45402913delGAG		180.0	0.0	0		225.0	63.0	0.28	.	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Splice_Site	DEL	ENST00000603300.1	hg19	CCDS10117.1																																																																																			.	.	.	none		0.611	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
SLC2A13	114134	hgsc.bcm.edu	37	12	40422123	40422134	+	In_Frame_Del	DEL	TCCTCTTCAATG	TCCTCTTCAATG	-	rs375574046		TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	TCCTCTTCAATG	TCCTCTTCAATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr12:40422123_40422134delTCCTCTTCAATG	ENST00000280871.4	-	3	944_955	c.894_905delCATTGAAGAGGA	c.(892-906)aacattgaagaggag>aag	p.298_302NIEEE>K	SLC2A13_ENST00000380858.1_In_Frame_Del_p.298_302NIEEE>K	NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	298					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				CTCTTTTTCCTCCTCTTCAATGTTGTTTTTGA	0.363										HNSCC(50;0.14)																											p.299_302del		Atlas-Indel,Pindel	.											.	SLC2A13	91	.	0			c.895_906del						PASS	.																																			SO:0001651	inframe_deletion	114134	exon3			.	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.894_905delCATTGAAGAGGA	chr12.hg19:g.40422123_40422134delTCCTCTTCAATG	ENSP00000280871:p.Asn298_Glu302delinsLys	67.0	0.0	0		46.0	12.0	0.26087	NM_052885	Q17S07	In_Frame_Del	DEL	ENST00000280871.4	hg19	CCDS8736.2																																																																																			.	.	.	none		0.363	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
PBRM1	55193	hgsc.bcm.edu	37	3	52613184	52613184	+	Frame_Shift_Del	DEL	T	T	-	rs373854321		TCGA-5P-A9K3-01A-11D-A42J-10	TCGA-5P-A9K3-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84a1aab7-7e50-4015-accb-e32579b2fc62	fe756f10-d087-48bf-984d-e9ba64bab839	g.chr3:52613184delT	ENST00000296302.7	-	21	3420	c.3419delA	c.(3418-3420)aatfs	p.N1140fs	PBRM1_ENST00000394830.3_Frame_Shift_Del_p.N1115fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.N1155fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.N1115fs|SMIM4_ENST00000476842.1_3'UTR|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.N1108fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.N1140fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.N1155fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.N1140fs			Q86U86	PB1_HUMAN	polybromo 1	1140					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.N1140fs*19(2)|p.N1108fs*19(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGGTTCACCATTGGACATTTC	0.443			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.N1115fs		Atlas-Indel,Pindel	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	3	Deletion - Frameshift(3)	kidney(3)	c.3345delT						PASS	.						165.0	141.0	149.0					3																	52613184		2203	4300	6503	SO:0001589	frameshift_variant	55193	exon22			.	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3419delA	chr3.hg19:g.52613184delT	ENSP00000296302:p.Asn1140fs	75.0	0.0	0		82.0	61.0	0.743902	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	hg19																																																																																				.	.	.	none		0.443	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
