#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLA2G2D	26279	hgsc.bcm.edu	37	1	20440719	20440719	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:20440719C>T	ENST00000375105.3	-	4	384	c.326G>A	c.(325-327)tGt>tAt	p.C109Y		NM_012400.2	NP_036532.1	Q9UNK4	PA2GD_HUMAN	phospholipase A2, group IID	109					glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			endometrium(1)|lung(2)	3		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000798)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GTCACAGGCACACAGCTGCTG	0.597										Multiple Myeloma(11;0.12)																											p.C109Y	Melanoma(60;742 1548 31762 39240)	Atlas-SNP	.											.	PLA2G2D	7	.	0			c.G326A						PASS	.						63.0	60.0	61.0					1																	20440719		2203	4300	6503	SO:0001583	missense	26279	exon4			CAGGCACACAGCT	AF112982	CCDS203.1, CCDS72721.1	1p36.12	2008-09-19			ENSG00000117215	ENSG00000117215	3.1.1.4		9033	protein-coding gene	gene with protein product		605630				10455175	Standard	NM_012400		Approved	sPLA2S	uc001bcz.4	Q9UNK4	OTTHUMG00000002701	ENST00000375105.3:c.326G>A	chr1.hg19:g.20440719C>T	ENSP00000364246:p.Cys109Tyr	76.0	0.0	.		61.0	15.0	.	NM_012400	A8K2Z1|B1AEL9|Q9UK01	Missense_Mutation	SNP	ENST00000375105.3	hg19	CCDS203.1	.	.	.	.	.	.	.	.	.	.	C	19.68	3.873650	0.72180	.	.	ENSG00000117215	ENST00000375105	D	0.86097	-2.07	5.2	5.2	0.72013	Phospholipase A2 (3);	0.000000	0.53938	D	0.000050	D	0.94443	0.8212	H	0.95365	3.66	0.47949	D	0.999553	D	0.89917	1.0	D	0.97110	1.0	D	0.95704	0.8752	10	0.87932	D	0	-24.7657	14.2445	0.65978	0.0:1.0:0.0:0.0	.	109	Q9UNK4	PA2GD_HUMAN	Y	109	ENSP00000364246:C109Y	ENSP00000364246:C109Y	C	-	2	0	PLA2G2D	20313306	0.996000	0.38824	0.998000	0.56505	0.910000	0.53928	4.132000	0.57977	2.443000	0.82685	0.462000	0.41574	TGT	.	.	.	none		0.597	PLA2G2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007683.1		
AGL	178	hgsc.bcm.edu	37	1	100327977	100327977	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:100327977C>G	ENST00000294724.4	+	4	936	c.458C>G	c.(457-459)tCa>tGa	p.S153*	AGL_ENST00000361302.3_Nonsense_Mutation_p.S137*|AGL_ENST00000370163.3_Nonsense_Mutation_p.S153*|AGL_ENST00000370161.2_Nonsense_Mutation_p.S137*|AGL_ENST00000361915.3_Nonsense_Mutation_p.S153*|AGL_ENST00000370165.3_Nonsense_Mutation_p.S153*|AGL_ENST00000361522.4_Nonsense_Mutation_p.S136*	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	153					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GCAAAAGAATCAGGTAATGTC	0.338																																					p.S153X		Atlas-SNP	.											.	AGL	137	.	0			c.C458G						PASS	.						159.0	150.0	153.0					1																	100327977		2203	4300	6503	SO:0001587	stop_gained	178	exon4			AAGAATCAGGTAA	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.458C>G	chr1.hg19:g.100327977C>G	ENSP00000294724:p.Ser153*	111.0	0.0	.		102.0	23.0	.	NM_000644	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Nonsense_Mutation	SNP	ENST00000294724.4	hg19	CCDS759.1	.	.	.	.	.	.	.	.	.	.	C	39	7.619744	0.98393	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	.	.	.	5.53	5.53	0.82687	.	0.435109	0.23914	N	0.043307	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	19.4571	0.94897	0.0:1.0:0.0:0.0	.	.	.	.	X	153;153;153;153;137;137;136	.	ENSP00000294724:S153X	S	+	2	0	AGL	100100565	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.764000	0.85297	2.599000	0.87857	0.655000	0.94253	TCA	.	.	.	none		0.338	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
NTRK1	4914	hgsc.bcm.edu	37	1	156843561	156843561	+	Silent	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:156843561C>T	ENST00000524377.1	+	8	1028	c.987C>T	c.(985-987)ttC>ttT	p.F329F	NTRK1_ENST00000368196.3_Silent_p.F329F|NTRK1_ENST00000392302.2_Silent_p.F299F|NTRK1_ENST00000358660.3_Silent_p.F329F	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	329	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GCTTCATCTTCACTGAGTTCC	0.617			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.F329F		Atlas-SNP	.		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	NTRK1	287	.	0			c.C987T						PASS	.						44.0	36.0	39.0					1																	156843561		2203	4299	6502	SO:0001819	synonymous_variant	4914	exon8			CATCTTCACTGAG	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.987C>T	chr1.hg19:g.156843561C>T		41.0	0.0	.		25.0	8.0	.	NM_001012331	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Silent	SNP	ENST00000524377.1	hg19	CCDS1161.1																																																																																			.	.	.	none		0.617	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
GORAB	92344	hgsc.bcm.edu	37	1	170501324	170501324	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:170501324C>T	ENST00000367763.3	+	1	55	c.35C>T	c.(34-36)gCg>gTg	p.A12V	RP11-576I22.2_ENST00000456083.1_RNA|GORAB_ENST00000367762.1_Missense_Mutation_p.A12V|RP11-576I22.2_ENST00000421020.1_RNA	NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	12						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						GTCGCGGCTGCGAGATTTGGG	0.622																																					p.A12V		Atlas-SNP	.											.	GORAB	41	.	0			c.C35T						PASS	.						51.0	62.0	58.0					1																	170501324		2203	4300	6503	SO:0001583	missense	92344	exon1			CGGCTGCGAGATT	AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.35C>T	chr1.hg19:g.170501324C>T	ENSP00000356737:p.Ala12Val	113.0	0.0	.		95.0	16.0	.	NM_152281	Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Missense_Mutation	SNP	ENST00000367763.3	hg19	CCDS1289.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836253	0.32421	.	.	ENSG00000120370	ENST00000367763;ENST00000367762	T;T	0.79247	-0.28;-1.25	5.24	-10.5	0.00291	.	3.953700	0.00937	N	0.002796	T	0.28167	0.0695	N	0.08118	0	0.09310	N	1	B;B	0.17268	0.021;0.021	B;B	0.14023	0.005;0.01	T	0.36986	-0.9725	10	0.37606	T	0.19	.	7.2128	0.25943	0.1379:0.6439:0.1383:0.0799	.	12;12	Q5T7V8-2;Q5T7V8	.;GORAB_HUMAN	V	12	ENSP00000356737:A12V;ENSP00000356736:A12V	ENSP00000356736:A12V	A	+	2	0	GORAB	168767948	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.322000	0.00253	-3.663000	0.00124	-1.000000	0.02509	GCG	.	.	.	none		0.622	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085226.1	NM_152281	
RGS21	431704	hgsc.bcm.edu	37	1	192321246	192321246	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:192321246C>A	ENST00000417209.2	+	4	332	c.158C>A	c.(157-159)gCc>gAc	p.A53D		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	53	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						TTCTGGCTTGCCTGTGAAGAC	0.328																																					p.A53D		Atlas-SNP	.											.	RGS21	32	.	0			c.C158A						PASS	.						68.0	66.0	66.0					1																	192321246		1836	4106	5942	SO:0001583	missense	431704	exon4			GGCTTGCCTGTGA	AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.158C>A	chr1.hg19:g.192321246C>A	ENSP00000428343:p.Ala53Asp	57.0	0.0	.		51.0	11.0	.	NM_001039152		Missense_Mutation	SNP	ENST00000417209.2	hg19	CCDS41448.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159165	0.94686	.	.	ENSG00000253148	ENST00000417209	T	0.02015	4.5	5.77	5.77	0.91146	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.33691	U	0.004656	T	0.14313	0.0346	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00016	-1.2383	10	0.87932	D	0	.	18.5418	0.91031	0.0:1.0:0.0:0.0	.	53	Q2M5E4	RGS21_HUMAN	D	53	ENSP00000428343:A53D	ENSP00000428343:A53D	A	+	2	0	RGS21	190587869	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.747000	0.85070	2.733000	0.93635	0.557000	0.71058	GCC	.	.	.	none		0.328	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086387.2		
CDC73	79577	hgsc.bcm.edu	37	1	193099338	193099338	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:193099338G>A	ENST00000367435.3	+	3	456	c.272G>A	c.(271-273)cGa>cAa	p.R91Q		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	91			R -> P (found in a patient with isolated hyperparathyroidism and parathyroid adenomas). {ECO:0000269|PubMed:17639062}.		cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.R91Q(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						AGACCTGATCGAAAAGATCTA	0.294																																					p.R91Q		Atlas-SNP	.											CDC73,caecum,carcinoma,0,1	CDC73	163	.	1	Substitution - Missense(1)	large_intestine(1)	c.G272A	GRCh37	CM072926	CDC73	M		PASS	.						140.0	144.0	143.0					1																	193099338		2203	4300	6503	SO:0001583	missense	79577	exon3			CTGATCGAAAAGA	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.272G>A	chr1.hg19:g.193099338G>A	ENSP00000356405:p.Arg91Gln	68.0	0.0	.		61.0	7.0	.	NM_024529	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	hg19	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	G	34	5.351125	0.95830	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	D	0.91407	-2.84	5.62	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.95648	0.8585	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96226	0.9164	10	0.87932	D	0	-10.3544	14.535	0.67953	0.0704:0.0:0.9296:0.0	.	91	Q6P1J9	CDC73_HUMAN	Q	91	ENSP00000356405:R91Q	ENSP00000356405:R91Q	R	+	2	0	CDC73	191365961	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.743000	0.98849	1.377000	0.46286	0.561000	0.74099	CGA	.	.	.	none		0.294	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	
SNRPE	6635	hgsc.bcm.edu	37	1	203832834	203832834	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:203832834G>A	ENST00000414487.2	+	3	170	c.125G>A	c.(124-126)cGg>cAg	p.R42Q	SNRPE_ENST00000367208.1_Missense_Mutation_p.R2Q|SNRPE_ENST00000483099.1_3'UTR	NM_003094.2	NP_003085.1	P62304	RUXE_HUMAN	small nuclear ribonucleoprotein polypeptide E	42					gene expression (GO:0010467)|hair cycle (GO:0042633)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	RNA binding (GO:0003723)			breast(1)|large_intestine(2)|lung(1)|skin(1)	5	all_cancers(21;0.103)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GTGAATATGCGGATAGAAGGC	0.428																																					p.R42Q	Ovarian(83;324 1318 17952 32395 39614)	Atlas-SNP	.											.	SNRPE	8	.	0			c.G125A						PASS	.						128.0	129.0	128.0					1																	203832834		2203	4300	6503	SO:0001583	missense	6635	exon3			ATATGCGGATAGA	M37716	CCDS30979.1	1q32	2011-10-11			ENSG00000182004	ENSG00000182004			11161	protein-coding gene	gene with protein product		128260				1835977, 2143747	Standard	NM_003094		Approved	Sm-E	uc001hai.3	P62304	OTTHUMG00000035985	ENST00000414487.2:c.125G>A	chr1.hg19:g.203832834G>A	ENSP00000400591:p.Arg42Gln	238.0	0.0	.		245.0	87.0	.	NM_003094	B2R5B9|P08578|Q15498|Q5BKT2	Missense_Mutation	SNP	ENST00000414487.2	hg19	CCDS30979.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058902	0.76074	.	.	ENSG00000182004	ENST00000414487;ENST00000367208	T;T	0.40756	1.02;1.02	5.35	5.35	0.76521	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.060085	0.64402	D	0.000002	T	0.40570	0.1122	.	.	.	0.80722	D	1	B	0.13594	0.008	B	0.15052	0.012	T	0.20940	-1.0260	9	0.54805	T	0.06	.	18.6824	0.91551	0.0:0.0:1.0:0.0	.	42	P62304	RUXE_HUMAN	Q	42;2	ENSP00000400591:R42Q;ENSP00000356176:R2Q	ENSP00000356176:R2Q	R	+	2	0	SNRPE	202099457	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.937000	0.87672	2.503000	0.84419	0.650000	0.86243	CGG	.	.	.	none		0.428	SNRPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087703.1	NM_003094	
LBR	3930	hgsc.bcm.edu	37	1	225599084	225599084	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:225599084A>T	ENST00000338179.2	-	9	1268	c.1143T>A	c.(1141-1143)ttT>ttA	p.F381L	AC092811.1_ENST00000366845.2_5'Flank|LBR_ENST00000272163.4_Missense_Mutation_p.F381L	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	381					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		ATTTGAGATCAAAAGTACCAA	0.373																																					p.F381L		Atlas-SNP	.											.	LBR	54	.	0			c.T1143A						PASS	.						122.0	130.0	127.0					1																	225599084		2203	4300	6503	SO:0001583	missense	3930	exon9			GAGATCAAAAGTA	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.1143T>A	chr1.hg19:g.225599084A>T	ENSP00000339883:p.Phe381Leu	147.0	0.0	.		153.0	28.0	.	NM_194442	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	hg19	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	A	16.15	3.040696	0.55003	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000424022	D;D;D	0.96885	-4.16;-4.16;-4.16	6.16	2.64	0.31445	.	0.045876	0.85682	D	0.000000	D	0.93135	0.7814	L	0.33710	1.025	0.48288	D	0.99962	P	0.39782	0.688	P	0.46685	0.524	D	0.87185	0.2230	10	0.13853	T	0.58	-33.8453	9.3222	0.37971	0.796:0.0:0.204:0.0	.	381	Q14739	LBR_HUMAN	L	381;381;12	ENSP00000272163:F381L;ENSP00000339883:F381L;ENSP00000397817:F12L	ENSP00000272163:F381L	F	-	3	2	LBR	223665707	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.577000	0.53885	0.212000	0.20703	0.528000	0.53228	TTT	.	.	.	none		0.373	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
HYAL1	3373	hgsc.bcm.edu	37	3	50340364	50340364	+	Missense_Mutation	SNP	G	G	C	rs370239620		TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr3:50340364G>C	ENST00000266031.4	-	1	639	c.24C>G	c.(22-24)atC>atG	p.I8M	HYAL1_ENST00000457214.2_Intron|HYAL1_ENST00000320295.8_Missense_Mutation_p.I8M|HYAL1_ENST00000447605.2_Intron|HYAL1_ENST00000395144.2_Missense_Mutation_p.I8M|HYAL1_ENST00000395143.2_Missense_Mutation_p.I8M			Q12794	HYAL1_HUMAN	hyaluronoglucosaminidase 1	8					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to pH (GO:0071467)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal joint morphogenesis (GO:0060272)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|negative regulation of cell growth (GO:0030308)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of growth (GO:0045927)|positive regulation of hyaluranon cable assembly (GO:1900106)|response to antibiotic (GO:0046677)|response to reactive oxygen species (GO:0000302)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|hyaluranon cable (GO:0036117)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	hyaluronan synthase activity (GO:0050501)|hyalurononglucosaminidase activity (GO:0004415)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AGAGGGCGCAGATGGGAAGCA	0.607																																					p.I8M		Atlas-SNP	.											.	HYAL1	28	.	0			c.C24G						PASS	.						35.0	38.0	37.0					3																	50340364		2203	4300	6503	SO:0001583	missense	3373	exon2			GGCGCAGATGGGA	U90094	CCDS2816.1, CCDS2817.1, CCDS46832.1, CCDS46833.1	3p21.31	2014-07-17			ENSG00000114378	ENSG00000114378	3.2.1.35		5320	protein-coding gene	gene with protein product		607071				9223416, 9409739	Standard	NM_153281		Approved	LUCA1, HYAL-1, FUS2, NAT6	uc003czp.4	Q12794	OTTHUMG00000156941	ENST00000266031.4:c.24C>G	chr3.hg19:g.50340364G>C	ENSP00000266031:p.Ile8Met	60.0	0.0	.		46.0	6.0	.	NM_033159	Q6FH23|Q6PIZ6|Q7KYU2|Q7LE34|Q8NFK5|Q8NFK6|Q8NFK7|Q8NFK8|Q8NFK9|Q93013|Q9UKD5|Q9UNI8	Missense_Mutation	SNP	ENST00000266031.4	hg19	CCDS2816.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780578	0.49891	.	.	ENSG00000114378	ENST00000395144;ENST00000266031;ENST00000320295;ENST00000395143;ENST00000418723;ENST00000452672	T;T;T;T;T;T	0.48522	2.16;2.16;2.16;1.83;0.81;0.81	5.3	1.26	0.21427	.	3.721710	0.00447	N	0.000080	T	0.49236	0.1545	L	0.50333	1.59	0.24266	N	0.99527	P;P;P	0.37636	0.603;0.603;0.468	B;B;B	0.42386	0.386;0.295;0.293	T	0.34179	-0.9839	10	0.46703	T	0.11	-3.0796	6.6937	0.23187	0.2193:0.0:0.6565:0.1242	.	8;8;8	Q12794-7;Q12794-2;Q12794	.;.;HYAL1_HUMAN	M	8	ENSP00000378576:I8M;ENSP00000266031:I8M;ENSP00000346068:I8M;ENSP00000378575:I8M;ENSP00000394526:I8M;ENSP00000391666:I8M	ENSP00000266031:I8M	I	-	3	3	HYAL1	50315368	0.761000	0.28439	0.005000	0.12908	0.266000	0.26442	1.468000	0.35332	0.324000	0.23333	0.655000	0.94253	ATC	.	.	.	alt		0.607	HYAL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346703.1		
LMLN	89782	hgsc.bcm.edu	37	3	197687277	197687277	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr3:197687277C>A	ENST00000330198.4	+	1	207	c.185C>A	c.(184-186)cCt>cAt	p.P62H	LMLN_ENST00000420910.2_Missense_Mutation_p.P62H|IQCG_ENST00000480302.1_5'Flank|IQCG_ENST00000265239.6_5'Flank|LMLN_ENST00000332636.5_Intron|LMLN_ENST00000482695.1_Intron	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	62					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		GGCAGTTCCCCTCCCTGCCGG	0.662																																					p.P62H		Atlas-SNP	.											.	LMLN	53	.	0			c.C185A						PASS	.						43.0	47.0	46.0					3																	197687277		2203	4300	6503	SO:0001583	missense	89782	exon1			GTTCCCCTCCCTG	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.185C>A	chr3.hg19:g.197687277C>A	ENSP00000328829:p.Pro62His	172.0	0.0	.		133.0	6.0	.	NM_001136049	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	ENST00000330198.4	hg19	CCDS3332.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992122	0.54041	.	.	ENSG00000185621	ENST00000330198;ENST00000420910	T;T	0.41758	0.99;0.99	4.22	1.34	0.21922	.	0.647122	0.14803	N	0.297489	T	0.22003	0.0530	N	0.02011	-0.69	0.18873	N	0.999987	B;P	0.36249	0.003;0.545	B;P	0.47376	0.01;0.545	T	0.31364	-0.9946	10	0.16896	T	0.51	-1.1491	6.4356	0.21821	0.0:0.5507:0.349:0.1003	.	62;62	Q96KR4;F8WB28	LMLN_HUMAN;.	H	62	ENSP00000328829:P62H;ENSP00000410926:P62H	ENSP00000328829:P62H	P	+	2	0	LMLN	199171674	0.000000	0.05858	0.290000	0.24890	0.995000	0.86356	0.090000	0.15025	0.161000	0.19458	0.456000	0.33151	CCT	.	.	.	none		0.662	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029	
DCK	1633	hgsc.bcm.edu	37	4	71892401	71892401	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr4:71892401C>A	ENST00000286648.5	+	6	1082	c.685C>A	c.(685-687)Caa>Aaa	p.Q229K	DCK_ENST00000504730.1_Nonsense_Mutation_p.S190*|DCK_ENST00000504952.1_Missense_Mutation_p.Q229K	NM_000788.2	NP_000779.1	P27707	DCK_HUMAN	deoxycytidine kinase	229					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxycytidine kinase activity (GO:0004137)|drug binding (GO:0008144)|nucleoside kinase activity (GO:0019206)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)	9			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Cytarabine(DB00987)|Decitabine(DB01262)|Emtricitabine(DB00879)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Lamivudine(DB00709)|Nelarabine(DB01280)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	CGATTATCTTCAAGAGGTGCC	0.284																																					p.Q229K		Atlas-SNP	.											.	DCK	23	.	0			c.C685A						PASS	.						43.0	45.0	44.0					4																	71892401		2202	4288	6490	SO:0001583	missense	1633	exon6			TATCTTCAAGAGG	M60527	CCDS3548.1	4q13.3-q21.1	2008-02-05			ENSG00000156136	ENSG00000156136	2.7.1.74		2704	protein-coding gene	gene with protein product		125450				8406512	Standard	NM_000788		Approved		uc003hfx.3	P27707	OTTHUMG00000129908	ENST00000286648.5:c.685C>A	chr4.hg19:g.71892401C>A	ENSP00000286648:p.Gln229Lys	70.0	0.0	.		39.0	13.0	.	NM_000788	B2R8V6|Q5TZY7|Q6FI11	Missense_Mutation	SNP	ENST00000286648.5	hg19	CCDS3548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.0|27.0	4.787431|4.787431	0.90367|0.90367	.|.	.|.	ENSG00000156136|ENSG00000156136	ENST00000286648;ENST00000504952|ENST00000504730	D;D|.	0.97870|.	-4.58;-4.58|.	5.78|5.78	4.92|4.92	0.64577|0.64577	.|.	0.274194|.	0.41194|.	D|.	0.000924|.	T|.	0.49864|.	0.1582|.	N|N	0.16233|0.16233	0.39|0.39	0.45272|0.45272	D|D	0.998276|0.998276	B|.	0.09022|.	0.002|.	B|.	0.09377|.	0.004|.	T|.	0.44483|.	-0.9325|.	10|.	0.05351|.	T|.	0.99|.	.|.	16.6255|16.6255	0.84969|0.84969	0.0:0.8699:0.1301:0.0|0.0:0.8699:0.1301:0.0	.|.	229|.	P27707|.	DCK_HUMAN|.	K|X	229|190	ENSP00000286648:Q229K;ENSP00000421508:Q229K|.	ENSP00000286648:Q229K|.	Q|S	+|+	1|2	0|0	DCK|DCK	72111265|72111265	0.983000|0.983000	0.35010|0.35010	0.987000|0.987000	0.45799|0.45799	0.467000|0.467000	0.32768|0.32768	3.040000|3.040000	0.49799|0.49799	1.391000|1.391000	0.46566|0.46566	0.591000|0.591000	0.81541|0.81541	CAA|TCA	.	.	.	none		0.284	DCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252159.2		
FAT4	79633	hgsc.bcm.edu	37	4	126371574	126371574	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr4:126371574G>A	ENST00000394329.3	+	9	9416	c.9403G>A	c.(9403-9405)Ggc>Agc	p.G3135S	FAT4_ENST00000335110.5_Missense_Mutation_p.G1433S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3135	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AAATGAAGAAGGCATTTTTGC	0.388																																					p.G3135S		Atlas-SNP	.											.	FAT4	1752	.	0			c.G9403A						PASS	.						67.0	68.0	68.0					4																	126371574		2203	4300	6503	SO:0001583	missense	79633	exon9			GAAGAAGGCATTT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.9403G>A	chr4.hg19:g.126371574G>A	ENSP00000377862:p.Gly3135Ser	89.0	0.0	.		37.0	15.0	.	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464553	0.43736	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.61859	0.07;0.07	5.63	4.79	0.61399	Cadherin (4);Cadherin-like (1);	0.000000	0.35067	U	0.003472	T	0.60650	0.2285	N	0.25647	0.755	0.80722	D	1	P;D;D	0.89917	0.839;1.0;1.0	B;D;D	0.97110	0.287;0.997;1.0	T	0.54951	-0.8216	10	0.08599	T	0.76	.	14.512	0.67794	0.0698:0.0:0.9302:0.0	.	1433;3135;3135	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	S	3135;1433	ENSP00000377862:G3135S;ENSP00000335169:G1433S	ENSP00000335169:G1433S	G	+	1	0	FAT4	126591024	1.000000	0.71417	0.835000	0.33067	0.669000	0.39330	7.835000	0.86780	1.389000	0.46526	0.655000	0.94253	GGC	.	.	.	none		0.388	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
HIST1H4C	8364	hgsc.bcm.edu	37	6	26104205	26104205	+	Silent	SNP	C	C	G	rs139978722	byFrequency	TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:26104205C>G	ENST00000377803.2	+	1	102	c.30C>G	c.(28-30)ggC>ggG	p.G10G		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	10					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						GCGGAAAAGGCTTGGGGAAGG	0.532																																					p.G10G		Atlas-SNP	.											.	HIST1H4C	14	.	0			c.C30G						PASS	.						57.0	58.0	58.0					6																	26104205		2203	4300	6503	SO:0001819	synonymous_variant	8364	exon1			AAAAGGCTTGGGG	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.30C>G	chr6.hg19:g.26104205C>G		115.0	0.0	.		88.0	21.0	.	NM_003542	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000377803.2	hg19	CCDS4583.1																																																																																			.	C|0.999;T|0.001	.	alt		0.532	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040092.2	NM_003542	
ZKSCAN8	7745	hgsc.bcm.edu	37	6	28116192	28116192	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:28116192G>A	ENST00000330236.6	+	2	191	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.E3K	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	3					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCTAATGGCTGAAGAATCAAG	0.473																																					p.E3K		Atlas-SNP	.											.	.	.	.	0			c.G7A						PASS	.						50.0	48.0	49.0					6																	28116192		2203	4300	6503	SO:0001583	missense	7745	exon2			ATGGCTGAAGAAT		CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.7G>A	chr6.hg19:g.28116192G>A	ENSP00000332750:p.Glu3Lys	67.0	0.0	.		35.0	12.0	.	NM_006298	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	ENST00000330236.6	hg19	CCDS4645.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614734	0.46631	.	.	ENSG00000198315	ENST00000330236;ENST00000457389;ENST00000536028	T;T;T	0.05580	3.42;3.42;3.99	5.2	-0.593	0.11667	.	1.155400	0.06424	N	0.722860	T	0.01189	0.0039	N	0.19112	0.55	0.22827	N	0.998682	B	0.02656	0.0	B	0.01281	0.0	T	0.48592	-0.9022	10	0.42905	T	0.14	.	3.6279	0.08120	0.2558:0.0:0.4473:0.2969	.	3	Q15776	ZN192_HUMAN	K	3	ENSP00000332750:E3K;ENSP00000402948:E3K;ENSP00000439117:E3K	ENSP00000332750:E3K	E	+	1	0	ZNF192	28224171	0.141000	0.22595	0.921000	0.36526	0.930000	0.56654	0.165000	0.16564	-0.225000	0.09913	0.563000	0.77884	GAA	.	.	.	none		0.473	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040178.2		
CRISP3	10321	hgsc.bcm.edu	37	6	49696475	49696475	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:49696475C>T	ENST00000393666.1	-	7	712	c.706G>A	c.(706-708)Gcc>Acc	p.A236T	CRISP3_ENST00000423399.2_Missense_Mutation_p.A146T|CRISP3_ENST00000433368.2_Missense_Mutation_p.A259T|CRISP3_ENST00000371159.4_Missense_Mutation_p.A267T|CRISP3_ENST00000263045.4_Missense_Mutation_p.A249T			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	236	ShKT. {ECO:0000255|PROSITE- ProRule:PRU01005}.				defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			TTGCAGGAGGCCTTGCAACTG	0.403																																					p.A259T		Atlas-SNP	.											.	CRISP3	67	.	0			c.G775A						PASS	.						188.0	169.0	175.0					6																	49696475		2203	4300	6503	SO:0001583	missense	10321	exon8			AGGAGGCCTTGCA	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.706G>A	chr6.hg19:g.49696475C>T	ENSP00000377274:p.Ala236Thr	150.0	0.0	.		120.0	38.0	.	NM_001190986	A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Missense_Mutation	SNP	ENST00000393666.1	hg19		.	.	.	.	.	.	.	.	.	.	C	17.52	3.410104	0.62399	.	.	ENSG00000096006	ENST00000263045;ENST00000433368;ENST00000393666;ENST00000423399;ENST00000371159	T;T;T;T;T	0.16073	2.88;2.87;2.9;2.37;2.87	4.55	4.55	0.56014	Cysteine-rich secretory protein (1);	0.089556	0.44285	U	0.000474	T	0.21921	0.0528	M	0.83483	2.645	0.30644	N	0.756123	D	0.60575	0.988	P	0.50590	0.645	T	0.06180	-1.0841	10	0.72032	D	0.01	.	13.1387	0.59423	0.0:1.0:0.0:0.0	.	236	P54108	CRIS3_HUMAN	T	249;259;236;146;267	ENSP00000263045:A249T;ENSP00000389026:A259T;ENSP00000377274:A236T;ENSP00000410469:A146T;ENSP00000360201:A267T	ENSP00000263045:A249T	A	-	1	0	CRISP3	49804434	0.287000	0.24315	0.827000	0.32855	0.121000	0.20230	1.129000	0.31381	2.236000	0.73375	0.609000	0.83330	GCC	.	.	.	none		0.403	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006061	
COL9A1	1297	hgsc.bcm.edu	37	6	70990561	70990561	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:70990561G>A	ENST00000357250.6	-	10	1087	c.929C>T	c.(928-930)cCg>cTg	p.P310L	COL9A1_ENST00000370499.4_Missense_Mutation_p.P67L|COL9A1_ENST00000370496.3_Missense_Mutation_p.P310L|COL9A1_ENST00000489611.1_5'Flank|COL9A1_ENST00000320755.7_Missense_Mutation_p.P67L	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	310	Collagen-like 1.|Triple-helical region (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TGGCTTTCCCGGTTCACCTGC	0.627																																					p.P310L		Atlas-SNP	.											.	COL9A1	228	.	0			c.C929T						PASS	.						18.0	19.0	19.0					6																	70990561		2203	4300	6503	SO:0001583	missense	1297	exon10			TTTCCCGGTTCAC		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.929C>T	chr6.hg19:g.70990561G>A	ENSP00000349790:p.Pro310Leu	33.0	0.0	.		28.0	9.0	.	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	hg19	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.410959	0.25465	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499;ENST00000370496	D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.28	5.6	4.72	0.59763	.	0.325795	0.37012	N	0.002296	D	0.90435	0.7005	M	0.84846	2.72	0.46981	D	0.999279	P;P	0.44429	0.835;0.516	B;B	0.38327	0.271;0.135	D	0.89481	0.3750	10	0.30854	T	0.27	.	15.4859	0.75569	0.0:0.139:0.861:0.0	.	310;67	P20849;P20849-2	CO9A1_HUMAN;.	L	310;67;67;310	ENSP00000349790:P310L;ENSP00000315252:P67L;ENSP00000359530:P67L;ENSP00000359527:P310L	ENSP00000315252:P67L	P	-	2	0	COL9A1	71047282	0.999000	0.42202	0.747000	0.31113	0.002000	0.02628	4.673000	0.61604	1.347000	0.45714	0.563000	0.77884	CCG	.	.	.	none		0.627	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
IMPG1	3617	hgsc.bcm.edu	37	6	76660465	76660465	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:76660465G>C	ENST00000369950.3	-	13	1827	c.1638C>G	c.(1636-1638)ttC>ttG	p.F546L	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TATCCTCCAAGAAATGATCTG	0.483																																					p.F546L	Pancreas(37;839 1141 2599 26037)	Atlas-SNP	.											.	IMPG1	143	.	0			c.C1638G						PASS	.						93.0	79.0	84.0					6																	76660465		2203	4300	6503	SO:0001583	missense	3617	exon13			CTCCAAGAAATGA	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1638C>G	chr6.hg19:g.76660465G>C	ENSP00000358966:p.Phe546Leu	87.0	0.0	.		63.0	15.0	.	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	hg19	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	9.188	1.025421	0.19512	.	.	ENSG00000112706	ENST00000369950	T	0.19532	2.14	5.67	0.817	0.18773	.	0.942898	0.08930	N	0.873167	T	0.08223	0.0205	M	0.73598	2.24	0.09310	N	1	B	0.26258	0.145	B	0.20955	0.032	T	0.42292	-0.9460	10	0.15066	T	0.55	.	8.972	0.35912	0.39:0.0:0.61:0.0	.	546	Q17R60	IMPG1_HUMAN	L	546	ENSP00000358966:F546L	ENSP00000358966:F546L	F	-	3	2	IMPG1	76717185	0.000000	0.05858	0.026000	0.17262	0.005000	0.04900	-0.651000	0.05372	0.055000	0.16094	-0.142000	0.14014	TTC	.	.	.	none		0.483	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
IMPG1	3617	hgsc.bcm.edu	37	6	76660529	76660529	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:76660529G>A	ENST00000369950.3	-	13	1763	c.1574C>T	c.(1573-1575)tCt>tTt	p.S525F	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AGGAGTGTCAGACAGATCCAT	0.488																																					p.S525F	Pancreas(37;839 1141 2599 26037)	Atlas-SNP	.											.	IMPG1	143	.	0			c.C1574T						PASS	.						97.0	80.0	86.0					6																	76660529		2203	4300	6503	SO:0001583	missense	3617	exon13			GTGTCAGACAGAT	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1574C>T	chr6.hg19:g.76660529G>A	ENSP00000358966:p.Ser525Phe	54.0	0.0	.		40.0	9.0	.	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	hg19	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.206277	0.39003	.	.	ENSG00000112706	ENST00000369950	T	0.21031	2.03	4.94	2.19	0.27852	.	1.695600	0.02971	N	0.144359	T	0.07954	0.0199	L	0.38175	1.15	0.09310	N	0.999999	P	0.46706	0.883	B	0.44044	0.439	T	0.13361	-1.0512	10	0.39692	T	0.17	.	4.5254	0.11980	0.435:0.0:0.4185:0.1465	.	525	Q17R60	IMPG1_HUMAN	F	525	ENSP00000358966:S525F	ENSP00000358966:S525F	S	-	2	0	IMPG1	76717249	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.632000	0.24583	0.339000	0.23719	0.650000	0.86243	TCT	.	.	.	none		0.488	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
IMPG1	3617	hgsc.bcm.edu	37	6	76660533	76660533	+	Silent	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:76660533G>A	ENST00000369950.3	-	13	1759	c.1570C>T	c.(1570-1572)Ctg>Ttg	p.L524L	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GTGTCAGACAGATCCATTTCA	0.493																																					p.L524L	Pancreas(37;839 1141 2599 26037)	Atlas-SNP	.											.	IMPG1	143	.	0			c.C1570T						PASS	.						99.0	82.0	88.0					6																	76660533		2203	4300	6503	SO:0001819	synonymous_variant	3617	exon13			CAGACAGATCCAT	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1570C>T	chr6.hg19:g.76660533G>A		52.0	0.0	.		39.0	10.0	.	NM_001563		Silent	SNP	ENST00000369950.3	hg19	CCDS4985.1																																																																																			.	.	.	none		0.493	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
IMPG1	3617	hgsc.bcm.edu	37	6	76660636	76660636	+	Silent	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:76660636G>A	ENST00000369950.3	-	13	1656	c.1467C>T	c.(1465-1467)atC>atT	p.I489I	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CCAGTTGGCTGATTGCAGAAT	0.498																																					p.I489I	Pancreas(37;839 1141 2599 26037)	Atlas-SNP	.											.	IMPG1	143	.	0			c.C1467T						PASS	.						159.0	151.0	153.0					6																	76660636		2203	4300	6503	SO:0001819	synonymous_variant	3617	exon13			TTGGCTGATTGCA	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1467C>T	chr6.hg19:g.76660636G>A		104.0	0.0	.		78.0	20.0	.	NM_001563		Silent	SNP	ENST00000369950.3	hg19	CCDS4985.1																																																																																			.	.	.	none		0.498	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
LAMA4	3910	hgsc.bcm.edu	37	6	112454683	112454683	+	Silent	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:112454683G>C	ENST00000230538.7	-	27	3961	c.3564C>G	c.(3562-3564)ctC>ctG	p.L1188L	LAMA4_ENST00000389463.4_Silent_p.L1181L|LAMA4_ENST00000424408.2_Silent_p.L1181L|LAMA4_ENST00000522006.1_Silent_p.L1181L	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1188	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GGTGTGCTCTGAGGGCCCTGG	0.438																																					p.L1188L		Atlas-SNP	.											.	LAMA4	227	.	0			c.C3564G						PASS	.						101.0	96.0	97.0					6																	112454683		2203	4300	6503	SO:0001819	synonymous_variant	3910	exon27			TGCTCTGAGGGCC		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.3564C>G	chr6.hg19:g.112454683G>C		154.0	0.0	.		119.0	29.0	.	NM_001105206	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Silent	SNP	ENST00000230538.7	hg19	CCDS43491.1																																																																																			.	.	.	none		0.438	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
MSRA	4482	hgsc.bcm.edu	37	8	9912062	9912062	+	Silent	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr8:9912062C>T	ENST00000317173.4	+	1	285	c.36C>T	c.(34-36)ctC>ctT	p.L12L	MSRA_ENST00000441698.2_Silent_p.L12L|RP11-1E4.1_ENST00000562143.1_RNA|MSRA_ENST00000518255.1_Silent_p.L12L	NM_012331.3	NP_036463.1	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A	12				Missing (in Ref. 6; AAG09689). {ECO:0000305}.	cellular protein modification process (GO:0006464)|methionine metabolic process (GO:0006555)|protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptide-methionine (S)-S-oxide reductase activity (GO:0008113)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(4)	8		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	GCCAGCTCCTCCTCCTCCACA	0.716																																					p.L12L	NSCLC(88;1378 1469 30580 49103 52286)	Atlas-SNP	.											.	MSRA	21	.	0			c.C36T						PASS	.						36.0	35.0	36.0					8																	9912062		2203	4300	6503	SO:0001819	synonymous_variant	4482	exon1			GCTCCTCCTCCTC	BC054033	CCDS5975.1, CCDS47798.1, CCDS47799.1, CCDS56522.1	8p23.1	2009-07-10			ENSG00000175806	ENSG00000175806	1.8.4.11		7377	protein-coding gene	gene with protein product		601250				10452521	Standard	NM_012331		Approved		uc003wsx.3	Q9UJ68	OTTHUMG00000090517	ENST00000317173.4:c.36C>T	chr8.hg19:g.9912062C>T		67.0	0.0	.		43.0	16.0	.	NM_012331	E9PAS8|Q52TC4|Q549N4|Q66MI7	Silent	SNP	ENST00000317173.4	hg19	CCDS5975.1																																																																																			.	.	.	none		0.716	MSRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207005.1	NM_012331	
MSRA	4482	hgsc.bcm.edu	37	8	9912103	9912103	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr8:9912103C>T	ENST00000317173.4	+	1	326	c.77C>T	c.(76-78)tCg>tTg	p.S26L	MSRA_ENST00000441698.2_Missense_Mutation_p.S26L|RP11-1E4.1_ENST00000562143.1_RNA|MSRA_ENST00000518255.1_Missense_Mutation_p.S26L	NM_012331.3	NP_036463.1	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A	26					cellular protein modification process (GO:0006464)|methionine metabolic process (GO:0006555)|protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptide-methionine (S)-S-oxide reductase activity (GO:0008113)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(4)	8		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	ATGGGCAACTCGGCCTCGAAC	0.697																																					p.S26L	NSCLC(88;1378 1469 30580 49103 52286)	Atlas-SNP	.											.	MSRA	21	.	0			c.C77T						PASS	.						38.0	37.0	37.0					8																	9912103		2203	4300	6503	SO:0001583	missense	4482	exon1			GCAACTCGGCCTC	BC054033	CCDS5975.1, CCDS47798.1, CCDS47799.1, CCDS56522.1	8p23.1	2009-07-10			ENSG00000175806	ENSG00000175806	1.8.4.11		7377	protein-coding gene	gene with protein product		601250				10452521	Standard	NM_012331		Approved		uc003wsx.3	Q9UJ68	OTTHUMG00000090517	ENST00000317173.4:c.77C>T	chr8.hg19:g.9912103C>T	ENSP00000313921:p.Ser26Leu	69.0	0.0	.		51.0	15.0	.	NM_012331	E9PAS8|Q52TC4|Q549N4|Q66MI7	Missense_Mutation	SNP	ENST00000317173.4	hg19	CCDS5975.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622922	0.28889	.	.	ENSG00000175806	ENST00000317173;ENST00000441698;ENST00000518255	.	.	.	4.84	3.94	0.45596	.	0.300238	0.32015	N	0.006711	T	0.34629	0.0904	L	0.42245	1.32	0.34862	D	0.74275	D;B	0.53885	0.963;0.249	B;B	0.37601	0.254;0.036	T	0.50039	-0.8874	8	.	.	.	0.3672	10.6214	0.45483	0.1922:0.8078:0.0:0.0	.	26;26	Q9UJ68-4;Q9UJ68	.;MSRA_HUMAN	L	26	.	.	S	+	2	0	MSRA	9949513	0.147000	0.22687	0.178000	0.23040	0.019000	0.09904	1.820000	0.39032	1.113000	0.41760	0.313000	0.20887	TCG	.	.	.	none		0.697	MSRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207005.1	NM_012331	
ZNF189	7743	hgsc.bcm.edu	37	9	104170234	104170234	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr9:104170234G>C	ENST00000339664.2	+	3	313	c.184G>C	c.(184-186)Gag>Cag	p.E62Q	ZNF189_ENST00000374861.3_Missense_Mutation_p.E48Q|ZNF189_ENST00000259395.4_Missense_Mutation_p.E20Q	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	62	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				AGATAAGGATGAGGAGCCAAC	0.368																																					p.E62Q		Atlas-SNP	.											.	ZNF189	79	.	0			c.G184C						PASS	.						58.0	60.0	60.0					9																	104170234		2202	4300	6502	SO:0001583	missense	7743	exon3			AAGGATGAGGAGC	AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.184G>C	chr9.hg19:g.104170234G>C	ENSP00000342019:p.Glu62Gln	29.0	0.0	.		17.0	5.0	.	NM_003452	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Missense_Mutation	SNP	ENST00000339664.2	hg19	CCDS6754.1	.	.	.	.	.	.	.	.	.	.	G	5.540	0.284544	0.10513	.	.	ENSG00000136870	ENST00000374861;ENST00000339664;ENST00000259395	T;T;T	0.05580	5.66;5.66;3.42	4.79	4.79	0.61399	Krueppel-associated box (3);	0.000000	0.49916	D	0.000140	T	0.03220	0.0094	N	0.16201	0.385	0.34306	D	0.684889	B;B;B	0.33073	0.396;0.396;0.006	B;B;B	0.26864	0.074;0.074;0.011	T	0.43261	-0.9402	10	0.14252	T	0.57	.	9.2106	0.37316	0.0942:0.0:0.9058:0.0	.	47;48;62	B7ZLK9;Q5T7D8;O75820	.;.;ZN189_HUMAN	Q	48;62;20	ENSP00000363995:E48Q;ENSP00000342019:E62Q;ENSP00000259395:E20Q	ENSP00000259395:E20Q	E	+	1	0	ZNF189	103210055	0.191000	0.23288	1.000000	0.80357	0.895000	0.52256	0.622000	0.24433	2.941000	0.99782	0.655000	0.94253	GAG	.	.	.	none		0.368	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452	
OR10Q1	219960	hgsc.bcm.edu	37	11	57996225	57996225	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr11:57996225C>T	ENST00000316770.2	-	1	165	c.123G>A	c.(121-123)atG>atA	p.M41I		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				CACAGAGGATCATCAAGTAGA	0.527																																					p.M41I		Atlas-SNP	.											.	OR10Q1	79	.	0			c.G123A						PASS	.						114.0	122.0	119.0					11																	57996225		2200	4294	6494	SO:0001583	missense	219960	exon1			GAGGATCATCAAG	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.123G>A	chr11.hg19:g.57996225C>T	ENSP00000314324:p.Met41Ile	129.0	0.0	.		106.0	28.0	.	NM_001004471	Q6IFG4	Missense_Mutation	SNP	ENST00000316770.2	hg19	CCDS31547.1	.	.	.	.	.	.	.	.	.	.	C	8.116	0.779975	0.16120	.	.	ENSG00000180475	ENST00000316770	T	0.00392	7.58	5.28	2.25	0.28309	.	0.123417	0.36555	N	0.002525	T	0.00178	0.0005	N	0.13168	0.305	0.09310	N	1	B	0.34181	0.44	B	0.30646	0.118	T	0.31558	-0.9939	10	0.10377	T	0.69	.	11.4267	0.50015	0.136:0.3334:0.5306:0.0	.	41	Q8NGQ4	O10Q1_HUMAN	I	41	ENSP00000314324:M41I	ENSP00000314324:M41I	M	-	3	0	OR10Q1	57752801	0.000000	0.05858	0.013000	0.15412	0.626000	0.37791	-0.168000	0.09925	0.305000	0.22832	0.650000	0.86243	ATG	.	.	.	none		0.527	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471	
ZNF385A	25946	hgsc.bcm.edu	37	12	54764720	54764720	+	Silent	SNP	T	T	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr12:54764720T>C	ENST00000338010.5	-	6	878	c.825A>G	c.(823-825)caA>caG	p.Q275Q	ZNF385A_ENST00000551109.1_Silent_p.Q255Q|ZNF385A_ENST00000551771.1_Silent_p.Q174Q|RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|ZNF385A_ENST00000546970.1_Silent_p.Q255Q|ZNF385A_ENST00000552382.1_5'UTR|ZNF385A_ENST00000352268.6_Silent_p.Q194Q|ZNF385A_ENST00000394313.2_Silent_p.Q255Q	NM_001130967.1	NP_001124439.1	Q96PM9	Z385A_HUMAN	zinc finger protein 385A	275	Necessary for binding to ITPR1, CEBPA and p53/TP53 mRNAs. {ECO:0000250}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|hemostasis (GO:0007599)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)|positive regulation of DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:1902164)|positive regulation of fat cell differentiation (GO:0045600)|regulation of cytoplasmic translation (GO:2000765)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(1)	15						CCTGTTTCAGTTGGACCTCCG	0.597											OREG0021894	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q275Q		Atlas-SNP	.											.	ZNF385A	45	.	0			c.A825G						PASS	.						89.0	96.0	94.0					12																	54764720		2203	4300	6503	SO:0001819	synonymous_variant	25946	exon6			TTTCAGTTGGACC	AF304052	CCDS8879.1, CCDS44910.1, CCDS44911.1	12q13.13	2012-10-05	2007-12-06	2007-12-06		ENSG00000161642			17521	protein-coding gene	gene with protein product		609124	"""zinc finger protein 385"""	ZNF385			Standard	XM_005268785		Approved	DKFZp586G1122, Hzf, ZFP385	uc001sfy.3	Q96PM9	OTTHUMG00000169840	ENST00000338010.5:c.825A>G	chr12.hg19:g.54764720T>C		217.0	0.0	.	1002	122.0	34.0	.	NM_001130967	B2RDN5|B4DKH2|F1T0F1|J3KNS3|Q5VH53|Q9H7R6|Q9UFU3	Silent	SNP	ENST00000338010.5	hg19	CCDS44911.1																																																																																			.	.	.	none		0.597	ZNF385A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406162.1	NM_015481	
C12orf74	338809	hgsc.bcm.edu	37	12	93100691	93100691	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr12:93100691C>G	ENST00000397833.3	+	2	735	c.284C>G	c.(283-285)tCt>tGt	p.S95C	C12orf74_ENST00000544406.2_Missense_Mutation_p.S95C	NM_001037671.3|NM_001178097.2	NP_001032760.1|NP_001171568.1	Q32Q52	CL074_HUMAN	chromosome 12 open reading frame 74	95										kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	10						CCAAAGGATTCTTCACACTTG	0.582																																					p.S95C		Atlas-SNP	.											.	C12orf74	17	.	0			c.C284G						PASS	.						55.0	59.0	58.0					12																	93100691		1914	4126	6040	SO:0001583	missense	338809	exon2			AGGATTCTTCACA	BC043363	CCDS41819.1, CCDS53818.1	12q22	2012-08-16			ENSG00000214215	ENSG00000214215			27887	protein-coding gene	gene with protein product						12477932	Standard	NM_001037671		Approved		uc001tch.2	Q32Q52	OTTHUMG00000170105	ENST00000397833.3:c.284C>G	chr12.hg19:g.93100691C>G	ENSP00000380933:p.Ser95Cys	138.0	0.0	.		87.0	23.0	.	NM_001037671	F5H4P0	Missense_Mutation	SNP	ENST00000397833.3	hg19	CCDS41819.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525193	0.27299	.	.	ENSG00000214215	ENST00000397833;ENST00000544406	.	.	.	4.98	0.507	0.16967	.	.	.	.	.	T	0.24314	0.0589	N	0.24115	0.695	0.09310	N	1	B;B	0.20261	0.043;0.043	B;B	0.21546	0.035;0.035	T	0.20940	-1.0260	8	0.37606	T	0.19	.	3.0572	0.06188	0.175:0.401:0.327:0.097	.	95;95	F5H4P0;Q32Q52	.;CL074_HUMAN	C	95	.	ENSP00000380933:S95C	S	+	2	0	C12orf74	91624822	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.457000	0.06745	0.212000	0.20703	0.462000	0.41574	TCT	.	.	.	none		0.582	C12orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407285.1	NM_001037671	
COASY	80347	hgsc.bcm.edu	37	17	40717244	40717244	+	Splice_Site	SNP	G	G	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr17:40717244G>T	ENST00000393818.2	+	6	1758		c.e6-1		COASY_ENST00000421097.2_Splice_Site|COASY_ENST00000420359.1_Splice_Site|MLX_ENST00000246912.4_5'Flank|COASY_ENST00000590958.1_Splice_Site|MLX_ENST00000435881.2_5'Flank|COASY_ENST00000449624.1_Splice_Site|MLX_ENST00000346833.4_5'Flank	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase						cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CCCCTCCCCAGAAGCAGCTGA	0.562																																					.		Atlas-SNP	.											.	COASY	45	.	0			c.1303-1G>T						PASS	.						135.0	138.0	137.0					17																	40717244		2203	4300	6503	SO:0001630	splice_region_variant	80347	exon7			TCCCCAGAAGCAG	AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.1303-1G>T	chr17.hg19:g.40717244G>T		307.0	0.0	.		219.0	45.0	.	NM_001042529	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Splice_Site	SNP	ENST00000393818.2	hg19	CCDS11429.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197183	0.79015	.	.	ENSG00000068120	ENST00000421097;ENST00000449624;ENST00000420359;ENST00000393818	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7387	0.85454	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COASY	37970770	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.174000	0.89682	2.649000	0.89929	0.556000	0.70494	.	.	.	.	none		0.562	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1	NM_025233	Intron
AOC2	314	hgsc.bcm.edu	37	17	40997487	40997487	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr17:40997487G>C	ENST00000253799.3	+	1	871	c.844G>C	c.(844-846)Gtg>Ctg	p.V282L	AOC2_ENST00000452774.2_Missense_Mutation_p.V282L	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	282					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CCGGTTGGAAGTGGTTAGAGT	0.572																																					p.V282L		Atlas-SNP	.											.	AOC2	61	.	0			c.G844C						PASS	.						85.0	85.0	85.0					17																	40997487		2203	4300	6503	SO:0001583	missense	314	exon1			TTGGAAGTGGTTA	AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.844G>C	chr17.hg19:g.40997487G>C	ENSP00000253799:p.Val282Leu	116.0	0.0	.		102.0	23.0	.	NM_009590	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	hg19	CCDS11443.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902404	0.33628	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.22945	1.93;1.93	5.75	5.75	0.90469	Copper amine oxidase, N2/N3-terminal (1);Copper amine oxidase, N-terminal (1);	0.267133	0.37219	N	0.002188	T	0.18087	0.0434	N	0.08118	0	0.19945	N	0.99994	P;P	0.50617	0.533;0.937	B;P	0.49561	0.069;0.615	T	0.16424	-1.0403	10	0.10902	T	0.67	-33.3282	14.1397	0.65311	0.0717:0.0:0.9283:0.0	.	282;282	O75106;O75106-2	AOC2_HUMAN;.	L	282	ENSP00000253799:V282L;ENSP00000406134:V282L	ENSP00000253799:V282L	V	+	1	0	AOC2	38251013	0.986000	0.35501	0.707000	0.30419	0.755000	0.42902	2.284000	0.43478	2.720000	0.93068	0.561000	0.74099	GTG	.	.	.	none		0.572	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158	
MAPT	4137	hgsc.bcm.edu	37	17	44101444	44101444	+	Silent	SNP	C	C	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr17:44101444C>G	ENST00000571987.1	+	13	2184	c.2184C>G	c.(2182-2184)gtC>gtG	p.V728V	MAPT_ENST00000535772.1_Silent_p.V380V|MAPT_ENST00000344290.5_Silent_p.V746V|MAPT_ENST00000576518.1_Silent_p.V311V|MAPT_ENST00000420682.2_Silent_p.V382V|MAPT_ENST00000340799.5_Silent_p.V382V|MAPT_ENST00000415613.2_Silent_p.V746V|MAPT_ENST00000574436.1_Silent_p.V411V|MAPT_ENST00000446361.3_Silent_p.V353V|MAPT_ENST00000262410.5_Silent_p.V728V|MAPT_ENST00000334239.8_Silent_p.V322V|MAPT_ENST00000351559.5_Silent_p.V411V|MAPT_ENST00000431008.3_Silent_p.V380V|MAPT_ENST00000347967.5_Silent_p.V286V			P10636	TAU_HUMAN	microtubule-associated protein tau	728					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	TCAGCAATGTCTCCTCCACCG	0.622																																					p.V746V		Atlas-SNP	.											.	MAPT	135	.	0			c.C2238G						PASS	.						124.0	105.0	112.0					17																	44101444		2203	4300	6503	SO:0001819	synonymous_variant	4137	exon15			CAATGTCTCCTCC	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.2184C>G	chr17.hg19:g.44101444C>G		186.0	0.0	.		155.0	10.0	.	NM_001123066	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Silent	SNP	ENST00000571987.1	hg19	CCDS11501.1																																																																																			.	.	.	none		0.622	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	NM_016835	
NDC80	10403	hgsc.bcm.edu	37	18	2616466	2616466	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr18:2616466G>C	ENST00000261597.4	+	17	2004	c.1822G>C	c.(1822-1824)Gat>Cat	p.D608H		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	608	Interaction with NEK2 and ZWINT.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						TGCTAAAGTTGATAGAGAATA	0.269																																					p.D608H		Atlas-SNP	.											.	NDC80	62	.	0			c.G1822C						PASS	.						44.0	47.0	46.0					18																	2616466		2200	4284	6484	SO:0001583	missense	10403	exon17			AAAGTTGATAGAG	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1822G>C	chr18.hg19:g.2616466G>C	ENSP00000261597:p.Asp608His	58.0	0.0	.		60.0	17.0	.	NM_006101	Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	hg19	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	G	8.778	0.927542	0.18056	.	.	ENSG00000080986	ENST00000261597	T	0.51325	0.71	5.32	3.48	0.39840	.	0.281499	0.39834	N	0.001252	T	0.43942	0.1270	M	0.62723	1.935	0.38915	D	0.957602	P	0.39216	0.664	B	0.38655	0.278	T	0.42498	-0.9448	10	0.46703	T	0.11	-22.92	9.4287	0.38597	0.0766:0.0:0.7799:0.1435	.	608	O14777	NDC80_HUMAN	H	608	ENSP00000261597:D608H	ENSP00000261597:D608H	D	+	1	0	NDC80	2606466	0.973000	0.33851	0.655000	0.29622	0.368000	0.29767	1.715000	0.37971	0.699000	0.31761	-0.266000	0.10368	GAT	.	.	.	none		0.269	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101	
NDC80	10403	hgsc.bcm.edu	37	18	2616517	2616517	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr18:2616517G>C	ENST00000261597.4	+	17	2055	c.1873G>C	c.(1873-1875)Gag>Cag	p.E625Q		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	625	Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						AAATATTAAAGAGATTAGAGA	0.299																																					p.E625Q		Atlas-SNP	.											.	NDC80	62	.	0			c.G1873C						PASS	.						40.0	43.0	42.0					18																	2616517		2199	4282	6481	SO:0001583	missense	10403	exon17			ATTAAAGAGATTA	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1873G>C	chr18.hg19:g.2616517G>C	ENSP00000261597:p.Glu625Gln	38.0	0.0	.		37.0	10.0	.	NM_006101	Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	hg19	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	G	7.891	0.732376	0.15507	.	.	ENSG00000080986	ENST00000261597	T	0.49432	0.78	5.47	4.59	0.56863	.	0.333418	0.34245	N	0.004123	T	0.34948	0.0915	L	0.47716	1.5	0.28039	N	0.933831	P	0.39216	0.664	B	0.34242	0.178	T	0.18871	-1.0323	10	0.15066	T	0.55	-4.8199	10.1561	0.42823	0.0768:0.137:0.7862:0.0	.	625	O14777	NDC80_HUMAN	Q	625	ENSP00000261597:E625Q	ENSP00000261597:E625Q	E	+	1	0	NDC80	2606517	1.000000	0.71417	0.991000	0.47740	0.167000	0.22549	2.210000	0.42816	1.407000	0.46875	0.555000	0.69702	GAG	.	.	.	none		0.299	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101	
ZNF844	284391	hgsc.bcm.edu	37	19	12187475	12187475	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr19:12187475C>G	ENST00000439326.3	+	4	1715	c.1540C>G	c.(1540-1542)Cat>Gat	p.H514D	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H514D(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						AAAGCCTTCACATCTGCCTCA	0.408																																					p.H514D		Atlas-SNP	.											ZNF844,NS,carcinoma,0,6	ZNF844	69	.	1	Substitution - Missense(1)	endometrium(1)	c.C1540G						PASS	.						87.0	81.0	83.0					19																	12187475		692	1591	2283	SO:0001583	missense	284391	exon4			CCTTCACATCTGC	AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.1540C>G	chr19.hg19:g.12187475C>G	ENSP00000392024:p.His514Asp	51.0	1.0	.		43.0	4.0	.	NM_001136501	Q5JPI8	Missense_Mutation	SNP	ENST00000439326.3	hg19	CCDS45985.1	.	.	.	.	.	.	.	.	.	.	c	0.059	-1.227642	0.01518	.	.	ENSG00000223547	ENST00000439326;ENST00000541708	T	0.06371	3.31	2.45	-4.91	0.03085	.	.	.	.	.	T	0.02649	0.0080	N	0.04387	-0.21	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44019	-0.9355	9	0.25106	T	0.35	.	9.0916	0.36614	0.0:0.4133:0.4132:0.1735	.	514	Q08AG5	ZN844_HUMAN	D	514	ENSP00000392024:H514D	ENSP00000392024:H514D	H	+	1	0	ZNF844	12048475	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-4.066000	0.00302	-2.826000	0.00341	-1.839000	0.00587	CAT	.	.	.	none		0.408	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344086.2		
FBXW9	84261	hgsc.bcm.edu	37	19	12800616	12800616	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr19:12800616G>A	ENST00000380339.3	-	7	1231	c.1195C>T	c.(1195-1197)Cac>Tac	p.H399Y	FBXW9_ENST00000544494.1_Missense_Mutation_p.H107Y|CTD-2192J16.26_ENST00000593554.1_lincRNA|CTD-2659N19.2_ENST00000585742.1_RNA|FBXW9_ENST00000587955.1_Missense_Mutation_p.H389Y|FBXW9_ENST00000393261.3_Missense_Mutation_p.H369Y			Q5XUX1	FBXW9_HUMAN	F-box and WD repeat domain containing 9	399					SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)					cervix(1)|lung(4)|ovary(1)|prostate(1)	7						GCGAAGACGTGCAGCAGGCCC	0.647																																					p.H369Y		Atlas-SNP	.											.	FBXW9	30	.	0			c.C1105T						PASS	.						63.0	62.0	62.0					19																	12800616		2203	4300	6503	SO:0001583	missense	84261	exon7			AGACGTGCAGCAG	BC004290	CCDS12278.2	19p13.2	2013-01-09	2007-02-08		ENSG00000132004	ENSG00000132004		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	28136	protein-coding gene	gene with protein product		609074	"""F-box and WD-40 domain protein 9"""			12477932	Standard	NM_032301		Approved	MGC10870, Fbw9	uc002mum.1	Q5XUX1	OTTHUMG00000150152	ENST00000380339.3:c.1195C>T	chr19.hg19:g.12800616G>A	ENSP00000369696:p.His399Tyr	180.0	0.0	.		98.0	22.0	.	NM_032301	B3KVP7|Q9BT89	Missense_Mutation	SNP	ENST00000380339.3	hg19		.	.	.	.	.	.	.	.	.	.	G	11.70	1.716443	0.30413	.	.	ENSG00000132004	ENST00000544494;ENST00000393261;ENST00000380339	T;T;T	0.75367	-0.93;-0.93;-0.93	4.62	3.5	0.40072	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.191473	0.45361	N	0.000365	T	0.48390	0.1497	N	0.11106	0.095	0.42212	D	0.991813	B;B;B	0.28880	0.226;0.011;0.002	B;B;B	0.22386	0.039;0.023;0.006	T	0.51356	-0.8716	10	0.51188	T	0.08	-14.7405	3.666	0.08255	0.3848:0.0:0.6152:0.0	.	389;399;369	Q5XUX1-2;Q5XUX1;Q5XUX1-3	.;FBXW9_HUMAN;.	Y	107;369;399	ENSP00000442714:H107Y;ENSP00000376945:H369Y;ENSP00000369696:H399Y	ENSP00000369696:H399Y	H	-	1	0	FBXW9	12661616	1.000000	0.71417	1.000000	0.80357	0.522000	0.34438	3.310000	0.51911	2.129000	0.65627	0.484000	0.47621	CAC	.	.	.	none		0.647	FBXW9-201	KNOWN	basic	protein_coding	protein_coding		NM_032301	
SIRPG	55423	hgsc.bcm.edu	37	20	1615980	1615980	+	Silent	SNP	C	C	A	rs147655438		TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr20:1615980C>A	ENST00000303415.3	-	4	1078	c.1014G>T	c.(1012-1014)gcG>gcT	p.A338A	SIRPG_ENST00000381580.1_Silent_p.A305A|RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000344103.4_Intron|SIRPG_ENST00000381583.2_Intron|SIRPG_ENST00000216927.4_Intron|RP11-77C3.3_ENST00000456177.1_RNA	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	338	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						GTTTGCTGACCGCCAGCTGCC	0.502																																					p.A338A		Atlas-SNP	.											SIRPG,NS,carcinoma,0,1	SIRPG	61	.	0			c.G1014T						PASS	.						116.0	94.0	101.0					20																	1615980		2203	4300	6503	SO:0001819	synonymous_variant	55423	exon4			GCTGACCGCCAGC	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.1014G>T	chr20.hg19:g.1615980C>A		131.0	0.0	.		90.0	24.0	.	NM_018556	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000303415.3	hg19	CCDS13020.2																																																																																			.	C|1.000;T|0.000	.	alt		0.502	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
FTCD	10841	hgsc.bcm.edu	37	21	47571511	47571511	+	Silent	SNP	G	G	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr21:47571511G>T	ENST00000291670.5	-	5	640	c.597C>A	c.(595-597)atC>atA	p.I199I	FTCD_ENST00000498355.2_5'UTR|FTCD-AS1_ENST00000446649.1_RNA|FTCD_ENST00000397748.1_Silent_p.I199I|FTCD_ENST00000397746.3_Silent_p.I199I|FTCD_ENST00000397743.1_Silent_p.I199I|FTCD_ENST00000355384.2_Silent_p.I199I|FTCD_ENST00000359679.2_Silent_p.I199I	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	199	Formiminotransferase C-subdomain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	GGTTGAGCGCGATGCGGTGGG	0.647																																					p.I199I		Atlas-SNP	.											.	FTCD	59	.	0			c.C597A						PASS	.						67.0	71.0	69.0					21																	47571511		2203	4300	6503	SO:0001819	synonymous_variant	10841	exon5			GAGCGCGATGCGG	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.597C>A	chr21.hg19:g.47571511G>T		157.0	0.0	.		97.0	27.0	.	NM_206965	B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Silent	SNP	ENST00000291670.5	hg19	CCDS13731.1																																																																																			.	.	.	none		0.647	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206962.1	NM_006657	
MSN	4478	hgsc.bcm.edu	37	X	64936758	64936758	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chrX:64936758G>C	ENST00000360270.5	+	2	263	c.91G>C	c.(91-93)Gac>Cac	p.D31H		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	31	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						GCAGCTATTTGACCAGGTAAG	0.507			T	ALK	ALCL																																p.D31H		Atlas-SNP	.		Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	MSN	89	.	0			c.G91C						PASS	.						132.0	99.0	111.0					X																	64936758		2203	4300	6503	SO:0001583	missense	4478	exon2			CTATTTGACCAGG	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.91G>C	chrX.hg19:g.64936758G>C	ENSP00000353408:p.Asp31His	105.0	0.0	.		77.0	13.0	.	NM_002444		Missense_Mutation	SNP	ENST00000360270.5	hg19	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	g	17.67	3.446489	0.63178	.	.	ENSG00000147065	ENST00000360270	T	0.80304	-1.36	5.73	5.73	0.89815	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.90892	0.7138	H	0.98155	4.16	0.80722	D	1	P	0.43542	0.81	P	0.47891	0.56	D	0.93688	0.7004	10	0.87932	D	0	.	16.1334	0.81461	0.0:0.0:1.0:0.0	.	31	P26038	MOES_HUMAN	H	31	ENSP00000353408:D31H	ENSP00000353408:D31H	D	+	1	0	MSN	64853483	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	8.899000	0.92544	2.412000	0.81896	0.597000	0.82753	GAC	.	.	.	none		0.507	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
OGT	8473	hgsc.bcm.edu	37	X	70782731	70782731	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chrX:70782731C>T	ENST00000373719.3	+	16	2229	c.2012C>T	c.(2011-2013)gCg>gTg	p.A671V	OGT_ENST00000373701.3_Missense_Mutation_p.A661V	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	671					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					ACGAGTGGTGCGCTTTTCATG	0.393																																					p.A671V		Atlas-SNP	.											.	OGT	207	.	0			c.C2012T						PASS	.						129.0	115.0	120.0					X																	70782731		2203	4300	6503	SO:0001583	missense	8473	exon16			GTGGTGCGCTTTT	U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.2012C>T	chrX.hg19:g.70782731C>T	ENSP00000362824:p.Ala671Val	123.0	0.0	.		132.0	31.0	.	NM_181672	Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	hg19	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612830	0.87258	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.18338	2.22;2.22	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.42063	0.1186	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.99;0.989	T	0.15435	-1.0437	10	0.23302	T	0.38	.	17.876	0.88825	0.0:1.0:0.0:0.0	.	545;661;671	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	V	671;661	ENSP00000362824:A671V;ENSP00000362805:A661V	ENSP00000362805:A661V	A	+	2	0	OGT	70699456	1.000000	0.71417	0.922000	0.36590	0.793000	0.44817	7.626000	0.83164	2.410000	0.81850	0.594000	0.82650	GCG	.	.	.	none		0.393	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672	
STAG2	10735	hgsc.bcm.edu	37	X	123197834	123197834	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chrX:123197834C>A	ENST00000371160.1	+	20	2248	c.1958C>A	c.(1957-1959)tCa>tAa	p.S653*	STAG2_ENST00000371145.3_Nonsense_Mutation_p.S653*|STAG2_ENST00000354548.5_Nonsense_Mutation_p.S584*|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Nonsense_Mutation_p.S653*|STAG2_ENST00000371157.3_Nonsense_Mutation_p.S653*|STAG2_ENST00000371144.3_Nonsense_Mutation_p.S653*	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	653					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GTAGATATTTCAAGAAGTCAA	0.333																																					p.S653X		Atlas-SNP	.											.	STAG2	309	.	0			c.C1958A						PASS	.						64.0	56.0	59.0					X																	123197834		2203	4300	6503	SO:0001587	stop_gained	10735	exon20			ATATTTCAAGAAG	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1958C>A	chrX.hg19:g.123197834C>A	ENSP00000360202:p.Ser653*	55.0	0.0	.		61.0	15.0	.	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Nonsense_Mutation	SNP	ENST00000371160.1	hg19	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	40	8.002701	0.98605	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	.	.	.	5.28	5.28	0.74379	.	0.124104	0.53938	D	0.000049	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-19.1078	18.0751	0.89424	0.0:1.0:0.0:0.0	.	.	.	.	X	653;584;653;653;653;653	.	ENSP00000218089:S653X	S	+	2	0	STAG2	123025515	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.759000	0.85235	2.203000	0.70933	0.600000	0.82982	TCA	.	.	.	none		0.333	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
LYPD3	27076	hgsc.bcm.edu	37	19	43967294	43967300	+	Frame_Shift_Del	DEL	GTTGCCG	GTTGCCG	-			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	GTTGCCG	GTTGCCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr19:43967294_43967300delGTTGCCG	ENST00000244333.3	-	4	610_616	c.522_528delCGGCAAC	c.(520-528)gacggcaacfs	p.DGN174fs		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	174	UPAR/Ly6 2.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				TCAAGGTGACGTTGCCGTCGAAGCAGC	0.647																																					p.175_177del		Atlas-INDEL	.											.	LYPD3	24	.	0			c.523_529del						PASS	.																																			SO:0001589	frameshift_variant	27076	exon4			.	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.522_528delCGGCAAC	chr19.hg19:g.43967294_43967300delGTTGCCG	ENSP00000244333:p.Asp174fs	171.0	0.0	0		98.0	20.0	0.204082	NM_014400	Q9UJ74	Frame_Shift_Del	DEL	ENST00000244333.3	hg19	CCDS12620.1																																																																																			.	.	.	none		0.647	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400	
RAB11FIP1	80223	hgsc.bcm.edu	37	8	37730588	37730589	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr8:37730588_37730589insG	ENST00000330843.4	-	4	1743_1744	c.1731_1732insC	c.(1729-1734)ccctctfs	p.S578fs	RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000287263.4_Intron	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	578	Ser-rich.				protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CCCAATTCAGAGGGGACAGATG	0.559																																					p.S578fs		Atlas-INDEL	.											.	RAB11FIP1	105	.	0			c.1732_1733insC						PASS	.																																			SO:0001589	frameshift_variant	80223	exon4			.	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.1732dupC	chr8.hg19:g.37730592_37730592dupG	ENSP00000331342:p.Ser578fs	115.0	0.0	0		77.0	26.0	0.337662	NM_001002814	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Frame_Shift_Ins	INS	ENST00000330843.4	hg19	CCDS34882.1																																																																																			.	.	.	none		0.559	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151	
