#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM52	339456	hgsc.bcm.edu	37	1	1850654	1850654	+	Silent	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:1850654G>C	ENST00000310991.3	-	1	58	c.51C>G	c.(49-51)ctC>ctG	p.L17L	TMEM52_ENST00000378602.3_5'Flank	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	17						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ggagcggcaggagcggcagca	0.771																																					p.L17L		Atlas-SNP	.											TMEM52,NS,carcinoma,0,1	TMEM52	21	.	0			c.C51G						PASS	.						1.0	2.0	1.0					1																	1850654		671	1684	2355	SO:0001819	synonymous_variant	339456	exon1			CGGCAGGAGCGGC	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.51C>G	chr1.hg19:g.1850654G>C		11.0	0.0	.		9.0	2.0	.	NM_178545	Q4VXS6|Q6UX25	Silent	SNP	ENST00000310991.3	hg19	CCDS35.1	.	.	.	.	.	.	.	.	.	.	.	4.530	0.098402	0.08681	.	.	ENSG00000178821	ENST00000378598	.	.	.	0.149	0.149	0.14863	.	.	.	.	.	T	0.39489	0.1080	.	.	.	0.22446	N	0.999091	.	.	.	.	.	.	T	0.39035	-0.9633	4	0.87932	D	0	.	.	.	.	.	.	.	.	C	15	.	ENSP00000367861:S15C	S	-	2	0	TMEM52	1840514	0.001000	0.12720	0.009000	0.14445	0.010000	0.07245	0.286000	0.18902	0.192000	0.20272	0.195000	0.17529	TCC	.	.	.	none		0.771	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002781.1	NM_178545	
CHD5	26038	hgsc.bcm.edu	37	1	6212475	6212475	+	Silent	SNP	G	G	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:6212475G>T	ENST00000262450.3	-	6	966	c.867C>A	c.(865-867)tcC>tcA	p.S289S	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		cactcacCGAGGAGCCTTTCT	0.552																																					p.S289S		Atlas-SNP	.											.	CHD5	267	.	0			c.C867A						PASS	.						128.0	103.0	111.0					1																	6212475		2203	4300	6503	SO:0001819	synonymous_variant	26038	exon6			CACCGAGGAGCCT	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.867C>A	chr1.hg19:g.6212475G>T		44.0	0.0	.		42.0	7.0	.	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	ENST00000262450.3	hg19	CCDS57.1																																																																																			.	.	.	none		0.552	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
GCLM	2730	hgsc.bcm.edu	37	1	94360206	94360206	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:94360206A>G	ENST00000370238.3	-	6	865	c.619T>C	c.(619-621)Ttt>Ctt	p.F207L	GCLM_ENST00000467772.1_5'UTR	NM_002061.2	NP_002052.1	P48507	GSH0_HUMAN	glutamate-cysteine ligase, modifier subunit	207					apoptotic mitochondrial changes (GO:0008637)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of glutamate-cysteine ligase activity (GO:0035229)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	glutamate-cysteine ligase activity (GO:0004357)|glutamate-cysteine ligase catalytic subunit binding (GO:0035226)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)	TGTATGTCAAATTGTTTAGCA	0.328																																					p.F207L		Atlas-SNP	.											.	GCLM	20	.	0			c.T619C						PASS	.						149.0	145.0	146.0					1																	94360206		2203	4300	6503	SO:0001583	missense	2730	exon6			TGTCAAATTGTTT	L35546	CCDS746.1	1p21	2008-02-05			ENSG00000023909	ENSG00000023909	6.3.2.2		4312	protein-coding gene	gene with protein product	"""gamma-glutamylcysteine synthetase"""	601176		GLCLR		7826375	Standard	NM_002061		Approved		uc001dqg.1	P48507	OTTHUMG00000010562	ENST00000370238.3:c.619T>C	chr1.hg19:g.94360206A>G	ENSP00000359258:p.Phe207Leu	81.0	0.0	.		61.0	12.0	.	NM_002061	A8K334|D3DT45|M5A959|Q6FHC1|Q9NPX9|Q9NU74	Missense_Mutation	SNP	ENST00000370238.3	hg19	CCDS746.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220456	0.79464	.	.	ENSG00000023909	ENST00000370238	T	0.38560	1.13	5.94	5.94	0.96194	NADP-dependent oxidoreductase domain (2);	0.000000	0.85682	D	0.000000	T	0.29423	0.0733	M	0.63428	1.95	0.58432	D	0.999999	B	0.30146	0.27	B	0.31812	0.136	T	0.10543	-1.0625	10	0.24483	T	0.36	.	16.4127	0.83723	1.0:0.0:0.0:0.0	.	207	P48507	GSH0_HUMAN	L	207	ENSP00000359258:F207L	ENSP00000359258:F207L	F	-	1	0	GCLM	94132794	1.000000	0.71417	0.994000	0.49952	0.952000	0.60782	9.251000	0.95483	2.279000	0.76181	0.528000	0.53228	TTT	.	.	.	none		0.328	GCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029169.1	NM_002061	
ATXN7L2	127002	hgsc.bcm.edu	37	1	110035211	110035211	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:110035211A>G	ENST00000369870.3	+	11	2173	c.2158A>G	c.(2158-2160)Aaa>Gaa	p.K720E	ATXN7L2_ENST00000459635.1_3'UTR|CYB561D1_ENST00000430195.2_5'Flank|CYB561D1_ENST00000527072.1_5'Flank|CYB561D1_ENST00000420578.2_5'Flank|CYB561D1_ENST00000528785.1_5'Flank|CYB561D1_ENST00000533024.1_5'Flank|CYB561D1_ENST00000310611.4_5'Flank|CYB561D1_ENST00000393709.3_5'Flank|CYB561D1_ENST00000496961.1_5'Flank|CYB561D1_ENST00000369868.3_5'Flank	NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	720										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		CCTGCAGTCAAAAGCCCATTA	0.572																																					p.K720E		Atlas-SNP	.											.	ATXN7L2	60	.	0			c.A2158G						PASS	.						166.0	165.0	166.0					1																	110035211		2203	4300	6503	SO:0001583	missense	127002	exon11			CAGTCAAAAGCCC	BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.2158A>G	chr1.hg19:g.110035211A>G	ENSP00000358886:p.Lys720Glu	73.0	0.0	.		74.0	17.0	.	NM_153340		Missense_Mutation	SNP	ENST00000369870.3	hg19	CCDS30794.1	.	.	.	.	.	.	.	.	.	.	A	15.78	2.935311	0.52866	.	.	ENSG00000162650	ENST00000369870;ENST00000369869	T	0.36157	1.27	4.9	4.9	0.64082	.	1.139640	0.06543	N	0.743509	T	0.28764	0.0713	N	0.08118	0	0.36581	D	0.873544	D	0.63880	0.993	D	0.70935	0.971	T	0.09975	-1.0650	10	0.66056	D	0.02	25.5507	10.8481	0.46754	1.0:0.0:0.0:0.0	.	720	Q5T6C5	AT7L2_HUMAN	E	720;347	ENSP00000358886:K720E	ENSP00000358885:K347E	K	+	1	0	ATXN7L2	109836734	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.732000	0.62029	2.064000	0.61679	0.459000	0.35465	AAA	.	.	.	none		0.572	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030331.1	NM_153340	
TRIM33	51592	hgsc.bcm.edu	37	1	114942184	114942184	+	Silent	SNP	G	G	A	rs376287925		TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:114942184G>A	ENST00000358465.2	-	18	3098	c.3015C>T	c.(3013-3015)acC>acT	p.T1005T	TRIM33_ENST00000450349.2_Silent_p.T637T|TRIM33_ENST00000369543.2_Silent_p.T1005T	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	1005	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTTTTTCACGGTGGATAAAT	0.348			T	RET	papillary thyroid								G|||	1	0.000199681	0.0	0.0	5008	,	,		13211	0.0		0.0	False		,,,				2504	0.001				p.T1005T		Atlas-SNP	.		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	TRIM33	115	.	0			c.C3015T						PASS	.	G	,	0,4406		0,0,2203	120.0	131.0	127.0		3015,3015	-2.2	1.0	1		127	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TRIM33	NM_015906.3,NM_033020.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	1005/1128,1005/1111	114942184	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	51592	exon18			TTTCACGGTGGAT	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.3015C>T	chr1.hg19:g.114942184G>A		71.0	0.0	.		70.0	19.0	.	NM_033020	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Silent	SNP	ENST00000358465.2	hg19	CCDS872.1	.	.	.	.	.	.	.	.	.	.	G	9.579	1.123105	0.20959	0.0	1.16E-4	ENSG00000197323	ENST00000448034	.	.	.	5.61	-2.2	0.06994	.	.	.	.	.	T	0.23532	0.0569	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32268	-0.9913	4	.	.	.	-9.9523	2.2583	0.04060	0.143:0.2503:0.1421:0.4645	.	.	.	.	L	766	.	.	P	-	2	0	TRIM33	114743707	0.082000	0.21442	0.998000	0.56505	0.999000	0.98932	-0.593000	0.05740	-0.013000	0.14199	0.650000	0.86243	CCG	.	.	.	none		0.348	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
VTCN1	79679	hgsc.bcm.edu	37	1	117699520	117699520	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:117699520T>C	ENST00000369458.3	-	3	199	c.121A>G	c.(121-123)Act>Gct	p.T41A	VTCN1_ENST00000539893.1_5'UTR|VTCN1_ENST00000463461.1_5'UTR|VTCN1_ENST00000328189.3_Intron|VTCN1_ENST00000359008.4_Missense_Mutation_p.T44A	NM_024626.3	NP_078902.2			V-set domain containing T cell activation inhibitor 1											large_intestine(7)|lung(4)|upper_aerodigestive_tract(1)	12	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		GAGGCGACAGTAGTGACTGTG	0.473																																					p.T41A		Atlas-SNP	.											.	VTCN1	26	.	0			c.A121G						PASS	.						68.0	65.0	66.0					1																	117699520		2203	4300	6503	SO:0001583	missense	79679	exon3			CGACAGTAGTGAC	BX648021	CCDS894.1, CCDS58019.1, CCDS58020.1	1p12	2013-01-29			ENSG00000134258	ENSG00000134258		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28873	protein-coding gene	gene with protein product	"""B7 family member, H4"", ""B7 superfamily member 1"""	608162				12818165, 12818166	Standard	NM_024626		Approved	B7-H4, FLJ22418, B7S1, B7X, B7H4	uc001ehb.3	Q7Z7D3	OTTHUMG00000012118	ENST00000369458.3:c.121A>G	chr1.hg19:g.117699520T>C	ENSP00000358470:p.Thr41Ala	54.0	0.0	.		45.0	13.0	.	NM_024626		Missense_Mutation	SNP	ENST00000369458.3	hg19	CCDS894.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.374|2.374	-0.343751|-0.343751	0.05208|0.05208	.|.	.|.	ENSG00000134258|ENSG00000134258	ENST00000369458;ENST00000359008|ENST00000369456	T;T|.	0.06142|.	3.35;3.34|.	5.88|5.88	4.76|4.76	0.60689|0.60689	Immunoglobulin subtype (1);|.	0.094559|.	0.47093|.	D|.	0.000254|.	T|T	0.10035|0.10035	0.0246|0.0246	N|N	0.00926|0.00926	-1.1|-1.1	0.44462|0.44462	D|D	0.997391|0.997391	B|.	0.21381|.	0.055|.	B|.	0.20955|.	0.032|.	T|T	0.10245|0.10245	-1.0638|-1.0638	10|6	0.07813|0.87932	T|D	0.8|0	-7.9789|-7.9789	7.5709|7.5709	0.27907|0.27907	0.0:0.1647:0.0:0.8353|0.0:0.1647:0.0:0.8353	.|.	41|.	Q7Z7D3|.	VTCN1_HUMAN|.	A|C	41;44|68	ENSP00000358470:T41A;ENSP00000351899:T44A|.	ENSP00000351899:T44A|ENSP00000358468:Y68C	T|Y	-|-	1|2	0|0	VTCN1|VTCN1	117501043|117501043	0.964000|0.964000	0.33143|0.33143	0.078000|0.078000	0.20375|0.20375	0.059000|0.059000	0.15707|0.15707	2.478000|2.478000	0.45189|0.45189	1.060000|1.060000	0.40578|0.40578	-0.270000|-0.270000	0.10280|0.10280	ACT|TAC	.	.	.	none		0.473	VTCN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000033500.2	NM_024626	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144881617	144881617	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:144881617A>T	ENST00000369354.3	-	25	3768	c.3579T>A	c.(3577-3579)gaT>gaA	p.D1193E	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.D1330E|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.D1330E|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.D1193E|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.D1149E			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1193					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGGACTGGTTATCCAACTGTG	0.582			T	PDGFRB	MPD																																p.D1193E		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.T3579A						PASS	.						77.0	70.0	73.0					1																	144881617		2203	4296	6499	SO:0001583	missense	9659	exon25			CTGGTTATCCAAC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3579T>A	chr1.hg19:g.144881617A>T	ENSP00000358360:p.Asp1193Glu	65.0	0.0	.		78.0	10.0	.	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.120|0.120	-1.126364|-1.126364	0.01770|0.01770	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359|ENST00000530592	T;T;T;T;T|.	0.01495|.	4.83;4.91;4.91;4.91;4.91|.	5.44|5.44	-2.4|-2.4	0.06583|0.06583	.|.	.|.	.|.	.|.	.|.	T|.	0.12135|.	0.0295|.	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	0.999995|0.999995	B;B|.	0.12013|.	0.002;0.005|.	B;B|.	0.12156|.	0.004;0.007|.	T|.	0.34378|.	-0.9831|.	9|.	0.07175|.	T|.	0.84|.	.|.	6.5931|6.5931	0.22658|0.22658	0.3516:0.171:0.4774:0.0|0.3516:0.171:0.4774:0.0	.|.	1149;1193|.	Q5VU43-3;Q5VU43|.	.;MYOME_HUMAN|.	E|K	1149;1193;1193;1330;1330|88	ENSP00000327209:D1149E;ENSP00000358360:D1193E;ENSP00000358363:D1193E;ENSP00000435654:D1330E;ENSP00000358366:D1330E|.	ENSP00000327209:D1149E|.	D|X	-|-	3|1	2|0	PDE4DIP|PDE4DIP	143592974|143592974	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.018000|0.018000	0.09664|0.09664	-0.226000|-0.226000	0.09139|0.09139	-0.300000|-0.300000	0.08895|0.08895	-0.256000|-0.256000	0.11100|0.11100	GAT|TAA	.	.	.	none		0.582	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
CCT3	7203	hgsc.bcm.edu	37	1	156279019	156279019	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:156279019C>G	ENST00000295688.3	-	14	1889	c.1609G>C	c.(1609-1611)Ggc>Cgc	p.G537R	CCT3_ENST00000368261.3_Missense_Mutation_p.G492R|CCT3_ENST00000472765.2_Missense_Mutation_p.G492R|CCT3_ENST00000368259.2_Missense_Mutation_p.G499R	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	537					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GGAGCCCCGCCTTGCCGGCTC	0.537																																					p.G537R		Atlas-SNP	.											.	CCT3	61	.	0			c.G1609C						PASS	.						112.0	119.0	116.0					1																	156279019		2203	4300	6503	SO:0001583	missense	7203	exon14			CCCCGCCTTGCCG	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.1609G>C	chr1.hg19:g.156279019C>G	ENSP00000295688:p.Gly537Arg	52.0	0.0	.		39.0	8.0	.	NM_005998	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	hg19	CCDS1140.2	.	.	.	.	.	.	.	.	.	.	C	13.57	2.276772	0.40294	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	T;T;T;T	0.78481	-1.18;-0.54;-0.61;-0.61	5.43	1.47	0.22746	.	0.687378	0.13466	N	0.385795	T	0.52403	0.1732	L	0.58101	1.795	0.26422	N	0.976086	B;B;B	0.27732	0.187;0.117;0.039	B;B;B	0.32342	0.144;0.068;0.089	T	0.47446	-0.9117	10	0.38643	T	0.18	-0.6586	3.7531	0.08575	0.17:0.5583:0.0:0.2717	.	499;536;537	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	R	537;499;492;492	ENSP00000295688:G537R;ENSP00000357242:G499R;ENSP00000357244:G492R;ENSP00000431543:G492R	ENSP00000295688:G537R	G	-	1	0	CCT3	154545643	0.035000	0.19736	0.167000	0.22817	0.977000	0.68977	0.217000	0.17603	0.117000	0.18138	0.650000	0.86243	GGC	.	.	.	none		0.537	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
SPTA1	6708	hgsc.bcm.edu	37	1	158621173	158621173	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:158621173C>G	ENST00000368147.4	-	24	3641	c.3461G>C	c.(3460-3462)gGa>gCa	p.G1154A		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1154					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GATTTGAGCTCCTTCTGGTGT	0.438																																					p.G1154A		Atlas-SNP	.											.	SPTA1	720	.	0			c.G3461C						PASS	.						209.0	207.0	208.0					1																	158621173		1885	4104	5989	SO:0001583	missense	6708	exon24			TGAGCTCCTTCTG	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3461G>C	chr1.hg19:g.158621173C>G	ENSP00000357129:p.Gly1154Ala	104.0	0.0	.		105.0	26.0	.	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.991563	0.35131	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.65178	-0.14;-0.14	4.66	4.66	0.58398	.	.	.	.	.	T	0.28067	0.0692	N	0.05574	-0.02	0.38698	D	0.952926	B	0.15930	0.015	B	0.26614	0.071	T	0.18555	-1.0333	9	0.51188	T	0.08	.	10.5066	0.44836	0.1931:0.8069:0.0:0.0	.	1154	P02549	SPTA1_HUMAN	A	1154	ENSP00000357130:G1154A;ENSP00000357129:G1154A	ENSP00000357129:G1154A	G	-	2	0	SPTA1	156887797	1.000000	0.71417	0.998000	0.56505	0.932000	0.56968	0.505000	0.22642	2.572000	0.86782	0.655000	0.94253	GGA	.	.	.	none		0.438	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
C1orf74	148304	hgsc.bcm.edu	37	1	209956492	209956492	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:209956492T>C	ENST00000294811.1	-	2	744	c.488A>G	c.(487-489)cAt>cGt	p.H163R		NM_152485.2	NP_689698.1	Q96LT6	CA074_HUMAN	chromosome 1 open reading frame 74	163										endometrium(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	15				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		GTCTGAGGAATGGAGCCTGCT	0.517																																					p.H163R		Atlas-SNP	.											.	C1orf74	30	.	0			c.A488G						PASS	.						83.0	86.0	85.0					1																	209956492		2203	4300	6503	SO:0001583	missense	148304	exon2			GAGGAATGGAGCC	AK057807	CCDS1491.1	1q32.2	2008-02-05			ENSG00000162757	ENSG00000162757			26319	protein-coding gene	gene with protein product						12477932	Standard	NM_152485		Approved	FLJ25078	uc001hhp.1	Q96LT6	OTTHUMG00000036483	ENST00000294811.1:c.488A>G	chr1.hg19:g.209956492T>C	ENSP00000294811:p.His163Arg	117.0	0.0	.		89.0	24.0	.	NM_152485		Missense_Mutation	SNP	ENST00000294811.1	hg19	CCDS1491.1	.	.	.	.	.	.	.	.	.	.	T	6.835	0.523237	0.13066	.	.	ENSG00000162757	ENST00000294811	T	0.41400	1.0	5.51	-1.42	0.08913	.	1.329280	0.04580	N	0.394789	T	0.20861	0.0502	N	0.12746	0.255	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11012	-1.0605	10	0.25106	T	0.35	0.017	1.6047	0.02681	0.2356:0.0875:0.2398:0.4371	.	163	Q96LT6	CA074_HUMAN	R	163	ENSP00000294811:H163R	ENSP00000294811:H163R	H	-	2	0	C1orf74	208023115	0.000000	0.05858	0.002000	0.10522	0.895000	0.52256	-0.733000	0.04898	-0.187000	0.10516	0.533000	0.62120	CAT	.	.	.	none		0.517	C1orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088745.1	NM_152485	
USH2A	7399	hgsc.bcm.edu	37	1	216595303	216595303	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr1:216595303T>C	ENST00000307340.3	-	2	762	c.376A>G	c.(376-378)Agt>Ggt	p.S126G	USH2A_ENST00000366942.3_Missense_Mutation_p.S126G|USH2A_ENST00000366943.2_Missense_Mutation_p.S126G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	126					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAAATAAAACTTGCAGAATTG	0.453										HNSCC(13;0.011)																											p.S126G		Atlas-SNP	.											.	USH2A	1168	.	0			c.A376G						PASS	.						96.0	94.0	95.0					1																	216595303		2203	4300	6503	SO:0001583	missense	7399	exon2			TAAAACTTGCAGA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.376A>G	chr1.hg19:g.216595303T>C	ENSP00000305941:p.Ser126Gly	112.0	0.0	.		110.0	27.0	.	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.050033	0.75846	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.65732	-0.17;-0.17;-0.17	5.42	5.42	0.78866	Concanavalin A-like lectin/glucanase (1);	0.000000	0.49916	U	0.000121	T	0.78329	0.4266	M	0.72118	2.19	0.53688	D	0.99997	D;D	0.89917	0.999;1.0	D;D	0.87578	0.96;0.998	T	0.81123	-0.1076	10	0.87932	D	0	.	15.45	0.75265	0.0:0.0:0.0:1.0	.	126;126	O75445-2;O75445	.;USH2A_HUMAN	G	126	ENSP00000305941:S126G;ENSP00000355910:S126G;ENSP00000355909:S126G	ENSP00000305941:S126G	S	-	1	0	USH2A	214661926	1.000000	0.71417	0.736000	0.30914	0.839000	0.47603	4.527000	0.60573	2.057000	0.61298	0.482000	0.46254	AGT	.	.	.	none		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
SMYD1	150572	hgsc.bcm.edu	37	2	88390544	88390544	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr2:88390544G>C	ENST00000419482.2	+	4	627	c.542G>C	c.(541-543)gGt>gCt	p.G181A	SMYD1_ENST00000444564.2_Missense_Mutation_p.G181A|SMYD1_ENST00000438570.1_Intron|SMYD1_ENST00000468008.1_3'UTR	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	181	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						AACTGCAACGGTTTTACTCTC	0.493																																					p.G181A		Atlas-SNP	.											.	SMYD1	95	.	0			c.G542C						PASS	.						172.0	171.0	171.0					2																	88390544		2203	4300	6503	SO:0001583	missense	150572	exon4			GCAACGGTTTTAC	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.542G>C	chr2.hg19:g.88390544G>C	ENSP00000393453:p.Gly181Ala	49.0	0.0	.		41.0	10.0	.	NM_198274	A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	hg19	CCDS33240.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.911492	0.33721	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000295833	T;T	0.11277	2.79;2.79	5.2	4.26	0.50523	SET domain (2);	0.095655	0.64402	D	0.000001	T	0.07324	0.0185	N	0.05230	-0.09	0.80722	D	1	P	0.36110	0.537	B	0.41332	0.354	T	0.49771	-0.8904	10	0.18276	T	0.48	-12.1291	15.8949	0.79326	0.0:0.217:0.783:0.0	.	181	Q8NB12	SMYD1_HUMAN	A	181;181;15	ENSP00000393453:G181A;ENSP00000407888:G181A	ENSP00000295833:G15A	G	+	2	0	SMYD1	88171659	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.135000	0.57997	2.575000	0.86900	0.561000	0.74099	GGT	.	.	.	none		0.493	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
DDX18	8886	hgsc.bcm.edu	37	2	118578868	118578868	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr2:118578868G>A	ENST00000263239.2	+	4	774	c.646G>A	c.(646-648)Ggc>Agc	p.G216S	DDX18_ENST00000474694.1_3'UTR	NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	216	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ACTTCTGGAAGGCAGGTATGA	0.313																																					p.G216S		Atlas-SNP	.											.	DDX18	79	.	0			c.G646A						PASS	.						76.0	78.0	77.0					2																	118578868		2203	4299	6502	SO:0001583	missense	8886	exon4			CTGGAAGGCAGGT	X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.646G>A	chr2.hg19:g.118578868G>A	ENSP00000263239:p.Gly216Ser	233.0	0.0	.		202.0	58.0	.	NM_006773	Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Missense_Mutation	SNP	ENST00000263239.2	hg19	CCDS2120.1	.	.	.	.	.	.	.	.	.	.	G	33	5.248238	0.95305	.	.	ENSG00000088205	ENST00000263239	T	0.18810	2.19	5.0	5.0	0.66597	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.049310	0.85682	N	0.000000	T	0.50429	0.1615	M	0.85945	2.785	0.80722	D	1	D	0.64830	0.994	D	0.66351	0.943	T	0.56643	-0.7945	10	0.87932	D	0	-0.8536	17.0203	0.86432	0.0:0.0:1.0:0.0	.	216	Q9NVP1	DDX18_HUMAN	S	216	ENSP00000263239:G216S	ENSP00000263239:G216S	G	+	1	0	DDX18	118295338	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.070000	0.93974	2.775000	0.95449	0.650000	0.86243	GGC	.	.	.	none		0.313	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129632.3	NM_006773	
LRP2	4036	hgsc.bcm.edu	37	2	170062024	170062024	+	Silent	SNP	A	A	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr2:170062024A>G	ENST00000263816.3	-	41	7965	c.7680T>C	c.(7678-7680)taT>taC	p.Y2560Y		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2560					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGTCCTCTTCATAGTCCAGAG	0.483																																					p.Y2560Y		Atlas-SNP	.											.	LRP2	751	.	0			c.T7680C						PASS	.						118.0	109.0	112.0					2																	170062024		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon41			CTCTTCATAGTCC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7680T>C	chr2.hg19:g.170062024A>G		62.0	0.0	.		64.0	21.0	.	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	hg19	CCDS2232.1																																																																																			.	.	.	none		0.483	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	hgsc.bcm.edu	37	2	179466287	179466287	+	Silent	SNP	T	T	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr2:179466287T>A	ENST00000591111.1	-	237	50738	c.50514A>T	c.(50512-50514)gtA>gtT	p.V16838V	TTN_ENST00000359218.5_Silent_p.V9539V|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Silent_p.V9414V|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.V18479V|TTN_ENST00000342992.6_Silent_p.V15911V|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Silent_p.V9606V|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16838					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGGGCCTGGTACATCTGTTG	0.393																																					p.V18479V		Atlas-SNP	.											.	TTN	18412	.	0			c.A55437T						PASS	.						190.0	172.0	178.0					2																	179466287		1883	4105	5988	SO:0001819	synonymous_variant	7273	exon287			GCCTGGTACATCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50514A>T	chr2.hg19:g.179466287T>A		38.0	0.0	.		45.0	10.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CALCRL	10203	hgsc.bcm.edu	37	2	188245407	188245407	+	Missense_Mutation	SNP	A	A	T	rs374525357		TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr2:188245407A>T	ENST00000409998.1	-	7	1073	c.292T>A	c.(292-294)Tca>Aca	p.S98T	AC007319.1_ENST00000453517.1_RNA|CALCRL_ENST00000410068.1_Missense_Mutation_p.S98T|CALCRL_ENST00000392370.3_Missense_Mutation_p.S98T|AC007319.1_ENST00000412276.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	98					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)	p.S98T(1)		endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			CTTTTACCTGATGGATCAAAG	0.378																																					p.S98T		Atlas-SNP	.											CALCRL,caecum,carcinoma,0,1	CALCRL	73	.	1	Substitution - Missense(1)	large_intestine(1)	c.T292A						PASS	.	A	THR/SER	0,4406		0,0,2203	70.0	68.0	68.0		292	2.8	1.0	2		68	1,8599	1.2+/-3.3	0,1,4299	no	missense	CALCRL	NM_005795.4	58	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	benign	98/462	188245407	1,13005	2203	4300	6503	SO:0001583	missense	10203	exon5			TACCTGATGGATC	U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.292T>A	chr2.hg19:g.188245407A>T	ENSP00000386972:p.Ser98Thr	150.0	0.0	.		138.0	22.0	.	NM_001271751	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	hg19	CCDS2293.1	.	.	.	.	.	.	.	.	.	.	A	9.664	1.144967	0.21288	0.0	1.16E-4	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.52295	0.67;0.67;0.67	5.3	2.75	0.32379	GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.53938	D	0.000056	T	0.20414	0.0491	N	0.04090	-0.28	0.47183	D	0.999341	B	0.09022	0.002	B	0.10450	0.005	T	0.07366	-1.0776	10	0.07813	T	0.8	.	9.1592	0.37012	0.7122:0.0:0.0:0.2878	.	98	Q16602	CALRL_HUMAN	T	98	ENSP00000376177:S98T;ENSP00000386972:S98T;ENSP00000387190:S98T	ENSP00000376177:S98T	S	-	1	0	CALCRL	187953652	1.000000	0.71417	0.993000	0.49108	0.940000	0.58332	5.513000	0.67037	1.005000	0.39183	0.460000	0.39030	TCA	.	.	.	weak		0.378	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795	
CCNYL1	151195	hgsc.bcm.edu	37	2	208576635	208576635	+	Silent	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr2:208576635G>A	ENST00000295414.3	+	1	226	c.15G>A	c.(13-15)ctG>ctA	p.L5L	CCNYL1_ENST00000339882.5_Silent_p.L5L|CCNYL1_ENST00000392209.3_Intron|CCNYL1_ENST00000420822.1_Silent_p.L5L			Q8N7R7	CCYL1_HUMAN	cyclin Y-like 1	5					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					endometrium(1)|large_intestine(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0731)|Epithelial(149;0.139)|Lung(261;0.14)		GGAACACGCTGACCTGTTGCG	0.711																																					p.L5L		Atlas-SNP	.											.	CCNYL1	15	.	0			c.G15A						PASS	.						14.0	25.0	22.0					2																	208576635		689	1587	2276	SO:0001819	synonymous_variant	151195	exon1			CACGCTGACCTGT	AK095479	CCDS2377.1, CCDS46503.1	2q33.3	2008-02-05			ENSG00000163249	ENSG00000163249			26868	protein-coding gene	gene with protein product							Standard	NM_152523		Approved	FLJ40432	uc002vci.3	Q8N7R7	OTTHUMG00000132946	ENST00000295414.3:c.15G>A	chr2.hg19:g.208576635G>A		131.0	0.0	.		97.0	24.0	.	NM_001142300	Q6NX60	Silent	SNP	ENST00000295414.3	hg19																																																																																				.	.	.	none		0.711	CCNYL1-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000337062.1	NM_152523	
ITM2C	81618	hgsc.bcm.edu	37	2	231741620	231741620	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr2:231741620G>C	ENST00000326427.6	+	4	625	c.499G>C	c.(499-501)Gaa>Caa	p.E167Q	ITM2C_ENST00000326407.6_Intron|ITM2C_ENST00000409704.2_Missense_Mutation_p.E105Q|ITM2C_ENST00000335005.6_Missense_Mutation_p.E120Q|ITM2C_ENST00000492029.1_3'UTR	NM_030926.4	NP_112188.1	Q9NQX7	ITM2C_HUMAN	integral membrane protein 2C	167	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			cervix(2)|lung(1)|ovary(1)|skin(1)	5		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;8.47e-12)|all cancers(144;3.44e-09)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CTATGTCATCGAACTCAACAC	0.577																																					p.E167Q		Atlas-SNP	.											ITM2C,NS,carcinoma,0,3	ITM2C	17	.	0			c.G499C						PASS	.						178.0	160.0	166.0					2																	231741620		2203	4300	6503	SO:0001583	missense	81618	exon4			GTCATCGAACTCA	AF038953	CCDS2479.1, CCDS33395.1, CCDS33396.1, CCDS74665.1	2q37	2012-10-10			ENSG00000135916	ENSG00000135916		"""BRICHOS domain containing"""	6175	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2C"""	609554				9653160	Standard	NM_030926		Approved	BRI3, E25, hRPC.1050_D_4, ITM3, BRICD2C	uc002vqz.3	Q9NQX7	OTTHUMG00000133219	ENST00000326427.6:c.499G>C	chr2.hg19:g.231741620G>C	ENSP00000322730:p.Glu167Gln	61.0	0.0	.		44.0	9.0	.	NM_030926	B3KPG4|Q4G0A8|Q53H84|Q6IAE7|Q86VK5|Q8N288|Q8TAW0|Q9BUP8	Missense_Mutation	SNP	ENST00000326427.6	hg19	CCDS2479.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.949503	0.92660	.	.	ENSG00000135916	ENST00000457215;ENST00000541852;ENST00000326427;ENST00000335005;ENST00000543957;ENST00000409704;ENST00000418408	T;T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	5.8	5.8	0.92144	BRICHOS (2);	0.000000	0.85682	D	0.000000	D	0.85978	0.5823	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.86536	0.1825	10	0.72032	D	0.01	-1.6305	15.5631	0.76266	0.0:0.0:1.0:0.0	.	120;167	Q9NQX7-2;Q9NQX7	.;ITM2C_HUMAN	Q	167;105;167;120;105;105;105	ENSP00000390655:E167Q;ENSP00000440295:E105Q;ENSP00000322730:E167Q;ENSP00000335121:E120Q;ENSP00000444899:E105Q;ENSP00000387242:E105Q;ENSP00000403257:E105Q	ENSP00000322730:E167Q	E	+	1	0	ITM2C	231449864	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.243000	0.72384	2.735000	0.93741	0.655000	0.94253	GAA	.	.	.	none		0.577	ITM2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256954.2	NM_030926	
SEC13	6396	hgsc.bcm.edu	37	3	10346761	10346761	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr3:10346761G>A	ENST00000350697.3	-	7	789	c.664C>T	c.(664-666)Ccc>Tcc	p.P222S	SEC13_ENST00000397109.3_Missense_Mutation_p.P208S|SEC13_ENST00000492602.1_5'Flank|SEC13_ENST00000397117.1_Missense_Mutation_p.P208S|SEC13_ENST00000337354.4_Missense_Mutation_p.P225S|SEC13_ENST00000383801.2_Missense_Mutation_p.P268S	NM_183352.1	NP_899195.1	P55735	SEC13_HUMAN	SEC13 homolog (S. cerevisiae)	222					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17						CCGATGGAGGGGGCCCAGGCC	0.612																																					p.P222S		Atlas-SNP	.											.	SEC13	35	.	0			c.C664T						PASS	.						99.0	91.0	93.0					3																	10346761		2203	4300	6503	SO:0001583	missense	6396	exon7			TGGAGGGGGCCCA		CCDS2599.1, CCDS46751.1, CCDS63540.1	3p25-p24	2013-01-10	2006-11-07	2006-11-07	ENSG00000157020	ENSG00000157020		"""WD repeat domain containing"""	10697	protein-coding gene	gene with protein product		600152	"""SEC13 (S. cerevisiae)-like 1"", ""SEC13-like 1 (S. cerevisiae)"""	D3S1231E, SEC13L1		7987303	Standard	NM_183352		Approved	SEC13R, npp-20	uc003bvn.3	P55735	OTTHUMG00000128671	ENST00000350697.3:c.664C>T	chr3.hg19:g.10346761G>A	ENSP00000312122:p.Pro222Ser	35.0	0.0	.		60.0	17.0	.	NM_183352	A8MV37|B4DXJ1|Q5BJF0|Q9BRM6|Q9BUG7	Missense_Mutation	SNP	ENST00000350697.3	hg19	CCDS2599.1	.	.	.	.	.	.	.	.	.	.	G	32	5.123386	0.94429	.	.	ENSG00000157020	ENST00000397109;ENST00000337354;ENST00000350697;ENST00000397117;ENST00000383801	T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83348	0.5235	M	0.72576	2.205	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.998;1.0	T	0.82995	-0.0180	9	.	.	.	.	17.1466	0.86767	0.0:0.0:1.0:0.0	.	222;208;268;222	E9PHR5;A8MXL6;B4DXJ1;P55735	.;.;.;SEC13_HUMAN	S	208;225;222;208;268	ENSP00000380298:P208S;ENSP00000336566:P225S;ENSP00000312122:P222S;ENSP00000380306:P208S;ENSP00000373312:P268S	.	P	-	1	0	SEC13	10321761	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.727000	0.98787	2.646000	0.89796	0.655000	0.94253	CCC	.	.	.	none		0.612	SEC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250563.3		
CTNNB1	1499	hgsc.bcm.edu	37	3	41268729	41268729	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr3:41268729G>C	ENST00000349496.5	+	7	1247	c.967G>C	c.(967-969)Gct>Cct	p.A323P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.A323P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.A323P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.A316P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.A323P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	323					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGACCCCAAGCTTTAGTAAA	0.398		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.A323P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	4904	.	0			c.G967C						PASS	.						70.0	74.0	73.0					3																	41268729		2203	4300	6503	SO:0001583	missense	1499	exon7	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CCCCAAGCTTTAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.967G>C	chr3.hg19:g.41268729G>C	ENSP00000344456:p.Ala323Pro	74.0	0.0	.		76.0	20.0	.	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625073	0.66901	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58119	0.2100	L	0.47716	1.5	0.80722	D	1	B;B	0.25105	0.054;0.118	B;B	0.23574	0.032;0.047	T	0.52653	-0.8547	10	0.25751	T	0.34	3.006	19.382	0.94540	0.0:0.0:1.0:0.0	.	251;323	B4DSW9;P35222	.;CTNB1_HUMAN	P	323;323;323;316;323	ENSP00000385604:A323P;ENSP00000379486:A323P;ENSP00000344456:A323P;ENSP00000411226:A316P;ENSP00000379488:A323P	ENSP00000344456:A323P	A	+	1	0	CTNNB1	41243733	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.869000	0.99810	2.591000	0.87537	0.591000	0.81541	GCT	.	.	.	none		0.398	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DAG1	1605	hgsc.bcm.edu	37	3	49568721	49568721	+	Silent	SNP	C	C	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr3:49568721C>G	ENST00000539901.1	+	3	1335	c.777C>G	c.(775-777)tcC>tcG	p.S259S	DAG1_ENST00000545947.1_Silent_p.S259S|DAG1_ENST00000541308.1_Silent_p.S259S|DAG1_ENST00000308775.2_Silent_p.S259S|DAG1_ENST00000515359.2_Silent_p.S259S|DAG1_ENST00000538711.1_Silent_p.S259S	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	259	Required for laminin recognition.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CCCTTCTCTCCTGGAAGCTGG	0.557																																					p.S259S		Atlas-SNP	.											.	DAG1	60	.	0			c.C777G						PASS	.						64.0	69.0	67.0					3																	49568721		2203	4300	6503	SO:0001819	synonymous_variant	1605	exon4			TCTCTCCTGGAAG	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.777C>G	chr3.hg19:g.49568721C>G		58.0	0.0	.		60.0	22.0	.	NM_001177642	A8K6M7|Q969J9	Silent	SNP	ENST00000539901.1	hg19	CCDS2799.1																																																																																			.	.	.	none		0.557	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1		
CACNA1D	776	hgsc.bcm.edu	37	3	53845165	53845165	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr3:53845165G>A	ENST00000350061.5	+	48	6729	c.6218G>A	c.(6217-6219)cGc>cAc	p.R2073H	CACNA1D_ENST00000544977.1_3'UTR|CACNA1D_ENST00000288139.4_Missense_Mutation_p.R2093H|CACNA1D_ENST00000422281.2_Missense_Mutation_p.R2049H	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	2073					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCTTGGGACGCTATGCAAGG	0.522																																					p.R2093H		Atlas-SNP	.											.	CACNA1D	324	.	0			c.G6278A						PASS	.						100.0	97.0	98.0					3																	53845165		2203	4300	6503	SO:0001583	missense	776	exon49			TGGGACGCTATGC	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.6218G>A	chr3.hg19:g.53845165G>A	ENSP00000288133:p.Arg2073His	101.0	0.0	.		100.0	27.0	.	NM_000720	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	hg19	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033345	0.54896	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.39	5.39	0.77823	.	0.320794	0.25083	N	0.033278	T	0.72391	0.3454	M	0.77103	2.36	0.80722	D	1	D;B;B;D	0.76494	0.996;0.051;0.051;0.999	P;B;B;P	0.62184	0.655;0.009;0.006;0.899	T	0.72937	-0.4140	10	0.48119	T	0.1	.	19.5276	0.95213	0.0:0.0:1.0:0.0	.	2049;1766;2073;2093	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	H	2073;2093;2049;1766	ENSP00000288133:R2073H;ENSP00000288139:R2093H;ENSP00000409174:R2049H;ENSP00000418014:R1766H	ENSP00000288139:R2093H	R	+	2	0	CACNA1D	53820205	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	3.789000	0.55454	2.710000	0.92621	0.655000	0.94253	CGC	.	.	.	none		0.522	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
FAM208A	23272	hgsc.bcm.edu	37	3	56694957	56694957	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr3:56694957A>C	ENST00000493960.2	-	10	1259	c.1249T>G	c.(1249-1251)Tta>Gta	p.L417V	FAM208A_ENST00000355628.5_Missense_Mutation_p.L417V|FAM208A_ENST00000431842.2_Missense_Mutation_p.L21V	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	417							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TTTGGACCTAAGTATGTTTCC	0.299																																					p.L417V		Atlas-SNP	.											.	FAM208A	113	.	0			c.T1249G						PASS	.						108.0	109.0	109.0					3																	56694957		2202	4299	6501	SO:0001583	missense	23272	exon10			GACCTAAGTATGT	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.1249T>G	chr3.hg19:g.56694957A>C	ENSP00000417509:p.Leu417Val	105.0	0.0	.		65.0	12.0	.	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	hg19	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	A	3.516	-0.098806	0.07010	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.11821	2.74;2.88;2.88	5.8	0.493	0.16878	.	0.773939	0.11384	N	0.569476	T	0.05318	0.0141	N	0.05383	-0.06	0.20307	N	0.999914	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.44726	-0.9309	10	0.15066	T	0.55	-0.0154	4.2051	0.10485	0.3113:0.4663:0.1139:0.1085	.	417;417;21	Q9UK61-3;Q9UK61-4;Q9UK61-2	.;.;.	V	21;417;417	ENSP00000399410:L21V;ENSP00000417509:L417V;ENSP00000347845:L417V	ENSP00000347845:L417V	L	-	1	2	C3orf63	56669997	0.306000	0.24490	0.992000	0.48379	0.983000	0.72400	-0.247000	0.08866	0.067000	0.16545	0.460000	0.39030	TTA	.	.	.	none		0.299	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
PARL	55486	hgsc.bcm.edu	37	3	183602589	183602589	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr3:183602589C>A	ENST00000317096.4	-	1	106	c.46G>T	c.(46-48)Gcg>Tcg	p.A16S	PARL_ENST00000311101.5_Missense_Mutation_p.A16S|PARL_ENST00000435888.1_Missense_Mutation_p.A16S|RP11-315J22.5_ENST00000445165.1_RNA|MIR4448_ENST00000584360.1_RNA	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	16					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GCACCCCACGCCTGGCCGCAG	0.711											OREG0015941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A16S		Atlas-SNP	.											.	PARL	32	.	0			c.G46T						PASS	.						8.0	9.0	9.0					3																	183602589		2142	4197	6339	SO:0001583	missense	55486	exon1			CCCACGCCTGGCC	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.46G>T	chr3.hg19:g.183602589C>A	ENSP00000325421:p.Ala16Ser	29.0	0.0	.	1985	29.0	5.0	.	NM_018622	Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	SNP	ENST00000317096.4	hg19	CCDS3248.1	.	.	.	.	.	.	.	.	.	.	C	4.654	0.121534	0.08881	.	.	ENSG00000175193	ENST00000317096;ENST00000311101;ENST00000435888	T;T;T	0.74947	-0.89;-0.89;-0.89	4.72	2.9	0.33743	.	0.347388	0.23680	N	0.045621	T	0.53786	0.1818	N	0.12182	0.205	0.26225	N	0.979108	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.50039	-0.8874	10	0.66056	D	0.02	-4.6318	7.7714	0.29010	0.0:0.8057:0.0:0.1943	.	16;16	Q9H300-2;Q9H300	.;PARL_HUMAN	S	16	ENSP00000325421:A16S;ENSP00000310676:A16S;ENSP00000402137:A16S	ENSP00000310676:A16S	A	-	1	0	PARL	185085283	0.667000	0.27484	0.913000	0.36048	0.025000	0.11179	0.254000	0.18314	0.693000	0.31634	0.655000	0.94253	GCG	.	.	.	none		0.711	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	NM_018622	
SLC2A9	56606	hgsc.bcm.edu	37	4	10022970	10022970	+	Silent	SNP	C	C	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr4:10022970C>T	ENST00000264784.3	-	1	137	c.84G>A	c.(82-84)ggG>ggA	p.G28G	SLC2A9_ENST00000309065.3_Intron|SLC2A9_ENST00000506583.1_Intron	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	28					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	CCCTCCCTGGCCCTGGAGGCC	0.587																																					p.G28G		Atlas-SNP	.											.	SLC2A9	158	.	0			c.G84A						PASS	.						126.0	136.0	133.0					4																	10022970		2203	4300	6503	SO:0001819	synonymous_variant	56606	exon1			CCCTGGCCCTGGA	AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.84G>A	chr4.hg19:g.10022970C>T		88.0	0.0	.		67.0	32.0	.	NM_020041	Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Silent	SNP	ENST00000264784.3	hg19	CCDS3407.1																																																																																			.	.	.	none		0.587	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207055.1		
FAT4	79633	hgsc.bcm.edu	37	4	126372770	126372770	+	Silent	SNP	T	T	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr4:126372770T>C	ENST00000394329.3	+	9	10612	c.10599T>C	c.(10597-10599)acT>acC	p.T3533T	FAT4_ENST00000335110.5_Silent_p.T1831T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3533	Cadherin 34. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTCAGTCCACTGACCCTGATC	0.483																																					p.T3533T		Atlas-SNP	.											.	FAT4	1752	.	0			c.T10599C						PASS	.						120.0	119.0	120.0					4																	126372770		2203	4300	6503	SO:0001819	synonymous_variant	79633	exon9			GTCCACTGACCCT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10599T>C	chr4.hg19:g.126372770T>C		90.0	0.0	.		93.0	19.0	.	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	hg19	CCDS3732.3																																																																																			.	.	.	none		0.483	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
CDH9	1007	hgsc.bcm.edu	37	5	26890623	26890623	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr5:26890623G>A	ENST00000231021.4	-	8	1476	c.1304C>T	c.(1303-1305)tCa>tTa	p.S435L		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	435	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ACCATTTTCTGAGTGAATACC	0.403																																					p.S435L	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											.	CDH9	305	.	0			c.C1304T						PASS	.						102.0	102.0	102.0					5																	26890623		2203	4300	6503	SO:0001583	missense	1007	exon8			TTTTCTGAGTGAA	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1304C>T	chr5.hg19:g.26890623G>A	ENSP00000231021:p.Ser435Leu	112.0	0.0	.		88.0	26.0	.	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	hg19	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362967	0.61403	.	.	ENSG00000113100	ENST00000231021	T	0.53206	0.63	5.09	5.09	0.68999	Cadherin (4);Cadherin-like (1);	0.301425	0.32736	N	0.005707	T	0.66257	0.2771	M	0.90595	3.13	0.53688	D	0.999978	B;B	0.26041	0.14;0.092	B;B	0.41174	0.219;0.349	T	0.67601	-0.5629	9	.	.	.	.	17.0519	0.86521	0.0:0.0:1.0:0.0	.	28;435	B4DFP0;Q9ULB4	.;CADH9_HUMAN	L	435	ENSP00000231021:S435L	.	S	-	2	0	CDH9	26926380	1.000000	0.71417	0.716000	0.30569	0.693000	0.40251	9.825000	0.99386	2.385000	0.81259	0.453000	0.30009	TCA	.	.	.	none		0.403	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
SETD9	133383	hgsc.bcm.edu	37	5	56207069	56207069	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr5:56207069A>C	ENST00000285947.2	+	2	558	c.172A>C	c.(172-174)Aaa>Caa	p.K58Q	SETD9_ENST00000541720.1_Missense_Mutation_p.K58Q|SETD9_ENST00000475908.1_Intron|AC008937.3_ENST00000453721.1_RNA	NM_153706.3	NP_714917.2	Q8NE22	SETD9_HUMAN	SET domain containing 9	58							methyltransferase activity (GO:0008168)										AACATTACTGAAAGTTTTCCA	0.358																																					p.K58Q		Atlas-SNP	.											.	.	.	.	0			c.A172C						PASS	.						41.0	43.0	42.0					5																	56207069		2202	4300	6502	SO:0001583	missense	133383	exon2			TTACTGAAAGTTT	BC036528	CCDS3972.1	5q11.2	2012-02-23	2012-02-23	2012-02-23	ENSG00000155542	ENSG00000155542			28508	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 35"""	C5orf35		20930037	Standard	NM_153706		Approved	MGC33648	uc003jqx.3	Q8NE22	OTTHUMG00000059485	ENST00000285947.2:c.172A>C	chr5.hg19:g.56207069A>C	ENSP00000285947:p.Lys58Gln	135.0	0.0	.		135.0	32.0	.	NM_153706	F5H713	Missense_Mutation	SNP	ENST00000285947.2	hg19	CCDS3972.1	.	.	.	.	.	.	.	.	.	.	A	11.05	1.525967	0.27299	.	.	ENSG00000155542	ENST00000285947;ENST00000541720;ENST00000423328	T;T	0.32023	1.48;1.47	5.3	1.52	0.23074	.	0.646198	0.16385	N	0.216710	T	0.23611	0.0571	L	0.50333	1.59	0.24433	N	0.994567	B	0.11235	0.004	B	0.06405	0.002	T	0.21211	-1.0252	10	0.27785	T	0.31	-11.5557	6.4957	0.22140	0.7288:0.1316:0.1396:0.0	.	58	Q8NE22	CE035_HUMAN	Q	58;58;32	ENSP00000285947:K58Q;ENSP00000442886:K58Q	ENSP00000285947:K58Q	K	+	1	0	C5orf35	56242826	0.995000	0.38212	0.994000	0.49952	0.992000	0.81027	0.899000	0.28417	0.026000	0.15269	0.533000	0.62120	AAA	.	.	.	none		0.358	SETD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132304.2	NM_153706	
POU5F2	134187	hgsc.bcm.edu	37	5	93076952	93076952	+	Silent	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr5:93076952G>C	ENST00000510627.4	-	1	391	c.318C>G	c.(316-318)gcC>gcG	p.A106A	FAM172A_ENST00000509163.1_Intron|FAM172A_ENST00000509739.1_Intron|RP11-185E12.2_ENST00000606528.1_RNA|FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000505869.1_Intron|POU5F2_ENST00000606183.1_5'Flank	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	106					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		TGCTCCGCAGGGCAATGTAGG	0.637																																					p.A106A		Atlas-SNP	.											.	POU5F2	10	.	0			c.C318G						PASS	.						52.0	51.0	51.0					5																	93076952		1903	4113	6016	SO:0001819	synonymous_variant	134187	exon1			CCGCAGGGCAATG		CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.318C>G	chr5.hg19:g.93076952G>C		57.0	0.0	.		45.0	11.0	.	NM_153216	Q15169|Q6MZL7|Q8N748	Silent	SNP	ENST00000510627.4	hg19	CCDS59489.1																																																																																			.	.	.	none		0.637	POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369873.5	NM_153216	
NREP	9315	hgsc.bcm.edu	37	5	111312420	111312420	+	Intron	SNP	T	T	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr5:111312420T>A	ENST00000450761.2	-	1	141				NREP-AS1_ENST00000503242.1_RNA|NREP_ENST00000395634.3_Missense_Mutation_p.N6I|NREP-AS1_ENST00000507222.1_RNA			Q16612	NREP_HUMAN	neuronal regeneration related protein						axon regeneration (GO:0031103)|regulation of neuron differentiation (GO:0045664)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											AGCAGAATAATTCCAAACTCC	0.398																																					p.N6I		Atlas-SNP	.											.	.	.	.	0			c.A17T						PASS	.						196.0	165.0	175.0					5																	111312420		692	1591	2283	SO:0001627	intron_variant	9315	exon1			GAATAATTCCAAA	AF119859	CCDS4105.1, CCDS47255.1	5q22.1	2012-12-07	2012-12-07	2012-01-23	ENSG00000134986	ENSG00000134986			16834	protein-coding gene	gene with protein product	"""neuronal protein 3.1"""	607332	"""chromosome 5 open reading frame 13"", ""neuronal regeneration related protein homolog (rat)"""	C5orf13		8261136, 10981724, 15485502	Standard	NM_004772		Approved	P311, D4S114, PRO1873, PTZ17, SEZ17	uc011cvr.2	Q16612	OTTHUMG00000128795	ENST00000450761.2:c.57+20600A>T	chr5.hg19:g.111312420T>A		133.0	0.0	.		100.0	21.0	.	NM_001142475	B2RDN8|B7Z5D2|D3DSZ8	Missense_Mutation	SNP	ENST00000450761.2	hg19	CCDS4105.1	.	.	.	.	.	.	.	.	.	.	T	7.833	0.720334	0.15372	.	.	ENSG00000134986	ENST00000395634	T	0.51325	0.71	4.17	-5.73	0.02398	.	.	.	.	.	T	0.30039	0.0752	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.31308	-0.9948	8	0.87932	D	0	.	5.377	0.16170	0.266:0.4746:0.0:0.2595	.	6	B7Z5D2	.	I	6	ENSP00000378996:N6I	ENSP00000378996:N6I	N	-	2	0	C5orf13	111340319	0.000000	0.05858	0.000000	0.03702	0.578000	0.36192	-0.626000	0.05527	-1.222000	0.02587	-0.301000	0.09380	AAT	.	.	.	none		0.398	NREP-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370888.1	NM_004772	
CEP120	153241	hgsc.bcm.edu	37	5	122713195	122713195	+	Missense_Mutation	SNP	C	C	T	rs376401743		TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr5:122713195C>T	ENST00000306467.5	-	16	2535	c.2231G>A	c.(2230-2232)cGt>cAt	p.R744H	CEP120_ENST00000328236.5_Missense_Mutation_p.R744H|CEP120_ENST00000306481.6_Missense_Mutation_p.R718H			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	744					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						GTTCCGCTGACGTTCTGATTG	0.398													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16908	0.0		0.0	False		,,,				2504	0.0				p.R744H		Atlas-SNP	.											.	CEP120	72	.	0			c.G2231A						PASS	.						182.0	167.0	172.0					5																	122713195		2203	4300	6503	SO:0001583	missense	153241	exon17			CGCTGACGTTCTG	AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.2231G>A	chr5.hg19:g.122713195C>T	ENSP00000303058:p.Arg744His	63.0	0.0	.		50.0	12.0	.	NM_153223	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Missense_Mutation	SNP	ENST00000306467.5	hg19	CCDS4134.2	.	.	.	.	.	.	.	.	.	.	C	10.91	1.485237	0.26598	.	.	ENSG00000168944	ENST00000306467;ENST00000328236;ENST00000306481;ENST00000508442	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.82	4.84	0.62591	.	0.362557	0.31922	N	0.006848	T	0.09468	0.0233	N	0.00210	-1.845	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.33189	-0.9878	10	0.11182	T	0.66	-14.0862	7.0171	0.24895	0.0:0.8097:0.0:0.1903	.	744	Q8N960	CE120_HUMAN	H	744;744;718;718	ENSP00000303058:R744H;ENSP00000327504:R744H;ENSP00000307419:R718H;ENSP00000421620:R718H	ENSP00000303058:R744H	R	-	2	0	CEP120	122741094	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	3.469000	0.53093	2.767000	0.95098	0.655000	0.94253	CGT	.	.	.	weak		0.398	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250899.2	NM_153223	
NPM1	4869	hgsc.bcm.edu	37	5	170814986	170814986	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr5:170814986C>A	ENST00000296930.5	+	1	335	c.34C>A	c.(34-36)Ctg>Atg	p.L12M	NPM1_ENST00000351986.6_Missense_Mutation_p.L12M|NPM1_ENST00000517671.1_Missense_Mutation_p.L12M|NPM1_ENST00000393820.2_Missense_Mutation_p.L12M|MIR3912_ENST00000577566.1_RNA	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	12	Necessary for interaction with APEX1.|Required for interaction with SENP3.				cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)		NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CATGAGCCCCCTGAGGCCCCA	0.622			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																p.L12M		Atlas-SNP	.		Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	.	NPM1	5003	.	0			c.C34A						PASS	.						23.0	27.0	26.0					5																	170814986		2203	4296	6499	SO:0001583	missense	4869	exon1			AGCCCCCTGAGGC	M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.34C>A	chr5.hg19:g.170814986C>A	ENSP00000296930:p.Leu12Met	84.0	0.0	.		89.0	25.0	.	NM_199185	A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Missense_Mutation	SNP	ENST00000296930.5	hg19	CCDS4376.1	.	.	.	.	.	.	.	.	.	.	c	17.74	3.464060	0.63513	.	.	ENSG00000181163	ENST00000517671;ENST00000296930;ENST00000351986;ENST00000393820;ENST00000523622	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	4.27	2.47	0.30058	Nucleoplasmin core (2);	0.179442	0.34802	U	0.003663	T	0.55369	0.1916	L	0.56199	1.76	0.26244	N	0.978822	P;P;D	0.56746	0.619;0.94;0.977	B;P;D	0.64687	0.132;0.481;0.928	T	0.44221	-0.9342	10	0.31617	T	0.26	.	8.1166	0.30946	0.0:0.8033:0.0:0.1967	.	12;12;12	P06748-2;P06748;Q9BYG9	.;NPM_HUMAN;.	M	12	ENSP00000428755:L12M;ENSP00000296930:L12M;ENSP00000341168:L12M;ENSP00000377408:L12M	ENSP00000296930:L12M	L	+	1	2	NPM1	170747591	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.062000	0.30555	0.372000	0.24591	0.472000	0.43445	CTG	.	.	.	none		0.622	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252858.2	NM_002520	
ABCF1	23	hgsc.bcm.edu	37	6	30558445	30558445	+	Silent	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr6:30558445G>A	ENST00000326195.8	+	25	2617	c.2505G>A	c.(2503-2505)ctG>ctA	p.L835L	ABCF1_ENST00000396515.4_Silent_p.L228L|ABCF1_ENST00000376545.3_Silent_p.L797L	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	835	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						TGGAGGCCCTGGGTGAAGTCA	0.552																																					p.L835L		Atlas-SNP	.											.	ABCF1	61	.	0			c.G2505A						PASS	.						161.0	178.0	172.0					6																	30558445		1510	2708	4218	SO:0001819	synonymous_variant	23	exon25			GGCCCTGGGTGAA	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.2505G>A	chr6.hg19:g.30558445G>A		152.0	0.0	.		122.0	34.0	.	NM_001025091	A2BF75|O14897|Q69YP6	Silent	SNP	ENST00000326195.8	hg19	CCDS34380.1																																																																																			.	.	.	none		0.552	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3		
RPL10A	4736	hgsc.bcm.edu	37	6	35437954	35437954	+	Splice_Site	SNP	A	A	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr6:35437954A>G	ENST00000322203.6	+	5	337		c.e5-1		RPL10A_ENST00000467020.1_Splice_Site	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a						anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(2)|ovary(1)	4						TCTCTCTATCAGCCAAGAAGT	0.483																																					.		Atlas-SNP	.											.	RPL10A	13	.	0			c.311-2A>G						PASS	.						93.0	85.0	88.0					6																	35437954		2203	4300	6503	SO:0001630	splice_region_variant	4736	exon5			TCTATCAGCCAAG	U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.311-1A>G	chr6.hg19:g.35437954A>G		33.0	0.0	.		41.0	14.0	.	NM_007104	B2R801|P52859|P53025|Q5TZT6|Q8J013	Splice_Site	SNP	ENST00000322203.6	hg19	CCDS4806.1	.	.	.	.	.	.	.	.	.	.	A	8.257	0.810319	0.16537	.	.	ENSG00000198755	ENST00000322203	.	.	.	3.94	3.94	0.45596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0737	0.48019	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RPL10A	35545932	1.000000	0.71417	0.929000	0.37066	0.230000	0.25150	5.893000	0.69798	1.788000	0.52465	0.460000	0.39030	.	.	.	.	none		0.483	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1	NM_007104	Intron
SAYSD1	55776	hgsc.bcm.edu	37	6	39082699	39082699	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr6:39082699G>C	ENST00000229903.4	-	1	266	c.167C>G	c.(166-168)cCt>cGt	p.P56R	SAYSD1_ENST00000481599.1_5'UTR	NM_018322.1	NP_060792.1	Q9NPB0	SMDC1_HUMAN	SAYSVFN motif domain containing 1	56						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)											CGCGGGCCTAGGTTTCCATAC	0.657																																					p.P56R		Atlas-SNP	.											.	.	.	.	0			c.C167G						PASS	.						36.0	43.0	41.0					6																	39082699		2203	4300	6503	SO:0001583	missense	55776	exon1			GGCCTAGGTTTCC	BC022007	CCDS4840.1	6p21.1	2011-12-13	2011-12-13	2011-12-13	ENSG00000112167	ENSG00000112167			21025	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 64"""	C6orf64			Standard	XM_005249222		Approved	FLJ11101	uc003ook.1	Q9NPB0	OTTHUMG00000014641	ENST00000229903.4:c.167C>G	chr6.hg19:g.39082699G>C	ENSP00000229903:p.Pro56Arg	59.0	0.0	.		49.0	13.0	.	NM_018322	Q9H0D8	Missense_Mutation	SNP	ENST00000229903.4	hg19	CCDS4840.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082573	0.36758	.	.	ENSG00000112167	ENST00000229903	.	.	.	5.15	0.0579	0.14325	.	0.551296	0.18522	N	0.138727	T	0.20210	0.0486	M	0.66939	2.045	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.24297	-1.0164	9	0.51188	T	0.08	-11.0707	4.3846	0.11311	0.3584:0.1591:0.4825:0.0	.	56	Q9NPB0	CF064_HUMAN	R	56	.	ENSP00000229903:P56R	P	-	2	0	C6orf64	39190677	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.087000	0.14958	0.144000	0.18951	-0.140000	0.14226	CCT	.	.	.	none		0.657	SAYSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040448.1	NM_018322	
SLC29A1	2030	hgsc.bcm.edu	37	6	44201182	44201182	+	Missense_Mutation	SNP	G	G	C	rs74750454		TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr6:44201182G>C	ENST00000393841.1	+	14	1779	c.1288G>C	c.(1288-1290)Gca>Cca	p.A430P	SLC29A1_ENST00000371724.1_Missense_Mutation_p.A430P|SLC29A1_ENST00000371708.1_Missense_Mutation_p.A430P|SLC29A1_ENST00000371713.1_Missense_Mutation_p.A430P|SLC29A1_ENST00000393844.1_Missense_Mutation_p.A430P|SLC29A1_ENST00000371740.5_Missense_Mutation_p.A430P|SLC29A1_ENST00000371755.3_Missense_Mutation_p.A430P|SLC29A1_ENST00000427851.2_Missense_Mutation_p.A430P|SLC29A1_ENST00000313248.7_Missense_Mutation_p.A509P|SLC29A1_ENST00000371731.1_Missense_Mutation_p.A430P	NM_001078177.1	NP_001071645.1	Q99808	S29A1_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 1	430					cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|lactation (GO:0007595)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sleep (GO:0030431)|transmembrane transport (GO:0055085)|uridine transport (GO:0015862)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	17	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Cytarabine(DB00987)|Didanosine(DB00900)|Fludarabine(DB01073)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Pemetrexed(DB00642)|Ribavirin(DB00811)|Zalcitabine(DB00943)	GGCAGAGACCGCAGGAGCCAT	0.577																																					p.A430P		Atlas-SNP	.											.	SLC29A1	45	.	0			c.G1288C						PASS	.						161.0	151.0	155.0					6																	44201182		2203	4300	6503	SO:0001583	missense	2030	exon13			GAGACCGCAGGAG	U81375	CCDS4908.1	6p21.1	2013-07-17	2013-07-17		ENSG00000112759	ENSG00000112759		"""Solute carriers"""	11003	protein-coding gene	gene with protein product		602193	"""solute carrier family 29 (nucleoside transporters), member 1"""	ENT1		8986748, 9344680	Standard	NM_004955		Approved		uc003owy.2	Q99808	OTTHUMG00000014759	ENST00000393841.1:c.1288G>C	chr6.hg19:g.44201182G>C	ENSP00000377424:p.Ala430Pro	56.0	0.0	.		60.0	10.0	.	NM_004955	B3KQV7|B3KQY5|Q5T9W9|Q9UJY2	Missense_Mutation	SNP	ENST00000393841.1	hg19	CCDS4908.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729616	0.89390	.	.	ENSG00000112759	ENST00000393844;ENST00000313248;ENST00000427851;ENST00000371755;ENST00000371740;ENST00000371731;ENST00000393841;ENST00000371724;ENST00000371713;ENST00000371708	T;T;T;T;T;T;T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48;-1.48;-1.48;-1.48;-1.48;-1.48;-1.48	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.92701	0.7680	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94086	0.7348	10	0.87932	D	0	-13.2332	19.2711	0.94010	0.0:0.0:1.0:0.0	.	509;430	B3KQV7;Q99808	.;S29A1_HUMAN	P	430;509;430;430;430;430;430;430;430;430	ENSP00000377427:A430P;ENSP00000319152:A509P;ENSP00000392668:A430P;ENSP00000360820:A430P;ENSP00000360805:A430P;ENSP00000360796:A430P;ENSP00000377424:A430P;ENSP00000360789:A430P;ENSP00000360778:A430P;ENSP00000360773:A430P	ENSP00000319152:A509P	A	+	1	0	SLC29A1	44309160	1.000000	0.71417	0.076000	0.20297	0.725000	0.41563	8.890000	0.92477	2.789000	0.95967	0.655000	0.94253	GCA	.	G|0.999;A|0.001	.	alt		0.577	SLC29A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040721.1		
GPRC6A	222545	hgsc.bcm.edu	37	6	117121778	117121778	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr6:117121778T>A	ENST00000310357.3	-	4	1538	c.1517A>T	c.(1516-1518)cAg>cTg	p.Q506L	GPRC6A_ENST00000530250.1_Missense_Mutation_p.Q331L|GPRC6A_ENST00000368549.3_Intron	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	506					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TTTTGTTTCCTGATCTGGGAT	0.423																																					p.Q506L		Atlas-SNP	.											.	GPRC6A	152	.	0			c.A1517T						PASS	.						191.0	166.0	175.0					6																	117121778		2203	4300	6503	SO:0001583	missense	222545	exon4			GTTTCCTGATCTG	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1517A>T	chr6.hg19:g.117121778T>A	ENSP00000309493:p.Gln506Leu	111.0	0.0	.		83.0	12.0	.	NM_148963	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	hg19	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	T	7.166	0.586705	0.13749	.	.	ENSG00000173612	ENST00000310357;ENST00000530250	D;D	0.90955	-2.52;-2.76	5.13	3.93	0.45458	.	0.408254	0.20735	N	0.086659	T	0.66356	0.2781	N	0.08118	0	0.25789	N	0.984637	B;B	0.21309	0.014;0.054	B;B	0.17433	0.018;0.008	T	0.59220	-0.7495	10	0.52906	T	0.07	.	7.3059	0.26447	0.0:0.0751:0.1437:0.7812	.	331;506	Q5T6X5-2;Q5T6X5	.;GPC6A_HUMAN	L	506;331	ENSP00000309493:Q506L;ENSP00000433465:Q331L	ENSP00000309493:Q506L	Q	-	2	0	GPRC6A	117228471	0.988000	0.35896	0.966000	0.40874	0.067000	0.16453	3.221000	0.51215	2.159000	0.67721	0.477000	0.44152	CAG	.	.	.	none		0.423	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2		
DNAJC30	84277	hgsc.bcm.edu	37	7	73097483	73097483	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr7:73097483A>G	ENST00000395176.2	-	1	300	c.271T>C	c.(271-273)Ttc>Ctc	p.F91L	WBSCR22_ENST00000423497.1_5'Flank|WBSCR22_ENST00000423166.2_5'Flank|WBSCR22_ENST00000265758.2_5'Flank|WBSCR22_ENST00000464615.1_3'UTR	NM_032317.2	NP_115693.2	Q96LL9	DJC30_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 30	91	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					mitochondrion (GO:0005739)				kidney(1)|large_intestine(2)|lung(1)	4						ATGCGCGTGAAGCGCTCGGCG	0.667																																					p.F91L		Atlas-SNP	.											.	DNAJC30	12	.	0			c.T271C						PASS	.						51.0	60.0	57.0					7																	73097483		2201	4297	6498	SO:0001583	missense	84277	exon1			GCGTGAAGCGCTC	AF412025	CCDS5556.1	7q11.23	2011-09-02	2008-06-17	2008-06-17	ENSG00000176410	ENSG00000176410		"""Heat shock proteins / DNAJ (HSP40)"""	16410	protein-coding gene	gene with protein product			"""Williams Beuren syndrome chromosome region 18"""	WBSCR18		12073013	Standard	NM_032317		Approved		uc003tys.1	Q96LL9	OTTHUMG00000023290	ENST00000395176.2:c.271T>C	chr7.hg19:g.73097483A>G	ENSP00000378605:p.Phe91Leu	64.0	0.0	.		98.0	17.0	.	NM_032317	Q9BSG8	Missense_Mutation	SNP	ENST00000395176.2	hg19	CCDS5556.1	.	.	.	.	.	.	.	.	.	.	A	36	5.928610	0.97116	.	.	ENSG00000176410	ENST00000395176;ENST00000539255	T	0.46063	0.88	5.15	5.15	0.70609	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.62744	0.2453	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66732	-0.5849	10	0.87932	D	0	-8.5361	12.9762	0.58538	1.0:0.0:0.0:0.0	.	91	Q96LL9	DJC30_HUMAN	L	91;88	ENSP00000378605:F91L	ENSP00000378605:F91L	F	-	1	0	DNAJC30	72735419	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.811000	0.86092	2.160000	0.67779	0.528000	0.53228	TTC	.	.	.	none		0.667	DNAJC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252304.2		
COPS6	10980	hgsc.bcm.edu	37	7	99686979	99686979	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr7:99686979T>C	ENST00000303904.3	+	2	180	c.143T>C	c.(142-144)aTt>aCt	p.I48T	COPS6_ENST00000418625.1_Missense_Mutation_p.I47T	NM_006833.4	NP_006824.2	Q7L5N1	CSN6_HUMAN	COP9 signalosome subunit 6	48	MPN.				cullin deneddylation (GO:0010388)|viral process (GO:0016032)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|stomach(1)	12	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CCCCTTGTCATTCTCAACATC	0.587																																					p.I48T		Atlas-SNP	.											.	COPS6	31	.	0			c.T143C						PASS	.						150.0	139.0	143.0					7																	99686979		2203	4300	6503	SO:0001583	missense	10980	exon2			TTGTCATTCTCAA	BC002520	CCDS5682.1	7q22.1	2013-03-14	2013-03-14		ENSG00000168090	ENSG00000168090			21749	protein-coding gene	gene with protein product	"""COP9 subunit 6 (MOV34 homolog, 34 kD)"""	614729	"""COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)"""			12477932	Standard	NM_006833		Approved	MOV34-34KD, CSN6	uc003usu.3	Q7L5N1	OTTHUMG00000154632	ENST00000303904.3:c.143T>C	chr7.hg19:g.99686979T>C	ENSP00000304102:p.Ile48Thr	49.0	0.0	.		60.0	13.0	.	NM_006833	A4D2A3|O15387	Missense_Mutation	SNP	ENST00000303904.3	hg19	CCDS5682.1	.	.	.	.	.	.	.	.	.	.	T	31	5.072932	0.93950	.	.	ENSG00000168090	ENST00000303904;ENST00000419210;ENST00000418625	T;T	0.55413	0.52;0.52	5.65	4.5	0.54988	.	0.060020	0.64402	N	0.000004	T	0.74574	0.3734	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.79784	0.993;0.961	T	0.78048	-0.2356	10	0.87932	D	0	-12.4631	9.559	0.39357	0.0:0.0815:0.0:0.9185	.	48;48	B4DHR8;Q7L5N1	.;CSN6_HUMAN	T	48;18;47	ENSP00000304102:I48T;ENSP00000400617:I47T	ENSP00000304102:I48T	I	+	2	0	COPS6	99524915	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	7.150000	0.77403	1.160000	0.42584	0.533000	0.62120	ATT	.	.	.	none		0.587	COPS6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336412.3	NM_006833	
DUS4L	11062	hgsc.bcm.edu	37	7	107217029	107217029	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr7:107217029G>T	ENST00000265720.3	+	7	1060	c.698G>T	c.(697-699)gGg>gTg	p.G233V	RP4-593H12.1_ENST00000610269.1_RNA|DUS4L_ENST00000402620.1_Missense_Mutation_p.G112V	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	233							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						CGGATTACTGGGACAGATGGT	0.343																																					p.G233V		Atlas-SNP	.											.	DUS4L	27	.	0			c.G698T						PASS	.						48.0	49.0	49.0					7																	107217029		2203	4300	6503	SO:0001583	missense	11062	exon7			TTACTGGGACAGA	U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.698G>T	chr7.hg19:g.107217029G>T	ENSP00000265720:p.Gly233Val	117.0	0.0	.		127.0	20.0	.	NM_001270419	B4DLX0|Q2NKK1	Missense_Mutation	SNP	ENST00000265720.3	hg19	CCDS5745.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383852	0.82792	.	.	ENSG00000105865	ENST00000265720;ENST00000402620	T;T	0.57752	0.38;0.38	6.01	6.01	0.97437	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.82323	0.5012	H	0.98048	4.135	0.80722	D	1	D;D	0.54397	0.966;0.966	D;D	0.66979	0.948;0.948	D	0.87908	0.2695	10	0.87932	D	0	.	15.5789	0.76418	0.0672:0.0:0.9328:0.0	.	233;233	A4D0R5;O95620	.;DUS4L_HUMAN	V	233;112	ENSP00000265720:G233V;ENSP00000385274:G112V	ENSP00000265720:G233V	G	+	2	0	DUS4L	107004265	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.156000	0.64905	2.861000	0.98227	0.650000	0.86243	GGG	.	.	.	none		0.343	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336967.2	NM_181581	
C8orf86	389649	hgsc.bcm.edu	37	8	38369906	38369906	+	Silent	SNP	T	T	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr8:38369906T>C	ENST00000358138.1	-	3	695	c.671A>G	c.(670-672)tAa>tGa	p.*224*	C8orf86_ENST00000437935.2_3'UTR	NM_207412.1	NP_997295.1	Q6ZUL3	CH086_HUMAN	chromosome 8 open reading frame 86	0										breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						cagtggttcttaaacttcagc	0.547																																					p.X224X		Atlas-SNP	.											.	C8orf86	17	.	0			c.A671G						PASS	.						34.0	35.0	35.0					8																	38369906		2203	4300	6503	SO:0001819	synonymous_variant	389649	exon3			GGTTCTTAAACTT	BC137511	CCDS6108.1	8p12-p11.23	2009-03-03			ENSG00000196166	ENSG00000196166			33774	protein-coding gene	gene with protein product							Standard	NM_207412		Approved	FLJ43582	uc003xlx.1	Q6ZUL3	OTTHUMG00000163992	ENST00000358138.1:c.671A>G	chr8.hg19:g.38369906T>C		99.0	0.0	.		94.0	28.0	.	NM_207412	A4QPB7	Silent	SNP	ENST00000358138.1	hg19	CCDS6108.1																																																																																			.	.	.	none		0.547	C8orf86-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376668.1	NM_207412	
CYHR1	50626	hgsc.bcm.edu	37	8	145689559	145689559	+	Intron	SNP	C	C	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr8:145689559C>T	ENST00000438911.2	-	2	380				KIFC2_ENST00000301332.2_5'Flank|CYHR1_ENST00000403000.2_Missense_Mutation_p.S177N|CYHR1_ENST00000424149.2_Missense_Mutation_p.S177N|CYHR1_ENST00000530374.1_5'Flank|CTD-2517M22.16_ENST00000525461.1_RNA|CYHR1_ENST00000306145.5_Missense_Mutation_p.S177N	NM_138496.1	NP_612505.1	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1							cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(3)|ovary(2)	7	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GTAAGCCCAGCTGCCTACAGC	0.642											OREG0019056	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S177N		Atlas-SNP	.											.	CYHR1	39	.	0			c.G530A						PASS	.						51.0	56.0	55.0					8																	145689559		2203	4300	6503	SO:0001627	intron_variant	50626	exon3			GCCCAGCTGCCTA	AB007965	CCDS6426.1, CCDS47943.1	8q24	2004-12-07	2005-07-24		ENSG00000187954	ENSG00000187954			17806	protein-coding gene	gene with protein product			"""cysteine and histidine rich 1"""			10745073	Standard	NM_138496		Approved	CHRP, KIAA0496, MGC13010	uc003zcv.2	Q6ZMK1	OTTHUMG00000165171	ENST00000438911.2:c.246+283G>A	chr8.hg19:g.145689559C>T		78.0	0.0	.	1696	76.0	24.0	.	NM_032687	B3KSX0|D3DWM3|Q9BSF6|Q9BSU6	Missense_Mutation	SNP	ENST00000438911.2	hg19	CCDS47943.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158532	0.78114	.	.	ENSG00000187954	ENST00000403000;ENST00000424149;ENST00000306145	T;T;T	0.55052	0.54;0.54;0.54	4.79	3.91	0.45181	.	0.155120	0.40469	N	0.001087	T	0.37892	0.1020	.	.	.	0.20196	N	0.999922	B	0.09022	0.002	B	0.12837	0.008	T	0.22243	-1.0222	9	0.35671	T	0.21	.	8.9929	0.36035	0.0:0.8958:0.0:0.1042	.	177	Q6ZMK1-3	.	N	177	ENSP00000385962:S177N;ENSP00000414647:S177N;ENSP00000304826:S177N	ENSP00000304826:S177N	S	-	2	0	CYHR1	145660367	0.978000	0.34361	0.981000	0.43875	0.946000	0.59487	0.811000	0.27198	1.014000	0.39417	0.462000	0.41574	AGC	.	.	.	none		0.642	CYHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382438.1	NM_032687	
TSC1	7248	hgsc.bcm.edu	37	9	135781381	135781381	+	Silent	SNP	G	G	A	rs149439187		TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr9:135781381G>A	ENST00000298552.3	-	15	1805	c.1584C>T	c.(1582-1584)ggC>ggT	p.G528G	TSC1_ENST00000440111.2_Silent_p.G528G|TSC1_ENST00000545250.1_Silent_p.G477G	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	528					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.A529S(1)|p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TCACGCTGGCGCCCTGAGAAC	0.592			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.G528G		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	167	.	2	Substitution - Missense(1)|Unknown(1)	lung(1)|bone(1)	c.C1584T						PASS	.	G	,,	0,4406		0,0,2203	62.0	61.0	61.0		1584,1581,1431	-3.3	0.0	9	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	TSC1	NM_000368.4,NM_001162426.1,NM_001162427.1	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	528/1165,527/1164,477/1114	135781381	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7248	exon15	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GCTGGCGCCCTGA	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.1584C>T	chr9.hg19:g.135781381G>A		117.0	0.0	.		118.0	30.0	.	NM_000368	B7Z897|Q5VVN5	Silent	SNP	ENST00000298552.3	hg19	CCDS6956.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.592	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
STOX1	219736	hgsc.bcm.edu	37	10	70644560	70644560	+	Missense_Mutation	SNP	G	G	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr10:70644560G>T	ENST00000298596.6	+	3	1091	c.1008G>T	c.(1006-1008)caG>caT	p.Q336H	STOX1_ENST00000399169.4_Missense_Mutation_p.Q336H|STOX1_ENST00000399162.2_Intron|STOX1_ENST00000399165.4_Intron|STOX1_ENST00000421961.2_Missense_Mutation_p.Q226H	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	336						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						TCTCTGCTCAGTTCCCACCTG	0.423																																					p.Q336H		Atlas-SNP	.											.	STOX1	75	.	0			c.G1008T						PASS	.						103.0	101.0	102.0					10																	70644560		1904	4122	6026	SO:0001583	missense	219736	exon3			TGCTCAGTTCCCA	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.1008G>T	chr10.hg19:g.70644560G>T	ENSP00000298596:p.Gln336His	160.0	0.0	.		93.0	30.0	.	NM_152709	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	ENST00000298596.6	hg19	CCDS41535.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.971544	0.74246	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000421961	D;D;D	0.92911	-3.13;-3.13;-2.64	6.08	6.08	0.98989	.	0.000000	0.64402	U	0.000001	D	0.96034	0.8708	M	0.82323	2.585	0.51012	D	0.999903	D	0.89917	1.0	D	0.87578	0.998	D	0.95942	0.8947	10	0.87932	D	0	.	13.8168	0.63297	0.0695:0.0:0.9305:0.0	.	336	Q6ZVD7	STOX1_HUMAN	H	336;336;226	ENSP00000382121:Q336H;ENSP00000298596:Q336H;ENSP00000394509:Q226H	ENSP00000298596:Q336H	Q	+	3	2	STOX1	70314566	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.634000	0.67833	2.894000	0.99253	0.591000	0.81541	CAG	.	.	.	none		0.423	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
BMPR1A	657	hgsc.bcm.edu	37	10	88678972	88678972	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr10:88678972G>C	ENST00000372037.3	+	10	1449	c.912G>C	c.(910-912)caG>caC	p.Q304H		NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	304	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						CCTGGACTCAGCTCTATTTGA	0.418			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												p.Q304H	Ovarian(190;603 2086 22044 30335 47971)	Atlas-SNP	.	yes	Rec		Juvenile polyposis	10	10q22.3	657	"""bone morphogenetic protein receptor, type IA"""		E	.	BMPR1A	118	.	0			c.G912C						PASS	.						106.0	106.0	106.0					10																	88678972		2203	4300	6503	SO:0001583	missense	657	exon10	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	GACTCAGCTCTAT	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.912G>C	chr10.hg19:g.88678972G>C	ENSP00000361107:p.Gln304His	112.0	0.0	.		86.0	20.0	.	NM_004329	A8K6U9|Q8NEN8	Missense_Mutation	SNP	ENST00000372037.3	hg19	CCDS7378.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419851	0.62622	.	.	ENSG00000107779	ENST00000224764;ENST00000372037	T	0.64438	-0.1	4.95	0.902	0.19290	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.46112	0.1376	L	0.39326	1.205	0.58432	D	0.999999	P	0.36110	0.537	B	0.34824	0.19	T	0.29822	-0.9999	10	0.72032	D	0.01	.	5.0205	0.14358	0.357:0.0:0.5133:0.1296	.	304	P36894	BMR1A_HUMAN	H	304	ENSP00000361107:Q304H	ENSP00000224764:Q304H	Q	+	3	2	BMPR1A	88668952	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.412000	0.34714	-0.028000	0.13850	0.467000	0.42956	CAG	.	.	.	none		0.418	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049170.3	NM_004329	
MICAL2	9645	hgsc.bcm.edu	37	11	12263967	12263967	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr11:12263967A>T	ENST00000256194.4	+	19	2832	c.2544A>T	c.(2542-2544)gaA>gaT	p.E848D	MICAL2_ENST00000527546.1_Intron|MICAL2_ENST00000342902.5_Missense_Mutation_p.E848D|MICAL2_ENST00000537344.1_Intron|MICAL2_ENST00000379612.3_Intron	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	848					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		AAGTGGAGGAAAAGATTCTCC	0.597																																					p.E848D		Atlas-SNP	.											.	MICAL2	114	.	0			c.A2544T						PASS	.						35.0	29.0	31.0					11																	12263967		2201	4294	6495	SO:0001583	missense	9645	exon19			GGAGGAAAAGATT	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.2544A>T	chr11.hg19:g.12263967A>T	ENSP00000256194:p.Glu848Asp	71.0	0.0	.		63.0	18.0	.	NM_014632	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	hg19	CCDS7809.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.525074	0.44969	.	.	ENSG00000133816	ENST00000256194;ENST00000342902	T;T	0.63580	-0.04;-0.05	5.79	-2.48	0.06423	.	0.173691	0.33753	N	0.004600	T	0.35913	0.0948	N	0.17082	0.46	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.11329	0.006;0.001	T	0.05354	-1.0890	10	0.16420	T	0.52	.	8.1203	0.30967	0.5788:0.1194:0.3018:0.0	.	848;848	G3XAC8;O94851	.;MICA2_HUMAN	D	848	ENSP00000256194:E848D;ENSP00000344894:E848D	ENSP00000256194:E848D	E	+	3	2	MICAL2	12220543	0.976000	0.34144	0.964000	0.40570	0.988000	0.76386	0.136000	0.15974	-0.336000	0.08438	0.460000	0.39030	GAA	.	.	.	none		0.597	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632	
PIK3C2A	5286	hgsc.bcm.edu	37	11	17124355	17124355	+	Silent	SNP	G	G	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr11:17124355G>T	ENST00000265970.7	-	23	3704	c.3705C>A	c.(3703-3705)tcC>tcA	p.S1235S	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Silent_p.S855S	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1235	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						ATCCAGCACAGGAATAGATAA	0.333																																					p.S1235S		Atlas-SNP	.											.	PIK3C2A	148	.	0			c.C3705A						PASS	.						67.0	60.0	63.0					11																	17124355		2200	4293	6493	SO:0001819	synonymous_variant	5286	exon23			AGCACAGGAATAG	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.3705C>A	chr11.hg19:g.17124355G>T		57.0	0.0	.		54.0	4.0	.	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Silent	SNP	ENST00000265970.7	hg19	CCDS7824.1																																																																																			.	.	.	none		0.333	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
PHLDB1	23187	hgsc.bcm.edu	37	11	118498570	118498570	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr11:118498570G>C	ENST00000361417.2	+	7	1442	c.1031G>C	c.(1030-1032)cGg>cCg	p.R344P	PHLDB1_ENST00000356063.5_Missense_Mutation_p.R344P	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	344										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GCGGAGGCCCGGAGAGCCACT	0.667																																					p.R344P		Atlas-SNP	.											.	PHLDB1	103	.	0			c.G1031C						PASS	.						20.0	23.0	22.0					11																	118498570		2199	4288	6487	SO:0001583	missense	23187	exon6			AGGCCCGGAGAGC		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.1031G>C	chr11.hg19:g.118498570G>C	ENSP00000354498:p.Arg344Pro	30.0	0.0	.		33.0	8.0	.	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	hg19	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.631475	0.46944	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000543207;ENST00000356063	T;T	0.32515	1.46;1.45	5.13	4.22	0.49857	.	0.644418	0.16313	N	0.219911	T	0.40645	0.1125	L	0.36672	1.1	0.80722	D	1	B;B;P;D	0.67145	0.254;0.009;0.943;0.996	B;B;P;D	0.72982	0.113;0.011;0.681;0.979	T	0.16247	-1.0409	10	0.48119	T	0.1	-8.6545	7.1746	0.25736	0.0904:0.1718:0.7379:0.0	.	343;344;344;344	B4DIX4;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	P	344;103;343;344	ENSP00000354498:R344P;ENSP00000348359:R344P	ENSP00000348359:R344P	R	+	2	0	PHLDB1	118003780	0.698000	0.27777	1.000000	0.80357	0.994000	0.84299	1.948000	0.40303	1.392000	0.46585	0.563000	0.77884	CGG	.	.	.	none		0.667	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
AEBP2	121536	hgsc.bcm.edu	37	12	19615597	19615597	+	Silent	SNP	C	C	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr12:19615597C>T	ENST00000398864.3	+	2	851	c.825C>T	c.(823-825)agC>agT	p.S275S	AEBP2_ENST00000360995.4_Silent_p.S59S|AEBP2_ENST00000266508.9_Silent_p.S275S|AEBP2_ENST00000541908.1_Silent_p.S46S	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	275	Interaction with RBBP4.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					TCAACTCTAGCCCAGATCTGG	0.443																																					p.S275S		Atlas-SNP	.											.	AEBP2	21	.	0			c.C825T						PASS	.						135.0	129.0	130.0					12																	19615597		1945	4140	6085	SO:0001819	synonymous_variant	121536	exon2			CTCTAGCCCAGAT		CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.825C>T	chr12.hg19:g.19615597C>T		78.0	0.0	.		70.0	11.0	.	NM_001114176	Q59FS5|Q6ZN62|Q96BG3	Silent	SNP	ENST00000398864.3	hg19	CCDS44841.1																																																																																			.	.	.	none		0.443	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401575.1	NM_153207	
KRT73	319101	hgsc.bcm.edu	37	12	53011930	53011930	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr12:53011930T>G	ENST00000305748.3	-	1	413	c.379A>C	c.(379-381)Aaa>Caa	p.K127Q	RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	127	Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCACGCACTTTCTGGATTTCA	0.577																																					p.K127Q		Atlas-SNP	.											.	KRT73	101	.	0			c.A379C						PASS	.						132.0	132.0	132.0					12																	53011930		2203	4300	6503	SO:0001583	missense	319101	exon1			GCACTTTCTGGAT	AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.379A>C	chr12.hg19:g.53011930T>G	ENSP00000307014:p.Lys127Gln	87.0	0.0	.		92.0	18.0	.	NM_175068	Q32MB2	Missense_Mutation	SNP	ENST00000305748.3	hg19	CCDS8834.1	.	.	.	.	.	.	.	.	.	.	T	13.80	2.344058	0.41498	.	.	ENSG00000186049	ENST00000305748	T	0.75367	-0.93	4.4	3.21	0.36854	.	0.000000	0.52532	D	0.000073	T	0.74809	0.3765	L	0.45744	1.44	0.25981	N	0.982374	D	0.62365	0.991	P	0.58721	0.844	T	0.63906	-0.6531	10	0.33940	T	0.23	.	7.536	0.27710	0.1468:0.0:0.1346:0.7185	.	127	Q86Y46	K2C73_HUMAN	Q	127	ENSP00000307014:K127Q	ENSP00000307014:K127Q	K	-	1	0	KRT73	51298197	0.000000	0.05858	0.998000	0.56505	0.817000	0.46193	-0.029000	0.12329	0.763000	0.33175	0.533000	0.62120	AAA	.	.	.	none		0.577	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068	
MON2	23041	hgsc.bcm.edu	37	12	62892784	62892784	+	Missense_Mutation	SNP	C	C	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr12:62892784C>G	ENST00000393632.2	+	5	912	c.521C>G	c.(520-522)aCt>aGt	p.T174S	MON2_ENST00000552115.1_Missense_Mutation_p.T174S|MON2_ENST00000393630.3_Missense_Mutation_p.T174S|MON2_ENST00000549378.1_3'UTR|MON2_ENST00000552738.1_Missense_Mutation_p.T174S|MON2_ENST00000393629.2_Missense_Mutation_p.T174S|MON2_ENST00000280379.6_Missense_Mutation_p.T174S|MON2_ENST00000546600.1_Missense_Mutation_p.T174S	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	174					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		CAAGTTGTTACTGTTGTTTTT	0.368																																					p.T174S		Atlas-SNP	.											.	MON2	160	.	0			c.C521G						PASS	.						241.0	230.0	234.0					12																	62892784		2203	4300	6503	SO:0001583	missense	23041	exon5			TTGTTACTGTTGT		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.521C>G	chr12.hg19:g.62892784C>G	ENSP00000377252:p.Thr174Ser	107.0	0.0	.		78.0	16.0	.	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	hg19	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	C	10.07	1.249102	0.22880	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.65178	0.7;-0.14;-0.14;0.71;0.71;-0.14;0.71	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.39937	0.1097	N	0.03050	-0.425	0.80722	D	1	B;B;B;B;B	0.22346	0.068;0.037;0.041;0.066;0.039	B;B;B;B;B	0.22386	0.018;0.032;0.032;0.039;0.018	T	0.33574	-0.9863	9	.	.	.	-16.895	19.173	0.93588	0.0:1.0:0.0:0.0	.	174;174;174;174;174	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4;Q7Z3U7	.;.;.;.;MON2_HUMAN	S	174;174;174;174;102;174;174;174	ENSP00000377252:T174S;ENSP00000377250:T174S;ENSP00000280379:T174S;ENSP00000447407:T174S;ENSP00000449215:T174S;ENSP00000377249:T174S;ENSP00000446635:T174S	.	T	+	2	0	MON2	61179051	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.818000	0.86416	2.553000	0.86117	0.491000	0.48974	ACT	.	.	.	none		0.368	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
RNFT2	84900	hgsc.bcm.edu	37	12	117178872	117178872	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr12:117178872G>C	ENST00000257575.4	+	3	289	c.56G>C	c.(55-57)aGc>aCc	p.S19T	RNFT2_ENST00000392549.2_Missense_Mutation_p.S19T|C12orf49_ENST00000536380.1_5'Flank|RNFT2_ENST00000319176.7_Missense_Mutation_p.S19T|RNFT2_ENST00000407967.3_Missense_Mutation_p.S19T			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	19						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CGCCACAGCAGCAACACGGAT	0.527																																					p.S19T		Atlas-SNP	.											.	RNFT2	28	.	0			c.G56C						PASS	.						100.0	107.0	105.0					12																	117178872		2197	4296	6493	SO:0001583	missense	84900	exon3			ACAGCAGCAACAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.56G>C	chr12.hg19:g.117178872G>C	ENSP00000257575:p.Ser19Thr	61.0	0.0	.		47.0	9.0	.	NM_001109903	E9PAM7|Q96SU5	Missense_Mutation	SNP	ENST00000257575.4	hg19	CCDS44987.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.800522	0.50315	.	.	ENSG00000135119	ENST00000257575;ENST00000407967;ENST00000392549;ENST00000319176	T;T	0.58506	0.33;0.33	4.49	4.49	0.54785	.	.	.	.	.	T	0.69815	0.3153	L	0.43152	1.355	0.54753	D	0.999981	P;D	0.67145	0.956;0.996	D;D	0.76071	0.931;0.987	T	0.73849	-0.3853	9	0.87932	D	0	-3.2449	17.4248	0.87524	0.0:0.0:1.0:0.0	.	19;19	Q96EX2;E9PAM7	RNFT2_HUMAN;.	T	19	ENSP00000257575:S19T;ENSP00000376332:S19T	ENSP00000257575:S19T	S	+	2	0	RNFT2	115663255	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.055000	0.93873	2.347000	0.79759	0.555000	0.69702	AGC	.	.	.	none		0.527	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
SACS	26278	hgsc.bcm.edu	37	13	23929405	23929405	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr13:23929405G>C	ENST00000382292.3	-	7	1619	c.1346C>G	c.(1345-1347)cCt>cGt	p.P449R	SACS_ENST00000382298.3_Missense_Mutation_p.P449R|SACS_ENST00000476776.1_5'Flank|SACS_ENST00000402364.1_5'UTR			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	449					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AGGTGGTAAAGGAAGGAAACA	0.458																																					p.P449R		Atlas-SNP	.											.	SACS	871	.	0			c.C1346G						PASS	.						81.0	72.0	75.0					13																	23929405		2203	4300	6503	SO:0001583	missense	26278	exon8			GGTAAAGGAAGGA	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.1346C>G	chr13.hg19:g.23929405G>C	ENSP00000371729:p.Pro449Arg	64.0	0.0	.		41.0	9.0	.	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	hg19	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681299	0.68042	.	.	ENSG00000151835	ENST00000382292;ENST00000382298;ENST00000423156	T;T;T	0.18338	2.22;2.22;2.22	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.52191	0.1719	M	0.88450	2.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.99	T	0.58103	-0.7695	10	0.87932	D	0	.	20.2406	0.98372	0.0:0.0:1.0:0.0	.	348;236;449	B2REB1;E9PAL4;Q9NZJ4	.;.;SACS_HUMAN	R	449;449;73	ENSP00000371729:P449R;ENSP00000371735:P449R;ENSP00000390925:P73R	ENSP00000371729:P449R	P	-	2	0	SACS	22827405	1.000000	0.71417	0.847000	0.33407	0.377000	0.30045	9.798000	0.99111	2.857000	0.98124	0.650000	0.86243	CCT	.	.	.	none		0.458	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
RNF17	56163	hgsc.bcm.edu	37	13	25373622	25373622	+	Missense_Mutation	SNP	A	A	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr13:25373622A>G	ENST00000255324.5	+	12	1541	c.1489A>G	c.(1489-1491)Aga>Gga	p.R497G	RNF17_ENST00000381921.1_Missense_Mutation_p.R497G|RNF17_ENST00000255325.6_Missense_Mutation_p.R497G	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	497					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TAGAAATACCAGAAAACCTTG	0.348																																					p.R497G		Atlas-SNP	.											.	RNF17	259	.	0			c.A1489G						PASS	.						106.0	112.0	110.0					13																	25373622		2203	4298	6501	SO:0001583	missense	56163	exon12			AATACCAGAAAAC	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1489A>G	chr13.hg19:g.25373622A>G	ENSP00000255324:p.Arg497Gly	101.0	0.0	.		65.0	21.0	.	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	hg19	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	A	9.146	1.015011	0.19355	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000255325	T;T;T	0.17370	3.51;3.51;2.28	5.41	2.99	0.34606	Maternal tudor protein (1);	0.222829	0.33916	N	0.004431	T	0.07188	0.0182	N	0.08118	0	0.80722	D	1	B;B	0.12013	0.001;0.005	B;B	0.14578	0.005;0.011	T	0.24621	-1.0155	10	0.26408	T	0.33	.	5.2251	0.15389	0.6627:0.0:0.3373:0.0	.	497;497	B7Z7S1;Q9BXT8	.;RNF17_HUMAN	G	497;497;356;498	ENSP00000255324:R497G;ENSP00000371346:R497G;ENSP00000255325:R498G	ENSP00000255324:R497G	R	+	1	2	RNF17	24271622	0.908000	0.30866	0.777000	0.31699	0.600000	0.36913	1.532000	0.36029	1.059000	0.40554	0.455000	0.32223	AGA	.	.	.	none		0.348	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
GPR12	2835	hgsc.bcm.edu	37	13	27333950	27333950	+	Silent	SNP	C	C	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr13:27333950C>T	ENST00000381436.2	-	1	477	c.15G>A	c.(13-15)ctG>ctA	p.L5L	GPR12_ENST00000405846.3_Silent_p.L5L			P47775	GPR12_HUMAN	G protein-coupled receptor 12	5					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		AATTGACCTTCAGGTCTTCAT	0.478																																					p.L5L		Atlas-SNP	.											.	GPR12	67	.	0			c.G15A						PASS	.						32.0	37.0	35.0					13																	27333950		2199	4300	6499	SO:0001819	synonymous_variant	2835	exon2			GACCTTCAGGTCT	U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.15G>A	chr13.hg19:g.27333950C>T		64.0	0.0	.		45.0	12.0	.	NM_005288	Q5T8P3	Silent	SNP	ENST00000381436.2	hg19	CCDS9319.1																																																																																			.	.	.	none		0.478	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044257.2		
MYH7	4625	hgsc.bcm.edu	37	14	23893155	23893155	+	Silent	SNP	C	C	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr14:23893155C>A	ENST00000355349.3	-	23	3045	c.2883G>T	c.(2881-2883)ctG>ctT	p.L961L		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	961					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CCACTTTGGCCAGTGTCAGCT	0.532																																					p.L961L		Atlas-SNP	.											.	MYH7	349	.	0			c.G2883T						PASS	.						186.0	169.0	175.0					14																	23893155		2203	4300	6503	SO:0001819	synonymous_variant	4625	exon23			TTTGGCCAGTGTC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2883G>T	chr14.hg19:g.23893155C>A		35.0	0.0	.		38.0	11.0	.	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	hg19	CCDS9601.1																																																																																			.	.	.	none		0.532	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
ALDH6A1	4329	hgsc.bcm.edu	37	14	74531541	74531541	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr14:74531541T>A	ENST00000553458.1	-	11	1585	c.1487A>T	c.(1486-1488)aAt>aTt	p.N496I	AC005484.5_ENST00000492026.1_RNA|ALDH6A1_ENST00000555126.1_Missense_Mutation_p.N213I|CCDC176_ENST00000394009.3_3'UTR|ALDH6A1_ENST00000350259.4_Missense_Mutation_p.N483I|CCDC176_ENST00000553773.1_Intron	NM_001278593.1|NM_005589.2	NP_001265522.1|NP_005580.1	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6 family, member A1	496					branched-chain amino acid catabolic process (GO:0009083)|brown fat cell differentiation (GO:0050873)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|thymine metabolic process (GO:0019859)|valine catabolic process (GO:0006574)|valine metabolic process (GO:0006573)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fatty-acyl-CoA binding (GO:0000062)|malonate-semialdehyde dehydrogenase (acetylating) activity (GO:0018478)|methylmalonate-semialdehyde dehydrogenase (acylating) activity (GO:0004491)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(3)|skin(3)	21				BRCA - Breast invasive adenocarcinoma(234;0.00354)		GCCATAGAAATTGGTGTCTCC	0.413																																					p.N496I		Atlas-SNP	.											.	ALDH6A1	42	.	0			c.A1487T						PASS	.						49.0	49.0	49.0					14																	74531541		2203	4300	6503	SO:0001583	missense	4329	exon11			TAGAAATTGGTGT	M93405	CCDS9826.1, CCDS61501.1	14q24.3	2014-02-03			ENSG00000119711	ENSG00000119711	1.2.1.27	"""Aldehyde dehydrogenases"""	7179	protein-coding gene	gene with protein product		603178		MMSDH		1527093	Standard	NM_005589		Approved		uc001xpo.3	Q02252	OTTHUMG00000171203	ENST00000553458.1:c.1487A>T	chr14.hg19:g.74531541T>A	ENSP00000450436:p.Asn496Ile	221.0	0.0	.		204.0	51.0	.	NM_005589	B2R609|B4DFS8|J3KNU8|Q9UKM8	Missense_Mutation	SNP	ENST00000553458.1	hg19	CCDS9826.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.818862	0.90873	.	.	ENSG00000119711	ENST00000553458;ENST00000350259;ENST00000555126	T;T;T	0.76186	-1.0;-1.0;-1.0	6.17	6.17	0.99709	Aldehyde dehydrogenase domain (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.87208	0.6120	M	0.87038	2.855	0.80722	D	1	P;D	0.52996	0.924;0.957	P;P	0.61397	0.888;0.888	D	0.89098	0.3487	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	483;496	B4DFS8;Q02252	.;MMSA_HUMAN	I	496;483;213	ENSP00000450436:N496I;ENSP00000342564:N483I;ENSP00000452081:N213I	ENSP00000342564:N496I	N	-	2	0	ALDH6A1	73601294	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	AAT	.	.	.	none		0.413	ALDH6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412309.1		
RYR3	6263	hgsc.bcm.edu	37	15	33941289	33941290	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr15:33941289_33941290TC>AT	ENST00000389232.4	+	31	4065_4066	c.3995_3996TC>AT	c.(3994-3996)aTC>aAT	p.I1332N	RYR3_ENST00000415757.3_Missense_Mutation_p.I1332N	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1332	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TACTACGCCATCCGCATCTTTG	0.53																																					p.I1332N|p.I1332I		Atlas-SNP	.											.	RYR3	760	.	0			c.T3995A|c.C3996T						PASS	.																																			SO:0001583	missense	6263	exon31			ACGCCATCCGCAT|CGCCATCCGCATC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		Exception_encountered	chr15.hg19:g.33941289_33941290delinsAT	ENSP00000373884:p.Ile1332Asn	49.0	0.0	.		50.0|52.0	14.0|16.0	.	NM_001243996	O15175|Q15412	Missense_Mutation|Silent	SNP	ENST00000389232.4	hg19	CCDS45210.1																																																																																			.	.	.	none		0.530	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
EIF2AK4	440275	hgsc.bcm.edu	37	15	40268924	40268924	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr15:40268924G>A	ENST00000263791.5	+	12	2171	c.2128G>A	c.(2128-2130)Gag>Aag	p.E710K	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.E710K	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	710	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		CAGCTCGGTGGAGTGGAGCAC	0.721																																					p.E710K		Atlas-SNP	.											.	EIF2AK4	107	.	0			c.G2128A						PASS	.						22.0	25.0	24.0					15																	40268924		1774	3885	5659	SO:0001583	missense	440275	exon12			TCGGTGGAGTGGA	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.2128G>A	chr15.hg19:g.40268924G>A	ENSP00000263791:p.Glu710Lys	71.0	0.0	.		63.0	12.0	.	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	hg19	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	G	37	6.303692	0.97458	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.71103	-0.54;-0.5	5.34	5.34	0.76211	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79203	0.4406	L	0.41356	1.27	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.75266	-0.3378	10	0.29301	T	0.29	-25.8872	19.4115	0.94675	0.0:0.0:1.0:0.0	.	710	Q9P2K8	E2AK4_HUMAN	K	710	ENSP00000263791:E710K;ENSP00000372174:E710K	ENSP00000263791:E710K	E	+	1	0	EIF2AK4	38056216	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.700000	0.98707	2.651000	0.90000	0.585000	0.79938	GAG	.	.	.	none		0.721	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
LRRC57	255252	hgsc.bcm.edu	37	15	42839565	42839565	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr15:42839565C>A	ENST00000323443.2	-	3	753	c.386G>T	c.(385-387)aGc>aTc	p.S129I	HAUS2_ENST00000568876.1_5'Flank|HAUS2_ENST00000568846.2_5'Flank|LRRC57_ENST00000397130.3_Missense_Mutation_p.S129I|HAUS2_ENST00000260372.3_5'Flank|LRRC57_ENST00000563454.1_Missense_Mutation_p.S129I			Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	129						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|lung(5)|prostate(1)	8		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		GTGCCGTAGGCTACAAAGTTG	0.527																																					p.S129I		Atlas-SNP	.											.	LRRC57	20	.	0			c.G386T						PASS	.						96.0	83.0	87.0					15																	42839565		2203	4299	6502	SO:0001583	missense	255252	exon4			CGTAGGCTACAAA	AK094891	CCDS10089.1	15q15.1	2006-02-13			ENSG00000180979	ENSG00000180979			26719	protein-coding gene	gene with protein product							Standard	NM_153260		Approved	FLJ36812	uc001zqc.3	Q8N9N7	OTTHUMG00000130679	ENST00000323443.2:c.386G>T	chr15.hg19:g.42839565C>A	ENSP00000326817:p.Ser129Ile	71.0	0.0	.		72.0	23.0	.	NM_153260	Q7Z2Z6|Q8N1T6	Missense_Mutation	SNP	ENST00000323443.2	hg19	CCDS10089.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707022	0.30232	.	.	ENSG00000180979	ENST00000323443;ENST00000397130	T;T	0.58940	0.3;0.3	5.41	0.293	0.15742	.	0.471361	0.27749	N	0.018005	T	0.49966	0.1588	M	0.70275	2.135	0.28209	N	0.927029	B	0.27192	0.171	B	0.28465	0.09	T	0.44847	-0.9301	10	0.42905	T	0.14	.	5.8582	0.18732	0.0:0.5396:0.1234:0.337	.	129	Q8N9N7	LRC57_HUMAN	I	129	ENSP00000326817:S129I;ENSP00000380319:S129I	ENSP00000326817:S129I	S	-	2	0	LRRC57	40626857	1.000000	0.71417	0.970000	0.41538	0.620000	0.37586	0.915000	0.28638	0.092000	0.17331	-0.818000	0.03119	AGC	.	.	.	none		0.527	LRRC57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253174.1	NM_153260	
DMXL2	23312	hgsc.bcm.edu	37	15	51758502	51758502	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr15:51758502G>A	ENST00000251076.5	-	30	7683	c.7396C>T	c.(7396-7398)Ctt>Ttt	p.L2466F	DMXL2_ENST00000543779.2_Missense_Mutation_p.L2467F|RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000449909.3_Missense_Mutation_p.L1830F	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2466						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		GACAAAGGAAGAAATGGCTGC	0.239																																					p.L2467F		Atlas-SNP	.											DMXL2,bladder,carcinoma,0,1	DMXL2	262	.	0			c.C7399T						PASS	.						62.0	61.0	62.0					15																	51758502		2195	4290	6485	SO:0001583	missense	23312	exon30			AAGGAAGAAATGG	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7396C>T	chr15.hg19:g.51758502G>A	ENSP00000251076:p.Leu2466Phe	142.0	1.0	.		123.0	43.0	.	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	hg19	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522339	0.85600	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.27557	1.8;1.79;1.66	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.55705	0.1937	M	0.69358	2.11	0.80722	D	1	D;D;D;P	0.76494	0.998;0.998;0.999;0.597	D;D;D;B	0.80764	0.943;0.986;0.994;0.293	T	0.55366	-0.8152	10	0.54805	T	0.06	.	18.8489	0.92218	0.0:0.0:1.0:0.0	.	2467;1830;2466;2467	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	F	2466;2467;1830;11	ENSP00000251076:L2466F;ENSP00000441858:L2467F;ENSP00000400855:L1830F	ENSP00000251076:L2466F	L	-	1	0	DMXL2	49545794	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.154000	0.77437	2.697000	0.92050	0.556000	0.70494	CTT	.	.	.	none		0.239	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
ZSCAN10	84891	hgsc.bcm.edu	37	16	3141821	3141821	+	Missense_Mutation	SNP	C	C	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr16:3141821C>T	ENST00000252463.2	-	3	595	c.508G>A	c.(508-510)Ggc>Agc	p.G170S	ZSCAN10_ENST00000575108.1_5'UTR|ZSCAN10_ENST00000538082.2_Missense_Mutation_p.G88S|ZSCAN10_ENST00000572548.1_Silent_p.R35R	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	170	Pro-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						GGTGAGGGGCCCTGGGGACCT	0.647																																					p.G170S		Atlas-SNP	.											.	ZSCAN10	63	.	0			c.G508A						PASS	.						14.0	13.0	14.0					16																	3141821		2189	4291	6480	SO:0001583	missense	84891	exon3			AGGGGCCCTGGGG	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.508G>A	chr16.hg19:g.3141821C>T	ENSP00000252463:p.Gly170Ser	90.0	0.0	.		101.0	18.0	.	NM_032805	B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	ENST00000252463.2	hg19	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727505	0.69074	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	T	0.06068	3.35	4.64	4.64	0.57946	.	0.377632	0.19741	N	0.107124	T	0.05044	0.0135	N	0.08118	0	0.80722	D	1	D;D	0.54047	0.964;0.964	P;P	0.47673	0.554;0.554	T	0.58306	-0.7659	10	0.18710	T	0.47	-25.2064	13.0179	0.58768	0.0:1.0:0.0:0.0	.	103;170	Q1WWM2;Q96SZ4	.;ZSC10_HUMAN	S	103;170	ENSP00000252463:G170S	ENSP00000252463:G170S	G	-	1	0	ZSCAN10	3081822	0.088000	0.21588	0.987000	0.45799	0.590000	0.36582	0.394000	0.20834	2.150000	0.67090	0.561000	0.74099	GGC	.	.	.	none		0.647	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805	
HSF4	3299	hgsc.bcm.edu	37	16	67199508	67199508	+	Silent	SNP	G	G	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr16:67199508G>T	ENST00000521374.1	+	2	207	c.207G>T	c.(205-207)gcG>gcT	p.A69A	HSF4_ENST00000264009.8_Silent_p.A69A|RP11-5A19.5_ENST00000518227.1_3'UTR|HSF4_ENST00000584272.1_Silent_p.A69A|HSF4_ENST00000421453.1_Silent_p.A69A			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	69					camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GCAACATGGCGAGCTTCGTGC	0.647																																					p.A69A		Atlas-SNP	.											.	HSF4	33	.	0			c.G207T						PASS	.						52.0	58.0	56.0					16																	67199508		2154	4289	6443	SO:0001819	synonymous_variant	3299	exon4			CATGGCGAGCTTC	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.207G>T	chr16.hg19:g.67199508G>T		87.0	0.0	.		97.0	21.0	.	NM_001538	Q99472|Q9ULV6	Silent	SNP	ENST00000521374.1	hg19	CCDS42175.1																																																																																			.	.	.	none		0.647	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375080.1	NM_001538	
MINK1	50488	hgsc.bcm.edu	37	17	4788851	4788851	+	Nonsense_Mutation	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:4788851G>A	ENST00000355280.6	+	7	778	c.582G>A	c.(580-582)tgG>tgA	p.W194*	MINK1_ENST00000347992.7_Nonsense_Mutation_p.W194*|RN7SL784P_ENST00000577319.1_RNA|MINK1_ENST00000453408.3_Nonsense_Mutation_p.W194*	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						CTCCCTACTGGATGGCTCCAG	0.577																																					p.W194X		Atlas-SNP	.											.	MINK1	110	.	0			c.G582A						PASS	.						97.0	102.0	100.0					17																	4788851		2062	4183	6245	SO:0001587	stop_gained	50488	exon7			CTACTGGATGGCT	AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.582G>A	chr17.hg19:g.4788851G>A	ENSP00000347427:p.Trp194*	70.0	0.0	.		73.0	21.0	.	NM_170663		Nonsense_Mutation	SNP	ENST00000355280.6	hg19	CCDS45588.1	.	.	.	.	.	.	.	.	.	.	G	38	6.985257	0.97983	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.0271	0.86450	0.0:0.0:1.0:0.0	.	.	.	.	X	194	.	ENSP00000269296:W194X	W	+	3	0	MINK1	4729634	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.884000	0.98904	0.655000	0.94253	TGG	.	.	.	none		0.577	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439801.1	NM_015716	
SLC2A4	6517	hgsc.bcm.edu	37	17	7187813	7187813	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:7187813G>A	ENST00000317370.8	+	7	1005	c.737G>A	c.(736-738)cGc>cAc	p.R246H	RP1-4G17.2_ENST00000576271.1_RNA|SLC2A4_ENST00000571308.1_Missense_Mutation_p.R246H|SLC2A4_ENST00000424875.2_Missense_Mutation_p.R236H	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	246					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)	p.R246H(1)		breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						GGTCTGAAGCGCCTGACAGGC	0.637																																					p.R246H		Atlas-SNP	.											SLC2A4,colon,carcinoma,0,1	SLC2A4	44	.	1	Substitution - Missense(1)	large_intestine(1)	c.G737A						PASS	.						42.0	44.0	43.0					17																	7187813		2203	4300	6503	SO:0001583	missense	6517	exon7			TGAAGCGCCTGAC	M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.737G>A	chr17.hg19:g.7187813G>A	ENSP00000320935:p.Arg246His	114.0	0.0	.		143.0	29.0	.	NM_001042	Q05BQ3|Q14CX2	Missense_Mutation	SNP	ENST00000317370.8	hg19	CCDS11097.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.789231	0.49997	.	.	ENSG00000181856	ENST00000317370;ENST00000424875	T;T	0.76448	-1.02;-1.02	4.88	3.84	0.44239	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.124816	0.51477	D	0.000087	T	0.75744	0.3891	M	0.90650	3.135	0.48040	D	0.999573	P;P	0.51933	0.484;0.949	B;B	0.37989	0.15;0.262	T	0.79642	-0.1718	10	0.59425	D	0.04	.	5.782	0.18312	0.2087:0.0:0.7913:0.0	.	246;236	P14672;F5H081	GTR4_HUMAN;.	H	246;236	ENSP00000320935:R246H;ENSP00000396887:R236H	ENSP00000320935:R246H	R	+	2	0	SLC2A4	7128537	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.296000	0.51802	2.535000	0.85469	0.655000	0.94253	CGC	.	.	.	none		0.637	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220031.3		
SHMT1	6470	hgsc.bcm.edu	37	17	18232685	18232685	+	Missense_Mutation	SNP	G	G	A	rs140862126		TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:18232685G>A	ENST00000316694.3	-	11	1323	c.1189C>T	c.(1189-1191)Cgg>Tgg	p.R397W	SHMT1_ENST00000539052.1_Missense_Mutation_p.R259W|SHMT1_ENST00000352886.6_Missense_Mutation_p.R317W|SHMT1_ENST00000354098.3_Missense_Mutation_p.R358W	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	397					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	CCACTGGGCCGCAGAGCGCTT	0.517																																					p.R397W		Atlas-SNP	.											.	SHMT1	36	.	0			c.C1189T						PASS	.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	37.0	39.0	38.0		1189,1072	3.4	1.0	17	dbSNP_134	38	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SHMT1	NM_004169.3,NM_148918.1	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	397/484,358/445	18232685	1,13005	2203	4300	6503	SO:0001583	missense	6470	exon11			TGGGCCGCAGAGC		CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.1189C>T	chr17.hg19:g.18232685G>A	ENSP00000318868:p.Arg397Trp	46.0	0.0	.		48.0	9.0	.	NM_004169	B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Missense_Mutation	SNP	ENST00000316694.3	hg19	CCDS11196.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044222	0.75732	0.0	1.16E-4	ENSG00000176974	ENST00000316694;ENST00000395684;ENST00000352886;ENST00000539052;ENST00000354098	T;T;T;T	0.43294	0.95;1.54;0.95;1.54	5.52	3.36	0.38483	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.051991	0.85682	D	0.000000	T	0.56077	0.1961	L	0.56124	1.755	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.66497	0.944;0.839	T	0.56613	-0.7950	10	0.37606	T	0.19	-17.6168	15.0169	0.71594	0.0:0.0:0.7428:0.2572	.	358;397	P34896-2;P34896	.;GLYC_HUMAN	W	397;172;317;259;358	ENSP00000318868:R397W;ENSP00000345881:R317W;ENSP00000440089:R259W;ENSP00000318805:R358W	ENSP00000318868:R397W	R	-	1	2	SHMT1	18173410	1.000000	0.71417	0.965000	0.40720	0.794000	0.44872	4.977000	0.63792	1.429000	0.47314	0.655000	0.94253	CGG	.	G|1.000;A|0.000	0.000	weak		0.517	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2	NM_004169	
EFCAB5	374786	hgsc.bcm.edu	37	17	28380417	28380417	+	Missense_Mutation	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:28380417G>A	ENST00000394835.3	+	10	1637	c.1445G>A	c.(1444-1446)aGt>aAt	p.S482N	EFCAB5_ENST00000394832.2_Missense_Mutation_p.S482N|EFCAB5_ENST00000536908.2_Missense_Mutation_p.S426N|EFCAB5_ENST00000320856.5_Missense_Mutation_p.S482N|EFCAB5_ENST00000541045.1_Missense_Mutation_p.S139N|EFCAB5_ENST00000378738.3_Missense_Mutation_p.S482N	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	482							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						AAAACCCAAAGTAAATTATTA	0.388																																					p.S482N		Atlas-SNP	.											.	EFCAB5	122	.	0			c.G1445A						PASS	.						135.0	135.0	135.0					17																	28380417		1894	4113	6007	SO:0001583	missense	374786	exon10			CCCAAAGTAAATT	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.1445G>A	chr17.hg19:g.28380417G>A	ENSP00000378312:p.Ser482Asn	179.0	0.0	.		170.0	31.0	.	NM_198529	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	hg19	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746070	0.69418	.	.	ENSG00000176927	ENST00000536908;ENST00000534836;ENST00000541045;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598;ENST00000419434	T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83	4.92	0.725	0.18242	.	0.461885	0.20171	N	0.097728	T	0.49864	0.1582	L	0.54323	1.7	0.09310	N	1	D;D;P;B;B;P	0.59767	0.976;0.986;0.949;0.004;0.011;0.949	P;P;P;B;B;P	0.58520	0.696;0.84;0.57;0.009;0.015;0.57	T	0.41592	-0.9500	10	0.19590	T	0.45	-1.5963	7.0606	0.25123	0.3652:0.0:0.6348:0.0	.	426;426;482;482;482;482	B4DS75;F5GYL2;A8MSY9;B5MEA3;E7EVS9;A4FU69	.;.;.;.;.;EFCB5_HUMAN	N	426;225;139;482;482;482;482;426;288	ENSP00000440619:S426N;ENSP00000445575:S139N;ENSP00000378312:S482N;ENSP00000322003:S482N;ENSP00000378309:S482N;ENSP00000368012:S482N;ENSP00000417009:S288N	ENSP00000322003:S482N	S	+	2	0	EFCAB5	25404543	0.000000	0.05858	0.000000	0.03702	0.750000	0.42670	-0.383000	0.07398	0.091000	0.17302	0.655000	0.94253	AGT	.	.	.	none		0.388	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
EFCAB5	374786	hgsc.bcm.edu	37	17	28380419	28380419	+	Nonsense_Mutation	SNP	A	A	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:28380419A>T	ENST00000394835.3	+	10	1639	c.1447A>T	c.(1447-1449)Aaa>Taa	p.K483*	EFCAB5_ENST00000394832.2_Nonsense_Mutation_p.K483*|EFCAB5_ENST00000536908.2_Nonsense_Mutation_p.K427*|EFCAB5_ENST00000320856.5_Nonsense_Mutation_p.K483*|EFCAB5_ENST00000541045.1_Nonsense_Mutation_p.K140*|EFCAB5_ENST00000378738.3_Nonsense_Mutation_p.K483*	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	483							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						AACCCAAAGTAAATTATTAGA	0.383																																					p.K483X		Atlas-SNP	.											.	EFCAB5	122	.	0			c.A1447T						PASS	.						135.0	135.0	135.0					17																	28380419		1892	4115	6007	SO:0001587	stop_gained	374786	exon10			CAAAGTAAATTAT	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.1447A>T	chr17.hg19:g.28380419A>T	ENSP00000378312:p.Lys483*	180.0	0.0	.		168.0	30.0	.	NM_198529	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Nonsense_Mutation	SNP	ENST00000394835.3	hg19	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	A	18.64	3.667002	0.67814	.	.	ENSG00000176927	ENST00000536908;ENST00000534836;ENST00000541045;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598;ENST00000419434	.	.	.	4.92	1.33	0.21861	.	0.764210	0.11787	N	0.529575	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-9.109	5.3513	0.16038	0.5721:0.3355:0.0924:0.0	.	.	.	.	X	427;226;140;483;483;483;483;427;289	.	ENSP00000322003:K483X	K	+	1	0	EFCAB5	25404545	0.000000	0.05858	0.000000	0.03702	0.791000	0.44710	0.097000	0.15168	0.083000	0.17047	0.533000	0.62120	AAA	.	.	.	none		0.383	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
STAT3	6774	hgsc.bcm.edu	37	17	40481785	40481786	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:40481785_40481786CC>TA	ENST00000264657.5	-	12	1430_1431	c.1118_1119GG>TA	c.(1117-1119)gGG>gTA	p.G373V	STAT3_ENST00000404395.3_Missense_Mutation_p.G373V|STAT3_ENST00000585517.1_Missense_Mutation_p.G373V|STAT3_ENST00000389272.3_Missense_Mutation_p.G275V|STAT3_ENST00000588969.1_Missense_Mutation_p.G373V	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	373					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CTGCAACGTCCCCAGAGTCTCT	0.421									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.G373G|p.G373V		Atlas-SNP	.											.	STAT3	268	.	0			c.G1119A|c.G1118T						PASS	.																																			SO:0001583	missense	6774	exon12	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	AACGTCCCCAGAG|ACGTCCCCAGAGT	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1118_1119delinsTA	chr17.hg19:g.40481785_40481786delinsTA	ENSP00000264657:p.Gly373Val	113.0	0.0	.		120.0	37.0|36.0	.	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	Silent|Missense_Mutation	SNP	ENST00000264657.5	hg19	CCDS32656.1																																																																																			.	.	.	none		0.421	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
EFTUD2	9343	hgsc.bcm.edu	37	17	42949881	42949881	+	Silent	SNP	G	G	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:42949881G>A	ENST00000426333.2	-	11	1224	c.927C>T	c.(925-927)ttC>ttT	p.F309F	EFTUD2_ENST00000592576.1_Silent_p.F299F|EFTUD2_ENST00000591382.1_Silent_p.F309F|EFTUD2_ENST00000402521.3_Silent_p.F274F	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	309	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				GGGAGCTGGAGAAGCAGACGT	0.547																																					p.F309F	Ovarian(10;65 485 10258 29980 30707)	Atlas-SNP	.											.	EFTUD2	85	.	0			c.C927T						PASS	.						187.0	166.0	174.0					17																	42949881		2203	4300	6503	SO:0001819	synonymous_variant	9343	exon11			GCTGGAGAAGCAG	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.927C>T	chr17.hg19:g.42949881G>A		102.0	0.0	.		162.0	73.0	.	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Silent	SNP	ENST00000426333.2	hg19	CCDS11489.1																																																																																			.	.	.	none		0.547	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
NFE2L1	4779	hgsc.bcm.edu	37	17	46128721	46128721	+	Silent	SNP	C	C	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:46128721C>A	ENST00000362042.3	+	2	857	c.241C>A	c.(241-243)Cgg>Agg	p.R81R	NFE2L1_ENST00000361665.3_Silent_p.R81R|NFE2L1_ENST00000585291.1_Silent_p.R81R|NFE2L1_ENST00000357480.5_Silent_p.R81R	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	81					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CTTCACTGCCCGGCGGCTCCT	0.562																																					p.R81R		Atlas-SNP	.											.	NFE2L1	60	.	0			c.C241A						PASS	.						81.0	83.0	82.0					17																	46128721		2203	4300	6503	SO:0001819	synonymous_variant	4779	exon2			ACTGCCCGGCGGC	AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.241C>A	chr17.hg19:g.46128721C>A		76.0	0.0	.		83.0	32.0	.	NM_003204	D3DTU3|D3DTU5|Q12877|Q96FN6	Silent	SNP	ENST00000362042.3	hg19	CCDS11524.1																																																																																			.	.	.	none		0.562	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443019.1	NM_003204	
CLTC	1213	hgsc.bcm.edu	37	17	57754372	57754372	+	Silent	SNP	T	T	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:57754372T>C	ENST00000269122.3	+	17	2893	c.2619T>C	c.(2617-2619)ccT>ccC	p.P873P	CLTC_ENST00000393043.1_Silent_p.P873P|CLTC_ENST00000579815.1_3'UTR|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	873	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GTGAGGAGCCTGCTACTCACA	0.428			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.P873P		Atlas-SNP	.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	124	.	0			c.T2619C						PASS	.						59.0	64.0	62.0					17																	57754372		2203	4300	6503	SO:0001819	synonymous_variant	1213	exon17			GGAGCCTGCTACT	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2619T>C	chr17.hg19:g.57754372T>C		95.0	0.0	.		91.0	34.0	.	NM_004859	D3DU00|Q6N0A0|Q86TF2	Silent	SNP	ENST00000269122.3	hg19	CCDS32696.1																																																																																			.	.	.	none		0.428	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
ABCA10	10349	hgsc.bcm.edu	37	17	67170897	67170897	+	Missense_Mutation	SNP	A	A	G	rs368716488		TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:67170897A>G	ENST00000269081.4	-	25	3808	c.2899T>C	c.(2899-2901)Tgg>Cgg	p.W967R	ABCA10_ENST00000519732.1_Intron|ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	967					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					CCTGAAATCCATAACTGGGAT	0.348																																					p.W967R		Atlas-SNP	.											.	ABCA10	209	.	0			c.T2899C						PASS	.	A	ARG/TRP	0,4402		0,0,2201	64.0	70.0	68.0		2899	-0.4	0.1	17		68	1,8595		0,1,4297	no	missense	ABCA10	NM_080282.3	101	0,1,6498	GG,GA,AA		0.0116,0.0,0.0077	benign	967/1544	67170897	1,12997	2201	4298	6499	SO:0001583	missense	10349	exon25			AAATCCATAACTG	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.2899T>C	chr17.hg19:g.67170897A>G	ENSP00000269081:p.Trp967Arg	187.0	0.0	.		236.0	57.0	.	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	hg19	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.075060	0.00379	0.0	1.16E-4	ENSG00000154263	ENST00000269081	T	0.80738	-1.41	3.3	-0.428	0.12306	.	.	.	.	.	T	0.50411	0.1614	N	0.03608	-0.345	0.24933	N	0.99191	B	0.10296	0.003	B	0.15484	0.013	T	0.39333	-0.9619	9	0.07030	T	0.85	.	3.54	0.07807	0.2691:0.0:0.2278:0.5031	.	967	Q8WWZ4	ABCAA_HUMAN	R	967	ENSP00000269081:W967R	ENSP00000269081:W967R	W	-	1	0	ABCA10	64682492	0.000000	0.05858	0.063000	0.19743	0.677000	0.39632	-1.398000	0.02509	-0.357000	0.08175	0.334000	0.21626	TGG	.	.	.	weak		0.348	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
DCC	1630	hgsc.bcm.edu	37	18	50432459	50432459	+	Missense_Mutation	SNP	T	T	G			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr18:50432459T>G	ENST00000442544.2	+	3	1074	c.458T>G	c.(457-459)aTg>aGg	p.M153R	DCC_ENST00000412726.1_Start_Codon_SNP_p.M1R	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	153	Ig-like C2-type 2.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ACAGCCTTCATGGGAGACACA	0.463																																					p.M153R		Atlas-SNP	.											.	DCC	360	.	0			c.T458G						PASS	.						95.0	89.0	91.0					18																	50432459		2203	4300	6503	SO:0001583	missense	1630	exon3			CCTTCATGGGAGA	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.458T>G	chr18.hg19:g.50432459T>G	ENSP00000389140:p.Met153Arg	74.0	0.0	.		46.0	13.0	.	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	hg19	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.912913	0.52439	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.55760	1.16;0.5	5.71	5.71	0.89125	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.064022	0.64402	D	0.000003	T	0.26593	0.0650	N	0.04387	-0.21	0.80722	D	1	B;B	0.18968	0.032;0.001	B;B	0.15052	0.012;0.001	T	0.19549	-1.0302	10	0.10111	T	0.7	.	9.9749	0.41777	0.0:0.0792:0.0:0.9208	.	1;153	E7EQM8;P43146	.;DCC_HUMAN	R	153;86;1	ENSP00000389140:M153R;ENSP00000397322:M1R	ENSP00000304146:M86R	M	+	2	0	DCC	48686457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.352000	0.59404	2.171000	0.68590	0.533000	0.62120	ATG	.	.	.	none		0.463	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
TNFRSF11A	8792	hgsc.bcm.edu	37	18	60017119	60017119	+	Missense_Mutation	SNP	G	G	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr18:60017119G>C	ENST00000586569.1	+	3	270	c.232G>C	c.(232-234)Gat>Cat	p.D78H	TNFRSF11A_ENST00000269485.7_Missense_Mutation_p.D78H	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	78					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				TGAATACTTGGATAGCTGGAA	0.438																																					p.D78H		Atlas-SNP	.											.	TNFRSF11A	51	.	0			c.G232C						PASS	.						195.0	184.0	188.0					18																	60017119		2203	4300	6503	SO:0001583	missense	8792	exon3			TACTTGGATAGCT	AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.232G>C	chr18.hg19:g.60017119G>C	ENSP00000465500:p.Asp78His	45.0	0.0	.		56.0	21.0	.	NM_001270951	I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Missense_Mutation	SNP	ENST00000586569.1	hg19	CCDS11980.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.048412	0.36181	.	.	ENSG00000141655	ENST00000382790;ENST00000269485	T	0.72051	-0.62	5.33	4.4	0.53042	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.160278	0.56097	D	0.000040	T	0.63022	0.2476	L	0.55103	1.725	0.34410	D	0.696278	B;B	0.31752	0.338;0.272	B;B	0.26864	0.065;0.074	T	0.70332	-0.4901	9	.	.	.	-22.1742	13.9329	0.64007	0.0:0.1522:0.8478:0.0	.	100;78	Q59EP9;Q9Y6Q6	.;TNR11_HUMAN	H	100;78	ENSP00000269485:D78H	.	D	+	1	0	TNFRSF11A	58168099	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	3.139000	0.50577	2.646000	0.89796	0.462000	0.41574	GAT	.	.	.	none		0.438	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256186.2		
ZNF557	79230	hgsc.bcm.edu	37	19	7083714	7083714	+	Missense_Mutation	SNP	T	T	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr19:7083714T>C	ENST00000439035.2	+	8	1471	c.1231T>C	c.(1231-1233)Tac>Cac	p.Y411H	ZNF557_ENST00000414706.1_Missense_Mutation_p.Y418H|ZNF557_ENST00000252840.6_Missense_Mutation_p.Y418H			Q8N988	ZN557_HUMAN	zinc finger protein 557	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17				Lung(535;0.179)		AAGTAACTCCTACCTTTCTGT	0.368																																					p.Y418H		Atlas-SNP	.											.	ZNF557	40	.	0			c.T1252C						PASS	.						90.0	92.0	91.0					19																	7083714		2174	4284	6458	SO:0001583	missense	79230	exon8			AACTCCTACCTTT	AK095524	CCDS42485.1, CCDS45945.1	19p13.2	2013-09-20			ENSG00000130544	ENSG00000130544		"""Zinc fingers, C2H2-type"", ""-"""	28632	protein-coding gene	gene with protein product						12477932	Standard	NM_024341		Approved	MGC4054	uc002mgc.3	Q8N988	OTTHUMG00000181977	ENST00000439035.2:c.1231T>C	chr19.hg19:g.7083714T>C	ENSP00000398965:p.Tyr411His	214.0	0.0	.		171.0	37.0	.	NM_001044387	Q6PEJ3|Q9BTZ1	Missense_Mutation	SNP	ENST00000439035.2	hg19	CCDS45945.1	.	.	.	.	.	.	.	.	.	.	T	5.054	0.195550	0.09599	.	.	ENSG00000130544	ENST00000252840;ENST00000414706;ENST00000439035	T;T;T	0.07444	3.19;3.19;3.19	0.994	-0.105	0.13601	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.16790	0.44	0.09310	N	1	B;B	0.15473	0.007;0.013	B;B	0.09377	0.002;0.004	T	0.46803	-0.9165	9	0.10377	T	0.69	.	2.0833	0.03640	0.2944:0.0:0.2971:0.4085	.	411;418	Q8N988;Q8N988-2	ZN557_HUMAN;.	H	418;418;411	ENSP00000252840:Y418H;ENSP00000404065:Y418H;ENSP00000398965:Y411H	ENSP00000252840:Y418H	Y	+	1	0	ZNF557	7034714	0.000000	0.05858	0.064000	0.19789	0.002000	0.02628	-3.017000	0.00644	-0.106000	0.12110	-0.991000	0.02546	TAC	.	.	.	none		0.368	ZNF557-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458502.1	NM_024341	
KEAP1	9817	hgsc.bcm.edu	37	19	10602767	10602767	+	Missense_Mutation	SNP	C	C	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr19:10602767C>A	ENST00000171111.5	-	3	1358	c.811G>T	c.(811-813)Gtg>Ttg	p.V271L	CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'UTR|KEAP1_ENST00000393623.2_Missense_Mutation_p.V271L	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	271	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TGGCAGCGCACGGCCCGCAGC	0.617																																					p.V271L		Atlas-SNP	.											KEAP1,right_upper_lobe,carcinoma,0,1	KEAP1	182	.	0			c.G811T						PASS	.						57.0	57.0	57.0					19																	10602767		2203	4300	6503	SO:0001583	missense	9817	exon3			AGCGCACGGCCCG	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.811G>T	chr19.hg19:g.10602767C>A	ENSP00000171111:p.Val271Leu	53.0	0.0	.		47.0	12.0	.	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	hg19	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	33	5.208480	0.95069	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.76316	-1.01;-1.01	5.61	5.61	0.85477	BTB/Kelch-associated (2);	0.056422	0.64402	N	0.000001	D	0.84897	0.5574	M	0.82630	2.6	0.80722	D	1	P	0.52170	0.951	P	0.50270	0.636	D	0.87391	0.2363	10	0.87932	D	0	.	17.1459	0.86766	0.0:1.0:0.0:0.0	.	271	Q14145	KEAP1_HUMAN	L	271	ENSP00000171111:V271L;ENSP00000377245:V271L	ENSP00000171111:V271L	V	-	1	0	KEAP1	10463767	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	5.874000	0.69652	2.656000	0.90262	0.561000	0.74099	GTG	.	.	.	none		0.617	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
IL17RA	23765	hgsc.bcm.edu	37	22	17590035	17590035	+	Missense_Mutation	SNP	A	A	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr22:17590035A>C	ENST00000319363.6	+	13	2059	c.1926A>C	c.(1924-1926)gaA>gaC	p.E642D		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	642					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		TCGGGGAGGAAGGAGGAGCAG	0.721																																					p.E642D		Atlas-SNP	.											.	IL17RA	62	.	0			c.A1926C						PASS	.						4.0	4.0	4.0					22																	17590035		2040	4043	6083	SO:0001583	missense	23765	exon13			GGAGGAAGGAGGA	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.1926A>C	chr22.hg19:g.17590035A>C	ENSP00000320936:p.Glu642Asp	404.0	1.0	.		423.0	106.0	.	NM_014339	O43844|Q20WK1	Missense_Mutation	SNP	ENST00000319363.6	hg19	CCDS13739.1	.	.	.	.	.	.	.	.	.	.	A	15.77	2.932763	0.52866	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.07800	3.16	4.89	1.27	0.21489	.	0.945953	0.08934	N	0.872522	T	0.10380	0.0254	M	0.70595	2.14	0.09310	N	1	P;P	0.47106	0.651;0.89	B;B	0.42625	0.115;0.393	T	0.27872	-1.0061	10	0.46703	T	0.11	-3.6798	1.3359	0.02145	0.4246:0.2756:0.0927:0.2071	.	590;642	D3YTB4;Q96F46	.;I17RA_HUMAN	D	590;642	ENSP00000320936:E642D	ENSP00000320936:E642D	E	+	3	2	IL17RA	15970035	0.024000	0.19004	0.004000	0.12327	0.011000	0.07611	0.018000	0.13422	0.301000	0.22738	0.459000	0.35465	GAA	.	.	.	none		0.721	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	
MICAL3	57553	hgsc.bcm.edu	37	22	18300493	18300493	+	Missense_Mutation	SNP	C	C	T	rs369106641		TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr22:18300493C>T	ENST00000441493.2	-	26	5286	c.4934G>A	c.(4933-4935)cGc>cAc	p.R1645H	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1645					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GTCAGGCCGGCGCTCCTTGCC	0.711																																					p.R1645H		Atlas-SNP	.											.	MICAL3	53	.	0			c.G4934A						PASS	.	C	HIS/ARG	0,3844		0,0,1922	15.0	19.0	18.0		4934	-3.4	0.0	22		18	1,8197		0,1,4098	no	missense	MICAL3	NM_015241.2	29	0,1,6020	TT,TC,CC		0.0122,0.0,0.0083	benign	1645/2003	18300493	1,12041	1922	4099	6021	SO:0001583	missense	57553	exon26			GGCCGGCGCTCCT	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4934G>A	chr22.hg19:g.18300493C>T	ENSP00000416015:p.Arg1645His	32.0	0.0	.		40.0	7.0	.	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	hg19	CCDS46659.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.047|4.047	0.006384|0.006384	0.07866|0.07866	0.0|0.0	1.22E-4|1.22E-4	ENSG00000093100|ENSG00000093100	ENST00000252134|ENST00000441493	.|T	.|0.62232	.|0.04	4.65|4.65	-3.39|-3.39	0.04868|0.04868	.|.	.|2.091240	.|0.02041	.|N	.|0.049305	T|T	0.37652|0.37652	0.1011|0.1011	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.13045|0.13045	-1.0524|-1.0524	5|10	.|0.44086	.|T	.|0.13	.|.	2.5643|2.5643	0.04779|0.04779	0.2761:0.3993:0.2159:0.1087|0.2761:0.3993:0.2159:0.1087	.|.	.|1645	.|Q7RTP6	.|MICA3_HUMAN	T|H	627|1645	.|ENSP00000416015:R1645H	.|ENSP00000416015:R1645H	A|R	-|-	1|2	0|0	XXbac-B461K10.4|XXbac-B461K10.4	16680493|16680493	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.055000|0.055000	0.15305|0.15305	0.227000|0.227000	0.17795|0.17795	-0.871000|-0.871000	0.04042|0.04042	-0.291000|-0.291000	0.09656|0.09656	GCC|CGC	.	.	.	weak		0.711	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
PPIL2	23759	hgsc.bcm.edu	37	22	22024222	22024222	+	Missense_Mutation	SNP	A	A	T			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr22:22024222A>T	ENST00000335025.8	+	2	144	c.53A>T	c.(52-54)tAc>tTc	p.Y18F	PPIL2_ENST00000406385.1_Missense_Mutation_p.Y18F|PPIL2_ENST00000398831.3_Missense_Mutation_p.Y18F|PPIL2_ENST00000492445.2_Missense_Mutation_p.Y18F|PPIL2_ENST00000412327.1_Missense_Mutation_p.Y18F|PPIL2_ENST00000456792.2_Missense_Mutation_p.Y18F					peptidylprolyl isomerase (cyclophilin)-like 2											endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					TGTGCTGAATACACTCACTTT	0.448																																					p.Y18F		Atlas-SNP	.											.	PPIL2	38	.	0			c.A53T						PASS	.						199.0	161.0	174.0					22																	22024222		2203	4300	6503	SO:0001583	missense	23759	exon2			CTGAATACACTCA		CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.53A>T	chr22.hg19:g.22024222A>T	ENSP00000334553:p.Tyr18Phe	73.0	0.0	.		82.0	4.0	.	NM_014337		Missense_Mutation	SNP	ENST00000335025.8	hg19	CCDS13793.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.494928	0.64186	.	.	ENSG00000100023	ENST00000412327;ENST00000335025;ENST00000398831;ENST00000492445;ENST00000458567;ENST00000406385;ENST00000456792	T;T;T;T;T;T	0.28454	1.66;1.7;1.7;1.7;1.7;1.61	4.39	4.39	0.52855	.	0.071138	0.64402	D	0.000017	T	0.34890	0.0913	L	0.59436	1.845	0.50632	D	0.999883	P;P;P	0.47409	0.61;0.868;0.895	B;P;B	0.46299	0.219;0.511;0.313	T	0.22591	-1.0212	10	0.87932	D	0	.	10.2502	0.43364	1.0:0.0:0.0:0.0	.	18;18;18	E7EW80;Q13356-2;Q13356	.;.;PPIL2_HUMAN	F	18;18;18;18;49;18;18	ENSP00000390427:Y18F;ENSP00000334553:Y18F;ENSP00000381812:Y18F;ENSP00000445312:Y18F;ENSP00000384299:Y18F;ENSP00000396228:Y18F	ENSP00000334553:Y18F	Y	+	2	0	PPIL2	20354222	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	4.011000	0.57124	1.974000	0.57490	0.456000	0.33151	TAC	.	.	.	none		0.448	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075028.4		
MN1	4330	hgsc.bcm.edu	37	22	28193956	28193956	+	Missense_Mutation	SNP	T	T	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr22:28193956T>A	ENST00000302326.4	-	1	3530	c.2576A>T	c.(2575-2577)aAa>aTa	p.K859I		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	859					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						CTGGCTCAGTTTCCTCTTGCC	0.662			T	ETV6	"""AML, meningioma"""																																p.K859I		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1	122	.	0			c.A2576T						PASS	.						68.0	74.0	72.0					22																	28193956		1884	4092	5976	SO:0001583	missense	4330	exon1			CTCAGTTTCCTCT	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.2576A>T	chr22.hg19:g.28193956T>A	ENSP00000304956:p.Lys859Ile	35.0	0.0	.		34.0	11.0	.	NM_002430	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	hg19	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.966868	0.74131	.	.	ENSG00000169184	ENST00000302326	T	0.60920	0.15	3.74	3.74	0.42951	.	0.064498	0.64402	D	0.000019	T	0.61912	0.2385	L	0.29908	0.895	0.47862	D	0.99953	D	0.76494	0.999	D	0.87578	0.998	T	0.59306	-0.7479	10	0.33141	T	0.24	0.0091	11.4387	0.50083	0.0:0.0:0.0:1.0	.	859	Q10571	MN1_HUMAN	I	859	ENSP00000304956:K859I	ENSP00000304956:K859I	K	-	2	0	MN1	26523956	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.044000	0.64214	1.567000	0.49668	0.379000	0.24179	AAA	.	.	.	none		0.662	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
EMID1	129080	hgsc.bcm.edu	37	22	29628294	29628294	+	Silent	SNP	C	C	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr22:29628294C>A	ENST00000404820.3	+	8	853	c.726C>A	c.(724-726)acC>acA	p.T242T	EMID1_ENST00000484039.1_3'UTR|EMID1_ENST00000334018.6_Silent_p.T242T|EMID1_ENST00000404755.3_Silent_p.T242T			Q96A84	EMID1_HUMAN	EMI domain containing 1	240	Collagen-like.					collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						CTGTGGGCACCCCTGGAGAGA	0.697																																					p.T242T		Atlas-SNP	.											.	EMID1	33	.	0			c.C726A						PASS	.						16.0	20.0	19.0					22																	29628294		2181	4257	6438	SO:0001819	synonymous_variant	129080	exon8			GGGCACCCCTGGA	AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.726C>A	chr22.hg19:g.29628294C>A		160.0	0.0	.		158.0	56.0	.	NM_133455	B0QYK6|Q6ICG1|Q86SS7	Silent	SNP	ENST00000404820.3	hg19		.	.	.	.	.	.	.	.	.	.	C	6.566	0.472782	0.12461	.	.	ENSG00000186998	ENST00000433143	.	.	.	4.12	0.833	0.18875	.	.	.	.	.	T	0.51635	0.1686	.	.	.	0.52501	D	0.999958	.	.	.	.	.	.	T	0.40831	-0.9542	4	.	.	.	-0.3746	5.7145	0.17952	0.0:0.6496:0.0:0.3504	.	.	.	.	H	105	.	.	P	+	2	0	EMID1	27958294	0.171000	0.23029	0.523000	0.27875	0.749000	0.42624	0.362000	0.20284	0.466000	0.27193	0.555000	0.69702	CCC	.	.	.	none		0.697	EMID1-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321075.1	NM_133455	
SVIL	6840	hgsc.bcm.edu	37	10	29821690	29821690	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr10:29821690delC	ENST00000355867.4	-	8	2358	c.1606delG	c.(1606-1608)gaafs	p.E536fs	SVIL_ENST00000375400.3_Intron|SVIL_ENST00000375398.2_Frame_Shift_Del_p.E536fs	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	536					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TTCGAGGCTTCCCTGTTGTGA	0.567																																					p.E536fs		Atlas-Indel,Pindel	.											.	SVIL	226	.	0			c.1607delA						PASS	.						213.0	205.0	208.0					10																	29821690		2203	4300	6503	SO:0001589	frameshift_variant	6840	exon8			.	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.1606delG	chr10.hg19:g.29821690delC	ENSP00000348128:p.Glu536fs	85.0	0.0	0		71.0	21.0	0.295775	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Frame_Shift_Del	DEL	ENST00000355867.4	hg19	CCDS7164.1																																																																																			.	.	.	none		0.567	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
MLLT6	4302	hgsc.bcm.edu	37	17	36880963	36880991	+	Frame_Shift_Del	DEL	CCCATGGCCAGCCTGCTGGCAGGAAGCTC	CCCATGGCCAGCCTGCTGGCAGGAAGCTC	-	rs150877733|rs528335314		TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	CCCATGGCCAGCCTGCTGGCAGGAAGCTC	CCCATGGCCAGCCTGCTGGCAGGAAGCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr17:36880963_36880991delCCCATGGCCAGCCTGCTGGCAGGAAGCTC	ENST00000325718.7	+	19	3065_3093	c.2974_3002delCCCATGGCCAGCCTGCTGGCAGGAAGCTC	c.(2974-3003)cccatggccagcctgctggcaggaagctccfs	p.PMASLLAGSS992fs		NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	992					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					CTCCCAGCTGCCCATGGCCAGCCTGCTGGCAGGAAGCTCCACCCCGCTG	0.664			T	MLL	AL																																p.991_1001del		Atlas-Indel,Pindel	.		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6	80	.	0			c.2973_3001del						PASS	.																																			SO:0001589	frameshift_variant	4302	exon19			.		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.2974_3002delCCCATGGCCAGCCTGCTGGCAGGAAGCTC	chr17.hg19:g.36880963_36880991delCCCATGGCCAGCCTGCTGGCAGGAAGCTC	ENSP00000316426:p.Pro992fs	74.0	0.0	0		78.0	23.0	0.294872	NM_005937	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Frame_Shift_Del	DEL	ENST00000325718.7	hg19	CCDS11327.1																																																																																			.	.	.	none		0.664	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
KDM6A	7403	hgsc.bcm.edu	37	X	44929004	44929005	+	Frame_Shift_Ins	INS	-	-	A			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chrX:44929004_44929005insA	ENST00000377967.4	+	17	2145_2146	c.2104_2105insA	c.(2104-2106)cacfs	p.H702fs	KDM6A_ENST00000382899.4_Frame_Shift_Ins_p.H709fs|KDM6A_ENST00000536777.1_Frame_Shift_Ins_p.H657fs|KDM6A_ENST00000543216.1_Frame_Shift_Ins_p.H623fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	702	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.H702fs*28(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						CCTCTCCTCTCACACTGCTACC	0.515			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.H702fs	Colon(129;1273 1667 15230 27352 52914)	Atlas-Indel,Pindel	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A	274	.	7	Whole gene deletion(6)|Insertion - Frameshift(1)	oesophagus(2)|breast(2)|pancreas(2)|urinary_tract(1)	c.2104_2105insA						PASS	.																																			SO:0001589	frameshift_variant	7403	exon17			.	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.2105dupA	chrX.hg19:g.44929005_44929005dupA	ENSP00000367203:p.His702fs	98.0	0.0	0		81.0	49.0	0.604938	NM_021140	Q52LL9|Q5JVQ7	Frame_Shift_Ins	INS	ENST00000377967.4	hg19	CCDS14265.1																																																																																			.	.	.	none		0.515	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
HMGCS1	3157	hgsc.bcm.edu	37	5	43294862	43294863	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr5:43294862_43294863insGT	ENST00000325110.6	-	7	1212_1213	c.1006_1007insAC	c.(1006-1008)cttfs	p.L336fs	HMGCS1_ENST00000433297.2_Frame_Shift_Ins_p.L336fs	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	336					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						ATTTGATACAAGTAAAGATGCC	0.356																																					p.L336fs		Atlas-Indel,Pindel	.											.	HMGCS1	33	.	0			c.1007_1008insAC						PASS	.																																			SO:0001589	frameshift_variant	3157	exon6			.		CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.1005_1006dupAC	chr5.hg19:g.43294863_43294864dupGT	ENSP00000322706:p.Leu336fs	50.0	0.0	0		53.0	19.0	0.358491	NM_002130	B2RDL8	Frame_Shift_Ins	INS	ENST00000325110.6	hg19	CCDS34154.1																																																																																			.	.	.	none		0.356	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368022.1		
VWA3A	146177	hgsc.bcm.edu	37	16	22130234	22130234	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr16:22130234delC	ENST00000389398.5	+	12	1098	c.1002delC	c.(1000-1002)agcfs	p.S334fs	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	334						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		ACTACACCAGCCGGGACATGG	0.607																																					p.S334fs		Atlas-Indel,Pindel	.											.	VWA3A	115	.	0			c.1001delG						PASS	.						53.0	57.0	56.0					16																	22130234		2107	4232	6339	SO:0001589	frameshift_variant	146177	exon12			.	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.1002delC	chr16.hg19:g.22130234delC	ENSP00000374049:p.Ser334fs	140.0	0.0	0		152.0	25.0	0.164474	NM_173615	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Frame_Shift_Del	DEL	ENST00000389398.5	hg19	CCDS45441.1																																																																																			.	.	.	none		0.607	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		
HIP1R	9026	hgsc.bcm.edu	37	12	123340130	123340131	+	Frame_Shift_Ins	INS	-	-	C			TCGA-5P-A9KE-01A-11D-A42J-10	TCGA-5P-A9KE-10A-01D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbd6f0f2-a322-4772-8c98-3594288fbf8d	f4097292-72af-4234-b9af-3cdcbb8333b2	g.chr12:123340130_123340131insC	ENST00000253083.4	+	12	1151_1152	c.1026_1027insC	c.(1027-1029)cccfs	p.P343fs		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	343					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		AGACGTTTGGACCCCCCAATGG	0.634																																					p.G342fs		Atlas-Indel,Pindel	.											.	HIP1R	68	.	0			c.1026_1027insC						PASS	.																																			SO:0001589	frameshift_variant	9026	exon12			.	AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.1032dupC	chr12.hg19:g.123340136_123340136dupC	ENSP00000253083:p.Pro343fs	46.0	0.0	0		41.0	13.0	0.317073	NM_003959	A6NHQ6|Q6NXG8|Q9UED9	Frame_Shift_Ins	INS	ENST00000253083.4	hg19	CCDS31922.1																																																																																			.	.	.	none		0.634	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1	NM_003959	
