#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
BAI2	576	hgsc.bcm.edu	37	1	32207416	32207416	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:32207416C>A	ENST00000373658.3	-	9	1911	c.1570G>T	c.(1570-1572)Gag>Tag	p.E524*	BAI2_ENST00000398542.1_Nonsense_Mutation_p.E457*|BAI2_ENST00000398538.1_Nonsense_Mutation_p.E512*|BAI2_ENST00000527361.1_Nonsense_Mutation_p.E524*|BAI2_ENST00000257070.4_Nonsense_Mutation_p.E524*|BAI2_ENST00000440175.2_Nonsense_Mutation_p.E166*|BAI2_ENST00000373655.2_Nonsense_Mutation_p.E524*|BAI2_ENST00000398547.1_Nonsense_Mutation_p.E457*|BAI2_ENST00000398556.3_Nonsense_Mutation_p.E472*	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	524	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CACCTCTTCTCACTACAAGGC	0.652																																					p.E524X		Atlas-SNP	.											.	BAI2	128	.	0			c.G1570T						PASS	.						95.0	100.0	98.0					1																	32207416		2203	4299	6502	SO:0001587	stop_gained	576	exon9			TCTTCTCACTACA	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.1570G>T	chr1.hg19:g.32207416C>A	ENSP00000362762:p.Glu524*	109.0	0.0	.		110.0	17.0	.	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Nonsense_Mutation	SNP	ENST00000373658.3	hg19	CCDS346.2	.	.	.	.	.	.	.	.	.	.	C	36	5.737223	0.96865	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125;ENST00000533175	.	.	.	4.95	4.95	0.65309	.	0.000000	0.39985	N	0.001213	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	17.3262	0.87248	0.0:1.0:0.0:0.0	.	.	.	.	X	472;457;524;524;457;524;524;166;512;462;503	.	ENSP00000257070:E524X	E	-	1	0	BAI2	31980003	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	5.765000	0.68834	2.457000	0.83068	0.561000	0.74099	GAG	.	.	.	none		0.652	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
TOE1	114034	hgsc.bcm.edu	37	1	45808095	45808095	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:45808095C>G	ENST00000372090.5	+	6	1115	c.532C>G	c.(532-534)Ctg>Gtg	p.L178V	MUTYH_ENST00000531105.1_5'Flank|MUTYH_ENST00000372115.3_5'Flank|TOE1_ENST00000495703.1_3'UTR|MUTYH_ENST00000456914.2_5'Flank|MUTYH_ENST00000372110.3_5'Flank|MUTYH_ENST00000488731.2_5'Flank|MUTYH_ENST00000372100.5_5'Flank|MUTYH_ENST00000372098.3_5'Flank|MUTYH_ENST00000354383.6_5'Flank|TESK2_ENST00000486676.1_5'Flank|MUTYH_ENST00000528013.2_5'Flank|MUTYH_ENST00000450313.1_5'Flank|MUTYH_ENST00000448481.1_5'Flank|MUTYH_ENST00000355498.2_5'Flank|TOE1_ENST00000539779.1_Missense_Mutation_p.L98V|MUTYH_ENST00000529984.1_5'Flank|MUTYH_ENST00000372104.1_5'Flank|MUTYH_ENST00000528332.2_5'Flank	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	178						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					GACCCTATTCCTGGAGCTAAT	0.552																																					p.L178V		Atlas-SNP	.											.	TOE1	27	.	0			c.C532G						PASS	.						97.0	100.0	99.0					1																	45808095		2203	4300	6503	SO:0001583	missense	114034	exon6			CTATTCCTGGAGC		CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.532C>G	chr1.hg19:g.45808095C>G	ENSP00000361162:p.Leu178Val	168.0	0.0	.		168.0	29.0	.	NM_025077	B4DEM6|Q6IA35|Q8IWN5|Q9H846	Missense_Mutation	SNP	ENST00000372090.5	hg19	CCDS521.1	.	.	.	.	.	.	.	.	.	.	C	9.622	1.133977	0.21123	.	.	ENSG00000132773	ENST00000372090;ENST00000539779	T;T	0.23552	1.9;1.9	5.79	4.88	0.63580	Ribonuclease H-like (1);	0.129811	0.53938	D	0.000050	T	0.24661	0.0598	L	0.36672	1.1	0.41103	D	0.985687	B;P;P	0.40398	0.164;0.716;0.716	B;B;B	0.42245	0.077;0.381;0.194	T	0.02358	-1.1171	10	0.27785	T	0.31	-8.8608	14.7036	0.69171	0.0:0.9309:0.0:0.0691	.	184;98;178	B4DP23;B4DEM6;Q96GM8	.;.;TOE1_HUMAN	V	178;98	ENSP00000361162:L178V;ENSP00000438900:L98V	ENSP00000361162:L178V	L	+	1	2	TOE1	45580682	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.049000	0.41288	1.455000	0.47813	0.655000	0.94253	CTG	.	.	.	none		0.552	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020517.1	NM_025077	
LPHN2	23266	hgsc.bcm.edu	37	1	82456455	82456455	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:82456455C>G	ENST00000370728.1	+	25	4651	c.4006C>G	c.(4006-4008)Ctg>Gtg	p.L1336V	LPHN2_ENST00000370717.2_Missense_Mutation_p.L1351V|LPHN2_ENST00000370725.1_Missense_Mutation_p.L1351V|LPHN2_ENST00000394879.1_Missense_Mutation_p.L1338V|LPHN2_ENST00000370721.1_Missense_Mutation_p.L1261V|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370723.1_Missense_Mutation_p.L1338V|LPHN2_ENST00000319517.6_Missense_Mutation_p.L1280V|LPHN2_ENST00000370730.1_Missense_Mutation_p.L1293V|LPHN2_ENST00000271029.4_Missense_Mutation_p.L1308V|LPHN2_ENST00000370715.1_3'UTR|LPHN2_ENST00000359929.3_Missense_Mutation_p.L1280V|LPHN2_ENST00000370727.1_Missense_Mutation_p.L1308V|LPHN2_ENST00000370713.1_3'UTR|LPHN2_ENST00000335786.5_Missense_Mutation_p.L1293V			O95490	LPHN2_HUMAN	latrophilin 2	1336					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TCACTCCCTTCTGTACCAACC	0.527																																					p.L1280V		Atlas-SNP	.											.	LPHN2	464	.	0			c.C3838G						PASS	.						84.0	87.0	86.0					1																	82456455		2203	4300	6503	SO:0001583	missense	23266	exon20			TCCCTTCTGTACC	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.4006C>G	chr1.hg19:g.82456455C>G	ENSP00000359763:p.Leu1336Val	142.0	0.0	.		165.0	44.0	.	NM_012302	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	hg19		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	13.57|13.57|13.57	2.275917|2.275917|2.275917	0.40294|0.40294|0.40294	.|.|.	.|.|.	ENSG00000117114|ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786|ENST00000402328	.|T;T;T;T;T;T;T;T;T;T;T;T|.	.|0.72835|.	.|-0.52;-0.53;-0.69;-0.63;-0.47;-0.43;-0.63;-0.63;-0.47;-0.43;-0.63;-0.69|.	5.67|5.67|5.67	5.67|5.67|5.67	0.87782|0.87782|0.87782	.|.|.	.|0.000000|.	.|0.64402|.	.|D|.	.|0.000011|.	T|T|T	0.68375|0.68375|0.68375	0.2994|0.2994|0.2994	M|M|M	0.62723|0.62723|0.62723	1.935|1.935|1.935	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|P;D|.	.|0.69078|.	.|0.663;0.997|.	.|B;D|.	.|0.76071|.	.|0.395;0.987|.	T|T|T	0.64841|0.64841|0.64841	-0.6312|-0.6312|-0.6312	5|10|5	.|0.59425|.	.|D|.	.|0.04|.	.|.|.	19.773|19.773|19.773	0.96379|0.96379|0.96379	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|1280;260|.	.|O95490-2;B3KVU1|.	.|.;.|.	L|V|C	1227|1261;1336;1293;1308;1351;1338;1280;1280;1351;1338;1308;1293|347	.|ENSP00000359756:L1261V;ENSP00000359763:L1336V;ENSP00000359765:L1293V;ENSP00000359762:L1308V;ENSP00000359760:L1351V;ENSP00000359758:L1338V;ENSP00000353006:L1280V;ENSP00000322270:L1280V;ENSP00000359752:L1351V;ENSP00000378344:L1338V;ENSP00000271029:L1308V;ENSP00000337306:L1293V|.	.|ENSP00000271029:L1308V|.	F|L|S	+|+|+	3|1|2	2|2|0	LPHN2|LPHN2|LPHN2	82229043|82229043|82229043	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.988000|0.988000|0.988000	0.76386|0.76386|0.76386	5.773000|5.773000|5.773000	0.68898|0.68898|0.68898	2.677000|2.677000|2.677000	0.91161|0.91161|0.91161	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TTC|CTG|TCT	.	.	.	none		0.527	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	
CIART	148523	hgsc.bcm.edu	37	1	150259000	150259000	+	Silent	SNP	T	T	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:150259000T>A	ENST00000290363.5	+	5	1241	c.792T>A	c.(790-792)acT>acA	p.T264T	C1orf51_ENST00000369094.1_Silent_p.T176T|C1orf51_ENST00000369095.1_Silent_p.T264T	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		264					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCCACACCACTCCAATTTGCA	0.522																																					p.T264T		Atlas-SNP	.											.	C1orf51	35	.	0			c.T792A						PASS	.						243.0	190.0	208.0					1																	150259000		2203	4300	6503	SO:0001819	synonymous_variant	148523	exon5			CACCACTCCAATT																												ENST00000290363.5:c.792T>A	chr1.hg19:g.150259000T>A		161.0	0.0	.		183.0	35.0	.	NM_144697	B2RD43|D3DV01|Q8N795|Q96MG6	Silent	SNP	ENST00000290363.5	hg19	CCDS949.1																																																																																			.	.	.	none		0.522	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035058.1		
CRTC2	200186	hgsc.bcm.edu	37	1	153924520	153924520	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:153924520C>A	ENST00000368633.1	-	10	1098	c.971G>T	c.(970-972)gGc>gTc	p.G324V	CRTC2_ENST00000368630.3_Intron|CRTC2_ENST00000476883.1_5'Flank	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	324				MGL -> HGP (in Ref. 1; AAQ98857). {ECO:0000305}.	gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGGGCCCAGGCCCATGCCCCT	0.607																																					p.G324V		Atlas-SNP	.											.	CRTC2	58	.	0			c.G971T						PASS	.						58.0	57.0	57.0					1																	153924520		2203	4300	6503	SO:0001583	missense	200186	exon10			CCCAGGCCCATGC	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.971G>T	chr1.hg19:g.153924520C>A	ENSP00000357622:p.Gly324Val	95.0	0.0	.		108.0	14.0	.	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	hg19	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	c	6.593	0.477845	0.12521	.	.	ENSG00000160741	ENST00000368633	T	0.12774	2.65	4.84	3.92	0.45320	.	0.625789	0.15810	N	0.243526	T	0.05502	0.0145	L	0.36672	1.1	0.48830	D	0.999715	B	0.23249	0.082	B	0.21708	0.036	T	0.09185	-1.0686	10	0.66056	D	0.02	-3.8662	11.1372	0.48381	0.0:0.813:0.187:0.0	.	324	Q53ET0	CRTC2_HUMAN	V	324	ENSP00000357622:G324V	ENSP00000357622:G324V	G	-	2	0	CRTC2	152191144	0.420000	0.25457	0.997000	0.53966	0.095000	0.18619	0.767000	0.26575	1.028000	0.39785	0.450000	0.29827	GGC	.	.	.	none		0.607	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
BRINP3	339479	hgsc.bcm.edu	37	1	190067269	190067269	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:190067269A>T	ENST00000367462.3	-	8	2411	c.2180T>A	c.(2179-2181)tTg>tAg	p.L727*	BRINP3_ENST00000534846.1_Nonsense_Mutation_p.L625*	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	727					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											ATGACGAAGCAAGCAAGAGAA	0.463																																					p.L727X		Atlas-SNP	.											.	FAM5C	343	.	0			c.T2180A						PASS	.						115.0	111.0	112.0					1																	190067269		2203	4300	6503	SO:0001587	stop_gained	339479	exon8			CGAAGCAAGCAAG	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2180T>A	chr1.hg19:g.190067269A>T	ENSP00000356432:p.Leu727*	146.0	0.0	.		129.0	14.0	.	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Nonsense_Mutation	SNP	ENST00000367462.3	hg19	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	A	37	6.250241	0.97412	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	.	.	.	5.72	4.6	0.57074	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7499	0.40470	0.9186:0.0:0.0814:0.0	.	.	.	.	X	727;625	.	ENSP00000356432:L727X	L	-	2	0	FAM5C	188333892	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.237000	0.95368	1.005000	0.39183	0.528000	0.53228	TTG	.	.	.	none		0.463	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
TAF1B	9014	hgsc.bcm.edu	37	2	10016047	10016047	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:10016047G>C	ENST00000263663.5	+	7	795	c.607G>C	c.(607-609)Gag>Cag	p.E203Q	TAF1B_ENST00000396242.3_Intron	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	203	N-terminal cyclin fold.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACAACGAAAGGAGAAGGGAAT	0.408																																					p.E203Q		Atlas-SNP	.											.	TAF1B	62	.	0			c.G607C						PASS	.						223.0	193.0	203.0					2																	10016047		2203	4300	6503	SO:0001583	missense	9014	exon7			CGAAAGGAGAAGG	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.607G>C	chr2.hg19:g.10016047G>C	ENSP00000263663:p.Glu203Gln	210.0	0.0	.		200.0	40.0	.	NM_005680	B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	ENST00000263663.5	hg19	CCDS33143.1	.	.	.	.	.	.	.	.	.	.	G	9.995	1.231767	0.22626	.	.	ENSG00000115750	ENST00000263663	T	0.01902	4.57	5.82	4.0	0.46444	.	0.254066	0.44285	D	0.000476	T	0.02807	0.0084	L	0.41236	1.265	0.80722	D	1	B;P	0.52316	0.172;0.952	B;P	0.46659	0.025;0.523	T	0.60419	-0.7267	9	.	.	.	-14.0229	5.6394	0.17554	0.1472:0.178:0.6747:0.0	.	203;203	Q53T94;Q53T94-2	TAF1B_HUMAN;.	Q	203	ENSP00000263663:E203Q	.	E	+	1	0	TAF1B	9933498	1.000000	0.71417	0.994000	0.49952	0.941000	0.58515	1.150000	0.31639	1.442000	0.47568	0.655000	0.94253	GAG	.	.	.	none		0.408	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2	NM_005680	
CAD	790	hgsc.bcm.edu	37	2	27460276	27460276	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:27460276G>A	ENST00000403525.1	+	27	4381	c.4237G>A	c.(4237-4239)Gaa>Aaa	p.E1413K	CAD_ENST00000264705.4_Missense_Mutation_p.E1476K			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCACCTGCGGGAACCAGGTGG	0.552																																					p.E1476K		Atlas-SNP	.											.	CAD	199	.	0			c.G4426A						PASS	.						87.0	84.0	85.0					2																	27460276		2203	4300	6503	SO:0001583	missense	790	exon28			CTGCGGGAACCAG	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4237G>A	chr2.hg19:g.27460276G>A	ENSP00000384510:p.Glu1413Lys	119.0	0.0	.		120.0	20.0	.	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	hg19		.	.	.	.	.	.	.	.	.	.	G	28.5	4.927886	0.92389	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	T;T	0.46063	0.88;0.88	4.91	4.01	0.46588	Dihydroorotase, conserved site (1);Amidohydrolase 1 (1);	0.167071	0.52532	D	0.000062	T	0.73249	0.3563	H	0.98111	4.15	0.80722	D	1	P;D	0.65815	0.941;0.995	P;P	0.62885	0.66;0.908	T	0.80306	-0.1438	10	0.33141	T	0.24	-0.4186	13.2019	0.59774	0.0:0.0:0.8392:0.1608	.	1413;1476	F8VPD4;P27708	.;PYR1_HUMAN	K	1476;1413	ENSP00000264705:E1476K;ENSP00000384510:E1413K	ENSP00000264705:E1476K	E	+	1	0	CAD	27313780	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.360000	0.97119	1.030000	0.39839	0.561000	0.74099	GAA	.	.	.	none		0.552	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
TSGA10	80705	hgsc.bcm.edu	37	2	99720473	99720473	+	Nonsense_Mutation	SNP	C	C	A	rs545440386	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:99720473C>A	ENST00000393483.3	-	10	1412	c.568G>T	c.(568-570)Gaa>Taa	p.E190*	TSGA10_ENST00000410001.1_Nonsense_Mutation_p.E190*|TSGA10_ENST00000355053.4_Nonsense_Mutation_p.E190*|TSGA10_ENST00000542655.1_Nonsense_Mutation_p.E190*|TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000539964.1_Nonsense_Mutation_p.E190*	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	190					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						AGTTCACTTTCGGTATCCATT	0.348																																					p.E190X		Atlas-SNP	.											.	TSGA10	81	.	0			c.G568T						PASS	.						240.0	212.0	222.0					2																	99720473		2202	4299	6501	SO:0001587	stop_gained	80705	exon9			CACTTTCGGTATC	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.568G>T	chr2.hg19:g.99720473C>A	ENSP00000377123:p.Glu190*	86.0	0.0	.		113.0	12.0	.	NM_182911	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Nonsense_Mutation	SNP	ENST00000393483.3	hg19	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	C	42	9.602630	0.99217	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482;ENST00000542655	.	.	.	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-16.4617	16.7002	0.85348	0.0:1.0:0.0:0.0	.	.	.	.	X	190	.	ENSP00000347161:E190X	E	-	1	0	TSGA10	99086905	0.986000	0.35501	0.969000	0.41365	0.988000	0.76386	2.774000	0.47694	2.801000	0.96364	0.650000	0.86243	GAA	.	.	.	none		0.348	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
DARS	1615	hgsc.bcm.edu	37	2	136736937	136736937	+	Splice_Site	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:136736937C>A	ENST00000264161.4	-	3	340		c.e3-1		DARS_ENST00000463008.1_Splice_Site|DARS_ENST00000537273.1_Splice_Site	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase						aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	AAAACTCGATCTGTAATAACA	0.318																																					.		Atlas-SNP	.											.	DARS	44	.	0			c.125-1G>T						PASS	.						105.0	108.0	107.0					2																	136736937		2203	4300	6503	SO:0001630	splice_region_variant	1615	exon4			CTCGATCTGTAAT	J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.125-1G>T	chr2.hg19:g.136736937C>A		93.0	0.0	.		124.0	25.0	.	NM_001349	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Splice_Site	SNP	ENST00000264161.4	hg19	CCDS2180.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.558088	0.27827	.	.	ENSG00000115866	ENST00000264161;ENST00000441323;ENST00000456565;ENST00000449218	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3312	0.83015	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DARS	136453407	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	5.328000	0.65887	2.655000	0.90218	0.462000	0.41574	.	.	.	.	none		0.318	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349	Intron
KIF5C	3800	hgsc.bcm.edu	37	2	149835496	149835496	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:149835496C>T	ENST00000435030.1	+	13	1722	c.1354C>T	c.(1354-1356)Cag>Tag	p.Q452*	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Nonsense_Mutation_p.Q357*|KIF5C_ENST00000397413.1_Nonsense_Mutation_p.Q220*			O60282	KIF5C_HUMAN	kinesin family member 5C	452					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		GATGTTGGATCAGGATGAGGT	0.353																																					p.Q452X		Atlas-SNP	.											.	KIF5C	166	.	0			c.C1354T						PASS	.						78.0	78.0	78.0					2																	149835496		1852	4105	5957	SO:0001587	stop_gained	3800	exon13			TTGGATCAGGATG	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.1354C>T	chr2.hg19:g.149835496C>T	ENSP00000393379:p.Gln452*	44.0	0.0	.		61.0	17.0	.	NM_004522	O95079|Q2YDC5	Nonsense_Mutation	SNP	ENST00000435030.1	hg19		.	.	.	.	.	.	.	.	.	.	C	39	7.391751	0.98255	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	.	.	.	X	452;357;355;220	.	ENSP00000334176:Q355X	Q	+	1	0	KIF5C	149543742	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.627000	0.83176	2.941000	0.99782	0.655000	0.94253	CAG	.	.	.	none		0.353	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522	
USP37	57695	hgsc.bcm.edu	37	2	219328058	219328058	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:219328058A>G	ENST00000258399.3	-	22	2910	c.2498T>C	c.(2497-2499)cTc>cCc	p.L833P	USP37_ENST00000418019.1_Missense_Mutation_p.L833P|USP37_ENST00000415516.1_Missense_Mutation_p.L739P|USP37_ENST00000454775.1_Missense_Mutation_p.L833P	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	833	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		AGCTCTTTTGAGGTCATCATC	0.318																																					p.L833P		Atlas-SNP	.											.	USP37	76	.	0			c.T2498C						PASS	.						107.0	106.0	106.0					2																	219328058		2203	4300	6503	SO:0001583	missense	57695	exon22			CTTTTGAGGTCAT	AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.2498T>C	chr2.hg19:g.219328058A>G	ENSP00000258399:p.Leu833Pro	99.0	0.0	.		87.0	5.0	.	NM_020935	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	ENST00000258399.3	hg19	CCDS2418.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.154173	0.57259	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019	T;T;T;T	0.55588	0.55;0.55;0.51;0.55	4.77	4.77	0.60923	Ubiquitin interacting motif (3);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.127314	0.53938	D	0.000041	T	0.65678	0.2714	L	0.59436	1.845	0.80722	D	1	D;D	0.62365	0.989;0.991	P;P	0.61658	0.892;0.881	T	0.68401	-0.5418	10	0.56958	D	0.05	-2.9498	14.7551	0.69557	1.0:0.0:0.0:0.0	.	739;833	Q86T82-2;Q86T82	.;UBP37_HUMAN	P	833;833;739;833	ENSP00000258399:L833P;ENSP00000393662:L833P;ENSP00000400902:L739P;ENSP00000396585:L833P	ENSP00000258399:L833P	L	-	2	0	USP37	219036302	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.305000	0.89960	2.127000	0.65507	0.477000	0.44152	CTC	.	.	.	none		0.318	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256779.3	NM_020935	
PTPRN	5798	hgsc.bcm.edu	37	2	220161767	220161767	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:220161767A>C	ENST00000295718.2	-	15	2416	c.2176T>G	c.(2176-2178)Tgt>Ggt	p.C726G	PTPRN_ENST00000423636.2_Missense_Mutation_p.C636G|PTPRN_ENST00000497977.1_5'Flank|PTPRN_ENST00000409251.3_Missense_Mutation_p.C697G|MIR153-1_ENST00000384914.1_RNA|AC114803.3_ENST00000417355.1_RNA	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	726	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GCGGTGGCACAGGTGTTTGGC	0.637																																					p.C726G		Atlas-SNP	.											.	PTPRN	138	.	0			c.T2176G						PASS	.						95.0	99.0	98.0					2																	220161767		2203	4300	6503	SO:0001583	missense	5798	exon15			TGGCACAGGTGTT		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2176T>G	chr2.hg19:g.220161767A>C	ENSP00000295718:p.Cys726Gly	80.0	0.0	.		75.0	21.0	.	NM_002846	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	hg19	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	A	12.22	1.872163	0.33069	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.14516	2.5;2.5;2.5	4.31	4.31	0.51392	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.250911	0.35179	N	0.003398	T	0.24044	0.0582	M	0.67397	2.05	0.39123	D	0.961697	D;B	0.60160	0.987;0.081	P;B	0.51385	0.668;0.078	T	0.06409	-1.0828	10	0.33940	T	0.23	.	13.3146	0.60399	1.0:0.0:0.0:0.0	.	697;726	Q6NSL1;Q16849	.;PTPRN_HUMAN	G	697;726;697;636	ENSP00000386638:C697G;ENSP00000295718:C726G;ENSP00000444244:C636G	ENSP00000295718:C726G	C	-	1	0	PTPRN	219870011	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.355000	0.52262	1.806000	0.52798	0.379000	0.24179	TGT	.	.	.	none		0.637	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
COL6A3	1293	hgsc.bcm.edu	37	2	238275884	238275884	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:238275884T>C	ENST00000295550.4	-	11	5398	c.4946A>G	c.(4945-4947)aAc>aGc	p.N1649S	COL6A3_ENST00000346358.4_Missense_Mutation_p.N1449S|COL6A3_ENST00000347401.3_Missense_Mutation_p.N1448S|COL6A3_ENST00000353578.4_Missense_Mutation_p.N1443S|COL6A3_ENST00000472056.1_Missense_Mutation_p.N1042S|COL6A3_ENST00000409809.1_Missense_Mutation_p.N1443S	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1649	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCTCCTGAAGTTGATGGAACC	0.438																																					p.N1649S		Atlas-SNP	.											.	COL6A3	608	.	0			c.A4946G						PASS	.						73.0	64.0	67.0					2																	238275884		2203	4300	6503	SO:0001583	missense	1293	exon11			CTGAAGTTGATGG	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4946A>G	chr2.hg19:g.238275884T>C	ENSP00000295550:p.Asn1649Ser	60.0	0.0	.		52.0	9.0	.	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	hg19	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.285417	0.40394	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66;-0.66	5.5	5.5	0.81552	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000018	T	0.65217	0.2670	N	0.05031	-0.125	0.46654	D	0.999143	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.87578	0.998;0.998;0.953	T	0.62469	-0.6848	10	0.02654	T	1	.	15.5966	0.76587	0.0:0.0:0.0:1.0	.	1042;1443;1649	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	S	1649;1448;1443;1042;1443;1449	ENSP00000295550:N1649S;ENSP00000315609:N1448S;ENSP00000315873:N1443S;ENSP00000418285:N1042S;ENSP00000386844:N1443S;ENSP00000295546:N1449S	ENSP00000295550:N1649S	N	-	2	0	COL6A3	237940623	1.000000	0.71417	0.994000	0.49952	0.786000	0.44442	4.105000	0.57797	2.080000	0.62538	0.533000	0.62120	AAC	.	.	.	none		0.438	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
SETD5	55209	hgsc.bcm.edu	37	3	9512542	9512542	+	Silent	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:9512542T>C	ENST00000406341.1	+	18	3314	c.3124T>C	c.(3124-3126)Ttg>Ctg	p.L1042L	SETD5_ENST00000302463.6_Silent_p.L944L|SETD5_ENST00000407969.1_Silent_p.L1061L|SETD5_ENST00000402466.1_Silent_p.L944L|SETD5_ENST00000402198.1_Silent_p.L1042L			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1042										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TCGTGGATCCTTGTCACCTGG	0.478																																					p.L1042L		Atlas-SNP	.											.	SETD5	210	.	0			c.T3124C						PASS	.						24.0	23.0	23.0					3																	9512542		1861	4094	5955	SO:0001819	synonymous_variant	55209	exon19			GGATCCTTGTCAC	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.3124T>C	chr3.hg19:g.9512542T>C		24.0	0.0	.		25.0	4.0	.	NM_001080517	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	ENST00000406341.1	hg19	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	T	8.531	0.871085	0.17322	.	.	ENSG00000168137	ENST00000399686;ENST00000421188	.	.	.	5.51	-0.229	0.13094	.	0.261170	0.47093	D	0.000242	T	0.54367	0.1854	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45673	-0.9245	5	.	.	.	-3.3658	8.5026	0.33168	0.5133:0.3613:0.0:0.1253	.	.	.	.	P	709;372	.	.	L	+	2	0	SETD5	9487542	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	1.768000	0.38511	0.028000	0.15324	-0.649000	0.03915	CTT	.	.	.	none		0.478	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
CAPN7	23473	hgsc.bcm.edu	37	3	15262464	15262464	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:15262464C>T	ENST00000253693.2	+	5	867	c.614C>T	c.(613-615)aCa>aTa	p.T205I		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	205					positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						CAGAGATACACAGCAGAAGAA	0.363																																					p.T205I		Atlas-SNP	.											.	CAPN7	63	.	0			c.C614T						PASS	.						59.0	59.0	59.0					3																	15262464		2203	4300	6503	SO:0001583	missense	23473	exon5			GATACACAGCAGA	AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.614C>T	chr3.hg19:g.15262464C>T	ENSP00000253693:p.Thr205Ile	51.0	0.0	.		65.0	16.0	.	NM_014296		Missense_Mutation	SNP	ENST00000253693.2	hg19	CCDS2624.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640356	0.87859	.	.	ENSG00000131375	ENST00000253693	T	0.43294	0.95	5.79	4.92	0.64577	.	0.109635	0.64402	D	0.000008	T	0.59959	0.2232	M	0.81802	2.56	0.58432	D	0.999998	D	0.62365	0.991	P	0.56823	0.807	T	0.65092	-0.6252	10	0.54805	T	0.06	-9.0239	12.9819	0.58568	0.0:0.9247:0.0:0.0753	.	205	Q9Y6W3	CAN7_HUMAN	I	205	ENSP00000253693:T205I	ENSP00000253693:T205I	T	+	2	0	CAPN7	15237468	1.000000	0.71417	0.555000	0.28281	0.997000	0.91878	7.223000	0.78033	1.465000	0.48006	0.555000	0.69702	ACA	.	.	.	none		0.363	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252105.2	NM_014296	
EXOSC7	23016	hgsc.bcm.edu	37	3	45048921	45048921	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:45048921C>T	ENST00000265564.7	+	7	673	c.625C>T	c.(625-627)Cgg>Tgg	p.R209W	CLEC3B_ENST00000490386.1_Intron|EXOSC7_ENST00000461361.1_3'UTR	NM_015004.3	NP_055819.2	Q15024	EXOS7_HUMAN	exosome component 7	209					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(193;0.00911)|KIRC - Kidney renal clear cell carcinoma(197;0.0509)|Kidney(197;0.064)		GATTGGCTATCGGCATGTGGT	0.612																																					p.R209W		Atlas-SNP	.											.	EXOSC7	19	.	0			c.C625T						PASS	.						62.0	53.0	56.0					3																	45048921		2203	4300	6503	SO:0001583	missense	23016	exon7			GGCTATCGGCATG	BC012831	CCDS2725.1	3p21.32	2010-05-07			ENSG00000075914	ENSG00000075914	3.1.13.-		28112	protein-coding gene	gene with protein product		606488				11719186, 11812149	Standard	NR_023353		Approved	hRrp42p, Rrp42p, RRP42, EAP1, KIAA0116, p8	uc003coi.2	Q15024	OTTHUMG00000133095	ENST00000265564.7:c.625C>T	chr3.hg19:g.45048921C>T	ENSP00000265564:p.Arg209Trp	57.0	0.0	.		31.0	10.0	.	NM_015004	Q96E72	Missense_Mutation	SNP	ENST00000265564.7	hg19	CCDS2725.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.879280	0.72294	.	.	ENSG00000075914	ENST00000265564	T	0.44482	0.92	5.77	4.82	0.62117	Exoribonuclease, phosphorolytic domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.62974	0.2472	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.66716	0.946;0.946	T	0.62525	-0.6836	10	0.38643	T	0.18	-14.1235	13.4903	0.61390	0.2342:0.7658:0.0:0.0	.	209;209	B2RDZ9;Q15024	.;EXOS7_HUMAN	W	209	ENSP00000265564:R209W	ENSP00000265564:R209W	R	+	1	2	EXOSC7	45023925	0.964000	0.33143	0.994000	0.49952	0.991000	0.79684	2.331000	0.43894	2.723000	0.93209	0.655000	0.94253	CGG	.	.	.	none		0.612	EXOSC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256754.2	NM_015004	
TREX1	11277	hgsc.bcm.edu	37	3	48508760	48508760	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:48508760A>T	ENST00000422277.2	+	1	1532	c.871A>T	c.(871-873)Aca>Tca	p.T291S	SHISA5_ENST00000465449.1_5'Flank|TREX1_ENST00000492235.1_3'UTR|TREX1_ENST00000444177.1_Missense_Mutation_p.T226S|TREX1_ENST00000456089.1_Missense_Mutation_p.T97S|TREX1_ENST00000433541.1_Missense_Mutation_p.T97S|TREX1_ENST00000436480.2_Missense_Mutation_p.T236S|TREX1_ENST00000296443.9_Missense_Mutation_p.T236S	NM_016381.4	NP_057465.1	Q9NSU2	TREX1_HUMAN	three prime repair exonuclease 1	291	Necessary for endoplasmic reticulum localization. {ECO:0000250}.				cell death (GO:0008219)|cellular response to interferon-beta (GO:0035458)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|innate immune response (GO:0045087)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	endoplasmic reticulum membrane (GO:0005789)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|3'-5'-exodeoxyribonuclease activity (GO:0008296)|adenyl deoxyribonucleotide binding (GO:0032558)|double-stranded DNA binding (GO:0003690)|exodeoxyribonuclease III activity (GO:0008853)|metal ion binding (GO:0046872)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein homodimerization activity (GO:0042803)|single-stranded DNA binding (GO:0003697)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|skin(3)	9				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GTATGGGGTCACAGCCTCTGC	0.617																																					p.T291S		Atlas-SNP	.											.	TREX1	17	.	0			c.A871T	GRCh37	CI075712	TREX1	I		PASS	.						97.0	83.0	88.0					3																	48508760		2203	4300	6503	SO:0001583	missense	11277	exon1			GGGGTCACAGCCT	AF151105	CCDS2769.1, CCDS59451.1	3p21.31	2014-09-17			ENSG00000213689	ENSG00000213689			12269	protein-coding gene	gene with protein product		606609	"""Aicardi-Goutieres syndrome 1"""	AGS1		10391904, 10393201, 16845398	Standard	NM_033629		Approved	DRN3	uc010hka.4	Q9NSU2	OTTHUMG00000156205	ENST00000422277.2:c.871A>T	chr3.hg19:g.48508760A>T	ENSP00000390478:p.Thr291Ser	101.0	0.0	.		93.0	12.0	.	NM_016381	B2RCN9|Q8TEU2|Q9BPW1|Q9Y4X2	Missense_Mutation	SNP	ENST00000422277.2	hg19	CCDS43086.1	.	.	.	.	.	.	.	.	.	.	A	19.05	3.752702	0.69533	.	.	ENSG00000213689	ENST00000296443;ENST00000433541;ENST00000436480;ENST00000422277;ENST00000444177;ENST00000456089	T;T;T;T;T;T	0.47528	1.49;0.84;1.49;1.44;1.49;0.84	5.1	-6.21	0.02065	.	.	.	.	.	T	0.32010	0.0815	L	0.54323	1.7	0.09310	N	1	B	0.24426	0.103	B	0.19391	0.025	T	0.34304	-0.9834	9	0.10902	T	0.67	.	6.7824	0.23654	0.2855:0.3313:0.3832:0.0	.	291	Q9NSU2	TREX1_HUMAN	S	236;97;236;291;226;97	ENSP00000296443:T236S;ENSP00000412404:T97S;ENSP00000392569:T236S;ENSP00000390478:T291S;ENSP00000415972:T226S;ENSP00000411331:T97S	ENSP00000296443:T236S	T	+	1	0	TREX1	48483764	0.000000	0.05858	0.000000	0.03702	0.852000	0.48524	-0.417000	0.07088	-1.057000	0.03201	0.459000	0.35465	ACA	.	.	.	none		0.617	TREX1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_016381	
VPS8	23355	hgsc.bcm.edu	37	3	184700420	184700420	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:184700420C>T	ENST00000437079.3	+	41	3658	c.3487C>T	c.(3487-3489)Cat>Tat	p.H1163Y	VPS8_ENST00000436792.2_Missense_Mutation_p.H1161Y|VPS8_ENST00000446204.2_Missense_Mutation_p.H1071Y|VPS8_ENST00000287546.4_Missense_Mutation_p.H1163Y	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1163							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AGCCATTCCTCATCTACACTC	0.393																																					p.H1163Y		Atlas-SNP	.											.	VPS8	109	.	0			c.C3487T						PASS	.						81.0	71.0	75.0					3																	184700420		1894	4126	6020	SO:0001583	missense	23355	exon40			ATTCCTCATCTAC	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3487C>T	chr3.hg19:g.184700420C>T	ENSP00000397879:p.His1163Tyr	65.0	0.0	.		71.0	13.0	.	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	hg19	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	C	0.295	-0.977536	0.02197	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	6.05	6.05	0.98169	.	0.769709	0.13007	N	0.421217	T	0.17789	0.0427	L	0.38175	1.15	0.24222	N	0.995432	B;B;B	0.13145	0.0;0.007;0.0	B;B;B	0.19391	0.0;0.025;0.001	T	0.09684	-1.0663	10	0.62326	D	0.03	-11.998	13.6828	0.62496	0.0:0.8456:0.1544:0.0	.	1163;1071;1161	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	Y	1163;1163;1161;1071	ENSP00000287546:H1163Y;ENSP00000397879:H1163Y;ENSP00000404704:H1161Y;ENSP00000405483:H1071Y	ENSP00000287546:H1163Y	H	+	1	0	VPS8	186183114	0.126000	0.22350	0.812000	0.32479	0.520000	0.34377	1.477000	0.35431	2.878000	0.98634	0.650000	0.86243	CAT	.	.	.	none		0.393	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
ABCG2	9429	hgsc.bcm.edu	37	4	89042889	89042889	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr4:89042889A>C	ENST00000237612.3	-	6	1132	c.587T>G	c.(586-588)aTa>aGa	p.I196R	ABCG2_ENST00000515655.1_Missense_Mutation_p.I196R	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	196	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	CTCCATTCCTATACTAGTCCT	0.398																																					p.I196R		Atlas-SNP	.											.	ABCG2	151	.	0			c.T587G						PASS	.						154.0	147.0	149.0					4																	89042889		2203	4300	6503	SO:0001583	missense	9429	exon6			ATTCCTATACTAG	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.587T>G	chr4.hg19:g.89042889A>C	ENSP00000237612:p.Ile196Arg	70.0	0.0	.		75.0	13.0	.	NM_004827	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	ENST00000237612.3	hg19	CCDS3628.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.478150	0.84747	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	D;D	0.96168	-3.93;-3.93	5.55	5.55	0.83447	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.98601	0.9532	H	0.97240	3.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.99755	1.1019	10	0.87932	D	0	-42.7755	15.3809	0.74654	1.0:0.0:0.0:0.0	.	196;196;196	Q9UNQ0-2;Q9UNQ0;Q4W5I3	.;ABCG2_HUMAN;.	R	196	ENSP00000426917:I196R;ENSP00000237612:I196R	ENSP00000237612:I196R	I	-	2	0	ABCG2	89261913	1.000000	0.71417	0.984000	0.44739	0.893000	0.52053	8.948000	0.93006	2.117000	0.64856	0.533000	0.62120	ATA	.	.	.	none		0.398	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827	
KIAA1109	84162	hgsc.bcm.edu	37	4	123156097	123156097	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr4:123156097G>T	ENST00000264501.4	+	27	3866	c.3493G>T	c.(3493-3495)Gag>Tag	p.E1165*	KIAA1109_ENST00000455637.1_Nonsense_Mutation_p.E1165*|KIAA1109_ENST00000388738.3_Nonsense_Mutation_p.E1165*|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	1165					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CACAAGTGCAGAGTCTGATAT	0.393																																					p.E1165X		Atlas-SNP	.											.	KIAA1109	424	.	0			c.G3493T						PASS	.						109.0	106.0	107.0					4																	123156097		1863	4108	5971	SO:0001587	stop_gained	84162	exon25			AGTGCAGAGTCTG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.3493G>T	chr4.hg19:g.123156097G>T	ENSP00000264501:p.Glu1165*	102.0	0.0	.		107.0	25.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Nonsense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.713265|7.713265	0.98447|0.98447	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	.|.	.|.	.|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	0.138537|.	0.28067|.	U|.	0.016735|.	.|T	.|0.74612	.|0.3739	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73956	.|-0.3819	.|3	0.14656|.	T|.	0.56|.	.|.	18.61|18.61	0.91281|0.91281	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1165|996	.|.	ENSP00000264501:E1165X|.	E|R	+|+	1|2	0|0	KIAA1109|KIAA1109	123375547|123375547	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.981000|0.981000	0.71138|0.71138	9.147000|9.147000	0.94646|0.94646	2.391000|2.391000	0.81399|0.81399	0.563000|0.563000	0.77884|0.77884	GAG|AGA	.	.	.	none		0.393	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
FASTKD3	79072	hgsc.bcm.edu	37	5	7867621	7867621	+	Silent	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:7867621A>G	ENST00000264669.5	-	2	712	c.576T>C	c.(574-576)ccT>ccC	p.P192P	MTRR_ENST00000440940.2_5'Flank|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000264668.2_5'Flank|FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000341013.6_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	192					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGCTACTTTGAGGATCCACAT	0.443																																					p.P192P		Atlas-SNP	.											.	FASTKD3	88	.	0			c.T576C						PASS	.						90.0	90.0	90.0					5																	7867621		2203	4300	6503	SO:0001819	synonymous_variant	79072	exon2			ACTTTGAGGATCC	AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.576T>C	chr5.hg19:g.7867621A>G		130.0	0.0	.		180.0	23.0	.	NM_024091	Q9BVD3	Silent	SNP	ENST00000264669.5	hg19	CCDS3873.1																																																																																			.	.	.	none		0.443	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091	
ADAMTS6	11174	hgsc.bcm.edu	37	5	64537954	64537954	+	IGR	SNP	T	T	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:64537954T>G								ADAMTS6 (43362 upstream) : ADAMTS6 (55080 downstream)																							TTTCCAGTTATAATACTTTCC	0.358																																					p.Y637S		Atlas-SNP	.											.	ADAMTS6	174	.	0			c.A1910C						PASS	.						97.0	101.0	100.0					5																	64537954		2203	4300	6503	SO:0001628	intergenic_variant	11174	exon15			CAGTTATAATACT																													chr5.hg19:g.64537954T>G		67.0	0.0	.		79.0	4.0	.	NM_197941		Missense_Mutation	SNP		hg19		.	.	.	.	.	.	.	.	.	.	T	16.74	3.205533	0.58234	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680	T;T	0.06608	3.28;7.39	5.62	5.62	0.85841	.	0.054793	0.85682	D	0.000000	T	0.12305	0.0299	M	0.71871	2.18	0.80722	D	1	B;B	0.22346	0.068;0.008	B;B	0.24848	0.056;0.034	T	0.01349	-1.1378	10	0.72032	D	0.01	.	15.8202	0.78633	0.0:0.0:0.0:1.0	.	637;637	D6R9L6;Q9UKP5	.;ATS6_HUMAN	S	637;587;637	ENSP00000370443:Y637S;ENSP00000423551:Y637S	ENSP00000261306:Y587S	Y	-	2	0	ADAMTS6	64573710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.581000	0.82535	2.139000	0.66308	0.460000	0.39030	TAT	.	.	.	none	0	0.358								
SPATA9	83890	hgsc.bcm.edu	37	5	94994451	94994451	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:94994451C>G	ENST00000274432.8	-	5	782	c.641G>C	c.(640-642)aGg>aCg	p.R214T	RFESD_ENST00000508206.1_Intron|SPATA9_ENST00000477047.2_Intron	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	214					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		CGGCAATGACCTATAAGGTTT	0.403																																					p.R214T		Atlas-SNP	.											.	SPATA9	17	.	0			c.G641C						PASS	.						102.0	98.0	99.0					5																	94994451		2203	4299	6502	SO:0001583	missense	83890	exon5			AATGACCTATAAG	AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.641G>C	chr5.hg19:g.94994451C>G	ENSP00000274432:p.Arg214Thr	51.0	0.0	.		62.0	10.0	.	NM_031952	A8K8H3|Q4G122|Q86X33|Q8NA28	Missense_Mutation	SNP	ENST00000274432.8	hg19	CCDS4076.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.491277	0.26774	.	.	ENSG00000145757	ENST00000274432	T	0.31510	1.49	5.37	5.37	0.77165	.	0.173364	0.39985	N	0.001210	T	0.31857	0.0810	L	0.27053	0.805	0.80722	D	1	P	0.51351	0.944	P	0.49999	0.628	T	0.02214	-1.1194	10	0.54805	T	0.06	-9.9082	14.4904	0.67647	0.0:1.0:0.0:0.0	.	214	Q9BWV2	SPAT9_HUMAN	T	214	ENSP00000274432:R214T	ENSP00000274432:R214T	R	-	2	0	SPATA9	95020207	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	2.187000	0.42602	2.808000	0.96608	0.650000	0.86243	AGG	.	.	.	none		0.403	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304036.1	NM_031952	
SLC36A2	153201	hgsc.bcm.edu	37	5	150701645	150701645	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:150701645A>T	ENST00000335244.4	-	9	1271	c.1142T>A	c.(1141-1143)cTg>cAg	p.L381Q	SLC36A2_ENST00000450886.1_Missense_Mutation_p.L105Q|SLC36A2_ENST00000521967.1_Missense_Mutation_p.L381Q	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	381					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	GGACAGATCCAGAGGCAGTGC	0.542																																					p.L381Q		Atlas-SNP	.											.	SLC36A2	71	.	0			c.T1142A						PASS	.						138.0	127.0	131.0					5																	150701645		2203	4300	6503	SO:0001583	missense	153201	exon9			AGATCCAGAGGCA	AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.1142T>A	chr5.hg19:g.150701645A>T	ENSP00000334223:p.Leu381Gln	130.0	0.0	.		147.0	31.0	.	NM_181776	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	ENST00000335244.4	hg19	CCDS4315.1	.	.	.	.	.	.	.	.	.	.	A	13.87	2.366710	0.41902	.	.	ENSG00000186335	ENST00000335244;ENST00000450886;ENST00000521967	T;T;T	0.11495	4.19;4.19;2.77	4.76	2.4	0.29515	.	0.920881	0.09207	N	0.833849	T	0.18383	0.0441	L	0.57536	1.79	0.31863	N	0.620713	P;B	0.45531	0.86;0.132	P;B	0.50314	0.637;0.158	T	0.16897	-1.0387	10	0.28530	T	0.3	-0.0361	8.697	0.34303	0.8453:0.0:0.1547:0.0	.	381;381	E5RJJ5;Q495M3	.;S36A2_HUMAN	Q	381;105;381	ENSP00000334223:L381Q;ENSP00000399479:L105Q;ENSP00000430535:L381Q	ENSP00000334223:L381Q	L	-	2	0	SLC36A2	150681838	0.997000	0.39634	0.549000	0.28204	0.633000	0.38033	4.784000	0.62411	0.426000	0.26116	0.460000	0.39030	CTG	.	.	.	none		0.542	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252437.1		
DOCK2	1794	hgsc.bcm.edu	37	5	169463529	169463529	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:169463529A>G	ENST00000256935.8	+	36	3715	c.3635A>G	c.(3634-3636)aAa>aGa	p.K1212R	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.K273R|DOCK2_ENST00000520908.1_Missense_Mutation_p.K704R	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1212	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AATTTCTACAAAGATAACAAC	0.423																																					p.K1212R		Atlas-SNP	.											.	DOCK2	389	.	0			c.A3635G						PASS	.						135.0	132.0	133.0					5																	169463529		2203	4300	6503	SO:0001583	missense	1794	exon36			TCTACAAAGATAA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3635A>G	chr5.hg19:g.169463529A>G	ENSP00000256935:p.Lys1212Arg	74.0	0.0	.		85.0	23.0	.	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.914002	0.72983	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.55930	0.49;0.49;0.49	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.53174	0.1780	M	0.69463	2.115	0.41312	D	0.987117	P;P	0.46859	0.885;0.468	B;B	0.41299	0.353;0.074	T	0.57510	-0.7799	10	0.38643	T	0.18	.	15.5299	0.75952	1.0:0.0:0.0:0.0	.	704;1212	E7ERW7;Q92608	.;DOCK2_HUMAN	R	1212;704;273	ENSP00000256935:K1212R;ENSP00000429283:K704R;ENSP00000438827:K273R	ENSP00000256935:K1212R	K	+	2	0	DOCK2	169396107	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.358000	0.90090	2.147000	0.66899	0.533000	0.62120	AAA	.	.	.	none		0.423	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
NSD1	64324	hgsc.bcm.edu	37	5	176696648	176696648	+	Silent	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:176696648C>T	ENST00000439151.2	+	16	5394	c.5349C>T	c.(5347-5349)aaC>aaT	p.N1783N	NSD1_ENST00000361032.4_Silent_p.N1680N|NSD1_ENST00000347982.4_Silent_p.N1514N|NSD1_ENST00000354179.4_Silent_p.N1514N	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1783	PWWP 2. {ECO:0000255|PROSITE- ProRule:PRU00162}.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TTCCTTCCAACATTGATAAGA	0.488			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.N1783N		Atlas-SNP	.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	416	.	0			c.C5349T	GRCh37	CD052485	NSD1	D		PASS	.						107.0	101.0	103.0					5																	176696648		2203	4300	6503	SO:0001819	synonymous_variant	64324	exon16	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	TTCCAACATTGAT	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5349C>T	chr5.hg19:g.176696648C>T		73.0	0.0	.		89.0	14.0	.	NM_022455	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	hg19	CCDS4412.1																																																																																			.	.	.	none		0.488	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
CLPS	1208	hgsc.bcm.edu	37	6	35765001	35765001	+	Missense_Mutation	SNP	C	C	G	rs140966197	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:35765001C>G	ENST00000259938.2	-	1	87	c.65G>C	c.(64-66)cGg>cCg	p.R22P		NM_001832.3	NP_001823.1	P04118	COL_HUMAN	colipase, pancreatic	22					lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme activator activity (GO:0008047)			large_intestine(2)|lung(2)|prostate(1)	5						AATGATCCCCCGGGGGCCAGG	0.587																																					p.R22P	Melanoma(167;2962 3494 37796)	Atlas-SNP	.											CLPS,NS,carcinoma,+1,1	CLPS	15	.	0			c.G65C						PASS	.						84.0	81.0	82.0					6																	35765001		2203	4300	6503	SO:0001583	missense	1208	exon1			ATCCCCCGGGGGC		CCDS4811.1, CCDS75437.1, CCDS75438.1	6p21.31	2012-02-06			ENSG00000137392	ENSG00000137392			2085	protein-coding gene	gene with protein product		120105				2045105	Standard	NM_001832		Approved		uc003ole.2	P04118	OTTHUMG00000014578	ENST00000259938.2:c.65G>C	chr6.hg19:g.35765001C>G	ENSP00000259938:p.Arg22Pro	118.0	0.0	.		153.0	13.0	.	NM_001252598	Q5T9G7|Q5U809	Missense_Mutation	SNP	ENST00000259938.2	hg19	CCDS4811.1	.	.	.	.	.	.	.	.	.	.	C	9.579	1.123120	0.20959	.	.	ENSG00000137392	ENST00000259938;ENST00000541088	T	0.36878	1.23	4.74	4.74	0.60224	Colipase, N-terminal (1);	0.240709	0.29486	N	0.012016	T	0.52468	0.1736	M	0.73962	2.25	0.42641	D	0.993411	D;B	0.89917	1.0;0.22	D;B	0.85130	0.997;0.117	T	0.56763	-0.7925	10	0.66056	D	0.02	-16.1424	14.5722	0.68218	0.0:1.0:0.0:0.0	.	22;22	G3V1M8;P04118	.;COL_HUMAN	P	22	ENSP00000259938:R22P	ENSP00000259938:R22P	R	-	2	0	CLPS	35872979	0.958000	0.32768	0.993000	0.49108	0.025000	0.11179	3.128000	0.50492	2.462000	0.83206	0.655000	0.94253	CGG	.	C|0.999;T|0.001	.	alt		0.587	CLPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040312.1	NM_001832	
GLTSCR1L	23506	hgsc.bcm.edu	37	6	42796705	42796705	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:42796705C>G	ENST00000314073.5	+	6	810	c.634C>G	c.(634-636)Caa>Gaa	p.Q212E	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.Q212E			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	212								p.Q212*(1)									TGGTTCTGGTCAAATACAGTT	0.418																																					p.Q212E		Atlas-SNP	.											KIAA0240,NS,carcinoma,0,1	.	.	.	1	Substitution - Nonsense(1)	lung(1)	c.C634G						PASS	.						149.0	143.0	145.0					6																	42796705		2203	4300	6503	SO:0001583	missense	23506	exon5			TCTGGTCAAATAC	AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.634C>G	chr6.hg19:g.42796705C>G	ENSP00000313933:p.Gln212Glu	215.0	0.0	.		221.0	35.0	.	NM_015349	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	hg19	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.510409	0.64522	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.35973	1.28;1.28	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000005	T	0.50599	0.1625	M	0.61703	1.905	0.58432	D	0.999998	P;D;D	0.61697	0.954;0.99;0.99	D;P;P	0.67900	0.954;0.848;0.848	T	0.36768	-0.9734	10	0.40728	T	0.16	-10.2526	19.7507	0.96267	0.0:1.0:0.0:0.0	.	212;212;212	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	E	212	ENSP00000313933:Q212E;ENSP00000377723:Q212E	ENSP00000313933:Q212E	Q	+	1	0	KIAA0240	42904683	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.946000	0.75953	2.722000	0.93159	0.655000	0.94253	CAA	.	.	.	none		0.418	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349	
MRPL2	51069	hgsc.bcm.edu	37	6	43023646	43023646	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:43023646A>C	ENST00000388752.3	-	5	1044	c.620T>G	c.(619-621)aTc>aGc	p.I207S	MRPL2_ENST00000230413.5_Missense_Mutation_p.I207S|MRPL2_ENST00000489623.1_Intron|CUL7_ENST00000535468.1_5'Flank|CUL7_ENST00000265348.3_5'Flank	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2	207					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		TGCAGCTCGGATATATTGGGC	0.567																																					p.I207S		Atlas-SNP	.											.	MRPL2	30	.	0			c.T620G						PASS	.						44.0	39.0	40.0					6																	43023646		2203	4300	6503	SO:0001583	missense	51069	exon5			GCTCGGATATATT	AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.620T>G	chr6.hg19:g.43023646A>C	ENSP00000373404:p.Ile207Ser	44.0	0.0	.		41.0	10.0	.	NM_015950	B2RC56|Q8WUL1|Q96Q56|Q9Y311	Missense_Mutation	SNP	ENST00000388752.3	hg19	CCDS34454.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.589723	0.86851	.	.	ENSG00000112651	ENST00000388752;ENST00000230413	T;T	0.44482	0.92;0.92	5.94	5.94	0.96194	Translation protein SH3-like (1);Translation protein SH3-like, subgroup (1);Ribosomal protein L2, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.47135	0.1429	L	0.49571	1.57	0.80722	D	1	D	0.63880	0.993	D	0.67382	0.951	T	0.37197	-0.9716	10	0.33141	T	0.24	-18.6054	14.9662	0.71196	1.0:0.0:0.0:0.0	.	207	Q5T653	RM02_HUMAN	S	207	ENSP00000373404:I207S;ENSP00000230413:I207S	ENSP00000230413:I207S	I	-	2	0	MRPL2	43131624	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.952000	0.93031	2.272000	0.75746	0.460000	0.39030	ATC	.	.	.	none		0.567	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040577.2		
SENP6	26054	hgsc.bcm.edu	37	6	76412443	76412443	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:76412443G>A	ENST00000447266.2	+	19	2849	c.2371G>A	c.(2371-2373)Gct>Act	p.A791T	SENP6_ENST00000370010.2_Missense_Mutation_p.A784T|SENP6_ENST00000370014.3_Missense_Mutation_p.A791T|SENP6_ENST00000541192.1_Intron	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	791	Protease.				protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				CCATGAAAATGCTGTCATACA	0.383																																					p.A791T		Atlas-SNP	.											.	SENP6	189	.	0			c.G2371A						PASS	.						59.0	55.0	56.0					6																	76412443		1832	4093	5925	SO:0001583	missense	26054	exon19			GAAAATGCTGTCA		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.2371G>A	chr6.hg19:g.76412443G>A	ENSP00000402527:p.Ala791Thr	58.0	0.0	.		62.0	11.0	.	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	hg19	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545641	0.27652	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000447266	T;T;T	0.12255	2.7;2.7;2.7	5.74	3.51	0.40186	.	0.723156	0.13837	N	0.359285	T	0.02494	0.0076	L	0.33485	1.01	0.24879	N	0.992236	B;B	0.06786	0.001;0.001	B;B	0.11329	0.004;0.006	T	0.41698	-0.9494	10	0.25751	T	0.34	-0.6313	0.5061	0.00588	0.197:0.1755:0.2906:0.3369	.	784;791	Q9GZR1-2;Q9GZR1	.;SENP6_HUMAN	T	784;791;791	ENSP00000359027:A784T;ENSP00000359031:A791T;ENSP00000402527:A791T	ENSP00000359027:A784T	A	+	1	0	SENP6	76469163	0.954000	0.32549	0.998000	0.56505	0.939000	0.58152	0.671000	0.25172	1.214000	0.43395	0.579000	0.79373	GCT	.	.	.	none		0.383	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
SHPRH	257218	hgsc.bcm.edu	37	6	146234630	146234630	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:146234630C>G	ENST00000367505.2	-	24	4574	c.4310G>C	c.(4309-4311)cGa>cCa	p.R1437P	SHPRH_ENST00000438092.2_Missense_Mutation_p.R1441P|SHPRH_ENST00000275233.7_Missense_Mutation_p.R1437P|SHPRH_ENST00000367503.3_Missense_Mutation_p.R1441P			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1437					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TCCTAGCTGTCGAGCACAGAT	0.308																																					p.R1441P		Atlas-SNP	.											.	SHPRH	169	.	0			c.G4322C						PASS	.						123.0	123.0	123.0					6																	146234630		1803	4069	5872	SO:0001583	missense	257218	exon24			AGCTGTCGAGCAC	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.4310G>C	chr6.hg19:g.146234630C>G	ENSP00000356475:p.Arg1437Pro	80.0	0.0	.		95.0	18.0	.	NM_173082	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	hg19	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415831	0.83449	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89	5.52	4.65	0.58169	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.088147	0.47455	D	0.000232	D	0.88514	0.6457	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89205	0.3560	10	0.51188	T	0.08	-9.0526	14.3892	0.66965	0.0:0.9287:0.0:0.0713	.	1437;1441	Q149N8;Q149N8-4	SHPRH_HUMAN;.	P	1437;1441;1441;1437	ENSP00000356475:R1437P;ENSP00000356473:R1441P;ENSP00000412797:R1441P;ENSP00000275233:R1437P	ENSP00000275233:R1437P	R	-	2	0	SHPRH	146276323	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.749000	0.62155	1.469000	0.48083	0.591000	0.81541	CGA	.	.	.	none		0.308	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
LPA	4018	hgsc.bcm.edu	37	6	161027563	161027563	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:161027563C>T	ENST00000316300.5	-	17	2775	c.2731G>A	c.(2731-2733)Gtc>Atc	p.V911I	LPA_ENST00000447678.1_Missense_Mutation_p.V911I			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3419	Kringle 8. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GGAGGCGCGACGGCAGTCCCT	0.547																																					p.V911I		Atlas-SNP	.											LPA,colon,carcinoma,0,1	LPA	237	.	0			c.G2731A						PASS	.						105.0	110.0	108.0					6																	161027563		2068	4257	6325	SO:0001583	missense	4018	exon18			GCGCGACGGCAGT	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2731G>A	chr6.hg19:g.161027563C>T	ENSP00000321334:p.Val911Ile	214.0	0.0	.		197.0	8.0	.	NM_005577	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	hg19	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	11.74	1.727367	0.30593	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62232	0.04;0.04	2.18	-2.62	0.06152	Kringle (1);Kringle-like fold (1);	.	.	.	.	T	0.21267	0.0512	L	0.38838	1.175	0.09310	N	1	P	0.50943	0.94	P	0.48089	0.566	T	0.26985	-1.0087	9	0.02654	T	1	.	0.3677	0.00374	0.2413:0.3112:0.2389:0.2086	.	3419	P08519	APOA_HUMAN	I	911	ENSP00000321334:V911I;ENSP00000395608:V911I	ENSP00000321334:V911I	V	-	1	0	LPA	160947553	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-2.331000	0.01110	-0.260000	0.09418	0.184000	0.17185	GTC	.	.	.	none		0.547	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
KIAA0895	23366	hgsc.bcm.edu	37	7	36396613	36396613	+	Silent	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:36396613G>A	ENST00000297063.6	-	3	815	c.765C>T	c.(763-765)ttC>ttT	p.F255F	KIAA0895_ENST00000436884.1_Silent_p.F104F|KIAA0895_ENST00000440378.1_Silent_p.F204F|KIAA0895_ENST00000317020.6_Silent_p.F204F|KIAA0895_ENST00000338533.5_Silent_p.F242F|KIAA0895_ENST00000453212.1_Intron|KIAA0895_ENST00000415803.2_Silent_p.F242F|KIAA0895_ENST00000480192.1_Intron	NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895	255										breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						AGTCAGATTTGAAGAATCTCA	0.393																																					p.F255F		Atlas-SNP	.											.	KIAA0895	89	.	0			c.C765T						PASS	.						103.0	95.0	97.0					7																	36396613		1840	4095	5935	SO:0001819	synonymous_variant	23366	exon3			AGATTTGAAGAAT	BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.765C>T	chr7.hg19:g.36396613G>A		85.0	0.0	.		79.0	11.0	.	NM_001100425	B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Silent	SNP	ENST00000297063.6	hg19	CCDS43570.1																																																																																			.	.	.	none		0.393	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337717.1	NM_015314	
URGCP	55665	hgsc.bcm.edu	37	7	43918082	43918082	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:43918082A>C	ENST00000453200.1	-	6	1473	c.980T>G	c.(979-981)aTt>aGt	p.I327S	URGCP_ENST00000443736.1_Missense_Mutation_p.I284S|URGCP_ENST00000447717.3_Missense_Mutation_p.I284S|URGCP_ENST00000223341.7_Missense_Mutation_p.I284S|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Missense_Mutation_p.I284S|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000402306.3_Missense_Mutation_p.I318S			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	327					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TTCTGGGAAAATGTCCAAGTC	0.512																																					p.I327S		Atlas-SNP	.											.	URGCP	170	.	0			c.T980G						PASS	.						69.0	70.0	70.0					7																	43918082		1897	4129	6026	SO:0001583	missense	55665	exon6			GGGAAAATGTCCA		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.980T>G	chr7.hg19:g.43918082A>C	ENSP00000396918:p.Ile327Ser	76.0	0.0	.		109.0	24.0	.	NM_001077663	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	ENST00000453200.1	hg19	CCDS47578.1	.	.	.	.	.	.	.	.	.	.	A	11.05	1.526247	0.27299	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.09630	2.96;2.96;2.96;2.96;2.96;2.96	5.66	5.66	0.87406	.	0.567596	0.17461	N	0.173449	T	0.10981	0.0268	L	0.47716	1.5	0.09310	N	1	B;B	0.30973	0.302;0.302	B;B	0.29942	0.109;0.109	T	0.20207	-1.0282	10	0.49607	T	0.09	-6.1339	8.3974	0.32566	0.913:0.0:0.087:0.0	.	318;327	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	S	284;284;318;284;327;284	ENSP00000223341:I284S;ENSP00000336872:I284S;ENSP00000384955:I318S;ENSP00000392136:I284S;ENSP00000396918:I327S;ENSP00000402803:I284S	ENSP00000223341:I284S	I	-	2	0	URGCP	43884607	0.050000	0.20438	0.044000	0.18714	0.845000	0.48019	3.327000	0.52045	2.158000	0.67659	0.482000	0.46254	ATT	.	.	.	none		0.512	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
RELN	5649	hgsc.bcm.edu	37	7	103629656	103629656	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:103629656C>T	ENST00000428762.1	-	1	307	c.148G>A	c.(148-150)Ggg>Agg	p.G50R	RELN_ENST00000424685.2_Missense_Mutation_p.G50R|RELN_ENST00000343529.5_Missense_Mutation_p.G50R	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	50	Reelin. {ECO:0000255|PROSITE- ProRule:PRU00363}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCCTGCTCCCCATCCCCTTCC	0.642																																					p.G50R	NSCLC(146;835 1944 15585 22231 52158)	Atlas-SNP	.											.	RELN	593	.	0			c.G148A						PASS	.						52.0	53.0	53.0					7																	103629656		2203	4300	6503	SO:0001583	missense	5649	exon1			GCTCCCCATCCCC		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.148G>A	chr7.hg19:g.103629656C>T	ENSP00000392423:p.Gly50Arg	90.0	0.0	.		112.0	20.0	.	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	hg19	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301758	0.81136	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.21361	2.01;2.01;2.01	4.63	4.63	0.57726	Reeler domain (1);	0.000000	0.64402	U	0.000010	T	0.32645	0.0836	N	0.19112	0.55	0.58432	D	0.999997	D;D	0.89917	0.999;1.0	D;D	0.75484	0.976;0.986	T	0.19095	-1.0316	10	0.52906	T	0.07	.	17.6802	0.88240	0.0:1.0:0.0:0.0	.	50;50	P78509-2;P78509	.;RELN_HUMAN	R	50	ENSP00000392423:G50R;ENSP00000345694:G50R;ENSP00000388446:G50R	ENSP00000345694:G50R	G	-	1	0	RELN	103416892	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.718000	0.74713	2.386000	0.81285	0.563000	0.77884	GGG	.	.	.	none		0.642	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
HAS2	3037	hgsc.bcm.edu	37	8	122641473	122641473	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr8:122641473A>T	ENST00000303924.4	-	2	645	c.108T>A	c.(106-108)ttT>ttA	p.F36L		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	36					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			CCGTTTGGATAAACTGGTAGC	0.423																																					p.F36L		Atlas-SNP	.											.	HAS2	87	.	0			c.T108A						PASS	.						88.0	85.0	86.0					8																	122641473		2203	4300	6503	SO:0001583	missense	3037	exon2			TTGGATAAACTGG	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.108T>A	chr8.hg19:g.122641473A>T	ENSP00000306991:p.Phe36Leu	95.0	0.0	.		90.0	16.0	.	NM_005328	Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	hg19	CCDS6335.1	.	.	.	.	.	.	.	.	.	.	A	8.872	0.949410	0.18356	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	T	0.37584	1.19	6.17	3.85	0.44370	.	0.042814	0.85682	D	0.000000	T	0.22166	0.0534	L	0.28192	0.835	0.53688	D	0.999978	B	0.09022	0.002	B	0.06405	0.002	T	0.05178	-1.0901	10	0.12430	T	0.62	-24.2374	9.8975	0.41327	0.809:0.0:0.191:0.0	.	36	Q92819	HAS2_HUMAN	L	36	ENSP00000306991:F36L	ENSP00000306991:F36L	F	-	3	2	HAS2	122710654	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	1.132000	0.31418	1.161000	0.42604	-0.250000	0.11733	TTT	.	.	.	none		0.423	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
COL5A1	1289	hgsc.bcm.edu	37	9	137734002	137734002	+	Splice_Site	SNP	G	G	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr9:137734002G>C	ENST00000371817.3	+	66	5784		c.e66-1			NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1						axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CTCTTCCCCAGACCAAGAAAG	0.547																																					.		Atlas-SNP	.											.	COL5A1	323	.	0			c.5371-1G>C						PASS	.						89.0	81.0	83.0					9																	137734002		2203	4300	6503	SO:0001630	splice_region_variant	1289	exon66			TCCCCAGACCAAG	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.5371-1G>C	chr9.hg19:g.137734002G>C		82.0	0.0	.		100.0	12.0	.	NM_000093	Q15094|Q5SUX4	Splice_Site	SNP	ENST00000371817.3	hg19	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985830	0.74589	.	.	ENSG00000130635	ENST00000371817;ENST00000355306	.	.	.	4.42	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3629	0.87356	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL5A1	136873823	1.000000	0.71417	0.075000	0.20258	0.907000	0.53573	9.541000	0.98083	2.174000	0.68829	0.563000	0.77884	.	.	.	.	none		0.547	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	Intron
HTRA1	5654	hgsc.bcm.edu	37	10	124273843	124273843	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr10:124273843A>T	ENST00000368984.3	+	9	1539	c.1411A>T	c.(1411-1413)Atc>Ttc	p.I471F		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	471					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				AGATATCATGATCACAGTGAT	0.507																																					p.I471F		Atlas-SNP	.											.	HTRA1	40	.	0			c.A1411T						PASS	.						155.0	138.0	144.0					10																	124273843		2203	4300	6503	SO:0001583	missense	5654	exon9			ATCATGATCACAG	AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.1411A>T	chr10.hg19:g.124273843A>T	ENSP00000357980:p.Ile471Phe	100.0	0.0	.		99.0	20.0	.	NM_002775	D3DRE4|Q9UNS5	Missense_Mutation	SNP	ENST00000368984.3	hg19	CCDS7630.1	.	.	.	.	.	.	.	.	.	.	A	1.382	-0.583027	0.03827	.	.	ENSG00000166033	ENST00000368984;ENST00000435263;ENST00000420892	D;D	0.82893	-1.66;-1.66	5.48	1.75	0.24633	PDZ/DHR/GLGF (1);	0.119403	0.56097	D	0.000029	T	0.67636	0.2914	L	0.31371	0.925	0.51767	D	0.999938	B	0.06786	0.001	B	0.06405	0.002	T	0.51601	-0.8685	10	0.28530	T	0.3	-8.1432	3.9311	0.09285	0.4669:0.3415:0.0687:0.1228	.	471	Q92743	HTRA1_HUMAN	F	471;438;212	ENSP00000357980:I471F;ENSP00000412676:I212F	ENSP00000357980:I471F	I	+	1	0	HTRA1	124263833	0.991000	0.36638	0.304000	0.25085	0.093000	0.18481	0.396000	0.20867	0.043000	0.15746	-0.313000	0.08912	ATC	.	.	.	none		0.507	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	NM_002775	
CNTN1	1272	hgsc.bcm.edu	37	12	41327590	41327590	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:41327590A>C	ENST00000551295.2	+	9	1012	c.895A>C	c.(895-897)Aat>Cat	p.N299H	CNTN1_ENST00000347616.1_Missense_Mutation_p.N299H|CNTN1_ENST00000547702.1_Missense_Mutation_p.N299H|CNTN1_ENST00000547849.1_Missense_Mutation_p.N299H|CNTN1_ENST00000360099.3_Missense_Mutation_p.N299H|CNTN1_ENST00000348761.2_Missense_Mutation_p.N288H	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	299	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TAAGATCTTCAATATTCAGCT	0.408																																					p.N299H		Atlas-SNP	.											.	CNTN1	207	.	0			c.A895C						PASS	.						85.0	87.0	87.0					12																	41327590		2203	4299	6502	SO:0001583	missense	1272	exon9			ATCTTCAATATTC	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.895A>C	chr12.hg19:g.41327590A>C	ENSP00000447006:p.Asn299His	84.0	0.0	.		76.0	14.0	.	NM_001256063	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	hg19	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293171	0.80914	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36	5.24	5.24	0.73138	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	L	0.56124	1.755	0.54753	D	0.999986	D;D;D	0.89917	1.0;0.997;0.998	D;D;D	0.75484	0.986;0.968;0.981	T	0.54309	-0.8313	10	0.46703	T	0.11	.	15.4433	0.75204	1.0:0.0:0.0:0.0	.	299;288;299	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	H	299;299;299;299;299;288	ENSP00000448004:N299H;ENSP00000447006:N299H;ENSP00000448653:N299H;ENSP00000325660:N299H;ENSP00000353213:N299H;ENSP00000261160:N288H	ENSP00000325660:N299H	N	+	1	0	CNTN1	39613857	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.730000	0.91510	2.130000	0.65690	0.528000	0.53228	AAT	.	.	.	none		0.408	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
KRT77	374454	hgsc.bcm.edu	37	12	53097170	53097170	+	Silent	SNP	G	G	T	rs375217197		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:53097170G>T	ENST00000341809.3	-	1	77	c.49C>A	c.(49-51)Cgg>Agg	p.R17R	KRT77_ENST00000537195.1_5'UTR	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	17	Head.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CTATAAACCCGCCTGCTCATT	0.542																																					p.R17R		Atlas-SNP	.											.	KRT77	58	.	0			c.C49A						PASS	.						64.0	70.0	68.0					12																	53097170		2203	4300	6503	SO:0001819	synonymous_variant	374454	exon1			AAACCCGCCTGCT	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.49C>A	chr12.hg19:g.53097170G>T		78.0	0.0	.		70.0	19.0	.	NM_175078	Q7RTS8	Silent	SNP	ENST00000341809.3	hg19	CCDS8837.1																																																																																			.	.	.	alt		0.542	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078	
GCN1L1	10985	hgsc.bcm.edu	37	12	120599294	120599294	+	Splice_Site	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:120599294C>T	ENST00000300648.6	-	22	2448	c.2436G>A	c.(2434-2436)gaG>gaA	p.E812E		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	812					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGTACTCACCTCCTTCAGCT	0.512																																					p.E812E		Atlas-SNP	.											.	GCN1L1	207	.	0			c.G2436A						PASS	.						166.0	169.0	168.0					12																	120599294		2172	4262	6434	SO:0001630	splice_region_variant	10985	exon22			ACTCACCTCCTTC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.2436+1G>A	chr12.hg19:g.120599294C>T		120.0	0.0	.		119.0	10.0	.	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	ENST00000300648.6	hg19	CCDS41847.1																																																																																			.	.	.	none		0.512	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		Silent
NFKBIA	4792	hgsc.bcm.edu	37	14	35871629	35871629	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr14:35871629A>T	ENST00000216797.5	-	5	978	c.877T>A	c.(877-879)Tca>Aca	p.S293T	NFKBIA_ENST00000557100.1_5'Flank|NFKBIA_ENST00000557389.1_Missense_Mutation_p.S203T|NFKBIA_ENST00000557140.1_Missense_Mutation_p.S250T	NM_020529.2	NP_065390.1	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	293					apoptotic process (GO:0006915)|cellular response to cold (GO:0070417)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|cytoplasmic sequestering of transcription factor (GO:0042994)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein import into nucleus, translocation (GO:0000060)|regulation of cell proliferation (GO:0042127)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to exogenous dsRNA (GO:0043330)|response to muramyl dipeptide (GO:0032495)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|nuclear localization sequence binding (GO:0008139)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(1)|large_intestine(2)|liver(1)	7	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Acetylsalicylic acid(DB00945)	GTGAACTCTGACTCTGTGTCA	0.562																																					p.S293T		Atlas-SNP	.											.	NFKBIA	28	.	0			c.T877A						PASS	.						88.0	94.0	92.0					14																	35871629		2203	4300	6503	SO:0001583	missense	4792	exon5			ACTCTGACTCTGT		CCDS9656.1	14q13	2014-09-17			ENSG00000100906	ENSG00000100906		"""Ankyrin repeat domain containing"""	7797	protein-coding gene	gene with protein product		164008		NFKBI		1829648	Standard	NM_020529		Approved	IKBA, MAD-3, IkappaBalpha	uc001wtf.4	P25963	OTTHUMG00000140220	ENST00000216797.5:c.877T>A	chr14.hg19:g.35871629A>T	ENSP00000216797:p.Ser293Thr	144.0	0.0	.		145.0	24.0	.	NM_020529	B2R8L6	Missense_Mutation	SNP	ENST00000216797.5	hg19	CCDS9656.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.759198	0.49468	.	.	ENSG00000100906	ENST00000216797;ENST00000557140;ENST00000557389	T;T;T	0.46063	0.88;0.89;1.06	5.9	4.73	0.59995	Ankyrin repeat-containing domain (1);	.	.	.	.	T	0.28400	0.0702	L	0.29908	0.895	0.34457	D	0.701352	B;B	0.32467	0.372;0.145	B;B	0.30316	0.114;0.034	T	0.36915	-0.9728	9	0.35671	T	0.21	0.4354	7.8624	0.29517	0.7845:0.1395:0.0759:0.0	.	250;293	G3V3I4;P25963	.;IKBA_HUMAN	T	293;250;203	ENSP00000216797:S293T;ENSP00000451257:S250T;ENSP00000450514:S203T	ENSP00000216797:S293T	S	-	1	0	NFKBIA	34941380	1.000000	0.71417	0.820000	0.32676	0.916000	0.54674	3.478000	0.53158	1.015000	0.39444	0.533000	0.62120	TCA	.	.	.	none		0.562	NFKBIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276683.1	NM_020529	
SLC39A9	55334	hgsc.bcm.edu	37	14	69866098	69866098	+	Silent	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr14:69866098C>T	ENST00000336643.5	+	1	690	c.12C>T	c.(10-12)ttC>ttT	p.F4F	ERH_ENST00000555373.1_5'Flank|SLC39A9_ENST00000031146.4_Silent_p.F4F|SLC39A9_ENST00000555245.1_Intron|ERH_ENST00000216520.6_5'Flank|SLC39A9_ENST00000556605.1_Silent_p.F4F|ERH_ENST00000557016.1_5'Flank|SLC39A9_ENST00000557046.1_Silent_p.F4F	NM_018375.4	NP_060845.2	Q9NUM3	S39A9_HUMAN	solute carrier family 39, member 9	4					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.F4F(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|skin(1)|stomach(1)	14				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		TGGATGATTTCATCTCCATTA	0.438																																					p.F4F		Atlas-SNP	.											SLC39A9,NS,carcinoma,0,1	SLC39A9	27	.	1	Substitution - coding silent(1)	endometrium(1)	c.C12T						PASS	.						224.0	200.0	208.0					14																	69866098		2203	4300	6503	SO:0001819	synonymous_variant	55334	exon1			TGATTTCATCTCC		CCDS9795.1, CCDS58327.1, CCDS58328.1	14q24.1	2013-07-17	2013-07-17			ENSG00000029364		"""Solute carriers"""	20182	protein-coding gene	gene with protein product							Standard	NM_018375		Approved	FLJ11274	uc001xle.3	Q9NUM3		ENST00000336643.5:c.12C>T	chr14.hg19:g.69866098C>T		39.0	0.0	.		47.0	13.0	.	NM_001252150	G3V5J8|Q53HN3|Q5MJQ0|Q6P2Q1|Q86WY2	Silent	SNP	ENST00000336643.5	hg19	CCDS9795.1																																																																																			.	.	.	none		0.438	SLC39A9-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412446.1	NM_018375	
SLC28A2	9153	hgsc.bcm.edu	37	15	45561728	45561728	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr15:45561728A>C	ENST00000347644.3	+	14	1626	c.1561A>C	c.(1561-1563)Att>Ctt	p.I521L	CTD-2651B20.3_ENST00000561404.1_RNA|CTD-2651B20.3_ENST00000560344.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	521					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)			NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	GAAACAGTGGATTTCTGTAAG	0.433																																					p.I521L	NSCLC(92;493 1501 26361 28917 47116)	Atlas-SNP	.											.	SLC28A2	64	.	0			c.A1561C						PASS	.						96.0	90.0	92.0					15																	45561728		2198	4298	6496	SO:0001583	missense	9153	exon14			CAGTGGATTTCTG	U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.1561A>C	chr15.hg19:g.45561728A>C	ENSP00000315006:p.Ile521Leu	38.0	0.0	.		37.0	6.0	.	NM_004212	A8K7F9|O43239|Q52LZ0	Missense_Mutation	SNP	ENST00000347644.3	hg19	CCDS10121.1	.	.	.	.	.	.	.	.	.	.	A	17.79	3.475336	0.63737	.	.	ENSG00000137860	ENST00000347644	T	0.04454	3.62	6.17	3.87	0.44632	Na dependent nucleoside transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.05318	0.0141	N	0.20445	0.575	0.58432	D	0.999999	P	0.39551	0.678	P	0.46339	0.513	T	0.50381	-0.8835	10	0.48119	T	0.1	-12.9596	7.5865	0.27995	0.7845:0.1422:0.0733:0.0	.	521	O43868	S28A2_HUMAN	L	521	ENSP00000315006:I521L	ENSP00000315006:I521L	I	+	1	0	SLC28A2	43349020	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.369000	0.52365	0.559000	0.29153	0.533000	0.62120	ATT	.	.	.	none		0.433	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254219.2	NM_004212	
MTFMT	123263	hgsc.bcm.edu	37	15	65295424	65295424	+	Silent	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr15:65295424A>C	ENST00000220058.4	-	9	1159	c.1146T>G	c.(1144-1146)gtT>gtG	p.V382V		NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	382						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)			endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	GTTGCATAGCAACAGTTTTTT	0.348																																					p.V382V		Atlas-SNP	.											.	MTFMT	28	.	0			c.T1146G						PASS	.						111.0	98.0	102.0					15																	65295424		1825	4084	5909	SO:0001819	synonymous_variant	123263	exon9			CATAGCAACAGTT	AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.1146T>G	chr15.hg19:g.65295424A>C		38.0	0.0	.		56.0	9.0	.	NM_139242	B7Z734	Silent	SNP	ENST00000220058.4	hg19	CCDS45280.1																																																																																			.	.	.	none		0.348	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242	
C15orf27	123591	hgsc.bcm.edu	37	15	76484312	76484312	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr15:76484312G>A	ENST00000388942.3	+	9	1048	c.772G>A	c.(772-774)Gag>Aag	p.E258K		NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	258					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						TCCGCAGTTTGAGATCCGGCA	0.741																																					p.E258K		Atlas-SNP	.											.	C15orf27	32	.	0			c.G772A						PASS	.						8.0	10.0	9.0					15																	76484312		2045	4020	6065	SO:0001583	missense	123591	exon9			CAGTTTGAGATCC	AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.772G>A	chr15.hg19:g.76484312G>A	ENSP00000373594:p.Glu258Lys	43.0	0.0	.		49.0	9.0	.	NM_152335	Q8N993|Q96LL5	Missense_Mutation	SNP	ENST00000388942.3	hg19	CCDS10289.2	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818369	0.71028	.	.	ENSG00000169758	ENST00000388942	T	0.47869	0.83	4.58	4.58	0.56647	.	0.123666	0.56097	D	0.000027	T	0.67392	0.2888	M	0.73962	2.25	0.58432	D	0.999999	D;D	0.71674	0.998;0.996	D;D	0.80764	0.994;0.99	T	0.70590	-0.4830	10	0.52906	T	0.07	-5.2743	14.5154	0.67816	0.0:0.0:1.0:0.0	.	222;258	Q2M3C6-2;Q2M3C6	.;CO027_HUMAN	K	258	ENSP00000373594:E258K	ENSP00000373594:E258K	E	+	1	0	C15orf27	74271367	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	8.737000	0.91562	2.097000	0.63578	0.491000	0.48974	GAG	.	.	.	none		0.741	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286637.2	NM_152335	
CIITA	4261	hgsc.bcm.edu	37	16	10992818	10992818	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr16:10992818T>C	ENST00000324288.8	+	5	528	c.395T>C	c.(394-396)aTg>aCg	p.M132T	CIITA_ENST00000381835.5_Missense_Mutation_p.M132T|CIITA_ENST00000537380.1_3'UTR	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	132	Asp/Glu-rich (acidic).|Required for acetyltransferase activity.				aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						GGTGAGAGTATGGAGATGCCA	0.483			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.M132T		Atlas-SNP	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	.	0			c.T395C						PASS	.						183.0	172.0	176.0					16																	10992818		2197	4300	6497	SO:0001583	missense	4261	exon5			AGAGTATGGAGAT	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.395T>C	chr16.hg19:g.10992818T>C	ENSP00000316328:p.Met132Thr	141.0	0.0	.		137.0	15.0	.	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	hg19	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	T	5.450	0.268042	0.10349	.	.	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	T;T	0.70749	-0.51;1.78	3.81	2.68	0.31781	.	1.431470	0.05038	N	0.475874	T	0.52224	0.1721	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.30824	0.296;0.01;0.017;0.017;0.052;0.109	B;B;B;B;B;B	0.28849	0.095;0.005;0.014;0.014;0.047;0.021	T	0.44283	-0.9338	10	0.30078	T	0.28	.	5.0256	0.14383	0.0:0.1558:0.0:0.8442	.	132;132;132;132;133;132	F5H2J4;E9PFE0;A0N0N9;P33076;F2Z2G8;Q96KL4	.;.;.;C2TA_HUMAN;.;.	T	132;132;133;132	ENSP00000316328:M132T;ENSP00000371257:M132T	ENSP00000316328:M132T	M	+	2	0	CIITA	10900319	0.615000	0.27026	0.024000	0.17045	0.006000	0.05464	1.060000	0.30530	0.628000	0.30357	0.455000	0.32223	ATG	.	.	.	none		0.483	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
ZFHX3	463	hgsc.bcm.edu	37	16	72821615	72821615	+	Silent	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr16:72821615G>A	ENST00000268489.5	-	10	11232	c.10560C>T	c.(10558-10560)ggC>ggT	p.G3520G	RP5-991G20.1_ENST00000563328.2_RNA|RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Silent_p.G2606G|AC004943.1_ENST00000584072.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3520	Poly-Gly.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				cgccgccgccgccaccgccgc	0.706																																					p.G3520G		Atlas-SNP	.											ZFHX3,NS,carcinoma,0,1	ZFHX3	404	.	0			c.C10560T						PASS	.						10.0	14.0	12.0					16																	72821615		1455	3158	4613	SO:0001819	synonymous_variant	463	exon10			GCCGCCGCCACCG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.10560C>T	chr16.hg19:g.72821615G>A		56.0	0.0	.		81.0	4.0	.	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	hg19	CCDS10908.1																																																																																			.	.	.	none		0.706	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
GAN	8139	hgsc.bcm.edu	37	16	81411103	81411103	+	Missense_Mutation	SNP	C	C	T	rs368372086		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr16:81411103C>T	ENST00000568107.2	+	11	1858	c.1696C>T	c.(1696-1698)Cgc>Tgc	p.R566C		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	566					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				ATCCGACCTTCGCCGTACAGG	0.493																																					p.R566C	GBM(106;1239 1507 7582 9741 33976)	Atlas-SNP	.											.	GAN	59	.	0			c.C1696T						PASS	.	C	CYS/ARG	1,4401	2.1+/-5.4	0,1,2200	237.0	206.0	216.0		1696	5.6	0.9	16		216	0,8600		0,0,4300	no	missense	GAN	NM_022041.3	180	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	566/598	81411103	1,13001	2201	4300	6501	SO:0001583	missense	8139	exon11			GACCTTCGCCGTA	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.1696C>T	chr16.hg19:g.81411103C>T	ENSP00000476795:p.Arg566Cys	261.0	0.0	.		359.0	54.0	.	NM_022041		Missense_Mutation	SNP	ENST00000568107.2	hg19	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.524137	0.64747	2.27E-4	0.0	ENSG00000127688	ENST00000248272	T	0.76448	-1.02	5.58	5.58	0.84498	.	0.183579	0.47852	D	0.000209	T	0.70064	0.3181	N	0.14661	0.345	0.80722	D	1	D	0.69078	0.997	P	0.47470	0.548	T	0.70103	-0.4964	10	0.29301	T	0.29	.	19.5747	0.95438	0.0:1.0:0.0:0.0	.	566	Q9H2C0	GAN_HUMAN	C	566	ENSP00000248272:R566C	ENSP00000248272:R566C	R	+	1	0	GAN	79968604	1.000000	0.71417	0.950000	0.38849	0.726000	0.41606	4.573000	0.60893	2.631000	0.89168	0.467000	0.42956	CGC	.	.	.	weak		0.493	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3		
KRT9	3857	hgsc.bcm.edu	37	17	39726126	39726126	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:39726126C>A	ENST00000246662.4	-	3	932	c.867G>T	c.(865-867)aaG>aaT	p.K289N	KRT9_ENST00000588431.1_Missense_Mutation_p.K56N	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	289	Coil 1B.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.K289N(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				TATGATTCTTCTTGAGGGCCA	0.537																																					p.K289N		Atlas-SNP	.											KRT9,NS,carcinoma,0,1	KRT9	78	.	1	Substitution - Missense(1)	lung(1)	c.G867T						PASS	.						100.0	101.0	101.0					17																	39726126		2200	4295	6495	SO:0001583	missense	3857	exon3			ATTCTTCTTGAGG		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.867G>T	chr17.hg19:g.39726126C>A	ENSP00000246662:p.Lys289Asn	264.0	0.0	.		277.0	60.0	.	NM_000226	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	hg19	CCDS32654.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.974370	0.53720	.	.	ENSG00000171403	ENST00000246662	D	0.93547	-3.24	4.86	2.84	0.33178	Filament (1);	0.249082	0.20923	N	0.083245	D	0.95940	0.8678	M	0.86805	2.84	0.29942	N	0.821017	D	0.58268	0.982	P	0.59825	0.864	D	0.92785	0.6243	10	0.87932	D	0	.	11.0067	0.47637	0.0:0.8453:0.0:0.1547	.	289	P35527	K1C9_HUMAN	N	289	ENSP00000246662:K289N	ENSP00000246662:K289N	K	-	3	2	KRT9	36979652	1.000000	0.71417	0.925000	0.36789	0.365000	0.29674	1.620000	0.36976	0.452000	0.26830	0.491000	0.48974	AAG	.	.	.	none		0.537	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226	
PPM1D	8493	hgsc.bcm.edu	37	17	58740446	58740446	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:58740446G>T	ENST00000305921.3	+	6	1583	c.1351G>T	c.(1351-1353)Gag>Tag	p.E451*	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	451					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			GAATTTTTTAGAGGTTTCAGC	0.443											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.E451X		Atlas-SNP	.											.	PPM1D	50	.	0			c.G1351T						PASS	.						100.0	99.0	100.0					17																	58740446		2203	4300	6503	SO:0001587	stop_gained	8493	exon6			TTTTTAGAGGTTT	U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1351G>T	chr17.hg19:g.58740446G>T	ENSP00000306682:p.Glu451*	101.0	0.0	.	1033	142.0	42.0	.	NM_003620	Q53XP4|Q6P991|Q8IVR6	Nonsense_Mutation	SNP	ENST00000305921.3	hg19	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	G	39	7.470853	0.98306	.	.	ENSG00000170836	ENST00000305921	.	.	.	6.08	6.08	0.98989	.	0.064947	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-21.5774	13.8168	0.63297	0.0695:0.0:0.9305:0.0	.	.	.	.	X	451	.	ENSP00000306682:E451X	E	+	1	0	PPM1D	56095228	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.119000	0.64679	2.894000	0.99253	0.591000	0.81541	GAG	.	.	.	none		0.443	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620	
TANC2	26115	hgsc.bcm.edu	37	17	61490920	61490920	+	Silent	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:61490920G>T	ENST00000424789.2	+	22	3697	c.3693G>T	c.(3691-3693)gcG>gcT	p.A1231A	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Silent_p.A1241A|AC015923.1_ENST00000431604.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1231					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						CCACATGGGCGATGGCCACCT	0.488																																					p.A1231A		Atlas-SNP	.											TANC2_ENST00000389520,NS,carcinoma,0,2	TANC2	266	.	0			c.G3693T						PASS	.						42.0	41.0	41.0					17																	61490920		2039	4205	6244	SO:0001819	synonymous_variant	26115	exon22			ATGGGCGATGGCC	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.3693G>T	chr17.hg19:g.61490920G>T		14.0	0.0	.		28.0	4.0	.	NM_025185	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Silent	SNP	ENST00000424789.2	hg19	CCDS45754.1																																																																																			.	.	.	none		0.488	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		
ABCA8	10351	hgsc.bcm.edu	37	17	66928478	66928478	+	Missense_Mutation	SNP	T	T	C	rs149928780	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:66928478T>C	ENST00000269080.2	-	6	885	c.748A>G	c.(748-750)Agg>Ggg	p.R250G	ABCA8_ENST00000430352.2_Missense_Mutation_p.R250G|ABCA8_ENST00000586539.1_Missense_Mutation_p.R250G	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	250					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GCCTTCATCCTTTTCCTCTCT	0.393													T|||	2	0.000399361	0.0015	0.0	5008	,	,		20503	0.0		0.0	False		,,,				2504	0.0				p.R250G		Atlas-SNP	.											.	ABCA8	213	.	0			c.A748G						PASS	.	T	GLY/ARG	1,4405	2.1+/-5.4	0,1,2202	89.0	82.0	84.0		748	1.2	0.0	17	dbSNP_134	84	0,8600		0,0,4300	no	missense	ABCA8	NM_007168.2	125	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign	250/1582	66928478	1,13005	2203	4300	6503	SO:0001583	missense	10351	exon6			TCATCCTTTTCCT	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.748A>G	chr17.hg19:g.66928478T>C	ENSP00000269080:p.Arg250Gly	47.0	0.0	.		76.0	5.0	.	NM_007168	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	hg19	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	T	7.800	0.713528	0.15306	2.27E-4	0.0	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000428549	D;D	0.84070	-1.8;-1.8	4.86	1.22	0.21188	.	0.865701	0.09871	N	0.744923	T	0.76550	0.4003	L	0.55481	1.735	0.09310	N	1	B;B;B;B;B	0.27951	0.195;0.157;0.044;0.109;0.034	B;B;B;B;B	0.29524	0.089;0.103;0.038;0.098;0.044	T	0.65253	-0.6213	10	0.56958	D	0.05	.	3.7768	0.08663	0.3317:0.0923:0.0:0.576	.	189;250;250;250;250	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	G	250;250;189;250	ENSP00000269080:R250G;ENSP00000402814:R250G	ENSP00000269080:R250G	R	-	1	2	ABCA8	64440073	0.000000	0.05858	0.002000	0.10522	0.197000	0.23852	0.098000	0.15189	0.065000	0.16485	0.460000	0.39030	AGG	.	T|1.000;C|0.000	0.000	weak		0.393	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
ABCA5	23461	hgsc.bcm.edu	37	17	67304486	67304486	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:67304486C>G	ENST00000392676.3	-	5	557	c.493G>C	c.(493-495)Gct>Cct	p.A165P	ABCA5_ENST00000588877.1_Missense_Mutation_p.A165P|ABCA5_ENST00000392677.2_Missense_Mutation_p.A165P			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	165					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TACTGAGCAGCCTCACATGAT	0.378																																					p.A165P		Atlas-SNP	.											.	ABCA5	162	.	0			c.G493C						PASS	.						98.0	103.0	101.0					17																	67304486		2203	4300	6503	SO:0001583	missense	23461	exon4			GAGCAGCCTCACA	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.493G>C	chr17.hg19:g.67304486C>G	ENSP00000376443:p.Ala165Pro	170.0	0.0	.		174.0	23.0	.	NM_018672	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	hg19	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.710325	0.48517	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	T;T	0.39229	1.09;1.09	4.96	4.96	0.65561	.	0.108387	0.40908	D	0.000993	T	0.54727	0.1876	L	0.47190	1.495	0.49483	D	0.999799	D;D	0.63880	0.984;0.993	P;D	0.67725	0.877;0.953	T	0.51276	-0.8726	9	.	.	.	.	13.9115	0.63869	0.1528:0.8472:0.0:0.0	.	165;165	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	P	165	ENSP00000376444:A165P;ENSP00000376443:A165P	.	A	-	1	0	ABCA5	64816081	0.993000	0.37304	0.999000	0.59377	0.987000	0.75469	2.955000	0.49121	2.293000	0.77203	0.585000	0.79938	GCT	.	.	.	none		0.378	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
ZNF681	148213	hgsc.bcm.edu	37	19	23926507	23926507	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr19:23926507C>G	ENST00000402377.3	-	4	1986	c.1845G>C	c.(1843-1845)gaG>gaC	p.E615D	ZNF681_ENST00000395385.3_Missense_Mutation_p.E546D	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	615					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TGTAGAGTTTCTCACCAGTAT	0.333																																					p.E615D		Atlas-SNP	.											ZNF681,colon,carcinoma,0,2	ZNF681	76	.	0			c.G1845C						PASS	.						60.0	61.0	61.0					19																	23926507		2202	4300	6502	SO:0001583	missense	148213	exon4			GAGTTTCTCACCA	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1845G>C	chr19.hg19:g.23926507C>G	ENSP00000384000:p.Glu615Asp	16.0	0.0	.		27.0	4.0	.	NM_138286	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	hg19	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	8.238	0.806253	0.16467	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.34472	1.36;1.36	1.44	1.44	0.22558	Zinc finger, C2H2 (1);	.	.	.	.	T	0.31327	0.0793	L	0.49350	1.555	0.25356	N	0.988829	B	0.18013	0.025	B	0.17979	0.02	T	0.31447	-0.9943	9	0.62326	D	0.03	.	8.329	0.32175	0.0:1.0:0.0:0.0	.	615	Q96N22	ZN681_HUMAN	D	615;546	ENSP00000384000:E615D;ENSP00000378783:E546D	ENSP00000378783:E546D	E	-	3	2	ZNF681	23718347	0.416000	0.25424	0.017000	0.16124	0.114000	0.19823	0.067000	0.14510	0.754000	0.32968	0.205000	0.17691	GAG	.	.	.	none		0.333	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
SLC23A2	9962	hgsc.bcm.edu	37	20	4855238	4855238	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr20:4855238A>T	ENST00000379333.1	-	10	1321	c.929T>A	c.(928-930)cTg>cAg	p.L310Q	SLC23A2_ENST00000338244.1_Missense_Mutation_p.L310Q|SLC23A2_ENST00000468355.1_5'UTR|SLC23A2_ENST00000424750.2_Missense_Mutation_p.L196Q	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	310					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CATTTTGAACAGCTGTAACTT	0.383																																					p.L310Q		Atlas-SNP	.											.	SLC23A2	62	.	0			c.T929A						PASS	.						195.0	187.0	190.0					20																	4855238		2203	4300	6503	SO:0001583	missense	9962	exon10			TTGAACAGCTGTA	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.929T>A	chr20.hg19:g.4855238A>T	ENSP00000368637:p.Leu310Gln	213.0	0.0	.		181.0	28.0	.	NM_203327	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	ENST00000379333.1	hg19	CCDS13085.1	.	.	.	.	.	.	.	.	.	.	A	12.02	1.811425	0.32053	.	.	ENSG00000089057	ENST00000379333;ENST00000338244;ENST00000424750	T;T;T	0.21543	2.0;2.0;2.0	5.44	5.44	0.79542	.	0.062992	0.64402	D	0.000005	T	0.40694	0.1127	M	0.62088	1.915	0.58432	D	0.999999	D;D;D	0.59767	0.986;0.976;0.976	P;P;P	0.60789	0.876;0.879;0.879	T	0.28996	-1.0026	10	0.87932	D	0	-14.7288	14.3204	0.66482	1.0:0.0:0.0:0.0	.	196;310;310	B4DJZ1;A0MSJ5;Q9UGH3	.;.;S23A2_HUMAN	Q	310;310;196	ENSP00000368637:L310Q;ENSP00000344322:L310Q;ENSP00000406601:L196Q	ENSP00000344322:L310Q	L	-	2	0	SLC23A2	4803238	1.000000	0.71417	0.998000	0.56505	0.004000	0.04260	9.339000	0.96797	2.063000	0.61619	0.533000	0.62120	CTG	.	.	.	none		0.383	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
MYO18B	84700	hgsc.bcm.edu	37	22	26423002	26423002	+	Silent	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr22:26423002C>G	ENST00000407587.2	+	43	7234	c.7065C>G	c.(7063-7065)ctC>ctG	p.L2355L	MYO18B_ENST00000335473.7_Silent_p.L2354L|MYO18B_ENST00000536101.1_Silent_p.L2354L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2354						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GCGAGTCCCTCTTAGAATCCA	0.572																																					p.L2354L		Atlas-SNP	.											MYO18B,right_upper_lobe,carcinoma,0,1	MYO18B	322	.	0			c.C7062G						PASS	.						86.0	94.0	91.0					22																	26423002		1936	4137	6073	SO:0001819	synonymous_variant	84700	exon43			GTCCCTCTTAGAA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7065C>G	chr22.hg19:g.26423002C>G		185.0	0.0	.		200.0	48.0	.	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	C	3.671	-0.067510	0.07273	.	.	ENSG00000133454	ENST00000543971	.	.	.	4.89	-0.276	0.12902	.	.	.	.	.	T	0.40222	0.1108	.	.	.	0.31595	N	0.653425	.	.	.	.	.	.	T	0.47100	-0.9143	4	.	.	.	.	8.3531	0.32314	0.0:0.4167:0.4883:0.095	.	.	.	.	C	304	.	.	S	+	2	0	MYO18B	24753002	0.045000	0.20229	0.019000	0.16419	0.647000	0.38526	-0.357000	0.07651	-0.215000	0.10063	0.462000	0.41574	TCT	.	.	.	none		0.572	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
PKDREJ	10343	hgsc.bcm.edu	37	22	46653660	46653660	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr22:46653660T>G	ENST00000253255.5	-	1	5559	c.5560A>C	c.(5560-5562)Aat>Cat	p.N1854H		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1854					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GTAAATCCATTGGTACTCTCA	0.383																																					p.N1854H		Atlas-SNP	.											.	PKDREJ	195	.	0			c.A5560C						PASS	.						133.0	136.0	135.0					22																	46653660		2203	4300	6503	SO:0001583	missense	10343	exon1			ATCCATTGGTACT	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.5560A>C	chr22.hg19:g.46653660T>G	ENSP00000253255:p.Asn1854His	134.0	0.0	.		137.0	34.0	.	NM_006071	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	hg19	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	T	4.903	0.167837	0.09339	.	.	ENSG00000130943	ENST00000253255	T	0.70045	-0.45	4.51	-2.95	0.05564	Polycystin cation channel, PKD1/PKD2 (1);	1.774300	0.02687	N	0.110187	T	0.44371	0.1290	N	0.11560	0.145	0.09310	N	1	B	0.12013	0.005	B	0.15052	0.012	T	0.20940	-1.0260	10	0.30078	T	0.28	-0.4113	5.5709	0.17196	0.0:0.3289:0.2649:0.4062	.	1854	Q9NTG1	PKDRE_HUMAN	H	1854	ENSP00000253255:N1854H	ENSP00000253255:N1854H	N	-	1	0	PKDREJ	45032324	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.516000	0.06282	-0.535000	0.06307	0.374000	0.22700	AAT	.	.	.	none		0.383	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
PPP6R2	9701	hgsc.bcm.edu	37	22	50878437	50878437	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr22:50878437G>T	ENST00000216061.5	+	22	2703	c.2333G>T	c.(2332-2334)aGc>aTc	p.S778I	PPP6R2_ENST00000395744.3_Missense_Mutation_p.S751I|PPP6R2_ENST00000395741.3_Missense_Mutation_p.S752I|PPP6R2_ENST00000359139.3_Missense_Mutation_p.S752I			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	778						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						ACAGAATGCAGCCATGCTGAG	0.642																																					p.S778I		Atlas-SNP	.											.	PPP6R2	71	.	0			c.G2333T						PASS	.						42.0	42.0	42.0					22																	50878437		2203	4300	6503	SO:0001583	missense	9701	exon21			AATGCAGCCATGC	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.2333G>T	chr22.hg19:g.50878437G>T	ENSP00000216061:p.Ser778Ile	86.0	0.0	.		69.0	13.0	.	NM_001242898	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	hg19		.	.	.	.	.	.	.	.	.	.	G	16.34	3.095777	0.56075	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	4.84	2.68	0.31781	.	0.269718	0.36628	N	0.002493	T	0.63153	0.2487	M	0.70275	2.135	0.09310	N	1	D;D;D;D;D;D	0.71674	0.993;0.992;0.986;0.998;0.996;0.998	P;D;P;D;D;D	0.70716	0.877;0.917;0.828;0.956;0.917;0.97	T	0.55296	-0.8163	10	0.72032	D	0.01	-11.7634	10.2693	0.43473	0.0:0.1469:0.7006:0.1524	.	311;778;778;752;751;752	F2Z3M7;O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;.;PP6R2_HUMAN;.;.;.	I	752;752;751;778	ENSP00000352051:S752I;ENSP00000379090:S752I;ENSP00000379093:S751I;ENSP00000216061:S778I	ENSP00000216061:S778I	S	+	2	0	PPP6R2	49225303	0.020000	0.18652	0.001000	0.08648	0.015000	0.08874	1.601000	0.36773	0.523000	0.28482	0.561000	0.74099	AGC	.	.	.	none		0.642	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
FMR1	2332	hgsc.bcm.edu	37	X	147011651	147011651	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chrX:147011651T>A	ENST00000370475.4	+	7	646	c.518T>A	c.(517-519)aTc>aAc	p.I173N	FMR1_ENST00000334557.6_Missense_Mutation_p.I173N|FMR1_ENST00000218200.8_Missense_Mutation_p.I173N|FMR1_ENST00000440235.2_5'Flank|FMR1_ENST00000439526.2_Missense_Mutation_p.I173N|FMR1_ENST00000370471.3_Missense_Mutation_p.I173N|FMR1_ENST00000370470.1_Missense_Mutation_p.I173N|FMR1_ENST00000370477.1_Missense_Mutation_p.I173N	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	173					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					ATTTAGTCCATCAATGAAGTC	0.353									Fragile X syndrome																												p.I173N		Atlas-SNP	.											.	FMR1	93	.	0			c.T518A						PASS	.						116.0	99.0	105.0					X																	147011651		2203	4300	6503	SO:0001583	missense	2332	exon7	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	AGTCCATCAATGA	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.518T>A	chrX.hg19:g.147011651T>A	ENSP00000359506:p.Ile173Asn	69.0	0.0	.		47.0	4.0	.	NM_002024	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	ENST00000370475.4	hg19	CCDS14682.1	.	.	.	.	.	.	.	.	.	.	T	7.528	0.658159	0.14645	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000334557;ENST00000439526;ENST00000370470	T;T;T;T;T;T;T	0.56103	1.25;0.48;1.26;1.26;1.56;1.27;1.28	5.12	5.12	0.69794	.	0.053956	0.85682	D	0.000000	T	0.40119	0.1104	N	0.02011	-0.69	0.80722	D	1	B;P;B;D;D	0.62365	0.0;0.88;0.007;0.991;0.98	B;B;B;P;P	0.59889	0.001;0.296;0.008;0.865;0.805	T	0.45760	-0.9239	10	0.17832	T	0.49	-24.9991	13.3209	0.60432	0.0:0.0:0.0:1.0	.	173;173;89;173;173	Q8IXW7;Q06787;Q59GC1;Q06787-8;G3V0J0	.;FMR1_HUMAN;.;.;.	N	173	ENSP00000218200:I173N;ENSP00000359502:I173N;ENSP00000359508:I173N;ENSP00000359506:I173N;ENSP00000355115:I173N;ENSP00000395923:I173N;ENSP00000359501:I173N	ENSP00000218200:I173N	I	+	2	0	FMR1	146819343	1.000000	0.71417	0.999000	0.59377	0.830000	0.47004	6.149000	0.71795	1.808000	0.52836	0.430000	0.28490	ATC	.	.	.	none		0.353	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024	
SEC24A	10802	hgsc.bcm.edu	37	5	133997149	133997160	+	In_Frame_Del	DEL	CTCACAAACAAA	CTCACAAACAAA	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	CTCACAAACAAA	CTCACAAACAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:133997149_133997160delCTCACAAACAAA	ENST00000398844.2	+	2	726_737	c.438_449delCTCACAAACAAA	c.(436-450)gcctcacaaacaaac>gcc	p.SQTN147del	SEC24A_ENST00000322887.4_In_Frame_Del_p.SQTN147del	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	147	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CATCCACAGCCTCACAAACAAACCATTGTCCT	0.415																																					p.146_150del		Atlas-INDEL	.											.	SEC24A	77	.	0			c.437_448del						PASS	.																																			SO:0001651	inframe_deletion	10802	exon2			.	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.438_449delCTCACAAACAAA	chr5.hg19:g.133997149_133997160delCTCACAAACAAA	ENSP00000381823:p.Ser147_Asn150del	108.0	0.0	0		104.0	12.0	0.115385	NM_021982	A8MVW3|Q8WUV2|Q96GP7	In_Frame_Del	DEL	ENST00000398844.2	hg19	CCDS43363.1																																																																																			.	.	.	none		0.415	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
PCDH18	54510	hgsc.bcm.edu	37	4	138452043	138452043	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr4:138452043delA	ENST00000344876.4	-	1	1586	c.1200delT	c.(1198-1200)catfs	p.H400fs	PCDH18_ENST00000507846.1_Frame_Shift_Del_p.H180fs|PCDH18_ENST00000412923.2_Frame_Shift_Del_p.H400fs|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000511115.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	400	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					GACCATGTCCATGAAGCTTAC	0.348																																					p.G401fs		Atlas-INDEL	.											.	PCDH18	229	.	0			c.1201delG						PASS	.						100.0	106.0	104.0					4																	138452043		2203	4300	6503	SO:0001589	frameshift_variant	54510	exon1			.	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1200delT	chr4.hg19:g.138452043delA	ENSP00000355082:p.His400fs	80.0	0.0	0		88.0	13.0	0.147727	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Frame_Shift_Del	DEL	ENST00000344876.4	hg19	CCDS34064.1																																																																																			.	.	.	none		0.348	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
GAA	2548	hgsc.bcm.edu	37	17	78085893	78085894	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	CC	CC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:78085893_78085894delCC	ENST00000302262.3	+	12	1967_1968	c.1748_1749delCC	c.(1747-1749)tccfs	p.S583fs	GAA_ENST00000390015.3_Frame_Shift_Del_p.S583fs	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	583					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	GCCATCGCCTCCCACAGGTGAG	0.649																																					p.583_583del		Atlas-INDEL	.											.	GAA	66	.	0			c.1747_1748del	GRCh37	CM082761	GAA	M		PASS	.																																			SO:0001589	frameshift_variant	2548	exon13			.		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.1748_1749delCC	chr17.hg19:g.78085893_78085894delCC	ENSP00000305692:p.Ser583fs	108.0	0.0	0		107.0	20.0	0.186916	NM_001079803	Q09GN4|Q14351|Q16302|Q8IWE7	Frame_Shift_Del	DEL	ENST00000302262.3	hg19	CCDS32760.1																																																																																			.	.	.	none		0.649	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1		
TECTA	7007	hgsc.bcm.edu	37	11	120980039	120980039	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr11:120980039delA	ENST00000392793.1	+	4	589	c.318delA	c.(316-318)ggafs	p.G106fs	TECTA_ENST00000264037.2_Frame_Shift_Del_p.G106fs			O75443	TECTA_HUMAN	tectorin alpha	106	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGCACAATGGAATTCGAGGCG	0.498																																					p.G106fs		Atlas-INDEL	.											.	TECTA	329	.	0			c.317delG						PASS	.						105.0	97.0	100.0					11																	120980039		2203	4299	6502	SO:0001589	frameshift_variant	7007	exon3			.	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.318delA	chr11.hg19:g.120980039delA	ENSP00000376543:p.Gly106fs	72.0	0.0	0		76.0	19.0	0.25	NM_005422		Frame_Shift_Del	DEL	ENST00000392793.1	hg19	CCDS8434.1																																																																																			.	.	.	none		0.498	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
PPRC1	23082	hgsc.bcm.edu	37	10	103898442	103898442	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr10:103898442delA	ENST00000278070.2	+	3	448	c.409delA	c.(409-411)aatfs	p.N137fs	PPRC1_ENST00000370012.1_5'Flank|PPRC1_ENST00000413464.2_Frame_Shift_Del_p.N137fs	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GATCTTGGACAATGCAGATTC	0.532																																					p.D136fs		Atlas-INDEL	.											.	PPRC1	151	.	0			c.408delC						PASS	.						120.0	108.0	112.0					10																	103898442		2203	4300	6503	SO:0001589	frameshift_variant	23082	exon3			.	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.409delA	chr10.hg19:g.103898442delA	ENSP00000278070:p.Asn137fs	87.0	0.0	0		90.0	15.0	0.166667	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Frame_Shift_Del	DEL	ENST00000278070.2	hg19	CCDS7529.1																																																																																			.	.	.	none		0.532	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
CACNA1G	8913	hgsc.bcm.edu	37	17	48692731	48692732	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:48692731_48692732delGC	ENST00000359106.5	+	27	4769_4770	c.4769_4770delGC	c.(4768-4770)tgcfs	p.C1590fs	CACNA1G_ENST00000515765.1_Frame_Shift_Del_p.C1579fs|CACNA1G_ENST00000360761.4_Frame_Shift_Del_p.C1567fs|CACNA1G_ENST00000515165.1_Frame_Shift_Del_p.C1590fs|CACNA1G_ENST00000358244.5_Frame_Shift_Del_p.C1556fs|CACNA1G_ENST00000510366.1_Frame_Shift_Del_p.C1538fs|CACNA1G_ENST00000354983.4_Frame_Shift_Del_p.C1556fs|CACNA1G_ENST00000429973.2_Frame_Shift_Del_p.C1572fs|CACNA1G_ENST00000507896.1_Frame_Shift_Del_p.C1579fs|CACNA1G_ENST00000352832.5_Frame_Shift_Del_p.C1556fs|CACNA1G_ENST00000514181.1_Frame_Shift_Del_p.C1572fs|CACNA1G_ENST00000442258.2_Frame_Shift_Del_p.C1549fs|CACNA1G_ENST00000505165.1_Frame_Shift_Del_p.C1590fs|CACNA1G_ENST00000515411.1_Frame_Shift_Del_p.C1572fs|CACNA1G_ENST00000514717.1_Frame_Shift_Del_p.C1533fs|CACNA1G_ENST00000507510.2_Frame_Shift_Del_p.C1590fs|CACNA1G_ENST00000502264.1_Frame_Shift_Del_p.C1567fs|CACNA1G_ENST00000514079.1_Frame_Shift_Del_p.C1597fs|CACNA1G_ENST00000512389.1_Frame_Shift_Del_p.C1579fs|CACNA1G_ENST00000513964.1_Frame_Shift_Del_p.C1545fs|CACNA1G_ENST00000507609.1_Frame_Shift_Del_p.C1590fs|CACNA1G_ENST00000513689.2_Frame_Shift_Del_p.C1545fs|CACNA1G_ENST00000503485.1_Frame_Shift_Del_p.C1556fs|CACNA1G_ENST00000507336.1_Frame_Shift_Del_p.C1579fs|CACNA1G_ENST00000510115.1_Frame_Shift_Del_p.C1556fs	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1590					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GAAGCCCAGTGCAAACCTTACT	0.629																																					p.1597_1597del		Atlas-INDEL	.											.	CACNA1G	659	.	0			c.4789_4790del						PASS	.																																			SO:0001589	frameshift_variant	8913	exon27			.	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4769_4770delGC	chr17.hg19:g.48692731_48692732delGC	ENSP00000352011:p.Cys1590fs	50.0	0.0	0		75.0	13.0	0.173333	NM_001256325	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Frame_Shift_Del	DEL	ENST00000359106.5	hg19	CCDS45730.1																																																																																			.	.	.	none		0.629	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
PTCHD1	139411	hgsc.bcm.edu	37	X	23411958	23411959	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chrX:23411958_23411959insG	ENST00000379361.4	+	3	3183_3184	c.2323_2324insG	c.(2323-2325)tttfs	p.F775fs		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	775					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						GTTATCCACATTTGTTCTGGGC	0.371																																					p.F775fs		Atlas-INDEL	.											.	PTCHD1	213	.	0			c.2323_2324insG						PASS	.																																			SO:0001589	frameshift_variant	139411	exon3			.	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	Exception_encountered	chrX.hg19:g.23411958_23411959insG	ENSP00000368666:p.Phe775fs	55.0	0.0	0		44.0	19.0	0.431818	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Frame_Shift_Ins	INS	ENST00000379361.4	hg19	CCDS35215.2																																																																																			.	.	.	none		0.371	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
LCT	3938	hgsc.bcm.edu	37	2	136566494	136566494	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:136566494delT	ENST00000264162.2	-	8	3433	c.3423delA	c.(3421-3423)gaafs	p.E1141fs	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1141	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GGTCAGCGGCTTCCACATCTC	0.552																																					p.A1142fs		Atlas-INDEL	.											.	LCT	309	.	0			c.3424delG						PASS	.						71.0	75.0	74.0					2																	136566494		2203	4300	6503	SO:0001589	frameshift_variant	3938	exon8			.	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.3423delA	chr2.hg19:g.136566494delT	ENSP00000264162:p.Glu1141fs	128.0	0.0	0		159.0	21.0	0.132075	NM_002299	Q4ZG58	Frame_Shift_Del	DEL	ENST00000264162.2	hg19	CCDS2178.1																																																																																			.	.	.	none		0.552	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
