#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CLCA2	9635	hgsc.bcm.edu	37	1	86890015	86890015	+	Silent	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr1:86890015C>T	ENST00000370565.4	+	1	247	c.85C>T	c.(85-87)Ctg>Ttg	p.L29L		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	29					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		ACTCCCATTCCTGGGAGCTGG	0.443																																					p.L29L	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Atlas-SNP	.											.	CLCA2	102	.	0			c.C85T						PASS	.						113.0	103.0	106.0					1																	86890015		2203	4300	6503	SO:0001819	synonymous_variant	9635	exon1			CCATTCCTGGGAG		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.85C>T	chr1.hg19:g.86890015C>T		47.0	0.0	.		55.0	35.0	.	NM_006536	A8K2T3|Q9Y6N2	Silent	SNP	ENST00000370565.4	hg19	CCDS708.1																																																																																			.	.	.	none		0.443	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
ADAR	103	hgsc.bcm.edu	37	1	154574741	154574741	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr1:154574741A>G	ENST00000368474.4	-	2	576	c.377T>C	c.(376-378)cTt>cCt	p.L126P	ADAR_ENST00000471068.1_5'UTR|ADAR_ENST00000292205.5_Missense_Mutation_p.L169P|ADAR_ENST00000368471.3_5'UTR	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	126					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ATGTGAGGAAAGGCAATCAAC	0.537																																					p.L126P		Atlas-SNP	.											.	ADAR	113	.	0			c.T377C						PASS	.						63.0	65.0	64.0					1																	154574741		2203	4300	6503	SO:0001583	missense	103	exon2			GAGGAAAGGCAAT	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.377T>C	chr1.hg19:g.154574741A>G	ENSP00000357459:p.Leu126Pro	94.0	0.0	.		41.0	24.0	.	NM_015840	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	hg19	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	A	14.52	2.559114	0.45590	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000529168	T;T;T	0.79749	-1.3;-1.3;-1.3	4.47	4.47	0.54385	.	0.972834	0.08506	N	0.935700	D	0.86167	0.5868	M	0.63843	1.955	0.54753	D	0.999983	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.991;0.991;0.997	T	0.82985	-0.0185	10	0.87932	D	0	-16.02	13.8697	0.63610	1.0:0.0:0.0:0.0	.	126;126;126	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	P	169;126;121	ENSP00000292205:L169P;ENSP00000357459:L126P;ENSP00000431794:L121P	ENSP00000292205:L169P	L	-	2	0	ADAR	152841365	0.992000	0.36948	0.866000	0.34008	0.393000	0.30537	5.187000	0.65087	1.992000	0.58205	0.402000	0.26972	CTT	.	.	.	none		0.537	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
MIA3	375056	hgsc.bcm.edu	37	1	222838735	222838735	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr1:222838735G>T	ENST00000344922.5	+	28	5523	c.5498G>T	c.(5497-5499)cGg>cTg	p.R1833L	MIA3_ENST00000340535.7_Missense_Mutation_p.R711L|MIA3_ENST00000344441.6_Missense_Mutation_p.R1833L|AIDA_ENST00000474863.1_5'Flank|MIA3_ENST00000344507.1_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1833	Pro-rich.				chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.R1833L(1)		breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		CTCCACCCTCGGGGATTTTTA	0.517																																					p.R1833L		Atlas-SNP	.											.	MIA3	167	.	1	Substitution - Missense(1)	lung(1)	c.G5498T						PASS	.						205.0	206.0	206.0					1																	222838735		1896	4114	6010	SO:0001583	missense	375056	exon28			ACCCTCGGGGATT		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.5498G>T	chr1.hg19:g.222838735G>T	ENSP00000340900:p.Arg1833Leu	315.0	0.0	.		185.0	9.0	.	NM_198551	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	hg19	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489698	0.64074	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000340535;ENST00000284471	T;T;T	0.09630	3.47;3.47;2.96	5.89	5.89	0.94794	.	.	.	.	.	T	0.30324	0.0761	M	0.71581	2.175	0.44234	D	0.997072	D;D	0.57257	0.979;0.972	P;P	0.56343	0.796;0.707	T	0.00411	-1.1756	9	0.72032	D	0.01	.	19.817	0.96573	0.0:0.0:1.0:0.0	.	711;1833	Q5JRA6-4;Q5JRA6	.;MIA3_HUMAN	L	1833;1833;1774;711;711	ENSP00000340900:R1833L;ENSP00000340587:R1833L;ENSP00000345866:R711L	ENSP00000284471:R711L	R	+	2	0	MIA3	220905358	1.000000	0.71417	0.917000	0.36280	0.179000	0.23085	6.055000	0.71103	2.786000	0.95864	0.591000	0.81541	CGG	.	.	.	none		0.517	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
CCT7	10574	hgsc.bcm.edu	37	2	73471795	73471795	+	Silent	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:73471795G>T	ENST00000258091.5	+	6	711	c.570G>T	c.(568-570)ctG>ctT	p.L190L	CCT7_ENST00000473786.1_3'UTR|CCT7_ENST00000540468.1_Silent_p.L103L|CCT7_ENST00000398422.2_Intron|CCT7_ENST00000538797.1_Silent_p.L62L|CCT7_ENST00000537131.1_Silent_p.L90L|CCT7_ENST00000539919.1_Silent_p.L146L	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	190					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						ATGATTTGCTGCAGCTTAAAA	0.498																																					p.L190L		Atlas-SNP	.											.	CCT7	60	.	0			c.G570T						PASS	.						64.0	63.0	63.0					2																	73471795		2046	4197	6243	SO:0001819	synonymous_variant	10574	exon6			TTTGCTGCAGCTT	AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.570G>T	chr2.hg19:g.73471795G>T		39.0	0.0	.		38.0	12.0	.	NM_006429	A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Silent	SNP	ENST00000258091.5	hg19	CCDS46336.1																																																																																			.	.	.	none		0.498	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327714.2		
GORASP2	26003	hgsc.bcm.edu	37	2	171806790	171806790	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:171806790T>C	ENST00000234160.4	+	4	1240	c.425T>C	c.(424-426)gTc>gCc	p.V142A	GORASP2_ENST00000452526.2_Missense_Mutation_p.V154A|GORASP2_ENST00000493692.1_3'UTR	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	142					mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						GCAGATACAGTCATGAATGAG	0.368																																					p.V142A		Atlas-SNP	.											.	GORASP2	40	.	0			c.T425C						PASS	.						72.0	73.0	73.0					2																	171806790		2203	4300	6503	SO:0001583	missense	26003	exon4			ATACAGTCATGAA		CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.425T>C	chr2.hg19:g.171806790T>C	ENSP00000234160:p.Val142Ala	29.0	0.0	.		76.0	32.0	.	NM_015530	B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Missense_Mutation	SNP	ENST00000234160.4	hg19	CCDS33325.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.583219	0.65992	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	T;T	0.31247	1.5;1.5	5.95	5.95	0.96441	PDZ/DHR/GLGF (1);	0.116778	0.64402	D	0.000018	T	0.44201	0.1282	M	0.73753	2.245	0.58432	D	0.999992	B;B;B	0.23591	0.045;0.088;0.035	B;B;B	0.36845	0.107;0.168;0.234	T	0.35201	-0.9798	10	0.45353	T	0.12	-6.4014	16.4069	0.83677	0.0:0.0:0.0:1.0	.	98;154;142	B4DNR1;B4DKT0;Q9H8Y8	.;.;GORS2_HUMAN	A	142;154	ENSP00000234160:V142A;ENSP00000410208:V154A	ENSP00000234160:V142A	V	+	2	0	GORASP2	171515036	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	4.174000	0.58256	2.272000	0.75746	0.460000	0.39030	GTC	.	.	.	none		0.368	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333719.2		
TTN	7273	hgsc.bcm.edu	37	2	179411556	179411556	+	Silent	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:179411556A>G	ENST00000591111.1	-	291	89900	c.89676T>C	c.(89674-89676)gaT>gaC	p.D29892D	TTN_ENST00000342175.6_Silent_p.D22660D|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.D22593D|TTN_ENST00000460472.2_Silent_p.D22468D|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.D31533D|TTN_ENST00000342992.6_Silent_p.D28965D|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29892	Fibronectin type-III 118. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCTGCCTCCATCATACGCTG	0.498																																					p.D31533D		Atlas-SNP	.											.	TTN	18412	.	0			c.T94599C						PASS	.						60.0	61.0	61.0					2																	179411556		2069	4216	6285	SO:0001819	synonymous_variant	7273	exon341			GCCTCCATCATAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.89676T>C	chr2.hg19:g.179411556A>G		17.0	0.0	.		44.0	22.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.498	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SF3B1	23451	hgsc.bcm.edu	37	2	198269882	198269882	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:198269882G>C	ENST00000335508.6	-	11	1548	c.1457C>G	c.(1456-1458)aCa>aGa	p.T486R	SF3B1_ENST00000462613.1_5'Flank|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	486	Interaction with PPP1R8.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TGGACTAAGTGTTGATTCATC	0.289			Mis		myelodysplastic syndrome																																p.T486R		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	1038	.	0			c.C1457G						PASS	.						51.0	54.0	53.0					2																	198269882		2201	4295	6496	SO:0001583	missense	23451	exon11			CTAAGTGTTGATT	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1457C>G	chr2.hg19:g.198269882G>C	ENSP00000335321:p.Thr486Arg	29.0	0.0	.		42.0	4.0	.	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	hg19	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931911	0.52866	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.53334	0.1790	L	0.27053	0.805	0.80722	D	1	B	0.23806	0.091	B	0.23275	0.045	T	0.44817	-0.9303	9	0.35671	T	0.21	.	19.9254	0.97100	0.0:0.0:1.0:0.0	.	486	O75533	SF3B1_HUMAN	R	486	.	ENSP00000335321:T486R	T	-	2	0	SF3B1	197978127	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.721000	0.98766	2.710000	0.92621	0.655000	0.94253	ACA	.	.	.	none		0.289	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
SATB2	23314	hgsc.bcm.edu	37	2	200193570	200193570	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:200193570C>A	ENST00000417098.1	-	8	2053	c.1237G>T	c.(1237-1239)Gta>Tta	p.V413L	RP11-486F17.1_ENST00000489557.2_RNA|SATB2_ENST00000428695.1_Missense_Mutation_p.V295L|SATB2_ENST00000443023.1_Missense_Mutation_p.V354L|SATB2_ENST00000260926.5_Missense_Mutation_p.V413L|SATB2_ENST00000457245.1_Missense_Mutation_p.V413L	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	413					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTCAGGTTTACTAGAAGAGAC	0.488																																					p.V413L	Colon(30;262 767 11040 24421 36230)	Atlas-SNP	.											.	SATB2	134	.	0			c.G1237T						PASS	.						93.0	87.0	89.0					2																	200193570		2203	4300	6503	SO:0001583	missense	23314	exon9			GGTTTACTAGAAG	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1237G>T	chr2.hg19:g.200193570C>A	ENSP00000401112:p.Val413Leu	16.0	0.0	.		46.0	11.0	.	NM_015265	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	hg19	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	C	31	5.081487	0.94050	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.54675	0.58;0.59;0.58;0.56;0.58	4.98	4.98	0.66077	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.71273	0.3320	M	0.63428	1.95	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.87578	0.992;0.998	T	0.73030	-0.4111	10	0.66056	D	0.02	-10.9637	18.8143	0.92071	0.0:1.0:0.0:0.0	.	295;413	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	L	413;354;413;295;413	ENSP00000401112:V413L;ENSP00000388764:V354L;ENSP00000260926:V413L;ENSP00000388581:V295L;ENSP00000405420:V413L	ENSP00000260926:V413L	V	-	1	0	SATB2	199901815	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	7.609000	0.82925	2.747000	0.94245	0.650000	0.86243	GTA	.	.	.	none		0.488	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265	
NOP58	51602	hgsc.bcm.edu	37	2	203155146	203155146	+	Silent	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:203155146T>C	ENST00000264279.5	+	7	826	c.600T>C	c.(598-600)gaT>gaC	p.D200D	SNORD11_ENST00000459124.1_RNA|SNORD11B_ENST00000607707.1_RNA	NM_015934.3	NP_057018.1	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein	200					cell growth (GO:0016049)|rRNA processing (GO:0006364)|snRNP protein import into nucleus (GO:0006608)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(4)|prostate(2)	16						TTATTTCAGATAATTTAACAT	0.323																																					p.D200D		Atlas-SNP	.											.	NOP58	41	.	0			c.T600C						PASS	.						92.0	98.0	96.0					2																	203155146		2203	4299	6502	SO:0001819	synonymous_variant	51602	exon7			TTCAGATAATTTA		CCDS2353.1	2q33.1	2012-12-10	2012-12-10		ENSG00000055044	ENSG00000055044			29926	protein-coding gene	gene with protein product			"""NOP58 ribonucleoprotein homolog (yeast)"""			10606270, 10925205	Standard	NM_015934		Approved	NOP5, HSPC120	uc002uzb.3	Q9Y2X3	OTTHUMG00000132840	ENST00000264279.5:c.600T>C	chr2.hg19:g.203155146T>C		58.0	0.0	.		76.0	31.0	.	NM_015934	Q53SA4|Q6PK08|Q9P036|Q9UFN3	Silent	SNP	ENST00000264279.5	hg19	CCDS2353.1																																																																																			.	.	.	none		0.323	NOP58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256313.2	NM_015934	
CYP27A1	1593	hgsc.bcm.edu	37	2	219677361	219677361	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr2:219677361G>T	ENST00000258415.4	+	4	1160	c.733G>T	c.(733-735)Ggg>Tgg	p.G245W		NM_000784.3	NP_000775.1	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A, polypeptide 1	245					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cholestanetriol 26-monooxygenase activity (GO:0047749)|cholesterol 26-hydroxylase activity (GO:0031073)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(3)|urinary_tract(1)	26		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Chenodeoxycholic acid(DB06777)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Pegvisomant(DB00082)	CAGATCCATCGGGTTAATGTT	0.542																																					p.G245W		Atlas-SNP	.											CYP27A1,NS,malignant_melanoma,-1,1	CYP27A1	52	.	0			c.G733T						PASS	.						293.0	279.0	283.0					2																	219677361		2203	4300	6503	SO:0001583	missense	1593	exon4			TCCATCGGGTTAA	BC017044	CCDS2423.1	2q35	2013-09-19	2003-01-14		ENSG00000135929	ENSG00000135929		"""Cytochrome P450s"""	2605	protein-coding gene	gene with protein product	"""cerebrotendinous xanthomatosis"""	606530	"""cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1"""	CYP27		2019602	Standard	NM_000784		Approved	CTX, CP27	uc002viz.4	Q02318	OTTHUMG00000048238	ENST00000258415.4:c.733G>T	chr2.hg19:g.219677361G>T	ENSP00000258415:p.Gly245Trp	528.0	1.0	.		328.0	15.0	.	NM_000784	A8K303|Q6LDB4|Q86YQ6	Missense_Mutation	SNP	ENST00000258415.4	hg19	CCDS2423.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.046552	0.36085	.	.	ENSG00000135929	ENST00000258415;ENST00000411688	T;T	0.68624	-0.34;-0.34	6.15	5.26	0.73747	.	0.687740	0.15167	N	0.276843	T	0.80747	0.4682	M	0.80616	2.505	0.09310	N	1	D	0.76494	0.999	D	0.73708	0.981	T	0.71686	-0.4518	10	0.59425	D	0.04	-13.3933	9.5132	0.39089	0.0802:0.1812:0.7386:0.0	.	245	Q02318	CP27A_HUMAN	W	245;151	ENSP00000258415:G245W;ENSP00000392671:G151W	ENSP00000258415:G245W	G	+	1	0	CYP27A1	219385605	0.163000	0.22920	0.017000	0.16124	0.140000	0.21249	2.817000	0.48034	1.510000	0.48803	0.643000	0.83706	GGG	.	.	.	none		0.542	CYP27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109734.4		
MLH1	4292	hgsc.bcm.edu	37	3	37067255	37067255	+	Missense_Mutation	SNP	G	G	T	rs63750361	byFrequency	TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:37067255G>T	ENST00000231790.2	+	12	1382	c.1166G>T	c.(1165-1167)cGg>cTg	p.R389L	MLH1_ENST00000458205.2_Missense_Mutation_p.R148L|MLH1_ENST00000455445.2_Missense_Mutation_p.R148L|MLH1_ENST00000539477.1_Missense_Mutation_p.R148L|MLH1_ENST00000536378.1_Missense_Mutation_p.R148L|MLH1_ENST00000435176.1_Missense_Mutation_p.R291L	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	389					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						ACAGATTCCCGGGAACAGAAG	0.493		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.R389L		Atlas-SNP	.	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	MLH1	226	.	1	Whole gene deletion(1)	ovary(1)	c.G1166T	GRCh37	CM076299	MLH1	M	rs63750361	PASS	.						108.0	108.0	108.0					3																	37067255		2203	4300	6503	SO:0001583	missense	4292	exon12	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	ATTCCCGGGAACA	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.1166G>T	chr3.hg19:g.37067255G>T	ENSP00000231790:p.Arg389Leu	206.0	0.0	.		186.0	12.0	.	NM_000249	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	hg19	CCDS2663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.26|19.26	3.792596|3.792596	0.70452|0.70452	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000456676|ENST00000231790;ENST00000383761;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176;ENST00000536378	.|D;D;D;D;D;D	.|0.90133	.|-2.62;-2.62;-2.62;-2.62;-2.62;-2.62	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.066158	.|0.64402	.|D	.|0.000013	D|D	0.89227|0.89227	0.6655|0.6655	L|L	0.49350|0.49350	1.555|1.555	0.80722|0.80722	D|D	1|1	.|B;B;P;P;B;B	.|0.38565	.|0.114;0.065;0.511;0.637;0.052;0.052	.|B;B;B;B;B;B	.|0.38020	.|0.046;0.068;0.254;0.263;0.04;0.04	D|D	0.88671|0.88671	0.3195|0.3195	5|10	.|0.46703	.|T	.|0.11	-17.9936|-17.9936	19.7664|19.7664	0.96346|0.96346	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|291;291;148;148;389;389	.|E9PCU2;B4DQ11;B7Z821;B4DI13;Q53GX1;P40692	.|.;.;.;.;.;MLH1_HUMAN	W|L	381|389;253;148;148;148;291;148	.|ENSP00000231790:R389L;ENSP00000402667:R148L;ENSP00000443665:R148L;ENSP00000398272:R148L;ENSP00000402564:R291L;ENSP00000444286:R148L	.|ENSP00000231790:R389L	G|R	+|+	1|2	0|0	MLH1|MLH1	37042259|37042259	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.985000|0.985000	0.73830|0.73830	7.058000|7.058000	0.76676|0.76676	2.671000|2.671000	0.90904|0.90904	0.557000|0.557000	0.71058|0.71058	GGG|CGG	.	G|1.000;A|0.000	.	alt		0.493	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	
PBRM1	55193	hgsc.bcm.edu	37	3	52588791	52588791	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:52588791G>T	ENST00000296302.7	-	27	4559	c.4558C>A	c.(4558-4560)Ccc>Acc	p.P1520T	PBRM1_ENST00000410007.1_Missense_Mutation_p.P1440T|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000356770.4_Missense_Mutation_p.P1433T|PBRM1_ENST00000409114.3_Intron|RNU6-856P_ENST00000516959.1_RNA|PBRM1_ENST00000337303.4_Intron|PBRM1_ENST00000409767.1_Intron|PBRM1_ENST00000409057.1_Missense_Mutation_p.P1465T|PBRM1_ENST00000394830.3_Missense_Mutation_p.P1413T			Q86U86	PB1_HUMAN	polybromo 1	1520	Pro-rich.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGATGGTGGGGTGGAGGCCCC	0.582			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.P1413T		Atlas-SNP	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	0			c.C4237A						PASS	.						46.0	46.0	46.0					3																	52588791		2203	4300	6503	SO:0001583	missense	55193	exon27			GGTGGGGTGGAGG	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4558C>A	chr3.hg19:g.52588791G>T	ENSP00000296302:p.Pro1520Thr	47.0	0.0	.		39.0	19.0	.	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	hg19		.	.	.	.	.	.	.	.	.	.	G	15.23	2.771379	0.49680	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000409057;ENST00000410007	T;T;T;T;T	0.34859	1.35;1.34;1.39;1.35;1.35	5.75	5.75	0.90469	.	0.192124	0.47455	D	0.000227	T	0.21761	0.0524	N	0.08118	0	0.80722	D	1	B;B;B;B;B	0.32829	0.386;0.386;0.386;0.267;0.386	B;B;B;B;B	0.31101	0.124;0.124;0.124;0.058;0.086	T	0.08411	-1.0723	10	0.22706	T	0.39	-8.6684	18.1254	0.89584	0.0:0.0:1.0:0.0	.	1440;1413;1465;1520;1433	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86;Q86U86-3	.;.;.;PB1_HUMAN;.	T	1433;1413;1520;1465;1440	ENSP00000349213:P1433T;ENSP00000378307:P1413T;ENSP00000296302:P1520T;ENSP00000386593:P1465T;ENSP00000386529:P1440T	ENSP00000296302:P1520T	P	-	1	0	PBRM1	52563831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.959000	0.63666	2.696000	0.92011	0.655000	0.94253	CCC	.	.	.	none		0.582	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
CLDN18	51208	hgsc.bcm.edu	37	3	137742626	137742626	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:137742626A>T	ENST00000183605.5	+	2	573	c.347A>T	c.(346-348)aAc>aTc	p.N116I	CLDN18_ENST00000343735.4_Missense_Mutation_p.N116I	NM_016369.3	NP_057453.1	P56856	CLD18_HUMAN	claudin 18	116					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						GCCAAAGCCAACATGACACTG	0.502																																					p.N116I		Atlas-SNP	.											.	CLDN18	33	.	0			c.A347T						PASS	.						105.0	85.0	92.0					3																	137742626		2203	4300	6503	SO:0001583	missense	51208	exon2			AAGCCAACATGAC	AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000183605.5:c.347A>T	chr3.hg19:g.137742626A>T	ENSP00000183605:p.Asn116Ile	89.0	0.0	.		68.0	22.0	.	NM_016369	A5PL21|Q96PH4	Missense_Mutation	SNP	ENST00000183605.5	hg19	CCDS3095.1	.	.	.	.	.	.	.	.	.	.	A	15.24	2.774666	0.49786	.	.	ENSG00000066405	ENST00000343735;ENST00000183605;ENST00000536138	D;D	0.85773	-1.98;-2.03	5.43	4.25	0.50352	.	0.400442	0.26013	N	0.026870	T	0.79684	0.4488	L	0.31065	0.9	0.36035	D	0.839645	P;P	0.38250	0.487;0.624	B;B	0.41332	0.285;0.354	T	0.81972	-0.0688	10	0.48119	T	0.1	.	12.5759	0.56363	0.861:0.139:0.0:0.0	.	116;116	P56856;P56856-2	CLD18_HUMAN;.	I	116;116;105	ENSP00000340939:N116I;ENSP00000183605:N116I	ENSP00000183605:N116I	N	+	2	0	CLDN18	139225316	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.836000	0.55813	0.878000	0.35920	0.528000	0.53228	AAC	.	.	.	none		0.502	CLDN18-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357199.2	NM_001002026	
FNDC3B	64778	hgsc.bcm.edu	37	3	171965496	171965496	+	Silent	SNP	C	C	A	rs139712731		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:171965496C>A	ENST00000336824.4	+	5	537	c.438C>A	c.(436-438)acC>acA	p.T146T	FNDC3B_ENST00000416957.1_Silent_p.T146T|FNDC3B_ENST00000415807.2_Silent_p.T146T	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	146					cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		CACCTGTTACCGGACCTGGAG	0.502																																					p.T146T		Atlas-SNP	.											.	FNDC3B	118	.	0			c.C438A						PASS	.						208.0	182.0	191.0					3																	171965496		2203	4300	6503	SO:0001819	synonymous_variant	64778	exon5			TGTTACCGGACCT	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.438C>A	chr3.hg19:g.171965496C>A		168.0	0.0	.		145.0	8.0	.	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	ENST00000336824.4	hg19	CCDS3217.1																																																																																			.	C|0.999;T|0.001	.	alt		0.502	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
TMEM41A	90407	hgsc.bcm.edu	37	3	185209397	185209397	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr3:185209397T>A	ENST00000421852.1	-	5	818	c.723A>T	c.(721-723)aaA>aaT	p.K241N	TMEM41A_ENST00000475480.1_Intron|TMEM41A_ENST00000296254.3_3'UTR	NM_080652.3	NP_542383.1	Q96HV5	TM41A_HUMAN	transmembrane protein 41A	241						integral component of membrane (GO:0016021)				large_intestine(1)|lung(2)|skin(1)	4	all_cancers(143;7.78e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			TCTGACTAAATTTTTTAATGA	0.408																																					p.K241N		Atlas-SNP	.											.,1	TMEM41A	18	.	0			c.A723T						PASS	.						115.0	114.0	115.0					3																	185209397		2203	4300	6503	SO:0001583	missense	90407	exon5			ACTAAATTTTTTA	BC019884	CCDS3271.1	3q27.2	2006-04-12			ENSG00000163900	ENSG00000163900			30544	protein-coding gene	gene with protein product						12975309	Standard	NM_080652		Approved	MGC15397	uc003fpj.2	Q96HV5	OTTHUMG00000156660	ENST00000421852.1:c.723A>T	chr3.hg19:g.185209397T>A	ENSP00000406885:p.Lys241Asn	75.0	0.0	.		95.0	41.0	.	NM_080652	A8K4B3|D3DNU2|Q6ZMJ0	Missense_Mutation	SNP	ENST00000421852.1	hg19	CCDS3271.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.427515	0.43122	.	.	ENSG00000163900	ENST00000421852	.	.	.	6.08	-4.0	0.04057	.	0.341077	0.31772	N	0.007083	T	0.54078	0.1836	M	0.76574	2.34	0.80722	D	1	B	0.14805	0.011	B	0.17433	0.018	T	0.42916	-0.9423	9	0.29301	T	0.29	-18.9262	10.7523	0.46216	0.0:0.4413:0.0938:0.4649	.	241	Q96HV5	TM41A_HUMAN	N	241	.	ENSP00000406885:K241N	K	-	3	2	TMEM41A	186692091	0.000000	0.05858	0.846000	0.33378	0.988000	0.76386	-1.837000	0.01689	-0.284000	0.09102	0.533000	0.62120	AAA	.	.	.	none		0.408	TMEM41A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345174.1	NM_080652	
FGFR3	2261	hgsc.bcm.edu	37	4	1806088	1806088	+	Silent	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:1806088G>T	ENST00000260795.2	+	8	1209	c.1107G>T	c.(1105-1107)gcG>gcT	p.A369A	FGFR3_ENST00000340107.4_Silent_p.A371A|FGFR3_ENST00000481110.2_Silent_p.A369A|FGFR3_ENST00000440486.2_Silent_p.A369A|FGFR3_ENST00000352904.1_Intron|FGFR3_ENST00000412135.2_Intron			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	369					alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)	p.A369A(6)|p.A369_G370>VC(1)		NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	CTGACGAGGCGGGCAGTGTGT	0.692		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.A371A		Atlas-SNP	.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	FGFR3,bladder,carcinoma,0,6	FGFR3	3320	.	7	Substitution - coding silent(6)|Complex - compound substitution(1)	urinary_tract(7)	c.G1113T						PASS	.						129.0	125.0	126.0					4																	1806088		2203	4300	6503	SO:0001819	synonymous_variant	2261	exon9	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	CGAGGCGGGCAGT	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1107G>T	chr4.hg19:g.1806088G>T		289.0	0.0	.		166.0	8.0	.	NM_001163213	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Silent	SNP	ENST00000260795.2	hg19	CCDS3353.1																																																																																			.	.	.	none		0.692	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
SLC10A6	345274	hgsc.bcm.edu	37	4	87749228	87749228	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:87749228G>C	ENST00000273905.6	-	4	826	c.679C>G	c.(679-681)Ctg>Gtg	p.L227V	SLC10A6_ENST00000505535.1_Intron	NM_197965.2	NP_932069.1	Q3KNW5	SOAT_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 6	227					sodium-dependent organic anion transport (GO:0043251)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)|sodium-dependent organic anion transmembrane transporter activity (GO:0043250)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	9		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		CTGATGGTCAGAAGGGTGATG	0.498																																					p.L227V		Atlas-SNP	.											.	SLC10A6	40	.	0			c.C679G						PASS	.						89.0	81.0	84.0					4																	87749228		2203	4300	6503	SO:0001583	missense	345274	exon4			TGGTCAGAAGGGT	AJ583502	CCDS3614.1	4q22.1	2013-07-18	2013-07-18		ENSG00000145283	ENSG00000145283		"""Solute carriers"""	30603	protein-coding gene	gene with protein product		613366				15020217, 17491011	Standard	NM_197965		Approved	SOAT	uc003hqd.2	Q3KNW5	OTTHUMG00000130596	ENST00000273905.6:c.679C>G	chr4.hg19:g.87749228G>C	ENSP00000273905:p.Leu227Val	55.0	0.0	.		45.0	16.0	.	NM_197965	Q70EX7	Missense_Mutation	SNP	ENST00000273905.6	hg19	CCDS3614.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010693	0.35511	.	.	ENSG00000145283	ENST00000273905	T	0.78816	-1.21	5.28	3.48	0.39840	.	0.167902	0.30320	N	0.009895	T	0.67477	0.2897	L	0.54323	1.7	0.28830	N	0.897216	P	0.42357	0.777	B	0.39339	0.297	T	0.66118	-0.6003	10	0.49607	T	0.09	-15.0839	4.1624	0.10291	0.1683:0.0:0.6333:0.1984	.	227	Q3KNW5	SOAT_HUMAN	V	227	ENSP00000273905:L227V	ENSP00000273905:L227V	L	-	1	2	SLC10A6	87968252	0.998000	0.40836	0.998000	0.56505	0.705000	0.40729	1.536000	0.36072	2.736000	0.93811	0.655000	0.94253	CTG	.	.	.	none		0.498	SLC10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253043.2	NM_197965	
CAMK2D	817	hgsc.bcm.edu	37	4	114434488	114434488	+	Silent	SNP	G	G	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:114434488G>A	ENST00000342666.5	-	12	941	c.942C>T	c.(940-942)ttC>ttT	p.F314F	CAMK2D_ENST00000418639.2_Silent_p.F314F|CAMK2D_ENST00000505990.1_Silent_p.F314F|CAMK2D_ENST00000429180.1_Silent_p.F314F|CAMK2D_ENST00000511664.1_Silent_p.F314F|CAMK2D_ENST00000514328.1_Silent_p.F314F|CAMK2D_ENST00000394524.3_Silent_p.F314F|CAMK2D_ENST00000296402.5_Silent_p.F314F|CAMK2D_ENST00000508738.1_Silent_p.F314F|CAMK2D_ENST00000454265.2_Silent_p.F314F|CAMK2D_ENST00000379773.2_Silent_p.F314F|CAMK2D_ENST00000394522.3_Silent_p.F314F|CAMK2D_ENST00000394526.2_Silent_p.F314F|CAMK2D_ENST00000515496.1_Silent_p.F314F			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	314					calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		ATGTACCTGAGAAATTCCTTG	0.358																																					p.F314F		Atlas-SNP	.											.	CAMK2D	55	.	0			c.C942T						PASS	.						94.0	93.0	93.0					4																	114434488		2203	4300	6503	SO:0001819	synonymous_variant	817	exon12			ACCTGAGAAATTC	U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.942C>T	chr4.hg19:g.114434488G>A		84.0	0.0	.		113.0	42.0	.	NM_172128	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Silent	SNP	ENST00000342666.5	hg19	CCDS3703.1	.	.	.	.	.	.	.	.	.	.	G	7.680	0.688715	0.14973	.	.	ENSG00000145349	ENST00000513132	.	.	.	5.36	-2.88	0.05682	.	.	.	.	.	T	0.51839	0.1698	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48031	-0.9070	4	.	.	.	.	8.2973	0.31993	0.2489:0.0:0.6045:0.1466	.	.	.	.	F	18	.	.	L	-	1	0	CAMK2D	114653937	1.000000	0.71417	0.988000	0.46212	0.671000	0.39405	2.348000	0.44045	-0.497000	0.06641	-1.284000	0.01376	CTC	.	.	.	none		0.358	CAMK2D-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256420.2		
NPY1R	4886	hgsc.bcm.edu	37	4	164246582	164246582	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:164246582C>A	ENST00000296533.2	-	3	1559	c.1028G>T	c.(1027-1029)cGg>cTg	p.R343L	NPY1R_ENST00000509586.1_Missense_Mutation_p.R100L	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	343					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)	p.R343L(1)		breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ATCATCATCCCGAGACCGGAA	0.398																																					p.R343L		Atlas-SNP	.											.	NPY1R	72	.	1	Substitution - Missense(1)	lung(1)	c.G1028T						PASS	.						140.0	147.0	144.0					4																	164246582		2203	4300	6503	SO:0001583	missense	4886	exon3			TCATCCCGAGACC		CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.1028G>T	chr4.hg19:g.164246582C>A	ENSP00000354652:p.Arg343Leu	113.0	0.0	.		188.0	8.0	.	NM_000909	B2R6H5	Missense_Mutation	SNP	ENST00000296533.2	hg19	CCDS34089.1	.	.	.	.	.	.	.	.	.	.	C	9.774	1.173580	0.21704	.	.	ENSG00000164128	ENST00000296533;ENST00000509586	T;T	0.36878	1.23;1.23	5.48	4.64	0.57946	.	0.258733	0.30859	N	0.008736	T	0.27798	0.0684	L	0.31926	0.97	0.46774	D	0.99919	B	0.27229	0.172	B	0.19391	0.025	T	0.03555	-1.1025	10	0.28530	T	0.3	.	14.4236	0.67200	0.0:0.9289:0.0:0.0711	.	343	P25929	NPY1R_HUMAN	L	343;100	ENSP00000354652:R343L;ENSP00000427284:R100L	ENSP00000354652:R343L	R	-	2	0	NPY1R	164466032	0.986000	0.35501	1.000000	0.80357	0.998000	0.95712	2.261000	0.43276	1.309000	0.44985	0.655000	0.94253	CGG	.	.	.	none		0.398	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364685.1		
TLR3	7098	hgsc.bcm.edu	37	4	187004092	187004092	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:187004092A>C	ENST00000296795.3	+	4	1356	c.1252A>C	c.(1252-1254)Aaa>Caa	p.K418Q	TLR3_ENST00000504367.1_Missense_Mutation_p.K141Q	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	418					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		AACCAAGAATAAAATCTCAAA	0.403																																					p.K418Q		Atlas-SNP	.											.	TLR3	83	.	0			c.A1252C						PASS	.						60.0	56.0	57.0					4																	187004092		2203	4299	6502	SO:0001583	missense	7098	exon4			AAGAATAAAATCT	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1252A>C	chr4.hg19:g.187004092A>C	ENSP00000296795:p.Lys418Gln	62.0	0.0	.		79.0	26.0	.	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	ENST00000296795.3	hg19	CCDS3846.1	.	.	.	.	.	.	.	.	.	.	A	12.05	1.822070	0.32237	.	.	ENSG00000164342	ENST00000296795;ENST00000542020;ENST00000504367	T;T	0.59083	0.29;0.29	5.78	4.59	0.56863	.	0.253731	0.46145	D	0.000313	T	0.42539	0.1207	L	0.31207	0.915	0.25382	N	0.988604	B	0.24823	0.112	B	0.29176	0.099	T	0.31998	-0.9923	10	0.37606	T	0.19	.	5.6089	0.17394	0.7025:0.1541:0.1434:0.0	.	418	O15455	TLR3_HUMAN	Q	418;418;141	ENSP00000296795:K418Q;ENSP00000423684:K141Q	ENSP00000296795:K418Q	K	+	1	0	TLR3	187241086	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.225000	0.58600	0.999000	0.39023	0.455000	0.32223	AAA	.	.	.	none		0.403	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
ZFR	51663	hgsc.bcm.edu	37	5	32403408	32403408	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr5:32403408G>A	ENST00000265069.8	-	8	1421	c.1319C>T	c.(1318-1320)tCa>tTa	p.S440L		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	440					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		AGTCGGCTTTGAAGCAGATAC	0.418																																					p.S440L		Atlas-SNP	.											.	ZFR	98	.	0			c.C1319T						PASS	.						188.0	171.0	177.0					5																	32403408		2203	4300	6503	SO:0001583	missense	51663	exon8			GGCTTTGAAGCAG	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.1319C>T	chr5.hg19:g.32403408G>A	ENSP00000265069:p.Ser440Leu	102.0	0.0	.		160.0	70.0	.	NM_016107	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	hg19	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934133	0.73442	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.05925	3.37	5.95	5.95	0.96441	.	0.316034	0.39210	N	0.001439	T	0.09555	0.0235	L	0.43152	1.355	0.58432	D	0.999997	B	0.26935	0.164	B	0.21917	0.037	T	0.08207	-1.0733	10	0.72032	D	0.01	.	20.3719	0.98893	0.0:0.0:1.0:0.0	.	440	Q96KR1	ZFR_HUMAN	L	440;418	ENSP00000265069:S440L	ENSP00000265069:S440L	S	-	2	0	ZFR	32439165	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.494000	0.81503	2.826000	0.97356	0.491000	0.48974	TCA	.	.	.	none		0.418	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
PIK3R1	5295	hgsc.bcm.edu	37	5	67576767	67576767	+	Silent	SNP	T	T	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr5:67576767T>G	ENST00000521381.1	+	7	1465	c.849T>G	c.(847-849)acT>acG	p.T283T	PIK3R1_ENST00000274335.5_Silent_p.T283T|PIK3R1_ENST00000521657.1_Silent_p.T283T|PIK3R1_ENST00000396611.1_Silent_p.T283T	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	283	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	CTGATAATACTGAAAACCTCA	0.328			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.T283T		Atlas-SNP	.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1	869	.	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	c.T849G						PASS	.						53.0	58.0	57.0					5																	67576767		2203	4299	6502	SO:0001819	synonymous_variant	5295	exon7			TAATACTGAAAAC	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.849T>G	chr5.hg19:g.67576767T>G		41.0	0.0	.		61.0	18.0	.	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Silent	SNP	ENST00000521381.1	hg19	CCDS3993.1																																																																																			.	.	.	none		0.328	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
PAPD4	167153	hgsc.bcm.edu	37	5	78975410	78975410	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr5:78975410G>C	ENST00000296783.3	+	14	1516	c.1217G>C	c.(1216-1218)aGt>aCt	p.S406T	PAPD4_ENST00000428308.2_Missense_Mutation_p.S406T|PAPD4_ENST00000453514.1_Missense_Mutation_p.S406T|PAPD4_ENST00000504233.1_Missense_Mutation_p.S363T|PAPD4_ENST00000423041.2_Missense_Mutation_p.S402T			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	406	PAP-associated.				hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)			biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		AGCTGGAATAGTCAAATGATT	0.323																																					p.S406T		Atlas-SNP	.											.	PAPD4	51	.	0			c.G1217C						PASS	.						106.0	99.0	102.0					5																	78975410		2203	4300	6503	SO:0001583	missense	167153	exon14			GGAATAGTCAAAT	AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.1217G>C	chr5.hg19:g.78975410G>C	ENSP00000296783:p.Ser406Thr	57.0	0.0	.		73.0	33.0	.	NM_173797	Q86WZ2|Q8N927	Missense_Mutation	SNP	ENST00000296783.3	hg19	CCDS4048.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653395	0.29425	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000504233;ENST00000428308;ENST00000296783	T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97	6.06	4.2	0.49525	PAP/25A-associated (1);	0.512215	0.23215	N	0.050628	T	0.50701	0.1631	N	0.08118	0	0.22982	N	0.998471	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.33954	-0.9848	10	0.30854	T	0.27	-6.8279	7.1177	0.25427	0.1866:0.1805:0.6329:0.0	.	406;402;363	Q6PIY7;Q6PIY7-2;D6RAF2	GLD2_HUMAN;.;.	T	406;402;363;406;406	ENSP00000397563:S406T;ENSP00000393412:S402T;ENSP00000421966:S363T;ENSP00000396861:S406T;ENSP00000296783:S406T	ENSP00000296783:S406T	S	+	2	0	PAPD4	79011166	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.626000	0.37039	1.428000	0.47296	0.655000	0.94253	AGT	.	.	.	none		0.323	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226967.1	NM_173797	
NELFE	7936	hgsc.bcm.edu	37	6	31922209	31922209	+	Silent	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr6:31922209T>C	ENST00000375429.3	-	8	979	c.753A>G	c.(751-753)tcA>tcG	p.S251S	NELFE_ENST00000375425.5_Silent_p.S258S|MIR1236_ENST00000408340.1_RNA|NELFE_ENST00000444811.2_Silent_p.S221S	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	251					gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										GTTCAGGGAATGAATCCGACC	0.483																																					p.S251S		Atlas-SNP	.											.	.	.	.	0			c.A753G						PASS	.						96.0	90.0	92.0					6																	31922209		2203	4300	6503	SO:0001819	synonymous_variant	7936	exon8			AGGGAATGAATCC	M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.753A>G	chr6.hg19:g.31922209T>C		109.0	0.0	.		88.0	30.0	.	NM_002904	A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Silent	SNP	ENST00000375429.3	hg19	CCDS4730.1																																																																																			.	.	.	none		0.483	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076047.4		
EYS	346007	hgsc.bcm.edu	37	6	66204808	66204808	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr6:66204808T>G	ENST00000370621.3	-	4	1022	c.496A>C	c.(496-498)Aat>Cat	p.N166H	EYS_ENST00000503581.1_Missense_Mutation_p.N166H|EYS_ENST00000393380.2_Missense_Mutation_p.N166H|EYS_ENST00000342421.5_Missense_Mutation_p.N166H|EYS_ENST00000370616.2_Missense_Mutation_p.N166H|EYS_ENST00000370618.3_Missense_Mutation_p.N166H			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	166					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ACTGTCACATTTAGTCGAAGT	0.423																																					p.N166H		Atlas-SNP	.											.	EYS	527	.	0			c.A496C						PASS	.						72.0	64.0	66.0					6																	66204808		2203	4300	6503	SO:0001583	missense	346007	exon4			TCACATTTAGTCG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.496A>C	chr6.hg19:g.66204808T>G	ENSP00000359655:p.Asn166His	54.0	0.0	.		97.0	32.0	.	NM_001142801	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	T	16.65	3.181420	0.57800	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	4.54	3.34	0.38264	.	.	.	.	.	T	0.69824	0.3154	N	0.08118	0	0.21020	N	0.99981	P;P;P	0.49862	0.844;0.929;0.884	B;P;P	0.48030	0.383;0.564;0.51	T	0.64588	-0.6372	9	0.45353	T	0.12	.	9.2337	0.37453	0.0:0.0:0.1827:0.8173	.	166;166;166	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	H	166	ENSP00000424243:N166H;ENSP00000359655:N166H;ENSP00000359650:N166H;ENSP00000377042:N166H;ENSP00000341818:N166H;ENSP00000359652:N166H	ENSP00000341818:N166H	N	-	1	0	EYS	66261529	0.997000	0.39634	0.962000	0.40283	0.996000	0.88848	2.828000	0.48120	0.667000	0.31107	0.482000	0.46254	AAT	.	.	.	none		0.423	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
ETV1	2115	hgsc.bcm.edu	37	7	13971323	13971323	+	Silent	SNP	C	C	G	rs531769320	byFrequency	TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr7:13971323C>G	ENST00000430479.1	-	9	1273	c.606G>C	c.(604-606)acG>acC	p.T202T	ETV1_ENST00000403685.1_Silent_p.T184T|ETV1_ENST00000420159.2_Silent_p.T144T|ETV1_ENST00000405358.4_Silent_p.T216T|ETV1_ENST00000405218.2_Silent_p.T202T|ETV1_ENST00000405192.2_Silent_p.T202T|ETV1_ENST00000403527.1_Silent_p.T162T|ETV1_ENST00000399357.3_Silent_p.T99T|ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000242066.5_Silent_p.T184T|ETV1_ENST00000343495.5_Silent_p.T184T	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	202					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						CCCTTGGCATCGTCGGCAAAG	0.502			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																p.T202T		Atlas-SNP	.		Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	.	ETV1	138	.	0			c.G606C						PASS	.						116.0	112.0	113.0					7																	13971323		2010	4169	6179	SO:0001819	synonymous_variant	2115	exon9			TGGCATCGTCGGC		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.606G>C	chr7.hg19:g.13971323C>G		46.0	0.0	.		45.0	17.0	.	NM_004956	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Silent	SNP	ENST00000430479.1	hg19	CCDS55088.1																																																																																			.	.	.	none		0.502	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956	
SUN3	256979	hgsc.bcm.edu	37	7	48035693	48035693	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr7:48035693C>T	ENST00000297325.4	-	7	787	c.628G>A	c.(628-630)Gca>Aca	p.A210T	SUN3_ENST00000453192.2_Missense_Mutation_p.A198T|SUN3_ENST00000412142.1_Missense_Mutation_p.A110T|SUN3_ENST00000395572.2_Missense_Mutation_p.A210T|SUN3_ENST00000473723.1_5'UTR	NM_001030019.1	NP_001025190.1	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 3	210	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.					integral component of membrane (GO:0016021)|SUN-KASH complex (GO:0034993)				central_nervous_system(1)|endometrium(3)|large_intestine(8)|liver(1)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TACAATTTTGCTTTATTATTT	0.299																																					p.A210T		Atlas-SNP	.											.	SUN3	52	.	0			c.G628A						PASS	.						82.0	87.0	85.0					7																	48035693		2203	4288	6491	SO:0001583	missense	256979	exon8			ATTTTGCTTTATT	AF429967	CCDS34636.1, CCDS64647.1	7p12.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164744	ENSG00000164744			22429	protein-coding gene	gene with protein product			"""Sad1 and UNC84 domain containing 1"""	SUNC1			Standard	NM_001284350		Approved	MGC33329	uc003tof.3	Q8TAQ9	OTTHUMG00000155646	ENST00000297325.4:c.628G>A	chr7.hg19:g.48035693C>T	ENSP00000297325:p.Ala210Thr	115.0	0.0	.		126.0	40.0	.	NM_152782	A4D2F3|B4DXK1|D3DVM3|E7EWC8|Q4F965|Q7Z4U8	Missense_Mutation	SNP	ENST00000297325.4	hg19	CCDS34636.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484372	0.44147	.	.	ENSG00000164744	ENST00000297325;ENST00000412371;ENST00000412142;ENST00000395572;ENST00000453192;ENST00000438771	T;T;T;T;T;T	0.46063	1.83;0.88;1.84;1.83;2.42;1.84	5.25	4.37	0.52481	Sad1/UNC-like, C-terminal (1);	0.236128	0.42548	N	0.000694	T	0.35537	0.0935	L	0.49350	1.555	0.34170	D	0.669671	B;B;B	0.31503	0.047;0.326;0.192	B;B;B	0.28465	0.019;0.09;0.065	T	0.52873	-0.8517	10	0.87932	D	0	.	9.6842	0.40089	0.0:0.9039:0.0:0.0961	.	198;110;210	E7EWC8;Q8TAQ9-2;Q8TAQ9	.;.;SUN3_HUMAN	T	210;32;110;210;198;110	ENSP00000297325:A210T;ENSP00000406887:A32T;ENSP00000410204:A110T;ENSP00000378939:A210T;ENSP00000387525:A198T;ENSP00000409077:A110T	ENSP00000297325:A210T	A	-	1	0	SUN3	48002218	0.937000	0.31787	0.973000	0.42090	0.803000	0.45373	1.417000	0.34770	1.244000	0.43870	0.650000	0.86243	GCA	.	.	.	none		0.299	SUN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340962.1	NM_152782	
PEX1	5189	hgsc.bcm.edu	37	7	92151473	92151473	+	Silent	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr7:92151473A>G	ENST00000248633.4	-	2	311	c.216T>C	c.(214-216)aaT>aaC	p.N72N	PEX1_ENST00000428214.1_Silent_p.N72N|PEX1_ENST00000438045.1_Silent_p.N72N	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	72					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TTTCAGCCACATTTTCACCTT	0.408																																					p.N72N		Atlas-SNP	.											.	PEX1	102	.	0			c.T216C						PASS	.						130.0	121.0	124.0					7																	92151473		2203	4300	6503	SO:0001819	synonymous_variant	5189	exon2			AGCCACATTTTCA	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.216T>C	chr7.hg19:g.92151473A>G		90.0	0.0	.		130.0	55.0	.	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Silent	SNP	ENST00000248633.4	hg19	CCDS5627.1																																																																																			.	.	.	none		0.408	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
TUSC3	7991	hgsc.bcm.edu	37	8	15508312	15508312	+	Missense_Mutation	SNP	G	G	A	rs371225890		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr8:15508312G>A	ENST00000503731.1	+	3	563	c.415G>A	c.(415-417)Gtt>Att	p.V139I	TUSC3_ENST00000506802.1_Missense_Mutation_p.V139I|TUSC3_ENST00000503191.1_Intron|TUSC3_ENST00000382020.4_Missense_Mutation_p.V139I|TUSC3_ENST00000509380.1_Missense_Mutation_p.V139I	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	139	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		GGGGACAGACGTTTTTCAGCA	0.343																																					p.V139I		Atlas-SNP	.											.	TUSC3	98	.	0			c.G415A						PASS	.	G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	239.0	237.0	238.0		415,415	3.7	1.0	8		238	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	TUSC3	NM_006765.3,NM_178234.2	29,29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign	139/349,139/348	15508312	2,13004	2203	4300	6503	SO:0001583	missense	7991	exon3			ACAGACGTTTTTC	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.415G>A	chr8.hg19:g.15508312G>A	ENSP00000424544:p.Val139Ile	163.0	0.0	.		222.0	96.0	.	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	hg19	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809796	0.70797	0.0	2.33E-4	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.47	3.67	0.42095	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.162707	0.53938	N	0.000046	T	0.55893	0.1949	M	0.66297	2.02	0.44323	D	0.997205	D;D;D;D;D;B	0.65815	0.971;0.995;0.981;0.977;0.995;0.004	P;P;D;P;P;B	0.65010	0.838;0.771;0.931;0.613;0.784;0.007	T	0.51411	-0.8709	10	0.27082	T	0.32	-11.5841	10.6624	0.45710	0.0719:0.1325:0.7956:0.0	.	139;139;139;139;139;139	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	I	139	ENSP00000371450:V139I;ENSP00000425777:V139I;ENSP00000423426:V139I;ENSP00000424544:V139I	ENSP00000221167:V139I	V	+	1	0	TUSC3	15552683	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	7.654000	0.83653	0.780000	0.33566	0.563000	0.77884	GTT	.	.	.	weak		0.343	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
PSD3	23362	hgsc.bcm.edu	37	8	18430149	18430149	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr8:18430149T>A	ENST00000327040.8	-	14	2775	c.2673A>T	c.(2671-2673)aaA>aaT	p.K891N	PSD3_ENST00000523619.1_Missense_Mutation_p.K826N|PSD3_ENST00000428502.2_Missense_Mutation_p.K220N|PSD3_ENST00000286485.8_Missense_Mutation_p.K357N|PSD3_ENST00000440756.2_Missense_Mutation_p.K893N	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	892	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CACAATTGATTTTGTTTATCC	0.433																																					p.K891N		Atlas-SNP	.											.	PSD3	142	.	0			c.A2673T						PASS	.						167.0	173.0	171.0					8																	18430149		2203	4300	6503	SO:0001583	missense	23362	exon14			ATTGATTTTGTTT	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.2673A>T	chr8.hg19:g.18430149T>A	ENSP00000324127:p.Lys891Asn	115.0	0.0	.		225.0	73.0	.	NM_015310	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	ENST00000327040.8	hg19	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	T	17.96	3.516949	0.64634	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000286485;ENST00000428502;ENST00000523619	T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26	5.71	2.04	0.26737	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.683311	0.11566	U	0.551222	T	0.74711	0.3752	L	0.48174	1.505	0.39428	D	0.967023	B;B;B;P	0.37688	0.423;0.423;0.048;0.605	P;P;B;B	0.45946	0.498;0.498;0.061;0.388	T	0.69647	-0.5089	10	0.72032	D	0.01	.	4.8511	0.13537	0.0:0.2364:0.1485:0.615	.	891;892;357;220	E9KL50;Q9NYI0;Q9NYI0-3;B4DKF8	.;PSD3_HUMAN;.;.	N	891;893;357;220;826	ENSP00000324127:K891N;ENSP00000401704:K893N;ENSP00000286485:K357N;ENSP00000393228:K220N;ENSP00000430640:K826N	ENSP00000286485:K357N	K	-	3	2	PSD3	18474429	0.972000	0.33761	0.998000	0.56505	0.918000	0.54935	0.105000	0.15333	0.177000	0.19895	-0.297000	0.09499	AAA	.	.	.	none		0.433	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310	
ZNF395	55893	hgsc.bcm.edu	37	8	28206721	28206721	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr8:28206721T>C	ENST00000344423.5	-	9	1482	c.1351A>G	c.(1351-1353)Agc>Ggc	p.S451G	ZNF395_ENST00000523202.1_Missense_Mutation_p.S451G|ZNF395_ENST00000523095.1_Missense_Mutation_p.S451G	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	451					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		TGGGGCTCGCTGAAGCTTAGC	0.617																																					p.S451G		Atlas-SNP	.											.	ZNF395	54	.	0			c.A1351G						PASS	.						75.0	79.0	78.0					8																	28206721		2203	4300	6503	SO:0001583	missense	55893	exon9			GCTCGCTGAAGCT	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1351A>G	chr8.hg19:g.28206721T>C	ENSP00000340494:p.Ser451Gly	110.0	0.0	.		70.0	22.0	.	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	ENST00000344423.5	hg19	CCDS6067.1	.	.	.	.	.	.	.	.	.	.	T	11.12	1.544128	0.27563	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	T;T;T	0.46063	0.88;0.88;0.88	5.5	4.27	0.50696	.	0.318422	0.40908	D	0.001000	T	0.19046	0.0457	N	0.05487	-0.04	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.09335	-1.0679	10	0.09338	T	0.73	-15.6215	8.8687	0.35303	0.0:0.0:0.189:0.811	.	451	Q9H8N7	ZN395_HUMAN	G	451	ENSP00000340494:S451G;ENSP00000429640:S451G;ENSP00000428452:S451G	ENSP00000340494:S451G	S	-	1	0	ZNF395	28262640	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.178000	0.50879	2.099000	0.63709	0.459000	0.35465	AGC	.	.	.	none		0.617	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
ARID3C	138715	hgsc.bcm.edu	37	9	34622092	34622092	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr9:34622092C>T	ENST00000378909.2	-	6	1155	c.1063G>A	c.(1063-1065)Ggg>Agg	p.G355R	DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000477738.2_5'Flank|DCTN3_ENST00000341694.2_5'Flank|DCTN3_ENST00000259632.7_5'Flank|DCTN3_ENST00000378913.2_5'Flank|DCTN3_ENST00000447983.2_5'Flank	NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	355	Pro-rich.|REKLES. {ECO:0000255|PROSITE- ProRule:PRU00819}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		TTAAGAGGCCCATCCAGCCGC	0.517																																					p.G355R		Atlas-SNP	.											.	ARID3C	33	.	0			c.G1063A						PASS	.						91.0	84.0	87.0					9																	34622092		2203	4300	6503	SO:0001583	missense	138715	exon6			GAGGCCCATCCAG		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.1063G>A	chr9.hg19:g.34622092C>T	ENSP00000368189:p.Gly355Arg	184.0	0.0	.		130.0	44.0	.	NM_001017363		Missense_Mutation	SNP	ENST00000378909.2	hg19	CCDS35006.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.335039	0.41398	.	.	ENSG00000205143	ENST00000378909	T	0.41065	1.01	5.03	5.03	0.67393	REKLES domain (1);	0.000000	0.47093	D	0.000254	T	0.35856	0.0946	L	0.51422	1.61	0.29866	N	0.827257	P	0.39831	0.69	B	0.35727	0.209	T	0.32481	-0.9905	10	0.17369	T	0.5	-15.5988	15.9067	0.79436	0.0:1.0:0.0:0.0	.	355	A6NKF2	ARI3C_HUMAN	R	355	ENSP00000368189:G355R	ENSP00000368189:G355R	G	-	1	0	ARID3C	34612092	0.960000	0.32886	1.000000	0.80357	0.988000	0.76386	1.491000	0.35583	2.612000	0.88384	0.549000	0.68633	GGG	.	.	.	none		0.517	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	XM_071061	
RUSC2	9853	hgsc.bcm.edu	37	9	35547391	35547391	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr9:35547391G>C	ENST00000455600.1	+	2	1442	c.873G>C	c.(871-873)atG>atC	p.M291I		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	291						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			ACAACAAGATGCATGGCACCC	0.582																																					p.M291I		Atlas-SNP	.											.	RUSC2	88	.	0			c.G873C						PASS	.						79.0	70.0	73.0					9																	35547391		2203	4300	6503	SO:0001583	missense	9853	exon2			CAAGATGCATGGC	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.873G>C	chr9.hg19:g.35547391G>C	ENSP00000393922:p.Met291Ile	150.0	0.0	.		93.0	31.0	.	NM_014806	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	hg19	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339018	0.41398	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	T;T	0.28069	1.63;1.63	5.61	5.61	0.85477	.	0.089636	0.85682	D	0.000000	T	0.28167	0.0695	L	0.29908	0.895	0.42729	D	0.993703	B	0.24258	0.1	B	0.24541	0.054	T	0.05338	-1.0891	10	0.62326	D	0.03	-8.6538	18.6114	0.91286	0.0:0.0:1.0:0.0	.	291	Q8N2Y8	RUSC2_HUMAN	I	291	ENSP00000355177:M291I;ENSP00000393922:M291I	ENSP00000355177:M291I	M	+	3	0	RUSC2	35537391	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.341000	0.79300	2.649000	0.89929	0.561000	0.74099	ATG	.	.	.	none		0.582	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
NANS	54187	hgsc.bcm.edu	37	9	100840514	100840514	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr9:100840514A>G	ENST00000210444.5	+	4	558	c.488A>G	c.(487-489)gAc>gGc	p.D163G	TRIM14_ENST00000375098.3_Intron|NANS_ENST00000461452.1_3'UTR|TRIM14_ENST00000478530.1_5'Flank	NM_018946.3	NP_061819.2	Q9NR45	SIAS_HUMAN	N-acetylneuraminic acid synthase	163					lipopolysaccharide biosynthetic process (GO:0009103)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	N-acetylneuraminate synthase activity (GO:0050462)|N-acylneuraminate cytidylyltransferase activity (GO:0008781)|N-acylneuraminate-9-phosphate synthase activity (GO:0047444)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	11		Acute lymphoblastic leukemia(62;0.0559)				CAGTCAATGGACACCATGAAG	0.522																																					p.D163G		Atlas-SNP	.											.	NANS	24	.	0			c.A488G						PASS	.						229.0	181.0	197.0					9																	100840514		2203	4300	6503	SO:0001583	missense	54187	exon4			CAATGGACACCAT	AF161387	CCDS6733.1	9p24.1-p23	2008-07-31	2008-07-31		ENSG00000095380	ENSG00000095380			19237	protein-coding gene	gene with protein product	"""sialic acid synthase"""	605202				10749855	Standard	NM_018946		Approved	SAS	uc004ayc.3	Q9NR45	OTTHUMG00000020341	ENST00000210444.5:c.488A>G	chr9.hg19:g.100840514A>G	ENSP00000210444:p.Asp163Gly	167.0	0.0	.		127.0	47.0	.	NM_018946	B2RE98|Q8WUV9|Q9BWS6|Q9NVD4	Missense_Mutation	SNP	ENST00000210444.5	hg19	CCDS6733.1	.	.	.	.	.	.	.	.	.	.	A	10.92	1.487927	0.26686	.	.	ENSG00000095380	ENST00000210444;ENST00000415280	T;T	0.42900	0.96;0.96	5.32	1.49	0.22878	Aldolase-type TIM barrel (1);N-acetylneuraminic acid synthase, N-terminal (1);	0.346769	0.36167	N	0.002757	T	0.16896	0.0406	N	0.02103	-0.685	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.05370	-1.0889	10	0.24483	T	0.36	-13.5844	11.9513	0.52956	0.5778:0.4222:0.0:0.0	.	163	Q9NR45	SIAS_HUMAN	G	163;22	ENSP00000210444:D163G;ENSP00000404107:D22G	ENSP00000210444:D163G	D	+	2	0	NANS	99880335	1.000000	0.71417	0.993000	0.49108	0.969000	0.65631	2.784000	0.47774	0.070000	0.16634	-1.293000	0.01348	GAC	.	.	.	none		0.522	NANS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053359.1	NM_018946	
NR6A1	2649	hgsc.bcm.edu	37	9	127316717	127316717	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr9:127316717C>A	ENST00000487099.2	-	3	432	c.275G>T	c.(274-276)cGg>cTg	p.R92L	NR6A1_ENST00000373584.3_Missense_Mutation_p.R88L|NR6A1_ENST00000344523.4_Missense_Mutation_p.R92L|NR6A1_ENST00000416460.2_Missense_Mutation_p.R88L	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	92					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						TCGATATACCCGTTTGTTGCA	0.532																																					p.R92L	Esophageal Squamous(192;272 2884 6208 20560)	Atlas-SNP	.											.	NR6A1	38	.	0			c.G275T						PASS	.						158.0	135.0	143.0					9																	127316717		2203	4300	6503	SO:0001583	missense	2649	exon3			TATACCCGTTTGT	U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.275G>T	chr9.hg19:g.127316717C>A	ENSP00000420267:p.Arg92Leu	107.0	0.0	.		135.0	7.0	.	NM_033334	O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Missense_Mutation	SNP	ENST00000487099.2	hg19	CCDS35137.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.295326	0.81025	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523;ENST00000475178	D;D;D;D;D	0.95918	-3.85;-3.85;-3.85;-3.85;-3.85	5.66	5.66	0.87406	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.94588	0.8256	N	0.12887	0.27	0.80722	D	1	D;D;D	0.89917	1.0;0.986;1.0	D;D;D	0.97110	1.0;0.96;0.998	D	0.92193	0.5761	10	0.13108	T	0.6	.	18.751	0.91814	0.0:1.0:0.0:0.0	.	88;92;88	F1DAM1;Q15406;Q15406-5	.;NR6A1_HUMAN;.	L	92;88;88;92;50	ENSP00000420267:R92L;ENSP00000362686:R88L;ENSP00000413701:R88L;ENSP00000341135:R92L;ENSP00000420587:R50L	ENSP00000341135:R92L	R	-	2	0	NR6A1	126356538	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.802000	0.62539	2.653000	0.90120	0.563000	0.77884	CGG	.	.	.	none		0.532	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054043.4		
USP6NL	9712	hgsc.bcm.edu	37	10	11523768	11523768	+	Splice_Site	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr10:11523768C>G	ENST00000609104.1	-	14	1473		c.e14+1		USP6NL_ENST00000379237.2_Splice_Site|USP6NL_ENST00000277575.5_Splice_Site	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like						Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						GTAATTCTTACCAGGTTCTGG	0.368																																					.		Atlas-SNP	.											USP6NL,NS,carcinoma,0,1	USP6NL	57	.	0			c.1078+1G>C						PASS	.						62.0	60.0	60.0					10																	11523768		1820	4075	5895	SO:0001630	splice_region_variant	9712	exon15			TTCTTACCAGGTT	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1078+1G>C	chr10.hg19:g.11523768C>G		41.0	0.0	.		50.0	2.0	.	NM_014688	A8KA79|Q15400|Q5VV10|Q7L0K9	Splice_Site	SNP	ENST00000609104.1	hg19	CCDS53492.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280472	0.80692	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	.	.	.	5.84	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8921	0.86090	0.0:0.8719:0.1281:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP6NL	11563774	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.140000	0.77322	1.431000	0.47355	0.655000	0.94253	.	.	.	.	none		0.368	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046764.3	NM_014688	Intron
THNSL1	79896	hgsc.bcm.edu	37	10	25312238	25312238	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr10:25312238C>T	ENST00000524413.1	+	3	433	c.86C>T	c.(85-87)gCa>gTa	p.A29V	THNSL1_ENST00000376356.4_Missense_Mutation_p.A29V			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	29						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	GATAAACATGCACAGCGATTT	0.363																																					p.A29V		Atlas-SNP	.											.	THNSL1	70	.	0			c.C86T						PASS	.						97.0	99.0	98.0					10																	25312238		2203	4300	6503	SO:0001583	missense	79896	exon3			AACATGCACAGCG	AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.86C>T	chr10.hg19:g.25312238C>T	ENSP00000434887:p.Ala29Val	80.0	0.0	.		118.0	48.0	.	NM_024838	B3KWL1|D3DRV3|Q5VV21	Missense_Mutation	SNP	ENST00000524413.1	hg19	CCDS7147.1	.	.	.	.	.	.	.	.	.	.	C	1.381	-0.583490	0.03827	.	.	ENSG00000185875	ENST00000524413;ENST00000376356	T;T	0.07444	3.19;3.19	5.87	1.3	0.21679	.	1.328470	0.05152	N	0.496208	T	0.03263	0.0095	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37596	-0.9699	10	0.02654	T	1	-32.9386	0.8315	0.01132	0.1692:0.23:0.1664:0.4344	.	29	Q8IYQ7	THNS1_HUMAN	V	29	ENSP00000434887:A29V;ENSP00000365534:A29V	ENSP00000365534:A29V	A	+	2	0	THNSL1	25352244	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.012000	0.13287	-0.006000	0.14370	0.557000	0.71058	GCA	.	.	.	none		0.363	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394913.1	NM_024838	
TULP3	7289	hgsc.bcm.edu	37	12	3048537	3048537	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr12:3048537A>C	ENST00000448120.2	+	11	1307	c.1256A>C	c.(1255-1257)aAc>aCc	p.N419T	TULP3_ENST00000397132.2_Missense_Mutation_p.N419T	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	419					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CTGGATTACAACTACCCACTT	0.443																																					p.N419T		Atlas-SNP	.											.,1	TULP3	45	.	0			c.A1256C						PASS	.						313.0	257.0	276.0					12																	3048537		2203	4300	6503	SO:0001583	missense	7289	exon11			ATTACAACTACCC	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.1256A>C	chr12.hg19:g.3048537A>C	ENSP00000410051:p.Asn419Thr	170.0	0.0	.		165.0	48.0	.	NM_003324	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	hg19	CCDS8519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.02|12.02	1.811439|1.811439	0.32053|0.32053	.|.	.|.	ENSG00000078246|ENSG00000078246	ENST00000228245;ENST00000542730;ENST00000448120;ENST00000397132|ENST00000541678;ENST00000538704	D;D|.	0.85088|.	-1.94;-1.94|.	5.64|5.64	1.97|1.97	0.26223|0.26223	Tubby, C-terminal (3);|.	0.134805|.	0.64402|.	D|.	0.000003|.	T|T	0.52661|0.52661	0.1748|0.1748	L|L	0.42487|0.42487	1.325|1.325	0.47214|0.47214	D|D	0.999359|0.999359	B;B;B|.	0.34161|.	0.051;0.078;0.439|.	B;B;B|.	0.40982|.	0.14;0.345;0.332|.	T|T	0.36138|0.36138	-0.9760|-0.9760	9|5	.|.	.|.	.|.	1.337|1.337	8.4366|8.4366	0.32791|0.32791	0.7077:0.0:0.2923:0.0|0.7077:0.0:0.2923:0.0	.|.	243;419;419|.	B7Z1E7;O75386;F8WBZ9|.	.;TULP3_HUMAN;.|.	T|H	419;243;419;419|95;84	ENSP00000410051:N419T;ENSP00000380321:N419T|.	.|.	N|Q	+|+	2|3	0|2	TULP3|TULP3	2918798|2918798	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.640000|0.640000	0.38277|0.38277	1.203000|1.203000	0.32284|0.32284	0.089000|0.089000	0.17243|0.17243	-0.589000|-0.589000	0.04120|0.04120	AAC|CAA	.	.	.	none		0.443	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324	
HEBP1	50865	hgsc.bcm.edu	37	12	13142261	13142261	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr12:13142261C>A	ENST00000014930.4	-	2	325	c.167G>T	c.(166-168)cGg>cTg	p.R56L	HEBP1_ENST00000536942.1_Missense_Mutation_p.R56L	NM_015987.4	NP_057071.2	Q9NRV9	HEBP1_HUMAN	heme binding protein 1	56					circadian rhythm (GO:0007623)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	heme binding (GO:0020037)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	7		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		CATTGCTTCCCGTAGAGCCTC	0.542																																					p.R56L		Atlas-SNP	.											.	HEBP1	16	.	0			c.G167T						PASS	.						203.0	153.0	170.0					12																	13142261		2203	4300	6503	SO:0001583	missense	50865	exon2			GCTTCCCGTAGAG	AF117615	CCDS31749.1	12p13.2	2014-01-30			ENSG00000013583	ENSG00000013583		"""Endogenous ligands"""	17176	protein-coding gene	gene with protein product		605826				10640688	Standard	NM_015987		Approved	HEBP, HBP	uc001rbd.3	Q9NRV9	OTTHUMG00000168771	ENST00000014930.4:c.167G>T	chr12.hg19:g.13142261C>A	ENSP00000014930:p.Arg56Leu	118.0	0.0	.		138.0	7.0	.	NM_015987	A8K1G2|Q9Y5Z5	Missense_Mutation	SNP	ENST00000014930.4	hg19	CCDS31749.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.385915	0.42308	.	.	ENSG00000013583	ENST00000014930;ENST00000536942	T;T	0.22743	1.94;1.94	6.02	3.89	0.44902	Regulatory factor, effector, bacterial (1);	0.389996	0.27749	N	0.018006	T	0.21307	0.0513	M	0.62723	1.935	0.20926	N	0.999824	B	0.28850	0.225	B	0.34242	0.178	T	0.13710	-1.0499	10	0.22706	T	0.39	-10.7345	7.1904	0.25822	0.0:0.676:0.0:0.324	.	56	Q9NRV9	HEBP1_HUMAN	L	56	ENSP00000014930:R56L;ENSP00000441678:R56L	ENSP00000014930:R56L	R	-	2	0	HEBP1	13033528	0.760000	0.28428	0.984000	0.44739	0.971000	0.66376	2.083000	0.41615	1.554000	0.49487	0.650000	0.86243	CGG	.	.	.	none		0.542	HEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401001.1		
HOXC11	3227	hgsc.bcm.edu	37	12	54367330	54367330	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr12:54367330G>T	ENST00000546378.1	+	1	421	c.305G>T	c.(304-306)cGg>cTg	p.R102L	HOTAIR_ENST00000424518.1_RNA|HOTAIR_ENST00000455246.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.R102L			O43248	HXC11_HUMAN	homeobox C11	102					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						CTTATGCACCGGGAGTGCCTG	0.672			T	NUP98	AML																																p.R102L		Atlas-SNP	.		Dom	yes		12	12q13.3	3227	homeo box C11		L	HOXC11_ENST00000546378,bladder,carcinoma,0,1	HOXC11	32	.	0			c.G305T						PASS	.						94.0	106.0	102.0					12																	54367330		2203	4300	6503	SO:0001583	missense	3227	exon1			TGCACCGGGAGTG		CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.305G>T	chr12.hg19:g.54367330G>T	ENSP00000446680:p.Arg102Leu	258.0	1.0	.		192.0	9.0	.	NM_014212	A8K7D1|Q96DH2	Missense_Mutation	SNP	ENST00000546378.1	hg19	CCDS8867.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.280254	0.80692	.	.	ENSG00000123388	ENST00000546378;ENST00000243082	T;T	0.59083	0.29;0.29	4.31	4.31	0.51392	Domain of unknown function DUF3528, homeobox protein, eukaryotic (1);	0.000000	0.85682	D	0.000000	T	0.77412	0.4126	M	0.83483	2.645	0.58432	D	0.999996	D	0.76494	0.999	D	0.79108	0.992	T	0.81922	-0.0711	10	0.87932	D	0	.	16.0846	0.81031	0.0:0.0:1.0:0.0	.	102	O43248	HXC11_HUMAN	L	102	ENSP00000446680:R102L;ENSP00000243082:R102L	ENSP00000243082:R102L	R	+	2	0	HOXC11	52653597	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	9.221000	0.95188	2.386000	0.81285	0.555000	0.69702	CGG	.	.	.	none		0.672	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358869.2		
ACAD10	80724	hgsc.bcm.edu	37	12	112183962	112183962	+	Silent	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr12:112183962T>C	ENST00000313698.4	+	14	2285	c.2130T>C	c.(2128-2130)gcT>gcC	p.A710A	ACAD10_ENST00000392636.2_Silent_p.A312A|ACAD10_ENST00000455480.2_Silent_p.A741A|ACAD10_ENST00000413681.3_3'UTR	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	710						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						AAGCCAAAGCTGAAGGACTTT	0.433																																					p.A741A		Atlas-SNP	.											.	ACAD10	93	.	0			c.T2223C						PASS	.						88.0	88.0	88.0					12																	112183962		2203	4300	6503	SO:0001819	synonymous_variant	80724	exon15			CAAAGCTGAAGGA	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2130T>C	chr12.hg19:g.112183962T>C		132.0	0.0	.		101.0	34.0	.	NM_001136538	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Silent	SNP	ENST00000313698.4	hg19	CCDS31903.1																																																																																			.	.	.	none		0.433	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247	
GAS6	2621	hgsc.bcm.edu	37	13	114523928	114523928	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr13:114523928T>C	ENST00000327773.6	-	15	2092	c.1946A>G	c.(1945-1947)aAc>aGc	p.N649S	GAS6_ENST00000450766.1_Missense_Mutation_p.N376S|GAS6_ENST00000357389.3_Missense_Mutation_p.N692S|GAS6_ENST00000418959.3_Missense_Mutation_p.N350S|GAS6_ENST00000355761.4_Missense_Mutation_p.N595S|GAS6-AS1_ENST00000458001.1_RNA	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	692	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				CAGCCTCCGGTTGACCTCCAG	0.662																																					p.N649S		Atlas-SNP	.											.	GAS6	75	.	0			c.A1946G						PASS	.						51.0	45.0	47.0					13																	114523928		2202	4299	6501	SO:0001583	missense	2621	exon15			CTCCGGTTGACCT		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.1946A>G	chr13.hg19:g.114523928T>C	ENSP00000331831:p.Asn649Ser	69.0	0.0	.		52.0	23.0	.	NM_000820	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	ENST00000327773.6	hg19	CCDS45072.1	.	.	.	.	.	.	.	.	.	.	T	12.32	1.901729	0.33535	.	.	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000450766;ENST00000418959;ENST00000327773	D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68	4.72	3.54	0.40534	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.79924	0.4530	M	0.83223	2.63	0.44547	D	0.997504	P;B;B	0.41214	0.742;0.015;0.1	B;B;B	0.32864	0.154;0.026;0.01	T	0.78204	-0.2295	9	0.62326	D	0.03	-27.6441	8.071	0.30689	0.0:0.1832:0.0:0.8168	.	692;376;649	Q14393;B3KVL4;Q14393-2	GAS6_HUMAN;.;.	S	692;595;376;350;649	ENSP00000349962:N692S;ENSP00000348003:N595S;ENSP00000416498:N376S;ENSP00000400117:N350S;ENSP00000331831:N649S	ENSP00000331831:N649S	N	-	2	0	GAS6	113590015	0.993000	0.37304	0.858000	0.33744	0.120000	0.20174	2.505000	0.45424	0.664000	0.31047	0.379000	0.24179	AAC	.	.	.	none		0.662	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045946.2	NM_000820	
RBM23	55147	hgsc.bcm.edu	37	14	23374814	23374814	+	Splice_Site	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr14:23374814C>G	ENST00000359890.3	-	6	651		c.e6+1		RBM23_ENST00000399922.2_Splice_Site|RBM23_ENST00000542016.2_Splice_Site|RBM23_ENST00000556984.1_5'Flank|RBM23_ENST00000555209.1_Intron|RBM23_ENST00000346528.5_Intron	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23						mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		TATCAACCCACCTGACTGGGC	0.378																																					.		Atlas-SNP	.											.	RBM23	44	.	0			c.407+1G>C						PASS	.						90.0	80.0	83.0					14																	23374814		1844	4103	5947	SO:0001630	splice_region_variant	55147	exon6			AACCCACCTGACT	AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.455+1G>C	chr14.hg19:g.23374814C>G		99.0	0.0	.		40.0	26.0	.	NM_018107	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Splice_Site	SNP	ENST00000359890.3	hg19	CCDS41921.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065110	0.55432	.	.	ENSG00000100461	ENST00000359890;ENST00000338980;ENST00000399922	.	.	.	4.88	3.99	0.46301	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2615	0.54652	0.0:0.9161:0.0:0.0839	.	.	.	.	.	-1	.	.	.	-	.	.	RBM23	22444654	1.000000	0.71417	0.998000	0.56505	0.851000	0.48451	3.163000	0.50763	1.422000	0.47177	0.655000	0.94253	.	.	.	.	none		0.378	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413545.3		Intron
SMG1	23049	hgsc.bcm.edu	37	16	18840922	18840922	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr16:18840922G>T	ENST00000446231.2	-	54	9701	c.9289C>A	c.(9289-9291)Cta>Ata	p.L3097I	SMG1_ENST00000389467.3_Missense_Mutation_p.L3097I			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3097					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGGTTGGGTAGCCCTATCAAG	0.468																																					p.L3097I		Atlas-SNP	.											.	SMG1	401	.	0			c.C9289A						PASS	.						58.0	57.0	57.0					16																	18840922		1905	4128	6033	SO:0001583	missense	23049	exon54			TGGGTAGCCCTAT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9289C>A	chr16.hg19:g.18840922G>T	ENSP00000402515:p.Leu3097Ile	38.0	0.0	.		70.0	40.0	.	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	hg19	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.510741	0.44660	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01005	5.45;5.45	6.07	5.11	0.69529	.	0.000000	0.53938	D	0.000041	T	0.00875	0.0029	N	0.12182	0.205	0.41248	D	0.986699	B	0.13145	0.007	B	0.15484	0.013	T	0.67565	-0.5638	10	0.20519	T	0.43	.	16.7418	0.85461	0.0:0.0:0.8697:0.1303	.	3097	Q96Q15	SMG1_HUMAN	I	3097	ENSP00000402515:L3097I;ENSP00000374118:L3097I	ENSP00000374118:L3097I	L	-	1	2	SMG1	18748423	1.000000	0.71417	0.831000	0.32960	0.967000	0.64934	6.417000	0.73337	1.558000	0.49541	0.585000	0.79938	CTA	.	.	.	none		0.468	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
CMTR2	55783	hgsc.bcm.edu	37	16	71317552	71317552	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr16:71317552C>T	ENST00000338099.5	-	3	2608	c.2272G>A	c.(2272-2274)Gag>Aag	p.E758K	CMTR2_ENST00000434935.2_Missense_Mutation_p.E758K			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	758					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										TCTTCTCTCTCTCTTTGAATA	0.373																																					p.E758K		Atlas-SNP	.											.	FTSJD1	70	.	0			c.G2272A						PASS	.						38.0	42.0	41.0					16																	71317552		2198	4300	6498	SO:0001583	missense	55783	exon3			CTCTCTCTCTTTG	BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.2272G>A	chr16.hg19:g.71317552C>T	ENSP00000337512:p.Glu758Lys	31.0	0.0	.		67.0	17.0	.	NM_018348	B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Missense_Mutation	SNP	ENST00000338099.5	hg19	CCDS10898.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.507361	0.44558	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	T;T	0.15603	2.41;2.41	5.8	4.8	0.61643	.	0.225081	0.35677	N	0.003053	T	0.09555	0.0235	N	0.17082	0.46	0.32079	N	0.593443	B	0.21071	0.051	B	0.17979	0.02	T	0.07214	-1.0784	10	0.27785	T	0.31	-35.113	7.8477	0.29435	0.0:0.6486:0.2684:0.083	.	758	Q8IYT2	FTSJ1_HUMAN	K	758	ENSP00000337512:E758K;ENSP00000411148:E758K	ENSP00000337512:E758K	E	-	1	0	FTSJD1	69875053	0.991000	0.36638	1.000000	0.80357	0.802000	0.45316	1.495000	0.35627	2.741000	0.93983	0.585000	0.79938	GAG	.	.	.	none		0.373	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268984.2	NM_018348	
PLCG2	5336	hgsc.bcm.edu	37	16	81990321	81990321	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr16:81990321T>G	ENST00000359376.3	+	32	3806	c.3592T>G	c.(3592-3594)Tcc>Gcc	p.S1198A		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	1198					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GGAACTTTACTCCTCCTGTCG	0.527																																					p.S1198A		Atlas-SNP	.											.	PLCG2	276	.	0			c.T3592G						PASS	.						59.0	61.0	61.0					16																	81990321		1979	4160	6139	SO:0001583	missense	5336	exon32			CTTTACTCCTCCT		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.3592T>G	chr16.hg19:g.81990321T>G	ENSP00000352336:p.Ser1198Ala	67.0	0.0	.		77.0	28.0	.	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	hg19	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	T	9.506	1.104525	0.20632	.	.	ENSG00000197943	ENST00000359376	T	0.65732	-0.17	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	L	0.52573	1.65	0.45205	D	0.998216	B	0.16166	0.016	B	0.12156	0.007	T	0.50224	-0.8853	10	0.10111	T	0.7	.	13.9529	0.64129	0.0:0.0:0.0:1.0	.	1198	P16885	PLCG2_HUMAN	A	1198	ENSP00000352336:S1198A	ENSP00000352336:S1198A	S	+	1	0	PLCG2	80547822	0.988000	0.35896	0.980000	0.43619	0.866000	0.49608	2.961000	0.49168	2.106000	0.64143	0.454000	0.30748	TCC	.	.	.	none		0.527	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
CRLF3	51379	hgsc.bcm.edu	37	17	29119514	29119514	+	Silent	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr17:29119514C>A	ENST00000324238.6	-	6	1027	c.903G>T	c.(901-903)tcG>tcT	p.S301S	CRLF3_ENST00000577725.1_Intron|CTD-2349P21.9_ENST00000580085.1_lincRNA|CRLF3_ENST00000544695.1_Silent_p.S185S	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	301					G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)		p.S301S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				AGAGAACACCCGATGATTCAG	0.433																																					p.S301S	Pancreas(30;346 881 29244 33464 41299)	Atlas-SNP	.											.	CRLF3	36	.	1	Substitution - coding silent(1)	lung(1)	c.G903T						PASS	.						153.0	147.0	149.0					17																	29119514		2203	4300	6503	SO:0001819	synonymous_variant	51379	exon6			AACACCCGATGAT	AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.903G>T	chr17.hg19:g.29119514C>A		205.0	0.0	.		189.0	11.0	.	NM_015986	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	Silent	SNP	ENST00000324238.6	hg19	CCDS32607.1																																																																																			.	.	.	none		0.433	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444354.1		
ZNHIT3	9326	hgsc.bcm.edu	37	17	34849806	34849806	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr17:34849806A>G	ENST00000225410.4	+	4	307	c.242A>G	c.(241-243)gAt>gGt	p.D81G	ZNHIT3_ENST00000592616.1_Missense_Mutation_p.D81G|ZNHIT3_ENST00000490126.2_5'UTR|RNA5SP439_ENST00000517103.1_RNA|ZNHIT3_ENST00000590858.1_Intron|ZNHIT3_ENST00000588253.1_5'UTR	NM_004773.2	NP_004764.1	Q15649	ZNHI3_HUMAN	zinc finger, HIT-type containing 3	81					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			lung(1)|pancreas(1)|prostate(1)	3		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0188)		CTCAATAGTGATGAGGAAGAA	0.373																																					p.D81G	Pancreas(89;112 2361 26810)	Atlas-SNP	.											.	ZNHIT3	14	.	0			c.A242G						PASS	.						152.0	148.0	149.0					17																	34849806		2203	4300	6503	SO:0001583	missense	9326	exon4			ATAGTGATGAGGA	L40410	CCDS11312.1, CCDS62156.1	17q21.1	2014-04-10	2010-09-15	2005-09-08	ENSG00000108278	ENSG00000273611		"""Zinc fingers, HIT-type"""	12309	protein-coding gene	gene with protein product		604500	"""thyroid hormone receptor interactor 3"", ""zinc finger, HIT type 3"""	TRIP3		7776974	Standard	NM_004773		Approved		uc002hms.1	Q15649	OTTHUMG00000188436	ENST00000225410.4:c.242A>G	chr17.hg19:g.34849806A>G	ENSP00000225410:p.Asp81Gly	128.0	0.0	.		162.0	65.0	.	NM_004773	A8K493|K7EQP1|Q8WVJ3	Missense_Mutation	SNP	ENST00000225410.4	hg19	CCDS11312.1	.	.	.	.	.	.	.	.	.	.	A	11.65	1.700781	0.30142	.	.	ENSG00000108278	ENST00000225410	.	.	.	6.02	4.94	0.65067	.	0.084595	0.85682	D	0.000000	T	0.69584	0.3127	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.64144	0.922	T	0.68387	-0.5422	9	0.37606	T	0.19	-14.422	9.5969	0.39580	0.8443:0.0:0.0:0.1557	.	81	Q15649	ZNHI3_HUMAN	G	81	.	ENSP00000225410:D81G	D	+	2	0	ZNHIT3	31923919	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	5.963000	0.70372	1.084000	0.41184	-0.327000	0.08410	GAT	.	.	.	none		0.373	ZNHIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256697.1	NM_004773	
DLX3	1747	hgsc.bcm.edu	37	17	48072053	48072053	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr17:48072053G>C	ENST00000434704.2	-	1	535	c.310C>G	c.(310-312)Cca>Gca	p.P104A	RP11-1094H24.3_ENST00000511867.1_lincRNA|DLX3_ENST00000512495.2_5'Flank	NM_005220.2	NP_005211.1	O60479	DLX3_HUMAN	distal-less homeobox 3	104					blood vessel development (GO:0001568)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|placenta development (GO:0001890)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						TCCTGGGCTGGCAGCGGCTGC	0.622																																					p.P104A		Atlas-SNP	.											.	DLX3	28	.	0			c.C310G						PASS	.						22.0	28.0	26.0					17																	48072053		2195	4295	6490	SO:0001583	missense	1747	exon1			GGGCTGGCAGCGG		CCDS11556.1	17q21.33	2011-06-20	2005-12-22			ENSG00000064195		"""Homeoboxes / ANTP class : NKL subclass"""	2916	protein-coding gene	gene with protein product		600525	"""distal-less homeo box 3"""			7613049	Standard	NM_005220		Approved		uc002ipy.3	O60479		ENST00000434704.2:c.310C>G	chr17.hg19:g.48072053G>C	ENSP00000389870:p.Pro104Ala	69.0	0.0	.		51.0	25.0	.	NM_005220	B3KQL6	Missense_Mutation	SNP	ENST00000434704.2	hg19	CCDS11556.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222006	0.39300	.	.	ENSG00000064195	ENST00000434704	D	0.91945	-2.94	5.01	5.01	0.66863	Homeodomain-like (1);	0.078892	0.53938	D	0.000057	D	0.86029	0.5835	N	0.21240	0.645	0.80722	D	1	B	0.11235	0.004	B	0.24006	0.05	T	0.80538	-0.1338	10	0.24483	T	0.36	-29.5674	13.6755	0.62451	0.0:0.0:1.0:0.0	.	104	O60479	DLX3_HUMAN	A	104	ENSP00000389870:P104A	ENSP00000389870:P104A	P	-	1	0	DLX3	45427052	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	4.079000	0.57613	2.617000	0.88574	0.491000	0.48974	CCA	.	.	.	none		0.622	DLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366307.1		
TBCD	6904	hgsc.bcm.edu	37	17	80885835	80885835	+	Silent	SNP	G	G	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr17:80885835G>C	ENST00000355528.4	+	30	2794	c.2664G>C	c.(2662-2664)cgG>cgC	p.R888R	TBCD_ENST00000539345.2_Silent_p.R888R	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	888					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TGCTGGCTCGGAGCCAGCCTG	0.642																																					p.R888R		Atlas-SNP	.											.	TBCD	94	.	0			c.G2664C						PASS	.						57.0	60.0	59.0					17																	80885835		2056	4211	6267	SO:0001819	synonymous_variant	6904	exon30			GGCTCGGAGCCAG	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.2664G>C	chr17.hg19:g.80885835G>C		108.0	0.0	.		97.0	33.0	.	NM_005993	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Silent	SNP	ENST00000355528.4	hg19	CCDS45818.1																																																																																			.	.	.	none		0.642	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993	
NPC1	4864	hgsc.bcm.edu	37	18	21128030	21128030	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr18:21128030G>T	ENST00000269228.5	-	11	2251	c.1697C>A	c.(1696-1698)cCt>cAt	p.P566H	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Intron	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	566					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATTATTGACAGGGAAGGTAAT	0.423																																					p.P566H		Atlas-SNP	.											.	NPC1	114	.	0			c.C1697A						PASS	.						153.0	147.0	149.0					18																	21128030		2203	4300	6503	SO:0001583	missense	4864	exon11			TTGACAGGGAAGG	AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.1697C>A	chr18.hg19:g.21128030G>T	ENSP00000269228:p.Pro566His	207.0	0.0	.		184.0	72.0	.	NM_000271	B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	hg19	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682504	0.88542	.	.	ENSG00000141458	ENST00000269228;ENST00000540608	D	0.93811	-3.29	5.72	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.95906	0.8667	M	0.81942	2.565	0.80722	D	1	D	0.63880	0.993	P	0.58928	0.848	D	0.96104	0.9071	10	0.66056	D	0.02	-8.8197	14.813	0.70010	0.0692:0.0:0.9308:0.0	.	566	O15118	NPC1_HUMAN	H	566;411	ENSP00000269228:P566H	ENSP00000269228:P566H	P	-	2	0	NPC1	19382028	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.865000	0.87049	1.417000	0.47077	0.563000	0.77884	CCT	.	.	.	none		0.423	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	NM_000271	
RNF165	494470	hgsc.bcm.edu	37	18	44013357	44013357	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr18:44013357A>G	ENST00000269439.7	+	2	317	c.266A>G	c.(265-267)cAg>cGg	p.Q89R	RNF165_ENST00000543885.1_Intron	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	89							zinc ion binding (GO:0008270)			NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		CCCACCCTGCAGTTCCAGGAC	0.697																																					p.Q89R		Atlas-SNP	.											.	RNF165	34	.	0			c.A266G						PASS	.						35.0	34.0	34.0					18																	44013357		2203	4300	6503	SO:0001583	missense	494470	exon2			CCCTGCAGTTCCA	BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.266A>G	chr18.hg19:g.44013357A>G	ENSP00000269439:p.Gln89Arg	58.0	0.0	.		58.0	16.0	.	NM_152470	B3KVD1	Missense_Mutation	SNP	ENST00000269439.7	hg19	CCDS32823.1	.	.	.	.	.	.	.	.	.	.	A	9.420	1.082835	0.20309	.	.	ENSG00000141622	ENST00000269439	T	0.18657	2.2	5.48	4.27	0.50696	.	0.146503	0.47093	D	0.000241	T	0.18676	0.0448	L	0.47716	1.5	0.80722	D	1	B	0.26445	0.149	B	0.28784	0.094	T	0.03717	-1.1010	10	0.12766	T	0.61	-5.9439	13.0518	0.58958	0.8124:0.1876:0.0:0.0	.	89	Q6ZSG1	RN165_HUMAN	R	89	ENSP00000269439:Q89R	ENSP00000269439:Q89R	Q	+	2	0	RNF165	42267355	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.579000	0.46059	2.086000	0.62901	0.455000	0.32223	CAG	.	.	.	none		0.697	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445358.1	NM_152470	
ABCA7	10347	hgsc.bcm.edu	37	19	1062293	1062293	+	Missense_Mutation	SNP	C	C	A	rs144378856		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:1062293C>A	ENST00000263094.6	+	42	5924	c.5693C>A	c.(5692-5694)cCg>cAg	p.P1898Q	ABCA7_ENST00000433129.1_Missense_Mutation_p.P1898Q|ABCA7_ENST00000435683.2_Missense_Mutation_p.P1760Q	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1898	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCGGTGTCCCGGAGGCCCAG	0.677																																					p.P1898Q		Atlas-SNP	.											.	ABCA7	174	.	0			c.C5693A						PASS	.						78.0	86.0	83.0					19																	1062293		2203	4296	6499	SO:0001583	missense	10347	exon42			GTGTCCCGGAGGC	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.5693C>A	chr19.hg19:g.1062293C>A	ENSP00000263094:p.Pro1898Gln	244.0	0.0	.		128.0	8.0	.	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	hg19	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.952395	0.34471	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.96396	-4.0;-4.0	3.4	2.34	0.29019	ATPase, AAA+ type, core (1);ABC transporter-like (2);	.	.	.	.	D	0.96827	0.8964	L	0.56280	1.765	0.33986	D	0.648578	D;P	0.89917	1.0;0.941	D;P	0.83275	0.996;0.787	D	0.96923	0.9675	9	0.87932	D	0	.	9.6915	0.40131	0.0:0.8916:0.0:0.1084	.	1023;1898	D6W5Y0;Q8IZY2	.;ABCA7_HUMAN	Q	1898	ENSP00000263094:P1898Q;ENSP00000414062:P1898Q	ENSP00000263094:P1898Q	P	+	2	0	ABCA7	1013293	0.620000	0.27068	0.034000	0.17996	0.151000	0.21798	2.777000	0.47717	0.628000	0.30357	0.555000	0.69702	CCG	.	C|1.000;T|0.000	.	alt		0.677	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
MUC16	94025	hgsc.bcm.edu	37	19	9061598	9061598	+	Silent	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:9061598A>G	ENST00000397910.4	-	3	26051	c.25848T>C	c.(25846-25848)ccT>ccC	p.P8616P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8618	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCAAATTTGGAGGTGAACTGG	0.483																																					p.P8616P		Atlas-SNP	.											.	MUC16	4315	.	0			c.T25848C						PASS	.						143.0	133.0	136.0					19																	9061598		2004	4163	6167	SO:0001819	synonymous_variant	94025	exon3			ATTTGGAGGTGAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.25848T>C	chr19.hg19:g.9061598A>G		66.0	0.0	.		100.0	4.0	.	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.	.	none		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
LDLR	3949	hgsc.bcm.edu	37	19	11216253	11216253	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:11216253A>C	ENST00000558518.1	+	4	858	c.671A>C	c.(670-672)gAc>gCc	p.D224A	LDLR_ENST00000455727.2_Intron|LDLR_ENST00000545707.1_Intron|LDLR_ENST00000558013.1_Missense_Mutation_p.D224A|LDLR_ENST00000535915.1_Missense_Mutation_p.D183A|LDLR_ENST00000557933.1_Missense_Mutation_p.D224A	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	224	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.		D -> G (in Italy-2).|D -> N (in Portugal).|D -> V (in FH; Cologne patient). {ECO:0000269|PubMed:7649546}.		cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	GACTGCAAGGACAAATCTGAC	0.647																																					p.D224A	GBM(18;201 575 7820 21545)	Atlas-SNP	.											.	LDLR	72	.	1	Unknown(1)	lung(1)	c.A671C	GRCh37	CM920421|CM950756|CM994425	LDLR	M		PASS	.						31.0	36.0	34.0					19																	11216253		2202	4299	6501	SO:0001583	missense	3949	exon4			GCAAGGACAAATC	AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.671A>C	chr19.hg19:g.11216253A>C	ENSP00000454071:p.Asp224Ala	74.0	0.0	.		66.0	28.0	.	NM_001195798	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	ENST00000558518.1	hg19	CCDS12254.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.301164	0.81136	.	.	ENSG00000130164	ENST00000252444;ENST00000535915	D;D	0.99220	-5.58;-4.44	5.6	5.6	0.85130	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000010	D	0.99677	0.9879	H	0.98407	4.225	0.80722	D	1	P;D;D;D	0.71674	0.917;0.998;0.996;0.998	D;D;D;D	0.83275	0.92;0.996;0.99;0.99	D	0.97323	0.9945	10	0.87932	D	0	.	14.7566	0.69569	1.0:0.0:0.0:0.0	.	103;183;236;224	B4DII3;B4DTQ3;Q59FQ1;P01130	.;.;.;LDLR_HUMAN	A	224;183	ENSP00000252444:D224A;ENSP00000440520:D183A	ENSP00000252444:D224A	D	+	2	0	LDLR	11077253	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	9.228000	0.95250	2.139000	0.66308	0.482000	0.46254	GAC	.	.	.	none		0.647	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415973.2		
AP1M1	8907	hgsc.bcm.edu	37	19	16339616	16339616	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:16339616C>G	ENST00000291439.3	+	9	1373	c.924C>G	c.(922-924)aaC>aaG	p.N308K	AP1M1_ENST00000429941.2_Intron|AP1M1_ENST00000444449.2_Missense_Mutation_p.N320K|AP1M1_ENST00000541844.1_Missense_Mutation_p.N236K|AP1M1_ENST00000590756.1_Missense_Mutation_p.N236K	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	308	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						CAACAGCCAACAACGTGGAGA	0.617																																					p.N320K		Atlas-SNP	.											.	AP1M1	48	.	0			c.C960G						PASS	.						173.0	116.0	135.0					19																	16339616		2203	4300	6503	SO:0001583	missense	8907	exon10			AGCCAACAACGTG		CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.924C>G	chr19.hg19:g.16339616C>G	ENSP00000291439:p.Asn308Lys	78.0	0.0	.		56.0	19.0	.	NM_001130524	Q4TTY5	Missense_Mutation	SNP	ENST00000291439.3	hg19	CCDS12342.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.429106	0.83667	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844	T;T;T	0.18502	2.21;2.21;2.21	3.64	3.64	0.41730	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.40347	0.1113	M	0.70787	2.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.39901	-0.9591	10	0.62326	D	0.03	-49.532	14.4911	0.67651	0.0:1.0:0.0:0.0	.	320;308	Q4TTY5;Q9BXS5	.;AP1M1_HUMAN	K	320;308;236	ENSP00000388996:N320K;ENSP00000291439:N308K;ENSP00000445682:N236K	ENSP00000291439:N308K	N	+	3	2	AP1M1	16200616	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.764000	0.55264	1.871000	0.54225	0.561000	0.74099	AAC	.	.	.	none		0.617	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493	
ZNF737	100129842	hgsc.bcm.edu	37	19	20728254	20728254	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:20728254C>G	ENST00000427401.4	-	4	849	c.755G>C	c.(754-756)aGt>aCt	p.S252T		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	252					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TTTCTCTCCACTATGAATTAT	0.403																																					p.S252T		Atlas-SNP	.											ZNF737,NS,carcinoma,0,1	ZNF737	50	.	0			c.G755C						PASS	.						34.0	34.0	34.0					19																	20728254		692	1591	2283	SO:0001583	missense	100129842	exon4			TCTCCACTATGAA	BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.755G>C	chr19.hg19:g.20728254C>G	ENSP00000395733:p.Ser252Thr	22.0	0.0	.		33.0	2.0	.	NM_001159293	C9JHM3	Missense_Mutation	SNP	ENST00000427401.4	hg19	CCDS54238.1	.	.	.	.	.	.	.	.	.	.	-	0	-2.857622	0.00065	.	.	ENSG00000237440	ENST00000427401	T	0.12879	2.64	0.1	-0.2	0.13216	.	.	.	.	.	T	0.03871	0.0109	N	0.03050	-0.425	0.24703	N	0.993244	B	0.02656	0.0	B	0.06405	0.002	T	0.41413	-0.9510	9	0.02654	T	1	.	5.4374	0.16488	0.0:0.645:0.355:0.0	.	252	C9JHM3	.	T	252	ENSP00000395733:S252T	ENSP00000395733:S252T	S	-	2	0	ZNF737	20520094	0.066000	0.20996	0.041000	0.18516	0.041000	0.13682	0.057000	0.14279	-1.260000	0.02465	-1.278000	0.01390	AGT	.	.	.	none		0.403	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447844.2	NM_145289	
ZNF430	80264	hgsc.bcm.edu	37	19	21240182	21240182	+	Silent	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:21240182A>G	ENST00000261560.5	+	5	1249	c.1068A>G	c.(1066-1068)caA>caG	p.Q356Q	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	356					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q356Q(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						CTTTTAACCAATCCTCAACCC	0.383																																					p.Q356Q		Atlas-SNP	.											ZNF430,NS,carcinoma,0,1	ZNF430	59	.	1	Substitution - coding silent(1)	lung(1)	c.A1068G						PASS	.						53.0	57.0	56.0					19																	21240182		2201	4290	6491	SO:0001819	synonymous_variant	80264	exon5			TAACCAATCCTCA	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.1068A>G	chr19.hg19:g.21240182A>G		69.0	1.0	.		94.0	4.0	.	NM_025189	Q86V70	Silent	SNP	ENST00000261560.5	hg19	CCDS32978.1																																																																																			.	.	.	none		0.383	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189	
FCGBP	8857	hgsc.bcm.edu	37	19	40362919	40362919	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:40362919C>A	ENST00000221347.6	-	32	15158	c.15151G>T	c.(15151-15153)Ggg>Tgg	p.G5051W		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5051	VWFD 12. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CGGAGCTGCCCGCAGGCCTCG	0.672																																					p.G5051W		Atlas-SNP	.											.	FCGBP	416	.	0			c.G15151T						PASS	.						46.0	53.0	50.0					19																	40362919		2203	4299	6502	SO:0001583	missense	8857	exon32			GCTGCCCGCAGGC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15151G>T	chr19.hg19:g.40362919C>A	ENSP00000221347:p.Gly5051Trp	148.0	0.0	.		82.0	8.0	.	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	hg19	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656182	0.47467	.	.	ENSG00000090920	ENST00000221347	T	0.78003	-1.14	4.84	4.84	0.62591	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	0.000000	0.64402	U	0.000001	D	0.90359	0.6983	M	0.92649	3.33	0.40754	D	0.982949	D	0.89917	1.0	D	0.97110	1.0	D	0.92815	0.6267	10	0.87932	D	0	.	14.9744	0.71261	0.0:1.0:0.0:0.0	.	5051	Q9Y6R7	FCGBP_HUMAN	W	5051	ENSP00000221347:G5051W	ENSP00000221347:G5051W	G	-	1	0	FCGBP	45054759	0.047000	0.20315	0.851000	0.33527	0.103000	0.19146	1.926000	0.40084	2.521000	0.84997	0.462000	0.41574	GGG	.	.	.	none		0.672	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ZNF577	84765	hgsc.bcm.edu	37	19	52376753	52376753	+	Missense_Mutation	SNP	C	C	A	rs200063901		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:52376753C>A	ENST00000301399.5	-	7	855	c.490G>T	c.(490-492)Ggg>Tgg	p.G164W	ZNF577_ENST00000412216.1_Intron|ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000420592.1_Missense_Mutation_p.G105W|ZNF577_ENST00000451628.2_Missense_Mutation_p.G105W	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		AAGGCTCTCCCGCACACACTG	0.443																																					p.G164W		Atlas-SNP	.											.	ZNF577	63	.	0			c.G490T						PASS	.						135.0	130.0	132.0					19																	52376753		2203	4300	6503	SO:0001583	missense	84765	exon7			CTCTCCCGCACAC	AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.490G>T	chr19.hg19:g.52376753C>A	ENSP00000301399:p.Gly164Trp	158.0	0.0	.		159.0	7.0	.	NM_032679	A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	hg19	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	10.17	1.275338	0.23307	.	.	ENSG00000161551	ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390	T;T;T;T	0.60040	0.22;0.22;0.22;0.22	3.1	2.04	0.26737	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.83142	0.5190	H	0.98507	4.25	0.27641	N	0.947716	D;D	0.89917	1.0;0.996	D;P	0.87578	0.998;0.784	T	0.73902	-0.3836	9	0.87932	D	0	.	9.3367	0.38054	0.0:0.8873:0.0:0.1127	.	164;105	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	W	164;105;105;164	ENSP00000301399:G164W;ENSP00000413476:G105W;ENSP00000389652:G105W;ENSP00000404509:G164W	ENSP00000301399:G164W	G	-	1	0	ZNF577	57068565	0.001000	0.12720	0.027000	0.17364	0.014000	0.08584	1.074000	0.30703	0.611000	0.30052	0.655000	0.94253	GGG	.	C|1.000;T|0.000	.	alt		0.443	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1	NM_032679	
UBOX5	22888	hgsc.bcm.edu	37	20	3102965	3102965	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:3102965G>A	ENST00000217173.2	-	3	791	c.320C>T	c.(319-321)cCa>cTa	p.P107L	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Missense_Mutation_p.P107L	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5											endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						TGGGACAGATGGCTCAGCTGG	0.567																																					p.P107L		Atlas-SNP	.											.	UBOX5	47	.	0			c.C320T						PASS	.						59.0	59.0	59.0					20																	3102965		2203	4300	6503	SO:0001583	missense	22888	exon3			ACAGATGGCTCAG	AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.320C>T	chr20.hg19:g.3102965G>A	ENSP00000217173:p.Pro107Leu	116.0	0.0	.		73.0	23.0	.	NM_014948		Missense_Mutation	SNP	ENST00000217173.2	hg19	CCDS13046.1	.	.	.	.	.	.	.	.	.	.	G	9.568	1.120384	0.20877	.	.	ENSG00000185019	ENST00000217173;ENST00000348031	T;T	0.29397	1.57;1.57	4.8	2.74	0.32292	.	0.705996	0.12704	U	0.446080	T	0.22859	0.0552	L	0.44542	1.39	0.29757	N	0.835874	B;B;B	0.13145	0.004;0.003;0.007	B;B;B	0.08055	0.003;0.002;0.003	T	0.13176	-1.0519	10	0.38643	T	0.18	-0.4251	5.1325	0.14917	0.1731:0.0:0.5509:0.276	.	107;107;107	Q53GQ5;Q86X87;O94941	.;.;RNF37_HUMAN	L	107	ENSP00000217173:P107L;ENSP00000311726:P107L	ENSP00000217173:P107L	P	-	2	0	UBOX5	3050965	0.241000	0.23857	0.305000	0.25099	0.964000	0.63967	0.662000	0.25038	1.232000	0.43678	0.563000	0.77884	CCA	.	.	.	none		0.567	UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948	
PLAGL2	5326	hgsc.bcm.edu	37	20	30784822	30784822	+	Silent	SNP	C	C	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:30784822C>A	ENST00000246229.4	-	3	1188	c.924G>T	c.(922-924)acG>acT	p.T308T		NM_002657.3	NP_002648.1	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	308					chylomicron assembly (GO:0034378)|lipid metabolic process (GO:0006629)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|post-embryonic development (GO:0009791)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|liver(1)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GTGGCACGCCCGTGCTGGGCA	0.597																																					p.T308T	Colon(163;15 1893 11280 16306 47518)	Atlas-SNP	.											PLAGL2,NS,carcinoma,-1,1	PLAGL2	56	.	0			c.G924T						PASS	.						99.0	100.0	100.0					20																	30784822		2202	4300	6502	SO:0001819	synonymous_variant	5326	exon3			CACGCCCGTGCTG		CCDS13197.1	20q11.21	2013-01-08			ENSG00000126003	ENSG00000126003		"""Zinc fingers, C2H2-type"""	9047	protein-coding gene	gene with protein product	"""C2H2-type zinc finger protein"""	604866				15585652, 17950244	Standard	NM_002657		Approved	ZNF900	uc002wxn.2	Q9UPG8	OTTHUMG00000032210	ENST00000246229.4:c.924G>T	chr20.hg19:g.30784822C>A		177.0	1.0	.		146.0	8.0	.	NM_002657	A8K8T5|E1P5M3|Q92584	Silent	SNP	ENST00000246229.4	hg19	CCDS13197.1																																																																																			.	.	.	none		0.597	PLAGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078615.2	NM_002657	
SETD4	54093	hgsc.bcm.edu	37	21	37418117	37418117	+	Silent	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr21:37418117T>C	ENST00000399215.1	-	5	1861	c.489A>G	c.(487-489)agA>agG	p.R163R	SETD4_ENST00000399212.1_Silent_p.R139R|SETD4_ENST00000399201.1_Silent_p.R139R|SETD4_ENST00000399207.1_Silent_p.R163R|SETD4_ENST00000399208.2_Silent_p.R163R|SETD4_ENST00000332131.4_Silent_p.R163R|SETD4_ENST00000399205.1_Silent_p.R139R|SETD4_ENST00000481477.1_5'UTR			Q9NVD3	SETD4_HUMAN	SET domain containing 4	163	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)			autonomic_ganglia(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	15						GCACGTGGGCTCTCTGCTCTT	0.502																																					p.R163R		Atlas-SNP	.											.	SETD4	37	.	0			c.A489G						PASS	.						99.0	112.0	107.0					21																	37418117		2203	4300	6503	SO:0001819	synonymous_variant	54093	exon6			GTGGGCTCTCTGC	AK001660	CCDS13640.1, CCDS42923.1, CCDS74791.1, CCDS74792.1	21q22.13	2006-02-15	2006-02-15	2006-02-15	ENSG00000185917	ENSG00000185917			1258	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 27"", ""chromosome 21 open reading frame 18"""	C21orf27, C21orf18			Standard	XM_005261000		Approved		uc021wiy.1	Q9NVD3	OTTHUMG00000086483	ENST00000399215.1:c.489A>G	chr21.hg19:g.37418117T>C		200.0	0.0	.		204.0	90.0	.	NM_001007259	B4DT14|D3DSG2|D3DSG4|Q8NE19|Q9BU46	Silent	SNP	ENST00000399215.1	hg19	CCDS13640.1																																																																																			.	.	.	none		0.502	SETD4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194456.1	NM_017438	
SIK1	150094	hgsc.bcm.edu	37	21	44841223	44841223	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr21:44841223T>C	ENST00000270162.6	-	6	656	c.524A>G	c.(523-525)aAg>aGg	p.K175R		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	175	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	CTCTCCTGACTTGTAGAAATT	0.567																																					p.K175R		Atlas-SNP	.											.	SIK1	65	.	0			c.A524G						PASS	.						51.0	61.0	58.0					21																	44841223		2203	4299	6502	SO:0001583	missense	150094	exon6			CCTGACTTGTAGA	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.524A>G	chr21.hg19:g.44841223T>C	ENSP00000270162:p.Lys175Arg	168.0	0.0	.		119.0	46.0	.	NM_173354	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Missense_Mutation	SNP	ENST00000270162.6	hg19	CCDS33575.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.379901	0.61845	.	.	ENSG00000142178	ENST00000270162	T	0.66280	-0.2	5.08	5.08	0.68730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.208643	0.49916	D	0.000136	T	0.45677	0.1354	N	0.12182	0.205	0.45150	D	0.998166	B	0.24721	0.11	B	0.25759	0.063	T	0.40664	-0.9551	10	0.37606	T	0.19	.	14.8612	0.70382	0.0:0.0:0.0:1.0	.	175	P57059	SIK1_HUMAN	R	175	ENSP00000270162:K175R	ENSP00000270162:K175R	K	-	2	0	SIK1	43665651	1.000000	0.71417	0.886000	0.34754	0.944000	0.59088	5.865000	0.69583	1.909000	0.55274	0.459000	0.35465	AAG	.	.	.	none		0.567	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354	
COL18A1	80781	hgsc.bcm.edu	37	21	46911142	46911143	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr21:46911142_46911143GA>AT	ENST00000359759.4	+	21	3337_3338	c.3316_3317GA>AT	c.(3316-3318)GAt>ATt	p.D1106I	COL18A1_ENST00000355480.5_Missense_Mutation_p.D871I|COL18A1_ENST00000400337.2_Missense_Mutation_p.D691I			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1106	Triple-helical region 4 (COL4).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CTTCCAGGGAGATCCAGGGAAG	0.698																																					p.D871N|p.D871V		Atlas-SNP	.											.	COL18A1	129	.	0			c.G2611A|c.A2612T						PASS	.																																			SO:0001583	missense	80781	exon21			CAGGGAGATCCAG|AGGGAGATCCAGG		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	Exception_encountered	chr21.hg19:g.46911142_46911143delinsAT	ENSP00000352798:p.Asp1106Ile	65.0	0.0	.		52.0|51.0	19.0|18.0	.	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	hg19																																																																																				.	.	.	none		0.698	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
PHF21B	112885	hgsc.bcm.edu	37	22	45312440	45312440	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr22:45312440G>T	ENST00000313237.5	-	4	434	c.284C>A	c.(283-285)cCc>cAc	p.P95H	PHF21B_ENST00000403565.1_5'UTR|PHF21B_ENST00000396103.3_Missense_Mutation_p.P95H|PHF21B_ENST00000447824.3_Missense_Mutation_p.P83H|PHF21B_ENST00000404079.2_Missense_Mutation_p.P83H	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	95							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GAATGTTGGGGGCTGCTTGGG	0.647																																					p.P95H		Atlas-SNP	.											.	PHF21B	61	.	0			c.C284A						PASS	.						43.0	48.0	46.0					22																	45312440		2202	4300	6502	SO:0001583	missense	112885	exon4			GTTGGGGGCTGCT	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.284C>A	chr22.hg19:g.45312440G>T	ENSP00000324403:p.Pro95His	134.0	0.0	.		85.0	30.0	.	NM_138415	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	ENST00000313237.5	hg19	CCDS14061.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671013	0.88348	.	.	ENSG00000056487	ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000420689	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	5.06	5.06	0.68205	.	0.076937	0.51477	D	0.000089	T	0.47619	0.1455	L	0.54323	1.7	0.47065	D	0.999309	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;P	0.68621	0.919;0.959;0.943;0.885	T	0.48636	-0.9018	10	0.87932	D	0	0.0639	18.4696	0.90767	0.0:0.0:1.0:0.0	.	83;95;83;95	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2	.;.;.;PF21B_HUMAN	H	95;95;83;83;83	ENSP00000324403:P95H;ENSP00000379410:P95H;ENSP00000385105:P83H;ENSP00000388619:P83H;ENSP00000401294:P83H	ENSP00000324403:P95H	P	-	2	0	PHF21B	43691104	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.530000	0.90606	2.346000	0.79739	0.655000	0.94253	CCC	.	.	.	none		0.647	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415	
KLHL4	56062	hgsc.bcm.edu	37	X	86773063	86773063	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chrX:86773063C>G	ENST00000373119.4	+	1	312	c.167C>G	c.(166-168)tCt>tGt	p.S56C	KLHL4_ENST00000373114.4_Missense_Mutation_p.S56C	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	56						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						AAGAGCCACTCTCGGGACAGA	0.547																																					p.S56C		Atlas-SNP	.											.	KLHL4	263	.	0			c.C167G						PASS	.						77.0	65.0	69.0					X																	86773063		2203	4300	6503	SO:0001583	missense	56062	exon1			GCCACTCTCGGGA	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.167C>G	chrX.hg19:g.86773063C>G	ENSP00000362211:p.Ser56Cys	16.0	0.0	.		31.0	26.0	.	NM_019117	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	hg19	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752200	0.69533	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.76448	-1.02;-0.99	5.05	5.05	0.67936	.	2.035340	0.02405	N	0.081043	D	0.85894	0.5803	L	0.57536	1.79	0.58432	D	0.999993	B;P	0.42973	0.384;0.796	B;P	0.51415	0.345;0.669	T	0.71341	-0.4622	10	0.72032	D	0.01	.	16.3817	0.83467	0.0:1.0:0.0:0.0	.	56;56	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	C	56	ENSP00000362211:S56C;ENSP00000362206:S56C	ENSP00000362206:S56C	S	+	2	0	KLHL4	86659719	1.000000	0.71417	0.968000	0.41197	0.845000	0.48019	6.820000	0.75267	2.327000	0.79052	0.513000	0.50165	TCT	.	.	.	none		0.547	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
GAB3	139716	hgsc.bcm.edu	37	X	153928305	153928305	+	Silent	SNP	G	G	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chrX:153928305G>T	ENST00000369575.3	-	5	1127	c.1096C>A	c.(1096-1098)Cga>Aga	p.R366R	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Silent_p.R367R	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	366					macrophage differentiation (GO:0030225)			p.R366*(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CGCTTGTCTCGGTGTCTTAAG	0.393																																					p.R367R		Atlas-SNP	.											.	GAB3	73	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1099A						PASS	.						159.0	142.0	148.0					X																	153928305		2203	4300	6503	SO:0001819	synonymous_variant	139716	exon5			TGTCTCGGTGTCT	AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1096C>A	chrX.hg19:g.153928305G>T		84.0	0.0	.		137.0	7.0	.	NM_001081573	A6NHF8|E9PB44	Silent	SNP	ENST00000369575.3	hg19	CCDS14760.1																																																																																			.	.	.	none		0.393	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573	
MT-ND4	4538	hgsc.bcm.edu	37	M	10816	10816	+	Silent	SNP	A	A	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chrM:10816A>G	ENST00000361381.2	+	1	57	c.57A>G	c.(55-57)aaA>aaG	p.K19K	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	19					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						TGACTTTCCAAAAAGCACATA	0.363																																					p.K19K		Atlas-SNP	.											.	.	.	.	0			c.A57G						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			TTCCAAAAAACAC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.57A>G	chrM.hg19:g.10816A>G		0.0	0.0	.		5.0	5.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Silent	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.363	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
HAO1	54363	hgsc.bcm.edu	37	20	7886831	7886832	+	In_Frame_Ins	INS	-	-	TTT			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:7886831_7886832insTTT	ENST00000378789.3	-	4	741_742	c.690_691insAAA	c.(688-693)tcattg>tcaAAAttg	p.230_231SL>SKL		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	230	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						ACAATTGGCAATGATGTCAGTC	0.386																																					p.L231delinsKL		Atlas-INDEL	.											.	HAO1	71	.	0			c.691_692insAAA						PASS	.																																			SO:0001652	inframe_insertion	54363	exon4			.	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.690_691insAAA	chr20.hg19:g.7886831_7886832insTTT	ENSP00000368066:p.Ser230_Leu231insLys	120.0	0.0	0		183.0	51.0	0.278689	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	In_Frame_Ins	INS	ENST00000378789.3	hg19	CCDS13100.1																																																																																			.	.	.	none		0.386	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
PROM1	8842	hgsc.bcm.edu	37	4	15989284	15989287	+	Splice_Site	DEL	ACCA	ACCA	-			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	ACCA	ACCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr4:15989284_15989287delACCA	ENST00000510224.1	-	20	2377_2379	c.2129_2131delTGGT	c.(2128-2133)ttggta>tta	p.V711fs	PROM1_ENST00000508167.1_Splice_Site_p.V702fs|PROM1_ENST00000543373.1_Splice_Site_p.V702fs|PROM1_ENST00000539194.1_Splice_Site_p.V711fs|PROM1_ENST00000505450.1_Splice_Site_p.V702fs|PROM1_ENST00000447510.2_Splice_Site_p.V711fs|PROM1_ENST00000540805.1_Splice_Site_p.V711fs			O43490	PROM1_HUMAN	prominin 1	711					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						GTAAACCCTTACCAACAATCCATT	0.343																																					p.710_710del		Atlas-INDEL	.											.	PROM1	91	.	0			c.2130_2130del						PASS	.																																			SO:0001630	splice_region_variant	8842	exon19			.	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.2130+1TGGT>-	chr4.hg19:g.15989284_15989287delACCA		228.0	0.0	0		233.0	69.0	0.296137	NM_001145850	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Frame_Shift_Del	DEL	ENST00000510224.1	hg19	CCDS47029.1																																																																																			.	.	.	none		0.343	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	Frame_Shift_Del
BPIFB2	80341	hgsc.bcm.edu	37	20	31604905	31604906	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr20:31604905_31604906insT	ENST00000170150.3	+	7	769_770	c.574_575insT	c.(574-576)attfs	p.I192fs		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	192						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										GGGCACCTTAATTGGTAAGATC	0.619																																					p.I192fs		Atlas-INDEL	.											.	.	.	.	0			c.574_575insT						PASS	.																																			SO:0001589	frameshift_variant	80341	exon7			.	AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.576dupT	chr20.hg19:g.31604907_31604907dupT	ENSP00000170150:p.Ile192fs	143.0	0.0	0		111.0	35.0	0.315315	NM_025227	Q6UWN3|Q6ZME0|Q8NFQ7	Frame_Shift_Ins	INS	ENST00000170150.3	hg19	CCDS13210.1																																																																																			.	.	.	none		0.619	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078652.2	NM_025227	
RNF165	494470	hgsc.bcm.edu	37	18	44013351	44013353	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr18:44013351_44013353delCCC	ENST00000269439.7	+	2	311_313	c.260_262delCCC	c.(259-264)accctg>atg	p.87_88TL>M	RNF165_ENST00000543885.1_Intron	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	87							zinc ion binding (GO:0008270)			NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		CCGCTGCCCACCCTGCAGTTCCA	0.7																																					p.87_87del		Atlas-INDEL	.											.	RNF165	34	.	0			c.259_261del						PASS	.																																			SO:0001651	inframe_deletion	494470	exon2			.	BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.260_262delCCC	chr18.hg19:g.44013351_44013353delCCC	ENSP00000269439:p.Thr87_Leu88delinsMet	51.0	0.0	0		49.0	15.0	0.306122	NM_152470	B3KVD1	In_Frame_Del	DEL	ENST00000269439.7	hg19	CCDS32823.1																																																																																			.	.	.	none		0.700	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445358.1	NM_152470	
SAMD4B	55095	hgsc.bcm.edu	37	19	39868382	39868391	+	Frame_Shift_Del	DEL	TCCCACTGAT	TCCCACTGAT	-	rs149585231		TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	TCCCACTGAT	TCCCACTGAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr19:39868382_39868391delTCCCACTGAT	ENST00000314471.6	+	10	2397_2406	c.1362_1371delTCCCACTGAT	c.(1360-1371)gctcccactgatfs	p.APTD454fs	SAMD4B_ENST00000598913.1_Frame_Shift_Del_p.APTD454fs|SAMD4B_ENST00000596368.1_Intron	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	454					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CAGCTCCAGCTCCCACTGATGGCAGTGAGC	0.648																																					p.454_457del		Atlas-INDEL	.											.	SAMD4B	48	.	0			c.1361_1370del						PASS	.																																			SO:0001589	frameshift_variant	55095	exon10			.		CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.1362_1371delTCCCACTGAT	chr19.hg19:g.39868382_39868391delTCCCACTGAT	ENSP00000317224:p.Ala454fs	110.0	0.0	0		61.0	10.0	0.163934	NM_018028	A5Z0M6|Q6P194	Frame_Shift_Del	DEL	ENST00000314471.6	hg19	CCDS33020.1																																																																																			.	.	.	none		0.648	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464467.1	NM_018028	
DOLK	22845	hgsc.bcm.edu	37	9	131708944	131708945	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr9:131708944_131708945insG	ENST00000372586.3	-	1	953_954	c.638_639insC	c.(637-639)ctgfs	p.L213fs	RP11-101E3.5_ENST00000482796.1_Intron|NUP188_ENST00000372577.2_5'Flank	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	213					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)			breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						CCACCAGTGTCAGAGAGCGCTT	0.55																																					p.L213fs		Atlas-INDEL	.											.	DOLK	39	.	0			c.639_640insC						PASS	.																																			SO:0001589	frameshift_variant	22845	exon1			.	AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.638_639insC	chr9.hg19:g.131708944_131708945insG	ENSP00000361667:p.Leu213fs	146.0	0.0	0		105.0	36.0	0.342857	NM_014908	Q5SRE6	Frame_Shift_Ins	INS	ENST00000372586.3	hg19	CCDS6915.1																																																																																			.	.	.	none		0.550	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054515.1	NM_014908	
HDGF	3068	hgsc.bcm.edu	37	1	156715103	156715104	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-7583-01A-11D-2136-08	TCGA-A4-7583-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b40c1178-c913-4b63-8863-f631473fffde	0a94c473-a646-42ca-9537-145517302063	g.chr1:156715103_156715104insA	ENST00000357325.5	-	2	463_464	c.149_150insT	c.(148-150)ttcfs	p.F50fs	HDGF_ENST00000368209.5_Frame_Shift_Ins_p.F43fs|HDGF_ENST00000537739.1_Frame_Shift_Ins_p.F50fs|HDGF_ENST00000465180.1_5'UTR|HDGF_ENST00000416666.2_Frame_Shift_Ins_p.F18fs|HDGF_ENST00000368206.5_Frame_Shift_Ins_p.F66fs	NM_004494.2	NP_004485.1	P51858	HDGF_HUMAN	hepatoma-derived growth factor	50	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription corepressor binding (GO:0001222)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CGTGGGTCCCGAAAAAAAAGAC	0.564																																					p.F66fs		Atlas-INDEL	.											.,2	HDGF	60	.	0			c.198_199insT						PASS	.																																			SO:0001589	frameshift_variant	3068	exon2			.	D16431	CCDS1156.1, CCDS44247.1, CCDS44248.1	1q23.1	2013-10-14	2010-03-19		ENSG00000143321	ENSG00000143321			4856	protein-coding gene	gene with protein product	"""high-mobility group protein 1-like"""	600339	"""hepatoma-derived growth factor (high-mobility group protein 1-like)"""			8833162	Standard	NM_004494		Approved	HMG1L2	uc001fpy.4	P51858	OTTHUMG00000041295	ENST00000357325.5:c.150dupT	chr1.hg19:g.156715111_156715111dupA	ENSP00000349878:p.Phe50fs	42.0	0.0	0		21.0	13.0	0.619048	NM_001126050	B3KU21|D3DVC9|Q5SZ07|Q5SZ08|Q5SZ09	Frame_Shift_Ins	INS	ENST00000357325.5	hg19	CCDS1156.1																																																																																			.	.	.	none		0.564	HDGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098946.1	NM_004494	
