#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTOR	2475	hgsc.bcm.edu	37	1	11269473	11269473	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:11269473G>T	ENST00000361445.4	-	25	3773	c.3697C>A	c.(3697-3699)Cag>Aag	p.Q1233K		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1233					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ATCCGATGCTGGTAAATCAAA	0.468																																					p.Q1233K		Atlas-SNP	.											.	MTOR	327	.	0			c.C3697A						PASS	.						260.0	247.0	251.0					1																	11269473		2203	4300	6503	SO:0001583	missense	2475	exon25			GATGCTGGTAAAT	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.3697C>A	chr1.hg19:g.11269473G>T	ENSP00000354558:p.Gln1233Lys	63.0	0.0	.		77.0	4.0	.	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	hg19	CCDS127.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601119	0.28534	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.66638	-0.22	5.78	5.78	0.91487	Armadillo-type fold (1);	0.202762	0.43919	D	0.000504	T	0.57169	0.2035	L	0.36672	1.1	0.80722	D	1	B	0.13594	0.008	B	0.14578	0.011	T	0.55082	-0.8196	10	0.07175	T	0.84	.	19.9981	0.97395	0.0:0.0:1.0:0.0	.	1233	P42345	MTOR_HUMAN	K	1233	ENSP00000354558:Q1233K	ENSP00000354558:Q1233K	Q	-	1	0	MTOR	11192060	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.599000	0.82757	2.733000	0.93635	0.561000	0.74099	CAG	.	.	.	none		0.468	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
FAM131C	348487	hgsc.bcm.edu	37	1	16388654	16388654	+	Missense_Mutation	SNP	C	C	T	rs374242693		TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:16388654C>T	ENST00000375662.4	-	4	391	c.208G>A	c.(208-210)Gac>Aac	p.D70N	FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C	70								p.D70N(1)		large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GATCTGGAGTCGGACAGGTAG	0.652																																					p.D70N		Atlas-SNP	.											FAM131C,caecum,carcinoma,0,1	FAM131C	21	.	1	Substitution - Missense(1)	large_intestine(1)	c.G208A						PASS	.	C	ASN/ASP	0,4104		0,0,2052	77.0	78.0	78.0		208	0.4	1.0	1		78	2,8368		0,2,4183	no	missense	FAM131C	NM_182623.2	23	0,2,6235	TT,TC,CC		0.0239,0.0,0.016	benign	70/281	16388654	2,12472	2052	4185	6237	SO:0001583	missense	348487	exon4			TGGAGTCGGACAG		CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.208G>A	chr1.hg19:g.16388654C>T	ENSP00000364814:p.Asp70Asn	119.0	0.0	.		103.0	15.0	.	NM_182623	Q5T5Q5|Q8N3X3|Q8N9P9	Missense_Mutation	SNP	ENST00000375662.4	hg19	CCDS41270.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.755733	0.31046	0.0	2.39E-4	ENSG00000185519	ENST00000375662	T	0.15256	2.44	4.64	0.426	0.16479	.	0.428262	0.22187	N	0.063432	T	0.13670	0.0331	L	0.60455	1.87	0.29394	N	0.862426	B	0.21309	0.054	B	0.12156	0.007	T	0.11036	-1.0604	10	0.37606	T	0.19	.	4.7214	0.12920	0.0:0.5558:0.1572:0.287	.	70	Q96AQ9	F131C_HUMAN	N	70	ENSP00000364814:D70N	ENSP00000364814:D70N	D	-	1	0	FAM131C	16261241	0.075000	0.21258	0.966000	0.40874	0.854000	0.48673	0.068000	0.14531	0.057000	0.16193	-0.379000	0.06801	GAC	.	.	.	none		0.652	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026319.1	NM_182623	
HP1BP3	50809	hgsc.bcm.edu	37	1	21091954	21091954	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:21091954C>T	ENST00000312239.5	-	8	945	c.806G>A	c.(805-807)cGc>cAc	p.R269H	HP1BP3_ENST00000375003.2_Missense_Mutation_p.R117H	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3	269	H15 2. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TTCACAAAGGCGAGTAAAGGC	0.418																																					p.R269H		Atlas-SNP	.											.	HP1BP3	47	.	0			c.G806A						PASS	.						123.0	118.0	120.0					1																	21091954		2203	4300	6503	SO:0001583	missense	50809	exon8			CAAAGGCGAGTAA	BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.806G>A	chr1.hg19:g.21091954C>T	ENSP00000312625:p.Arg269His	102.0	0.0	.		117.0	35.0	.	NM_016287	A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Missense_Mutation	SNP	ENST00000312239.5	hg19	CCDS30621.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599025	0.87055	.	.	ENSG00000127483	ENST00000312239;ENST00000375004;ENST00000375003;ENST00000419948;ENST00000438032;ENST00000424732	T;T;T;T;T	0.22336	1.98;1.98;1.98;1.98;1.96	6.1	5.19	0.71726	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.045842	0.85682	D	0.000000	T	0.40094	0.1103	L	0.48362	1.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69824	0.966;0.945	T	0.26018	-1.0115	10	0.87932	D	0	-0.8069	15.6469	0.77063	0.0:0.9343:0.0:0.0657	.	231;269	Q5SSJ5-2;Q5SSJ5	.;HP1B3_HUMAN	H	269;231;117;128;269;231	ENSP00000312625:R269H;ENSP00000364142:R117H;ENSP00000391721:R128H;ENSP00000403039:R269H;ENSP00000402754:R231H	ENSP00000312625:R269H	R	-	2	0	HP1BP3	20964541	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.997000	0.70646	1.593000	0.50029	0.650000	0.86243	CGC	.	.	.	none		0.418	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007457.2	NM_016287	
COL8A2	1296	hgsc.bcm.edu	37	1	36564328	36564328	+	Silent	SNP	T	T	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:36564328T>G	ENST00000397799.1	-	4	1178	c.954A>C	c.(952-954)ccA>ccC	p.P318P	COL8A2_ENST00000303143.4_Silent_p.P318P|COL8A2_ENST00000481785.1_Silent_p.P253P			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	318	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGGCAGTCCTGGCATCCCAT	0.716																																					p.P318P		Atlas-SNP	.											.	COL8A2	41	.	0			c.A954C						PASS	.						10.0	12.0	12.0					1																	36564328		2039	4085	6124	SO:0001819	synonymous_variant	1296	exon2			CAGTCCTGGCATC	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.954A>C	chr1.hg19:g.36564328T>G		75.0	0.0	.		82.0	21.0	.	NM_005202	Q5JV31|Q8TEJ5	Silent	SNP	ENST00000397799.1	hg19	CCDS403.1																																																																																			.	.	.	none		0.716	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1	NM_005202	
TYW3	127253	hgsc.bcm.edu	37	1	75199100	75199100	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:75199100C>T	ENST00000370867.3	+	1	261	c.172C>T	c.(172-174)Cgg>Tgg	p.R58W	CRYZ_ENST00000370872.3_5'Flank|CRYZ_ENST00000417775.1_5'Flank|CRYZ_ENST00000340866.5_5'Flank|TYW3_ENST00000457880.2_Missense_Mutation_p.R58W|CRYZ_ENST00000370871.3_5'Flank|TYW3_ENST00000421739.2_Missense_Mutation_p.R58W|TYW3_ENST00000479111.1_5'UTR	NM_138467.2	NP_612476.1	Q6IPR3	TYW3_HUMAN	tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)	58					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)	p.R58W(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|ovary(2)|prostate(1)|skin(1)	15						ACTCCTTGACCGGGTGAGGCC	0.567																																					p.R58W		Atlas-SNP	.											TYW3,NS,carcinoma,0,1	TYW3	36	.	1	Substitution - Missense(1)	prostate(1)	c.C172T						PASS	.						74.0	65.0	68.0					1																	75199100		2203	4300	6503	SO:0001583	missense	127253	exon1			CTTGACCGGGTGA	BX647591	CCDS666.1, CCDS53334.1	1p31.1	2008-02-05	2006-05-25	2006-05-25	ENSG00000162623	ENSG00000162623			24757	protein-coding gene	gene with protein product		611245	"""chromosome 1 open reading frame 171"""	C1orf171		17150819	Standard	NM_138467		Approved	FLJ40918	uc001dgn.3	Q6IPR3	OTTHUMG00000009641	ENST00000370867.3:c.172C>T	chr1.hg19:g.75199100C>T	ENSP00000359904:p.Arg58Trp	47.0	0.0	.		62.0	3.0	.	NM_001162916	B4DSP9|E9PGR7|Q5HYJ0|Q8N7L1	Missense_Mutation	SNP	ENST00000370867.3	hg19	CCDS666.1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.689848	0.48097	.	.	ENSG00000162623	ENST00000457880;ENST00000370867;ENST00000421739	T;T	0.30981	1.51;1.51	5.03	2.11	0.27256	tRNA wybutosine-synthesizing protein (2);	0.702089	0.14447	N	0.318982	T	0.23532	0.0569	L	0.50333	1.59	0.24118	N	0.995819	D;D;D	0.63046	0.99;0.992;0.989	B;P;P	0.49301	0.417;0.498;0.606	T	0.13019	-1.0525	10	0.72032	D	0.01	-0.7708	16.5745	0.84633	0.0:0.5347:0.4653:0.0	.	58;58;58	B4DFU6;E9PGR7;Q6IPR3	.;.;TYW3_HUMAN	W	58	ENSP00000407025:R58W;ENSP00000359904:R58W	ENSP00000359904:R58W	R	+	1	2	TYW3	74971688	0.849000	0.29639	0.878000	0.34440	0.268000	0.26511	0.521000	0.22893	0.288000	0.22398	-0.228000	0.12330	CGG	.	.	.	none		0.567	TYW3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026573.1	NM_138467	
PSMD4	5710	hgsc.bcm.edu	37	1	151238063	151238063	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:151238063G>T	ENST00000368884.3	+	6	712	c.632G>T	c.(631-633)aGt>aTt	p.S211I	PSMD4_ENST00000368881.4_Missense_Mutation_p.S211I	NM_002810.2	NP_002801.1	P55036	PSMD4_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	211					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, base subcomplex (GO:0008540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(7)	11	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTAGATCCCAGTGCTGATCCT	0.507																																					p.S211I		Atlas-SNP	.											.	PSMD4	27	.	0			c.G632T						PASS	.						84.0	76.0	79.0					1																	151238063		2203	4300	6503	SO:0001583	missense	5710	exon6			ATCCCAGTGCTGA	U51007	CCDS991.1	1q21.2	2008-05-22			ENSG00000159352	ENSG00000159352		"""Proteasome (prosome, macropain) subunits"""	9561	protein-coding gene	gene with protein product		601648				8641424	Standard	XM_005245354		Approved	S5A, AF-1, AF, Rpn10	uc001exl.3	P55036	OTTHUMG00000012349	ENST00000368884.3:c.632G>T	chr1.hg19:g.151238063G>T	ENSP00000357879:p.Ser211Ile	95.0	0.0	.		83.0	23.0	.	NM_002810	D3DV16|Q5VWC5|Q9NS92	Missense_Mutation	SNP	ENST00000368884.3	hg19	CCDS991.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414949	0.83449	.	.	ENSG00000159352	ENST00000368884;ENST00000368881;ENST00000437736	T;T	0.15834	2.39;2.39	5.7	5.7	0.88788	Ubiquitin interacting motif (3);	0.000000	0.85682	D	0.000000	T	0.32102	0.0818	M	0.65677	2.01	0.58432	D	0.999998	D;D	0.55172	0.97;0.97	P;P	0.60473	0.875;0.875	T	0.02668	-1.1126	10	0.87932	D	0	-15.2977	19.4422	0.94825	0.0:0.0:1.0:0.0	.	211;211	Q5VWC4;P55036	.;PSMD4_HUMAN	I	211;211;196	ENSP00000357879:S211I;ENSP00000357876:S211I	ENSP00000357876:S211I	S	+	2	0	PSMD4	149504687	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.403000	0.73264	2.688000	0.91661	0.655000	0.94253	AGT	.	.	.	none		0.507	PSMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034409.3	NM_002810	
SMG7	9887	hgsc.bcm.edu	37	1	183520249	183520249	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:183520249G>A	ENST00000347615.2	+	21	3343	c.3224G>A	c.(3223-3225)aGc>aAc	p.S1075N	SMG7_ENST00000507469.1_Missense_Mutation_p.S1079N|SMG7_ENST00000515829.2_Missense_Mutation_p.S1029N|SMG7_ENST00000508461.1_Missense_Mutation_p.S1083N|SMG7_ENST00000367537.3_Missense_Mutation_p.S1108N|SMG7_ENST00000456731.2_Missense_Mutation_p.S987N	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	1075					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						CATCAGGCCAGCACTCCGAGT	0.493																																					p.S1083N		Atlas-SNP	.											.	SMG7	165	.	0			c.G3248A						PASS	.						77.0	71.0	73.0					1																	183520249		2203	4300	6503	SO:0001583	missense	9887	exon21			AGGCCAGCACTCC	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.3224G>A	chr1.hg19:g.183520249G>A	ENSP00000340766:p.Ser1075Asn	101.0	0.0	.		124.0	28.0	.	NM_001174061	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	ENST00000347615.2	hg19	CCDS1355.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922705	0.52653	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T	0.20463	2.11;2.09;2.11;2.11;2.07;2.11	5.34	4.43	0.53597	.	0.231216	0.52532	N	0.000077	T	0.10208	0.0250	N	0.19112	0.55	0.37364	D	0.911351	B;B;B;B;B	0.32245	0.181;0.079;0.13;0.181;0.361	B;B;B;B;B	0.27076	0.014;0.021;0.076;0.024;0.054	T	0.09465	-1.0673	10	0.02654	T	1	-2.1512	10.3745	0.44075	0.1495:0.0:0.8505:0.0	.	1083;987;1029;1075;1079	E9PCI0;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;SMG7_HUMAN;.	N	987;1108;1083;1075;1079;1029	ENSP00000407629:S987N;ENSP00000356507:S1108N;ENSP00000426915:S1083N;ENSP00000340766:S1075N;ENSP00000425133:S1079N;ENSP00000421358:S1029N	ENSP00000340766:S1075N	S	+	2	0	SMG7	181786872	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.986000	0.63851	1.373000	0.46208	0.650000	0.86243	AGC	.	.	.	none		0.493	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837	
CAMK1G	57172	hgsc.bcm.edu	37	1	209778922	209778922	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:209778922G>C	ENST00000009105.1	+	5	583	c.338G>C	c.(337-339)gGt>gCt	p.G113A	CAMK1G_ENST00000361322.2_Missense_Mutation_p.G113A			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	113	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		CTGGAGCGGGGTGTCTACACA	0.493																																					p.G113A	Ovarian(163;530 1939 9680 28669 48710)	Atlas-SNP	.											.	CAMK1G	49	.	0			c.G338C						PASS	.						146.0	135.0	139.0					1																	209778922		2203	4300	6503	SO:0001583	missense	57172	exon5			AGCGGGGTGTCTA		CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.338G>C	chr1.hg19:g.209778922G>C	ENSP00000009105:p.Gly113Ala	42.0	0.0	.		64.0	15.0	.	NM_020439	Q86UH5|Q9Y3J7	Missense_Mutation	SNP	ENST00000009105.1	hg19	CCDS1486.1	.	.	.	.	.	.	.	.	.	.	G	32	5.184022	0.94885	.	.	ENSG00000008118	ENST00000009105;ENST00000423146;ENST00000361322	T;T;T	0.46063	0.88;1.64;0.88	5.34	5.34	0.76211	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000035	T	0.66036	0.2749	M	0.72576	2.205	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.77004	0.956;0.989	T	0.68614	-0.5362	10	0.87932	D	0	.	19.4188	0.94712	0.0:0.0:1.0:0.0	.	113;113	Q96NX5-2;Q96NX5	.;KCC1G_HUMAN	A	113	ENSP00000009105:G113A;ENSP00000392173:G113A;ENSP00000354861:G113A	ENSP00000009105:G113A	G	+	2	0	CAMK1G	207845545	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	9.507000	0.97996	2.664000	0.90586	0.655000	0.94253	GGT	.	.	.	none		0.493	CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088526.1	NM_020439	
RHOU	58480	hgsc.bcm.edu	37	1	228879035	228879035	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:228879035G>A	ENST00000366691.3	+	3	991	c.325G>A	c.(325-327)Gaa>Aaa	p.E109K		NM_021205.5	NP_067028.1			ras homolog family member U											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	13	Breast(184;0.162)	Prostate(94;0.183)				GTTGCAGGATGAATTTGACAA	0.448																																					p.E109K		Atlas-SNP	.											.	RHOU	20	.	0			c.G325A						PASS	.						190.0	199.0	196.0					1																	228879035		2203	4300	6503	SO:0001583	missense	58480	exon3			CAGGATGAATTTG		CCDS1575.1	1q42.11-q42.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000116574	ENSG00000116574			17794	protein-coding gene	gene with protein product	"""Ryu GTPase"", ""Wnt-1 responsive Cdc42 homolog"", ""2310026M05Rik"", ""GTP-binding protein like 1"", ""CDC42-like GTPase"", ""GTP-binding protein SB128"", ""ras-like gene family member U"""	606366	"""ras homolog gene family, member U"""	ARHU		11459829	Standard	NM_021205		Approved	WRCH-1, DJ646B12.2, FLJ10616, WRCH1, CDC42L1, hG28K, fJ646B12.2	uc001htf.3	Q7L0Q8	OTTHUMG00000037919	ENST00000366691.3:c.325G>A	chr1.hg19:g.228879035G>A	ENSP00000355652:p.Glu109Lys	77.0	0.0	.		78.0	13.0	.	NM_021205		Missense_Mutation	SNP	ENST00000366691.3	hg19	CCDS1575.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.860283	0.91433	.	.	ENSG00000116574	ENST00000366691	T	0.77489	-1.1	4.73	4.73	0.59995	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.78559	0.4302	L	0.50919	1.6	0.80722	D	1	B	0.29508	0.246	B	0.40285	0.325	T	0.80020	-0.1557	10	0.87932	D	0	.	15.2086	0.73198	0.0:0.0:1.0:0.0	.	109	Q7L0Q8	RHOU_HUMAN	K	109	ENSP00000355652:E109K	ENSP00000355652:E109K	E	+	1	0	RHOU	226945658	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.690000	0.84178	2.439000	0.82584	0.655000	0.94253	GAA	.	.	.	none		0.448	RHOU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092555.1	NM_021205	
KIF26B	55083	hgsc.bcm.edu	37	1	245850297	245850297	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:245850297G>A	ENST00000407071.2	+	12	4452	c.4012G>A	c.(4012-4014)Gac>Aac	p.D1338N	KIF26B_ENST00000366518.4_Missense_Mutation_p.D957N	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1338					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GGCCAGCCCCGACAACTTGCT	0.567																																					p.D1338N		Atlas-SNP	.											.	KIF26B	343	.	0			c.G4012A						PASS	.						49.0	54.0	52.0					1																	245850297		2051	4213	6264	SO:0001583	missense	55083	exon12			AGCCCCGACAACT	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4012G>A	chr1.hg19:g.245850297G>A	ENSP00000385545:p.Asp1338Asn	112.0	0.0	.		106.0	29.0	.	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.091651	0.36952	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.79940	-1.32;-1.31	5.82	3.94	0.45596	.	.	.	.	.	T	0.74122	0.3675	L	0.43152	1.355	0.21386	N	0.9997	B;B	0.16396	0.017;0.004	B;B	0.08055	0.003;0.002	T	0.65294	-0.6203	9	0.51188	T	0.08	.	11.8996	0.52675	0.1401:0.0:0.8599:0.0	.	957;1338	B7WPD9;Q2KJY2	.;KI26B_HUMAN	N	1338;957;954	ENSP00000385545:D1338N;ENSP00000355475:D957N	ENSP00000355475:D957N	D	+	1	0	KIF26B	243916920	0.992000	0.36948	0.356000	0.25785	0.517000	0.34286	3.275000	0.51639	1.462000	0.47948	0.561000	0.74099	GAC	.	.	.	none		0.567	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
PUM2	23369	hgsc.bcm.edu	37	2	20482914	20482914	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr2:20482914T>C	ENST00000361078.2	-	11	1536	c.1514A>G	c.(1513-1515)cAg>cGg	p.Q505R	PUM2_ENST00000536417.1_Missense_Mutation_p.Q449R|PUM2_ENST00000319801.5_Missense_Mutation_p.Q505R|PUM2_ENST00000403432.1_Missense_Mutation_p.Q505R|PUM2_ENST00000338086.5_Missense_Mutation_p.Q505R			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	505					regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGTGGTGGCTGAGTGCCAAT	0.453																																					p.Q505R		Atlas-SNP	.											.	PUM2	91	.	0			c.A1514G						PASS	.						71.0	75.0	73.0					2																	20482914		2203	4300	6503	SO:0001583	missense	23369	exon11			GGTGGCTGAGTGC	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.1514A>G	chr2.hg19:g.20482914T>C	ENSP00000354370:p.Gln505Arg	59.0	0.0	.		61.0	10.0	.	NM_015317	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	hg19		.	.	.	.	.	.	.	.	.	.	T	15.48	2.844781	0.51164	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	T;T;T;T;T;T	0.19532	2.17;2.45;2.4;2.14;2.17;2.16	6.03	4.81	0.61882	.	0.059994	0.64402	D	0.000002	T	0.33818	0.0876	L	0.43923	1.385	0.51012	D	0.999907	B;D;B	0.54601	0.005;0.967;0.016	B;D;B	0.65140	0.008;0.932;0.017	T	0.01557	-1.1325	10	0.26408	T	0.33	-4.0585	13.0341	0.58860	0.0:0.0:0.1341:0.8659	.	449;505;505	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	R	505;505;505;396;505;449	ENSP00000338173:Q505R;ENSP00000354370:Q505R;ENSP00000326746:Q505R;ENSP00000409905:Q396R;ENSP00000385992:Q505R;ENSP00000440093:Q449R	ENSP00000326746:Q505R	Q	-	2	0	PUM2	20346395	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.965000	0.49200	2.313000	0.78055	0.454000	0.30748	CAG	.	.	.	none		0.453	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	
CIB4	130106	hgsc.bcm.edu	37	2	26805731	26805731	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr2:26805731C>G	ENST00000288861.4	-	6	542	c.489G>C	c.(487-489)gaG>gaC	p.E163D	CIB4_ENST00000405346.3_5'UTR	NM_001029881.1	NP_001025052.1	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	163	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATGTTCAAACTCTGAGAAGG	0.547																																					p.E163D		Atlas-SNP	.											.	CIB4	15	.	0			c.G489C						PASS	.						144.0	110.0	121.0					2																	26805731		2203	4300	6503	SO:0001583	missense	130106	exon6			TTCAAACTCTGAG		CCDS33160.1	2p23.3	2013-01-10			ENSG00000157884	ENSG00000157884		"""EF-hand domain containing"""	33703	protein-coding gene	gene with protein product		610646				15574431	Standard	NM_001029881		Approved		uc002rhm.3	A0PJX0	OTTHUMG00000151993	ENST00000288861.4:c.489G>C	chr2.hg19:g.26805731C>G	ENSP00000288861:p.Glu163Asp	88.0	0.0	.		69.0	18.0	.	NM_001029881	B2RU18	Missense_Mutation	SNP	ENST00000288861.4	hg19	CCDS33160.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.479953	0.63849	.	.	ENSG00000157884	ENST00000288861;ENST00000403670;ENST00000405346	D	0.84370	-1.84	5.29	5.29	0.74685	EF-hand-like domain (1);	0.000000	0.64402	D	0.000013	D	0.90484	0.7019	M	0.69248	2.105	0.44366	D	0.997261	D	0.63880	0.993	D	0.72982	0.979	D	0.88822	0.3299	10	0.31617	T	0.26	.	14.503	0.67734	0.0:1.0:0.0:0.0	.	163	A0PJX0	CIB4_HUMAN	D	163;118;165	ENSP00000288861:E163D	ENSP00000288861:E163D	E	-	3	2	CIB4	26659235	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.684000	0.37649	2.491000	0.84063	0.650000	0.86243	GAG	.	.	.	none		0.547	CIB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324709.1		
SNX17	9784	hgsc.bcm.edu	37	2	27596784	27596784	+	Silent	SNP	G	G	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr2:27596784G>C	ENST00000233575.2	+	5	600	c.378G>C	c.(376-378)ggG>ggC	p.G126G	SNX17_ENST00000537606.1_Silent_p.G101G|SNX17_ENST00000542478.1_5'UTR|SNX17_ENST00000543024.1_5'UTR	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	126	FERM-like.|Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAGCAACGGGCAGAAAGTTC	0.562																																					p.G126G		Atlas-SNP	.											.	SNX17	40	.	0			c.G378C						PASS	.						127.0	108.0	114.0					2																	27596784		2203	4300	6503	SO:0001819	synonymous_variant	9784	exon5			CAACGGGCAGAAA	D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.378G>C	chr2.hg19:g.27596784G>C		118.0	0.0	.		72.0	22.0	.	NM_014748	B4DQM7|Q53HN7|Q6IAS3	Silent	SNP	ENST00000233575.2	hg19	CCDS1750.1																																																																																			.	.	.	none		0.562	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215024.1	NM_014748	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125320891	125320891	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr2:125320891T>A	ENST00000431078.1	+	11	2108	c.1744T>A	c.(1744-1746)Tgc>Agc	p.C582S		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	582	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGGTGCCACCTGCCACAACTG	0.483																																					p.C582S		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.T1744A						PASS	.						36.0	39.0	38.0					2																	125320891		1938	4153	6091	SO:0001583	missense	129684	exon11			GCCACCTGCCACA	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1744T>A	chr2.hg19:g.125320891T>A	ENSP00000399013:p.Cys582Ser	45.0	0.0	.		58.0	20.0	.	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.851039	0.91277	.	.	ENSG00000155052	ENST00000431078	D	0.84730	-1.89	6.07	6.07	0.98685	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (2);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.53938	D	0.000043	D	0.96037	0.8709	H	0.99435	4.565	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.97784	1.0234	10	0.72032	D	0.01	.	15.4647	0.75390	0.0:0.0:0.0:1.0	.	582	Q8WYK1	CNTP5_HUMAN	S	582	ENSP00000399013:C582S	ENSP00000399013:C582S	C	+	1	0	CNTNAP5	125037361	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.316000	0.79007	2.326000	0.78906	0.533000	0.62120	TGC	.	.	.	none		0.483	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
UBR3	130507	hgsc.bcm.edu	37	2	170871867	170871867	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr2:170871867T>C	ENST00000272793.5	+	30	4494	c.4444T>C	c.(4444-4446)Tct>Cct	p.S1482P	UBR3_ENST00000392631.1_Missense_Mutation_p.S303P|UBR3_ENST00000465630.1_3'UTR|UBR3_ENST00000418381.1_Missense_Mutation_p.S1482P			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1482					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						TGGCAAAAGGTCTTGTTTAAG	0.318																																					p.S1482P		Atlas-SNP	.											.	UBR3	182	.	0			c.T4444C						PASS	.						80.0	83.0	82.0					2																	170871867		2203	4300	6503	SO:0001583	missense	130507	exon30			AAAAGGTCTTGTT	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.4444T>C	chr2.hg19:g.170871867T>C	ENSP00000272793:p.Ser1482Pro	73.0	0.0	.		44.0	16.0	.	NM_172070	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	hg19		.	.	.	.	.	.	.	.	.	.	T	21.0	4.083095	0.76642	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.78710	0.4326	L	0.59436	1.845	0.48452	D	0.999656	D;D;D	0.76494	0.998;0.999;0.995	D;D;D	0.80764	0.986;0.994;0.979	T	0.76906	-0.2786	10	0.35671	T	0.21	.	16.05	0.80749	0.0:0.0:0.0:1.0	.	1482;303;1482	Q6ZT12;Q6ZT12-2;E7EVK3	UBR3_HUMAN;.;.	P	1482;1482;1482;303;153	ENSP00000272793:S1482P;ENSP00000396068:S1482P;ENSP00000376408:S303P;ENSP00000389097:S153P	ENSP00000272793:S1482P	S	+	1	0	UBR3	170580113	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	7.353000	0.79414	2.263000	0.75096	0.533000	0.62120	TCT	.	.	.	none		0.318	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070	
CFLAR	8837	hgsc.bcm.edu	37	2	202025647	202025647	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr2:202025647A>G	ENST00000309955.3	+	9	1801	c.1286A>G	c.(1285-1287)cAg>cGg	p.Q429R	CFLAR_ENST00000479953.2_Missense_Mutation_p.Q333R|CFLAR_ENST00000423241.2_Missense_Mutation_p.Q429R|CFLAR_ENST00000457277.1_Missense_Mutation_p.Q429R|CFLAR_ENST00000341582.6_Missense_Mutation_p.Q394R|CFLAR_ENST00000340870.5_Missense_Mutation_p.Q429R|CFLAR_ENST00000443227.1_Missense_Mutation_p.Q333R|CFLAR_ENST00000355558.4_Intron	NM_001202515.1|NM_003879.5	NP_001189444.1|NP_003870.4	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator	429	Interaction with TRAF1 and TRAF2.|Interaction with caspase-3.|Interaction with caspase-8 subunits p18 and p10.|Interaction with caspase-8.|Not proteolytically processed and involved in apoptosis inhibition.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of myoblast fusion (GO:1901740)|positive regulation of catalytic activity (GO:0043085)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of necroptotic process (GO:0060544)|regulation of satellite cell proliferation (GO:0014842)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|skeletal myofibril assembly (GO:0014866)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|ripoptosome (GO:0097342)	cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|enzyme activator activity (GO:0008047)|protease binding (GO:0002020)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|stomach(1)	13						TGCCTCTCCCAGAAACTGAGA	0.557																																					p.Q429R	Pancreas(16;548 657 22190 32864 42338)	Atlas-SNP	.											.	CFLAR	37	.	0			c.A1286G						PASS	.						38.0	36.0	37.0					2																	202025647		2203	4300	6503	SO:0001583	missense	8837	exon9			TCTCCCAGAAACT	AF005774	CCDS2337.1, CCDS46487.1, CCDS56157.1, CCDS56158.1, CCDS59436.1	2q33-q34	2014-01-30			ENSG00000003402	ENSG00000003402		"""Endogenous ligands"""	1876	protein-coding gene	gene with protein product		603599		CASP8AP1		9208847, 9217161	Standard	NM_003879		Approved	CASH, Casper, CLARP, FLAME, FLIP, I-FLICE, MRIT, c-FLIP	uc002uxb.4	O15519	OTTHUMG00000132819	ENST00000309955.3:c.1286A>G	chr2.hg19:g.202025647A>G	ENSP00000312455:p.Gln429Arg	66.0	0.0	.		72.0	20.0	.	NM_003879	B4DJE0|B7Z9F9|O14673|O14674|O14675|O15137|O15138|O15356|O15510|O43618|O43619|O43620|O60458|O60459|Q53TS6|Q54AF1|Q96TE4|Q9UEW1	Missense_Mutation	SNP	ENST00000309955.3	hg19	CCDS2337.1	.	.	.	.	.	.	.	.	.	.	A	19.35	3.809868	0.70797	.	.	ENSG00000003402	ENST00000309955;ENST00000443227;ENST00000340870;ENST00000343375;ENST00000341582;ENST00000423241;ENST00000457277	T;T;T;T;T;T	0.03065	4.06;4.06;4.06;4.06;4.06;4.06	5.61	5.61	0.85477	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);	0.249814	0.40144	N	0.001170	T	0.14527	0.0351	M	0.69248	2.105	0.35533	D	0.802442	D;D;D;D	0.76494	0.963;0.99;0.997;0.999	P;P;D;D	0.70227	0.846;0.856;0.918;0.968	T	0.08411	-1.0723	10	0.41790	T	0.15	-21.5966	12.3315	0.55041	0.859:0.141:0.0:0.0	.	333;429;394;429	O15519-3;O15519-11;O15519-8;O15519	.;.;.;CFLAR_HUMAN	R	429;333;429;315;394;429;429	ENSP00000312455:Q429R;ENSP00000413270:Q333R;ENSP00000339326:Q429R;ENSP00000345807:Q394R;ENSP00000399420:Q429R;ENSP00000411535:Q429R	ENSP00000312455:Q429R	Q	+	2	0	CFLAR	201733892	1.000000	0.71417	0.999000	0.59377	0.875000	0.50365	4.249000	0.58766	2.135000	0.66039	0.454000	0.30748	CAG	.	.	.	none		0.557	CFLAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256276.3	NM_003879	
CARF	79800	hgsc.bcm.edu	37	2	203817333	203817333	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr2:203817333C>T	ENST00000402905.3	+	5	679	c.358C>T	c.(358-360)Cct>Tct	p.P120S	CARF_ENST00000428585.1_Missense_Mutation_p.P44S|CARF_ENST00000414439.1_Missense_Mutation_p.P18S|CARF_ENST00000434998.1_Missense_Mutation_p.P18S|CARF_ENST00000320443.8_Missense_Mutation_p.P120S|WDR12_ENST00000477723.1_Intron|CARF_ENST00000545262.1_Missense_Mutation_p.P44S|CARF_ENST00000456821.2_Missense_Mutation_p.P108S|CARF_ENST00000444724.1_Missense_Mutation_p.P120S|CARF_ENST00000438828.2_Missense_Mutation_p.P120S|CARF_ENST00000471271.1_3'UTR|CARF_ENST00000545253.1_Missense_Mutation_p.P32S	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	120					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGTAATTCCACCTACCCAGAC	0.433																																					p.P120S		Atlas-SNP	.											.	ALS2CR8	56	.	0			c.C358T						PASS	.						135.0	124.0	127.0					2																	203817333		1865	4114	5979	SO:0001583	missense	79800	exon6			ATTCCACCTACCC	AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.358C>T	chr2.hg19:g.203817333C>T	ENSP00000384006:p.Pro120Ser	94.0	0.0	.		89.0	23.0	.	NM_024744	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	ENST00000402905.3	hg19	CCDS42801.1	.	.	.	.	.	.	.	.	.	.	C	2.275	-0.366143	0.05069	.	.	ENSG00000138380	ENST00000402905;ENST00000431787;ENST00000444724;ENST00000414857;ENST00000414439;ENST00000428585;ENST00000545253;ENST00000545262;ENST00000447539;ENST00000456821;ENST00000434998;ENST00000320443;ENST00000438828	.	.	.	5.24	-0.0813	0.13703	.	0.079962	0.50627	N	0.000102	T	0.03053	0.0090	N	0.00128	-2.045	0.21184	N	0.999761	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.36841	-0.9731	9	0.02654	T	1	-0.7081	2.635	0.04955	0.2506:0.0707:0.1307:0.5481	.	32;44;120;120;120	B4DIA7;G3V1K7;B4DRP6;Q8N187;F6SXV3	.;.;.;AL2S8_HUMAN;.	S	120;90;120;120;18;44;32;44;44;108;18;120;120	.	ENSP00000316224:P120S	P	+	1	0	ALS2CR8	203525578	1.000000	0.71417	0.987000	0.45799	0.917000	0.54804	1.699000	0.37804	-0.235000	0.09767	-1.728000	0.00702	CCT	.	.	.	none		0.433	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	chr2.hg19:g.241696843C>A		78.0	0.0	.		127.0	16.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	hg19	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
RAF1	5894	hgsc.bcm.edu	37	3	12650333	12650333	+	Missense_Mutation	SNP	T	T	A	rs561163045		TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr3:12650333T>A	ENST00000251849.4	-	5	952	c.513A>T	c.(511-513)aaA>aaT	p.K171N	RAF1_ENST00000442415.2_Missense_Mutation_p.K171N|RAF1_ENST00000542177.1_Missense_Mutation_p.K90N|RAF1_ENST00000534997.1_5'UTR	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	171					activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	GCTCATGAAATTTGTAGCCAC	0.428			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.K171N		Atlas-SNP	.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	.	RAF1	66	.	0			c.A513T						PASS	.						137.0	122.0	127.0					3																	12650333		2203	4300	6503	SO:0001583	missense	5894	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	ATGAAATTTGTAG	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.513A>T	chr3.hg19:g.12650333T>A	ENSP00000251849:p.Lys171Asn	136.0	0.0	.		131.0	38.0	.	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	hg19	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	T	19.80	3.894506	0.72639	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000542177	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	5.52	1.27	0.21489	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.100276	0.64402	D	0.000003	T	0.80844	0.4701	N	0.14661	0.345	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.80764	0.994;0.984	T	0.79813	-0.1645	10	0.87932	D	0	.	9.4339	0.38626	0.0:0.3375:0.0:0.6625	.	90;171	B4E0X2;P04049	.;RAF1_HUMAN	N	171;171;83;90	ENSP00000251849:K171N;ENSP00000401888:K171N;ENSP00000398591:K83N;ENSP00000443567:K90N	ENSP00000251849:K171N	K	-	3	2	RAF1	12625333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.110000	0.31147	0.354000	0.24105	0.460000	0.39030	AAA	.	.	.	none		0.428	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
ZDHHC23	254887	hgsc.bcm.edu	37	3	113673053	113673053	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr3:113673053G>C	ENST00000330212.3	+	3	967	c.668G>C	c.(667-669)gGg>gCg	p.G223A	ZDHHC23_ENST00000498275.1_Missense_Mutation_p.G217A	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	223					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						AAGACCAAAGGGTTCCCTGGG	0.562																																					p.G223A		Atlas-SNP	.											.	ZDHHC23	38	.	0			c.G668C						PASS	.						95.0	97.0	97.0					3																	113673053		2203	4300	6503	SO:0001583	missense	254887	exon3			CCAAAGGGTTCCC	AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.668G>C	chr3.hg19:g.113673053G>C	ENSP00000330485:p.Gly223Ala	153.0	0.0	.		199.0	43.0	.	NM_173570	D3DN76	Missense_Mutation	SNP	ENST00000330212.3	hg19	CCDS33827.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.491910	0.26774	.	.	ENSG00000184307	ENST00000330212;ENST00000498275	T;T	0.41400	1.0;1.01	5.64	3.81	0.43845	.	0.364534	0.32687	N	0.005764	T	0.44582	0.1300	L	0.48642	1.525	0.19300	N	0.99997	P	0.52463	0.953	P	0.52454	0.699	T	0.24548	-1.0157	10	0.29301	T	0.29	-14.6686	10.8169	0.46583	0.0706:0.1325:0.7969:0.0	.	223	Q8IYP9	ZDH23_HUMAN	A	223;217	ENSP00000330485:G223A;ENSP00000417840:G217A	ENSP00000330485:G223A	G	+	2	0	ZDHHC23	115155743	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	3.650000	0.54424	1.352000	0.45808	0.561000	0.74099	GGG	.	.	.	none		0.562	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354702.1	NM_173570	
RAB6B	51560	hgsc.bcm.edu	37	3	133557104	133557104	+	Splice_Site	SNP	C	C	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr3:133557104C>T	ENST00000285208.4	-	6	751		c.e6-1		RAB6B_ENST00000543906.1_Splice_Site|RAB6B_ENST00000469959.1_Intron|RAB6B_ENST00000486858.1_Splice_Site	NM_016577.3	NP_057661.3	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family						GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	11						GGTTATCTGCCTAGAGATGAG	0.592																																					.		Atlas-SNP	.											.	RAB6B	36	.	0			c.402-1G>A						PASS	.						112.0	105.0	107.0					3																	133557104		2203	4300	6503	SO:0001630	splice_region_variant	51560	exon7			ATCTGCCTAGAGA	AF166492	CCDS3082.1	3q22.1	2008-05-15			ENSG00000154917	ENSG00000154917		"""RAB, member RAS oncogene"""	14902	protein-coding gene	gene with protein product		615852					Standard	NM_016577		Approved		uc003epy.3	Q9NRW1	OTTHUMG00000159749	ENST00000285208.4:c.402-1G>A	chr3.hg19:g.133557104C>T		42.0	0.0	.		54.0	18.0	.	NM_016577	B2R5Z9|B7Z337|D3DND3|Q92929	Splice_Site	SNP	ENST00000285208.4	hg19	CCDS3082.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.724693	0.68959	.	.	ENSG00000154917	ENST00000285208;ENST00000543906;ENST00000486858;ENST00000477759;ENST00000460865	.	.	.	4.64	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9471	0.52934	0.1739:0.8261:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RAB6B	135039794	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.013000	0.76373	2.573000	0.86826	0.655000	0.94253	.	.	.	.	none		0.592	RAB6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357152.1		Intron
MUC4	4585	hgsc.bcm.edu	37	3	195511396	195511396	+	Missense_Mutation	SNP	G	G	T	rs201453005	byFrequency	TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr3:195511396G>T	ENST00000463781.3	-	2	7514	c.7055C>A	c.(7054-7056)cCt>cAt	p.P2352H	MUC4_ENST00000475231.1_Missense_Mutation_p.P2352H|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P2352H(2)|p.P2352L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACATGAAGAGGGGTGGCGTG	0.582																																					p.P2352H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	.	3	Substitution - Missense(3)	kidney(2)|endometrium(1)	c.C7055A						PASS	.						16.0	14.0	14.0					3																	195511396		674	1562	2236	SO:0001583	missense	4585	exon2			TGAAGAGGGGTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7055C>A	chr3.hg19:g.195511396G>T	ENSP00000417498:p.Pro2352His	83.0	0.0	.		113.0	7.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	4.104	0.017349	0.07959	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.48;1.48	.	.	.	.	.	.	.	.	T	0.08935	0.0221	N	0.02539	-0.55	0.09310	N	1	P	0.50156	0.932	B	0.37943	0.261	T	0.06625	-1.0816	7	.	.	.	.	2.9304	0.05797	0.3911:0.0:0.6089:0.0	.	2352	E7ESK3	.	H	2352	ENSP00000417498:P2352H;ENSP00000420243:P2352H	.	P	-	2	0	MUC4	196995791	0.028000	0.19301	0.005000	0.12908	0.064000	0.16182	1.205000	0.32308	0.488000	0.27723	0.064000	0.15345	CCT	.	G|0.991;A|0.008	.	alt		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
RNF212	285498	hgsc.bcm.edu	37	4	1066753	1066753	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr4:1066753T>A	ENST00000433731.2	-	10	864	c.803A>T	c.(802-804)cAg>cTg	p.Q268L	RNF212_ENST00000382968.5_3'UTR			Q495C1	RN212_HUMAN	ring finger protein 212	268					chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CTCAGCCTGCTGGAACGGAAA	0.478											OREG0016028	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q268L		Atlas-SNP	.											.	RNF212	69	.	0			c.A803T						PASS	.						87.0	90.0	89.0					4																	1066753		2203	4300	6503	SO:0001583	missense	285498	exon10			GCCTGCTGGAACG	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.803A>T	chr4.hg19:g.1066753T>A	ENSP00000389709:p.Gln268Leu	198.0	0.0	.	593	190.0	44.0	.	NM_001131034	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	Missense_Mutation	SNP	ENST00000433731.2	hg19	CCDS46996.1	.	.	.	.	.	.	.	.	.	.	T	7.107	0.575269	0.13623	.	.	ENSG00000178222	ENST00000433731	T	0.51071	0.72	1.17	-2.34	0.06704	.	.	.	.	.	T	0.19485	0.0468	N	0.08118	0	0.09310	N	0.999999	P	0.34977	0.478	B	0.26614	0.071	T	0.08868	-1.0701	9	0.87932	D	0	.	3.1593	0.06515	0.0:0.231:0.4453:0.3237	.	268	Q495C1	RN212_HUMAN	L	268	ENSP00000389709:Q268L	ENSP00000389709:Q268L	Q	-	2	0	RNF212	1056753	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	-0.798000	0.04565	-1.036000	0.03287	-0.331000	0.08364	CAG	.	.	.	none		0.478	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359124.2	NM_194439	
MTTP	4547	hgsc.bcm.edu	37	4	100534106	100534106	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr4:100534106G>A	ENST00000265517.5	+	15	2229	c.2026G>A	c.(2026-2028)Gca>Aca	p.A676T	MTTP_ENST00000457717.1_Missense_Mutation_p.A676T|MTTP_ENST00000511045.1_Missense_Mutation_p.A703T|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	676					cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)	p.A676T(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	AGCCTTAATCGCAGCCACCCC	0.483																																					p.A676T		Atlas-SNP	.											MTTP,rectum,carcinoma,0,1	MTTP	127	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2026A						PASS	.						136.0	134.0	135.0					4																	100534106		2203	4300	6503	SO:0001583	missense	4547	exon16			TTAATCGCAGCCA		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.2026G>A	chr4.hg19:g.100534106G>A	ENSP00000265517:p.Ala676Thr	41.0	0.0	.		49.0	2.0	.	NM_000253	A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	ENST00000265517.5	hg19	CCDS3651.1	.	.	.	.	.	.	.	.	.	.	G	36	5.669852	0.96754	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	T;T;T	0.64991	-0.13;-0.1;-0.1	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.76751	0.4031	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.914;0.996	T	0.70000	-0.4992	10	0.18276	T	0.48	-15.6636	19.7133	0.96105	0.0:0.0:1.0:0.0	.	703;676	E9PBP6;P55157	.;MTP_HUMAN	T	703;676;676	ENSP00000427679:A703T;ENSP00000400821:A676T;ENSP00000265517:A676T	ENSP00000265517:A676T	A	+	1	0	MTTP	100753129	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.307000	0.96226	2.659000	0.90383	0.650000	0.86243	GCA	.	.	.	none		0.483	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3		
PDCD6	10016	hgsc.bcm.edu	37	5	306756	306756	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr5:306756G>C	ENST00000264933.4	+	4	348	c.248G>C	c.(247-249)aGc>aCc	p.S83T	AHRR_ENST00000316418.5_Intron|AHRR_ENST00000505113.1_Intron|PDCD6_ENST00000507528.1_Missense_Mutation_p.S83T|AHRR_ENST00000512529.1_Intron|PDCD6_ENST00000505221.1_Intron	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	83	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			GTGAACTTCAGCGAGTTCACG	0.537																																					p.S83T		Atlas-SNP	.											.	PDCD6	24	.	0			c.G248C						PASS	.						95.0	79.0	84.0					5																	306756		2203	4300	6503	SO:0001583	missense	10016	exon4			ACTTCAGCGAGTT	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.248G>C	chr5.hg19:g.306756G>C	ENSP00000264933:p.Ser83Thr	76.0	0.0	.		77.0	19.0	.	NM_013232	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000264933.4	hg19	CCDS3854.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	5.045|5.045	0.193946|0.193946	0.09599|0.09599	.|.	.|.	ENSG00000249915|ENSG00000249915	ENST00000502359|ENST00000264933;ENST00000507528	.|T;T	.|0.78481	.|-1.18;-1.18	5.53|5.53	3.75|3.75	0.43078|0.43078	.|EF-hand-like domain (1);	.|.	.|.	.|.	.|.	T|T	0.57873|0.57873	0.2083|0.2083	N|N	0.16567|0.16567	0.415|0.415	0.80722|0.80722	D|D	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.06405	.|0.002;0.002	T|T	0.43956|0.43956	-0.9359|-0.9359	5|9	.|0.21014	.|T	.|0.42	.|.	6.1331|6.1331	0.20217|0.20217	0.1641:0.1548:0.6811:0.0|0.1641:0.1548:0.6811:0.0	.|.	.|83;83	.|Q2YDC2;O75340	.|.;PDCD6_HUMAN	P|T	14|83	.|ENSP00000264933:S83T;ENSP00000423815:S83T	.|ENSP00000264933:S83T	A|S	+|+	1|2	0|0	PDCD6|PDCD6	359756|359756	0.978000|0.978000	0.34361|0.34361	0.971000|0.971000	0.41717|0.41717	0.011000|0.011000	0.07611|0.07611	2.062000|2.062000	0.41413|0.41413	0.703000|0.703000	0.31848|0.31848	-0.127000|-0.127000	0.14921|0.14921	GCG|AGC	.	.	.	none		0.537	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
FASTKD3	79072	hgsc.bcm.edu	37	5	7867443	7867443	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr5:7867443T>C	ENST00000264669.5	-	2	890	c.754A>G	c.(754-756)Acc>Gcc	p.T252A	FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000440940.2_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	252					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TCCTCCGGGGTAAATGTTTCC	0.363																																					p.T252A		Atlas-SNP	.											.	FASTKD3	88	.	0			c.A754G						PASS	.						79.0	84.0	82.0					5																	7867443		2202	4300	6502	SO:0001583	missense	79072	exon2			CCGGGGTAAATGT	AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.754A>G	chr5.hg19:g.7867443T>C	ENSP00000264669:p.Thr252Ala	36.0	0.0	.		43.0	13.0	.	NM_024091	Q9BVD3	Missense_Mutation	SNP	ENST00000264669.5	hg19	CCDS3873.1	.	.	.	.	.	.	.	.	.	.	T	9.962	1.223021	0.22457	.	.	ENSG00000124279	ENST00000264669	T	0.23552	1.9	4.85	-3.71	0.04424	.	0.721105	0.14271	N	0.330147	T	0.09423	0.0232	N	0.13235	0.315	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.38112	-0.9676	10	0.07482	T	0.82	-1.8934	6.0475	0.19768	0.1224:0.3502:0.0:0.5273	.	252	Q14CZ7	FAKD3_HUMAN	A	252	ENSP00000264669:T252A	ENSP00000264669:T252A	T	-	1	0	FASTKD3	7920443	0.617000	0.27043	0.000000	0.03702	0.742000	0.42306	0.512000	0.22755	-0.538000	0.06281	0.528000	0.53228	ACC	.	.	.	none		0.363	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091	
FYB	2533	hgsc.bcm.edu	37	5	39153579	39153579	+	Silent	SNP	G	G	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr5:39153579G>T	ENST00000351578.6	-	3	1453	c.1263C>A	c.(1261-1263)ccC>ccA	p.P421P	FYB_ENST00000505428.1_Silent_p.P421P|FYB_ENST00000515010.1_Silent_p.P421P|FYB_ENST00000512982.1_Silent_p.P421P|FYB_ENST00000540520.1_Silent_p.P431P	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	421	Interaction with SKAP1.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			TAATGTTTCTGGGAGGTAGGC	0.488																																					p.P431P		Atlas-SNP	.											.	FYB	354	.	0			c.C1293A						PASS	.						291.0	298.0	296.0					5																	39153579		2025	4174	6199	SO:0001819	synonymous_variant	2533	exon3			GTTTCTGGGAGGT	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1263C>A	chr5.hg19:g.39153579G>T		156.0	0.0	.		192.0	55.0	.	NM_001243093	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Silent	SNP	ENST00000351578.6	hg19	CCDS47200.1																																																																																			.	.	.	none		0.488	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465	
GNB2L1	10399	hgsc.bcm.edu	37	5	180670768	180670768	+	Silent	SNP	G	G	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr5:180670768G>C	ENST00000512805.1	-	1	441	c.33C>G	c.(31-33)ctC>ctG	p.L11L	SNORD95_ENST00000579879.1_RNA|GNB2L1_ENST00000456394.2_Silent_p.L11L|SNORD96A_ENST00000606577.1_RNA|GNB2L1_ENST00000376817.4_Silent_p.L11L|GNB2L1_ENST00000505461.1_5'UTR|GNB2L1_ENST00000504726.1_Silent_p.L11L|CTC-338M12.4_ENST00000506340.1_RNA|CTC-338M12.4_ENST00000511331.1_RNA|GNB2L1_ENST00000511566.1_Silent_p.L11L|GNB2L1_ENST00000511900.1_Silent_p.L11L	NM_006098.4	NP_006089.1	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	11					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cell cycle (GO:0007049)|gastrulation (GO:0007369)|negative regulation of cell growth (GO:0030308)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of translation (GO:0017148)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of cell migration (GO:0030335)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of gastrulation (GO:2000543)|positive regulation of GTPase activity (GO:0043547)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein phosphorylation (GO:0001934)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein localization (GO:0032880)|rhythmic process (GO:0048511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|phagocytic cup (GO:0001891)|small ribosomal subunit (GO:0015935)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|ion channel inhibitor activity (GO:0008200)|poly(A) RNA binding (GO:0044822)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase inhibitor activity (GO:0030292)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)			lung(3)|skin(2)	5	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		TGTGGCCCTTGAGGGTGCCAC	0.597																																					p.L11L		Atlas-SNP	.											.	GNB2L1	22	.	0			c.C33G						PASS	.						107.0	78.0	88.0					5																	180670768		2203	4300	6503	SO:0001819	synonymous_variant	10399	exon1			GCCCTTGAGGGTG	M24194	CCDS34324.1	5q35.3	2013-01-10				ENSG00000204628		"""WD repeat domain containing"""	4399	protein-coding gene	gene with protein product	"""Receptor for Activated C Kinase 1"""	176981				8302854, 2499885	Standard	NM_006098		Approved	Gnb2-rs1, RACK1, H12.3	uc003mni.1	P63244		ENST00000512805.1:c.33C>G	chr5.hg19:g.180670768G>C		88.0	0.0	.		88.0	24.0	.	NM_006098	B3KTJ0|D3DWS0|P25388|P99049|Q53HU2|Q5J8M6|Q5VLR4|Q6FH47	Silent	SNP	ENST00000512805.1	hg19	CCDS34324.1																																																																																			.	.	.	none		0.597	GNB2L1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372943.2	NM_006098	
ATXN1	6310	hgsc.bcm.edu	37	6	16328017	16328017	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr6:16328017C>G	ENST00000244769.4	-	8	1461	c.525G>C	c.(523-525)gaG>gaC	p.E175D	ATXN1_ENST00000436367.1_Missense_Mutation_p.E175D	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	175					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				TGGAATAGGCCTCCAGCTGGG	0.662																																					p.E175D		Atlas-SNP	.											.	ATXN1	117	.	0			c.G525C						PASS	.						33.0	37.0	36.0					6																	16328017		2195	4282	6477	SO:0001583	missense	6310	exon7			ATAGGCCTCCAGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.525G>C	chr6.hg19:g.16328017C>G	ENSP00000244769:p.Glu175Asp	34.0	0.0	.		34.0	9.0	.	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	hg19	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.169241	0.57584	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.50277	0.75;0.75	5.26	3.47	0.39725	.	0.105649	0.64402	D	0.000007	T	0.23249	0.0562	M	0.63843	1.955	0.42281	D	0.992091	B	0.25441	0.126	B	0.16289	0.015	T	0.08229	-1.0732	10	0.16420	T	0.52	-30.305	11.2182	0.48838	0.0:0.8513:0.0:0.1487	.	175	P54253	ATX1_HUMAN	D	175	ENSP00000244769:E175D;ENSP00000416360:E175D	ENSP00000244769:E175D	E	-	3	2	ATXN1	16435996	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.505000	0.45424	1.211000	0.43351	0.467000	0.42956	GAG	.	.	.	none		0.662	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
C6orf222	389384	hgsc.bcm.edu	37	6	36291122	36291122	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr6:36291122G>C	ENST00000437635.2	-	8	1596	c.1419C>G	c.(1417-1419)agC>agG	p.S473R		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	473										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						GGGGCAGAAAGCTGGGCCTCT	0.622																																					p.S473R		Atlas-SNP	.											.	C6orf222	72	.	0			c.C1419G						PASS	.						86.0	97.0	93.0					6																	36291122		2203	4300	6503	SO:0001583	missense	389384	exon8			CAGAAAGCTGGGC		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.1419C>G	chr6.hg19:g.36291122G>C	ENSP00000418983:p.Ser473Arg	51.0	0.0	.		61.0	15.0	.	NM_001010903	B2RTY8	Missense_Mutation	SNP	ENST00000437635.2	hg19	CCDS34439.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958254	0.53400	.	.	ENSG00000189325	ENST00000437635	T	0.55930	0.49	4.68	2.88	0.33553	.	0.339819	0.25964	N	0.027169	T	0.50188	0.1601	M	0.74258	2.255	0.26291	N	0.978125	D	0.57571	0.98	P	0.60068	0.868	T	0.38993	-0.9635	10	0.56958	D	0.05	-16.2355	6.0853	0.19964	0.2203:0.0:0.7797:0.0	.	473	P0C671	CF222_HUMAN	R	473	ENSP00000418983:S473R	ENSP00000418983:S473R	S	-	3	2	C6orf222	36399100	0.989000	0.36119	0.953000	0.39169	0.456000	0.32438	1.288000	0.33296	1.274000	0.44362	0.655000	0.94253	AGC	.	.	.	none		0.622	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903	
NFYA	4800	hgsc.bcm.edu	37	6	41051876	41051876	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr6:41051876G>A	ENST00000341376.6	+	4	455	c.254G>A	c.(253-255)gGa>gAa	p.G85E	NFYA_ENST00000353205.5_Missense_Mutation_p.G56E|OARD1_ENST00000480585.1_Intron	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	85	Gln-rich.				cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					GTCCCTGGTGGACAAGGTCAA	0.473																																					p.G85E		Atlas-SNP	.											.	NFYA	33	.	0			c.G254A						PASS	.						102.0	78.0	86.0					6																	41051876		2203	4300	6503	SO:0001583	missense	4800	exon4			CTGGTGGACAAGG		CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.254G>A	chr6.hg19:g.41051876G>A	ENSP00000345702:p.Gly85Glu	52.0	0.0	.		80.0	16.0	.	NM_002505	Q8IXU0	Missense_Mutation	SNP	ENST00000341376.6	hg19	CCDS4849.1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.888578	0.72524	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	5.76	4.89	0.63831	.	0.046056	0.85682	D	0.000000	T	0.44095	0.1277	L	0.55481	1.735	0.58432	D	0.999995	B;B	0.30236	0.274;0.057	B;B	0.18871	0.023;0.01	T	0.53809	-0.8386	9	0.72032	D	0.01	-8.7123	16.2087	0.82144	0.0:0.1331:0.8669:0.0	.	56;85	P23511-2;P23511	.;NFYA_HUMAN	E	85;56	.	ENSP00000345702:G85E	G	+	2	0	NFYA	41159854	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.792000	0.99085	1.552000	0.49463	0.650000	0.86243	GGA	.	.	.	none		0.473	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
HCRTR2	3062	hgsc.bcm.edu	37	6	55145137	55145137	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr6:55145137G>A	ENST00000370862.3	+	6	1336	c.1000G>A	c.(1000-1002)Gcc>Acc	p.A334T		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	334					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)	p.A334S(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TGGGATGTTTGCCCATACTGA	0.368																																					p.A334T		Atlas-SNP	.											HCRTR2,NS,carcinoma,0,1	HCRTR2	112	.	1	Substitution - Missense(1)	lung(1)	c.G1000A						PASS	.						216.0	207.0	210.0					6																	55145137		2203	4300	6503	SO:0001583	missense	3062	exon6			ATGTTTGCCCATA	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.1000G>A	chr6.hg19:g.55145137G>A	ENSP00000359899:p.Ala334Thr	85.0	0.0	.		82.0	24.0	.	NM_001526	Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	hg19	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	G	2.547	-0.304921	0.05495	.	.	ENSG00000137252	ENST00000370862	T	0.61392	0.11	5.62	-3.24	0.05094	GPCR, rhodopsin-like superfamily (1);	0.482845	0.24143	N	0.041156	T	0.12008	0.0292	N	0.05441	-0.05	0.09310	N	0.999991	B	0.02656	0.0	B	0.04013	0.001	T	0.39143	-0.9628	10	0.13108	T	0.6	.	12.8352	0.57770	0.6041:0.0:0.3959:0.0	.	334	O43614	OX2R_HUMAN	T	334	ENSP00000359899:A334T	ENSP00000359899:A334T	A	+	1	0	HCRTR2	55253096	0.385000	0.25172	0.674000	0.29902	0.116000	0.19942	0.901000	0.28445	-0.455000	0.07054	-0.385000	0.06624	GCC	.	.	.	none		0.368	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
SMAP1	60682	hgsc.bcm.edu	37	6	71508431	71508431	+	Silent	SNP	A	A	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr6:71508431A>G	ENST00000370455.3	+	6	815	c.567A>G	c.(565-567)acA>acG	p.T189T	SMAP1_ENST00000370452.3_Silent_p.T162T|SMAP1_ENST00000316999.5_Silent_p.T162T	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	189					positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						AACCACTTACAGCTGAAAAGG	0.274																																					p.T189T		Atlas-SNP	.											.	SMAP1	77	.	0			c.A567G						PASS	.						37.0	43.0	41.0					6																	71508431		2199	4290	6489	SO:0001819	synonymous_variant	60682	exon6			ACTTACAGCTGAA	AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.567A>G	chr6.hg19:g.71508431A>G		1050.0	0.0	.		1198.0	310.0	.	NM_001044305	Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Silent	SNP	ENST00000370455.3	hg19	CCDS43478.1	.	.	.	.	.	.	.	.	.	.	A	9.297	1.052127	0.19827	.	.	ENSG00000112305	ENST00000439432	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	T	0.48624	0.1510	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52358	-0.8586	4	.	.	.	-19.7696	8.9897	0.36017	0.9161:0.0:0.0839:0.0	.	.	.	.	G	64	.	.	S	+	1	0	SMAP1	71565152	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.702000	0.37836	2.126000	0.65437	0.529000	0.55759	AGC	.	.	.	none		0.274	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041149.1	NM_001044305	
SENP6	26054	hgsc.bcm.edu	37	6	76388567	76388567	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr6:76388567T>G	ENST00000447266.2	+	16	2477	c.1999T>G	c.(1999-2001)Tct>Gct	p.S667A	SENP6_ENST00000370010.2_Missense_Mutation_p.S660A|SENP6_ENST00000541192.1_Missense_Mutation_p.S263A|SENP6_ENST00000327284.8_Missense_Mutation_p.S660A|SENP6_ENST00000370014.3_Missense_Mutation_p.S667A	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	667	Protease.				protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				GGGAGGCATCTCTGTTACCAA	0.323																																					p.S667A		Atlas-SNP	.											.	SENP6	189	.	0			c.T1999G						PASS	.						76.0	74.0	75.0					6																	76388567		1851	4085	5936	SO:0001583	missense	26054	exon16			GGCATCTCTGTTA		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.1999T>G	chr6.hg19:g.76388567T>G	ENSP00000402527:p.Ser667Ala	152.0	0.0	.		165.0	35.0	.	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	hg19	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024669	0.54683	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000327284;ENST00000447266;ENST00000424947;ENST00000541192	T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.67	5.98	5.98	0.97165	.	0.099352	0.64402	D	0.000001	T	0.21881	0.0527	L	0.38838	1.175	0.50313	D	0.999867	B;B;P	0.51653	0.167;0.104;0.947	B;B;P	0.47528	0.127;0.059;0.549	T	0.01039	-1.1472	10	0.38643	T	0.18	-15.2821	16.4622	0.84064	0.0:0.0:0.0:1.0	.	660;667;660	Q9GZR1-2;Q9GZR1;F8W6D9	.;SENP6_HUMAN;.	A	660;667;660;667;557;263	ENSP00000359027:S660A;ENSP00000359031:S667A;ENSP00000321820:S660A;ENSP00000402527:S667A;ENSP00000391426:S557A;ENSP00000441715:S263A	ENSP00000321820:S660A	S	+	1	0	SENP6	76445287	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	4.735000	0.62051	2.289000	0.77006	0.533000	0.62120	TCT	.	.	.	none		0.323	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
SASH1	23328	hgsc.bcm.edu	37	6	148840743	148840743	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr6:148840743C>G	ENST00000367467.3	+	10	1398	c.923C>G	c.(922-924)tCt>tGt	p.S308C		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	308					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GCCCTCTACTCTGGCGTGCAC	0.552																																					p.S308C		Atlas-SNP	.											.	SASH1	123	.	0			c.C923G						PASS	.						80.0	82.0	81.0					6																	148840743		2203	4300	6503	SO:0001583	missense	23328	exon10			TCTACTCTGGCGT	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.923C>G	chr6.hg19:g.148840743C>G	ENSP00000356437:p.Ser308Cys	111.0	0.0	.		99.0	27.0	.	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	hg19	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136995	0.77775	.	.	ENSG00000111961	ENST00000367467;ENST00000535767	T	0.40476	1.03	5.43	5.43	0.79202	.	0.113799	0.64402	D	0.000008	T	0.42562	0.1208	L	0.27053	0.805	0.44798	D	0.997802	D;D	0.76494	0.999;0.999	P;D	0.64042	0.862;0.921	T	0.45527	-0.9255	10	0.72032	D	0.01	-8.9095	17.4215	0.87516	0.0:1.0:0.0:0.0	.	289;308	Q6P4R9;O94885	.;SASH1_HUMAN	C	308;69	ENSP00000356437:S308C	ENSP00000356437:S308C	S	+	2	0	SASH1	148882436	1.000000	0.71417	0.638000	0.29380	0.954000	0.61252	7.127000	0.77210	2.548000	0.85928	0.655000	0.94253	TCT	.	.	.	none		0.552	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
MEOX2	4223	hgsc.bcm.edu	37	7	15725797	15725797	+	Silent	SNP	A	A	G	rs113582077	byFrequency	TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr7:15725797A>G	ENST00000262041.5	-	1	640	c.231T>C	c.(229-231)caT>caC	p.H77H	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	77	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		gatggtggtgatggtggtggt	0.617																																					p.H77H	Esophageal Squamous(140;197 1769 16409 18257 29929)	Atlas-SNP	.											MEOX2,rectum,carcinoma,0,2	MEOX2	68	.	0			c.T231C						PASS	.						21.0	22.0	22.0					7																	15725797		2203	4300	6503	SO:0001819	synonymous_variant	4223	exon1			GTGGTGATGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.231T>C	chr7.hg19:g.15725797A>G		52.0	1.0	.		67.0	10.0	.	NM_005924	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	hg19	CCDS34605.1																																																																																			.	.	.	none		0.617	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
MEOX2	4223	hgsc.bcm.edu	37	7	15725800	15725800	+	Silent	SNP	G	G	A	rs113582077	byFrequency	TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr7:15725800G>A	ENST00000262041.5	-	1	637	c.228C>T	c.(226-228)caC>caT	p.H76H	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	76	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)	p.H80delH(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtggtgatggtggtggtggt	0.612																																					p.H76H	Esophageal Squamous(140;197 1769 16409 18257 29929)	Atlas-SNP	.											.	MEOX2	68	.	1	Deletion - In frame(1)	stomach(1)	c.C228T						PASS	.						11.0	13.0	13.0					7																	15725800		2192	4293	6485	SO:0001819	synonymous_variant	4223	exon1			GTGATGGTGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.228C>T	chr7.hg19:g.15725800G>A		13.0	0.0	.		34.0	11.0	.	NM_005924	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	hg19	CCDS34605.1																																																																																			.	.	.	none		0.612	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
COA1	55744	hgsc.bcm.edu	37	7	43679188	43679188	+	Missense_Mutation	SNP	T	T	C	rs537301566		TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr7:43679188T>C	ENST00000395879.1	-	5	2115	c.434A>G	c.(433-435)aAg>aGg	p.K145R	COA1_ENST00000395880.3_Missense_Mutation_p.K145R|COA1_ENST00000310564.6_Missense_Mutation_p.K145R|COA1_ENST00000223336.6_Missense_Mutation_p.K145R|COA1_ENST00000488813.1_5'UTR			Q9GZY4	COA1_HUMAN	cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae)	145					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)	cytoplasm (GO:0005737)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrion (GO:0005739)											TCTCTACTCCTTTTTCACTTC	0.517																																					p.K145R		Atlas-SNP	.											.	.	.	.	0			c.A434G						PASS	.						169.0	175.0	173.0					7																	43679188		2203	4300	6503	SO:0001583	missense	55744	exon6			TACTCCTTTTTCA	AK001665	CCDS5471.1	7p13	2012-12-05	2012-10-15	2012-06-25	ENSG00000106603	ENSG00000106603		"""Mitochondrial respiratory chain complex assembly factors"""	21868	protein-coding gene	gene with protein product		614769	"""chromosome 7 open reading frame 44"""	C7orf44		22356826	Standard	NM_018224		Approved	FLJ10803, MITRAC15	uc003tin.2	Q9GZY4	OTTHUMG00000128949	ENST00000395879.1:c.434A>G	chr7.hg19:g.43679188T>C	ENSP00000379218:p.Lys145Arg	74.0	0.0	.		114.0	5.0	.	NM_018224	A6NJU8|A8KAH8|Q9HAB7|Q9NVD2	Missense_Mutation	SNP	ENST00000395879.1	hg19	CCDS5471.1	.	.	.	.	.	.	.	.	.	.	T	10.24	1.295640	0.23564	.	.	ENSG00000106603	ENST00000395879;ENST00000310564;ENST00000395880;ENST00000223336	.	.	.	3.36	-0.562	0.11781	.	1.528020	0.03663	N	0.242820	T	0.26593	0.0650	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.19321	-1.0309	9	0.49607	T	0.09	0.2435	2.7004	0.05146	0.4087:0.1199:0.0:0.4714	.	145	Q9GZY4	CG044_HUMAN	R	145	.	ENSP00000223336:K145R	K	-	2	0	C7orf44	43645713	0.000000	0.05858	0.005000	0.12908	0.073000	0.16967	-0.710000	0.05024	-0.096000	0.12329	0.533000	0.62120	AAG	.	.	.	none		0.517	COA1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313664.1	NM_018224	
TFPI2	7980	hgsc.bcm.edu	37	7	93519981	93519981	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr7:93519981C>T	ENST00000222543.5	-	1	322	c.10G>A	c.(10-12)Gct>Act	p.A4T	TFPI2_ENST00000545378.1_Missense_Mutation_p.A4T|GNGT1_ENST00000455502.1_Intron|AC002076.10_ENST00000435257.1_RNA	NM_001271003.1|NM_001271004.1|NM_006528.3	NP_001257932.1|NP_001257933.1|NP_006519.1	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2	4					blood coagulation (GO:0007596)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(5)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			AGGGGGCGAGCGGGGTCCATG	0.701																																					p.A4T		Atlas-SNP	.											TFPI2,NS,carcinoma,0,1	TFPI2	37	.	0			c.G10A						PASS	.						18.0	23.0	22.0					7																	93519981		2155	4228	6383	SO:0001583	missense	7980	exon1			GGCGAGCGGGGTC	L27624	CCDS5632.1	7q	2008-07-18			ENSG00000105825	ENSG00000105825			11761	protein-coding gene	gene with protein product		600033				7896752, 8945635	Standard	NM_006528		Approved	PP5, TFPI-2, REF1	uc003umy.2	P48307	OTTHUMG00000022963	ENST00000222543.5:c.10G>A	chr7.hg19:g.93519981C>T	ENSP00000222543:p.Ala4Thr	163.0	0.0	.		206.0	94.0	.	NM_001271003	Q66ME8|Q8NAK6|Q9UC86	Missense_Mutation	SNP	ENST00000222543.5	hg19	CCDS5632.1	.	.	.	.	.	.	.	.	.	.	C	9.953	1.220665	0.22457	.	.	ENSG00000105825	ENST00000222543;ENST00000545378	T;T	0.55930	0.65;0.49	3.98	-3.56	0.04626	.	1.700580	0.02712	N	0.112974	T	0.29423	0.0733	N	0.17082	0.46	0.09310	N	1	B;B;B	0.11235	0.001;0.004;0.001	B;B;B	0.10450	0.001;0.005;0.001	T	0.22382	-1.0218	10	0.06365	T	0.9	.	4.5229	0.11968	0.2394:0.3512:0.0:0.4095	.	4;4;4	Q8NAK6;F5H3J8;P48307	.;.;TFPI2_HUMAN	T	4	ENSP00000222543:A4T;ENSP00000438861:A4T	ENSP00000222543:A4T	A	-	1	0	TFPI2	93357917	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.016000	0.00645	-1.242000	0.02523	-2.185000	0.00314	GCT	.	.	.	none		0.701	TFPI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254720.2	NM_006528	
HBP1	26959	hgsc.bcm.edu	37	7	106829794	106829794	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr7:106829794G>A	ENST00000222574.4	+	7	1009	c.823G>A	c.(823-825)Gag>Aag	p.E275K	HBP1_ENST00000461963.1_Intron|HBP1_ENST00000468410.1_Missense_Mutation_p.E275K|HBP1_ENST00000485846.1_Missense_Mutation_p.E275K	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	275	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						ATCATTTGGCGAGTCTGTACT	0.373																																					p.E285K		Atlas-SNP	.											.	HBP1	31	.	0			c.G853A						PASS	.						205.0	173.0	183.0					7																	106829794		2203	4300	6503	SO:0001583	missense	26959	exon7			TTTGGCGAGTCTG	BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.823G>A	chr7.hg19:g.106829794G>A	ENSP00000222574:p.Glu275Lys	88.0	0.0	.		129.0	60.0	.	NM_001244262	B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Missense_Mutation	SNP	ENST00000222574.4	hg19	CCDS5741.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707854	0.89018	.	.	ENSG00000105856	ENST00000468410;ENST00000222574;ENST00000485846;ENST00000498408	D;D;D	0.98978	-5.29;-5.29;-5.29	5.94	5.94	0.96194	Ataxin, AXH domain (1);Ataxin-1/HBP1 module (AXH) (3);	0.045424	0.85682	D	0.000000	D	0.97882	0.9304	L	0.38531	1.155	0.80722	D	1	P;P;B	0.51537	0.946;0.634;0.146	P;B;B	0.45681	0.49;0.121;0.055	D	0.98523	1.0624	10	0.72032	D	0.01	-5.9607	20.3736	0.98901	0.0:0.0:1.0:0.0	.	285;275;275	B4DJ36;O60381-3;O60381	.;.;HBP1_HUMAN	K	275;275;275;267	ENSP00000420500:E275K;ENSP00000222574:E275K;ENSP00000418738:E275K	ENSP00000222574:E275K	E	+	1	0	HBP1	106617030	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.748000	0.74877	2.820000	0.97059	0.650000	0.86243	GAG	.	.	.	none		0.373	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257	
TMEM176B	28959	hgsc.bcm.edu	37	7	150491072	150491072	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr7:150491072A>G	ENST00000447204.2	-	3	664	c.292T>C	c.(292-294)Tgt>Cgt	p.C98R	TMEM176B_ENST00000492607.1_Missense_Mutation_p.C98R|TMEM176B_ENST00000429904.2_Missense_Mutation_p.C98R|TMEM176B_ENST00000326442.5_Missense_Mutation_p.C98R|TMEM176B_ENST00000450753.2_Intron|TMEM176B_ENST00000434545.1_Missense_Mutation_p.C98R	NM_014020.3	NP_054739.3	Q3YBM2	T176B_HUMAN	transmembrane protein 176B	98					cell differentiation (GO:0030154)|negative regulation of dendritic cell differentiation (GO:2001199)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|large_intestine(4)|lung(10)|ovary(1)|skin(3)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGAAGGCACAGCCTGAGGCA	0.572																																					p.C98R		Atlas-SNP	.											.	TMEM176B	36	.	0			c.T292C						PASS	.						204.0	180.0	188.0					7																	150491072		2203	4300	6503	SO:0001583	missense	28959	exon3			AGGCACAGCCTGA	AF115384	CCDS5908.1, CCDS47746.1	7q36.1	2006-09-04			ENSG00000106565	ENSG00000106565			29596	protein-coding gene	gene with protein product		610385				9922225	Standard	NM_014020		Approved	LR8	uc003whu.4	Q3YBM2	OTTHUMG00000157577	ENST00000447204.2:c.292T>C	chr7.hg19:g.150491072A>G	ENSP00000410269:p.Cys98Arg	141.0	0.0	.		228.0	46.0	.	NM_014020	B2RDK2|D3DWZ7|E9PAV4|Q5BJI2|Q9BT42|Q9Y609	Missense_Mutation	SNP	ENST00000447204.2	hg19	CCDS5908.1	.	.	.	.	.	.	.	.	.	.	a	16.03	3.007339	0.54361	.	.	ENSG00000106565	ENST00000492607;ENST00000326442;ENST00000447204;ENST00000434545;ENST00000429904;ENST00000528038	T;T;T;T;T	0.02498	4.27;4.27;4.27;4.27;4.27	4.93	3.72	0.42706	.	0.150640	0.45126	D	0.000393	T	0.12135	0.0295	M	0.75447	2.3	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.00220	-1.1906	10	0.87932	D	0	-13.3179	8.7774	0.34769	0.8105:0.1895:0.0:0.0	.	98	Q3YBM2	T176B_HUMAN	R	98	ENSP00000419258:C98R;ENSP00000318409:C98R;ENSP00000410269:C98R;ENSP00000413531:C98R;ENSP00000397810:C98R	ENSP00000318409:C98R	C	-	1	0	TMEM176B	150122005	0.774000	0.28592	0.998000	0.56505	0.758000	0.43043	1.283000	0.33237	1.858000	0.53909	0.446000	0.29264	TGT	.	.	.	none		0.572	TMEM176B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349204.1	NM_014020	
LPL	4023	hgsc.bcm.edu	37	8	19805804	19805804	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr8:19805804C>T	ENST00000311322.8	+	2	672	c.202C>T	c.(202-204)Cat>Tat	p.H68Y	LPL_ENST00000521994.1_3'UTR	NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	68					chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	GGCTACCTGTCATTTCAATCA	0.517																																					p.H68Y		Atlas-SNP	.											.	LPL	78	.	0			c.C202T						PASS	.						129.0	111.0	117.0					8																	19805804		2203	4300	6503	SO:0001583	missense	4023	exon2			ACCTGTCATTTCA		CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.202C>T	chr8.hg19:g.19805804C>T	ENSP00000309757:p.His68Tyr	111.0	0.0	.		125.0	40.0	.	NM_000237	B2R5T9|Q16282|Q16283|Q96FC4	Missense_Mutation	SNP	ENST00000311322.8	hg19	CCDS6012.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.256638	0.39896	.	.	ENSG00000175445	ENST00000524029;ENST00000522701;ENST00000311322;ENST00000535763	D;D;D	0.90385	-2.66;-2.66;-2.66	5.53	4.57	0.56435	Lipase, N-terminal (1);	0.381500	0.31963	N	0.006798	D	0.86768	0.6012	L	0.28556	0.865	0.30370	N	0.782972	P	0.45011	0.848	P	0.46885	0.53	D	0.88243	0.2911	8	.	.	.	-18.2601	12.3788	0.55295	0.2421:0.7579:0.0:0.0	.	68	P06858	LIPL_HUMAN	Y	68;68;68;54	ENSP00000428237:H68Y;ENSP00000428557:H68Y;ENSP00000309757:H68Y	.	H	+	1	0	LPL	19850084	0.406000	0.25344	1.000000	0.80357	0.178000	0.23041	1.150000	0.31639	2.599000	0.87857	0.655000	0.94253	CAT	.	.	.	none		0.517	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089113.3		
PEBP4	157310	hgsc.bcm.edu	37	8	22777789	22777789	+	Missense_Mutation	SNP	T	T	A	rs201637080	byFrequency	TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr8:22777789T>A	ENST00000256404.6	-	3	257	c.166A>T	c.(166-168)Att>Ttt	p.I56F	PEBP4_ENST00000521284.1_5'UTR	NM_144962.2	NP_659399.2	Q96S96	PEBP4_HUMAN	phosphatidylethanolamine-binding protein 4	56						extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)				breast(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|stomach(2)	10		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)		TTGCAGCCAATGTTCCCCAAC	0.537																																					p.I56F		Atlas-SNP	.											.	PEBP4	23	.	0			c.A166T						PASS	.						78.0	84.0	82.0					8																	22777789		1907	4111	6018	SO:0001583	missense	157310	exon3			AGCCAATGTTCCC	BC020779	CCDS43724.1	8p21.3	2009-08-13			ENSG00000134020	ENSG00000134020			28319	protein-coding gene	gene with protein product	"""cousin-of-RKIP 1 protein"""	612473				15302887, 16865237	Standard	NM_144962		Approved	MGC22776, CORK1, hPEBP4	uc003xcn.1	Q96S96	OTTHUMG00000163749	ENST00000256404.6:c.166A>T	chr8.hg19:g.22777789T>A	ENSP00000256404:p.Ile56Phe	68.0	0.0	.		76.0	26.0	.	NM_144962	Q5EVA1|Q8WW74	Missense_Mutation	SNP	ENST00000256404.6	hg19	CCDS43724.1	.	.	.	.	.	.	.	.	.	.	T	9.085	1.000215	0.19121	.	.	ENSG00000134020	ENST00000256404	T	0.49432	0.78	5.75	-5.55	0.02536	.	0.657684	0.14588	N	0.310461	T	0.33990	0.0882	L	0.29908	0.895	0.09310	N	0.999999	P	0.50066	0.931	P	0.47402	0.546	T	0.35822	-0.9773	10	0.54805	T	0.06	-12.6443	7.9829	0.30194	0.0:0.4548:0.2715:0.2737	.	56	Q96S96	PEBP4_HUMAN	F	56	ENSP00000256404:I56F	ENSP00000256404:I56F	I	-	1	0	PEBP4	22833734	0.005000	0.15991	0.016000	0.15963	0.006000	0.05464	-1.156000	0.03160	-1.083000	0.03097	-0.263000	0.10527	ATT	.	.	.	alt		0.537	PEBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375141.2	NM_144962	
ZNF250	58500	hgsc.bcm.edu	37	8	146106965	146106965	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr8:146106965A>G	ENST00000292579.7	-	6	1734	c.1618T>C	c.(1618-1620)Tgt>Cgt	p.C540R	ZNF250_ENST00000417550.2_Missense_Mutation_p.C535R|ZNF250_ENST00000543949.1_Intron|ZNF250_ENST00000342660.6_Intron	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	540					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		GCACGCCCACACTCCCCGCAC	0.542																																					p.C540R	NSCLC(16;520 556 24096 40084 43446)	Atlas-SNP	.											.	ZNF250	37	.	0			c.T1618C						PASS	.						78.0	61.0	67.0					8																	146106965		2203	4300	6503	SO:0001583	missense	58500	exon6			GCCCACACTCCCC	AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.1618T>C	chr8.hg19:g.146106965A>G	ENSP00000292579:p.Cys540Arg	63.0	0.0	.		65.0	16.0	.	NM_021061	D3DWP1|Q59HE9|Q8N942|Q96AH9	Missense_Mutation	SNP	ENST00000292579.7	hg19	CCDS34972.1	.	.	.	.	.	.	.	.	.	.	A	18.89	3.718818	0.68844	.	.	ENSG00000196150	ENST00000292579;ENST00000417550;ENST00000394912	D;D	0.85955	-2.05;-2.05	4.06	4.06	0.47325	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000059	D	0.94522	0.8236	H	0.96916	3.905	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.95711	0.8758	10	0.72032	D	0.01	-18.4303	12.9415	0.58348	1.0:0.0:0.0:0.0	.	535;540	D3DWP1;P15622	.;ZN250_HUMAN	R	540;535;423	ENSP00000292579:C540R;ENSP00000393442:C535R	ENSP00000292579:C540R	C	-	1	0	ZNF250	146077769	0.973000	0.33851	0.998000	0.56505	0.874000	0.50279	4.788000	0.62439	2.077000	0.62373	0.397000	0.26171	TGT	.	.	.	none		0.542	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382968.1	NM_021061	
PFKP	5214	hgsc.bcm.edu	37	10	3109839	3109839	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr10:3109839G>A	ENST00000381125.4	+	1	128	c.52G>A	c.(52-54)Gag>Aag	p.E18K	RP11-118K6.3_ENST00000607898.1_lincRNA|PFKP_ENST00000381075.2_5'Flank	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	18	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		GAAGTTCCTGGAGCACCTCTC	0.746																																					p.E18K		Atlas-SNP	.											.	PFKP	182	.	0			c.G52A						PASS	.						4.0	4.0	4.0					10																	3109839		1949	3792	5741	SO:0001583	missense	5214	exon1			TTCCTGGAGCACC	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.52G>A	chr10.hg19:g.3109839G>A	ENSP00000370517:p.Glu18Lys	76.0	0.0	.		91.0	22.0	.	NM_002627	B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	ENST00000381125.4	hg19	CCDS7059.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977986	0.53720	.	.	ENSG00000067057	ENST00000381125	T	0.79940	-1.32	3.84	3.84	0.44239	.	0.305787	0.28718	N	0.014375	T	0.67618	0.2912	N	0.20986	0.625	0.80722	D	1	B	0.13145	0.007	B	0.11329	0.006	T	0.62186	-0.6907	10	0.11485	T	0.65	.	15.7657	0.78126	0.0:0.0:1.0:0.0	.	18	Q01813	K6PP_HUMAN	K	18	ENSP00000370517:E18K	ENSP00000370517:E18K	E	+	1	0	PFKP	3099839	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	6.336000	0.72954	1.876000	0.54355	0.450000	0.29827	GAG	.	.	.	none		0.746	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627	
POLR3A	11128	hgsc.bcm.edu	37	10	79741958	79741958	+	Missense_Mutation	SNP	G	G	C	rs200705099		TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr10:79741958G>C	ENST00000372371.3	-	28	3850	c.3713C>G	c.(3712-3714)aCa>aGa	p.T1238R		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	1238					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			CACACCGTGTGTGGCCATGAC	0.557																																					p.T1238R		Atlas-SNP	.											.	POLR3A	104	.	0			c.C3713G						PASS	.						178.0	140.0	153.0					10																	79741958		2203	4300	6503	SO:0001583	missense	11128	exon28			CCGTGTGTGGCCA	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.3713C>G	chr10.hg19:g.79741958G>C	ENSP00000361446:p.Thr1238Arg	90.0	0.0	.		86.0	23.0	.	NM_007055	Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	hg19	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837201	0.91117	.	.	ENSG00000148606	ENST00000539141;ENST00000372371;ENST00000540842	T	0.67865	-0.29	5.99	5.99	0.97316	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	D	0.82476	0.5045	M	0.75777	2.31	0.80722	D	1	D	0.69078	0.997	D	0.74674	0.984	T	0.80830	-0.1207	9	.	.	.	-23.5145	20.4488	0.99124	0.0:0.0:1.0:0.0	.	1238	O14802	RPC1_HUMAN	R	54;1238;1217	ENSP00000361446:T1238R	.	T	-	2	0	POLR3A	79411964	1.000000	0.71417	0.953000	0.39169	0.779000	0.44077	9.155000	0.94700	2.843000	0.97960	0.655000	0.94253	ACA	.	G|1.000;A|0.000	.	alt		0.557	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055	
CNNM1	26507	hgsc.bcm.edu	37	10	101090293	101090293	+	Silent	SNP	G	G	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr10:101090293G>C	ENST00000356713.4	+	1	1438	c.1149G>C	c.(1147-1149)gcG>gcC	p.A383A	CNNM1_ENST00000370528.3_Silent_p.A312A|CNNM1_ENST00000370534.4_Silent_p.A18A|CNNM1_ENST00000446890.1_Silent_p.A312A	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	383	DUF21.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		TGGACTGGGCGCTGCGCCAGG	0.662																																					p.A383A		Atlas-SNP	.											.	CNNM1	101	.	0			c.G1149C						PASS	.						18.0	16.0	17.0					10																	101090293		2202	4294	6496	SO:0001819	synonymous_variant	26507	exon1			CTGGGCGCTGCGC	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.1149G>C	chr10.hg19:g.101090293G>C		91.0	0.0	.		100.0	28.0	.	NM_020348	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Silent	SNP	ENST00000356713.4	hg19	CCDS7478.2																																																																																			.	.	.	none		0.662	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
TACC2	10579	hgsc.bcm.edu	37	10	123842717	123842717	+	Silent	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr10:123842717T>C	ENST00000369005.1	+	4	1042	c.702T>C	c.(700-702)ttT>ttC	p.F234F	TACC2_ENST00000515603.1_Silent_p.F234F|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000334433.3_Silent_p.F234F|TACC2_ENST00000453444.2_Silent_p.F234F|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Silent_p.F234F	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	234					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CAGGTGGCTTTCCCCCTGCAG	0.627																																					p.F234F		Atlas-SNP	.											.	TACC2	271	.	0			c.T702C						PASS	.						31.0	35.0	34.0					10																	123842717		2203	4300	6503	SO:0001819	synonymous_variant	10579	exon4			TGGCTTTCCCCCT	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.702T>C	chr10.hg19:g.123842717T>C		101.0	0.0	.		94.0	4.0	.	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	hg19	CCDS7626.1																																																																																			.	.	.	none		0.627	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
OR5P3	120066	hgsc.bcm.edu	37	11	7846802	7846802	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr11:7846802T>C	ENST00000328375.1	-	1	717	c.718A>G	c.(718-720)Acc>Gcc	p.T240A	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153445.1	NP_703146.1	Q8WZ94	OR5P3_HUMAN	olfactory receptor, family 5, subfamily P, member 3	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	15				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GAGGTGCAGGTGGAGAAGGCC	0.507																																					p.T240A		Atlas-SNP	.											.	OR5P3	44	.	0			c.A718G						PASS	.						131.0	110.0	117.0					11																	7846802		2190	4296	6486	SO:0001583	missense	120066	exon1			TGCAGGTGGAGAA	AF158377	CCDS7783.1	11p15.4	2012-08-09			ENSG00000182334	ENSG00000182334		"""GPCR / Class A : Olfactory receptors"""	14784	protein-coding gene	gene with protein product							Standard	NM_153445		Approved	JCG1	uc010rbg.2	Q8WZ94	OTTHUMG00000165669	ENST00000328375.1:c.718A>G	chr11.hg19:g.7846802T>C	ENSP00000332068:p.Thr240Ala	121.0	0.0	.		132.0	37.0	.	NM_153445	Q6IFE1|Q8NGM2	Missense_Mutation	SNP	ENST00000328375.1	hg19	CCDS7783.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.417992	0.83449	.	.	ENSG00000182334	ENST00000328375	T	0.41065	1.01	5.12	5.12	0.69794	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000037	T	0.74245	0.3691	H	0.96365	3.81	0.40222	D	0.977746	D	0.89917	1.0	D	0.97110	1.0	T	0.83182	-0.0088	10	0.87932	D	0	-38.011	12.9161	0.58207	0.0:0.0:0.0:1.0	.	240	Q8WZ94	OR5P3_HUMAN	A	240	ENSP00000332068:T240A	ENSP00000332068:T240A	T	-	1	0	OR5P3	7803378	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.944000	0.70219	2.147000	0.66899	0.528000	0.53228	ACC	.	.	.	none		0.507	OR5P3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385697.1	NM_153445	
TRIM44	54765	hgsc.bcm.edu	37	11	35685224	35685224	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr11:35685224T>A	ENST00000299413.5	+	1	872	c.565T>A	c.(565-567)Tat>Aat	p.Y189N	RP1-276E15.1_ENST00000525573.2_lincRNA	NM_017583.4	NP_060053.2	Q96DX7	TRI44_HUMAN	tripartite motif containing 44	189						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				TTTGAGTACCTATTGCCAGGA	0.498																																					p.Y189N		Atlas-SNP	.											.	TRIM44	29	.	0			c.T565A						PASS	.						134.0	122.0	126.0					11																	35685224		2202	4298	6500	SO:0001583	missense	54765	exon1			AGTACCTATTGCC	BC024031	CCDS31461.1	11p13	2011-04-20	2011-01-25		ENSG00000166326	ENSG00000166326		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19016	protein-coding gene	gene with protein product		612298	"""tripartite motif-containing 44"""				Standard	NM_017583		Approved	DIPB, MC7	uc001mwi.2	Q96DX7	OTTHUMG00000166312	ENST00000299413.5:c.565T>A	chr11.hg19:g.35685224T>A	ENSP00000299413:p.Tyr189Asn	130.0	0.0	.		132.0	39.0	.	NM_017583	D3DR14|Q96QY2|Q9UGK0	Missense_Mutation	SNP	ENST00000299413.5	hg19	CCDS31461.1	.	.	.	.	.	.	.	.	.	.	T	12.74	2.029805	0.35797	.	.	ENSG00000166326	ENST00000299413	T	0.52754	0.65	4.99	2.61	0.31194	Zinc finger, B-box (3);	0.000000	0.32608	N	0.005868	T	0.50051	0.1593	M	0.88704	2.975	0.42521	D	0.993006	B	0.22146	0.065	B	0.21708	0.036	T	0.50294	-0.8845	10	0.87932	D	0	-6.2404	5.5627	0.17152	0.1523:0.0858:0.0:0.7619	.	189	Q96DX7	TRI44_HUMAN	N	189	ENSP00000299413:Y189N	ENSP00000299413:Y189N	Y	+	1	0	TRIM44	35641800	1.000000	0.71417	0.666000	0.29783	0.021000	0.10359	5.358000	0.66064	0.308000	0.22923	-0.250000	0.11733	TAT	.	.	.	none		0.498	TRIM44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389081.1	NM_017583	
SUV420H1	51111	hgsc.bcm.edu	37	11	67926523	67926523	+	Silent	SNP	A	A	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr11:67926523A>C	ENST00000304363.4	-	11	1643	c.1290T>G	c.(1288-1290)acT>acG	p.T430T		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	430					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TATTTATATGAGTTAGCTTAG	0.388																																					p.T430T		Atlas-SNP	.											.	SUV420H1	125	.	0			c.T1290G						PASS	.						102.0	106.0	105.0					11																	67926523		2199	4294	6493	SO:0001819	synonymous_variant	51111	exon11			TATATGAGTTAGC	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.1290T>G	chr11.hg19:g.67926523A>C		82.0	0.0	.		67.0	14.0	.	NM_017635	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Silent	SNP	ENST00000304363.4	hg19	CCDS31623.1																																																																																			.	.	.	none		0.388	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635	
CNTN5	53942	hgsc.bcm.edu	37	11	99941227	99941227	+	Nonsense_Mutation	SNP	A	A	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr11:99941227A>T	ENST00000524871.1	+	11	1524	c.1234A>T	c.(1234-1236)Aag>Tag	p.K412*	CNTN5_ENST00000418526.2_Nonsense_Mutation_p.K338*|CNTN5_ENST00000279463.3_Nonsense_Mutation_p.K412*|CNTN5_ENST00000528682.1_Nonsense_Mutation_p.K412*|CNTN5_ENST00000527185.1_Nonsense_Mutation_p.K412*	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	412	Ig-like C2-type 4.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ATGGGAATGTAAGGCTACTGG	0.468																																					p.K412X		Atlas-SNP	.											.	CNTN5	324	.	0			c.A1234T						PASS	.						93.0	92.0	92.0					11																	99941227		1892	4111	6003	SO:0001587	stop_gained	53942	exon10			GAATGTAAGGCTA	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1234A>T	chr11.hg19:g.99941227A>T	ENSP00000435637:p.Lys412*	79.0	0.0	.		89.0	15.0	.	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Nonsense_Mutation	SNP	ENST00000524871.1	hg19	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	A	40	8.015620	0.98610	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	.	.	.	5.97	5.97	0.96955	.	0.045838	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6272	0.76870	1.0:0.0:0.0:0.0	.	.	.	.	X	412;412;412;338;412	.	ENSP00000279463:K412X	K	+	1	0	CNTN5	99446437	1.000000	0.71417	0.993000	0.49108	0.844000	0.47949	9.339000	0.96797	2.285000	0.76669	0.528000	0.53228	AAG	.	.	.	none		0.468	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
OR8B8	26493	hgsc.bcm.edu	37	11	124310809	124310809	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr11:124310809G>T	ENST00000328064.2	-	1	245	c.173C>A	c.(172-174)cCt>cAt	p.P58H		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	58					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GAAGTACATAGGGGTGTGCAA	0.453																																					p.P58H		Atlas-SNP	.											.	OR8B8	76	.	0			c.C173A						PASS	.						120.0	123.0	122.0					11																	124310809		2201	4299	6500	SO:0001583	missense	26493	exon1			TACATAGGGGTGT	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.173C>A	chr11.hg19:g.124310809G>T	ENSP00000330280:p.Pro58His	82.0	0.0	.		75.0	28.0	.	NM_012378	A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	hg19	CCDS8446.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698534	0.68386	.	.	ENSG00000197125	ENST00000328064	T	0.02050	4.48	3.8	2.89	0.33648	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000161	T	0.20047	0.0482	H	0.97440	4.005	0.48696	D	0.999697	D	0.89917	1.0	D	0.97110	1.0	T	0.24977	-1.0145	10	0.87932	D	0	.	11.8548	0.52431	0.0889:0.0:0.9111:0.0	.	58	Q15620	OR8B8_HUMAN	H	58	ENSP00000330280:P58H	ENSP00000330280:P58H	P	-	2	0	OR8B8	123816019	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.395000	0.79876	1.174000	0.42811	0.557000	0.71058	CCT	.	.	.	none		0.453	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43769218	43769218	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr12:43769218T>C	ENST00000389420.3	-	36	5409	c.5410A>G	c.(5410-5412)Aaa>Gaa	p.K1804E		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1804	GON. {ECO:0000255|PROSITE- ProRule:PRU00383}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ATTCTTATTTTGCTGAAAACA	0.338																																					p.K1804E		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.A5410G						PASS	.						125.0	120.0	121.0					12																	43769218		2203	4300	6503	SO:0001583	missense	80070	exon36			TTATTTTGCTGAA	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.5410A>G	chr12.hg19:g.43769218T>C	ENSP00000374071:p.Lys1804Glu	85.0	0.0	.		111.0	28.0	.	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	hg19	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	T	15.21	2.766630	0.49574	.	.	ENSG00000173157	ENST00000389420	T	0.32515	1.45	4.93	4.93	0.64822	Peptidase M12B, GON-ADAMTSs (2);	0.000000	0.52532	D	0.000076	T	0.62060	0.2397	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70651	-0.4813	10	0.72032	D	0.01	.	15.2892	0.73854	0.0:0.0:0.0:1.0	.	1804	P59510	ATS20_HUMAN	E	1804	ENSP00000374071:K1804E	ENSP00000374071:K1804E	K	-	1	0	ADAMTS20	42055485	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	6.588000	0.74076	2.150000	0.67090	0.455000	0.32223	AAA	.	.	.	none		0.338	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
DDN	23109	hgsc.bcm.edu	37	12	49392077	49392077	+	Silent	SNP	T	T	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr12:49392077T>A	ENST00000421952.2	-	2	603	c.582A>T	c.(580-582)ggA>ggT	p.G194G	RP11-386G11.3_ENST00000549516.1_RNA|RP11-386G11.5_ENST00000547866.1_RNA|RP11-386G11.5_ENST00000547395.1_RNA|RP11-386G11.5_ENST00000552284.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA	NM_015086.1	NP_055901.2	O94850	DEND_HUMAN	dendrin	194	Interaction with MAGI2.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	8						GCCGCCGACCTCCCCAGGGCC	0.781																																					p.G194G		Atlas-SNP	.											.	DDN	54	.	0			c.A582T						PASS	.						6.0	7.0	7.0					12																	49392077		1658	3517	5175	SO:0001819	synonymous_variant	23109	exon2			CCGACCTCCCCAG	AB018292	CCDS31791.2	12q13	2008-02-05			ENSG00000181418	ENSG00000181418			24458	protein-coding gene	gene with protein product		610588					Standard	NM_015086		Approved	KIAA0749	uc001rsv.1	O94850	OTTHUMG00000156183	ENST00000421952.2:c.582A>T	chr12.hg19:g.49392077T>A		37.0	0.0	.		29.0	7.0	.	NM_015086		Silent	SNP	ENST00000421952.2	hg19	CCDS31791.2																																																																																			.	.	.	none		0.781	DDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343335.1		
ERBB3	2065	hgsc.bcm.edu	37	12	56481697	56481697	+	Splice_Site	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr12:56481697T>C	ENST00000267101.3	+	6	1172	c.732T>C	c.(730-732)ttT>ttC	p.F244F	ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000415288.2_Splice_Site_p.F185F	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	244					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CAGACTGCTTTGTATGTACCC	0.532																																					p.F244F		Atlas-SNP	.											.	ERBB3	350	.	0			c.T732C						PASS	.						161.0	158.0	159.0					12																	56481697		2203	4300	6503	SO:0001630	splice_region_variant	2065	exon6			CTGCTTTGTATGT	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.732+1T>C	chr12.hg19:g.56481697T>C		64.0	0.0	.		91.0	45.0	.	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	ENST00000267101.3	hg19	CCDS31833.1																																																																																			.	.	.	none		0.532	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		Silent
R3HDM2	22864	hgsc.bcm.edu	37	12	57662177	57662177	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr12:57662177G>A	ENST00000347140.3	-	18	2287	c.1897C>T	c.(1897-1899)Cct>Tct	p.P633S	R3HDM2_ENST00000441731.2_Missense_Mutation_p.P328S|R3HDM2_ENST00000546843.1_5'UTR|R3HDM2_ENST00000413953.2_Missense_Mutation_p.P360S|R3HDM2_ENST00000402412.1_Missense_Mutation_p.P647S|R3HDM2_ENST00000403821.2_Missense_Mutation_p.P667S|R3HDM2_ENST00000358907.2_Missense_Mutation_p.P633S|RP11-123K3.4_ENST00000548184.1_3'UTR			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	633	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TGGCTCACAGGGACCAGCATG	0.557																																					p.P633S		Atlas-SNP	.											.	R3HDM2	125	.	0			c.C1897T						PASS	.						87.0	75.0	79.0					12																	57662177		2203	4300	6503	SO:0001583	missense	22864	exon16			TCACAGGGACCAG	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.1897C>T	chr12.hg19:g.57662177G>A	ENSP00000317903:p.Pro633Ser	52.0	0.0	.		72.0	17.0	.	NM_014925	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	hg19	CCDS8937.2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475222	0.84640	.	.	ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821;ENST00000548161	T;T;T;T;T;T;T;T	0.49720	0.82;0.8;1.83;1.83;1.83;0.77;1.4;1.72	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.67674	0.2918	M	0.64170	1.965	0.58432	D	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.996;0.996;0.998	T	0.67177	-0.5736	10	0.54805	T	0.06	-10.1624	18.5737	0.91147	0.0:0.0:1.0:0.0	.	667;647;633;360	B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;R3HD2_HUMAN;.	S	360;360;633;647;633;328;398;667;22	ENSP00000409146:P360S;ENSP00000377400:P360S;ENSP00000317903:P633S;ENSP00000385839:P647S;ENSP00000351784:P633S;ENSP00000408536:P328S;ENSP00000394676:P398S;ENSP00000385169:P667S	ENSP00000317903:P633S	P	-	1	0	R3HDM2	55948444	1.000000	0.71417	0.995000	0.50966	0.754000	0.42855	7.382000	0.79729	2.755000	0.94549	0.650000	0.86243	CCT	.	.	.	none		0.557	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
ASCL4	121549	hgsc.bcm.edu	37	12	108169302	108169302	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr12:108169302C>A	ENST00000342331.4	+	1	1141	c.310C>A	c.(310-312)Ctg>Atg	p.L104M		NM_203436.2	NP_982260.2	Q6XD76	ASCL4_HUMAN	achaete-scute family bHLH transcription factor 4	103	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|skin development (GO:0043588)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	13						GCCCCGGGAGCTGGCAGACAA	0.697																																					p.L104M	GBM(170;776 3695 11650)	Atlas-SNP	.											.	ASCL4	28	.	0			c.C310A						PASS	.						6.0	7.0	7.0					12																	108169302		2116	4159	6275	SO:0001583	missense	121549	exon1			CGGGAGCTGGCAG	AY238895	CCDS31894.2	12q24.11	2013-10-17	2013-10-17		ENSG00000187855	ENSG00000187855		"""Basic helix-loop-helix proteins"""	24311	protein-coding gene	gene with protein product		609155	"""achaete-scute complex-like 4 (Drosophila)"", ""achaete-scute complex homolog 4 (Drosophila)"""				Standard	NM_203436		Approved	HASH4, bHLHa44	uc001tmr.3	Q6XD76	OTTHUMG00000156964	ENST00000342331.4:c.310C>A	chr12.hg19:g.108169302C>A	ENSP00000345420:p.Leu104Met	41.0	0.0	.		38.0	17.0	.	NM_203436	Q7RTS2	Missense_Mutation	SNP	ENST00000342331.4	hg19	CCDS31894.2	.	.	.	.	.	.	.	.	.	.	C	12.88	2.070242	0.36566	.	.	ENSG00000187855	ENST00000342331	D	0.98164	-4.76	4.33	1.4	0.22301	Helix-loop-helix DNA-binding (5);	0.283517	0.28748	N	0.014263	D	0.97717	0.9251	M	0.68317	2.08	0.22648	N	0.998896	P	0.42483	0.781	P	0.57152	0.814	D	0.93422	0.6778	10	0.34782	T	0.22	-17.6037	6.1213	0.20154	0.0:0.6081:0.1363:0.2556	.	103	Q6XD76	ASCL4_HUMAN	M	104	ENSP00000345420:L104M	ENSP00000345420:L104M	L	+	1	2	ASCL4	106693432	1.000000	0.71417	0.994000	0.49952	0.566000	0.35808	0.947000	0.29082	0.057000	0.16193	0.305000	0.20034	CTG	.	.	.	none		0.697	ASCL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346845.1	NM_203436	
PARP4	143	hgsc.bcm.edu	37	13	25009275	25009275	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr13:25009275C>T	ENST00000381989.3	-	31	4109	c.4004G>A	c.(4003-4005)aGt>aAt	p.S1335N		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1335					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		GGAAGCAGGACTGTGAGCGCG	0.498																																					p.S1335N		Atlas-SNP	.											.	PARP4	142	.	0			c.G4004A						PASS	.						86.0	92.0	90.0					13																	25009275		2203	4300	6503	SO:0001583	missense	143	exon31			GCAGGACTGTGAG	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.4004G>A	chr13.hg19:g.25009275C>T	ENSP00000371419:p.Ser1335Asn	95.0	0.0	.		118.0	36.0	.	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	hg19	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	c	0.841	-0.742013	0.03088	.	.	ENSG00000102699	ENST00000381989	T	0.01821	4.62	2.35	-4.71	0.03279	.	9.944990	0.00691	U	0.000733	T	0.01156	0.0038	N	0.19112	0.55	0.09310	N	1	B	0.24186	0.099	B	0.18263	0.021	T	0.46205	-0.9208	10	0.16420	T	0.52	.	0.5609	0.00679	0.1939:0.2856:0.2729:0.2476	.	1335	Q9UKK3	PARP4_HUMAN	N	1335	ENSP00000371419:S1335N	ENSP00000371419:S1335N	S	-	2	0	PARP4	23907275	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.146000	0.03191	-1.910000	0.01083	0.313000	0.20887	AGT	.	.	.	none		0.498	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
TGDS	23483	hgsc.bcm.edu	37	13	95230409	95230409	+	Silent	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr13:95230409T>C	ENST00000261296.5	-	9	795	c.675A>G	c.(673-675)tcA>tcG	p.S225S	TGDS_ENST00000498294.1_5'Flank	NM_014305.2	NP_055120.1	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase	225					nucleotide-sugar metabolic process (GO:0009225)		coenzyme binding (GO:0050662)|dTDP-glucose 4,6-dehydratase activity (GO:0008460)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					TTTGAAGCCCTGACCCATGAA	0.373																																					p.S225S		Atlas-SNP	.											.	TGDS	24	.	0			c.A675G						PASS	.						77.0	74.0	75.0					13																	95230409		2203	4300	6503	SO:0001819	synonymous_variant	23483	exon9			AAGCCCTGACCCA	AF048686	CCDS9471.1	13q32.1	2012-02-22			ENSG00000088451	ENSG00000088451	4.2.1.46	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	20324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 2E, member 1"""					19027726	Standard	NM_014305		Approved	TDPGD, SDR2E1	uc001vlw.3	O95455	OTTHUMG00000046308	ENST00000261296.5:c.675A>G	chr13.hg19:g.95230409T>C		142.0	0.0	.		134.0	35.0	.	NM_014305	Q05DQ3|Q2TU31|Q5T3Z2|Q9H1T9	Silent	SNP	ENST00000261296.5	hg19	CCDS9471.1																																																																																			.	.	.	none		0.373	TGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106904.2	NM_014305	
LINC00283	100874057	hgsc.bcm.edu	37	13	103398632	103398632	+	RNA	SNP	A	A	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr13:103398632A>T	ENST00000430111.1	+	0	3894									long intergenic non-protein coding RNA 283																		CGCTGCTTCTAATAAAACTTT	0.443																																					p.L1472X		Atlas-SNP	.											.	.	.	.	0			c.T4415A						PASS	.						55.0	42.0	46.0					13																	103398632		692	1590	2282			643677	exon4			GCTTCTAATAAAA			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103398632A>T		91.0	0.0	.		73.0	18.0	.	NM_001146197		Nonsense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	.	.	none		0.443	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
SYT16	83851	hgsc.bcm.edu	37	14	62547937	62547937	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr14:62547937A>G	ENST00000430451.2	+	4	1576	c.1379A>G	c.(1378-1380)cAc>cGc	p.H460R	RP11-355I22.5_ENST00000553990.1_lincRNA	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	460					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		AGCCACCTGCACCCAGAAGGG	0.502																																					p.H460R		Atlas-SNP	.											.	SYT16	144	.	0			c.A1379G						PASS	.						30.0	32.0	31.0					14																	62547937		2105	4243	6348	SO:0001583	missense	83851	exon4			ACCTGCACCCAGA	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1379A>G	chr14.hg19:g.62547937A>G	ENSP00000394700:p.His460Arg	82.0	0.0	.		91.0	24.0	.	NM_031914	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	ENST00000430451.2	hg19	CCDS45121.1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.503479	0.26949	.	.	ENSG00000139973	ENST00000430451	T	0.78003	-1.14	4.88	4.88	0.63580	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.521666	0.22640	N	0.057462	T	0.56156	0.1966	N	0.08118	0	0.80722	D	1	B	0.18310	0.027	B	0.17098	0.017	T	0.53885	-0.8375	10	0.34782	T	0.22	-1.3072	7.2012	0.25881	0.831:0.0:0.169:0.0	.	460	Q17RD7	SYT16_HUMAN	R	460	ENSP00000394700:H460R	ENSP00000394700:H460R	H	+	2	0	SYT16	61617690	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.399000	0.44495	2.164000	0.68074	0.533000	0.62120	CAC	.	.	.	none		0.502	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
SAMD15	161394	hgsc.bcm.edu	37	14	77845295	77845295	+	Nonsense_Mutation	SNP	G	G	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr14:77845295G>T	ENST00000216471.4	+	1	1820	c.1534G>T	c.(1534-1536)Gaa>Taa	p.E512*	SAMD15_ENST00000533095.2_Intron|TMED8_ENST00000216468.7_5'Flank	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	512										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TCATGAAAAGGAAGTTGTAGA	0.408																																					p.E512X		Atlas-SNP	.											.	SAMD15	60	.	0			c.G1534T						PASS	.						98.0	96.0	97.0					14																	77845295		2203	4300	6503	SO:0001587	stop_gained	161394	exon1			GAAAAGGAAGTTG	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.1534G>T	chr14.hg19:g.77845295G>T	ENSP00000216471:p.Glu512*	168.0	0.0	.		198.0	57.0	.	NM_001010860	Q2M3P3	Nonsense_Mutation	SNP	ENST00000216471.4	hg19	CCDS32126.1	.	.	.	.	.	.	.	.	.	.	G	36	5.723196	0.96847	.	.	ENSG00000100583	ENST00000216471	.	.	.	4.33	-2.85	0.05734	.	1.341590	0.05553	N	0.567955	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	5.1042	0.14775	0.3883:0.1822:0.4296:0.0	.	.	.	.	X	512	.	ENSP00000216471:E512X	E	+	1	0	SAMD15	76915048	0.002000	0.14202	0.000000	0.03702	0.020000	0.10135	-0.284000	0.08422	-0.515000	0.06479	-0.459000	0.05422	GAA	.	.	.	none		0.408	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860	
TTC7B	145567	hgsc.bcm.edu	37	14	91161915	91161915	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr14:91161915T>C	ENST00000328459.6	-	6	827	c.706A>G	c.(706-708)Aca>Gca	p.T236A	RP11-661G16.2_ENST00000553712.1_RNA|TTC7B_ENST00000357056.2_Missense_Mutation_p.T236A	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	236										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				ACTCCTCTTGTCAAGTTCCTG	0.383																																					p.T236A		Atlas-SNP	.											.	TTC7B	93	.	0			c.A706G						PASS	.						123.0	101.0	108.0					14																	91161915		2203	4300	6503	SO:0001583	missense	145567	exon6			CTCTTGTCAAGTT	BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.706A>G	chr14.hg19:g.91161915T>C	ENSP00000336127:p.Thr236Ala	43.0	0.0	.		50.0	14.0	.	NM_001010854	Q86U24|Q86VT3	Missense_Mutation	SNP	ENST00000328459.6	hg19	CCDS32140.1	.	.	.	.	.	.	.	.	.	.	T	12.89	2.073012	0.36566	.	.	ENSG00000165914	ENST00000555768;ENST00000357056;ENST00000328459;ENST00000557766	T;T	0.37235	1.9;1.21	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.45276	0.1334	L	0.35723	1.085	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.21211	-1.0252	10	0.09084	T	0.74	-16.2664	15.4112	0.74923	0.0:0.0:0.0:1.0	.	236	Q86TV6	TTC7B_HUMAN	A	134;236;236;156	ENSP00000349564:T236A;ENSP00000336127:T236A	ENSP00000336127:T236A	T	-	1	0	TTC7B	90231668	1.000000	0.71417	0.998000	0.56505	0.186000	0.23388	7.386000	0.79775	2.118000	0.64928	0.402000	0.26972	ACA	.	.	.	none		0.383	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2		
NPAP1	23742	hgsc.bcm.edu	37	15	24924481	24924481	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr15:24924481C>G	ENST00000329468.2	+	1	3941	c.3467C>G	c.(3466-3468)cCg>cGg	p.P1156R		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1156					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P1156Q(1)									TTCCAACTTCCGTAAGAGCAC	0.418																																					p.P1156R		Atlas-SNP	.											C15orf2,NS,carcinoma,-1,1	.	.	.	1	Substitution - Missense(1)	lung(1)	c.C3467G						PASS	.						72.0	63.0	66.0					15																	24924481		2203	4298	6501	SO:0001583	missense	23742	exon1			AACTTCCGTAAGA	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3467C>G	chr15.hg19:g.24924481C>G	ENSP00000333735:p.Pro1156Arg	57.0	0.0	.		83.0	17.0	.	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	hg19	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	10.24	1.295704	0.23564	.	.	ENSG00000185823	ENST00000329468	T	0.09630	2.96	1.77	0.827	0.18835	.	.	.	.	.	T	0.10723	0.0262	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	P	0.62813	0.907	T	0.22208	-1.0223	9	0.87932	D	0	.	4.3207	0.11016	0.0:0.7896:0.0:0.2104	.	1156	Q9NZP6	CO002_HUMAN	R	1156	ENSP00000333735:P1156R	ENSP00000333735:P1156R	P	+	2	0	C15orf2	22475574	0.000000	0.05858	0.004000	0.12327	0.013000	0.08279	0.156000	0.16382	0.304000	0.22809	0.313000	0.20887	CCG	.	.	.	none		0.418	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
SCAMP2	10066	hgsc.bcm.edu	37	15	75165566	75165566	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr15:75165566C>T	ENST00000268099.9	-	1	140	c.31G>A	c.(31-33)Gac>Aac	p.D11N		NM_005697.3	NP_005688.2	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	11					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)|trans-Golgi network membrane (GO:0032588)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	9						TCCACTGGGTCCGCGAAGGGG	0.682																																					p.D11N		Atlas-SNP	.											.	SCAMP2	18	.	0			c.G31A						PASS	.						48.0	43.0	45.0					15																	75165566		2018	3917	5935	SO:0001583	missense	10066	exon1			CTGGGTCCGCGAA	AF005038	CCDS10271.1	15q23-q25	2013-02-21			ENSG00000140497	ENSG00000140497		"""Secretory carrier membrane proteins"""	10564	protein-coding gene	gene with protein product		606912				9378760	Standard	NM_005697		Approved		uc002azb.1	O15127	OTTHUMG00000142817	ENST00000268099.9:c.31G>A	chr15.hg19:g.75165566C>T	ENSP00000268099:p.Asp11Asn	40.0	0.0	.		68.0	14.0	.	NM_005697	B2RDF0|Q9BQE8	Missense_Mutation	SNP	ENST00000268099.9	hg19	CCDS10271.1	.	.	.	.	.	.	.	.	.	.	C	34	5.355708	0.95854	.	.	ENSG00000140497	ENST00000268099;ENST00000543345	T	0.20463	2.07	5.19	5.19	0.71726	.	0.108092	0.64402	D	0.000009	T	0.24586	0.0596	L	0.59436	1.845	0.49051	D	0.999744	P	0.39964	0.697	B	0.38500	0.275	T	0.02546	-1.1143	10	0.72032	D	0.01	.	14.1356	0.65287	0.0:1.0:0.0:0.0	.	11	O15127	SCAM2_HUMAN	N	11	ENSP00000268099:D11N	ENSP00000268099:D11N	D	-	1	0	SCAMP2	72952619	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.069000	0.50026	2.716000	0.92895	0.650000	0.86243	GAC	.	.	.	none		0.682	SCAMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286403.3	NM_005697	
SCAPER	49855	hgsc.bcm.edu	37	15	76646306	76646306	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr15:76646306A>T	ENST00000563290.1	-	30	4126	c.4031T>A	c.(4030-4032)cTg>cAg	p.L1344Q	SCAPER_ENST00000538941.2_Missense_Mutation_p.L1098Q|SCAPER_ENST00000324767.7_Missense_Mutation_p.L1344Q			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	1344						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GAAAGTGGCCAGTAAAACACA	0.398																																					p.L1344Q		Atlas-SNP	.											.	SCAPER	160	.	0			c.T4031A						PASS	.						116.0	116.0	116.0					15																	76646306		1978	4174	6152	SO:0001583	missense	49855	exon29			GTGGCCAGTAAAA	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.4031T>A	chr15.hg19:g.76646306A>T	ENSP00000454973:p.Leu1344Gln	118.0	0.0	.		110.0	25.0	.	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	hg19	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.470147	0.84533	.	.	ENSG00000140386	ENST00000324767;ENST00000538941	T;T	0.58652	0.42;0.32	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.78566	0.4303	M	0.83774	2.66	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.81833	-0.0751	10	0.87932	D	0	.	16.4563	0.84015	1.0:0.0:0.0:0.0	.	1343;1098	Q9BY12;F5H7X8	SCAPE_HUMAN;.	Q	1344;1098	ENSP00000326924:L1344Q;ENSP00000442190:L1098Q	ENSP00000326924:L1344Q	L	-	2	0	SCAPER	74433361	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	8.851000	0.92205	2.343000	0.79666	0.533000	0.62120	CTG	.	.	.	none		0.398	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
ERI2	112479	hgsc.bcm.edu	37	16	20809656	20809656	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr16:20809656G>C	ENST00000357967.4	-	9	1508	c.1466C>G	c.(1465-1467)gCc>gGc	p.A489G	ERI2_ENST00000389345.5_Missense_Mutation_p.A224G|ERI2_ENST00000564349.1_Missense_Mutation_p.A396G|ERI2_ENST00000563117.1_Missense_Mutation_p.A396G|ERI2_ENST00000300005.3_Intron|ERI2_ENST00000569729.1_Intron	NM_001142725.1	NP_001136197.1	A8K979	ERI2_HUMAN	ERI1 exoribonuclease family member 2	489							exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(2)	11						TGGATCTTTGGCTTCTTTTAC	0.353																																					p.A489G		Atlas-SNP	.											.	ERI2	50	.	0			c.C1466G						PASS	.						109.0	95.0	99.0					16																	20809656		692	1591	2283	SO:0001583	missense	112479	exon9			TCTTTGGCTTCTT	BC010503	CCDS10590.1, CCDS45436.1	16p12.3	2014-02-18	2009-10-07	2008-12-16	ENSG00000196678	ENSG00000196678		"""Enhanced RNAi three prime mRNA exonucleases"""	30541	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 2 (C.elegans)"", ""exoribonuclease 2"", ""zinc finger, GRF-type containing 5"""		"""exonuclease domain containing 1"""	EXOD1		10819331	Standard	NM_080663		Approved	KIAA1504, MGC16943, ZGRF5	uc010vbb.1	A8K979	OTTHUMG00000131557	ENST00000357967.4:c.1466C>G	chr16.hg19:g.20809656G>C	ENSP00000350651:p.Ala489Gly	62.0	0.0	.		75.0	14.0	.	NM_001142725	Q6ZSJ2|Q96FR9|Q9P224|Q9Y6V3	Missense_Mutation	SNP	ENST00000357967.4	hg19	CCDS45436.1	.	.	.	.	.	.	.	.	.	.	G	10.97	1.501882	0.26949	.	.	ENSG00000196678	ENST00000357967;ENST00000389345	T;T	0.20069	2.14;2.1	5.83	3.8	0.43715	.	1.431980	0.04342	N	0.354195	T	0.21881	0.0527	L	0.59436	1.845	0.09310	N	1	B	0.31680	0.335	B	0.28139	0.086	T	0.33523	-0.9865	10	0.66056	D	0.02	1.127	2.2941	0.04145	0.1648:0.2783:0.4135:0.1434	.	489	A8K979	ERI2_HUMAN	G	489;224	ENSP00000350651:A489G;ENSP00000373996:A224G	ENSP00000350651:A489G	A	-	2	0	ERI2	20717157	0.012000	0.17670	0.966000	0.40874	0.901000	0.52897	0.386000	0.20702	0.743000	0.32719	0.655000	0.94253	GCC	.	.	.	none		0.353	ERI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_080663	
PFN1	5216	hgsc.bcm.edu	37	17	4850000	4850000	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr17:4850000T>A	ENST00000225655.5	-	2	867	c.248A>T	c.(247-249)gAa>gTa	p.E83V	PFN1_ENST00000574872.1_Missense_Mutation_p.E47V	NM_005022.3	NP_005013.1	P07737	PROF1_HUMAN	profilin 1	83					actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cell death (GO:0008219)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of ruffle assembly (GO:1900029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|proline-rich region binding (GO:0070064)			NS(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5						CATGCTAAATTCCCCATCCTG	0.532																																					p.E83V		Atlas-SNP	.											.	PFN1	6	.	0			c.A248T						PASS	.						98.0	100.0	99.0					17																	4850000		2203	4300	6503	SO:0001583	missense	5216	exon2			CTAAATTCCCCAT	BC057828	CCDS11061.1	17p13.2	2010-07-09			ENSG00000108518	ENSG00000108518			8881	protein-coding gene	gene with protein product		176610				3356709, 1968707	Standard	NM_005022		Approved		uc002gaa.4	P07737	OTTHUMG00000099396	ENST00000225655.5:c.248A>T	chr17.hg19:g.4850000T>A	ENSP00000225655:p.Glu83Val	43.0	0.0	.		62.0	22.0	.	NM_005022	Q53Y44	Missense_Mutation	SNP	ENST00000225655.5	hg19	CCDS11061.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.255562	0.59321	.	.	ENSG00000108518	ENST00000225655	D	0.86694	-2.16	4.41	4.41	0.53225	.	0.225081	0.37577	N	0.002024	D	0.82323	0.5012	L	0.27053	0.805	0.40895	D	0.984105	P;D	0.57899	0.826;0.981	B;P	0.50860	0.251;0.652	D	0.83494	0.0071	10	0.87932	D	0	.	6.7098	0.23270	0.0:0.1044:0.0:0.8956	.	83;83	P07737;Q53Y44	PROF1_HUMAN;.	V	83	ENSP00000225655:E83V	ENSP00000225655:E83V	E	-	2	0	PFN1	4790745	1.000000	0.71417	0.973000	0.42090	0.877000	0.50540	6.167000	0.71902	1.992000	0.58205	0.379000	0.24179	GAA	.	.	.	none		0.532	PFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216853.1	NM_005022	
SLFN13	146857	hgsc.bcm.edu	37	17	33768163	33768163	+	Silent	SNP	A	A	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr17:33768163A>G	ENST00000285013.6	-	6	2420	c.2145T>C	c.(2143-2145)ctT>ctC	p.L715L	SLFN13_ENST00000534689.1_Silent_p.L397L|SLFN13_ENST00000533791.1_Silent_p.L715L|SLFN13_ENST00000360502.2_Silent_p.L397L|SLFN13_ENST00000542635.1_Silent_p.L715L|SLFN13_ENST00000526861.1_Silent_p.L715L	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	715						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AGAGAGGGGGAAGGCCACTGT	0.458																																					p.L715L		Atlas-SNP	.											.	SLFN13	79	.	0			c.T2145C						PASS	.						135.0	143.0	140.0					17																	33768163		2203	4300	6503	SO:0001819	synonymous_variant	146857	exon6			AGGGGGAAGGCCA	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.2145T>C	chr17.hg19:g.33768163A>G		43.0	0.0	.		72.0	4.0	.	NM_144682	E1P645|Q658M1|Q6ZS51|Q96A81	Silent	SNP	ENST00000285013.6	hg19	CCDS32620.1																																																																																			.	.	.	none		0.458	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
ACLY	47	hgsc.bcm.edu	37	17	40062802	40062802	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr17:40062802C>A	ENST00000352035.2	-	8	975	c.845G>T	c.(844-846)gGt>gTt	p.G282V	ACLY_ENST00000393896.2_Missense_Mutation_p.G282V|ACLY_ENST00000353196.1_Missense_Mutation_p.G282V|ACLY_ENST00000537919.1_Intron|ACLY_ENST00000590151.1_Missense_Mutation_p.G282V	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	282					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				AGAGGCGCCACCCCCGGCCAC	0.602																																					p.G282V	Colon(64;807 1396 15971 30971)	Atlas-SNP	.											.	ACLY	85	.	0			c.G845T						PASS	.						111.0	103.0	105.0					17																	40062802		2203	4300	6503	SO:0001583	missense	47	exon8			GCGCCACCCCCGG	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.845G>T	chr17.hg19:g.40062802C>A	ENSP00000253792:p.Gly282Val	48.0	0.0	.		47.0	13.0	.	NM_001096	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	hg19	CCDS11412.1	.	.	.	.	.	.	.	.	.	.	C	34	5.324101	0.95708	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000393896	T;T;T	0.70986	-0.53;-0.53;-0.53	6.07	6.07	0.98685	Succinyl-CoA synthetase-like (2);Succinyl-CoA synthetase, beta subunit, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.89230	0.6656	M	0.94101	3.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.90677	0.4602	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	336;336;282;282	B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;ACLY_HUMAN	V	282;336;282;282	ENSP00000253792:G282V;ENSP00000345398:G282V;ENSP00000377474:G282V	ENSP00000253792:G282V	G	-	2	0	ACLY	37316328	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.616000	0.83018	2.884000	0.98904	0.655000	0.94253	GGT	.	.	.	none		0.602	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
BRCA1	672	hgsc.bcm.edu	37	17	41246841	41246841	+	Missense_Mutation	SNP	G	G	C	rs80356990		TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr17:41246841G>C	ENST00000357654.3	-	10	825	c.707C>G	c.(706-708)aCt>aGt	p.T236S	BRCA1_ENST00000471181.2_Missense_Mutation_p.T236S|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000354071.3_Missense_Mutation_p.T236S|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000309486.4_5'UTR|BRCA1_ENST00000493795.1_Missense_Mutation_p.T189S|BRCA1_ENST00000468300.1_Missense_Mutation_p.T236S|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000346315.3_Missense_Mutation_p.T236S|BRCA1_ENST00000491747.2_Missense_Mutation_p.T236S	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	236					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		ATGATGTTCAGTATTTGTTAC	0.348			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.T236S		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	304	.	0			c.C707G						PASS	.						40.0	38.0	38.0					17																	41246841		2203	4299	6502	SO:0001583	missense	672	exon9	Familial Cancer Database		TGTTCAGTATTTG	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.707C>G	chr17.hg19:g.41246841G>C	ENSP00000350283:p.Thr236Ser	54.0	0.0	.		53.0	15.0	.	NM_007298	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	hg19	CCDS11453.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.010|0.010	-1.767696|-1.767696	0.00645|0.00645	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000473961|ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825;ENST00000470026;ENST00000477152;ENST00000494123	.|D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.97161	.|-2.25;-2.36;-2.35;-2.14;-2.64;-2.25;-2.4;-1.96;-1.79;-2.26;-1.65;-2.81;-4.27;-2.49	4.86|4.86	-0.582|-0.582	0.11709|0.11709	.|.	.|0.962464	.|0.08592	.|N	.|0.922956	D|D	0.93048|0.93048	0.7787|0.7787	L|L	0.44542|0.44542	1.39|1.39	0.18873|0.18873	N|N	0.999988|0.999988	.|B;B;P;B;B;B;P;B;P;B;B	.|0.37864	.|0.058;0.039;0.457;0.146;0.091;0.146;0.592;0.051;0.61;0.41;0.228	.|B;B;B;B;B;B;B;B;B;B;B	.|0.35278	.|0.01;0.02;0.098;0.024;0.024;0.024;0.199;0.016;0.138;0.096;0.053	D|D	0.86464|0.86464	0.1781|0.1781	5|10	.|0.66056	.|D	.|0.02	.|.	3.5881|3.5881	0.07978|0.07978	0.4166:0.0:0.2972:0.2863|0.4166:0.0:0.2972:0.2863	.|.	.|235;189;235;236;195;236;236;236;236;236;236	.|E7EUM2;B4DES0;E7ETR2;E7EMP0;E7ERL4;Q5YLB2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2	.|.;.;.;.;.;.;.;.;.;BRCA1_HUMAN;.	V|S	102|236;236;236;236;236;189;236;189;235;235;110;189;111;236;210;236	.|ENSP00000350283:T236S;ENSP00000326002:T236S;ENSP00000246907:T236S;ENSP00000417148:T236S;ENSP00000377294:T189S;ENSP00000418960:T236S;ENSP00000418775:T189S;ENSP00000420412:T235S;ENSP00000419481:T110S;ENSP00000418819:T189S;ENSP00000418212:T111S;ENSP00000419274:T236S;ENSP00000419988:T210S;ENSP00000419103:T236S	.|ENSP00000246907:T236S	L|T	-|-	1|2	2|0	BRCA1|BRCA1	38500367|38500367	0.000000|0.000000	0.05858|0.05858	0.106000|0.106000	0.21319|0.21319	0.131000|0.131000	0.20780|0.20780	-0.880000|-0.880000	0.04183|0.04183	-0.208000|-0.208000	0.10171|0.10171	-0.218000|-0.218000	0.12543|0.12543	CTG|ACT	.	.	.	weak		0.348	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
CHAD	1101	hgsc.bcm.edu	37	17	48545993	48545993	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr17:48545993T>A	ENST00000508540.1	-	1	334	c.182A>T	c.(181-183)aAc>aTc	p.N61I	ACSF2_ENST00000504392.1_Intron|ACSF2_ENST00000427954.2_Intron|ACSF2_ENST00000300441.4_Intron|ACSF2_ENST00000502667.1_Intron|ACSF2_ENST00000506085.1_Intron|CHAD_ENST00000258969.4_Missense_Mutation_p.N61I|ACSF2_ENST00000541920.1_Intron	NM_001267.2	NP_001258.2	O15335	CHAD_HUMAN	chondroadherin	61					bone development (GO:0060348)|cartilage condensation (GO:0001502)|negative regulation of bone trabecula formation (GO:1900155)	proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(2)|ovary(2)	15	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CGGGAAGTTGTTGCGCTGTAG	0.622																																					p.N61I		Atlas-SNP	.											.	CHAD	36	.	0			c.A182T						PASS	.						97.0	81.0	86.0					17																	48545993		2203	4300	6503	SO:0001583	missense	1101	exon1			AAGTTGTTGCGCT	U96767	CCDS11568.1	17q21.33	2008-02-05			ENSG00000136457	ENSG00000136457		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1909	protein-coding gene	gene with protein product	"""chondroadherin proteoglycan"""	602178				9344663	Standard	NM_001267		Approved	SLRR4A	uc010dbr.3	O15335	OTTHUMG00000162129	ENST00000508540.1:c.182A>T	chr17.hg19:g.48545993T>A	ENSP00000423812:p.Asn61Ile	72.0	0.0	.		56.0	14.0	.	NM_001267	A8K812|Q6GTU0|Q96RJ5	Missense_Mutation	SNP	ENST00000508540.1	hg19	CCDS11568.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.250312	0.80024	.	.	ENSG00000136457	ENST00000508540;ENST00000258969	T;T	0.08282	3.11;3.11	4.31	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.44201	0.1282	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65307	-0.6200	10	0.87932	D	0	.	13.6404	0.62246	0.0:0.0:0.0:1.0	.	61	O15335	CHAD_HUMAN	I	61	ENSP00000423812:N61I;ENSP00000258969:N61I	ENSP00000258969:N61I	N	-	2	0	CHAD	45900992	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.774000	0.85478	1.811000	0.52892	0.379000	0.24179	AAC	.	.	.	none		0.622	CHAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367447.3	NM_001267	
TMC8	147138	hgsc.bcm.edu	37	17	76130534	76130534	+	Silent	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr17:76130534G>A	ENST00000318430.5	+	8	1250	c.876G>A	c.(874-876)acG>acA	p.T292T	TMC6_ENST00000322914.3_5'Flank|TMC8_ENST00000589691.1_Silent_p.T69T	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	292					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			GGGCCCAGACGGCCTGCCGCC	0.672																																					p.T292T		Atlas-SNP	.											.	TMC8	44	.	0			c.G876A						PASS	.						38.0	42.0	41.0					17																	76130534		2203	4300	6503	SO:0001819	synonymous_variant	147138	exon8			CCAGACGGCCTGC	AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.876G>A	chr17.hg19:g.76130534G>A		46.0	0.0	.		47.0	13.0	.	NM_152468	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Silent	SNP	ENST00000318430.5	hg19	CCDS32749.1																																																																																			.	.	.	none		0.672	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436900.3		
CLUL1	27098	hgsc.bcm.edu	37	18	619236	619236	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr18:619236G>A	ENST00000400606.2	+	3	275	c.130G>A	c.(130-132)Gat>Aat	p.D44N	CLUL1_ENST00000580436.1_3'UTR|CLUL1_ENST00000581619.1_Missense_Mutation_p.D69N|CLUL1_ENST00000579494.1_Missense_Mutation_p.D44N|CLUL1_ENST00000540035.1_Missense_Mutation_p.D96N|CLUL1_ENST00000338387.7_Missense_Mutation_p.D44N	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	44					cell death (GO:0008219)	extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						GGGGGAGATAGATGCAGATGA	0.388																																					p.D44N		Atlas-SNP	.											.	CLUL1	57	.	0			c.G130A						PASS	.						133.0	125.0	127.0					18																	619236		1882	4114	5996	SO:0001583	missense	27098	exon3			GAGATAGATGCAG	D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.130G>A	chr18.hg19:g.619236G>A	ENSP00000383449:p.Asp44Asn	165.0	0.0	.		154.0	19.0	.	NM_199167	A0FDN7	Missense_Mutation	SNP	ENST00000400606.2	hg19	CCDS42405.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.568182	0.00895	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	T;T;T	0.24151	1.87;1.87;1.87	5.07	0.56	0.17279	Clusterin, N-terminal (1);	0.746850	0.13546	N	0.379829	T	0.15522	0.0374	L	0.51422	1.61	0.09310	N	1	B;B	0.17268	0.021;0.006	B;B	0.13407	0.008;0.009	T	0.38908	-0.9639	10	0.02654	T	1	-0.8279	3.5588	0.07874	0.0916:0.1057:0.2609:0.5417	.	96;44	F5GWQ8;Q15846	.;CLUL1_HUMAN	N	44;96;44	ENSP00000383449:D44N;ENSP00000441726:D96N;ENSP00000341128:D44N	ENSP00000341128:D44N	D	+	1	0	CLUL1	609236	0.897000	0.30589	0.007000	0.13788	0.005000	0.04900	1.467000	0.35321	0.154000	0.19237	-0.182000	0.12963	GAT	.	.	.	none		0.388	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1		
ICAM1	3383	hgsc.bcm.edu	37	19	10394341	10394341	+	Silent	SNP	G	G	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr19:10394341G>T	ENST00000264832.3	+	3	841	c.516G>T	c.(514-516)acG>acT	p.T172T	ICAM1_ENST00000423829.2_Intron|CTD-2369P2.5_ENST00000592893.1_RNA|CTD-2369P2.8_ENST00000589379.1_RNA	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	172	Ig-like C2-type 2.				adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	TCACGACCACGGTGCTGGTGA	0.657																																					p.T172T		Atlas-SNP	.											ICAM1,NS,carcinoma,0,1	ICAM1	32	.	0			c.G516T						PASS	.						33.0	34.0	33.0					19																	10394341		2203	4300	6503	SO:0001819	synonymous_variant	3383	exon3			GACCACGGTGCTG		CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.516G>T	chr19.hg19:g.10394341G>T		67.0	0.0	.		54.0	4.0	.	NM_000201	B2R6M3|Q5NKV7|Q96B50	Silent	SNP	ENST00000264832.3	hg19	CCDS12231.1																																																																																			.	.	.	none		0.657	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1		
CEP250	11190	hgsc.bcm.edu	37	20	34067123	34067123	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr20:34067123A>G	ENST00000397527.1	+	18	2882	c.2162A>G	c.(2161-2163)gAa>gGa	p.E721G	RP3-477O4.14_ENST00000444933.1_RNA|RP3-477O4.14_ENST00000453914.1_RNA|RP3-477O4.14_ENST00000416260.1_RNA|CEP250_ENST00000342580.4_Missense_Mutation_p.E721G	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	721	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AAGCGACAGGAAGAAGTGCTT	0.612																																					p.E721G		Atlas-SNP	.											.	CEP250	141	.	0			c.A2162G						PASS	.						115.0	99.0	104.0					20																	34067123		2203	4300	6503	SO:0001583	missense	11190	exon18			GACAGGAAGAAGT	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.2162A>G	chr20.hg19:g.34067123A>G	ENSP00000380661:p.Glu721Gly	130.0	0.0	.		148.0	46.0	.	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	hg19	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	A	14.68	2.606924	0.46527	.	.	ENSG00000126001	ENST00000397527;ENST00000342580	T;T	0.11169	2.8;2.85	4.74	4.74	0.60224	.	0.093895	0.46442	D	0.000300	T	0.13500	0.0327	M	0.71581	2.175	0.26978	N	0.965431	B	0.14012	0.009	B	0.15484	0.013	T	0.08046	-1.0741	10	0.45353	T	0.12	.	8.6617	0.34097	0.9136:0.0:0.0864:0.0	.	721	Q9BV73	CP250_HUMAN	G	721	ENSP00000380661:E721G;ENSP00000341541:E721G	ENSP00000341541:E721G	E	+	2	0	CEP250	33530537	0.998000	0.40836	0.870000	0.34147	0.519000	0.34347	0.789000	0.26886	2.118000	0.64928	0.533000	0.62120	GAA	.	.	.	none		0.612	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
CHRNA4	1137	hgsc.bcm.edu	37	20	61982275	61982275	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr20:61982275A>G	ENST00000370263.4	-	5	709	c.488T>C	c.(487-489)aTc>aCc	p.I163T	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	163					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GGTGACGTCGATGCTGCAGGA	0.602																																					p.I163T		Atlas-SNP	.											.	CHRNA4	98	.	0			c.T488C						PASS	.						113.0	103.0	107.0					20																	61982275		2202	4300	6502	SO:0001583	missense	1137	exon5			ACGTCGATGCTGC		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.488T>C	chr20.hg19:g.61982275A>G	ENSP00000359285:p.Ile163Thr	58.0	0.0	.		75.0	13.0	.	NM_000744	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	hg19	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.218747	0.79464	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	D	0.81499	-1.5	4.87	4.87	0.63330	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.92192	0.7524	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	1.0;1.0	D	0.94266	0.7506	10	0.87932	D	0	.	14.4626	0.67462	1.0:0.0:0.0:0.0	.	92;163	Q4VAQ5;P43681	.;ACHA4_HUMAN	T	69;163;92	ENSP00000359285:I163T	ENSP00000359280:I69T	I	-	2	0	CHRNA4	61452719	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.135000	0.94478	1.806000	0.52798	0.459000	0.35465	ATC	.	.	.	none		0.602	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
LZTR1	8216	hgsc.bcm.edu	37	22	21343964	21343964	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr22:21343964G>T	ENST00000215739.8	+	7	1003	c.644G>T	c.(643-645)tGg>tTg	p.W215L	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Missense_Mutation_p.W196L	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	215					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CTCACCTGCTgggaggaggtg	0.647																																					p.W215L		Atlas-SNP	.											.	LZTR1	99	.	0			c.G644T						PASS	.						53.0	42.0	46.0					22																	21343964		2203	4300	6503	SO:0001583	missense	8216	exon7			CCTGCTGGGAGGA	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.644G>T	chr22.hg19:g.21343964G>T	ENSP00000215739:p.Trp215Leu	23.0	0.0	.		16.0	6.0	.	NM_006767	Q14776|Q20WK0	Missense_Mutation	SNP	ENST00000215739.8	hg19	CCDS33606.1	.	.	.	.	.	.	.	.	.	.	G	35	5.532619	0.96446	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	D;D	0.81659	-1.52;-1.52	5.96	5.96	0.96718	Kelch-type beta propeller (1);	0.366329	0.33712	N	0.004632	D	0.91112	0.7202	M	0.89095	3.005	0.80722	D	1	D;D;D;P	0.71674	0.998;0.996;0.978;0.95	P;D;P;P	0.67900	0.903;0.954;0.832;0.487	D	0.92081	0.5672	10	0.87932	D	0	-8.4501	17.8985	0.88896	0.0:0.0:1.0:0.0	.	196;174;215;174	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	L	174;215;196	ENSP00000215739:W215L;ENSP00000374006:W196L	ENSP00000215739:W215L	W	+	2	0	LZTR1	19673964	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.497000	0.97970	2.834000	0.97654	0.650000	0.86243	TGG	.	.	.	none		0.647	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	
MPP1	4354	hgsc.bcm.edu	37	X	154007573	154007573	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chrX:154007573G>C	ENST00000369534.3	-	12	1427	c.1280C>G	c.(1279-1281)gCt>gGt	p.A427G	MPP1_ENST00000413259.3_Missense_Mutation_p.A397G|MPP1_ENST00000393531.1_Missense_Mutation_p.A407G	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	427	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.|Interaction with MPP5.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AAAGTAGTGAGCGTACTGGCT	0.517																																					p.A427G		Atlas-SNP	.											.	MPP1	52	.	0			c.C1280G						PASS	.						101.0	81.0	88.0					X																	154007573		2203	4300	6503	SO:0001583	missense	4354	exon12			TAGTGAGCGTACT		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.1280C>G	chrX.hg19:g.154007573G>C	ENSP00000358547:p.Ala427Gly	187.0	0.0	.		183.0	51.0	.	NM_002436	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	ENST00000369534.3	hg19	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	G	5.893	0.348929	0.11126	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531	T;T;T	0.43294	0.95;0.95;0.95	5.86	5.86	0.93980	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.154571	0.56097	D	0.000023	T	0.31513	0.0799	N	0.25992	0.78	0.47037	D	0.999298	B;B;B;B	0.12013	0.005;0.0;0.0;0.0	B;B;B;B	0.10450	0.004;0.005;0.003;0.003	T	0.13019	-1.0525	10	0.11182	T	0.66	.	17.5546	0.87887	0.0:0.0:1.0:0.0	.	410;397;407;427	B4E325;B4DZV5;G3XAI1;Q00013	.;.;.;EM55_HUMAN	G	427;397;407	ENSP00000358547:A427G;ENSP00000400155:A397G;ENSP00000377165:A407G	ENSP00000358547:A427G	A	-	2	0	MPP1	153660767	0.997000	0.39634	0.644000	0.29465	0.990000	0.78478	5.737000	0.68606	2.465000	0.83290	0.600000	0.82982	GCT	.	.	.	none		0.517	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	
MT-ATP6	4508	hgsc.bcm.edu	37	M	9185	9185	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chrM:9185T>C	ENST00000361899.2	+	1	659	c.659T>C	c.(658-660)cTc>cCc	p.L220P	MT-TD_ENST00000387419.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TK_ENST00000387421.1_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	220					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						TCTAGTAAGCCTCTACCTGCA	0.458																																					p.L220P		Atlas-SNP	.											.	.	.	.	0			c.T659C						PASS	.																																			SO:0001583	missense	0	exon1			TAAGCCTCTACCT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.659T>C	chrM.hg19:g.9185T>C	ENSP00000354632:p.Leu220Pro	46.0	0.0	.		50.0	26.0	.	ENST00000361899	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	ENST00000361899.2	hg19																																																																																				.	.	.	none		0.458	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024031	
SMARCB1	6598	hgsc.bcm.edu	37	22	24167567	24167568	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr22:24167567_24167568delAC	ENST00000263121.7	+	7	1147_1148	c.951_952delAC	c.(949-954)ggacagfs	p.Q318fs	SMARCB1_ENST00000407422.3_Frame_Shift_Del_p.Q309fs|SMARCB1_ENST00000407082.3_Frame_Shift_Del_p.Q272fs|SMARCB1_ENST00000344921.6_Frame_Shift_Del_p.Q327fs	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	318	2 X approximate tandem repeats.|Interaction with PPP1R15A.				ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(6)|p.L266_*386del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				GCATCCGGGGACAGCTGAGCTG	0.545			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.317_317del		Atlas-Indel,Pindel	.	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	.,3	SMARCB1	586	.	7	Unknown(6)|Deletion - In frame(1)	central_nervous_system(6)|soft_tissue(1)	c.950_951del						PASS	.																																			SO:0001589	frameshift_variant	6598	exon7			.	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.951_952delAC	chr22.hg19:g.24167567_24167568delAC	ENSP00000263121:p.Gln318fs	77.0	0.0	0		40.0	22.0	0.55	NM_003073	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Frame_Shift_Del	DEL	ENST00000263121.7	hg19	CCDS13817.1																																																																																			.	.	.	none		0.545	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
ELOVL6	79071	hgsc.bcm.edu	37	4	110980893	110980894	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr4:110980893_110980894delCG	ENST00000394607.3	-	4	401_402	c.238_239delCG	c.(238-240)cgafs	p.R80fs	ELOVL6_ENST00000506461.1_5'UTR|ELOVL6_ENST00000302274.3_Frame_Shift_Del_p.R80fs			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	80					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		AGCACCAGTTCGAAGAGCACCG	0.401																																					p.80_80del		Atlas-Indel,Pindel	.											.	ELOVL6	27	.	0			c.239_240del						PASS	.																																			SO:0001589	frameshift_variant	79071	exon4			.	AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.238_239delCG	chr4.hg19:g.110980893_110980894delCG	ENSP00000378105:p.Arg80fs	176.0	0.0	0		169.0	36.0	0.213018	NM_001130721	Q4W5L0|Q8NCD1	Frame_Shift_Del	DEL	ENST00000394607.3	hg19	CCDS3690.1																																																																																			.	.	.	none		0.401	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255748.1	NM_024090	
TMEM170B	100113407	hgsc.bcm.edu	37	6	11575790	11575797	+	Stop_Codon_Del	DEL	TTTGAGGT	TTTGAGGT	-			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	TTTGAGGT	TTTGAGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr6:11575790_11575797delTTTGAGGT	ENST00000379426.1	+	0	395_402				TMEM170B_ENST00000543875.1_Stop_Codon_Del	NM_001100829.1	NP_001094299.1	Q5T4T1	T170B_HUMAN	transmembrane protein 170B							integral component of membrane (GO:0016021)				large_intestine(3)|lung(5)	8						CTCGCTACACTTTGAGGTTTCTGTGGGA	0.442																																					p.132_133del		Atlas-INDEL	.											.	TMEM170B	9	.	0			c.394_450del						PASS	.																																			SO:0001567	stop_retained_variant	100113407	exon3			.		CCDS43425.1	6p24.1	2008-08-08			ENSG00000205269	ENSG00000205269			34244	protein-coding gene	gene with protein product							Standard	NM_001100829		Approved		uc010jpa.4	Q5T4T1	OTTHUMG00000014259	Exception_encountered	chr6.hg19:g.11575790_11575797delTTTGAGGT	ENSP00000368737:p.*133Trpext*16	61.0	0.0	0		72.0	10.0	0.138889	NM_001100829		Frame_Shift_Del	DEL	ENST00000379426.1	hg19	CCDS43425.1																																																																																			.	.	.	none		0.442	TMEM170B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000039862.1	NM_001100829	
ZMYND10	51364	hgsc.bcm.edu	37	3	50382588	50382598	+	Frame_Shift_Del	DEL	CTCGCCCTGGC	CTCGCCCTGGC	-			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	CTCGCCCTGGC	CTCGCCCTGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr3:50382588_50382598delCTCGCCCTGGC	ENST00000231749.3	-	2	1430_1440	c.158_168delGCCAGGGCGAG	c.(157-168)agccagggcgagfs	p.SQGE53fs	ZMYND10_ENST00000490675.1_5'Flank|ZMYND10-AS1_ENST00000440013.1_RNA|ZMYND10_ENST00000360165.3_Frame_Shift_Del_p.SQGE53fs|NPRL2_ENST00000493465.1_5'Flank	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10	53					inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCTGAATGGGCTCGCCCTGGCTGACTGTGGC	0.602										TSP Lung(30;0.18)																											p.53_57del		Atlas-INDEL	.											.	ZMYND10	37	.	0			c.159_169del						PASS	.																																			SO:0001589	frameshift_variant	51364	exon2			.	U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874	ENST00000231749.3:c.158_168delGCCAGGGCGAG	chr3.hg19:g.50382588_50382598delCTCGCCCTGGC	ENSP00000231749:p.Ser53fs	73.0	0.0	0		45.0	11.0	0.244444	NM_015896	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Frame_Shift_Del	DEL	ENST00000231749.3	hg19	CCDS2825.1																																																																																			.	.	.	none		0.602	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346376.1	NM_015896	
RIC1	57589	hgsc.bcm.edu	37	9	5763340	5763340	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr9:5763340delT	ENST00000414202.2	+	19	2504	c.2313delT	c.(2311-2313)cctfs	p.P771fs	KIAA1432_ENST00000418622.3_Frame_Shift_Del_p.P692fs|KIAA1432_ENST00000381532.2_Frame_Shift_Del_p.P692fs|KIAA1432_ENST00000251879.6_Frame_Shift_Del_p.P771fs|KIAA1432_ENST00000449720.2_Frame_Shift_Del_p.P655fs	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TCATGCTGCCTTTCCACATCA	0.493																																					p.P771fs		Atlas-Indel,Pindel	.											.	KIAA1432	97	.	0			c.2312delC						PASS	.						258.0	237.0	244.0					9																	5763340		2203	4300	6503	SO:0001589	frameshift_variant	57589	exon19			.																												ENST00000414202.2:c.2313delT	chr9.hg19:g.5763340delT	ENSP00000416696:p.Pro771fs	109.0	0.0	0		135.0	44.0	0.325926	NM_001135920		Frame_Shift_Del	DEL	ENST00000414202.2	hg19	CCDS34982.2																																																																																			.	.	.	none		0.493	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
ZNF226	7769	hgsc.bcm.edu	37	19	44677042	44677042	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr19:44677042delC	ENST00000590089.1	+	6	539	c.172delC	c.(172-174)cctfs	p.P58fs	ZNF226_ENST00000588742.1_Frame_Shift_Del_p.P58fs|ZNF226_ENST00000300823.6_Frame_Shift_Del_p.P58fs|ZNF226_ENST00000589160.1_Frame_Shift_Del_p.P58fs|ZNF226_ENST00000413984.2_Frame_Shift_Del_p.P58fs|ZNF226_ENST00000454662.2_Frame_Shift_Del_p.P58fs|ZNF226_ENST00000588795.1_Frame_Shift_Del_p.P58fs|ZNF226_ENST00000337433.5_Frame_Shift_Del_p.P58fs|ZNF226_ENST00000588883.1_Frame_Shift_Del_p.P58fs			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				AGATGTATCACCTATAGAAAG	0.363																																					p.S57fs	Pancreas(115;581 1665 13228 19278 50070)	Atlas-Indel,Pindel	.											.	.	.	.	0			c.171delA						PASS	.						73.0	68.0	69.0					19																	44677042		1872	4108	5980	SO:0001589	frameshift_variant	7769	exon5			.	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.172delC	chr19.hg19:g.44677042delC	ENSP00000465121:p.Pro58fs	273.0	0.0	0		281.0	81.0	0.288256	NM_001032372	Q8WWE6|Q96TE6|Q9NS44	Frame_Shift_Del	DEL	ENST00000590089.1	hg19	CCDS46102.1																																																																																			.	.	.	none		0.363	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
AHNAK	79026	hgsc.bcm.edu	37	11	62294536	62294536	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr11:62294536delG	ENST00000378024.4	-	5	7627	c.7353delC	c.(7351-7353)cccfs	p.P2451fs	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2451					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TAGAAATATTGGGGGCTTTGA	0.453																																					p.N2452fs		Atlas-Indel,Pindel	.											.	AHNAK	532	.	0			c.7354delA						PASS	.						123.0	125.0	125.0					11																	62294536		2202	4299	6501	SO:0001589	frameshift_variant	79026	exon5			.	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.7353delC	chr11.hg19:g.62294536delG	ENSP00000367263:p.Pro2451fs	113.0	0.0	0		116.0	33.0	0.284483	NM_001620	A1A586	Frame_Shift_Del	DEL	ENST00000378024.4	hg19	CCDS31584.1																																																																																			.	.	.	none		0.453	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
LPIN1	23175	hgsc.bcm.edu	37	2	11959665	11959665	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr2:11959665delA	ENST00000256720.2	+	18	2443	c.2350delA	c.(2350-2352)aaafs	p.K784fs	LPIN1_ENST00000449576.2_Frame_Shift_Del_p.K869fs|LPIN1_ENST00000396099.1_Frame_Shift_Del_p.K826fs|LPIN1_ENST00000396097.1_Frame_Shift_Del_p.K514fs|LPIN1_ENST00000425416.2_Frame_Shift_Del_p.K790fs|LPIN1_ENST00000404113.2_Frame_Shift_Del_p.K285fs	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	784	C-LIP.				cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		GACAGACATCAAAAACCTGTT	0.373																																					p.I868fs		Atlas-Indel,Pindel	.											.	LPIN1	99	.	0			c.2604delC						PASS	.						170.0	175.0	173.0					2																	11959665		2203	4300	6503	SO:0001589	frameshift_variant	23175	exon20			.	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.2350delA	chr2.hg19:g.11959665delA	ENSP00000256720:p.Lys784fs	117.0	0.0	0		110.0	37.0	0.336364	NM_001261428	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Frame_Shift_Del	DEL	ENST00000256720.2	hg19	CCDS1682.1																																																																																			.	.	.	none		0.373	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
GDAP2	54834	hgsc.bcm.edu	37	1	118420722	118420723	+	Frame_Shift_Ins	INS	-	-	T			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr1:118420722_118420723insT	ENST00000369443.5	-	13	1603_1604	c.1354_1355insA	c.(1354-1356)atcfs	p.I452fs	GDAP2_ENST00000369442.3_Frame_Shift_Ins_p.I452fs	NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2	452	CRAL-TRIO.				response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)				kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		CACATGGTGGATTTTGTCCTTC	0.401																																					p.I452fs		Atlas-Indel,Pindel	.											.	GDAP2	37	.	0			c.1355_1356insA						PASS	.																																			SO:0001589	frameshift_variant	54834	exon13			.	AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.1355dupA	chr1.hg19:g.118420726_118420726dupT	ENSP00000358451:p.Ile452fs	144.0	0.0	0		160.0	49.0	0.30625	NM_017686	Q96DZ0	Frame_Shift_Ins	INS	ENST00000369443.5	hg19	CCDS897.1																																																																																			.	.	.	none		0.401	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033732.2	NM_017686	
ITGB3	3690	hgsc.bcm.edu	37	17	45380155	45380156	+	Frame_Shift_Ins	INS	-	-	A			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr17:45380155_45380156insA	ENST00000559488.1	+	13	2099_2100	c.2083_2084insA	c.(2083-2085)tacfs	p.Y695fs	RP11-290H9.4_ENST00000576345.1_RNA|ITGB3_ENST00000560629.1_Frame_Shift_Ins_p.L684fs|RP11-290H9.4_ENST00000575039.1_RNA|ITGB3_ENST00000435993.2_Frame_Shift_Ins_p.Y648fs	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	695					activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	CAGATTCCAGTACTATGAAGAT	0.5																																					p.Y695_Y696delinsX		Atlas-Indel,Pindel	.											.	ITGB3	157	.	0			c.2083_2084insA						PASS	.																																			SO:0001589	frameshift_variant	3690	exon13			.		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.2084dupA	chr17.hg19:g.45380156_45380156dupA	ENSP00000452786:p.Tyr695fs	59.0	0.0	0		97.0	29.0	0.298969	NM_000212	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Frame_Shift_Ins	INS	ENST00000559488.1	hg19	CCDS11511.1																																																																																			.	.	.	none		0.500	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
ZMYND10	51364	hgsc.bcm.edu	37	3	50382584	50382594	+	Frame_Shift_Del	DEL	TGGGCTCGCCC	TGGGCTCGCCC	-			TCGA-5P-A9KC-01A-11D-A42J-10	TCGA-5P-A9KC-10A-01D-A42M-10	TGGGCTCGCCC	TGGGCTCGCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6a01a138-dd7b-4d04-b7c1-53e09d984f27	1a9bde7a-dc3e-413a-91fe-bf1fd077ada1	g.chr3:50382584_50382594delTGGGCTCGCCC	ENST00000231749.3	-	2	1434_1444	c.162_172delGGGCGAGCCCA	c.(160-174)cagggcgagcccattfs	p.QGEPI54fs	ZMYND10_ENST00000490675.1_5'Flank|ZMYND10-AS1_ENST00000440013.1_RNA|ZMYND10_ENST00000360165.3_Frame_Shift_Del_p.QGEPI54fs|NPRL2_ENST00000493465.1_5'Flank	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10	54					inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AGCTCCTGAATGGGCTCGCCCTGGCTGACTG	0.607										TSP Lung(30;0.18)																											p.55_58del		Pindel	.											.	ZMYND10	37	.	0			c.163_173del						PASS	.																																			SO:0001589	frameshift_variant	51364	exon2			.	U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874	ENST00000231749.3:c.162_172delGGGCGAGCCCA	chr3.hg19:g.50382584_50382594delTGGGCTCGCCC	ENSP00000231749:p.Gln54fs	74.0	0.0	.		50.0	14.0	0.280	NM_015896	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Frame_Shift_Del	DEL	ENST00000231749.3	hg19	CCDS2825.1																																																																																			.	.	.	none		0.607	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346376.1	NM_015896	
