#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRDM2	7799	hgsc.bcm.edu	37	1	14105118	14105118	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:14105118G>T	ENST00000235372.7	+	8	1684	c.828G>T	c.(826-828)gaG>gaT	p.E276D	PRDM2_ENST00000343137.4_Missense_Mutation_p.E75D|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.E75D|PRDM2_ENST00000311066.5_Missense_Mutation_p.E276D|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000505823.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	276	Asp/Glu-rich (acidic).			EDEEEEEDDDDDELEDEG -> VGGGGGVVVVVSWKARGE (in Ref. 6; AAA87023). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		aagaggaggaggatgaagaag	0.507																																					p.E276D		Atlas-SNP	.											.	PRDM2	147	.	0			c.G828T						PASS	.						53.0	54.0	54.0					1																	14105118		2203	4300	6503	SO:0001583	missense	7799	exon8			GGAGGAGGATGAA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.828G>T	chr1.hg19:g.14105118G>T	ENSP00000235372:p.Glu276Asp	135.0	0.0	.		139.0	9.0	.	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	hg19	CCDS150.1	.	.	.	.	.	.	.	.	.	.	G	2.186	-0.386540	0.04966	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137;ENST00000407521	T;T;T;T	0.01871	4.71;4.59;4.59;4.59	3.35	-4.1	0.03940	.	0.206931	0.16085	U	0.230348	T	0.00906	0.0030	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.44620	-0.9316	10	0.25106	T	0.35	.	0.6861	0.00883	0.2164:0.1476:0.3377:0.2984	.	134;276;276	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	D	276;276;276;75;75;75	ENSP00000235372:E276D;ENSP00000312352:E276D;ENSP00000411103:E75D;ENSP00000341621:E75D	ENSP00000235372:E276D	E	+	3	2	PRDM2	13977705	0.000000	0.05858	0.076000	0.20297	0.107000	0.19398	-2.098000	0.01347	-0.616000	0.05671	-0.226000	0.12346	GAG	.	.	.	none		0.507	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
PRDM2	7799	hgsc.bcm.edu	37	1	14105121	14105121	+	Missense_Mutation	SNP	T	T	A	rs199679022		TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:14105121T>A	ENST00000235372.7	+	8	1687	c.831T>A	c.(829-831)gaT>gaA	p.D277E	PRDM2_ENST00000343137.4_Missense_Mutation_p.D76E|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.D76E|PRDM2_ENST00000311066.5_Missense_Mutation_p.D277E|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000505823.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	277	Asp/Glu-rich (acidic).			EDEEEEEDDDDDELEDEG -> VGGGGGVVVVVSWKARGE (in Ref. 6; AAA87023). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		aggaggaggatgaagaagaag	0.498																																					p.D277E		Atlas-SNP	.											PRDM2,colon,carcinoma,0,1	PRDM2	147	.	0			c.T831A						PASS	.						55.0	56.0	56.0					1																	14105121		2203	4300	6503	SO:0001583	missense	7799	exon8			GGAGGATGAAGAA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.831T>A	chr1.hg19:g.14105121T>A	ENSP00000235372:p.Asp277Glu	134.0	0.0	.		139.0	14.0	.	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	hg19	CCDS150.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.833500	0.00069	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137;ENST00000407521	T;T;T;T	0.01495	4.93;4.83;4.85;4.85	2.72	0.517	0.17025	.	1.614850	0.05616	N	0.579053	T	0.00967	0.0032	N	0.08118	0	0.09310	N	1	B;B;B;B	0.09022	0.001;0.0;0.001;0.002	B;B;B;B	0.04013	0.0;0.0;0.0;0.001	T	0.43637	-0.9379	10	0.02654	T	1	.	3.8016	0.08760	0.1568:0.0:0.5983:0.245	.	277;135;277;277	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	E	277;277;277;76;76;76	ENSP00000235372:D277E;ENSP00000312352:D277E;ENSP00000411103:D76E;ENSP00000341621:D76E	ENSP00000235372:D277E	D	+	3	2	PRDM2	13977708	0.074000	0.21230	0.135000	0.22099	0.097000	0.18754	-1.008000	0.03663	0.237000	0.21200	-0.319000	0.08680	GAT	.	T|0.999;G|0.001	.	alt		0.498	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
SZT2	23334	hgsc.bcm.edu	37	1	43896951	43896951	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:43896951C>A	ENST00000562955.1	+	33	4761	c.4761C>A	c.(4759-4761)agC>agA	p.S1587R	SZT2_ENST00000372442.1_Missense_Mutation_p.S745R	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1644					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CATCTGAAAGCAGTGCTTCAT	0.532																																					p.S1587R		Atlas-SNP	.											.	SZT2	383	.	0			c.C4761A						PASS	.						190.0	196.0	194.0					1																	43896951		2203	4300	6503	SO:0001583	missense	23334	exon33			TGAAAGCAGTGCT	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.4761C>A	chr1.hg19:g.43896951C>A	ENSP00000457168:p.Ser1587Arg	156.0	0.0	.		114.0	32.0	.	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	hg19	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407481	0.42715	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.61464	0.2349	L	0.52573	1.65	0.27731	N	0.944803	D	0.89917	1.0	D	0.87578	0.998	T	0.56583	-0.7955	9	0.56958	D	0.05	.	12.4908	0.55899	0.0:0.9231:0.0:0.0769	.	1587	Q5T011-5	.	R	745	.	ENSP00000361519:S745R	S	+	3	2	SZT2	43669538	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.696000	0.47052	2.595000	0.87683	0.563000	0.77884	AGC	.	.	.	none		0.532	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
DIO1	1733	hgsc.bcm.edu	37	1	54371929	54371929	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:54371929A>G	ENST00000361921.3	+	3	667	c.643A>G	c.(643-645)Agg>Ggg	p.R215G	DIO1_ENST00000524406.1_Missense_Mutation_p.R86G|DIO1_ENST00000322679.6_Intron|DIO1_ENST00000525202.1_Missense_Mutation_p.R151G|DIO1_ENST00000388876.3_Missense_Mutation_p.R167G|DIO1_ENST00000532493.1_Intron	NM_000792.5|NM_213593.3	NP_000783.2|NP_998758.1	P49895	IOD1_HUMAN	deiodinase, iodothyronine, type I	215					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)			cervix(1)|endometrium(2)|large_intestine(3)|lung(2)|skin(1)	9						ACTGCCTGAGAGGCTCTACAT	0.642																																					p.R167G		Atlas-SNP	.											.	DIO1	66	.	0			c.A499G						PASS	.						37.0	34.0	35.0					1																	54371929		2203	4300	6503	SO:0001583	missense	1733	exon2			CCTGAGAGGCTCT		CCDS30722.1, CCDS41339.1, CCDS41340.1, CCDS53320.1	1p33-p32	2012-03-01			ENSG00000211452	ENSG00000211452	1.97.1.10		2883	protein-coding gene	gene with protein product		147892		TXDI1		8964838	Standard	NM_000792		Approved		uc001cwb.3	P49895	OTTHUMG00000008435	ENST00000361921.3:c.643A>G	chr1.hg19:g.54371929A>G	ENSP00000354643:p.Arg215Gly	146.0	0.0	.		143.0	6.0	.	NM_001039715	Q1RN02|Q3KNP8|Q6Q4C1|Q6Q4C2|Q6Q4C3|Q6Q4C4|Q6Q4C5|Q6Q4C6|Q6Q4C7|Q6Q4C9|Q8WWC6	Missense_Mutation	SNP	ENST00000361921.3	hg19	CCDS41339.1	.	.	.	.	.	.	.	.	.	.	A	18.85	3.710682	0.68730	.	.	ENSG00000211452	ENST00000529589;ENST00000361921;ENST00000525202;ENST00000524406;ENST00000388876	T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72	4.94	2.35	0.29111	Thioredoxin-like fold (1);	0.000000	0.64402	D	0.000004	T	0.71929	0.3398	M	0.91459	3.21	0.35969	D	0.835158	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.989;0.997	T	0.81357	-0.0969	9	.	.	.	.	11.6333	0.51189	0.7221:0.2779:0.0:0.0	.	215;151;167	P49895;P49895-2;P49895-4	IOD1_HUMAN;.;.	G	172;215;151;86;167	ENSP00000432797:R172G;ENSP00000354643:R215G;ENSP00000435725:R151G;ENSP00000434152:R86G;ENSP00000373528:R167G	.	R	+	1	2	DIO1	54144517	1.000000	0.71417	0.983000	0.44433	0.963000	0.63663	1.113000	0.31184	0.794000	0.33899	0.459000	0.35465	AGG	.	.	.	none		0.642	DIO1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000023247.3		
PLA2G4A	5321	hgsc.bcm.edu	37	1	186880403	186880403	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:186880403G>A	ENST00000367466.3	+	7	592	c.440G>A	c.(439-441)aGt>aAt	p.S147N	PLA2G4A_ENST00000442353.2_Intron|PLA2G4A_ENST00000466600.1_3'UTR	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	147	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.|Phospholipid binding. {ECO:0000305}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	CTACGATTTAGTATGGCTCTG	0.448																																					p.S147N		Atlas-SNP	.											.	PLA2G4A	125	.	0			c.G440A						PASS	.						162.0	167.0	165.0					1																	186880403		2203	4300	6503	SO:0001583	missense	5321	exon7			GATTTAGTATGGC	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.440G>A	chr1.hg19:g.186880403G>A	ENSP00000356436:p.Ser147Asn	82.0	0.0	.		94.0	20.0	.	NM_024420	B1AKG4|Q29R80	Missense_Mutation	SNP	ENST00000367466.3	hg19	CCDS1372.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654167	0.47362	.	.	ENSG00000116711	ENST00000367466	T	0.04706	3.57	5.24	5.24	0.73138	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.06962	0.0177	L	0.53561	1.675	0.80722	D	1	B	0.21821	0.061	B	0.19148	0.024	T	0.30937	-0.9961	10	0.16420	T	0.52	-18.437	16.3228	0.82958	0.0:0.0:1.0:0.0	.	147	P47712	PA24A_HUMAN	N	147	ENSP00000356436:S147N	ENSP00000356436:S147N	S	+	2	0	PLA2G4A	185147026	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	5.534000	0.67167	2.437000	0.82529	0.650000	0.86243	AGT	.	.	.	none		0.448	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	
PPP2R5A	5525	hgsc.bcm.edu	37	1	212534084	212534084	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:212534084G>C	ENST00000261461.2	+	13	2007	c.1433G>C	c.(1432-1434)aGt>aCt	p.S478T	RP11-384C4.2_ENST00000447949.1_RNA|PPP2R5A_ENST00000537030.3_Missense_Mutation_p.S421T	NM_006243.3	NP_006234.1	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B', alpha	478					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of lipid kinase activity (GO:0090219)|positive regulation of protein dephosphorylation (GO:0035307)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|M band (GO:0031430)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|Z disc (GO:0030018)	kinase binding (GO:0019900)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		AACATGCACAGTATTCTCAGC	0.343																																					p.S478T		Atlas-SNP	.											.	PPP2R5A	48	.	0			c.G1433C						PASS	.						66.0	71.0	70.0					1																	212534084		2203	4300	6503	SO:0001583	missense	5525	exon13			TGCACAGTATTCT	BC022474	CCDS1503.1, CCDS55686.1	1q32.2-q32.3	2010-06-18	2010-04-14		ENSG00000066027	ENSG00000066027		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9309	protein-coding gene	gene with protein product		601643	"""protein phosphatase 2, regulatory subunit B (B56), alpha isoform"", ""protein phosphatase 2, regulatory subunit B', alpha isoform"""			7592815	Standard	NM_006243		Approved	PR61A, B56A	uc001hjb.3	Q15172	OTTHUMG00000036750	ENST00000261461.2:c.1433G>C	chr1.hg19:g.212534084G>C	ENSP00000261461:p.Ser478Thr	612.0	0.0	.		616.0	68.0	.	NM_006243	B2R6D2|B7Z7L2|D3DT99|Q2NL72|Q5VVB2|Q8TBI9	Missense_Mutation	SNP	ENST00000261461.2	hg19	CCDS1503.1	.	.	.	.	.	.	.	.	.	.	g	8.348	0.830290	0.16749	.	.	ENSG00000066027	ENST00000542178;ENST00000261461;ENST00000537030	.	.	.	5.74	3.63	0.41609	.	0.809925	0.12040	N	0.505128	T	0.14874	0.0359	N	0.08118	0	0.23813	N	0.996775	B;B	0.09022	0.002;0.002	B;B	0.12156	0.004;0.007	T	0.26710	-1.0095	9	0.13853	T	0.58	-12.4512	1.8913	0.03249	0.258:0.0:0.4334:0.3086	.	421;478	B7Z7L2;Q15172	.;2A5A_HUMAN	T	478;478;421	.	ENSP00000261461:S478T	S	+	2	0	PPP2R5A	210600707	1.000000	0.71417	0.991000	0.47740	0.255000	0.26057	1.499000	0.35671	1.408000	0.46895	0.651000	0.88453	AGT	.	.	.	none		0.343	PPP2R5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089302.1	NM_006243	
PGBD2	267002	hgsc.bcm.edu	37	1	249210858	249210858	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:249210858G>T	ENST00000329291.5	+	3	222	c.75G>T	c.(73-75)gaG>gaT	p.E25D	PGBD2_ENST00000462488.1_Intron|PGBD2_ENST00000539153.1_Missense_Mutation_p.E22D|PGBD2_ENST00000355360.4_Intron	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	25										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AGCTGCTTGAGGTTCTGAATG	0.483																																					p.E25D		Atlas-SNP	.											.	PGBD2	103	.	0			c.G75T						PASS	.						81.0	79.0	80.0					1																	249210858		2203	4300	6503	SO:0001583	missense	267002	exon3			GCTTGAGGTTCTG	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.75G>T	chr1.hg19:g.249210858G>T	ENSP00000331643:p.Glu25Asp	91.0	0.0	.		101.0	5.0	.	NM_170725	B3KVR8|Q6MZF8	Missense_Mutation	SNP	ENST00000329291.5	hg19	CCDS31128.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201001	0.58234	.	.	ENSG00000185220	ENST00000329291;ENST00000539153	T;T	0.12465	2.68;2.68	4.08	3.16	0.36331	.	0.241764	0.20985	U	0.082152	T	0.12263	0.0298	L	0.47716	1.5	0.24031	N	0.996119	P;P	0.50528	0.936;0.895	P;B	0.44477	0.451;0.264	T	0.13202	-1.0518	10	0.25106	T	0.35	-3.497	7.0352	0.24989	0.1209:0.0:0.8791:0.0	.	22;25	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	D	25;22	ENSP00000331643:E25D;ENSP00000439950:E22D	ENSP00000331643:E25D	E	+	3	2	PGBD2	247177481	1.000000	0.71417	0.998000	0.56505	0.850000	0.48378	0.537000	0.23144	2.272000	0.75746	0.655000	0.94253	GAG	.	.	.	none		0.483	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
ZDBF2	57683	hgsc.bcm.edu	37	2	207170563	207170563	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr2:207170563T>G	ENST00000374423.3	+	5	1697	c.1311T>G	c.(1309-1311)gaT>gaG	p.D437E		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	437							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TACGTACTGATGTACAGTATA	0.338																																					p.D437E		Atlas-SNP	.											.	ZDBF2	531	.	0			c.T1311G						PASS	.						70.0	68.0	69.0					2																	207170563		1844	4091	5935	SO:0001583	missense	57683	exon5			TACTGATGTACAG	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.1311T>G	chr2.hg19:g.207170563T>G	ENSP00000363545:p.Asp437Glu	87.0	0.0	.		92.0	7.0	.	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	hg19	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	T	10.36	1.328042	0.24080	.	.	ENSG00000204186	ENST00000374423	T	0.45668	0.89	3.89	-2.8	0.05823	.	0.201148	0.24681	N	0.036479	T	0.28632	0.0709	L	0.43152	1.355	0.09310	N	1	B	0.26876	0.162	B	0.27076	0.076	T	0.17868	-1.0355	10	0.30854	T	0.27	.	9.0122	0.36148	0.0:0.5221:0.0:0.4779	.	437	Q9HCK1	ZDBF2_HUMAN	E	437	ENSP00000363545:D437E	ENSP00000363545:D437E	D	+	3	2	ZDBF2	206878808	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.004000	0.13106	-0.539000	0.06273	-0.256000	0.11100	GAT	.	.	.	none		0.338	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
UNC80	285175	hgsc.bcm.edu	37	2	210752974	210752974	+	Silent	SNP	G	G	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr2:210752974G>A	ENST00000439458.1	+	26	4352	c.4272G>A	c.(4270-4272)gaG>gaA	p.E1424E	UNC80_ENST00000272845.6_Silent_p.E1419E	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1424					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CAGGAGTCGAGGAGAAGAAAG	0.433																																					p.E1424E		Atlas-SNP	.											.	UNC80	280	.	0			c.G4272A						PASS	.						34.0	32.0	32.0					2																	210752974		692	1591	2283	SO:0001819	synonymous_variant	285175	exon26			AGTCGAGGAGAAG	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4272G>A	chr2.hg19:g.210752974G>A		205.0	0.0	.		197.0	61.0	.	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	ENST00000439458.1	hg19	CCDS46504.1																																																																																			.	.	.	none		0.433	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
FAM134A	79137	hgsc.bcm.edu	37	2	220044862	220044862	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr2:220044862C>G	ENST00000430297.2	+	4	586	c.450C>G	c.(448-450)caC>caG	p.H150Q	CNPPD1_ENST00000409789.1_5'Flank	NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	150						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCGGCCGCACCTGCTGAGTG	0.592																																					p.H150Q		Atlas-SNP	.											.	FAM134A	34	.	0			c.C450G						PASS	.						75.0	76.0	76.0					2																	220044862		2203	4300	6503	SO:0001583	missense	79137	exon4			GCCGCACCTGCTG	AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.450C>G	chr2.hg19:g.220044862C>G	ENSP00000395249:p.His150Gln	145.0	0.0	.		145.0	49.0	.	NM_024293	Q6P1P5|Q9H0K7	Missense_Mutation	SNP	ENST00000430297.2	hg19	CCDS2434.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026015	0.54683	.	.	ENSG00000144567	ENST00000430297	T	0.39997	1.05	4.53	4.53	0.55603	.	0.167420	0.56097	D	0.000032	T	0.41073	0.1143	N	0.22421	0.69	0.35553	D	0.804029	P	0.52692	0.955	P	0.54759	0.76	T	0.49952	-0.8884	10	0.39692	T	0.17	-10.4898	11.9832	0.53131	0.0:0.9169:0.0:0.0831	.	150	Q8NC44	F134A_HUMAN	Q	150	ENSP00000395249:H150Q	ENSP00000395249:H150Q	H	+	3	2	FAM134A	219753106	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.267000	0.33050	2.342000	0.79632	0.561000	0.74099	CAC	.	.	.	none		0.592	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336147.2	NM_024293	
CUL3	8452	hgsc.bcm.edu	37	2	225370771	225370771	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr2:225370771T>A	ENST00000264414.4	-	8	1446	c.1108A>T	c.(1108-1110)Att>Ttt	p.I370F	CUL3_ENST00000409777.1_Missense_Mutation_p.I346F|CUL3_ENST00000344951.4_Missense_Mutation_p.I304F|CUL3_ENST00000409096.1_Missense_Mutation_p.I346F	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	370					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TCACCCGCAATAGTTTGTTTA	0.383																																					p.I376F		Atlas-SNP	.											.	CUL3	96	.	0			c.A1126T						PASS	.						75.0	73.0	74.0					2																	225370771		2203	4300	6503	SO:0001583	missense	8452	exon8			CCGCAATAGTTTG	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1108A>T	chr2.hg19:g.225370771T>A	ENSP00000264414:p.Ile370Phe	318.0	1.0	.		274.0	89.0	.	NM_001257198	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	ENST00000264414.4	hg19	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.609729	0.87258	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84	5.63	5.63	0.86233	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76350	0.3975	M	0.71920	2.185	0.80722	D	1	P;B;P	0.45986	0.87;0.372;0.717	B;B;B	0.43301	0.291;0.415;0.415	T	0.79492	-0.1781	10	0.54805	T	0.06	.	16.1413	0.81528	0.0:0.0:0.0:1.0	.	304;348;370	Q13618-3;Q53S54;Q13618	.;.;CUL3_HUMAN	F	370;304;346;346	ENSP00000264414:I370F;ENSP00000343601:I304F;ENSP00000387200:I346F;ENSP00000386525:I346F	ENSP00000264414:I370F	I	-	1	0	CUL3	225079015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.655000	0.83696	2.270000	0.75569	0.482000	0.46254	ATT	.	.	.	none		0.383	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
TRIP12	9320	hgsc.bcm.edu	37	2	230656640	230656641	+	Missense_Mutation	DNP	CT	CT	TA			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr2:230656640_230656641CT>TA	ENST00000283943.5	-	28	4309_4310	c.4131_4132AG>TA	c.(4129-4134)acAGat>acTAat	p.D1378N	TRIP12_ENST00000389045.3_Missense_Mutation_p.D1108N|TRIP12_ENST00000389044.4_Missense_Mutation_p.D1426N	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1378					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CTCTCATCATCTGTGGATTCTC	0.381																																					p.D1378N|p.T1377T		Atlas-SNP	.											.	TRIP12	207	.	0			c.G4132A|c.A4131T						PASS	.																																			SO:0001583	missense	9320	exon28			CATCATCTGTGGA|ATCATCTGTGGAT	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4131_4132delinsTA	chr2.hg19:g.230656640_230656641delinsTA	ENSP00000283943:p.Asp1378Asn	205.0|206.0	0.0	.		163.0|161.0	51.0|49.0	.	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation|Silent	SNP	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.	.	none		0.381	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
ITPR1	3708	hgsc.bcm.edu	37	3	4704871	4704871	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr3:4704871A>G	ENST00000443694.2	+	13	1490	c.1490A>G	c.(1489-1491)gAa>gGa	p.E497G	ITPR1_ENST00000423119.2_Missense_Mutation_p.E512G|ITPR1_ENST00000357086.4_Missense_Mutation_p.E512G|ITPR1_ENST00000456211.2_Missense_Mutation_p.E497G|ITPR1_ENST00000302640.8_Missense_Mutation_p.E497G|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.E512G			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	512					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CTGATGAGAGAACAGAATATT	0.453																																					p.E512G		Atlas-SNP	.											.	ITPR1	659	.	0			c.A1535G						PASS	.						112.0	116.0	115.0					3																	4704871		1992	4184	6176	SO:0001583	missense	3708	exon16			TGAGAGAACAGAA	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.1490A>G	chr3.hg19:g.4704871A>G	ENSP00000401671:p.Glu497Gly	102.0	0.0	.		107.0	11.0	.	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	hg19	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.606397	0.87157	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72;-2.72	4.72	4.72	0.59763	Intracellular calcium-release channel (1);	0.098627	0.64402	D	0.000002	D	0.96018	0.8703	M	0.91459	3.21	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.998	D;D;D	0.80764	0.994;0.992;0.986	D	0.96933	0.9682	10	0.87932	D	0	.	14.3957	0.67010	1.0:0.0:0.0:0.0	.	497;512;512	E7EPX7;Q14643;G5E9P1	.;ITPR1_HUMAN;.	G	512;497;512;512;512;497;497	ENSP00000306253:E497G;ENSP00000346595:E512G;ENSP00000405934:E512G;ENSP00000349597:E512G;ENSP00000397885:E497G;ENSP00000401671:E497G	ENSP00000306253:E497G	E	+	2	0	ITPR1	4679871	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.054000	0.93866	1.990000	0.58119	0.533000	0.62120	GAA	.	.	.	none		0.453	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
CAND2	23066	hgsc.bcm.edu	37	3	12856913	12856913	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr3:12856913T>A	ENST00000456430.2	+	8	1321	c.1280T>A	c.(1279-1281)cTc>cAc	p.L427H	CAND2_ENST00000295989.5_Missense_Mutation_p.L334H	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	427					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GGCAGCAACCTCCATATGCTA	0.602																																					p.L427H	GBM(43;676 868 1633 6395 37496)	Atlas-SNP	.											.	CAND2	138	.	0			c.T1280A						PASS	.						43.0	51.0	49.0					3																	12856913		2080	4201	6281	SO:0001583	missense	23066	exon8			GCAACCTCCATAT		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1280T>A	chr3.hg19:g.12856913T>A	ENSP00000387641:p.Leu427His	419.0	0.0	.		418.0	137.0	.	NM_001162499	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	hg19	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	T	16.65	3.183403	0.57800	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	D;D	0.90620	-2.7;-2.7	4.7	2.12	0.27331	Armadillo-like helical (1);Armadillo-type fold (1);	0.184696	0.36740	N	0.002429	D	0.92893	0.7739	M	0.72894	2.215	0.80722	D	1	B;D	0.76494	0.439;0.999	B;D	0.81914	0.105;0.995	D	0.88911	0.3359	10	0.19590	T	0.45	-15.1226	9.6264	0.39752	0.0:0.0:0.3388:0.6612	.	427;334	O75155;O75155-2	CAND2_HUMAN;.	H	334;427	ENSP00000295989:L334H;ENSP00000387641:L427H	ENSP00000295989:L334H	L	+	2	0	CAND2	12831913	0.437000	0.25593	0.809000	0.32408	0.782000	0.44232	2.017000	0.40981	0.132000	0.18615	0.459000	0.35465	CTC	.	.	.	none		0.602	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
CCR9	10803	hgsc.bcm.edu	37	3	45943247	45943247	+	Silent	SNP	A	A	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr3:45943247A>C	ENST00000357632.2	+	3	1147	c.967A>C	c.(967-969)Aga>Cga	p.R323R	Y_RNA_ENST00000364765.1_RNA|CCR9_ENST00000395963.2_Silent_p.R311R|LZTFL1_ENST00000536047.1_Intron|LZTFL1_ENST00000539217.1_Intron|CCR9_ENST00000355983.2_Silent_p.R311R|CCR9_ENST00000422395.1_3'UTR	NM_001256369.1|NM_031200.2	NP_001243298.1|NP_112477.1	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9	323					cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(4)|large_intestine(8)|lung(2)|ovary(2)|prostate(2)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		TGTGGGTGAGAGATTCCGCCG	0.517																																					p.R323R		Atlas-SNP	.											.	CCR9	45	.	0			c.A967C						PASS	.						107.0	100.0	102.0					3																	45943247		2203	4300	6503	SO:0001819	synonymous_variant	10803	exon3			GGTGAGAGATTCC	AJ132337	CCDS2732.1, CCDS2733.1	3p21.31	2012-09-20			ENSG00000173585	ENSG00000173585		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1610	protein-coding gene	gene with protein product		604738		GPR28		10229797	Standard	NM_006641		Approved	GPR-9-6, CDw199	uc003coz.2	P51686	OTTHUMG00000133450	ENST00000357632.2:c.967A>C	chr3.hg19:g.45943247A>C		101.0	0.0	.		91.0	32.0	.	NM_031200	Q4VBM3|Q549E0|Q9UQQ6	Silent	SNP	ENST00000357632.2	hg19	CCDS2732.1																																																																																			.	.	.	none		0.517	CCR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257323.2		
HYAL2	8692	hgsc.bcm.edu	37	3	50357467	50357467	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr3:50357467G>A	ENST00000447092.1	-	1	2746	c.454C>T	c.(454-456)Cgc>Tgc	p.R152C	TUSC2_ENST00000462137.1_5'UTR|HYAL2_ENST00000357750.4_Missense_Mutation_p.R152C|HYAL2_ENST00000395139.3_Missense_Mutation_p.R152C|HYAL2_ENST00000442581.1_Missense_Mutation_p.R152C			Q12891	HYAL2_HUMAN	hyaluronoglucosaminidase 2	152					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|defense response to virus (GO:0051607)|fusion of virus membrane with host plasma membrane (GO:0019064)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hematopoietic progenitor cell differentiation (GO:0002244)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|kidney development (GO:0001822)|monocyte activation (GO:0042117)|multicellular organismal aging (GO:0010259)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|response to antibiotic (GO:0046677)|response to reactive oxygen species (GO:0000302)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|transformation of host cell by virus (GO:0019087)|viral entry into host cell (GO:0046718)	anchored component of external side of plasma membrane (GO:0031362)|anchored component of plasma membrane (GO:0046658)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|lysosome (GO:0005764)|membrane raft (GO:0045121)|microvillus (GO:0005902)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|hyaluronic acid binding (GO:0005540)|hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)|receptor signaling protein tyrosine kinase inhibitor activity (GO:0030294)|receptor tyrosine kinase binding (GO:0030971)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)			breast(1)|endometrium(2)|kidney(1)|ovary(1)|prostate(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GATAACCGGCGATACACATCT	0.582																																					p.R152C		Atlas-SNP	.											.	HYAL2	31	.	0			c.C454T						PASS	.						100.0	94.0	96.0					3																	50357467		2203	4300	6503	SO:0001583	missense	8692	exon3			ACCGGCGATACAC	AJ000099	CCDS2818.1	3p21.3	2008-07-18			ENSG00000068001	ENSG00000068001			5321	protein-coding gene	gene with protein product	"""lysosomal hyaluronidase"", ""PH-20 homolog"", ""hyaluronidase 2"""	603551				9712871, 9790770	Standard	NM_003773		Approved	LuCa-2, LUCA2	uc003czv.3	Q12891	OTTHUMG00000156876	ENST00000447092.1:c.454C>T	chr3.hg19:g.50357467G>A	ENSP00000401853:p.Arg152Cys	52.0	0.0	.		59.0	19.0	.	NM_033158	B3KRZ2|O15177|Q9BW29	Missense_Mutation	SNP	ENST00000447092.1	hg19	CCDS2818.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444411	0.83993	.	.	ENSG00000068001	ENST00000447092;ENST00000357750;ENST00000395139;ENST00000442581	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.68	5.68	0.88126	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.100850	0.64402	D	0.000003	T	0.62270	0.2414	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.69217	-0.5203	10	0.87932	D	0	-33.2855	13.3441	0.60561	0.0:0.0:0.8421:0.1579	.	152;152	B3KRZ2;Q12891	.;HYAL2_HUMAN	C	152	ENSP00000401853:R152C;ENSP00000350387:R152C;ENSP00000378571:R152C;ENSP00000406657:R152C	ENSP00000350387:R152C	R	-	1	0	HYAL2	50332471	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	7.819000	0.86621	2.683000	0.91414	0.455000	0.32223	CGC	.	.	.	none		0.582	HYAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346391.1	NM_003773	
GPR128	84873	hgsc.bcm.edu	37	3	100354648	100354648	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr3:100354648C>G	ENST00000273352.3	+	5	843	c.575C>G	c.(574-576)aCt>aGt	p.T192S	GPR128_ENST00000475887.1_5'UTR	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	192					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						ATATTCAACACTTCCAGAAAT	0.368																																					p.T192S	Pancreas(87;185 1975 7223 18722)	Atlas-SNP	.											.	GPR128	126	.	0			c.C575G						PASS	.						73.0	69.0	71.0					3																	100354648		2203	4300	6503	SO:0001583	missense	84873	exon5			TCAACACTTCCAG	AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.575C>G	chr3.hg19:g.100354648C>G	ENSP00000273352:p.Thr192Ser	182.0	0.0	.		178.0	71.0	.	NM_032787	Q14D94|Q86SQ2	Missense_Mutation	SNP	ENST00000273352.3	hg19	CCDS2938.1	.	.	.	.	.	.	.	.	.	.	C	4.358	0.065875	0.08388	.	.	ENSG00000144820	ENST00000273352	T	0.38401	1.14	5.65	1.34	0.21922	.	1.897240	0.02251	N	0.066623	T	0.33206	0.0855	L	0.56769	1.78	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.20974	-1.0259	10	0.07644	T	0.81	.	7.141	0.25556	0.5112:0.4042:0.0:0.0846	.	192	Q96K78	GP128_HUMAN	S	192	ENSP00000273352:T192S	ENSP00000273352:T192S	T	+	2	0	GPR128	101837338	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-1.307000	0.02733	0.228000	0.21019	0.591000	0.81541	ACT	.	.	.	none		0.368	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353236.1		
KIAA1524	57650	hgsc.bcm.edu	37	3	108271221	108271221	+	Splice_Site	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr3:108271221C>A	ENST00000295746.8	-	20	2484		c.e20-1		KIAA1524_ENST00000491772.1_Splice_Site	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524						positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGATGCAAATCTTAAAAGAAA	0.303																																					.		Atlas-SNP	.											.	KIAA1524	82	.	0			c.2408-1G>T						PASS	.						72.0	69.0	70.0					3																	108271221		2195	4296	6491	SO:0001630	splice_region_variant	57650	exon21			GCAAATCTTAAAA	AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.2408-1G>T	chr3.hg19:g.108271221C>A		39.0	0.0	.		34.0	15.0	.	NM_020890	A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Splice_Site	SNP	ENST00000295746.8	hg19	CCDS33812.1	.	.	.	.	.	.	.	.	.	.	C	18.19	3.569304	0.65765	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1089	0.89528	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA1524	109753911	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	4.749000	0.62155	2.244000	0.73946	0.557000	0.71058	.	.	.	.	none		0.303	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353975.2	NM_020890	Intron
C3orf30	152405	hgsc.bcm.edu	37	3	118865256	118865256	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr3:118865256G>C	ENST00000295622.1	+	1	260	c.220G>C	c.(220-222)Gga>Cga	p.G74R	IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	74										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		AGCTACCAACGGAGTAGCTGA	0.502																																					p.G74R		Atlas-SNP	.											.	C3orf30	64	.	0			c.G220C						PASS	.						71.0	55.0	60.0					3																	118865256		2203	4300	6503	SO:0001583	missense	152405	exon1			ACCAACGGAGTAG	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.220G>C	chr3.hg19:g.118865256G>C	ENSP00000295622:p.Gly74Arg	174.0	0.0	.		162.0	70.0	.	NM_152539	A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	hg19	CCDS2984.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.49|11.49	1.654796|1.654796	0.29425|0.29425	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150	T|.	0.22336|.	1.96|.	3.31|3.31	0.864|0.864	0.19068|0.19068	.|.	.|.	.|.	.|.	.|.	T|T	0.19366|0.19366	0.0465|0.0465	N|N	0.17082|0.17082	0.46|0.46	0.09310|0.09310	N|N	1|1	B;B|.	0.33583|.	0.004;0.418|.	B;B|.	0.26969|.	0.001;0.075|.	T|T	0.24621|0.24621	-1.0155|-1.0155	9|5	0.15952|.	T|.	0.53|.	-1.8244|-1.8244	4.332|4.332	0.11067|0.11067	0.6757:0.2027:0.1216:0.0|0.6757:0.2027:0.1216:0.0	.|.	74;74|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	R|P	74|37	ENSP00000295622:G74R|.	ENSP00000295622:G74R|.	G|R	+|+	1|2	0|0	C3orf30|C3orf30	120347946|120347946	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	1.226000|1.226000	0.32563|0.32563	0.176000|0.176000	0.19873|0.19873	-0.471000|-0.471000	0.05019|0.05019	GGA|CGG	.	.	.	none		0.502	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539	
ITGB5	3693	hgsc.bcm.edu	37	3	124527967	124527967	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr3:124527967G>T	ENST00000296181.4	-	9	1461	c.1165C>A	c.(1165-1167)Cag>Aag	p.Q389K		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	389					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		TCCTCAGGCTGATCCCAGACT	0.488																																					p.Q389K		Atlas-SNP	.											.	ITGB5	66	.	0			c.C1165A						PASS	.						114.0	111.0	112.0					3																	124527967		2203	4300	6503	SO:0001583	missense	3693	exon9			CAGGCTGATCCCA	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.1165C>A	chr3.hg19:g.124527967G>T	ENSP00000296181:p.Gln389Lys	109.0	0.0	.		117.0	25.0	.	NM_002213	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	hg19	CCDS3030.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.146|8.146	0.786378|0.786378	0.16189|0.16189	.|.	.|.	ENSG00000082781|ENSG00000082781	ENST00000296181|ENST00000496703	T|.	0.62498|.	0.02|.	5.63|5.63	3.69|3.69	0.42338|0.42338	Integrin beta subunit, N-terminal (2);|.	0.444750|.	0.23612|.	N|.	0.046324|.	T|.	0.30885|.	0.0779|.	N|N	0.21373|0.21373	0.66|0.66	0.29615|0.29615	N|N	0.846611|0.846611	B|.	0.25351|.	0.124|.	B|.	0.27500|.	0.08|.	T|.	0.10497|.	-1.0627|.	10|.	0.23891|.	T|.	0.37|.	.|.	7.7963|7.7963	0.29150|0.29150	0.0:0.1207:0.5314:0.3479|0.0:0.1207:0.5314:0.3479	.|.	389|.	P18084|.	ITB5_HUMAN|.	K|X	389|155	ENSP00000296181:Q389K|.	ENSP00000296181:Q389K|.	Q|S	-|-	1|2	0|0	ITGB5|ITGB5	126010657|126010657	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	4.353000|4.353000	0.59411|0.59411	2.656000|2.656000	0.90262|0.90262	0.655000|0.655000	0.94253|0.94253	CAG|TCA	.	.	.	none		0.488	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
CRMP1	1400	hgsc.bcm.edu	37	4	5838634	5838634	+	Splice_Site	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr4:5838634C>A	ENST00000397890.2	-	10	1183		c.e10-1		CRMP1_ENST00000512574.1_Splice_Site|CRMP1_ENST00000511535.1_Splice_Site|CRMP1_ENST00000324989.7_Splice_Site	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1						axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CAAGTCCCCACTGGCAAGGAC	0.532																																					.		Atlas-SNP	.											.	CRMP1	118	.	0			c.1311-1G>T						PASS	.						80.0	72.0	74.0					4																	5838634		2203	4300	6503	SO:0001630	splice_region_variant	1400	exon11			TCCCCACTGGCAA	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.969-1G>T	chr4.hg19:g.5838634C>A		43.0	0.0	.		47.0	7.0	.	NM_001014809	A0EJG6|Q13024|Q4W5F1|Q96TC8	Splice_Site	SNP	ENST00000397890.2	hg19	CCDS43207.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669144	0.67814	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9555	0.79884	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CRMP1	5889535	1.000000	0.71417	0.990000	0.47175	0.800000	0.45204	7.319000	0.79040	2.325000	0.78763	0.456000	0.33151	.	.	.	.	none		0.532	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	Intron
LRBA	987	hgsc.bcm.edu	37	4	151935618	151935618	+	Silent	SNP	T	T	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr4:151935618T>C	ENST00000357115.3	-	2	420	c.177A>G	c.(175-177)gaA>gaG	p.E59E	LRBA_ENST00000507224.1_Silent_p.E59E|LRBA_ENST00000510413.1_Silent_p.E59E|LRBA_ENST00000535741.1_Silent_p.E59E	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	59						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TATTGGATACTTCTCCAACTT	0.438																																					p.E59E		Atlas-SNP	.											.	LRBA	253	.	0			c.A177G						PASS	.						56.0	55.0	55.0					4																	151935618		2203	4300	6503	SO:0001819	synonymous_variant	987	exon2			GGATACTTCTCCA	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.177A>G	chr4.hg19:g.151935618T>C		183.0	0.0	.		152.0	40.0	.	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	ENST00000357115.3	hg19	CCDS3773.1																																																																																			.	.	.	none		0.438	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
CCDC110	256309	hgsc.bcm.edu	37	4	186379896	186379896	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr4:186379896C>G	ENST00000307588.3	-	6	1920	c.1845G>C	c.(1843-1845)caG>caC	p.Q615H	CCDC110_ENST00000393540.3_Missense_Mutation_p.Q578H|CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000510617.1_Missense_Mutation_p.Q615H	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	615						nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TCTCTTTTAGCTGGATTATCT	0.318																																					p.Q615H		Atlas-SNP	.											.	CCDC110	78	.	0			c.G1845C						PASS	.						74.0	78.0	76.0					4																	186379896		2200	4295	6495	SO:0001583	missense	256309	exon6			TTTTAGCTGGATT	AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.1845G>C	chr4.hg19:g.186379896C>G	ENSP00000306776:p.Gln615His	73.0	0.0	.		64.0	15.0	.	NM_152775	Q86YI9|Q8N7W0	Missense_Mutation	SNP	ENST00000307588.3	hg19	CCDS3843.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848641	0.32699	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.35421	1.31;1.31;1.31	5.55	1.79	0.24919	.	0.267348	0.27219	N	0.020368	T	0.48040	0.1478	M	0.65975	2.015	0.28722	N	0.902995	D;D;D	0.63880	0.993;0.98;0.993	P;P;P	0.60415	0.874;0.824;0.874	T	0.43523	-0.9386	10	0.72032	D	0.01	-6.7213	6.9762	0.24677	0.0:0.3022:0.0:0.6978	.	615;578;615	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	H	578;615;615	ENSP00000377172:Q578H;ENSP00000306776:Q615H;ENSP00000427246:Q615H	ENSP00000306776:Q615H	Q	-	3	2	CCDC110	186616890	1.000000	0.71417	0.193000	0.23327	0.716000	0.41182	0.893000	0.28336	0.109000	0.17891	0.655000	0.94253	CAG	.	.	.	none		0.318	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360519.2	NM_152775	
PCDHA7	56141	hgsc.bcm.edu	37	5	140215838	140215838	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr5:140215838G>A	ENST00000525929.1	+	1	1870	c.1870G>A	c.(1870-1872)Gtg>Atg	p.V624M	PCDHA7_ENST00000378125.3_Missense_Mutation_p.V624M|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGTTCCGCGTGGGGCTGTA	0.637																																					p.V624M	NSCLC(160;258 2013 5070 22440 28951)	Atlas-SNP	.											PCDHA7_ENST00000525929,colon,carcinoma,0,2	PCDHA7	367	.	0			c.G1870A						PASS	.						105.0	105.0	105.0					5																	140215838		2203	4300	6503	SO:0001583	missense	56141	exon1			TTCCGCGTGGGGC	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1870G>A	chr5.hg19:g.140215838G>A	ENSP00000436426:p.Val624Met	97.0	0.0	.		97.0	34.0	.	NM_031852	O75282	Missense_Mutation	SNP	ENST00000525929.1	hg19	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.640241	0.29157	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.59502	0.26;0.26	3.57	3.57	0.40892	Cadherin (4);Cadherin-like (1);	0.382752	0.15065	U	0.282541	T	0.75398	0.3844	M	0.78223	2.4	0.21386	N	0.999704	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.984	T	0.66019	-0.6027	10	0.87932	D	0	.	13.8776	0.63662	0.0:0.0:1.0:0.0	.	624;624	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	M	624	ENSP00000436426:V624M;ENSP00000367365:V624M	ENSP00000367365:V624M	V	+	1	0	PCDHA7	140196022	0.411000	0.25384	1.000000	0.80357	0.518000	0.34316	0.668000	0.25127	1.968000	0.57251	0.462000	0.41574	GTG	.	.	.	none		0.637	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDH12	51294	hgsc.bcm.edu	37	5	141331117	141331117	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr5:141331117T>A	ENST00000231484.3	-	2	4129	c.2919A>T	c.(2917-2919)caA>caT	p.Q973H	AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	973					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGCTGGAATTGGCCCTGAT	0.547											OREG0016877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q973H		Atlas-SNP	.											.	PCDH12	133	.	0			c.A2919T						PASS	.						113.0	104.0	107.0					5																	141331117		2203	4300	6503	SO:0001583	missense	51294	exon2			CTGGAATTGGCCC	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2919A>T	chr5.hg19:g.141331117T>A	ENSP00000231484:p.Gln973His	82.0	0.0	.	1663	104.0	22.0	.	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	hg19	CCDS4269.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.228733	0.79576	.	.	ENSG00000113555	ENST00000231484	T	0.76060	-0.99	6.08	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.82144	0.4973	M	0.74881	2.28	0.44012	D	0.996728	D	0.89917	1.0	D	0.73708	0.981	T	0.80845	-0.1200	10	0.49607	T	0.09	.	6.5721	0.22545	0.0:0.247:0.0:0.753	.	973	Q9NPG4	PCD12_HUMAN	H	973	ENSP00000231484:Q973H	ENSP00000231484:Q973H	Q	-	3	2	PCDH12	141311301	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.537000	0.36083	1.117000	0.41842	0.533000	0.62120	CAA	.	.	.	none		0.547	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
RANBP17	64901	hgsc.bcm.edu	37	5	170289055	170289055	+	Splice_Site	SNP	G	G	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr5:170289055G>A	ENST00000523189.1	+	1	182	c.18G>A	c.(16-18)caG>caA	p.Q6Q		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	6					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGCACTTCCAGGTCAGTGTGC	0.781			T	TRD@	ALL																																p.Q6Q		Atlas-SNP	.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17	108	.	0			c.G18A						PASS	.						2.0	2.0	2.0					5																	170289055		998	1929	2927	SO:0001630	splice_region_variant	64901	exon1			CTTCCAGGTCAGT	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.18+1G>A	chr5.hg19:g.170289055G>A		5.0	0.0	.		6.0	5.0	.	NM_022897	Q8IU74	Silent	SNP	ENST00000523189.1	hg19	CCDS34287.1																																																																																			.	.	.	none		0.781	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	Silent
KIAA0319	9856	hgsc.bcm.edu	37	6	24551749	24551749	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr6:24551749T>G	ENST00000378214.3	-	20	3477	c.2953A>C	c.(2953-2955)Aaa>Caa	p.K985Q	KIAA0319_ENST00000535378.1_Missense_Mutation_p.K976Q|KIAA0319_ENST00000537886.1_Intron|KIAA0319_ENST00000430948.2_Missense_Mutation_p.K940Q|KIAA0319_ENST00000543707.1_Missense_Mutation_p.K985Q	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	985					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						TTAGTCCTTTTTTGTCTGAAA	0.373																																					p.K985Q		Atlas-SNP	.											.	KIAA0319	117	.	0			c.A2953C						PASS	.						234.0	198.0	210.0					6																	24551749		2203	4300	6503	SO:0001583	missense	9856	exon20			TCCTTTTTTGTCT	AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.2953A>C	chr6.hg19:g.24551749T>G	ENSP00000367459:p.Lys985Gln	75.0	0.0	.		63.0	22.0	.	NM_001168375	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	ENST00000378214.3	hg19	CCDS34348.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041125	0.75732	.	.	ENSG00000137261	ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T	0.10005	2.92;2.93;2.92;2.92	4.55	4.55	0.56014	.	0.143376	0.46758	D	0.000269	T	0.19725	0.0474	L	0.56396	1.775	0.42490	D	0.992892	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.00891	-1.1525	10	0.62326	D	0.03	-16.8042	14.1127	0.65132	0.0:0.0:0.0:1.0	.	976;985	Q5VV43-2;Q5VV43	.;K0319_HUMAN	Q	976;940;985;985	ENSP00000442403:K976Q;ENSP00000401086:K940Q;ENSP00000367459:K985Q;ENSP00000437656:K985Q	ENSP00000367459:K985Q	K	-	1	0	KIAA0319	24659728	1.000000	0.71417	0.972000	0.41901	0.956000	0.61745	3.686000	0.54685	1.906000	0.55180	0.449000	0.29647	AAA	.	.	.	none		0.373	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	NM_014809	
FBXL4	26235	hgsc.bcm.edu	37	6	99374476	99374476	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr6:99374476G>A	ENST00000369244.2	-	4	817	c.389C>T	c.(388-390)aCt>aTt	p.T130I	FBXL4_ENST00000229971.1_Missense_Mutation_p.T130I	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	130					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TTGTTCAAAAGTAAGTTCCAC	0.443																																					p.T130I		Atlas-SNP	.											.	FBXL4	54	.	0			c.C389T						PASS	.						95.0	76.0	83.0					6																	99374476		2203	4300	6503	SO:0001583	missense	26235	exon3			TCAAAAGTAAGTT	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.389C>T	chr6.hg19:g.99374476G>A	ENSP00000358247:p.Thr130Ile	161.0	0.0	.		123.0	41.0	.	NM_012160	B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	ENST00000369244.2	hg19	CCDS5041.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.202194	0.38905	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.14893	2.47;2.47	5.52	5.52	0.82312	.	0.301455	0.40144	N	0.001178	T	0.07098	0.0180	N	0.19112	0.55	0.36933	D	0.89199	B	0.18166	0.026	B	0.20577	0.03	T	0.18524	-1.0334	10	0.30854	T	0.27	.	19.8176	0.96576	0.0:0.0:1.0:0.0	.	130	Q9UKA2	FBXL4_HUMAN	I	130	ENSP00000358247:T130I;ENSP00000229971:T130I	ENSP00000229971:T130I	T	-	2	0	FBXL4	99481197	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.947000	0.63583	2.765000	0.95021	0.650000	0.86243	ACT	.	.	.	none		0.443	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2		
SESN1	27244	hgsc.bcm.edu	37	6	109319902	109319902	+	Silent	SNP	T	T	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr6:109319902T>G	ENST00000356644.7	-	5	703	c.609A>C	c.(607-609)gtA>gtC	p.V203V	SESN1_ENST00000302071.2_Silent_p.V137V|RP11-787I22.3_ENST00000605885.1_RNA|SESN1_ENST00000436639.2_Silent_p.V262V	NM_001199933.1	NP_001186862.1	Q9Y6P5	SESN1_HUMAN	sestrin 1	203					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of cell proliferation (GO:0008285)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)	nucleus (GO:0005634)				cervix(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	10		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		TGAGTAAAACTACTGCATGTA	0.423																																					p.V262V		Atlas-SNP	.											.	SESN1	29	.	0			c.A786C						PASS	.						106.0	100.0	102.0					6																	109319902		2203	4299	6502	SO:0001819	synonymous_variant	27244	exon5			TAAAACTACTGCA	AF033120	CCDS5070.1, CCDS56444.1, CCDS56445.1	6q21	2008-10-23			ENSG00000080546	ENSG00000080546			21595	protein-coding gene	gene with protein product		606103				9926927, 7938006	Standard	NM_014454		Approved	SEST1, PA26	uc003psu.3	Q9Y6P5	OTTHUMG00000015338	ENST00000356644.7:c.609A>C	chr6.hg19:g.109319902T>G		133.0	0.0	.		126.0	31.0	.	NM_014454	Q2M2B7|Q5T316|Q9NV00|Q9UPD5|Q9Y6P6	Silent	SNP	ENST00000356644.7	hg19	CCDS56445.1																																																																																			.	.	.	none		0.423	SESN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041738.4	NM_014454	
TUBE1	51175	hgsc.bcm.edu	37	6	112392751	112392751	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr6:112392751T>C	ENST00000368662.5	-	12	1370	c.1292A>G	c.(1291-1293)cAa>cGa	p.Q431R	TUBE1_ENST00000604814.1_5'UTR	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	431					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	CCCTTCAACTTGTAGATAGTG	0.358																																					p.Q431R		Atlas-SNP	.											.	TUBE1	49	.	0			c.A1292G						PASS	.						109.0	100.0	103.0					6																	112392751		2203	4300	6503	SO:0001583	missense	51175	exon12			TCAACTTGTAGAT	AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.1292A>G	chr6.hg19:g.112392751T>C	ENSP00000357651:p.Gln431Arg	78.0	0.0	.		59.0	13.0	.	NM_016262	Q5H8W8|Q8NEG3	Missense_Mutation	SNP	ENST00000368662.5	hg19	CCDS5100.1	.	.	.	.	.	.	.	.	.	.	T	15.27	2.784984	0.49997	.	.	ENSG00000074935	ENST00000368662	T	0.78595	-1.19	5.62	5.62	0.85841	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.175445	0.51477	D	0.000096	T	0.65512	0.2698	L	0.48986	1.54	0.80722	D	1	B	0.13145	0.007	B	0.19946	0.027	T	0.67879	-0.5556	10	0.87932	D	0	.	15.807	0.78520	0.0:0.0:0.0:1.0	.	431	Q9UJT0	TBE_HUMAN	R	431	ENSP00000357651:Q431R	ENSP00000357651:Q431R	Q	-	2	0	TUBE1	112499444	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.903000	0.56318	2.128000	0.65567	0.533000	0.62120	CAA	.	.	.	none		0.358	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041867.1	NM_016262	
TSPYL4	23270	hgsc.bcm.edu	37	6	116574508	116574508	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr6:116574508C>A	ENST00000420283.1	-	1	753	c.664G>T	c.(664-666)Gac>Tac	p.D222Y	RP3-486I3.7_ENST00000448740.2_lincRNA|DSE_ENST00000540275.1_5'Flank	NM_021648.4	NP_067680.3	Q9UJ04	TSYL4_HUMAN	TSPY-like 4	222					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				endometrium(2)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(2)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.045)|OV - Ovarian serous cystadenocarcinoma(136;0.0666)|GBM - Glioblastoma multiforme(226;0.095)|Epithelial(106;0.125)		AAGGCCCTGTCAGCCTGGGCA	0.537																																					p.D222Y		Atlas-SNP	.											.	TSPYL4	18	.	0			c.G664T						PASS	.						33.0	34.0	33.0					6																	116574508		2017	4176	6193	SO:0001583	missense	23270	exon1			CCCTGTCAGCCTG		CCDS5106.1	6q22.1	2010-05-12			ENSG00000187189	ENSG00000187189			21559	protein-coding gene	gene with protein product							Standard	NM_021648		Approved	dJ486I3.2, KIAA0721	uc003pwn.3	Q9UJ04	OTTHUMG00000015429	ENST00000420283.1:c.664G>T	chr6.hg19:g.116574508C>A	ENSP00000410943:p.Asp222Tyr	74.0	0.0	.		73.0	24.0	.	NM_021648	B4DYQ2|O94828|Q96GW8	Missense_Mutation	SNP	ENST00000420283.1	hg19	CCDS5106.1	.	.	.	.	.	.	.	.	.	.	C	19.87	3.906607	0.72868	.	.	ENSG00000187189	ENST00000420283	T	0.26067	1.76	3.98	3.98	0.46160	.	.	.	.	.	T	0.43634	0.1256	M	0.77820	2.39	0.42876	D	0.994152	D	0.69078	0.997	D	0.77557	0.99	T	0.45308	-0.9270	9	0.72032	D	0.01	-19.1634	14.3987	0.67027	0.0:1.0:0.0:0.0	.	222	Q9UJ04	TSYL4_HUMAN	Y	222	ENSP00000410943:D222Y	ENSP00000410943:D222Y	D	-	1	0	TSPYL4	116681201	0.942000	0.31987	0.994000	0.49952	0.993000	0.82548	2.046000	0.41260	2.514000	0.84764	0.462000	0.41574	GAC	.	.	.	none		0.537	TSPYL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041934.2		
SHPRH	257218	hgsc.bcm.edu	37	6	146262786	146262786	+	Silent	SNP	A	A	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr6:146262786A>T	ENST00000367505.2	-	10	2727	c.2463T>A	c.(2461-2463)gcT>gcA	p.A821A	SHPRH_ENST00000438092.2_Silent_p.A821A|SHPRH_ENST00000275233.7_Silent_p.A821A|SHPRH_ENST00000367503.3_Silent_p.A821A			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	821	Helicase ATP-binding; second part. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CAACCATCTGAGCTTCATCAA	0.512																																					p.A821A		Atlas-SNP	.											.	SHPRH	169	.	0			c.T2463A						PASS	.						71.0	75.0	74.0					6																	146262786		1977	4155	6132	SO:0001819	synonymous_variant	257218	exon10			CATCTGAGCTTCA	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2463T>A	chr6.hg19:g.146262786A>T		84.0	0.0	.		60.0	23.0	.	NM_173082	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Silent	SNP	ENST00000367505.2	hg19	CCDS43513.2																																																																																			.	.	.	none		0.512	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
VOPP1	81552	hgsc.bcm.edu	37	7	55560085	55560085	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr7:55560085A>G	ENST00000285279.5	-	4	418	c.218T>C	c.(217-219)tTc>tCc	p.F73S	VOPP1_ENST00000418904.1_Missense_Mutation_p.F56S|VOPP1_ENST00000471168.1_5'Flank|VOPP1_ENST00000454227.1_Missense_Mutation_p.F10S|VOPP1_ENST00000427700.1_Missense_Mutation_p.F71S|VOPP1_ENST00000453256.1_Missense_Mutation_p.F6S|VOPP1_ENST00000428648.1_Missense_Mutation_p.F6S|VOPP1_ENST00000433959.1_Missense_Mutation_p.F64S|VOPP1_ENST00000545390.1_Missense_Mutation_p.F70S|VOPP1_ENST00000428097.1_Missense_Mutation_p.F6S	NM_001284282.1|NM_030796.3	NP_001271211.1|NP_110423.3	Q96AW1	VOPP1_HUMAN	vesicular, overexpressed in cancer, prosurvival protein 1	73					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|integral component of organelle membrane (GO:0031301)	signal transducer activity (GO:0004871)			endometrium(1)|lung(4)	5						TCCGCAGCAGAAAAGCACGCC	0.622																																					p.F73S		Atlas-SNP	.											.	VOPP1	14	.	0			c.T218C						PASS	.						17.0	21.0	20.0					7																	55560085		1930	4125	6055	SO:0001583	missense	81552	exon4			CAGCAGAAAAGCA		CCDS47588.1, CCDS64654.1, CCDS64656.1	7p11.2	2010-06-22			ENSG00000154978	ENSG00000154978			34518	protein-coding gene	gene with protein product	"""Glioblastoma-amplified secreted protein"", ""EGFR-coamplified and overexpressed protein"""	611915				15735698	Standard	NM_030796		Approved	ECop, GASP, FLJ20532, DKFZp564K0822	uc003tqs.3	Q96AW1	OTTHUMG00000156124	ENST00000285279.5:c.218T>C	chr7.hg19:g.55560085A>G	ENSP00000285279:p.Phe73Ser	163.0	0.0	.		149.0	35.0	.	NM_030796	B0AZU1|B2RAT4|B3KS72|C9JWR3|Q6FIE3|Q8NBN8|Q96RE5|Q9H0W4	Missense_Mutation	SNP	ENST00000285279.5	hg19	CCDS47588.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.551347	0.86127	.	.	ENSG00000154978	ENST00000285279;ENST00000428648;ENST00000433959;ENST00000545390;ENST00000428097;ENST00000418904;ENST00000454227;ENST00000453256;ENST00000427700;ENST00000455023;ENST00000414113;ENST00000417399;ENST00000452832	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	T	0.61702	0.2368	N	0.24115	0.695	0.53688	D	0.999971	D;D;D;D	0.76494	0.999;0.997;0.999;0.999	D;D;D;D	0.80764	0.994;0.991;0.994;0.994	T	0.65890	-0.6058	8	0.72032	D	0.01	-14.8351	11.7138	0.51641	1.0:0.0:0.0:0.0	.	56;70;73;64	C9JWR3;B0AZU1;Q96AW1;B3KS72	.;.;VOPP1_HUMAN;.	S	73;6;64;70;6;56;10;6;71;6;6;6;6	.	ENSP00000285279:F73S	F	-	2	0	VOPP1	55527579	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.730000	0.84881	1.635000	0.50512	0.460000	0.39030	TTC	.	.	.	none		0.622	VOPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343074.1	NM_030796	
ZNF713	349075	hgsc.bcm.edu	37	7	56006915	56006915	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr7:56006915A>C	ENST00000429591.2	+	4	547	c.509A>C	c.(508-510)aAt>aCt	p.N170T	MRPS17_ENST00000426595.1_Intron	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTTGAGTGTAATAAATTTGCA	0.383																																					p.N170T		Atlas-SNP	.											.	ZNF713	47	.	0			c.A509C						PASS	.						57.0	59.0	58.0					7																	56006915		2203	4300	6503	SO:0001583	missense	349075	exon4			AGTGTAATAAATT	AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.509A>C	chr7.hg19:g.56006915A>C	ENSP00000416662:p.Asn170Thr	245.0	0.0	.		184.0	48.0	.	NM_182633		Missense_Mutation	SNP	ENST00000429591.2	hg19	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	A	0.926	-0.714248	0.03206	.	.	ENSG00000178665	ENST00000429591	T	0.06933	3.24	3.78	0.12	0.14691	.	0.592008	0.14084	N	0.342516	T	0.07728	0.0194	L	0.55481	1.735	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.30327	-0.9982	10	0.49607	T	0.09	.	3.9021	0.09166	0.4915:0.1908:0.3177:0.0	.	170	Q8N859	ZN713_HUMAN	T	170	ENSP00000416662:N170T	ENSP00000416662:N170T	N	+	2	0	ZNF713	55974409	0.000000	0.05858	0.008000	0.14137	0.057000	0.15508	-1.087000	0.03383	0.015000	0.14971	-0.326000	0.08463	AAT	.	.	.	none		0.383	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633	
MET	4233	hgsc.bcm.edu	37	7	116423474	116423474	+	Missense_Mutation	SNP	T	T	C	rs121913245		TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr7:116423474T>C	ENST00000318493.6	+	19	3990	c.3803T>C	c.(3802-3804)aTg>aCg	p.M1268T	MET_ENST00000539704.1_Missense_Mutation_p.M120T|MET_ENST00000397752.3_Missense_Mutation_p.M1250T			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.M1268T(4)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GTGAAGTGGATGGCTTTGGAA	0.393			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.M1268T		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,rectum,carcinoma,+1,5	MET	412	.	4	Substitution - Missense(4)	kidney(4)	c.T3803C	GRCh37	CM992181	MET	M	rs121913245	PASS	.						93.0	92.0	92.0					7																	116423474		1872	4102	5974	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	AGTGGATGGCTTT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3803T>C	chr7.hg19:g.116423474T>C	ENSP00000317272:p.Met1268Thr	138.0	0.0	.		136.0	45.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.740165	0.69304	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.37752	1.18;1.18;1.18	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;1.0	T	0.65734	-0.6096	10	0.87932	D	0	.	16.2225	0.82267	0.0:0.0:0.0:1.0	.	1268;1250	P08581-2;P08581	.;MET_HUMAN	T	1250;1268;120	ENSP00000380860:M1250T;ENSP00000317272:M1268T;ENSP00000445020:M120T	ENSP00000317272:M1268T	M	+	2	0	MET	116210710	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.289000	0.77006	0.460000	0.39030	ATG	.	.	.	weak		0.393	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
CTTNBP2	83992	hgsc.bcm.edu	37	7	117375153	117375153	+	Splice_Site	SNP	T	T	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr7:117375153T>A	ENST00000160373.3	-	16	3781	c.3690A>T	c.(3688-3690)ggA>ggT	p.G1230G		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1230					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		ACAGTCCATTTCCTGAAACAA	0.438																																					p.G1230G		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.A3690T						PASS	.						43.0	46.0	45.0					7																	117375153		2203	4300	6503	SO:0001630	splice_region_variant	83992	exon16			TCCATTTCCTGAA		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3689-1A>T	chr7.hg19:g.117375153T>A		181.0	0.0	.		188.0	60.0	.	NM_033427	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	hg19	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	T	6.108	0.388122	0.11581	.	.	ENSG00000077063	ENST00000446636	.	.	.	5.52	3.13	0.36017	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7914	0.29123	0.0:0.0682:0.2618:0.67	.	.	.	.	X	718	.	.	K	-	1	0	CTTNBP2	117162389	1.000000	0.71417	0.995000	0.50966	0.166000	0.22503	4.491000	0.60326	0.460000	0.27045	-0.313000	0.08912	AAA	.	.	.	none		0.438	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	Silent
PTPRZ1	5803	hgsc.bcm.edu	37	7	121616253	121616253	+	Silent	SNP	C	C	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr7:121616253C>T	ENST00000393386.2	+	5	894	c.483C>T	c.(481-483)gaC>gaT	p.D161D	PTPRZ1_ENST00000449182.1_Silent_p.D161D	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	161	Alpha-carbonic anhydrase.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TTGATGCGGACCGATTTTCAA	0.308																																					p.D161D		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.C483T						PASS	.						112.0	106.0	108.0					7																	121616253		2203	4296	6499	SO:0001819	synonymous_variant	5803	exon5			TGCGGACCGATTT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.483C>T	chr7.hg19:g.121616253C>T		53.0	0.0	.		75.0	27.0	.	NM_001206838	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	hg19	CCDS34740.1																																																																																			.	.	.	none		0.308	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
SLC13A1	6561	hgsc.bcm.edu	37	7	122839917	122839917	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr7:122839917G>C	ENST00000194130.2	-	1	123	c.84C>G	c.(82-84)atC>atG	p.I28M		NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	28					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TGTGGAGGACGATGGGCAGAG	0.433																																					p.I28M		Atlas-SNP	.											.	SLC13A1	110	.	0			c.C84G						PASS	.						123.0	96.0	105.0					7																	122839917		2203	4300	6503	SO:0001583	missense	6561	exon1			GAGGACGATGGGC		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.84C>G	chr7.hg19:g.122839917G>C	ENSP00000194130:p.Ile28Met	75.0	0.0	.		95.0	31.0	.	NM_022444	Q9H5Z0	Missense_Mutation	SNP	ENST00000194130.2	hg19	CCDS5786.1	.	.	.	.	.	.	.	.	.	.	G	0.327	-0.958172	0.02267	.	.	ENSG00000081800	ENST00000194130	T	0.03035	4.07	5.73	0.75	0.18387	.	0.275865	0.35525	N	0.003157	T	0.05135	0.0137	M	0.67700	2.07	0.21105	N	0.999788	P	0.43542	0.81	B	0.42495	0.389	T	0.26224	-1.0109	10	0.49607	T	0.09	.	4.9281	0.13903	0.4153:0.0:0.4347:0.15	.	28	Q9BZW2	S13A1_HUMAN	M	28	ENSP00000194130:I28M	ENSP00000194130:I28M	I	-	3	3	SLC13A1	122627153	0.387000	0.25188	0.004000	0.12327	0.004000	0.04260	0.832000	0.27490	0.198000	0.20407	0.655000	0.94253	ATC	.	.	.	none		0.433	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444	
KMT2C	58508	hgsc.bcm.edu	37	7	151877112	151877112	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr7:151877112G>T	ENST00000262189.6	-	37	7467	c.7249C>A	c.(7249-7251)Cca>Aca	p.P2417T	KMT2C_ENST00000355193.2_Missense_Mutation_p.P2417T	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2417	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGAGGCCCTGGATGAGGCACT	0.552																																					p.P2417T		Atlas-SNP	.											.	MLL3	1564	.	0			c.C7249A						PASS	.						246.0	210.0	222.0					7																	151877112		2203	4300	6503	SO:0001583	missense	58508	exon37			GCCCTGGATGAGG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.7249C>A	chr7.hg19:g.151877112G>T	ENSP00000262189:p.Pro2417Thr	122.0	0.0	.		119.0	41.0	.	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	8.065	0.769065	0.15983	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.83591	-1.74;-1.74	5.5	3.67	0.42095	.	0.332800	0.21736	N	0.069896	T	0.73869	0.3642	L	0.59436	1.845	0.26605	N	0.972947	B;B	0.24823	0.008;0.112	B;B	0.17722	0.003;0.019	T	0.57051	-0.7877	10	0.15499	T	0.54	.	5.2311	0.15422	0.0787:0.3973:0.3945:0.1295	.	2417;1478	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	T	2417	ENSP00000262189:P2417T;ENSP00000347325:P2417T	ENSP00000262189:P2417T	P	-	1	0	MLL3	151508045	0.106000	0.21978	0.035000	0.18076	0.963000	0.63663	0.673000	0.25203	1.294000	0.44707	0.650000	0.86243	CCA	.	.	.	none		0.552	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ZNF572	137209	hgsc.bcm.edu	37	8	125988832	125988832	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr8:125988832C>A	ENST00000319286.5	+	3	476	c.322C>A	c.(322-324)Cac>Aac	p.H108N		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	108					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			AAAACCCAATCACCAGGAATG	0.418										HNSCC(60;0.17)																											p.H108N		Atlas-SNP	.											.	ZNF572	82	.	0			c.C322A						PASS	.						93.0	99.0	97.0					8																	125988832		2203	4300	6503	SO:0001583	missense	137209	exon3			CCCAATCACCAGG	BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.322C>A	chr8.hg19:g.125988832C>A	ENSP00000319305:p.His108Asn	224.0	0.0	.		156.0	44.0	.	NM_152412	A1L4F1|Q8N1Q0	Missense_Mutation	SNP	ENST00000319286.5	hg19	CCDS6354.1	.	.	.	.	.	.	.	.	.	.	C	1.701	-0.501601	0.04261	.	.	ENSG00000180938	ENST00000319286	T	0.07444	3.19	4.56	1.76	0.24704	.	0.869576	0.09725	N	0.763920	T	0.06371	0.0164	N	0.22421	0.69	0.09310	N	1	B	0.16802	0.019	B	0.19391	0.025	T	0.37549	-0.9701	10	0.72032	D	0.01	-0.0456	5.9665	0.19328	0.0:0.6519:0.1632:0.1849	.	108	Q7Z3I7	ZN572_HUMAN	N	108	ENSP00000319305:H108N	ENSP00000319305:H108N	H	+	1	0	ZNF572	126058013	0.054000	0.20591	0.001000	0.08648	0.102000	0.19082	0.699000	0.25586	0.644000	0.30656	0.655000	0.94253	CAC	.	.	.	none		0.418	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1	NM_152412	
RANBP6	26953	hgsc.bcm.edu	37	9	6012658	6012658	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr9:6012658T>G	ENST00000259569.5	-	1	2960	c.2950A>C	c.(2950-2952)Ata>Cta	p.I984L	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	984					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I984L(4)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		ATCTTCCCTATTGCTGAGATA	0.363																																					p.I984L		Atlas-SNP	.											RANBP6,bladder,carcinoma,0,7	RANBP6	127	.	4	Substitution - Missense(4)	lung(2)|endometrium(1)|kidney(1)	c.A2950C						PASS	.						110.0	103.0	106.0					9																	6012658		2203	4300	6503	SO:0001583	missense	26953	exon1			TCCCTATTGCTGA	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2950A>C	chr9.hg19:g.6012658T>G	ENSP00000259569:p.Ile984Leu	106.0	0.0	.		94.0	5.0	.	NM_012416	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	hg19	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	T	10.80	1.451466	0.26074	.	.	ENSG00000137040	ENST00000259569	T	0.08807	3.05	4.79	2.63	0.31362	Armadillo-like helical (1);Armadillo-type fold (1);	0.121890	0.53938	D	0.000050	T	0.03263	0.0095	N	0.11341	0.13	0.36993	D	0.894861	B;B;B	0.17268	0.021;0.012;0.021	B;B;B	0.16722	0.016;0.011;0.016	T	0.36648	-0.9739	10	0.06891	T	0.86	-4.4735	5.2001	0.15258	0.0:0.4849:0.0:0.5151	.	151;572;984	B4E340;B4DTX6;O60518	.;.;RNBP6_HUMAN	L	984	ENSP00000259569:I984L	ENSP00000259569:I984L	I	-	1	0	RANBP6	6002658	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.090000	0.50191	0.682000	0.31407	0.533000	0.62120	ATA	.	.	.	none		0.363	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
RANBP6	26953	hgsc.bcm.edu	37	9	6012698	6012698	+	Silent	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr9:6012698G>T	ENST00000259569.5	-	1	2920	c.2910C>A	c.(2908-2910)acC>acA	p.T970T	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	970					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K971fs*1(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		CATTTTTTTTGGTTTTGGAAT	0.368																																					p.T970T		Atlas-SNP	.											.	RANBP6	127	.	1	Insertion - Frameshift(1)	NS(1)	c.C2910A						PASS	.						108.0	101.0	104.0					9																	6012698		2203	4300	6503	SO:0001819	synonymous_variant	26953	exon1			TTTTTTGGTTTTG	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2910C>A	chr9.hg19:g.6012698G>T		81.0	0.0	.		75.0	5.0	.	NM_012416	Q5T7X4|Q7Z3V2|Q96E78	Silent	SNP	ENST00000259569.5	hg19	CCDS6467.1																																																																																			.	.	.	none		0.368	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
PTPLAD2	401494	hgsc.bcm.edu	37	9	21008120	21008120	+	Silent	SNP	A	A	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr9:21008120A>G	ENST00000495827.2	-	6	561	c.516T>C	c.(514-516)ccT>ccC	p.P172P	PTPLAD2_ENST00000513293.2_Silent_p.P172P	NM_001010915.3	NP_001010915.2	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain containing 2	172					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		ATTCAAAATAAGGCAGCGATT	0.358																																					p.P172P		Atlas-SNP	.											.	PTPLAD2	26	.	0			c.T516C						PASS	.						115.0	110.0	111.0					9																	21008120		1869	4102	5971	SO:0001819	synonymous_variant	401494	exon6			AAAATAAGGCAGC		CCDS43791.1	9p21.3	2008-02-05			ENSG00000188921	ENSG00000188921			20920	protein-coding gene	gene with protein product		615941					Standard	NM_001010915		Approved	Em:AL662879.1, OTTHUMG00000021016	uc010mir.1	Q5VWC8	OTTHUMG00000021016	ENST00000495827.2:c.516T>C	chr9.hg19:g.21008120A>G		178.0	0.0	.		162.0	51.0	.	NM_001010915	Q7Z385	Silent	SNP	ENST00000495827.2	hg19	CCDS43791.1																																																																																			.	.	.	none		0.358	PTPLAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055434.3	NM_001010915	
NOL6	65083	hgsc.bcm.edu	37	9	33467722	33467722	+	Silent	SNP	G	G	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr9:33467722G>A	ENST00000379471.2	-	12	1656	c.1569C>T	c.(1567-1569)aaC>aaT	p.N523N	NOL6_ENST00000455041.2_Silent_p.N471N|NOL6_ENST00000464829.1_Intron			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	523					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		GAGCCAGCAGGTTCAGCCGAG	0.627																																					p.N523N		Atlas-SNP	.											.	NOL6	85	.	0			c.C1569T						PASS	.						27.0	30.0	29.0					9																	33467722		2202	4300	6502	SO:0001819	synonymous_variant	65083	exon12			CAGCAGGTTCAGC	AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.1569C>T	chr9.hg19:g.33467722G>A		56.0	0.0	.		68.0	22.0	.	NM_022917	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Silent	SNP	ENST00000379471.2	hg19																																																																																				.	.	.	none		0.627	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917	
ZBTB5	9925	hgsc.bcm.edu	37	9	37442100	37442100	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr9:37442100C>T	ENST00000307750.4	-	2	637	c.449G>A	c.(448-450)gGa>gAa	p.G150E		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	150					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		GATGCTTAGTCCCAGCTGCTG	0.597																																					p.G150E		Atlas-SNP	.											.	ZBTB5	43	.	0			c.G449A						PASS	.						58.0	59.0	58.0					9																	37442100		2203	4300	6503	SO:0001583	missense	9925	exon2			CTTAGTCCCAGCT	AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.449G>A	chr9.hg19:g.37442100C>T	ENSP00000307604:p.Gly150Glu	68.0	0.0	.		57.0	19.0	.	NM_014872		Missense_Mutation	SNP	ENST00000307750.4	hg19	CCDS6610.1	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857578	0.71834	.	.	ENSG00000168795	ENST00000307750	T	0.09073	3.02	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.17746	0.0426	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.07712	-1.0758	10	0.30854	T	0.27	.	19.6787	0.95950	0.0:1.0:0.0:0.0	.	150	O15062	ZBTB5_HUMAN	E	150	ENSP00000307604:G150E	ENSP00000307604:G150E	G	-	2	0	ZBTB5	37432100	1.000000	0.71417	0.973000	0.42090	0.872000	0.50106	7.226000	0.78060	2.884000	0.98904	0.655000	0.94253	GGA	.	.	.	none		0.597	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052462.1	NM_014872	
GFI1B	8328	hgsc.bcm.edu	37	9	135863782	135863782	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr9:135863782C>T	ENST00000339463.3	+	8	1256	c.437C>T	c.(436-438)aCt>aTt	p.T146I	GFI1B_ENST00000372122.1_Missense_Mutation_p.T146I|GFI1B_ENST00000450530.1_Missense_Mutation_p.T146I|GFI1B_ENST00000534944.1_Missense_Mutation_p.T146I|GFI1B_ENST00000372123.1_Missense_Mutation_p.T146I|GFI1B_ENST00000372124.1_Missense_Mutation_p.T146I			Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription repressor	146	Interaction with ARIH2.				cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K9 methylation (GO:0051574)|regulation of erythrocyte differentiation (GO:0045646)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II transcription factor binding (GO:0001085)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		GTGCCCAGCACTGAGCCCGCC	0.637																																					p.T146I		Atlas-SNP	.											.	GFI1B	37	.	0			c.C437T						PASS	.						70.0	54.0	59.0					9																	135863782		2203	4300	6503	SO:0001583	missense	8328	exon4			CCAGCACTGAGCC	AF081946	CCDS6957.1, CCDS48049.1	9q34.13	2014-09-17	2007-10-04		ENSG00000165702	ENSG00000165702		"""Zinc fingers, C2H2-type"""	4238	protein-coding gene	gene with protein product		604383	"""growth factor independent 1B (potential regulator of CDKN1A, translocated in CML)"""			9878267	Standard	NM_001135031		Approved		uc004ccg.3	Q5VTD9	OTTHUMG00000020848	ENST00000339463.3:c.437C>T	chr9.hg19:g.135863782C>T	ENSP00000344782:p.Thr146Ile	52.0	0.0	.		52.0	18.0	.	NM_001135031	O95270|Q5VTD8|Q6FHZ2|Q6T888	Missense_Mutation	SNP	ENST00000339463.3	hg19	CCDS6957.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669057	0.29604	.	.	ENSG00000165702	ENST00000372124;ENST00000339463;ENST00000450530;ENST00000534944;ENST00000372123;ENST00000372122	T;T;T;T;T;T	0.09538	3.12;2.97;2.97;3.12;3.12;2.97	4.97	4.97	0.65823	.	0.601268	0.17315	N	0.178721	T	0.12817	0.0311	L	0.36672	1.1	0.20638	N	0.999877	B;B	0.25105	0.118;0.01	B;B	0.29942	0.109;0.013	T	0.15492	-1.0435	10	0.41790	T	0.15	-0.9295	17.229	0.86979	0.0:1.0:0.0:0.0	.	146;146	Q5VTD9-2;Q5VTD9	.;GFI1B_HUMAN	I	146	ENSP00000361197:T146I;ENSP00000344782:T146I;ENSP00000409546:T146I;ENSP00000446134:T146I;ENSP00000361196:T146I;ENSP00000361195:T146I	ENSP00000344782:T146I	T	+	2	0	GFI1B	134853603	0.468000	0.25839	0.029000	0.17559	0.159000	0.22180	5.530000	0.67141	2.276000	0.75962	0.563000	0.77884	ACT	.	.	.	none		0.637	GFI1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393840.1	NM_004188	
AGAP11	119385	hgsc.bcm.edu	37	10	88768386	88768386	+	RNA	SNP	G	G	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr10:88768386G>C	ENST00000444431.1	+	0	2986				RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.10_ENST00000451760.1_RNA|RP11-96C23.14_ENST00000444180.3_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										ATTAAACAGGGCATGCTCTTA	0.493																																					p.G126A		Atlas-SNP	.											.	.	.	.	0			c.G377C						PASS	.						174.0	188.0	183.0					10																	88768386		2150	4274	6424			119385	exon12			AACAGGGCATGCT			10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		chr10.hg19:g.88768386G>C		121.0	0.0	.		114.0	42.0	.	NM_133447	B9EIP7|D3DWE4	Missense_Mutation	SNP	ENST00000444431.1	hg19																																																																																				.	.	.	none		0.493	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000049193.1	NM_133447	
CFAP43	80217	hgsc.bcm.edu	37	10	105990410	105990410	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr10:105990410T>C	ENST00000278064.2	-	2	372	c.47A>G	c.(46-48)aAg>aGg	p.K16R	WDR96_ENST00000428666.1_Missense_Mutation_p.K86R|WDR96_ENST00000369719.1_Missense_Mutation_p.K16R|WDR96_ENST00000357060.3_Missense_Mutation_p.K86R|WDR96_ENST00000369720.1_Missense_Mutation_p.K16R																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AGGTTTTAGCTTCCGGTCAGA	0.433																																					p.K86R		Atlas-SNP	.											.	WDR96	183	.	0			c.A257G						PASS	.						119.0	110.0	113.0					10																	105990410		2203	4300	6503	SO:0001583	missense	80217	exon2			TTTAGCTTCCGGT																												ENST00000278064.2:c.47A>G	chr10.hg19:g.105990410T>C	ENSP00000278064:p.Lys16Arg	121.0	0.0	.		98.0	34.0	.	NM_025145		Missense_Mutation	SNP	ENST00000278064.2	hg19		.	.	.	.	.	.	.	.	.	.	T	5.114	0.206598	0.09704	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064;ENST00000369720;ENST00000369719	T;T;T;T;T	0.13778	2.56;2.56;2.56;2.56;2.56	4.94	-5.89	0.02282	WD40/YVTN repeat-like-containing domain (1);	1.068010	0.07464	N	0.901047	T	0.07098	0.0180	N	0.16233	0.39	0.09310	N	1	B;B;B	0.20671	0.002;0.047;0.006	B;B;B	0.18561	0.009;0.022;0.009	T	0.44467	-0.9326	10	0.12766	T	0.61	.	11.2618	0.49087	0.0999:0.5681:0.0:0.332	.	86;86;86	Q8NDM7-5;B4DHB6;Q8NDM7	.;.;WDR96_HUMAN	R	86;86;16;16;16	ENSP00000349568:K86R;ENSP00000400289:K86R;ENSP00000278064:K16R;ENSP00000358734:K16R;ENSP00000358733:K16R	ENSP00000278064:K16R	K	-	2	0	WDR96	105980400	0.000000	0.05858	0.000000	0.03702	0.782000	0.44232	-1.097000	0.03349	-1.561000	0.01684	0.397000	0.26171	AAG	.	.	.	none		0.433	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1		
ATRNL1	26033	hgsc.bcm.edu	37	10	117228744	117228744	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr10:117228744G>T	ENST00000355044.3	+	24	3685	c.3559G>T	c.(3559-3561)Gat>Tat	p.D1187Y	ATRNL1_ENST00000303745.7_Intron|ATRNL1_ENST00000423111.2_Missense_Mutation_p.D238Y	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1187					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GGAATACAGAGATAGTTTTTC	0.284																																					p.D1187Y		Atlas-SNP	.											.	ATRNL1	219	.	0			c.G3559T						PASS	.						35.0	39.0	38.0					10																	117228744		2188	4264	6452	SO:0001583	missense	26033	exon24			TACAGAGATAGTT	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3559G>T	chr10.hg19:g.117228744G>T	ENSP00000347152:p.Asp1187Tyr	234.0	0.0	.		191.0	50.0	.	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	hg19	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.413636	0.62511	.	.	ENSG00000107518	ENST00000355044;ENST00000423111	T;T	0.58652	0.32;0.32	5.73	5.73	0.89815	.	0.092022	0.64402	D	0.000001	T	0.66268	0.2772	L	0.41236	1.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.986;0.997	T	0.56848	-0.7911	10	0.02654	T	1	-28.319	19.9112	0.97025	0.0:0.0:1.0:0.0	.	238;1187	B4DH41;Q5VV63	.;ATRN1_HUMAN	Y	1187;238	ENSP00000347152:D1187Y;ENSP00000409624:D238Y	ENSP00000347152:D1187Y	D	+	1	0	ATRNL1	117218734	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.001000	0.88508	2.718000	0.92993	0.585000	0.79938	GAT	.	.	.	none		0.284	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
QSER1	79832	hgsc.bcm.edu	37	11	32955850	32955850	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr11:32955850A>G	ENST00000399302.2	+	4	2994	c.2659A>G	c.(2659-2661)Aaa>Gaa	p.K887E	QSER1_ENST00000527788.1_Missense_Mutation_p.K648E	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	887										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TGGTGATTCTAAATCTCATTT	0.388																																					p.K887E		Atlas-SNP	.											.	QSER1	153	.	0			c.A2659G						PASS	.						79.0	73.0	75.0					11																	32955850		1879	4115	5994	SO:0001583	missense	79832	exon4			GATTCTAAATCTC	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.2659A>G	chr11.hg19:g.32955850A>G	ENSP00000382241:p.Lys887Glu	123.0	0.0	.		121.0	38.0	.	NM_001076786	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	hg19	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.022835	0.75275	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.25912	2.1;1.77	5.84	5.84	0.93424	.	0.154150	0.44483	D	0.000455	T	0.49626	0.1568	M	0.64997	1.995	0.51233	D	0.99991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.994	T	0.46871	-0.9160	10	0.54805	T	0.06	.	16.2149	0.82206	1.0:0.0:0.0:0.0	.	648;648;887	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	E	887;648;648	ENSP00000382241:K887E;ENSP00000432766:K648E	ENSP00000078652:K648E	K	+	1	0	QSER1	32912426	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.923000	0.92808	2.234000	0.73211	0.459000	0.35465	AAA	.	.	.	none		0.388	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
QSER1	79832	hgsc.bcm.edu	37	11	32955852	32955852	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr11:32955852A>T	ENST00000399302.2	+	4	2996	c.2661A>T	c.(2659-2661)aaA>aaT	p.K887N	QSER1_ENST00000527788.1_Missense_Mutation_p.K648N	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	887										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					GTGATTCTAAATCTCATTTTC	0.393																																					p.K887N		Atlas-SNP	.											.	QSER1	153	.	0			c.A2661T						PASS	.						79.0	74.0	75.0					11																	32955852		1879	4114	5993	SO:0001583	missense	79832	exon4			TTCTAAATCTCAT	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.2661A>T	chr11.hg19:g.32955852A>T	ENSP00000382241:p.Lys887Asn	124.0	0.0	.		119.0	38.0	.	NM_001076786	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	hg19	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	15.87	2.961485	0.53400	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.26660	2.05;1.72	5.84	-0.203	0.13204	.	0.154150	0.44483	D	0.000455	T	0.42539	0.1207	M	0.64997	1.995	0.35835	D	0.825631	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	T	0.48736	-0.9009	10	0.56958	D	0.05	.	10.6404	0.45590	0.5806:0.0:0.4194:0.0	.	648;648;887	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	N	887;648;648	ENSP00000382241:K887N;ENSP00000432766:K648N	ENSP00000078652:K648N	K	+	3	2	QSER1	32912428	0.998000	0.40836	0.991000	0.47740	0.993000	0.82548	1.360000	0.34125	-0.056000	0.13221	0.459000	0.35465	AAA	.	.	.	none		0.393	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
IGHMBP2	3508	hgsc.bcm.edu	37	11	68703885	68703885	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr11:68703885T>G	ENST00000255078.3	+	13	2048	c.1937T>G	c.(1936-1938)aTt>aGt	p.I646S		NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	646	SS DNA-binding. {ECO:0000250}.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTTGACGATATTGTCCCAGAA	0.547																																					p.I646S		Atlas-SNP	.											.	IGHMBP2	83	.	0			c.T1937G						PASS	.						103.0	104.0	104.0					11																	68703885		2200	4294	6494	SO:0001583	missense	3508	exon13			ACGATATTGTCCC	L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.1937T>G	chr11.hg19:g.68703885T>G	ENSP00000255078:p.Ile646Ser	98.0	0.0	.		131.0	43.0	.	NM_002180	A0PJD2|Q00443|Q14177	Missense_Mutation	SNP	ENST00000255078.3	hg19	CCDS8187.1	.	.	.	.	.	.	.	.	.	.	T	12.56	1.973900	0.34848	.	.	ENSG00000132740	ENST00000255078	D	0.90261	-2.64	4.1	4.1	0.47936	.	0.358876	0.27816	N	0.017721	D	0.88089	0.6343	L	0.61218	1.895	0.80722	D	1	B	0.20550	0.046	B	0.15870	0.014	D	0.85819	0.1384	10	0.44086	T	0.13	-22.5874	12.4851	0.55868	0.0:0.0:0.0:1.0	.	646	P38935	SMBP2_HUMAN	S	646	ENSP00000255078:I646S	ENSP00000255078:I646S	I	+	2	0	IGHMBP2	68460461	1.000000	0.71417	0.265000	0.24526	0.788000	0.44548	4.434000	0.59935	1.848000	0.53677	0.459000	0.35465	ATT	.	.	.	none		0.547	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396862.1	NM_002180	
SIDT2	51092	hgsc.bcm.edu	37	11	117064631	117064631	+	Silent	SNP	C	C	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr11:117064631C>T	ENST00000324225.4	+	24	2805	c.2274C>T	c.(2272-2274)gtC>gtT	p.V758V	SIDT2_ENST00000532062.1_Silent_p.V50V|SIDT2_ENST00000431081.2_Silent_p.V755V	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	758					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		CCTCCGTGGTCTGGGGCTTCG	0.617																																					p.V758V		Atlas-SNP	.											.	SIDT2	82	.	0			c.C2274T						PASS	.						100.0	92.0	95.0					11																	117064631		2201	4296	6497	SO:0001819	synonymous_variant	51092	exon24			CGTGGTCTGGGGC	AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.2274C>T	chr11.hg19:g.117064631C>T		41.0	0.0	.		39.0	10.0	.	NM_001040455	Q8NBY7|Q9Y357	Silent	SNP	ENST00000324225.4	hg19	CCDS31682.1																																																																																			.	.	.	none		0.617	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996	
RNF26	79102	hgsc.bcm.edu	37	11	119206568	119206568	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr11:119206568C>A	ENST00000311413.4	+	1	1332	c.736C>A	c.(736-738)Cat>Aat	p.H246N	RP11-334E6.10_ENST00000501918.2_RNA	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	246						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		GACTGTGTTGCATCCGGACTT	0.612																																					p.H246N		Atlas-SNP	.											.	RNF26	23	.	0			c.C736A						PASS	.						105.0	99.0	101.0					11																	119206568		2199	4295	6494	SO:0001583	missense	79102	exon1			GTGTTGCATCCGG	AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.736C>A	chr11.hg19:g.119206568C>A	ENSP00000312439:p.His246Asn	25.0	0.0	.		23.0	4.0	.	NM_032015	Q542Y8	Missense_Mutation	SNP	ENST00000311413.4	hg19	CCDS8419.1	.	.	.	.	.	.	.	.	.	.	C	2.446	-0.327525	0.05314	.	.	ENSG00000173456	ENST00000311413	T	0.25414	1.8	5.21	5.21	0.72293	.	0.069763	0.53938	D	0.000046	T	0.26557	0.0649	N	0.24115	0.695	0.35730	D	0.817828	D	0.53885	0.963	P	0.58873	0.847	T	0.11012	-1.0605	10	0.10636	T	0.68	-14.9067	9.8055	0.40791	0.0:0.9063:0.0:0.0937	.	246	Q9BY78	RNF26_HUMAN	N	246	ENSP00000312439:H246N	ENSP00000312439:H246N	H	+	1	0	RNF26	118711778	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	2.732000	0.47352	2.432000	0.82394	0.561000	0.74099	CAT	.	.	.	none		0.612	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388220.1	NM_032015	
B3GAT1	27087	hgsc.bcm.edu	37	11	134253770	134253770	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr11:134253770G>C	ENST00000524765.1	-	3	4969	c.425C>G	c.(424-426)aCg>aGg	p.T142R	B3GAT1_ENST00000312527.4_Missense_Mutation_p.T142R|B3GAT1_ENST00000392580.1_Missense_Mutation_p.T142R|B3GAT1_ENST00000537389.1_Missense_Mutation_p.T155R|B3GAT1_ENST00000531510.1_5'Flank			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	142					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		GTGCAGGTGCGTGTAGTTGAG	0.726																																					p.T142R		Atlas-SNP	.											.	B3GAT1	49	.	0			c.C425G						PASS	.						30.0	29.0	29.0					11																	134253770		2175	4226	6401	SO:0001583	missense	27087	exon3			AGGTGCGTGTAGT	AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.425C>G	chr11.hg19:g.134253770G>C	ENSP00000433847:p.Thr142Arg	53.0	0.0	.		40.0	5.0	.	NM_054025	Q96FS7	Missense_Mutation	SNP	ENST00000524765.1	hg19	CCDS8500.1	.	.	.	.	.	.	.	.	.	.	G	37	6.104294	0.97286	.	.	ENSG00000109956	ENST00000392580;ENST00000312527;ENST00000524765;ENST00000537389	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.72358	0.3450	L	0.41573	1.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	T	0.66822	-0.5826	10	0.23302	T	0.38	-24.5871	19.1576	0.93517	0.0:0.0:1.0:0.0	.	155;142	F5H0S0;Q9P2W7	.;B3GA1_HUMAN	R	142;142;142;155	ENSP00000376359:T142R;ENSP00000307875:T142R;ENSP00000433847:T142R;ENSP00000445983:T155R	ENSP00000307875:T142R	T	-	2	0	B3GAT1	133758980	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.822000	0.99363	2.541000	0.85698	0.561000	0.74099	ACG	.	.	.	none		0.726	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393639.1	NM_018644	
PTPRB	5787	hgsc.bcm.edu	37	12	70974991	70974991	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr12:70974991T>G	ENST00000261266.5	-	8	1778	c.1749A>C	c.(1747-1749)gaA>gaC	p.E583D	PTPRB_ENST00000550358.1_Missense_Mutation_p.E801D|PTPRB_ENST00000550857.1_Missense_Mutation_p.E493D|PTPRB_ENST00000451516.2_Missense_Mutation_p.E493D|PTPRB_ENST00000551525.1_Missense_Mutation_p.E800D|PTPRB_ENST00000334414.6_Missense_Mutation_p.E801D|PTPRB_ENST00000538708.1_Missense_Mutation_p.E583D	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	583	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTTGGTAAAATTCTACGTCTC	0.458																																					p.E801D		Atlas-SNP	.											.	PTPRB	676	.	0			c.A2403C						PASS	.						137.0	136.0	136.0					12																	70974991		1932	4140	6072	SO:0001583	missense	5787	exon10			GTAAAATTCTACG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.1749A>C	chr12.hg19:g.70974991T>G	ENSP00000261266:p.Glu583Asp	151.0	0.0	.		161.0	76.0	.	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	T	0.968	-0.701100	0.03255	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000544694;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53	5.86	-10.8	0.00216	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.192388	0.53938	N	0.000057	T	0.08537	0.0212	N	0.00608	-1.33	0.20196	N	0.999928	B;B;B;B;B;B;B	0.09022	0.0;0.0;0.0;0.001;0.002;0.0;0.001	B;B;B;B;B;B;B	0.08055	0.002;0.002;0.002;0.002;0.003;0.003;0.003	T	0.46414	-0.9193	10	0.02654	T	1	.	1.1909	0.01864	0.1973:0.1989:0.3143:0.2895	.	493;583;680;800;801;583;801	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;.;PTPRB_HUMAN;.	D	801;493;801;801;583;493;583;800;680	ENSP00000334928:E801D;ENSP00000393028:E493D;ENSP00000448058:E801D;ENSP00000438927:E583D;ENSP00000447302:E493D;ENSP00000261266:E583D;ENSP00000448349:E800D;ENSP00000446982:E680D	ENSP00000261266:E583D	E	-	3	2	PTPRB	69261258	0.000000	0.05858	0.614000	0.29051	0.388000	0.30384	-2.979000	0.00663	-1.448000	0.01941	-0.309000	0.09137	GAA	.	.	.	none		0.458	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
KNTC1	9735	hgsc.bcm.edu	37	12	123034324	123034324	+	Silent	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr12:123034324C>A	ENST00000333479.7	+	13	1176	c.999C>A	c.(997-999)ctC>ctA	p.L333L	KNTC1_ENST00000450485.2_Silent_p.L296L	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	333					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TGAAAAACCTCATGGTTTATT	0.308																																					p.L333L		Atlas-SNP	.											.	KNTC1	182	.	0			c.C999A						PASS	.						44.0	41.0	42.0					12																	123034324		1806	4067	5873	SO:0001819	synonymous_variant	9735	exon13			AAACCTCATGGTT		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.999C>A	chr12.hg19:g.123034324C>A		98.0	0.0	.		122.0	54.0	.	NM_014708	A7E2C4|B3KSG2	Silent	SNP	ENST00000333479.7	hg19	CCDS45002.1																																																																																			.	.	.	none		0.308	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
ZIC5	85416	hgsc.bcm.edu	37	13	100623797	100623798	+	Missense_Mutation	DNP	CC	CC	GT			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr13:100623797_100623798CC>GT	ENST00000267294.4	-	1	365_366	c.132_133GG>AC	c.(130-135)acGGct>acACct	p.A45P		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	45					cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGGACCTGAGCCGTTGCCAAAT	0.658																																					p.A45P|p.T44T		Atlas-SNP	.											.	ZIC5	38	.	0			c.G133C|c.G132A						PASS	.																																			SO:0001583	missense	85416	exon1			CCTGAGCCGTTGC|CTGAGCCGTTGCC	AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.132_133delinsGT	chr13.hg19:g.100623797_100623798delinsGT	ENSP00000267294:p.Ala45Pro	65.0|66.0	0.0	.		69.0	18.0|16.0	.	NM_033132	Q5VYB0	Missense_Mutation|Silent	SNP	ENST00000267294.4	hg19	CCDS9494.2																																																																																			.	.	.	none		0.658	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045623.3	NM_033132	
TPP2	7174	hgsc.bcm.edu	37	13	103289504	103289504	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr13:103289504G>A	ENST00000376065.4	+	14	1787	c.1751G>A	c.(1750-1752)aGc>aAc	p.S584N	TPP2_ENST00000376052.3_Missense_Mutation_p.S584N	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	584					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CAGTGTCCCAGCCATTTGGAA	0.383																																					p.S584N		Atlas-SNP	.											.	TPP2	124	.	0			c.G1751A						PASS	.						116.0	112.0	113.0					13																	103289504		2203	4300	6503	SO:0001583	missense	7174	exon14			GTCCCAGCCATTT	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.1751G>A	chr13.hg19:g.103289504G>A	ENSP00000365233:p.Ser584Asn	59.0	0.0	.		68.0	22.0	.	NM_003291	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	hg19	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587138	0.46110	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.92	5.04	0.67666	.	0.178273	0.64402	D	0.000007	T	0.56891	0.2016	L	0.44542	1.39	0.47949	D	0.999558	B	0.18166	0.026	B	0.18561	0.022	T	0.50939	-0.8768	9	0.33141	T	0.24	.	18.5671	0.91120	0.0:0.1842:0.8158:0.0	.	584	P29144	TPP2_HUMAN	N	584	.	ENSP00000365220:S584N	S	+	2	0	TPP2	102087505	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.411000	0.52672	2.822000	0.97130	0.650000	0.86243	AGC	.	.	.	none		0.383	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
SYNE2	23224	hgsc.bcm.edu	37	14	64494496	64494496	+	Silent	SNP	T	T	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr14:64494496T>C	ENST00000344113.4	+	43	6911	c.6699T>C	c.(6697-6699)ctT>ctC	p.L2233L	SYNE2_ENST00000554584.1_Silent_p.L2233L|SYNE2_ENST00000358025.3_Silent_p.L2233L|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2233					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ACGAAAGTCTTCTTCAACAAC	0.378																																					p.L2233L		Atlas-SNP	.											.	SYNE2	577	.	0			c.T6699C						PASS	.						58.0	53.0	55.0					14																	64494496		1847	4099	5946	SO:0001819	synonymous_variant	23224	exon43			AAGTCTTCTTCAA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6699T>C	chr14.hg19:g.64494496T>C		165.0	0.0	.		156.0	55.0	.	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	hg19	CCDS41963.1																																																																																			.	.	.	none		0.378	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
CPSF2	53981	hgsc.bcm.edu	37	14	92627590	92627590	+	Splice_Site	SNP	A	A	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr14:92627590A>T	ENST00000298875.4	+	15	2541	c.2256A>T	c.(2254-2256)agA>agT	p.R752S		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	752					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		CAGTCCGCAGAGTAAGTGTGT	0.388																																					p.R752S	Ovarian(78;28 1788 18702 44111)	Atlas-SNP	.											.	CPSF2	63	.	0			c.A2256T						PASS	.						152.0	141.0	145.0					14																	92627590		2203	4300	6503	SO:0001630	splice_region_variant	53981	exon15			CCGCAGAGTAAGT	AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.2256+1A>T	chr14.hg19:g.92627590A>T		115.0	0.0	.		102.0	32.0	.	NM_017437	B3KME1|Q6NSJ1|Q9H3W7	Missense_Mutation	SNP	ENST00000298875.4	hg19	CCDS9902.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.759873	0.89932	.	.	ENSG00000165934	ENST00000298875	T	0.53640	0.61	5.78	0.956	0.19608	.	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	M	0.74467	2.265	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.61936	-0.6960	10	0.87932	D	0	.	8.5209	0.33275	0.4617:0.0:0.5383:0.0	.	752	Q9P2I0	CPSF2_HUMAN	S	752	ENSP00000298875:R752S	ENSP00000298875:R752S	R	+	3	2	CPSF2	91697343	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	3.124000	0.50461	0.134000	0.18681	0.533000	0.62120	AGA	.	.	.	none		0.388	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1		Missense_Mutation
TSC2	7249	hgsc.bcm.edu	37	16	2112991	2112991	+	Silent	SNP	C	C	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr16:2112991C>G	ENST00000219476.3	+	14	2010	c.1380C>G	c.(1378-1380)gcC>gcG	p.A460A	TSC2_ENST00000401874.2_Silent_p.A460A|TSC2_ENST00000350773.4_Silent_p.A460A|TSC2_ENST00000568454.1_Silent_p.A471A|TSC2_ENST00000382538.6_Silent_p.A411A|TSC2_ENST00000439673.2_Silent_p.A423A|TSC2_ENST00000353929.4_Silent_p.A460A	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	460					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CCCGAGGCGCCGTGCGCATCA	0.706			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.A460A		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	0			c.C1380G						PASS	.						53.0	42.0	46.0					16																	2112991		1960	3715	5675	SO:0001819	synonymous_variant	7249	exon14	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AGGCGCCGTGCGC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.1380C>G	chr16.hg19:g.2112991C>G		40.0	0.0	.		67.0	14.0	.	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	ENST00000219476.3	hg19	CCDS10458.1																																																																																			.	.	.	none		0.706	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
ZFHX3	463	hgsc.bcm.edu	37	16	72991450	72991450	+	Silent	SNP	G	G	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr16:72991450G>A	ENST00000268489.5	-	2	3267	c.2595C>T	c.(2593-2595)taC>taT	p.Y865Y	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	865					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TCTGGGCCAGGTAGTATTGGT	0.607																																					p.Y865Y		Atlas-SNP	.											.	ZFHX3	404	.	0			c.C2595T						PASS	.						115.0	105.0	108.0					16																	72991450		2198	4300	6498	SO:0001819	synonymous_variant	463	exon2			GGCCAGGTAGTAT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2595C>T	chr16.hg19:g.72991450G>A		77.0	0.0	.		73.0	26.0	.	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	hg19	CCDS10908.1																																																																																			.	.	.	none		0.607	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
CTC1	80169	hgsc.bcm.edu	37	17	8137889	8137889	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr17:8137889C>T	ENST00000315684.8	-	10	1709	c.1702G>A	c.(1702-1704)Gac>Aac	p.D568N	CTC1_ENST00000581671.1_5'Flank	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	568					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						GCCTTAGGGTCAAAGGAGGCC	0.632																																					p.D568N		Atlas-SNP	.											.	CTC1	75	.	0			c.G1702A						PASS	.						45.0	53.0	50.0					17																	8137889		2051	4182	6233	SO:0001583	missense	80169	exon10			TAGGGTCAAAGGA	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.1702G>A	chr17.hg19:g.8137889C>T	ENSP00000313759:p.Asp568Asn	173.0	0.0	.		188.0	53.0	.	NM_025099	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	ENST00000315684.8	hg19	CCDS42259.1	.	.	.	.	.	.	.	.	.	.	c	11.75	1.732111	0.30684	.	.	ENSG00000178971	ENST00000315684;ENST00000449476	D;D	0.84589	-1.87;-1.87	5.44	4.47	0.54385	.	0.422251	0.23775	N	0.044690	T	0.81550	0.4846	M	0.65975	2.015	0.32033	N	0.599281	B	0.23540	0.087	B	0.25759	0.063	T	0.76926	-0.2778	10	0.16896	T	0.51	-7.7145	10.2272	0.43233	0.0:0.9083:0.0:0.0917	.	568	Q2NKJ3	CTC1_HUMAN	N	568;533	ENSP00000313759:D568N;ENSP00000396018:D533N	ENSP00000313759:D568N	D	-	1	0	CTC1	8078614	0.998000	0.40836	1.000000	0.80357	0.708000	0.40852	0.458000	0.21892	1.328000	0.45358	-0.371000	0.07208	GAC	.	.	.	none		0.632	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
MYH8	4626	hgsc.bcm.edu	37	17	10299694	10299694	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr17:10299694C>A	ENST00000403437.2	-	33	4700	c.4606G>T	c.(4606-4608)Gta>Tta	p.V1536L	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1536					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCTTGTTCTACTTGCTTCTTT	0.383									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.V1536L		Atlas-SNP	.											.	MYH8	346	.	0			c.G4606T						PASS	.						169.0	149.0	156.0					17																	10299694		2203	4300	6503	SO:0001583	missense	4626	exon33	Familial Cancer Database	Carney Complex Variant	GTTCTACTTGCTT		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4606G>T	chr17.hg19:g.10299694C>A	ENSP00000384330:p.Val1536Leu	80.0	0.0	.		68.0	19.0	.	NM_002472	Q14910	Missense_Mutation	SNP	ENST00000403437.2	hg19	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	1.961	-0.438953	0.04636	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.55588	0.51	5.26	4.3	0.51218	Myosin tail (1);	0.267575	0.20576	U	0.089628	T	0.14700	0.0355	N	0.00507	-1.42	0.29779	N	0.834145	B	0.02656	0.0	B	0.06405	0.002	T	0.29701	-1.0003	10	0.02654	T	1	.	5.6007	0.17351	0.0:0.6792:0.0:0.3208	.	1536	P13535	MYH8_HUMAN	L	1536	ENSP00000384330:V1536L	ENSP00000252173:V1536L	V	-	1	0	MYH8	10240419	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-1.501000	0.02281	1.458000	0.47871	0.650000	0.86243	GTA	.	.	.	none		0.383	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
SPAG5	10615	hgsc.bcm.edu	37	17	26906847	26906847	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr17:26906847A>C	ENST00000321765.5	-	17	3138	c.2806T>G	c.(2806-2808)Tca>Gca	p.S936A	ALDOC_ENST00000395321.2_5'Flank|ALDOC_ENST00000226253.4_5'Flank|ALDOC_ENST00000395319.3_5'Flank	NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	936					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					ACAGGAGTTGATTCTGGCTCT	0.532																																					p.S936A		Atlas-SNP	.											.	SPAG5	92	.	0			c.T2806G						PASS	.						107.0	111.0	110.0					17																	26906847		2203	4300	6503	SO:0001583	missense	10615	exon17			GAGTTGATTCTGG	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.2806T>G	chr17.hg19:g.26906847A>C	ENSP00000323300:p.Ser936Ala	132.0	0.0	.		111.0	29.0	.	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	hg19	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	a	1.508	-0.550368	0.03996	.	.	ENSG00000076382	ENST00000321765	T	0.29142	1.58	5.51	-2.49	0.06403	.	0.926052	0.09003	N	0.862743	T	0.11580	0.0282	N	0.08118	0	0.09310	N	0.999998	B	0.06786	0.001	B	0.06405	0.002	T	0.36625	-0.9740	10	0.07813	T	0.8	0.0217	6.531	0.22326	0.2456:0.4877:0.2668:0.0	.	936	Q96R06	SPAG5_HUMAN	A	936	ENSP00000323300:S936A	ENSP00000323300:S936A	S	-	1	0	SPAG5	23930974	0.320000	0.24616	0.867000	0.34043	0.630000	0.37929	-0.063000	0.11655	-0.336000	0.08438	0.524000	0.50904	TCA	.	.	.	none		0.532	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
LAMA3	3909	hgsc.bcm.edu	37	18	21343469	21343469	+	Silent	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr18:21343469G>T	ENST00000313654.9	+	8	1405	c.1164G>T	c.(1162-1164)ggG>ggT	p.G388G	LAMA3_ENST00000399516.3_Silent_p.G388G	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	388	Domain V.|Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CTGGTGGAGGGGTCTGCATTA	0.488																																					p.G388G		Atlas-SNP	.											.	LAMA3	397	.	0			c.G1164T						PASS	.						126.0	129.0	128.0					18																	21343469		2023	4178	6201	SO:0001819	synonymous_variant	3909	exon8			TGGAGGGGTCTGC	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.1164G>T	chr18.hg19:g.21343469G>T		96.0	0.0	.		84.0	23.0	.	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	hg19	CCDS42419.1																																																																																			.	.	.	none		0.488	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
C18orf25	147339	hgsc.bcm.edu	37	18	43796193	43796193	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr18:43796193A>T	ENST00000282059.6	+	2	721	c.347A>T	c.(346-348)gAa>gTa	p.E116V	C18orf25_ENST00000321319.6_Missense_Mutation_p.E116V	NM_145055.3	NP_659492	Q96B23	CR025_HUMAN	chromosome 18 open reading frame 25	116										central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	11						GAAGAGAATGAACCCTCTCAG	0.522																																					p.E116V		Atlas-SNP	.											.	C18orf25	27	.	0			c.A347T						PASS	.						102.0	102.0	102.0					18																	43796193		1920	4136	6056	SO:0001583	missense	147339	exon2			AGAATGAACCCTC	AL713661	CCDS42430.1, CCDS42431.1	18q21.1	2014-01-03			ENSG00000152242	ENSG00000152242			28172	protein-coding gene	gene with protein product	"""ARKadia-like 1"""					15722956	Standard	NM_001008239		Approved	MGC12909, ARKL1, RNF111L1	uc002lbw.3	Q96B23		ENST00000282059.6:c.347A>T	chr18.hg19:g.43796193A>T	ENSP00000282059:p.Glu116Val	146.0	0.0	.		144.0	42.0	.	NM_145055	A8K123|A8KAB6|Q5XG78|Q6N058|Q86TB5|Q8TCQ5	Missense_Mutation	SNP	ENST00000282059.6	hg19	CCDS42430.1	.	.	.	.	.	.	.	.	.	.	A	17.05	3.291056	0.59976	.	.	ENSG00000152242	ENST00000282059;ENST00000321319	.	.	.	5.95	5.95	0.96441	.	0.108809	0.64402	D	0.000013	T	0.50514	0.1620	L	0.38175	1.15	0.47737	D	0.9995	B;P	0.45531	0.007;0.86	B;P	0.47075	0.013;0.536	T	0.54556	-0.8276	9	0.72032	D	0.01	-14.0694	12.2973	0.54854	0.8589:0.1411:0.0:0.0	.	116;116	Q96B23-2;Q96B23	.;CR025_HUMAN	V	116	.	ENSP00000282059:E116V	E	+	2	0	C18orf25	42050191	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.954000	0.56708	2.282000	0.76494	0.533000	0.62120	GAA	.	.	.	none		0.522	C18orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445242.1	NM_145055	
PHLPP1	23239	hgsc.bcm.edu	37	18	60646284	60646284	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr18:60646284G>T	ENST00000262719.5	+	17	5008	c.4774G>T	c.(4774-4776)Gat>Tat	p.D1592Y	PHLPP1_ENST00000400316.4_Missense_Mutation_p.D1080Y			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1592					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						AGAGGCCAGTGATGAGGGCAT	0.632																																					p.D1592Y		Atlas-SNP	.											.	PHLPP1	164	.	0			c.G4774T						PASS	.						34.0	39.0	38.0					18																	60646284		2098	4215	6313	SO:0001583	missense	23239	exon17			GCCAGTGATGAGG	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.4774G>T	chr18.hg19:g.60646284G>T	ENSP00000262719:p.Asp1592Tyr	110.0	0.0	.		103.0	27.0	.	NM_194449	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	hg19	CCDS45881.2	.	.	.	.	.	.	.	.	.	.	G	18.89	3.720529	0.68959	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.27890	1.78;1.64	4.18	4.18	0.49190	.	.	.	.	.	T	0.38241	0.1033	N	0.22421	0.69	0.54753	D	0.999982	D	0.67145	0.996	P	0.59703	0.862	T	0.40813	-0.9543	9	0.72032	D	0.01	-19.3796	16.6946	0.85332	0.0:0.0:1.0:0.0	.	1592	O60346	PHLP1_HUMAN	Y	1080;1592	ENSP00000383170:D1080Y;ENSP00000262719:D1592Y	ENSP00000262719:D1592Y	D	+	1	0	PHLPP1	58797264	1.000000	0.71417	0.948000	0.38648	0.894000	0.52154	5.705000	0.68355	2.173000	0.68751	0.561000	0.74099	GAT	.	.	.	none		0.632	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
VAV1	7409	hgsc.bcm.edu	37	19	6854009	6854009	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:6854009C>T	ENST00000602142.1	+	26	2466	c.2384C>T	c.(2383-2385)gCc>gTc	p.A795V	VAV1_ENST00000599806.1_Missense_Mutation_p.A740V|VAV1_ENST00000596764.1_Missense_Mutation_p.A763V|VAV1_ENST00000539284.1_Missense_Mutation_p.A698V|VAV1_ENST00000304076.2_Missense_Mutation_p.A773V	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	795	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						GACTTCTGCGCCCGAGACCGA	0.547																																					p.A795V		Atlas-SNP	.											.	VAV1	140	.	0			c.C2384T						PASS	.						110.0	99.0	103.0					19																	6854009		2203	4300	6503	SO:0001583	missense	7409	exon26			TCTGCGCCCGAGA		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.2384C>T	chr19.hg19:g.6854009C>T	ENSP00000472929:p.Ala795Val	48.0	0.0	.		38.0	14.0	.	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	hg19	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720792	0.89205	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T	0.59083	0.29	4.35	4.35	0.52113	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	T	0.80105	0.4562	M	0.90977	3.165	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.91635	0.998;0.999;0.988;0.981	D	0.84741	0.0751	10	0.66056	D	0.02	.	14.4087	0.67101	0.0:1.0:0.0:0.0	.	698;795;740;795	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	V	795;698	ENSP00000443242:A698V	ENSP00000302269:A795V	A	+	2	0	VAV1	6805009	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.530000	0.73816	2.278000	0.76064	0.561000	0.74099	GCC	.	.	.	none		0.547	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
C19orf57	79173	hgsc.bcm.edu	37	19	14004035	14004035	+	Splice_Site	SNP	A	A	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:14004035A>G	ENST00000586783.1	-	3	207	c.208T>C	c.(208-210)Tcc>Ccc	p.S70P	C19orf57_ENST00000454313.1_Splice_Site_p.S70P|C19orf57_ENST00000346736.2_Splice_Site_p.S70P|C19orf57_ENST00000591586.1_Splice_Site_p.S70P			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	70					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			TCATCAGGGGAGCTATGTAGG	0.587																																					p.S70P		Atlas-SNP	.											.	C19orf57	34	.	0			c.T208C						PASS	.						37.0	37.0	37.0					19																	14004035		2201	4296	6497	SO:0001630	splice_region_variant	79173	exon4			CAGGGGAGCTATG	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.207-1T>C	chr19.hg19:g.14004035A>G		92.0	0.0	.		94.0	32.0	.	NM_024323	Q13411|Q8N825|Q96D63|Q9BU49	Missense_Mutation	SNP	ENST00000586783.1	hg19		.	.	.	.	.	.	.	.	.	.	A	13.17	2.155863	0.38021	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	T;T	0.36878	1.23;1.23	3.65	2.63	0.31362	.	1.390520	0.05098	N	0.486553	T	0.46678	0.1405	L	0.32530	0.975	0.09310	N	1	D	0.76494	0.999	D	0.69479	0.964	T	0.24368	-1.0162	10	0.52906	T	0.07	-2.3155	5.53	0.16978	0.87:0.0:0.13:0.0	.	70	Q0VDD7-2	.	P	70	ENSP00000404382:S70P;ENSP00000254336:S70P	ENSP00000254336:S70P	S	-	1	0	C19orf57	13865035	0.805000	0.28982	0.068000	0.19968	0.011000	0.07611	1.213000	0.32407	0.587000	0.29643	0.459000	0.35465	TCC	.	.	.	none		0.587	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323	Missense_Mutation
C19orf57	79173	hgsc.bcm.edu	37	19	14004037	14004037	+	Splice_Site	SNP	C	C	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:14004037C>T	ENST00000586783.1	-	3	206		c.e3-1		C19orf57_ENST00000454313.1_Splice_Site|C19orf57_ENST00000346736.2_Splice_Site|C19orf57_ENST00000591586.1_Splice_Site			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57						multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			ATCAGGGGAGCTATGTAGGAA	0.587																																					.		Atlas-SNP	.											.	C19orf57	34	.	0			c.207-1G>A						PASS	.						37.0	37.0	37.0					19																	14004037		2201	4296	6497	SO:0001630	splice_region_variant	79173	exon5			GGGGAGCTATGTA	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.207-1G>A	chr19.hg19:g.14004037C>T		88.0	0.0	.		93.0	32.0	.	NM_024323	Q13411|Q8N825|Q96D63|Q9BU49	Splice_Site	SNP	ENST00000586783.1	hg19		.	.	.	.	.	.	.	.	.	.	C	9.753	1.167971	0.21621	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	.	.	.	3.41	3.41	0.39046	.	.	.	.	.	.	.	.	.	.	.	0.53005	D	0.999969	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5024	0.44813	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C19orf57	13865037	1.000000	0.71417	0.114000	0.21550	0.016000	0.09150	2.959000	0.49153	1.917000	0.55516	0.561000	0.74099	.	.	.	.	none		0.587	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323	Intron
ISYNA1	51477	hgsc.bcm.edu	37	19	18545729	18545729	+	Silent	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:18545729G>T	ENST00000338128.8	-	11	1888	c.1671C>A	c.(1669-1671)acC>acA	p.T557T	ISYNA1_ENST00000578963.1_Silent_p.T429T|ISYNA1_ENST00000545187.1_Silent_p.T407T|ISYNA1_ENST00000457269.4_Silent_p.T503T|ISYNA1_ENST00000317018.6_Silent_p.T355T	NM_001170938.1|NM_016368.4	NP_001164409.1|NP_057452.1	Q9NPH2	INO1_HUMAN	inositol-3-phosphate synthase 1	557					inositol biosynthetic process (GO:0006021)|inositol phosphate metabolic process (GO:0043647)|phospholipid biosynthetic process (GO:0008654)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-3-phosphate synthase activity (GO:0004512)			breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	12						GGCCTCAGGTGGTGGGCATTG	0.617																																					p.T557T		Atlas-SNP	.											.	ISYNA1	31	.	0			c.C1671A						PASS	.						47.0	53.0	51.0					19																	18545729		2203	4300	6503	SO:0001819	synonymous_variant	51477	exon11			TCAGGTGGTGGGC		CCDS12379.1, CCDS54234.1, CCDS62603.1	19p13.11	2014-09-04			ENSG00000105655	ENSG00000105655	5.5.1.4		29821	protein-coding gene	gene with protein product	"""myo-inositol 1-phosphate synthase"""	611670				15024000, 12941308	Standard	NM_016368		Approved	Ino1, INOS, IPS	uc002njd.2	Q9NPH2	OTTHUMG00000179027	ENST00000338128.8:c.1671C>A	chr19.hg19:g.18545729G>T		69.0	0.0	.		85.0	29.0	.	NM_016368	B3KRT1|G5E9U0|Q6NXT5|Q7Z525|Q9BT65|Q9H2Y2|Q9NSU0|Q9NVW7	Silent	SNP	ENST00000338128.8	hg19	CCDS12379.1																																																																																			.	.	.	none		0.617	ISYNA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444469.2	NM_016368	
ZNF536	9745	hgsc.bcm.edu	37	19	30935607	30935607	+	Silent	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:30935607C>A	ENST00000355537.3	+	2	1285	c.1138C>A	c.(1138-1140)Cgg>Agg	p.R380R		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	380					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GATCTGCGGCCGGCGCTTCAA	0.597																																					p.R380R		Atlas-SNP	.											.	ZNF536	424	.	0			c.C1138A						PASS	.						66.0	71.0	70.0					19																	30935607		2203	4300	6503	SO:0001819	synonymous_variant	9745	exon2			TGCGGCCGGCGCT		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1138C>A	chr19.hg19:g.30935607C>A		68.0	0.0	.		82.0	25.0	.	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	hg19	CCDS32984.1																																																																																			.	.	.	none		0.597	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ECH1	1891	hgsc.bcm.edu	37	19	39321795	39321795	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:39321795T>G	ENST00000221418.4	-	3	504	c.272A>C	c.(271-273)gAg>gCg	p.E91A	ECH1_ENST00000597805.1_5'UTR|AC104534.3_ENST00000594769.1_Missense_Mutation_p.S261R	NM_001398.2	NP_001389.2	Q13011	ECH1_HUMAN	enoyl CoA hydratase 1, peroxisomal	91					fatty acid beta-oxidation (GO:0006635)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	isomerase activity (GO:0016853)|receptor binding (GO:0005102)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	6	all_cancers(60;9.36e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GTTGAAGCACTCTACCATCTC	0.522																																					p.E91A		Atlas-SNP	.											.	ECH1	14	.	0			c.A272C						PASS	.						131.0	117.0	122.0					19																	39321795		2203	4300	6503	SO:0001583	missense	1891	exon3			AAGCACTCTACCA	U16660	CCDS33014.1	19q13.1	2010-04-30	2010-04-30			ENSG00000104823			3149	protein-coding gene	gene with protein product		600696	"""enoyl Coenzyme A hydratase 1, peroxisomal"""			7558027	Standard	XM_005258610		Approved	HPXEL		Q13011		ENST00000221418.4:c.272A>C	chr19.hg19:g.39321795T>G	ENSP00000221418:p.Glu91Ala	94.0	0.0	.		76.0	28.0	.	NM_001398	A8K745|Q8WVX0|Q96EZ9	Missense_Mutation	SNP	ENST00000221418.4	hg19	CCDS33014.1	.	.	.	.	.	.	.	.	.	.	T	16.65	3.180975	0.57800	.	.	ENSG00000104823	ENST00000221418	T	0.70045	-0.45	5.73	4.71	0.59529	Crotonase, core (1);	0.403282	0.26631	N	0.023320	T	0.65933	0.2739	N	0.20610	0.595	0.54753	D	0.999986	D;P	0.64830	0.994;0.586	D;P	0.65573	0.936;0.477	T	0.63616	-0.6597	10	0.34782	T	0.22	.	9.8374	0.40977	0.1601:0.0:0.0:0.8399	.	91;91	B4DVS4;Q13011	.;ECH1_HUMAN	A	91	ENSP00000221418:E91A	ENSP00000221418:E91A	E	-	2	0	ECH1	44013635	0.977000	0.34250	0.983000	0.44433	0.956000	0.61745	1.856000	0.39389	0.983000	0.38602	0.533000	0.62120	GAG	.	.	.	none		0.522	ECH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462650.1		
MAP3K10	4294	hgsc.bcm.edu	37	19	40721175	40721175	+	Silent	SNP	G	G	C			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:40721175G>C	ENST00000253055.3	+	10	3129	c.2841G>C	c.(2839-2841)ctG>ctC	p.L947L		NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	947					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CAGTGCCCCTGTGCGGGGCCC	0.701																																					p.L947L		Atlas-SNP	.											.	MAP3K10	70	.	0			c.G2841C						PASS	.						7.0	5.0	6.0					19																	40721175		2053	4054	6107	SO:0001819	synonymous_variant	4294	exon10			GCCCCTGTGCGGG	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.2841G>C	chr19.hg19:g.40721175G>C		115.0	0.0	.		122.0	40.0	.	NM_002446	Q12761|Q14871	Silent	SNP	ENST00000253055.3	hg19	CCDS12549.1																																																																																			.	.	.	none		0.701	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446	
CEACAM5	1048	hgsc.bcm.edu	37	19	42219064	42219064	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:42219064T>A	ENST00000221992.6	+	3	713	c.599T>A	c.(598-600)cTc>cAc	p.L200H	CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000405816.1_Missense_Mutation_p.L200H|CEACAM5_ENST00000398599.4_Missense_Mutation_p.L200H	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	200	Ig-like 2.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		AACAGGACCCTCACTCTATTC	0.517																																					p.L200H		Atlas-SNP	.											.	CEACAM5	84	.	0			c.T599A						PASS	.						184.0	167.0	173.0					19																	42219064		2203	4300	6503	SO:0001583	missense	1048	exon3			GGACCCTCACTCT	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.599T>A	chr19.hg19:g.42219064T>A	ENSP00000221992:p.Leu200His	144.0	0.0	.		138.0	34.0	.	NM_004363	H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	hg19	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	-	7.761	0.705442	0.15172	.	.	ENSG00000105388	ENST00000221992;ENST00000405816	T;T	0.09630	2.96;2.96	2.94	2.94	0.34122	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.44307	0.1287	H	0.97635	4.045	0.24084	N	0.995938	D;B;D	0.89917	1.0;0.277;1.0	D;P;D	0.97110	1.0;0.619;1.0	T	0.37478	-0.9704	9	0.87932	D	0	.	7.7048	0.28644	0.0:0.0:0.0:1.0	.	200;200;200	Q8N4D0;P06731;Q53G30	.;CEAM5_HUMAN;.	H	200	ENSP00000221992:L200H;ENSP00000385072:L200H	ENSP00000221992:L200H	L	+	2	0	CEACAM5	46910904	1.000000	0.71417	0.973000	0.42090	0.044000	0.14063	3.332000	0.52083	1.133000	0.42147	0.164000	0.16699	CTC	.	.	.	none		0.517	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363	
SYMPK	8189	hgsc.bcm.edu	37	19	46324744	46324744	+	Splice_Site	SNP	C	C	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:46324744C>T	ENST00000245934.7	-	22	3036		c.e22-1		SYMPK_ENST00000598155.1_Splice_Site	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin						cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TTTCCCTCACCTGCAGCAGGC	0.557																																					.		Atlas-SNP	.											SYMPK,NS,carcinoma,0,1	SYMPK	104	.	0			c.2792-1G>A						PASS	.						105.0	83.0	90.0					19																	46324744		2203	4300	6503	SO:0001630	splice_region_variant	8189	exon23			CCTCACCTGCAGC	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.2792-1G>A	chr19.hg19:g.46324744C>T		49.0	0.0	.		40.0	14.0	.	NM_004819	O00521|O00689|O00733|Q59GT5|Q8N2U5	Splice_Site	SNP	ENST00000245934.7	hg19	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	C	14.50	2.553529	0.45487	.	.	ENSG00000125755	ENST00000245934	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2551	0.66045	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYMPK	51016584	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	6.903000	0.75703	2.228000	0.72767	0.555000	0.69702	.	.	.	.	none		0.557	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	Intron
PPP5C	5536	hgsc.bcm.edu	37	19	46888119	46888119	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:46888119T>A	ENST00000012443.4	+	7	960	c.857T>A	c.(856-858)cTt>cAt	p.L286H	PPP5C_ENST00000391919.1_Missense_Mutation_p.L158H|AC007193.9_ENST00000599645.1_RNA	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	286	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		ATCCTCACCCTTTTCGGCTTC	0.527																																					p.L286H		Atlas-SNP	.											PPP5C,bladder,carcinoma,0,1	PPP5C	44	.	0			c.T857A						PASS	.						130.0	108.0	116.0					19																	46888119		2203	4300	6503	SO:0001583	missense	5536	exon7			TCACCCTTTTCGG		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.857T>A	chr19.hg19:g.46888119T>A	ENSP00000012443:p.Leu286His	56.0	0.0	.		67.0	14.0	.	NM_006247	Q16722|Q53XV2	Missense_Mutation	SNP	ENST00000012443.4	hg19	CCDS12684.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.336873	0.81801	.	.	ENSG00000011485	ENST00000012443;ENST00000451918;ENST00000391919	T;T	0.14144	2.53;2.53	4.59	4.59	0.56863	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.144822	0.46758	D	0.000266	T	0.59197	0.2176	H	0.99937	4.99	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.996;0.999	T	0.77413	-0.2597	10	0.87932	D	0	-8.0808	11.9499	0.52948	0.0:0.0:0.0:1.0	.	144;286;286	B7Z1I1;B2R6R6;P53041	.;.;PPP5_HUMAN	H	286;273;158	ENSP00000012443:L286H;ENSP00000375786:L158H	ENSP00000012443:L286H	L	+	2	0	PPP5C	51579959	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.482000	0.81143	1.706000	0.51276	0.402000	0.26972	CTT	.	.	.	none		0.527	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
PPP2R1A	5518	hgsc.bcm.edu	37	19	52719042	52719042	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:52719042C>T	ENST00000322088.6	+	7	876	c.818C>T	c.(817-819)gCa>gTa	p.A273V	PPP2R1A_ENST00000462990.1_Missense_Mutation_p.A94V|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.A218V	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	273	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CTCCAGAAAGCAGTGGGGCCT	0.577			Mis		clear cell ovarian carcinoma																																p.A273V		Atlas-SNP	.		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	PPP2R1A	187	.	0			c.C818T						PASS	.						60.0	59.0	60.0					19																	52719042		2203	4300	6503	SO:0001583	missense	5518	exon7			AGAAAGCAGTGGG		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.818C>T	chr19.hg19:g.52719042C>T	ENSP00000324804:p.Ala273Val	73.0	0.0	.		77.0	27.0	.	NM_014225	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	hg19	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.975313	0.74360	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.04234	3.67;3.67	4.67	4.67	0.58626	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000006	T	0.07818	0.0196	M	0.71581	2.175	0.80722	D	1	P;B;B	0.40144	0.704;0.012;0.012	B;B;B	0.33196	0.159;0.007;0.007	T	0.10753	-1.0616	10	0.49607	T	0.09	-6.7782	15.501	0.75698	0.0:1.0:0.0:0.0	.	218;273;273	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	V	263;193;273;218	ENSP00000324804:A273V;ENSP00000415067:A218V	ENSP00000324804:A273V	A	+	2	0	PPP2R1A	57410854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.796000	0.75145	2.595000	0.87683	0.655000	0.94253	GCA	.	.	.	none		0.577	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
SSC5D	284297	hgsc.bcm.edu	37	19	56028874	56028874	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:56028874T>A	ENST00000389623.6	+	14	3254	c.3231T>A	c.(3229-3231)agT>agA	p.S1077R		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1077	Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CTGACTCCAGTGTGGTTCCCG	0.637																																					p.S1077R		Atlas-SNP	.											.	SSC5D	65	.	0			c.T3231A						PASS	.						57.0	52.0	54.0					19																	56028874		692	1591	2283	SO:0001583	missense	284297	exon14			CTCCAGTGTGGTT		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3231T>A	chr19.hg19:g.56028874T>A	ENSP00000374274:p.Ser1077Arg	95.0	0.0	.		101.0	33.0	.	NM_001144950	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	hg19	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	-	14.11	2.438994	0.43326	.	.	ENSG00000179954	ENST00000389623	T	0.01397	4.94	3.35	-3.18	0.05186	.	903.953000	0.00166	N	0.000002	T	0.01765	0.0056	L	0.44542	1.39	0.09310	N	1	B	0.27594	0.182	B	0.24006	0.05	T	0.46048	-0.9219	10	0.72032	D	0.01	.	4.6051	0.12372	0.0:0.4894:0.2028:0.3078	.	1077	A1L4H1	SRCRL_HUMAN	R	1077	ENSP00000374274:S1077R	ENSP00000374274:S1077R	S	+	3	2	SSC5D	60720686	0.000000	0.05858	0.000000	0.03702	0.317000	0.28152	-0.214000	0.09292	-0.484000	0.06763	0.235000	0.17854	AGT	.	.	.	none		0.637	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
SDCBP2	27111	hgsc.bcm.edu	37	20	1293357	1293357	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr20:1293357C>A	ENST00000360779.3	-	6	607	c.434G>T	c.(433-435)gGg>gTg	p.G145V	SDCBP2_ENST00000339987.3_Missense_Mutation_p.G145V|SDCBP2_ENST00000467129.1_5'Flank|SDCBP2_ENST00000381812.1_Missense_Mutation_p.G145V|SDCBP2_ENST00000381808.3_Missense_Mutation_p.G60V	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	145	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						AAAGCGCAGCCCCACAAGGGA	0.637																																					p.G145V		Atlas-SNP	.											.	SDCBP2	78	.	0			c.G434T						PASS	.						55.0	52.0	53.0					20																	1293357		2203	4300	6503	SO:0001583	missense	27111	exon6			CGCAGCCCCACAA	AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.434G>T	chr20.hg19:g.1293357C>A	ENSP00000354013:p.Gly145Val	43.0	0.0	.		49.0	19.0	.	NM_080489	O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	ENST00000360779.3	hg19	CCDS42848.1	.	.	.	.	.	.	.	.	.	.	c	14.90	2.672885	0.47781	.	.	ENSG00000125775	ENST00000381812;ENST00000381808;ENST00000360779;ENST00000339987	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	4.51	3.56	0.40772	PDZ/DHR/GLGF (4);	0.126644	0.53938	D	0.000055	D	0.93631	0.7966	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.95321	0.8420	10	0.87932	D	0	-8.1802	13.8898	0.63731	0.1538:0.8462:0.0:0.0	.	145	Q9H190	SDCB2_HUMAN	V	145;60;145;145	ENSP00000371233:G145V;ENSP00000371229:G60V;ENSP00000354013:G145V;ENSP00000342935:G145V	ENSP00000342935:G145V	G	-	2	0	SDCBP2	1241357	1.000000	0.71417	0.988000	0.46212	0.165000	0.22458	7.545000	0.82128	1.212000	0.43366	-0.314000	0.08810	GGG	.	.	.	none		0.637	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077513.2	NM_080489	
EMILIN3	90187	hgsc.bcm.edu	37	20	39990966	39990966	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr20:39990966G>T	ENST00000332312.3	-	4	1435	c.1243C>A	c.(1243-1245)Ccg>Acg	p.P415T		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	415						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				TCCCCGGCCGGGGCACCGGGG	0.652																																					p.P415T		Atlas-SNP	.											.	EMILIN3	63	.	0			c.C1243A						PASS	.						42.0	48.0	46.0					20																	39990966		2203	4300	6503	SO:0001583	missense	90187	exon4			CGGCCGGGGCACC	AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.1243C>A	chr20.hg19:g.39990966G>T	ENSP00000332806:p.Pro415Thr	49.0	0.0	.		51.0	18.0	.	NM_052846	Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	ENST00000332312.3	hg19	CCDS13316.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.832401	0.00579	.	.	ENSG00000183798	ENST00000332312	T	0.13089	2.62	5.14	0.703	0.18116	.	1.249350	0.05414	N	0.543007	T	0.12008	0.0292	L	0.44542	1.39	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.36890	-0.9729	9	.	.	.	-1.804	4.9083	0.13809	0.0688:0.1239:0.4241:0.3832	.	415	Q9NT22	EMIL3_HUMAN	T	415	ENSP00000332806:P415T	.	P	-	1	0	EMILIN3	39424380	0.293000	0.24371	0.000000	0.03702	0.005000	0.04900	2.297000	0.43593	0.181000	0.19994	-0.264000	0.10439	CCG	.	.	.	none		0.652	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106876.2	XM_029741	
SIK1	150094	hgsc.bcm.edu	37	21	44838412	44838412	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr21:44838412A>T	ENST00000270162.6	-	12	1604	c.1472T>A	c.(1471-1473)gTc>gAc	p.V491D		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	491					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	GGAGGGGGAGACGACTATACC	0.637																																					p.V491D		Atlas-SNP	.											.	SIK1	65	.	0			c.T1472A						PASS	.						27.0	30.0	29.0					21																	44838412		2202	4300	6502	SO:0001583	missense	150094	exon12			GGGGAGACGACTA	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1472T>A	chr21.hg19:g.44838412A>T	ENSP00000270162:p.Val491Asp	92.0	0.0	.		90.0	23.0	.	NM_173354	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Missense_Mutation	SNP	ENST00000270162.6	hg19	CCDS33575.1	.	.	.	.	.	.	.	.	.	.	A	13.46	2.245017	0.39697	.	.	ENSG00000142178	ENST00000270162	T	0.73575	-0.76	4.79	4.79	0.61399	.	0.429630	0.24920	N	0.034556	T	0.67998	0.2953	L	0.50333	1.59	0.21553	N	0.999647	P	0.46395	0.877	B	0.38562	0.276	T	0.64896	-0.6299	10	0.49607	T	0.09	.	14.3387	0.66608	1.0:0.0:0.0:0.0	.	491	P57059	SIK1_HUMAN	D	491	ENSP00000270162:V491D	ENSP00000270162:V491D	V	-	2	0	SIK1	43662840	1.000000	0.71417	0.004000	0.12327	0.159000	0.22180	5.993000	0.70616	1.790000	0.52503	0.533000	0.62120	GTC	.	.	.	none		0.637	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354	
TST	7263	hgsc.bcm.edu	37	22	37407323	37407323	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr22:37407323G>T	ENST00000403892.3	-	2	1373	c.639C>A	c.(637-639)ttC>ttA	p.F213L	Y_RNA_ENST00000516603.1_RNA|TST_ENST00000249042.3_Missense_Mutation_p.F213L	NM_001270483.1	NP_001257412.1	Q16762	THTR_HUMAN	thiosulfate sulfurtransferase (rhodanese)	213	Rhodanese 2. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cellular nitrogen compound metabolic process (GO:0034641)|cyanate catabolic process (GO:0009440)|epithelial cell differentiation (GO:0030855)|rRNA import into mitochondrion (GO:0035928)|rRNA transport (GO:0051029)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|thiosulfate sulfurtransferase activity (GO:0004792)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	7						GGAAGTCCATGAAAGGCATGT	0.582																																					p.F213L		Atlas-SNP	.											.	TST	22	.	0			c.C639A						PASS	.						55.0	45.0	49.0					22																	37407323		2203	4300	6503	SO:0001583	missense	7263	exon3			GTCCATGAAAGGC	Z73420	CCDS13938.1	22q13.1	2002-02-05			ENSG00000128311	ENSG00000128311	2.8.1.1		12388	protein-coding gene	gene with protein product		180370				1953758	Standard	NM_003312		Approved	RDS	uc003aqh.4	Q16762	OTTHUMG00000150533	ENST00000403892.3:c.639C>A	chr22.hg19:g.37407323G>T	ENSP00000385828:p.Phe213Leu	97.0	0.0	.		100.0	41.0	.	NM_003312	B3KRM1|Q6IB06	Missense_Mutation	SNP	ENST00000403892.3	hg19	CCDS13938.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481640	0.63849	.	.	ENSG00000128311	ENST00000403892;ENST00000249042;ENST00000413912	T;T	0.38240	1.15;1.15	5.08	4.07	0.47477	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.52980	0.1768	M	0.75447	2.3	0.58432	D	0.999997	P	0.50943	0.94	P	0.62014	0.897	T	0.53669	-0.8406	10	0.51188	T	0.08	-4.9919	8.164	0.31215	0.289:0.0:0.711:0.0	.	213	Q16762	THTR_HUMAN	L	213	ENSP00000385828:F213L;ENSP00000249042:F213L	ENSP00000249042:F213L	F	-	3	2	TST	35737269	0.999000	0.42202	0.977000	0.42913	0.767000	0.43475	2.480000	0.45206	1.366000	0.46076	0.655000	0.94253	TTC	.	.	.	none		0.582	TST-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318790.1		
CD33	945	hgsc.bcm.edu	37	19	51728819	51728820	+	Frame_Shift_Ins	INS	-	-	T	rs267605608|rs34919259	byFrequency	TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr19:51728819_51728820insT	ENST00000262262.4	+	2	404_405	c.383_384insT	c.(382-387)agttacfs	p.Y129fs	CD33_ENST00000391796.3_Frame_Shift_Ins_p.Y129fs|CD33_ENST00000436584.2_Intron|CD33_ENST00000421133.2_Intron	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	129	Ig-like V-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	ACCAAATACAGTTACAAATCTC	0.53																																					p.S128fs		Atlas-Indel,Pindel	.											.	CD33	55	.	0			c.383_384insT						PASS	.																																			SO:0001589	frameshift_variant	945	exon2			.	M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.385dupT	chr19.hg19:g.51728821_51728821dupT	ENSP00000262262:p.Tyr129fs	111.0	0.0	0		120.0	35.0	0.291667	NM_001177608	B4E3P8|C9JEN7|F8WAL2|Q8TD24	Frame_Shift_Ins	INS	ENST00000262262.4	hg19	CCDS33084.1																																																																																			.	.	.	none		0.530	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464199.2	NM_001772	
ZC3H7A	29066	hgsc.bcm.edu	37	16	11856532	11856534	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr16:11856532_11856534delCTC	ENST00000396516.2	-	16	2269_2271	c.2072_2074delGAG	c.(2071-2076)ggagcg>gcg	p.G691del	ZC3H7A_ENST00000575984.1_5'Flank|ZC3H7A_ENST00000355758.4_In_Frame_Del_p.G691del			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	691						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						AATACCTGCGCTCCAGGTACATT	0.404																																					p.691_692del		Atlas-INDEL	.											ZC3H7A,colon,carcinoma,+1,1	ZC3H7A	72	.	0			c.2073_2075del						PASS	.																																			SO:0001651	inframe_deletion	29066	exon17			.	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.2072_2074delGAG	chr16.hg19:g.11856532_11856534delCTC	ENSP00000379773:p.Gly691del	64.0	0.0	0		55.0	11.0	0.2	NM_014153	D3DUG5|Q9NPE9	In_Frame_Del	DEL	ENST00000396516.2	hg19	CCDS10550.1																																																																																			.	.	.	none		0.404	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
PEX5	5830	hgsc.bcm.edu	37	12	7351708	7351710	+	Splice_Site	DEL	TGG	TGG	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	TGG	TGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr12:7351708_7351710delTGG	ENST00000455147.2	+	7	1130_1131	c.550_551delTGG	c.(550-552)tgg>g	p.W184del	PEX5_ENST00000434354.2_Splice_Site_p.W199del|PEX5_ENST00000412720.2_Splice_Site_p.W205del|PEX5_ENST00000545220.1_Intron|PEX5_ENST00000420616.2_Splice_Site_p.W184del|PEX5_ENST00000266563.5_Splice_Site_p.W184del|PEX5_ENST00000266564.3_Splice_Site_p.W184del	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5	184					cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						CACCGATCGCTGGTGAGTTCAGA	0.522																																					p.198_199del		Atlas-Indel,Pindel	.											.	PEX5	63	.	0			c.594_596del						PASS	.																																			SO:0001630	splice_region_variant	5830	exon6			.	U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.551+1TGG>-	chr12.hg19:g.7351708_7351710delTGG		53.0	0.0	0		62.0	13.0	0.209677	NM_001131023	A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	In_Frame_Del	DEL	ENST00000455147.2	hg19	CCDS44823.1																																																																																			.	.	.	none		0.522	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398611.1	NM_000319	In_Frame_Del
NVL	4931	hgsc.bcm.edu	37	1	224455838	224455838	+	Intron	DEL	A	A	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:224455838delA	ENST00000281701.6	-	18	2342				NVL_ENST00000482491.1_Intron|NVL_ENST00000361463.3_Intron|NVL_ENST00000340871.4_Intron|NVL_ENST00000469075.1_Intron|NVL_ENST00000391875.2_Intron	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like							membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		GCCCCTGTCTAAAAAGACATA	0.423																																					.		Atlas-Indel,Pindel	.											.	NVL	74	.	0			c.1765-2T>-						PASS	.						67.0	63.0	64.0					1																	224455838		2203	4300	6503	SO:0001627	intron_variant	4931	exon18			.	U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.2083-3T>-	chr1.hg19:g.224455838delA		114.0	0.0	0		80.0	22.0	0.275	NM_206840	B4DMC4|B4DP98|Q96EM7	Splice_Site	DEL	ENST00000281701.6	hg19	CCDS1541.1																																																																																			.	.	.	none		0.423	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533	
TRAPPC6B	122553	hgsc.bcm.edu	37	14	39627583	39627583	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr14:39627583delA	ENST00000330149.5	-	3	399	c.173delT	c.(172-174)ttcfs	p.F58fs	TRAPPC6B_ENST00000557764.1_Intron|TRAPPC6B_ENST00000347691.5_Frame_Shift_Del_p.F58fs	NM_001079537.1	NP_001073005.1	Q86SZ2	TPC6B_HUMAN	trafficking protein particle complex 6B	58					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0128)		CTCATCCTTGAACCTTGCAGT	0.313																																					p.F58fs		Atlas-Indel,Pindel	.											.	TRAPPC6B	13	.	0			c.174delC						PASS	.						93.0	90.0	91.0					14																	39627583		2203	4295	6498	SO:0001589	frameshift_variant	122553	exon3			.	AK025437	CCDS9670.1, CCDS41947.1	14q13.3	2011-10-10			ENSG00000182400	ENSG00000182400		"""Trafficking protein particle complex"""	23066	protein-coding gene	gene with protein product		610397					Standard	NM_177452		Approved		uc001wut.1	Q86SZ2	OTTHUMG00000140259	ENST00000330149.5:c.173delT	chr14.hg19:g.39627583delA	ENSP00000330289:p.Phe58fs	71.0	0.0	0		64.0	29.0	0.453125	NM_001079537	B3KPS2|Q5JPD6|Q86U35|Q86X35	Frame_Shift_Del	DEL	ENST00000330149.5	hg19	CCDS41947.1																																																																																			.	.	.	none		0.313	TRAPPC6B-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276775.1	NM_177452	
PTGES	9536	hgsc.bcm.edu	37	9	132502088	132502090	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr9:132502088_132502090delGAA	ENST00000340607.4	-	3	293_295	c.259_261delTTC	c.(259-261)ttcdel	p.F87del	PTGES_ENST00000481476.1_5'UTR	NM_004878.4	NP_004869.1	O14684	PTGES_HUMAN	prostaglandin E synthase	87					acute inflammatory response (GO:0002526)|arachidonic acid metabolic process (GO:0019369)|chronic inflammatory response (GO:0002544)|cyclooxygenase pathway (GO:0019371)|negative regulation of cell proliferation (GO:0008285)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|response to calcium ion (GO:0051592)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)	glutathione binding (GO:0043295)|prostaglandin-E synthase activity (GO:0050220)			lung(1)|skin(1)	2		Ovarian(14;0.00556)				AGGAGTAGACGAAGCCCAGGAAA	0.596																																					p.87_88del		Atlas-Indel,Pindel	.											.	PTGES	7	.	0			c.260_262del						PASS	.																																			SO:0001651	inframe_deletion	9536	exon3			.	AF010316	CCDS6927.1	9q34.3	2008-07-21			ENSG00000148344	ENSG00000148344			9599	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase 1-like 1"", ""tumor protein p53 inducible protein 12"", ""p53-induced gene 12"", ""microsomal prostaglandin E synthase-1"", ""glutathione S-transferase 1-like 1"", ""MGST1-like 1"""	605172		MGST1L1		9305847, 10091672	Standard	NM_004878		Approved	MGST-IV, PIG12, MGST1-L1, TP53I12	uc004byi.3	O14684	OTTHUMG00000020791	ENST00000340607.4:c.259_261delTTC	chr9.hg19:g.132502088_132502090delGAA	ENSP00000342385:p.Phe87del	244.0	0.0	0		231.0	73.0	0.316017	NM_004878	O14900|Q5SZC0	In_Frame_Del	DEL	ENST00000340607.4	hg19	CCDS6927.1																																																																																			.	.	.	none		0.596	PTGES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054599.2	NM_004878	
TBX21	30009	hgsc.bcm.edu	37	17	45822709	45822709	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr17:45822709delT	ENST00000177694.1	+	6	1796	c.1585delT	c.(1585-1587)tttfs	p.F529fs		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	529					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						TGAAGGACAGTTTTATAACTA	0.483																																					p.Q528fs		Atlas-Indel,Pindel	.											.	TBX21	50	.	0			c.1584delG						PASS	.						44.0	50.0	48.0					17																	45822709		2199	4298	6497	SO:0001589	frameshift_variant	30009	exon6			.	AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.1585delT	chr17.hg19:g.45822709delT	ENSP00000177694:p.Phe529fs	51.0	0.0	0		50.0	15.0	0.3	NM_013351		Frame_Shift_Del	DEL	ENST00000177694.1	hg19	CCDS11514.1																																																																																			.	.	.	none		0.483	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
PRAMEF18	391003	hgsc.bcm.edu	37	1	13475225	13475225	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:13475225delA	ENST00000376126.2	-	3	903	c.904delT	c.(904-906)tatfs	p.Y302fs		NM_001099850.1	NP_001093320.1	Q5VWM3	PRA18_HUMAN	PRAME family member 18	302					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					lung(2)|ovary(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGAGCCATAAGTTAATGCC	0.493																																					p.Y302fs		Atlas-INDEL	.											.	PRAMEF19	6	.	0			c.905delA						PASS	.						3.0	4.0	4.0					1																	13475225		1676	3663	5339	SO:0001589	frameshift_variant	645414	exon3			.			1p36.21	2013-01-17			ENSG00000204491			"""-"""	30693	protein-coding gene	gene with protein product							Standard			Approved	OTTHUMG00000002932		Q5VWM3	OTTHUMG00000002932	ENST00000376126.2:c.904delT	chr1.hg19:g.13475225delA	ENSP00000365294:p.Tyr302fs	307.0	0.0	0		305.0	92.0	0.301639	NM_001099790		Frame_Shift_Del	DEL	ENST00000376126.2	hg19	CCDS41258.1																																																																																			.	.	.	none		0.493	PRAMEF18-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008177.2	NM_001099850	
KMT2C	58508	hgsc.bcm.edu	37	7	151919089	151919091	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr7:151919089_151919091delGCT	ENST00000262189.6	-	22	3712_3714	c.3494_3496delAGC	c.(3493-3498)gagcta>gta	p.1165_1166EL>V	KMT2C_ENST00000355193.2_In_Frame_Del_p.1165_1166EL>V	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1165					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ATTTTACCTAGCTCTTTTACTTT	0.315																																					p.1165_1166del		Atlas-Indel,Pindel	.											.	MLL3	1564	.	0			c.3495_3497del						PASS	.																																			SO:0001651	inframe_deletion	58508	exon22			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3494_3496delAGC	chr7.hg19:g.151919089_151919091delGCT	ENSP00000262189:p.Glu1165_Leu1166delinsVal	228.0	0.0	0		182.0	55.0	0.302198	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	In_Frame_Del	DEL	ENST00000262189.6	hg19	CCDS5931.1																																																																																			.	.	.	none		0.315	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
DSCAML1	57453	hgsc.bcm.edu	37	11	117335821	117335844	+	In_Frame_Del	DEL	GTTGCTGCCGGGGCTGTTCTCTCT	GTTGCTGCCGGGGCTGTTCTCTCT	-	rs375180039|rs140840612|rs574227365		TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	GTTGCTGCCGGGGCTGTTCTCTCT	GTTGCTGCCGGGGCTGTTCTCTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr11:117335821_117335844delGTTGCTGCCGGGGCTGTTCTCTCT	ENST00000321322.6	-	17	3260_3283	c.3259_3282delAGAGAGAACAGCCCCGGCAGCAAC	c.(3259-3282)agagagaacagccccggcagcaacdel	p.RENSPGSN1087del	DSCAML1_ENST00000527706.1_In_Frame_Del_p.RENSPGSN817del	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1027	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGTACTGCCCGTTGCTGCCGGGGCTGTTCTCTCTGTAGCCAATC	0.598																																					p.1087_1095del		Atlas-Indel,Pindel	.											.	DSCAML1	286	.	0			c.3260_3283del						PASS	.																																			SO:0001651	inframe_deletion	57453	exon17			.		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.3259_3282delAGAGAGAACAGCCCCGGCAGCAAC	chr11.hg19:g.117335821_117335844delGTTGCTGCCGGGGCTGTTCTCTCT	ENSP00000315465:p.Arg1087_Asn1094del	105.0	0.0	0		107.0	30.0	0.280374	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	In_Frame_Del	DEL	ENST00000321322.6	hg19	CCDS8384.1																																																																																			.	.	.	none		0.598	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
USP43	124739	hgsc.bcm.edu	37	17	9559778	9559778	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr17:9559778delA	ENST00000285199.7	+	2	659	c.563delA	c.(562-564)gaafs	p.E188fs	USP43_ENST00000570827.2_3'UTR|USP43_ENST00000570475.1_Frame_Shift_Del_p.E188fs	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	188	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						GACGCCCTGGAATTCCTGCTC	0.522																																					p.E188fs		Atlas-Indel,Pindel	.											.	USP43	65	.	0			c.562delG						PASS	.						75.0	73.0	74.0					17																	9559778		1866	4108	5974	SO:0001589	frameshift_variant	124739	exon2			.	AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.563delA	chr17.hg19:g.9559778delA	ENSP00000285199:p.Glu188fs	157.0	0.0	0		146.0	42.0	0.287671	NM_001267576	A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Frame_Shift_Del	DEL	ENST00000285199.7	hg19	CCDS45610.1																																																																																			.	.	.	none		0.522	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439855.3	NM_153210	
HLA-C	3107	hgsc.bcm.edu	37	6	31239449	31239450	+	Frame_Shift_Ins	INS	-	-	T	rs28626310	byFrequency	TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr6:31239449_31239450insT	ENST00000376228.5	-	2	283_284	c.269_270insA	c.(268-270)aagfs	p.K90fs	HLA-C_ENST00000383329.3_Frame_Shift_Ins_p.K90fs	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	90	Alpha-1.		K -> N (in dbSNP:rs28626310).		antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GGCGCTTGTACTTCTGTGTCTC	0.698																																					p.K90fs		Atlas-Indel,Pindel	.											.	HLA-C	92	.	0			c.270_271insA						PASS	.																																			SO:0001589	frameshift_variant	3107	exon2			.	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.270dupA	chr6.hg19:g.31239451_31239451dupT	ENSP00000365402:p.Lys90fs	107.0	0.0	0		133.0	31.0	0.233083	NM_002117	O02864|O02958|Q29643|Q9MY30	Frame_Shift_Ins	INS	ENST00000376228.5	hg19	CCDS34393.1																																																																																			.	.	.	none		0.698	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
JAZF1	221895	hgsc.bcm.edu	37	7	27872487	27872487	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr7:27872487delG	ENST00000283928.5	-	5	829	c.664delC	c.(664-666)ctgfs	p.L222fs	JAZF1_ENST00000466516.1_5'UTR	NM_175061.3	NP_778231.2	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1	222					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transcription corepressor activity (GO:0003714)		JAZF1/SUZ12(133)	endometrium(1)|large_intestine(1)|lung(4)	6						TGGTGCCGCAGGCCCTGAGCT	0.488			T	SUZ12	endometrial stromal tumours																																p.L222fs		Atlas-Indel,Pindel	.		Dom	yes		7	7p15.2-p15.1	221895	juxtaposed with another zinc finger gene 1		M	.	JAZF1	13	.	0			c.665delT						PASS	.						171.0	154.0	160.0					7																	27872487		2203	4300	6503	SO:0001589	frameshift_variant	221895	exon5			.	BC047229	CCDS5416.1	7p15.2-p15.1	2010-04-14			ENSG00000153814	ENSG00000153814		"""Zinc fingers, C2H2-type"""	28917	protein-coding gene	gene with protein product		606246				8401585	Standard	XM_006715656		Approved	TIP27, DKFZp761K2222, ZNF802	uc003szn.3	Q86VZ6	OTTHUMG00000128545	ENST00000283928.5:c.664delC	chr7.hg19:g.27872487delG	ENSP00000283928:p.Leu222fs	77.0	0.0	0		73.0	20.0	0.273973	NM_175061	A4D195|Q8N3L7	Frame_Shift_Del	DEL	ENST00000283928.5	hg19	CCDS5416.1																																																																																			.	.	.	none		0.488	JAZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250382.2	NM_175061	
PRAMEF19	645414	hgsc.bcm.edu	37	1	13696061	13696061	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr1:13696061delA	ENST00000376101.2	-	3	696	c.697delT	c.(697-699)tatfs	p.Y233fs	PRAMEF19_ENST00000540591.1_Frame_Shift_Del_p.Y302fs			Q5SWL8	PRA19_HUMAN	PRAME family member 19	233					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					lung(3)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGAGCCATAAGTTAATGCC	0.493																																					p.Y302fs		Atlas-Indel,Pindel	.											.	PRAMEF19	6	.	0			c.905delA						PASS	.						2.0	2.0	2.0					1																	13696061		1123	2538	3661	SO:0001589	frameshift_variant	645414	exon3			.			1p36.21	2013-01-17			ENSG00000204480	ENSG00000204480		"""-"""	24908	protein-coding gene	gene with protein product							Standard	NM_001099790		Approved	OTTHUMG00000007919	uc009vnu.1	Q5SWL8	OTTHUMG00000007919	ENST00000376101.2:c.697delT	chr1.hg19:g.13696061delA	ENSP00000365269:p.Tyr233fs	323.0	0.0	0		242.0	46.0	0.190083	NM_001099790		Frame_Shift_Del	DEL	ENST00000376101.2	hg19																																																																																				.	.	.	none		0.493	PRAMEF19-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000021794.2	NM_001099790	
TLN2	83660	hgsc.bcm.edu	37	15	63112730	63112731	+	Frame_Shift_Ins	INS	-	-	A			TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr15:63112730_63112731insA	ENST00000561311.1	+	53	7153_7154	c.6923_6924insA	c.(6922-6927)acagagfs	p.E2309fs	TLN2_ENST00000306829.6_Frame_Shift_Ins_p.E2309fs			Q9Y4G6	TLN2_HUMAN	talin 2	2309	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						ATTGCAGAAACAGAGTTACTGG	0.47																																					p.T2308fs		Atlas-Indel,Pindel	.											.	TLN2	253	.	0			c.6923_6924insA						PASS	.																																			SO:0001589	frameshift_variant	83660	exon51			.	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6924dupA	chr15.hg19:g.63112731_63112731dupA	ENSP00000453508:p.Glu2309fs	91.0	0.0	0		96.0	25.0	0.260417	NM_015059	A6NLB8	Frame_Shift_Ins	INS	ENST00000561311.1	hg19	CCDS32261.1																																																																																			.	.	.	none		0.470	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
ZC3H7A	29066	hgsc.bcm.edu	37	16	11856530	11856530	+	Frame_Shift_Del	DEL	C	C	-	rs571101988		TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr16:11856530delC	ENST00000396516.2	-	16	2273	c.2076delG	c.(2074-2076)gcgfs	p.A692fs	ZC3H7A_ENST00000575984.1_5'Flank|ZC3H7A_ENST00000355758.4_Frame_Shift_Del_p.A692fs			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	692						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A692A(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						AAAATACCTGCGCTCCAGGTA	0.413																																					p.Q693fs		Atlas-INDEL	.											.	ZC3H7A	72	.	1	Substitution - coding silent(1)	prostate(1)	c.2077delC						PASS	.						115.0	99.0	105.0					16																	11856530		2197	4300	6497	SO:0001589	frameshift_variant	29066	exon17			.	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.2076delG	chr16.hg19:g.11856530delC	ENSP00000379773:p.Ala692fs	64.0	0.0	0		53.0	11.0	0.207547	NM_014153	D3DUG5|Q9NPE9	Frame_Shift_Del	DEL	ENST00000396516.2	hg19	CCDS10550.1																																																																																			.	.	.	none		0.413	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
PABPC3	5042	hgsc.bcm.edu	37	13	25670355	25670366	+	In_Frame_Del	DEL	AGCTACCCAACG	AGCTACCCAACG	-	rs371856829|rs533997128		TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	AGCTACCCAACG	AGCTACCCAACG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr13:25670355_25670366delAGCTACCCAACG	ENST00000281589.3	+	1	56_67	c.19_30delAGCTACCCAACG	c.(19-30)agctacccaacgdel	p.SYPT7del		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	7					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CAGCACCCCCAGCTACCCAACGGCCTCGCTCT	0.67																																					p.6_10del		Atlas-INDEL	.											.	PABPC3	129	.	0			c.18_29del						PASS	.																																			SO:0001651	inframe_deletion	5042	exon1			.	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.19_30delAGCTACCCAACG	chr13.hg19:g.25670355_25670366delAGCTACCCAACG	ENSP00000281589:p.Ser7_Thr10del	93.0	0.0	0		91.0	16.0	0.175824	NM_030979	Q8NHV0|Q9H086	In_Frame_Del	DEL	ENST00000281589.3	hg19	CCDS9311.1																																																																																			.	.	.	none		0.670	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
PRB4	5545	hgsc.bcm.edu	37	12	11461534	11461596	+	In_Frame_Del	DEL	CCTCCTTGTGGGGGTGGTCTTTCTGGCTTTCCTGGAGGAGGTGGGGTACCTTGGGACTGGTTT	CCTCCTTGTGGGGGTGGTCTTTCTGGCTTTCCTGGAGGAGGTGGGGTACCTTGGGACTGGTTT	-	rs11054244|rs59021567|rs11054243|rs551775057|rs12303607|rs199532199|rs148027029|rs71057722|rs59189129|rs536297617	byFrequency	TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	CCTCCTTGTGGGGGTGGTCTTTCTGGCTTTCCTGGAGGAGGTGGGGTACCTTGGGACTGGTTT	CCTCCTTGTGGGGGTGGTCTTTCTGGCTTTCCTGGAGGAGGTGGGGTACCTTGGGACTGGTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr12:11461534_11461596delCCTCCTTGTGGGGGTGGTCTTTCTGGCTTTCCTGGAGGAGGTGGGGTACCTTGGGACTGGTTT	ENST00000535904.1	-	3	354_416	c.321_383delAAACCAGTCCCAAGGTACCCCACCTCCTCCAGGAAAGCCAGAAAGACCACCCCCACAAGGAGG	c.(319-384)ggaaaccagtcccaaggtaccccacctcctccaggaaagccagaaagaccacccccacaaggaggc>ggc	p.107_128GNQSQGTPPPPGKPERPPPQGG>G	PRB4_ENST00000445719.2_Splice_Site_p.107_112GNQSQG>G|PRB4_ENST00000279575.1_In_Frame_Del_p.107_128GNQSQGTPPPPGKPERPPPQGG>G			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	128	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).	SR -> RP (in Ref. 7; CAA30542). {ECO:0000305}.		extracellular region (GO:0005576)		p.P115L(1)|p.G118E(1)|p.P117T(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGACTGGTTGCCTCCTTGTGGGGGTGGTCTTTCTGGCTTTCCTGGAGGAGGTGGGGTACCTTGGGACTGGTTTCCTCCTTGTG	0.605										HNSCC(22;0.051)																											p.108_112del		Pindel	.											.	PRB4	59	.	3	Substitution - Missense(3)	lung(1)|kidney(1)|skin(1)	c.322_334del						PASS	.																																			SO:0001651	inframe_deletion	5545	exon3			.		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.321_383delAAACCAGTCCCAAGGTACCCCACCTCCTCCAGGAAAGCCAGAAAGACCACCCCCACAAGGAGG	chr12.hg19:g.11461534_11461596delCCTCCTTGTGGGGGTGGTCTTTCTGGCTTTCCTGGAGGAGGTGGGGTACCTTGGGACTGGTTT	ENSP00000442834:p.Gly107_Gly127del	96.0	0.0	.		123.0	12.0	0.098	NM_001261399	A1L439|O00600|P02813|P10161|P10162|P81489	Frame_Shift_Del	DEL	ENST00000535904.1	hg19	CCDS8641.1																																																																																			.	.	.	none		0.605	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
ZC3H7A	29066	hgsc.bcm.edu	37	16	11856530	11856535	+	In_Frame_Del	DEL	CGCTCC	CGCTCC	-	rs571101988|rs199622419		TCGA-5P-A9KA-01A-11D-A42J-10	TCGA-5P-A9KA-10A-01D-A42M-10	CGCTCC	CGCTCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5c321a-1ec5-43d8-a9ce-dea256ce836f	88f8e541-dd2d-4548-bad0-c30265b48b79	g.chr16:11856530_11856535delCGCTCC	ENST00000396516.2	-	16	2268_2273	c.2071_2076delGGAGCG	c.(2071-2076)ggagcgdel	p.GA691del	ZC3H7A_ENST00000575984.1_5'Flank|ZC3H7A_ENST00000355758.4_In_Frame_Del_p.GA691del			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	691						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A692V(1)|p.A692A(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						AAAATACCTGCGCTCCAGGTACATTT	0.403																																					p.691_693del		Pindel	.											.	ZC3H7A	72	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.2072_2077del						PASS	.																																			SO:0001651	inframe_deletion	29066	exon17			.	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.2071_2076delGGAGCG	chr16.hg19:g.11856530_11856535delCGCTCC	ENSP00000379773:p.Gly691_Ala692del	65.0	0.0	.		56.0	10.0	0.179	NM_014153	D3DUG5|Q9NPE9	In_Frame_Del	DEL	ENST00000396516.2	hg19	CCDS10550.1																																																																																			.	.	.	none		0.403	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
