#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM200B	399474	hgsc.bcm.edu	37	1	29447533	29447533	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr1:29447533G>A	ENST00000420504.2	-	2	965	c.808C>T	c.(808-810)Ctt>Ttt	p.L270F	TMEM200B_ENST00000521452.1_Missense_Mutation_p.L270F	NM_001171868.1	NP_001165339.1	Q69YZ2	T200B_HUMAN	transmembrane protein 200B	270						integral component of membrane (GO:0016021)				ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.00765)|Lung NSC(340;0.0153)|all_lung(284;0.0173)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;7.32e-08)|COAD - Colon adenocarcinoma(152;4.92e-06)|STAD - Stomach adenocarcinoma(196;0.00618)|BRCA - Breast invasive adenocarcinoma(304;0.0501)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.126)		GGGGCCCCAAGGAGGAGCTCC	0.622																																					p.L270F		Atlas-SNP	.											.	TMEM200B	9	.	0			c.C808T						PASS	.						23.0	25.0	25.0					1																	29447533		2202	4300	6502	SO:0001583	missense	399474	exon2			CCCCAAGGAGGAG		CCDS30658.1	1p35	2007-12-18			ENSG00000253304	ENSG00000253304			33785	protein-coding gene	gene with protein product						15722956	Standard	NM_001003682		Approved	TTMB	uc001brn.2	Q69YZ2	OTTHUMG00000003658	ENST00000420504.2:c.808C>T	chr1.hg19:g.29447533G>A	ENSP00000428544:p.Leu270Phe	72.0	0.0	.		34.0	14.0	.	NM_001171868	Q6P2G8|Q6P2Q5	Missense_Mutation	SNP	ENST00000420504.2	hg19	CCDS30658.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.565457	0.65651	.	.	ENSG00000253304	ENST00000521452;ENST00000420504	.	.	.	4.15	4.15	0.48705	.	0.000000	0.35903	U	0.002907	T	0.64681	0.2620	L	0.27053	0.805	0.35733	D	0.818101	D	0.89917	1.0	D	0.80764	0.994	T	0.75133	-0.3425	9	0.87932	D	0	.	15.9517	0.79843	0.0:0.0:1.0:0.0	.	270	Q69YZ2	T200B_HUMAN	F	270	.	ENSP00000428544:L270F	L	-	1	0	TMEM200B	29320120	0.952000	0.32445	1.000000	0.80357	0.996000	0.88848	2.717000	0.47227	2.288000	0.76882	0.655000	0.94253	CTT	.	.	.	none		0.622	TMEM200B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010377.2	NM_001003682	
ABCA4	24	hgsc.bcm.edu	37	1	94548962	94548962	+	Silent	SNP	G	G	A			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr1:94548962G>A	ENST00000370225.3	-	7	890	c.804C>T	c.(802-804)atC>atT	p.I268I	ABCA4_ENST00000535735.1_Silent_p.I268I	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	268					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		ATCTCAGATTGATACCTTGAG	0.348																																					p.I268I		Atlas-SNP	.											.	ABCA4	275	.	0			c.C804T						PASS	.						188.0	206.0	200.0					1																	94548962		2203	4300	6503	SO:0001819	synonymous_variant	24	exon7			CAGATTGATACCT	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.804C>T	chr1.hg19:g.94548962G>A		393.0	1.0	.		257.0	119.0	.	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	hg19	CCDS747.1																																																																																			.	.	.	none		0.348	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
PTPN22	26191	hgsc.bcm.edu	37	1	114402065	114402065	+	Silent	SNP	A	A	G			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr1:114402065A>G	ENST00000359785.5	-	2	240	c.105T>C	c.(103-105)tcT>tcC	p.S35S	PTPN22_ENST00000528414.1_Silent_p.S35S|PTPN22_ENST00000525799.1_Silent_p.S35S|PTPN22_ENST00000420377.2_Silent_p.S35S|AP4B1-AS1_ENST00000419536.1_RNA|PTPN22_ENST00000460620.1_Silent_p.S35S|PTPN22_ENST00000534519.1_5'UTR|PTPN22_ENST00000538253.1_5'UTR	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	35	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTACTTGGTAGATTGCCTTT	0.373																																					p.S35S		Atlas-SNP	.											.	PTPN22	90	.	0			c.T105C						PASS	.						151.0	151.0	151.0					1																	114402065		2203	4300	6503	SO:0001819	synonymous_variant	26191	exon2			CTTGGTAGATTGC	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.105T>C	chr1.hg19:g.114402065A>G		151.0	0.0	.		97.0	46.0	.	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Silent	SNP	ENST00000359785.5	hg19	CCDS863.1																																																																																			.	.	.	none		0.373	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
ADCK3	56997	hgsc.bcm.edu	37	1	227174187	227174187	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr1:227174187A>G	ENST00000366779.1	+	20	4464	c.1693A>G	c.(1693-1695)Atc>Gtc	p.I565V	ADCK3_ENST00000366778.1_Missense_Mutation_p.I513V|ADCK3_ENST00000433743.2_Missense_Mutation_p.I239V|ADCK3_ENST00000366777.3_Missense_Mutation_p.I565V|ADCK3_ENST00000458507.2_Missense_Mutation_p.I286V|ADCK3_ENST00000478406.1_3'UTR			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	565					cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						TGCCATCCTCATCCTGGGGGA	0.592																																					p.I565V		Atlas-SNP	.											.	ADCK3	77	.	0			c.A1693G						PASS	.						89.0	90.0	90.0					1																	227174187		2203	4300	6503	SO:0001583	missense	56997	exon15			ATCCTCATCCTGG	AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.1693A>G	chr1.hg19:g.227174187A>G	ENSP00000355741:p.Ile565Val	134.0	0.0	.		97.0	45.0	.	NM_020247	Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Missense_Mutation	SNP	ENST00000366779.1	hg19	CCDS1557.1	.	.	.	.	.	.	.	.	.	.	A	16.71	3.198951	0.58126	.	.	ENSG00000163050	ENST00000366779;ENST00000366778;ENST00000366777;ENST00000366776;ENST00000458507;ENST00000366775;ENST00000405743;ENST00000433743	T;T;T;T;T;T;T	0.74737	-0.76;-0.73;-0.76;-0.87;-0.43;-0.83;-0.71	5.87	5.87	0.94306	.	0.044860	0.85682	D	0.000000	T	0.71117	0.3302	L	0.60012	1.86	0.80722	D	1	B;B	0.20550	0.001;0.046	B;B	0.19148	0.01;0.024	T	0.66101	-0.6007	10	0.24483	T	0.36	-21.7545	16.2688	0.82603	1.0:0.0:0.0:0.0	.	239;565	E7EVZ8;Q8NI60	.;ADCK3_HUMAN	V	565;513;565;490;286;410;516;239	ENSP00000355741:I565V;ENSP00000355740:I513V;ENSP00000355739:I565V;ENSP00000355738:I490V;ENSP00000403704:I286V;ENSP00000355737:I410V;ENSP00000404550:I239V	ENSP00000355737:I410V	I	+	1	0	ADCK3	225240810	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.289000	0.96061	2.244000	0.73946	0.533000	0.62120	ATC	.	.	.	none		0.592	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091712.1	NM_020247	
PCNXL2	80003	hgsc.bcm.edu	37	1	233134020	233134020	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr1:233134020G>A	ENST00000258229.9	-	32	6002	c.5768C>T	c.(5767-5769)tCc>tTc	p.S1923F	PCNXL2_ENST00000344698.2_Missense_Mutation_p.S575F	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1923						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				CCCTTCACAGGATGACACCCC	0.592																																					p.S1923F		Atlas-SNP	.											.	PCNXL2	204	.	0			c.C5768T						PASS	.						43.0	46.0	45.0					1																	233134020		2040	4195	6235	SO:0001583	missense	80003	exon32			TCACAGGATGACA	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5768C>T	chr1.hg19:g.233134020G>A	ENSP00000258229:p.Ser1923Phe	28.0	0.0	.		18.0	9.0	.	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	hg19	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.779932	0.31502	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.24723	1.84;3.01	4.86	4.86	0.63082	.	1.450940	0.04437	N	0.370187	T	0.23410	0.0566	L	0.36672	1.1	0.25414	N	0.988333	P;B	0.40266	0.71;0.302	B;B	0.26614	0.071;0.047	T	0.43491	-0.9388	10	0.72032	D	0.01	.	15.136	0.72566	0.0:0.0:1.0:0.0	.	1923;575	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	F	575;1923	ENSP00000340759:S575F;ENSP00000258229:S1923F	ENSP00000258229:S1923F	S	-	2	0	PCNXL2	231200643	0.023000	0.18921	0.320000	0.25306	0.131000	0.20780	2.059000	0.41384	2.255000	0.74692	0.563000	0.77884	TCC	.	.	.	none		0.592	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
GCFC2	6936	hgsc.bcm.edu	37	2	75929399	75929399	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr2:75929399G>T	ENST00000321027.3	-	3	678	c.545C>A	c.(544-546)cCt>cAt	p.P182H	GCFC2_ENST00000470503.1_Missense_Mutation_p.P182H|GCFC2_ENST00000409857.3_Intron|GCFC2_ENST00000541687.1_Missense_Mutation_p.P182H	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	182					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)										ATGGTCATCAGGCTCACTCTC	0.418																																					p.P182H		Atlas-SNP	.											.	.	.	.	0			c.C545A						PASS	.						196.0	185.0	189.0					2																	75929399		2203	4300	6503	SO:0001583	missense	6936	exon3			TCATCAGGCTCAC	AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.545C>A	chr2.hg19:g.75929399G>T	ENSP00000318690:p.Pro182His	202.0	0.0	.		135.0	59.0	.	NM_001201335	A4UHQ8|O95032|Q53TY0|Q6P2F2	Missense_Mutation	SNP	ENST00000321027.3	hg19	CCDS1961.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.505961	0.64410	.	.	ENSG00000005436	ENST00000321027;ENST00000541687	T;T	0.34072	2.49;1.38	4.85	4.85	0.62838	.	0.455607	0.22605	N	0.057903	T	0.54822	0.1882	M	0.66939	2.045	0.27164	N	0.961081	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.987	T	0.49031	-0.8981	10	0.56958	D	0.05	-15.8005	9.7929	0.40717	0.0967:0.0:0.9033:0.0	.	182;182	A4UHQ8;P16383	.;GCF_HUMAN	H	182	ENSP00000318690:P182H;ENSP00000437767:P182H	ENSP00000318690:P182H	P	-	2	0	C2orf3	75782907	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.496000	0.53288	2.620000	0.88729	0.591000	0.81541	CCT	.	.	.	none		0.418	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252255.2	NM_003203	
IL1R1	3554	hgsc.bcm.edu	37	2	102792833	102792833	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr2:102792833G>C	ENST00000410023.1	+	12	1642	c.1324G>C	c.(1324-1326)Gaa>Caa	p.E442Q	IL1R1_ENST00000409589.1_Intron|AC007271.3_ENST00000428188.1_RNA|IL1R1_ENST00000424272.1_3'UTR|IL1R1_ENST00000409929.1_Missense_Mutation_p.E411Q|IL1R1_ENST00000233946.3_Missense_Mutation_p.E442Q			P14778	IL1R1_HUMAN	interleukin 1 receptor, type I	442	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|interleukin-1-mediated signaling pathway (GO:0070498)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)|platelet-derived growth factor receptor binding (GO:0005161)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(2)|skin(3)	19					Anakinra(DB00026)	GGTCATTAATGAAAACGTAAA	0.373																																					p.E442Q		Atlas-SNP	.											IL1R1,NS,malignant_melanoma,0,2	IL1R1	52	.	0			c.G1324C						PASS	.						49.0	51.0	50.0					2																	102792833		2203	4300	6503	SO:0001583	missense	3554	exon11			ATTAATGAAAACG	M27492	CCDS2055.1, CCDS74547.1	2q12	2013-01-29			ENSG00000115594	ENSG00000115594		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5993	protein-coding gene	gene with protein product		147810		IL1R, IL1RA		1833184, 10191101	Standard	XM_005263929		Approved	D2S1473, CD121A	uc002tbr.3	P14778	OTTHUMG00000130783	ENST00000410023.1:c.1324G>C	chr2.hg19:g.102792833G>C	ENSP00000386380:p.Glu442Gln	52.0	0.0	.		36.0	2.0	.	NM_000877	Q587I7	Missense_Mutation	SNP	ENST00000410023.1	hg19	CCDS2055.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154988	0.78114	.	.	ENSG00000115594	ENST00000409929;ENST00000428279;ENST00000410023;ENST00000233946	T;T;T;T	0.09538	2.97;2.97;2.97;2.97	5.61	4.73	0.59995	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.465576	0.25450	N	0.030588	T	0.33556	0.0867	M	0.77313	2.365	0.37504	D	0.916883	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.983	T	0.18808	-1.0325	10	0.62326	D	0.03	.	13.9351	0.64021	0.0726:0.0:0.9274:0.0	.	411;442	B8ZZW4;P14778	.;IL1R1_HUMAN	Q	411;298;442;442	ENSP00000386776:E411Q;ENSP00000410461:E298Q;ENSP00000386380:E442Q;ENSP00000233946:E442Q	ENSP00000233946:E442Q	E	+	1	0	IL1R1	102159265	1.000000	0.71417	0.947000	0.38551	0.951000	0.60555	4.341000	0.59335	2.646000	0.89796	0.563000	0.77884	GAA	.	.	.	none		0.373	IL1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253299.1		
SCN2A	6326	hgsc.bcm.edu	37	2	166210795	166210795	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr2:166210795A>C	ENST00000375437.2	+	17	3303	c.3013A>C	c.(3013-3015)Att>Ctt	p.I1005L	SCN2A_ENST00000283256.6_Missense_Mutation_p.I1005L|SCN2A_ENST00000375427.2_Missense_Mutation_p.I1005L|SCN2A_ENST00000357398.3_Missense_Mutation_p.I1005L	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1005					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TAATCTCCAGATTGCTGTGGG	0.383																																					p.I1005L		Atlas-SNP	.											.	SCN2A	589	.	0			c.A3013C						PASS	.						146.0	151.0	149.0					2																	166210795		2203	4300	6503	SO:0001583	missense	6326	exon16			CTCCAGATTGCTG	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.3013A>C	chr2.hg19:g.166210795A>C	ENSP00000364586:p.Ile1005Leu	219.0	0.0	.		154.0	66.0	.	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	hg19	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	A	13.51	2.257989	0.39896	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87	5.6	5.6	0.85130	Sodium ion transport-associated (1);	0.080914	0.52532	D	0.000063	D	0.83101	0.5181	L	0.53671	1.685	0.49915	D	0.999837	B;B	0.17268	0.021;0.005	B;B	0.25291	0.059;0.042	T	0.78513	-0.2175	10	0.30854	T	0.27	.	15.7718	0.78176	1.0:0.0:0.0:0.0	.	1005;1005	Q99250-2;Q99250	.;SCN2A_HUMAN	L	1005	ENSP00000364586:I1005L;ENSP00000349973:I1005L;ENSP00000283256:I1005L;ENSP00000364576:I1005L	ENSP00000283256:I1005L	I	+	1	0	SCN2A	165919041	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.572000	0.82409	2.110000	0.64415	0.482000	0.46254	ATT	.	.	.	none		0.383	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
PDE11A	50940	hgsc.bcm.edu	37	2	178936278	178936278	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr2:178936278G>T	ENST00000286063.6	-	1	1204	c.887C>A	c.(886-888)aCg>aAg	p.T296K	PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	296	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	AATGTTGACCGTTTCTCCATG	0.537									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.T296K		Atlas-SNP	.											PDE11A,NS,carcinoma,0,1	PDE11A	283	.	0			c.C887A						PASS	.						153.0	132.0	139.0					2																	178936278		2203	4300	6503	SO:0001583	missense	50940	exon1	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	TTGACCGTTTCTC	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.887C>A	chr2.hg19:g.178936278G>T	ENSP00000286063:p.Thr296Lys	169.0	0.0	.		100.0	52.0	.	NM_016953	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	hg19	CCDS33334.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.521048	0.85495	.	.	ENSG00000128655	ENST00000286063	T	0.68181	-0.31	5.63	5.63	0.86233	GAF (2);	0.042243	0.85682	D	0.000000	D	0.82559	0.5063	M	0.82716	2.605	0.80722	D	1	D	0.64830	0.994	D	0.65140	0.932	T	0.82643	-0.0356	10	0.44086	T	0.13	.	18.6717	0.91514	0.0:0.0:1.0:0.0	.	296	Q9HCR9	PDE11_HUMAN	K	296	ENSP00000286063:T296K	ENSP00000286063:T296K	T	-	2	0	PDE11A	178644524	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	9.379000	0.97198	2.650000	0.89964	0.655000	0.94253	ACG	.	.	.	none		0.537	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		
KIAA0226	9711	hgsc.bcm.edu	37	3	197427622	197427622	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr3:197427622C>G	ENST00000296343.5	-	7	1122	c.1123G>C	c.(1123-1125)Ggt>Cgt	p.G375R	KIAA0226_ENST00000449205.1_Missense_Mutation_p.G375R|KIAA0226_ENST00000273582.5_Missense_Mutation_p.G315R|KIAA0226_ENST00000467303.1_5'Flank|KIAA0226_ENST00000389665.5_Missense_Mutation_p.G375R	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	375	Ser-rich.				autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		CTCTCCCCACCTCCTTCCTGG	0.577																																					p.G375R	Esophageal Squamous(3;167 355 3763 15924)	Atlas-SNP	.											.	KIAA0226	136	.	0			c.G1123C						PASS	.						57.0	61.0	60.0					3																	197427622		2021	4184	6205	SO:0001583	missense	9711	exon7			CCCCACCTCCTTC	D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.1123G>C	chr3.hg19:g.197427622C>G	ENSP00000296343:p.Gly375Arg	76.0	0.0	.		36.0	11.0	.	NM_014687	Q96CK5	Missense_Mutation	SNP	ENST00000296343.5	hg19	CCDS43195.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	1.899|1.899|1.899	-0.453623|-0.453623|-0.453623	0.04540|0.04540|0.04540	.|.|.	.|.|.	ENSG00000145016|ENSG00000145016|ENSG00000145016	ENST00000415452|ENST00000273582;ENST00000296343;ENST00000389665;ENST00000447048;ENST00000449205|ENST00000413360	.|.|.	.|.|.	.|.|.	5.85|5.85|5.85	2.98|2.98|2.98	0.34508|0.34508|0.34508	.|.|.	.|0.954594|.	.|0.08839|.	.|N|.	.|0.886108|.	T|T|T	0.23886|0.23886|0.23886	0.0578|0.0578|0.0578	N|N|N	0.19112|0.19112|0.19112	0.55|0.55|0.55	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|P;P;P;P;B|.	.|0.52577|.	.|0.954;0.785;0.704;0.905;0.282|.	.|P;P;B;B;B|.	.|0.50192|.	.|0.634;0.49;0.299;0.394;0.051|.	T|T|T	0.20538|0.20538|0.20538	-1.0272|-1.0272|-1.0272	5|9|5	.|0.16896|.	.|T|.	.|0.51|.	.|.|.	7.6388|7.6388|7.6388	0.28282|0.28282|0.28282	0.0:0.5923:0.0:0.4077|0.0:0.5923:0.0:0.4077|0.0:0.5923:0.0:0.4077	.|.|.	.|375;208;375;315;375|.	.|E9PEM3;Q5HYI6;Q92622-3;Q92622-2;Q92622|.	.|.;.;.;.;RUBIC_HUMAN|.	D|R|T	133|315;375;375;7;375|353	.|.|.	.|ENSP00000273582:G315R|.	E|G|R	-|-|-	3|1|2	2|0|0	KIAA0226|KIAA0226|KIAA0226	198912019|198912019|198912019	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.010000|0.010000|0.010000	0.14722|0.14722|0.14722	0.364000|0.364000|0.364000	0.29643|0.29643|0.29643	0.779000|0.779000|0.779000	0.26746|0.26746|0.26746	0.756000|0.756000|0.756000	0.33013|0.33013|0.33013	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAG|GGT|AGG	.	.	.	none		0.577	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340184.1	XM_032901	
PCDHGB7	56099	hgsc.bcm.edu	37	5	140798373	140798373	+	Missense_Mutation	SNP	C	C	G	rs200530054		TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr5:140798373C>G	ENST00000398594.2	+	1	947	c.947C>G	c.(946-948)aCg>aGg	p.T316R	PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000518882.1_5'Flank	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	316	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAAGATATACGATAAACATA	0.408																																					p.T316R		Atlas-SNP	.											.	PCDHGB7	117	.	0			c.C947G						PASS	.						66.0	62.0	63.0					5																	140798373		1868	4100	5968	SO:0001583	missense	56099	exon1			GATATACGATAAA	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.947C>G	chr5.hg19:g.140798373C>G	ENSP00000381594:p.Thr316Arg	27.0	0.0	.		24.0	4.0	.	NM_018927	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	hg19	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	c	11.77	1.736942	0.30774	.	.	ENSG00000254122	ENST00000398594	T	0.51325	0.71	5.7	3.93	0.45458	Cadherin (5);Cadherin-like (1);	1.919090	0.04837	U	0.439841	T	0.56615	0.1997	L	0.49350	1.555	0.09310	N	1	D;D	0.54397	0.966;0.958	P;P	0.57204	0.815;0.795	T	0.26916	-1.0089	10	0.54805	T	0.06	.	4.1608	0.10282	0.1578:0.5582:0.0:0.284	.	316;316	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	R	316	ENSP00000381594:T316R	ENSP00000381594:T316R	T	+	2	0	PCDHGB7	140778557	0.000000	0.05858	0.048000	0.18961	0.684000	0.39900	0.516000	0.22817	0.776000	0.33473	0.561000	0.74099	ACG	.	C|1.000;T|0.000	.	alt		0.408	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
ARHGEF37	389337	hgsc.bcm.edu	37	5	149006787	149006787	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr5:149006787A>G	ENST00000333677.6	+	11	1776	c.1613A>G	c.(1612-1614)aAc>aGc	p.N538S		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	538	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						ATCCTTCAAAACAAGGACACC	0.597																																					p.N538S		Atlas-SNP	.											.	ARHGEF37	45	.	0			c.A1613G						PASS	.						82.0	94.0	90.0					5																	149006787		2091	4214	6305	SO:0001583	missense	389337	exon11			TTCAAAACAAGGA	BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.1613A>G	chr5.hg19:g.149006787A>G	ENSP00000328083:p.Asn538Ser	251.0	0.0	.		116.0	43.0	.	NM_001001669	Q6ZW51	Missense_Mutation	SNP	ENST00000333677.6	hg19	CCDS43385.1	.	.	.	.	.	.	.	.	.	.	A	11.15	1.553479	0.27739	.	.	ENSG00000183111	ENST00000333677	T	0.41065	1.01	5.11	3.94	0.45596	Src homology-3 domain (2);Variant SH3 (1);	0.646786	0.17386	N	0.176119	T	0.23965	0.0580	N	0.16478	0.41	0.28347	N	0.921071	B	0.23249	0.082	B	0.21151	0.033	T	0.19745	-1.0296	10	0.14656	T	0.56	.	8.9935	0.36039	0.8446:0.0:0.1554:0.0	.	538	A1IGU5	ARH37_HUMAN	S	538	ENSP00000328083:N538S	ENSP00000328083:N538S	N	+	2	0	ARHGEF37	148986980	0.615000	0.27026	1.000000	0.80357	0.932000	0.56968	3.659000	0.54489	0.785000	0.33685	-0.441000	0.05720	AAC	.	.	.	none		0.597	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373763.1	NM_001001669	
PRSS16	10279	hgsc.bcm.edu	37	6	27222771	27222771	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr6:27222771C>T	ENST00000230582.3	+	11	1352	c.1337C>T	c.(1336-1338)aCa>aTa	p.T446I	PRSS16_ENST00000377456.2_3'UTR|PRSS16_ENST00000421826.2_Missense_Mutation_p.T189I	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	446					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CCAGGGGACACAGACCCCTGG	0.547																																					p.T446I	NSCLC(178;1118 2105 17078 23587 44429)	Atlas-SNP	.											.	PRSS16	66	.	0			c.C1337T						PASS	.						123.0	127.0	126.0					6																	27222771		2203	4300	6503	SO:0001583	missense	10279	exon11			GGGACACAGACCC	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.1337C>T	chr6.hg19:g.27222771C>T	ENSP00000230582:p.Thr446Ile	266.0	0.0	.		184.0	83.0	.	NM_005865	O75416	Missense_Mutation	SNP	ENST00000230582.3	hg19	CCDS4623.1	.	.	.	.	.	.	.	.	.	.	C	0.210	-1.036976	0.02013	.	.	ENSG00000112812	ENST00000421826;ENST00000230582	T;T	0.12039	2.72;2.72	4.64	-1.58	0.08479	.	0.476548	0.23981	N	0.042674	T	0.01222	0.0040	N	0.02011	-0.69	0.09310	N	1	B;B	0.15930	0.015;0.002	B;B	0.10450	0.005;0.001	T	0.46005	-0.9222	10	0.23302	T	0.38	0.0031	9.7619	0.40537	0.0:0.3092:0.0:0.6908	.	189;446	F2Z2N5;Q9NQE7	.;TSSP_HUMAN	I	189;446	ENSP00000404349:T189I;ENSP00000230582:T446I	ENSP00000230582:T446I	T	+	2	0	PRSS16	27330750	0.007000	0.16637	0.571000	0.28486	0.927000	0.56198	-0.021000	0.12504	-0.193000	0.10415	-0.267000	0.10333	ACA	.	.	.	none		0.547	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2		
HSPA1L	3305	hgsc.bcm.edu	37	6	31779708	31779708	+	Silent	SNP	G	G	A			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr6:31779708G>A	ENST00000375654.4	-	2	231	c.42C>T	c.(40-42)ggC>ggT	p.G14G	HSPA1L_ENST00000417199.3_Silent_p.G14G	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	14					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						AGTAGGTGGTGCCCAGGTCGA	0.557																																					p.G14G		Atlas-SNP	.											.	HSPA1L	185	.	0			c.C42T						PASS	.						71.0	60.0	64.0					6																	31779708		2203	4300	6503	SO:0001819	synonymous_variant	3305	exon2			GGTGGTGCCCAGG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.42C>T	chr6.hg19:g.31779708G>A		85.0	0.0	.		36.0	16.0	.	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Silent	SNP	ENST00000375654.4	hg19	CCDS34413.1																																																																																			.	.	.	none		0.557	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
SLC26A5	375611	hgsc.bcm.edu	37	7	103029857	103029857	+	Silent	SNP	G	G	A			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr7:103029857G>A	ENST00000306312.3	-	13	1587	c.1326C>T	c.(1324-1326)gcC>gcT	p.A442A	SLC26A5_ENST00000354356.4_5'UTR|SLC26A5_ENST00000393723.1_Intron|SLC26A5_ENST00000393730.1_Intron|SLC26A5_ENST00000393729.1_Silent_p.A405A|SLC26A5_ENST00000432958.2_Intron|SLC26A5_ENST00000339444.6_Silent_p.A442A|SLC26A5_ENST00000393735.2_Silent_p.A442A|SLC26A5_ENST00000393727.1_Silent_p.A442A|SLC26A5_ENST00000356767.4_Intron	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	442					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						CAATCACAATGGCCGACAGCA	0.498																																					p.A442A		Atlas-SNP	.											.	SLC26A5	231	.	0			c.C1326T						PASS	.						145.0	124.0	131.0					7																	103029857		2203	4300	6503	SO:0001819	synonymous_variant	375611	exon13			CACAATGGCCGAC	AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.1326C>T	chr7.hg19:g.103029857G>A		78.0	0.0	.		78.0	30.0	.	NM_206883	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Silent	SNP	ENST00000306312.3	hg19	CCDS5733.1																																																																																			.	.	.	none		0.498	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999	
MAPK15	225689	hgsc.bcm.edu	37	8	144801161	144801161	+	Splice_Site	SNP	A	A	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr8:144801161A>T	ENST00000338033.4	+	6	536		c.e6-1		RP11-429J17.5_ENST00000527908.1_RNA|MAPK15_ENST00000395107.4_Splice_Site|MAPK15_ENST00000395108.2_Splice_Site	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15						MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCCTCTCTGCAGCCGTCCAAT	0.711																																					.		Atlas-SNP	.											.	MAPK15	32	.	0			c.418-2A>T						PASS	.						21.0	19.0	20.0					8																	144801161		2202	4299	6501	SO:0001630	splice_region_variant	225689	exon6			CTCTGCAGCCGTC	AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.418-1A>T	chr8.hg19:g.144801161A>T		26.0	0.0	.		12.0	7.0	.	NM_139021	Q2TCF9|Q8N362	Splice_Site	SNP	ENST00000338033.4	hg19	CCDS6409.2	.	.	.	.	.	.	.	.	.	.	A	16.20	3.054752	0.55325	.	.	ENSG00000181085	ENST00000338033;ENST00000395107;ENST00000395108	.	.	.	4.02	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9881	0.24739	0.8928:0.0:0.1072:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAPK15	144873149	1.000000	0.71417	0.912000	0.35992	0.794000	0.44872	4.544000	0.60691	1.680000	0.50976	0.157000	0.16456	.	.	.	.	none		0.711	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000300348.1	NM_139021	Intron
SLC1A1	6505	hgsc.bcm.edu	37	9	4585458	4585458	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr9:4585458T>C	ENST00000262352.3	+	12	1711	c.1475T>C	c.(1474-1476)cTt>cCt	p.L492P		NM_004170.5	NP_004161.4	P43005	EAA3_HUMAN	solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1	492					D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|pancreas(1)|skin(1)	15		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|Pregabalin(DB00230)	TCCACAATCCTTGACAACGAA	0.463																																					p.L492P		Atlas-SNP	.											.	SLC1A1	43	.	0			c.T1475C						PASS	.						134.0	109.0	118.0					9																	4585458		2203	4300	6503	SO:0001583	missense	6505	exon12			CAATCCTTGACAA		CCDS6452.1	9p24	2013-05-22			ENSG00000106688	ENSG00000106688		"""Solute carriers"""	10939	protein-coding gene	gene with protein product		133550				8020993	Standard	NM_004170		Approved	EAAC1, EAAT3	uc003zij.2	P43005	OTTHUMG00000019468	ENST00000262352.3:c.1475T>C	chr9.hg19:g.4585458T>C	ENSP00000262352:p.Leu492Pro	84.0	0.0	.		56.0	27.0	.	NM_004170	O75587|Q5VZ24|Q8N199|Q9UEW2	Missense_Mutation	SNP	ENST00000262352.3	hg19	CCDS6452.1	.	.	.	.	.	.	.	.	.	.	T	3.609	-0.079875	0.07141	.	.	ENSG00000106688	ENST00000262352	T	0.57752	0.38	5.71	3.33	0.38152	.	0.566440	0.18485	N	0.139812	T	0.28200	0.0696	N	0.08118	0	0.21878	N	0.999492	B	0.12013	0.005	B	0.11329	0.006	T	0.14420	-1.0473	10	0.35671	T	0.21	.	5.5545	0.17109	0.1284:0.1394:0.0:0.7322	.	492	P43005	EAA3_HUMAN	P	492	ENSP00000262352:L492P	ENSP00000262352:L492P	L	+	2	0	SLC1A1	4575458	0.890000	0.30428	0.013000	0.15412	0.092000	0.18411	3.193000	0.50997	0.417000	0.25871	0.460000	0.39030	CTT	.	.	.	none		0.463	SLC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051571.1		
APTX	54840	hgsc.bcm.edu	37	9	32988092	32988092	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr9:32988092T>A	ENST00000379819.1	-	3	210	c.211A>T	c.(211-213)Aag>Tag	p.K71*	APTX_ENST00000468275.1_Nonsense_Mutation_p.K57*|APTX_ENST00000379817.2_Nonsense_Mutation_p.K57*|APTX_ENST00000476858.1_Intron|APTX_ENST00000309615.3_Nonsense_Mutation_p.K71*|APTX_ENST00000379813.3_Nonsense_Mutation_p.K57*|APTX_ENST00000397172.3_Nonsense_Mutation_p.K71*|APTX_ENST00000436040.2_Nonsense_Mutation_p.K57*|APTX_ENST00000463596.1_Nonsense_Mutation_p.K57*|APTX_ENST00000379825.2_Nonsense_Mutation_p.K71*			Q7Z2E3	APTX_HUMAN	aprataxin	71	FHA-like.|Interactions with ADPRT and NCL.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|dephosphorylation (GO:0016311)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA ligation (GO:0006266)|double-strand break repair (GO:0006302)|polynucleotide 3' dephosphorylation (GO:0098506)|regulation of protein stability (GO:0031647)|response to hydrogen peroxide (GO:0042542)|single strand break repair (GO:0000012)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA 5'-adenosine monophosphate hydrolase activity (GO:0033699)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|phosphoglycolate phosphatase activity (GO:0008967)|phosphoprotein binding (GO:0051219)|polynucleotide 3'-phosphatase activity (GO:0046403)|protein N-terminus binding (GO:0047485)			endometrium(1)|lung(1)|ovary(2)|prostate(2)	6			LUSC - Lung squamous cell carcinoma(29;0.0302)	GBM - Glioblastoma multiforme(74;0.105)		TGCTTTACCTTGACATATCCC	0.388								Editing and processing nucleases																													p.K71X		Atlas-SNP	.											.	APTX	44	.	0			c.A211T						PASS	.						136.0	132.0	134.0					9																	32988092		2203	4300	6503	SO:0001587	stop_gained	54840	exon3			TTACCTTGACATA	AK000164	CCDS47956.1, CCDS56568.1, CCDS75827.1	9p13.3	2014-01-28	2003-04-03		ENSG00000137074	ENSG00000137074			15984	protein-coding gene	gene with protein product		606350	"""ataxia 1, early onset with hypoalbuminemia"""	AXA1		11586299, 11586300	Standard	NM_175069		Approved	FLJ20157, AOA, AOA1, EAOH, EOAHA	uc003zry.3	Q7Z2E3	OTTHUMG00000019759	ENST00000379819.1:c.211A>T	chr9.hg19:g.32988092T>A	ENSP00000369147:p.Lys71*	132.0	0.0	.		76.0	25.0	.	NM_001195252	A8MTN4|D3DRK9|D3DRL0|Q0P662|Q5T781|Q5T782|Q5T784|Q6JV81|Q6JV82|Q6JV85|Q7Z2F3|Q7Z336|Q7Z5R5|Q7Z6V7|Q7Z6V8|Q9NXM5	Nonsense_Mutation	SNP	ENST00000379819.1	hg19		.	.	.	.	.	.	.	.	.	.	T	36	5.750052	0.96890	.	.	ENSG00000137074	ENST00000379825;ENST00000309615;ENST00000397172;ENST00000379817;ENST00000436040;ENST00000379819;ENST00000468275;ENST00000463596;ENST00000344355;ENST00000379813;ENST00000379812	.	.	.	5.16	5.16	0.70880	.	0.326514	0.35805	N	0.002978	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.792	12.9503	0.58397	0.0:0.0:0.0:1.0	.	.	.	.	X	71;71;71;57;57;71;57;57;71;57;71	.	ENSP00000311547:K71X	K	-	1	0	APTX	32978092	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.233000	0.58651	1.957000	0.56846	0.455000	0.32223	AAG	.	.	.	none		0.388	APTX-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000052028.2	NM_017692	
PTCH1	5727	hgsc.bcm.edu	37	9	98268787	98268787	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr9:98268787C>T	ENST00000331920.6	-	2	595	c.296G>A	c.(295-297)gGc>gAc	p.G99D	PTCH1_ENST00000437951.1_Missense_Mutation_p.G33D|PTCH1_ENST00000430669.2_Missense_Mutation_p.G33D|PTCH1_ENST00000418258.1_5'UTR|RP11-435O5.5_ENST00000604104.1_RNA|PTCH1_ENST00000375274.2_Missense_Mutation_p.G98D|PTCH1_ENST00000429896.2_5'UTR|PTCH1_ENST00000421141.1_5'UTR|PTCH1_ENST00000468211.2_Missense_Mutation_p.G33D	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	99					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.C98fs*13(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CAAGAACTTGCCGCAGTTTTT	0.537																																					p.G99D		Atlas-SNP	.											.	PTCH1	1850	.	1	Deletion - Frameshift(1)	skin(1)	c.G296A						PASS	.						67.0	69.0	68.0					9																	98268787		2203	4300	6503	SO:0001583	missense	5727	exon2			AACTTGCCGCAGT	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.296G>A	chr9.hg19:g.98268787C>T	ENSP00000332353:p.Gly99Asp	77.0	0.0	.		36.0	17.0	.	NM_000264	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	hg19	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593802	0.86953	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000430669;ENST00000375274;ENST00000544247;ENST00000468211	D;D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47;-2.47	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	D	0.94056	0.8095	M	0.78916	2.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.93805	0.7104	10	0.40728	T	0.16	-11.9121	16.7843	0.85570	0.0:1.0:0.0:0.0	.	33;98;99	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	D	99;33;33;98;33;33	ENSP00000332353:G99D;ENSP00000389744:G33D;ENSP00000410287:G33D;ENSP00000364423:G98D;ENSP00000449745:G33D	ENSP00000332353:G99D	G	-	2	0	PTCH1	97308608	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.168000	0.77570	2.033000	0.60031	0.561000	0.74099	GGC	.	.	.	none		0.537	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
ZMYND11	10771	hgsc.bcm.edu	37	10	287963	287963	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr10:287963A>G	ENST00000397962.3	+	10	1262	c.834A>G	c.(832-834)atA>atG	p.I278M	ZMYND11_ENST00000602682.1_Missense_Mutation_p.I193M|ZMYND11_ENST00000402736.1_Missense_Mutation_p.I247M|ZMYND11_ENST00000381604.4_Missense_Mutation_p.I238M|ZMYND11_ENST00000381602.4_Missense_Mutation_p.I238M|ZMYND11_ENST00000509513.2_Missense_Mutation_p.I277M|ZMYND11_ENST00000381607.4_Missense_Mutation_p.I184M|ZMYND11_ENST00000403354.1_Missense_Mutation_p.I198M|ZMYND11_ENST00000397959.3_Missense_Mutation_p.I193M|ZMYND11_ENST00000545619.1_Missense_Mutation_p.I158M|ZMYND11_ENST00000381584.1_Missense_Mutation_p.I261M|ZMYND11_ENST00000381591.1_Missense_Mutation_p.I278M|ZMYND11_ENST00000558098.2_Missense_Mutation_p.I278M|ZMYND11_ENST00000309776.4_Missense_Mutation_p.I238M|ZMYND11_ENST00000535374.1_Missense_Mutation_p.I73M			Q15326	ZMY11_HUMAN	zinc finger, MYND-type containing 11	278					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription elongation from RNA polymerase II promoter (GO:0034243)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	24		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ATTTCCAGATACCTAATCATG	0.328																																					p.I278M		Atlas-SNP	.											.	ZMYND11	72	.	0			c.A834G						PASS	.						111.0	110.0	111.0					10																	287963		2203	4300	6503	SO:0001583	missense	10771	exon10			CCAGATACCTAAT	X86098	CCDS7052.1, CCDS7053.1, CCDS7052.2, CCDS55696.1, CCDS55697.1, CCDS7053.2, CCDS73060.1, CCDS73061.1	10p14	2011-01-26	2011-01-26		ENSG00000015171	ENSG00000015171		"""Zinc fingers, MYND-type"""	16966	protein-coding gene	gene with protein product		608668	"""zinc finger, MYND domain containing 11"""			7621829, 10734313	Standard	NM_006624		Approved	BS69	uc010pzx.2	Q15326	OTTHUMG00000017526	ENST00000397962.3:c.834A>G	chr10.hg19:g.287963A>G	ENSP00000381053:p.Ile278Met	76.0	0.0	.		46.0	17.0	.	NM_006624	B2R6G8|B7Z293|F6UH50|Q2LD45|Q2LD46|Q2LD47|Q2LD48|Q5VUI1|Q8N4B3	Missense_Mutation	SNP	ENST00000397962.3	hg19	CCDS7052.2	.	.	.	.	.	.	.	.	.	.	A	16.71	3.199641	0.58126	.	.	ENSG00000015171	ENST00000397962;ENST00000309776;ENST00000381602;ENST00000509513;ENST00000397959;ENST00000381591;ENST00000403354;ENST00000381607;ENST00000402736;ENST00000381604;ENST00000381584;ENST00000545619;ENST00000535374	T;T;T;T;T;T;T;T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47	6.17	5.03	0.67393	PWWP (2);	0.248837	0.46758	D	0.000271	T	0.59088	0.2168	N	0.08118	0	0.30416	N	0.778601	P;P;P;P;D;P;P;P;P;D	0.55800	0.918;0.921;0.727;0.727;0.973;0.832;0.918;0.882;0.927;0.973	P;P;P;P;P;P;P;B;B;P	0.49752	0.49;0.587;0.56;0.56;0.592;0.621;0.49;0.397;0.402;0.592	T	0.70839	-0.4763	9	0.46703	T	0.11	-28.5082	12.919	0.58222	0.8782:0.0:0.0:0.1218	.	238;278;193;223;278;198;207;224;224;247	Q15326;Q2LD45;B7Z293;B7Z2J6;Q2LD48;B0QZE2;B0QZE3;Q2LD46;Q2LD47;E7ENI9	ZMY11_HUMAN;.;.;.;.;.;.;.;.;.	M	278;238;238;278;193;278;198;184;247;238;261;158;73	ENSP00000381053:I278M;ENSP00000309992:I238M;ENSP00000371015:I238M;ENSP00000381050:I193M;ENSP00000371003:I278M;ENSP00000385484:I198M;ENSP00000371020:I184M;ENSP00000386010:I247M;ENSP00000371017:I238M;ENSP00000370996:I261M;ENSP00000438461:I158M;ENSP00000439587:I73M	ENSP00000309992:I238M	I	+	3	3	ZMYND11	277963	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.942000	0.40243	1.134000	0.42165	0.533000	0.62120	ATA	.	.	.	none		0.328	ZMYND11-206	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046382.4	NM_006624	
PPRC1	23082	hgsc.bcm.edu	37	10	103900396	103900396	+	Missense_Mutation	SNP	G	G	A	rs17847386		TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr10:103900396G>A	ENST00000278070.2	+	5	2170	c.2131G>A	c.(2131-2133)Gtg>Atg	p.V711M	PPRC1_ENST00000370012.1_5'Flank|PPRC1_ENST00000413464.2_Missense_Mutation_p.V711M	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	711					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CCAGCTCCTCGTGGAGTCAGA	0.532																																					p.V711M		Atlas-SNP	.											PPRC1,colon,carcinoma,0,1	PPRC1	151	.	0			c.G2131A						PASS	.						79.0	75.0	76.0					10																	103900396		2203	4300	6503	SO:0001583	missense	23082	exon5			CTCCTCGTGGAGT	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.2131G>A	chr10.hg19:g.103900396G>A	ENSP00000278070:p.Val711Met	101.0	0.0	.		64.0	6.0	.	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	hg19	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	g	8.673	0.903227	0.17760	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.24151	1.88;1.87	3.89	-0.341	0.12639	.	0.355194	0.16037	N	0.232573	T	0.08670	0.0215	N	0.08118	0	0.09310	N	1	B;P;B	0.41345	0.191;0.746;0.191	B;B;B	0.31191	0.036;0.125;0.036	T	0.22765	-1.0207	10	0.46703	T	0.11	.	5.7647	0.18219	0.0:0.3035:0.4867:0.2099	rs17847386	711;591;711	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	M	711	ENSP00000278070:V711M;ENSP00000399743:V711M	ENSP00000278070:V711M	V	+	1	0	PPRC1	103890386	0.000000	0.05858	0.006000	0.13384	0.068000	0.16541	-0.952000	0.03881	-0.046000	0.13446	-1.200000	0.01667	GTG	.	G|0.999;T|0.001	.	weak		0.532	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
SLC43A3	29015	hgsc.bcm.edu	37	11	57177469	57177469	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr11:57177469T>G	ENST00000395123.2	-	12	1490	c.1186A>C	c.(1186-1188)Atc>Ctc	p.I396L	SLC43A3_ENST00000352187.1_Missense_Mutation_p.I396L|SLC43A3_ENST00000395124.1_Missense_Mutation_p.I396L|SLC43A3_ENST00000533524.1_Missense_Mutation_p.I409L|RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.I40L|SLC43A3_ENST00000529554.1_Missense_Mutation_p.I396L	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	396					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						ACTTGCAGGATGAAGGTGAGG	0.632																																					p.I396L		Atlas-SNP	.											.	SLC43A3	54	.	0			c.A1186C						PASS	.						93.0	72.0	79.0					11																	57177469		2201	4296	6497	SO:0001583	missense	29015	exon12			GCAGGATGAAGGT	AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.1186A>C	chr11.hg19:g.57177469T>G	ENSP00000378555:p.Ile396Leu	47.0	0.0	.		24.0	7.0	.	NM_017611	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	ENST00000395123.2	hg19	CCDS7956.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.711618	0.68730	.	.	ENSG00000254979;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802	ENST00000529411;ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524	T;T;T;T;T;T	0.80123	-1.34;0.43;0.43;0.43;0.43;0.43	5.65	0.744	0.18353	Major facilitator superfamily domain, general substrate transporter (1);	0.373532	0.30235	N	0.010082	T	0.73218	0.3559	M	0.64997	1.995	0.35492	D	0.799026	B;B	0.22276	0.031;0.067	B;B	0.25614	0.062;0.062	T	0.64343	-0.6430	10	0.23891	T	0.37	-18.2579	8.0046	0.30317	0.0:0.353:0.0:0.647	.	409;396	E7EQD2;Q8NBI5	.;S43A3_HUMAN	L	40;396;396;396;396;409	ENSP00000431536:I40L;ENSP00000378555:I396L;ENSP00000378556:I396L;ENSP00000337561:I396L;ENSP00000436254:I396L;ENSP00000434515:I409L	ENSP00000431536:I40L	I	-	1	0	RP11-872D17.8;SLC43A3	56934045	0.962000	0.33011	0.995000	0.50966	0.953000	0.61014	-0.028000	0.12350	-0.110000	0.12022	0.533000	0.62120	ATC	.	.	.	none		0.632	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
USP28	57646	hgsc.bcm.edu	37	11	113705056	113705056	+	Splice_Site	SNP	G	G	C			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr11:113705056G>C	ENST00000003302.4	-	6	604	c.536C>G	c.(535-537)tCt>tGt	p.S179C	USP28_ENST00000545540.1_Splice_Site_p.S54C|USP28_ENST00000537706.1_Splice_Site_p.S179C|USP28_ENST00000260188.5_Splice_Site_p.S179C|USP28_ENST00000542033.1_5'UTR	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	179	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TTGAAAGAGAGACTGAAATAA	0.313																																					p.S179C	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	Atlas-SNP	.											.	USP28	135	.	0			c.C536G						PASS	.						83.0	78.0	80.0					11																	113705056		2201	4296	6497	SO:0001630	splice_region_variant	57646	exon6			AAGAGAGACTGAA	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.535-1C>G	chr11.hg19:g.113705056G>C		47.0	0.0	.		34.0	18.0	.	NM_020886	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	hg19	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470732	0.84533	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000545540;ENST00000537706	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.08	5.08	0.68730	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.52533	0.1740	L	0.55743	1.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.994;1.0;0.997;0.999	T	0.55147	-0.8186	10	0.87932	D	0	-14.6997	17.4468	0.87580	0.0:0.0:1.0:0.0	.	179;54;179;179	B4E2Q2;B4E3L3;Q6NZX9;Q96RU2	.;.;.;UBP28_HUMAN	C	179;179;54;179	ENSP00000003302:S179C;ENSP00000260188:S179C;ENSP00000444991:S54C;ENSP00000445743:S179C	ENSP00000003302:S179C	S	-	2	0	USP28	113210266	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.444000	0.97578	2.357000	0.79964	0.460000	0.39030	TCT	.	.	.	none		0.313	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		Missense_Mutation
DPAGT1	1798	hgsc.bcm.edu	37	11	118969112	118969112	+	Splice_Site	SNP	C	C	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr11:118969112C>T	ENST00000409993.2	-	7	2280		c.e7+1		DPAGT1_ENST00000432443.2_Splice_Site|DPAGT1_ENST00000445653.1_5'Flank|H2AFX_ENST00000530167.1_5'Flank|DPAGT1_ENST00000354202.4_Splice_Site			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)						cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		GGCCTACTTACCAGTTGTGGT	0.463																																					.		Atlas-SNP	.											DPAGT1,NS,malignant_melanoma,0,1	DPAGT1	43	.	0			c.728+1G>A						PASS	.						194.0	173.0	180.0					11																	118969112		2200	4295	6495	SO:0001630	splice_region_variant	1798	exon6			TACTTACCAGTTG	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.728+1G>A	chr11.hg19:g.118969112C>T		175.0	0.0	.		101.0	50.0	.	NM_001382	O15216|Q86WV9|Q9BWE6	Splice_Site	SNP	ENST00000409993.2	hg19	CCDS8411.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.476893	0.84640	.	.	ENSG00000172269	ENST00000409993;ENST00000354202;ENST00000432443	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2906	0.90129	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DPAGT1	118474322	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.570000	0.82390	2.788000	0.95919	0.650000	0.86243	.	.	.	.	none		0.463	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	NM_001382	Intron
TFCP2	7024	hgsc.bcm.edu	37	12	51495806	51495806	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr12:51495806C>T	ENST00000257915.5	-	11	1521	c.1063G>A	c.(1063-1065)Gca>Aca	p.A355T	TFCP2_ENST00000548115.1_Missense_Mutation_p.A304T|TFCP2_ENST00000307660.4_Missense_Mutation_p.A304T|TFCP2_ENST00000549867.1_Intron	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	355	DNA-binding.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						AATAAATCTGCCCCTGGAATA	0.343																																					p.A355T		Atlas-SNP	.											.	TFCP2	49	.	0			c.G1063A						PASS	.						51.0	53.0	52.0					12																	51495806		2202	4300	6502	SO:0001583	missense	7024	exon11			AATCTGCCCCTGG	U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.1063G>A	chr12.hg19:g.51495806C>T	ENSP00000257915:p.Ala355Thr	93.0	0.0	.		65.0	15.0	.	NM_001173452	A8K5E9|Q12801|Q9UD75|Q9UD77	Missense_Mutation	SNP	ENST00000257915.5	hg19	CCDS8808.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089945	0.76756	.	.	ENSG00000135457	ENST00000257915;ENST00000307660;ENST00000548115;ENST00000548108	T;T;T;T	0.51325	2.11;0.71;0.74;2.09	5.19	4.31	0.51392	Sterile alpha motif/pointed domain (1);	0.000000	0.85682	D	0.000000	T	0.61689	0.2367	L	0.53729	1.69	0.58432	D	0.999995	D;B;B	0.67145	0.996;0.059;0.182	D;B;B	0.79784	0.993;0.059;0.177	T	0.61564	-0.7037	10	0.42905	T	0.14	-20.1909	12.9675	0.58492	0.0:0.9209:0.0:0.0791	.	304;355;355	Q12800-2;Q12800;Q12800-4	.;TFCP2_HUMAN;.	T	355;304;304;257	ENSP00000257915:A355T;ENSP00000304411:A304T;ENSP00000447991:A304T;ENSP00000449280:A257T	ENSP00000257915:A355T	A	-	1	0	TFCP2	49782073	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.576000	0.60915	1.574000	0.49760	0.563000	0.77884	GCA	.	.	.	none		0.343	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405119.1	NM_005653	
SLC39A5	283375	hgsc.bcm.edu	37	12	56626598	56626598	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr12:56626598A>G	ENST00000266980.4	+	3	706	c.413A>G	c.(412-414)gAc>gGc	p.D138G	SLC39A5_ENST00000454355.2_Missense_Mutation_p.D138G	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	138					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TCGGGCCTGGACCTCCTTCAC	0.612																																					p.D138G		Atlas-SNP	.											.	SLC39A5	52	.	0			c.A413G						PASS	.						51.0	52.0	52.0					12																	56626598		2203	4300	6503	SO:0001583	missense	283375	exon5			GCCTGGACCTCCT		CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.413A>G	chr12.hg19:g.56626598A>G	ENSP00000266980:p.Asp138Gly	86.0	0.0	.		83.0	32.0	.	NM_173596	B2R808|Q8N6Y3	Missense_Mutation	SNP	ENST00000266980.4	hg19	CCDS8912.2	.	.	.	.	.	.	.	.	.	.	A	10.38	1.334275	0.24253	.	.	ENSG00000139540	ENST00000419753;ENST00000454355;ENST00000436633;ENST00000266980	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.43	-4.08	0.03963	.	0.862131	0.10182	N	0.705702	T	0.15739	0.0379	N	0.25647	0.755	0.23473	N	0.997603	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.31668	-0.9935	9	.	.	.	-2.6848	13.1574	0.59524	0.4593:0.0:0.5407:0.0	.	138;29	Q6ZMH5;B4DPG8	S39A5_HUMAN;.	G	138;138;109;138	ENSP00000402891:D138G;ENSP00000405360:D138G;ENSP00000391711:D109G;ENSP00000266980:D138G	.	D	+	2	0	SLC39A5	54912865	0.782000	0.28689	0.322000	0.25334	0.858000	0.48976	-0.215000	0.09279	-0.637000	0.05516	-0.269000	0.10298	GAC	.	.	.	none		0.612	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346834.1	NM_173596	
GLI1	2735	hgsc.bcm.edu	37	12	57864354	57864354	+	Missense_Mutation	SNP	C	C	T	rs368078339		TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr12:57864354C>T	ENST00000228682.2	+	12	1922	c.1831C>T	c.(1831-1833)Cgg>Tgg	p.R611W	GLI1_ENST00000543426.1_Missense_Mutation_p.R483W|GLI1_ENST00000546141.1_Missense_Mutation_p.R570W	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	611					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CAGCCTGGATCGGATAGGTGG	0.617																																					p.R611W	Pancreas(157;841 1936 10503 41495 50368)	Atlas-SNP	.											.	GLI1	141	.	0			c.C1831T						PASS	.	C	TRP/ARG,TRP/ARG,TRP/ARG	1,4405		0,1,2202	55.0	47.0	49.0		1447,1708,1831	3.9	1.0	12		49	0,8600		0,0,4300	no	missense,missense,missense	GLI1	NM_001160045.1,NM_001167609.1,NM_005269.2	101,101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	483/979,570/1066,611/1107	57864354	1,13005	2203	4300	6503	SO:0001583	missense	2735	exon12			CTGGATCGGATAG		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1831C>T	chr12.hg19:g.57864354C>T	ENSP00000228682:p.Arg611Trp	77.0	0.0	.		57.0	21.0	.	NM_005269	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	hg19	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547626	0.27652	2.27E-4	0.0	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	T;T;T;T	0.22336	2.12;1.96;2.06;2.06	3.86	3.86	0.44501	.	0.172694	0.28166	N	0.016347	T	0.21761	0.0524	M	0.64997	1.995	0.37842	D	0.929105	B	0.09022	0.002	B	0.04013	0.001	T	0.14839	-1.0458	10	0.87932	D	0	.	9.2479	0.37539	0.328:0.672:0.0:0.0	.	611	P08151	GLI1_HUMAN	W	483;611;570;570	ENSP00000437607:R483W;ENSP00000228682:R611W;ENSP00000441006:R570W;ENSP00000434408:R570W	ENSP00000228682:R611W	R	+	1	2	GLI1	56150621	0.021000	0.18746	0.995000	0.50966	0.883000	0.51084	0.653000	0.24902	2.436000	0.82500	0.491000	0.48974	CGG	.	.	.	weak		0.617	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269	
NAA16	79612	hgsc.bcm.edu	37	13	41894809	41894809	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr13:41894809A>T	ENST00000379406.3	+	4	575	c.251A>T	c.(250-252)cAt>cTt	p.H84L	NAA16_ENST00000379367.3_Missense_Mutation_p.H84L|NAA16_ENST00000403412.3_Missense_Mutation_p.H84L	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	84					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						ATAGGTTGGCATGTATATGGA	0.299																																					p.H84L		Atlas-SNP	.											.	NAA16	74	.	0			c.A251T						PASS	.						76.0	79.0	78.0					13																	41894809		2203	4300	6503	SO:0001583	missense	79612	exon4			GTTGGCATGTATA	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.251A>T	chr13.hg19:g.41894809A>T	ENSP00000368716:p.His84Leu	72.0	0.0	.		58.0	4.0	.	NM_001110798	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	hg19	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.530845	0.85706	.	.	ENSG00000172766	ENST00000379367;ENST00000379406;ENST00000403412	T;T;T	0.58060	0.36;0.36;0.36	4.9	4.9	0.64082	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000001	T	0.80265	0.4591	H	0.95816	3.725	0.80722	D	1	D;P;D	0.76494	0.999;0.754;0.985	D;P;D	0.85130	0.997;0.673;0.943	D	0.86393	0.1737	10	0.72032	D	0.01	-17.5873	14.6766	0.68983	1.0:0.0:0.0:0.0	.	84;84;84	Q6N069;Q6N069-4;Q6N069-5	NAA16_HUMAN;.;.	L	84	ENSP00000368674:H84L;ENSP00000368716:H84L;ENSP00000386103:H84L	ENSP00000368674:H84L	H	+	2	0	NAA16	40792809	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.523000	0.90576	2.048000	0.60808	0.533000	0.62120	CAT	.	.	.	none		0.299	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
MDGA2	161357	hgsc.bcm.edu	37	14	47351354	47351354	+	Missense_Mutation	SNP	G	G	T	rs369029916		TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr14:47351354G>T	ENST00000399232.2	-	11	2466	c.2102C>A	c.(2101-2103)aCa>aAa	p.T701K	MDGA2_ENST00000426342.1_Missense_Mutation_p.T472K|MDGA2_ENST00000357362.3_Missense_Mutation_p.T472K|MDGA2_ENST00000399222.3_5'UTR|MDGA2_ENST00000439988.3_Missense_Mutation_p.T770K	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	701	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CAAGTTATATGTAATTAATTC	0.368																																					p.T770K		Atlas-SNP	.											.	MDGA2	470	.	0			c.C2309A						PASS	.						65.0	62.0	63.0					14																	47351354		1827	4086	5913	SO:0001583	missense	161357	exon11			TTATATGTAATTA	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2102C>A	chr14.hg19:g.47351354G>T	ENSP00000382178:p.Thr701Lys	25.0	0.0	.		29.0	7.0	.	NM_001113498	F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	hg19		.	.	.	.	.	.	.	.	.	.	G	15.69	2.907198	0.52333	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.1	5.1	0.69264	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.52532	U	0.000066	T	0.49098	0.1537	L	0.36672	1.1	0.80722	D	1	P;B	0.35139	0.486;0.227	B;B	0.38755	0.281;0.146	T	0.52388	-0.8582	10	0.54805	T	0.06	.	17.4396	0.87562	0.0:0.0:1.0:0.0	.	472;701	F6W3S7;Q7Z553	.;MDGA2_HUMAN	K	701;472;770;472	ENSP00000400011:T701K;ENSP00000405456:T472K;ENSP00000382178:T770K;ENSP00000349925:T472K	ENSP00000349925:T472K	T	-	2	0	MDGA2	46421104	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.258000	0.72487	2.547000	0.85894	0.467000	0.42956	ACA	.	.	.	alt		0.368	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830	
KCNK13	56659	hgsc.bcm.edu	37	14	90528673	90528673	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr14:90528673G>A	ENST00000282146.4	+	1	565	c.124G>A	c.(124-126)Gag>Aag	p.E42K		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	42					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				CTCCGCGCTGGAGCTGGCGCA	0.721																																					p.E42K		Atlas-SNP	.											.	KCNK13	76	.	0			c.G124A						PASS	.						4.0	5.0	4.0					14																	90528673		1987	3967	5954	SO:0001583	missense	56659	exon1			GCGCTGGAGCTGG	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.124G>A	chr14.hg19:g.90528673G>A	ENSP00000282146:p.Glu42Lys	12.0	0.0	.		7.0	4.0	.	NM_022054	B5TJL8|Q96E79	Missense_Mutation	SNP	ENST00000282146.4	hg19	CCDS9889.1	.	.	.	.	.	.	.	.	.	.	G	35	5.521378	0.96416	.	.	ENSG00000152315	ENST00000282146	T	0.39787	1.06	4.0	4.0	0.46444	.	0.000000	0.32753	N	0.005686	T	0.71492	0.3346	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80843	-0.1201	10	0.87932	D	0	.	16.446	0.83932	0.0:0.0:1.0:0.0	.	42	Q9HB14	KCNKD_HUMAN	K	42	ENSP00000282146:E42K	ENSP00000282146:E42K	E	+	1	0	KCNK13	89598426	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.054000	0.93866	1.946000	0.56461	0.313000	0.20887	GAG	.	.	.	none		0.721	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054	
RRN3	54700	hgsc.bcm.edu	37	16	15159184	15159184	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr16:15159184T>C	ENST00000198767.6	-	16	1681	c.1598A>G	c.(1597-1599)aAt>aGt	p.N533S	RRN3_ENST00000429751.2_Missense_Mutation_p.N503S|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000327307.7_Missense_Mutation_p.N500S|RRN3_ENST00000563559.1_Missense_Mutation_p.N533S|RRN3_ENST00000540462.1_Missense_Mutation_p.N351S	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	533	Interaction with TWISTNB.				cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CATCTGGCGATTGTTCCTCTC	0.502																																					p.N533S		Atlas-SNP	.											.	RRN3	36	.	0			c.A1598G						PASS	.						95.0	80.0	85.0					16																	15159184		2197	4300	6497	SO:0001583	missense	54700	exon16			TGGCGATTGTTCC	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.1598A>G	chr16.hg19:g.15159184T>C	ENSP00000198767:p.Asn533Ser	105.0	0.0	.		77.0	13.0	.	NM_018427	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	hg19	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	8.281	0.815443	0.16607	.	.	ENSG00000085721	ENST00000198767;ENST00000429751;ENST00000327307;ENST00000540462	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.39	3.07	0.35406	.	0.056806	0.64402	D	0.000003	T	0.35038	0.0918	L	0.48642	1.525	0.47123	D	0.999324	B;B;B	0.17038	0.004;0.02;0.01	B;B;B	0.27500	0.009;0.08;0.022	T	0.07849	-1.0751	10	0.23891	T	0.37	.	9.8617	0.41118	0.0:0.127:0.0:0.873	.	503;434;533	F5H148;B4DZL9;Q9NYV6	.;.;RRN3_HUMAN	S	533;503;500;351	ENSP00000198767:N533S;ENSP00000402027:N503S;ENSP00000318484:N500S;ENSP00000437963:N351S	ENSP00000198767:N533S	N	-	2	0	RRN3	15066685	1.000000	0.71417	0.993000	0.49108	0.185000	0.23345	3.207000	0.51106	0.410000	0.25675	0.482000	0.46254	AAT	.	.	.	none		0.502	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
TANGO6	79613	hgsc.bcm.edu	37	16	68909060	68909060	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr16:68909060G>T	ENST00000261778.1	+	5	1010	c.998G>T	c.(997-999)gGa>gTa	p.G333V		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	333						integral component of membrane (GO:0016021)											GTGCCAGCGGGAGCAGCTGGT	0.473																																					p.G333V		Atlas-SNP	.											.	.	.	.	0			c.G998T						PASS	.						78.0	88.0	85.0					16																	68909060		2134	4251	6385	SO:0001583	missense	79613	exon5			CAGCGGGAGCAGC		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.998G>T	chr16.hg19:g.68909060G>T	ENSP00000261778:p.Gly333Val	97.0	0.0	.		37.0	17.0	.	NM_024562	Q569F9|Q9H9K1	Missense_Mutation	SNP	ENST00000261778.1	hg19	CCDS45516.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.713100	0.48517	.	.	ENSG00000103047	ENST00000261778	T	0.69175	-0.38	4.94	4.94	0.65067	.	.	.	.	.	T	0.81138	0.4760	M	0.77820	2.39	0.80722	D	1	D	0.69078	0.997	D	0.64687	0.928	D	0.83369	0.0006	9	0.59425	D	0.04	-8.1136	17.3079	0.87200	0.0:0.0:1.0:0.0	.	333	Q9C0B7	TMCO7_HUMAN	V	333	ENSP00000261778:G333V	ENSP00000261778:G333V	G	+	2	0	TMCO7	67466561	1.000000	0.71417	0.969000	0.41365	0.107000	0.19398	5.015000	0.64035	2.437000	0.82529	0.591000	0.81541	GGA	.	.	.	none		0.473	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2	
CLUH	23277	hgsc.bcm.edu	37	17	2601454	2601454	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr17:2601454A>G	ENST00000570628.2	-	10	1688	c.1583T>C	c.(1582-1584)cTc>cCc	p.L528P	CLUH_ENST00000538975.1_Missense_Mutation_p.L528P|CLUH_ENST00000435359.1_Missense_Mutation_p.L528P			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	528					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											CAGGATCTTGAGGGGCCGACT	0.647																																					p.L528P		Atlas-SNP	.											.	.	.	.	0			c.T1583C						PASS	.						37.0	48.0	44.0					17																	2601454		2169	4256	6425	SO:0001583	missense	23277	exon10			ATCTTGAGGGGCC	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.1583T>C	chr17.hg19:g.2601454A>G	ENSP00000458986:p.Leu528Pro	9.0	0.0	.		9.0	7.0	.	NM_015229	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	hg19	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.819136	0.90873	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	D;D	0.87412	-2.25;-2.25	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.95098	0.8412	M	0.93507	3.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96211	0.9153	10	0.87932	D	0	.	15.0034	0.71492	1.0:0.0:0.0:0.0	.	528;528	O75153;C9J6D7	K0664_HUMAN;.	P	528	ENSP00000388872:L528P;ENSP00000439628:L528P	ENSP00000320468:L528P	L	-	2	0	KIAA0664	2548204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.144000	0.66660	0.533000	0.62120	CTC	.	.	.	none		0.647	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
DNAH9	1770	hgsc.bcm.edu	37	17	11772554	11772554	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr17:11772554C>T	ENST00000262442.4	+	51	10105	c.10037C>T	c.(10036-10038)tCc>tTc	p.S3346F	DNAH9_ENST00000454412.2_Missense_Mutation_p.S3346F	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3346					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GTCACCATCTCCCTTGCCAAC	0.498																																					p.S3346F		Atlas-SNP	.											.	DNAH9	695	.	0			c.C10037T						PASS	.						93.0	83.0	87.0					17																	11772554		2203	4300	6503	SO:0001583	missense	1770	exon51			CCATCTCCCTTGC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10037C>T	chr17.hg19:g.11772554C>T	ENSP00000262442:p.Ser3346Phe	118.0	0.0	.		91.0	28.0	.	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	16.32	3.091444	0.55968	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.75589	-0.95;-0.95	4.54	4.54	0.55810	Dynein heavy chain, coiled coil stalk (1);	0.361482	0.29246	N	0.012706	D	0.84238	0.5428	M	0.87682	2.9	0.80722	D	1	P	0.44195	0.828	P	0.52554	0.702	D	0.87047	0.2144	10	0.66056	D	0.02	.	15.0338	0.71728	0.0:0.8577:0.1423:0.0	.	3346	Q9NYC9	DYH9_HUMAN	F	3346;3346;1928	ENSP00000262442:S3346F;ENSP00000414874:S3346F	ENSP00000262442:S3346F	S	+	2	0	DNAH9	11713279	0.799000	0.28903	1.000000	0.80357	0.588000	0.36517	1.816000	0.38992	2.510000	0.84645	0.643000	0.83706	TCC	.	.	.	none		0.498	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
ZNF207	7756	hgsc.bcm.edu	37	17	30692444	30692444	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr17:30692444A>G	ENST00000321233.6	+	7	872	c.718A>G	c.(718-720)Aca>Gca	p.T240A	ZNF207_ENST00000394670.4_Missense_Mutation_p.T256A|ZNF207_ENST00000341711.6_Missense_Mutation_p.T157A|ZNF207_ENST00000342555.6_Missense_Mutation_p.T259A|ZNF207_ENST00000577908.1_Missense_Mutation_p.T256A|ZNF207_ENST00000394673.2_Missense_Mutation_p.T256A	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207	240					attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			ACCTGCACCAACAGCAACTGT	0.502																																					p.T256A		Atlas-SNP	.											.	ZNF207	32	.	0			c.A766G						PASS	.						70.0	60.0	63.0					17																	30692444		2203	4300	6503	SO:0001583	missense	7756	exon8			GCACCAACAGCAA	AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810	ENST00000321233.6:c.718A>G	chr17.hg19:g.30692444A>G	ENSP00000322777:p.Thr240Ala	62.0	0.0	.		82.0	4.0	.	NM_001098507	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	Missense_Mutation	SNP	ENST00000321233.6	hg19	CCDS11271.1	.	.	.	.	.	.	.	.	.	.	A	11.34	1.611008	0.28712	.	.	ENSG00000010244	ENST00000394670;ENST00000394673;ENST00000394679;ENST00000321233;ENST00000341711;ENST00000342555	T;T	0.41065	1.01;1.04	5.87	2.05	0.26809	.	0.483859	0.24044	N	0.042070	T	0.20495	0.0493	N	0.14661	0.345	0.24350	N	0.99493	B;B;B;B;B	0.16396	0.0;0.0;0.0;0.0;0.017	B;B;B;B;B	0.20767	0.0;0.0;0.0;0.0;0.031	T	0.25950	-1.0117	10	0.07644	T	0.81	.	8.3666	0.32391	0.6656:0.0:0.3344:0.0	.	240;259;256;256;240	A8MTG3;Q59G94;E1P660;O43670-2;O43670	.;.;.;.;ZN207_HUMAN	A	256;240;259;256;157;240	ENSP00000378165:T256A;ENSP00000344913:T157A	ENSP00000322777:T256A	T	+	1	0	ZNF207	27716557	0.786000	0.28738	1.000000	0.80357	0.998000	0.95712	0.603000	0.24149	0.492000	0.27815	0.477000	0.44152	ACA	.	.	.	none		0.502	ZNF207-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256251.2		
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305911	39305911	+	Missense_Mutation	SNP	G	G	A	rs557154279|rs141058010	byFrequency	TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr17:39305911G>A	ENST00000343246.4	-	1	143	c.109C>T	c.(109-111)Cgc>Tgc	p.R37C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	37	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCTGGGGCGGCAGCAGGTG	0.657																																					p.R37C		Atlas-SNP	.											KRTAP4-5,NS,carcinoma,0,1	KRTAP4-5	34	.	0			c.C109T						PASS	.						25.0	29.0	27.0					17																	39305911		2176	4272	6448	SO:0001583	missense	85289	exon1			TGGGGCGGCAGCA	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.109C>T	chr17.hg19:g.39305911G>A	ENSP00000340546:p.Arg37Cys	86.0	1.0	.		78.0	7.0	.	NM_033188		Missense_Mutation	SNP	ENST00000343246.4	hg19	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	12.13	1.844454	0.32606	.	.	ENSG00000198271	ENST00000343246	T	0.01455	4.87	3.22	-1.8	0.07907	.	2.080600	0.03668	U	0.243553	T	0.02767	0.0083	L	0.57536	1.79	0.18873	N	0.999989	B	0.18461	0.028	B	0.12837	0.008	T	0.47045	-0.9147	10	0.56958	D	0.05	.	5.7249	0.18008	0.1011:0.0:0.4232:0.4757	.	37	Q9BYR2	KRA45_HUMAN	C	37	ENSP00000340546:R37C	ENSP00000340546:R37C	R	-	1	0	KRTAP4-5	36559437	0.000000	0.05858	0.674000	0.29902	0.928000	0.56348	-0.202000	0.09451	-0.272000	0.09259	0.556000	0.70494	CGC	.	.	.	weak		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
SLC16A5	9121	hgsc.bcm.edu	37	17	73096278	73096278	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr17:73096278G>T	ENST00000450736.2	+	4	935	c.520G>T	c.(520-522)Gtc>Ttc	p.V174F	SLC16A5_ENST00000538213.2_Missense_Mutation_p.V214F|SLC16A5_ENST00000580123.1_Missense_Mutation_p.V174F|SLC16A5_ENST00000329783.4_Missense_Mutation_p.V174F			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	174					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	TACCTTCCTTGTCTTCGGCGG	0.642																																					p.V174F		Atlas-SNP	.											.	SLC16A5	80	.	0			c.G520T						PASS	.						49.0	49.0	49.0					17																	73096278		2203	4300	6503	SO:0001583	missense	9121	exon5			TTCCTTGTCTTCG	U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.520G>T	chr17.hg19:g.73096278G>T	ENSP00000390564:p.Val174Phe	77.0	0.0	.		49.0	4.0	.	NM_001271765	B4E288	Missense_Mutation	SNP	ENST00000450736.2	hg19	CCDS11713.1	.	.	.	.	.	.	.	.	.	.	G	8.724	0.915027	0.17907	.	.	ENSG00000170190	ENST00000329783;ENST00000450736;ENST00000538213	T;T;T	0.59772	0.24;0.24;0.24	4.58	-5.33	0.02713	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.457119	0.24674	N	0.036522	T	0.53899	0.1825	L	0.39692	1.235	0.21740	N	0.99956	D;D	0.56287	0.975;0.975	P;P	0.58391	0.791;0.838	T	0.55933	-0.8062	10	0.66056	D	0.02	.	8.4103	0.32640	0.444:0.112:0.444:0.0	.	214;174	B4E288;O15375	.;MOT6_HUMAN	F	174;174;214	ENSP00000330141:V174F;ENSP00000390564:V174F;ENSP00000440212:V214F	ENSP00000330141:V174F	V	+	1	0	SLC16A5	70607873	0.006000	0.16342	0.067000	0.19924	0.636000	0.38137	0.220000	0.17660	-1.012000	0.03387	0.561000	0.74099	GTC	.	.	.	none		0.642	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445547.1	NM_004695	
ZNF439	90594	hgsc.bcm.edu	37	19	11978986	11978986	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr19:11978986T>C	ENST00000304030.2	+	3	1302	c.1102T>C	c.(1102-1104)Tca>Cca	p.S368P	ZNF439_ENST00000455282.1_Missense_Mutation_p.S232P|ZNF439_ENST00000592534.1_Intron	NM_152262.2	NP_689475.1	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	368					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(7)|pancreas(1)|skin(2)	27						TTCTGCCAAGTCATTTCAAAG	0.383																																					p.S368P		Atlas-SNP	.											.	ZNF439	67	.	0			c.T1102C						PASS	.						65.0	66.0	66.0					19																	11978986		2203	4300	6503	SO:0001583	missense	90594	exon3			GCCAAGTCATTTC	AL833935	CCDS12268.1	19p13.13	2013-01-08			ENSG00000171291	ENSG00000171291		"""Zinc fingers, C2H2-type"", ""-"""	20873	protein-coding gene	gene with protein product							Standard	NM_152262		Approved	DKFZp571K0837	uc002mss.3	Q8NDP4	OTTHUMG00000156527	ENST00000304030.2:c.1102T>C	chr19.hg19:g.11978986T>C	ENSP00000305077:p.Ser368Pro	109.0	0.0	.		60.0	4.0	.	NM_152262	Q8IYZ7|Q96SU1	Missense_Mutation	SNP	ENST00000304030.2	hg19	CCDS12268.1	.	.	.	.	.	.	.	.	.	.	t	11.77	1.736704	0.30774	.	.	ENSG00000171291	ENST00000455282;ENST00000304030	T;T	0.07908	3.15;3.15	0.575	0.575	0.17374	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24392	0.0591	M	0.84082	2.675	0.09310	N	1	P	0.49961	0.93	P	0.62885	0.908	T	0.03863	-1.0997	9	0.54805	T	0.06	.	6.7827	0.23654	0.0:0.0:0.0:1.0	.	368	Q8NDP4	ZN439_HUMAN	P	232;368	ENSP00000395632:S232P;ENSP00000305077:S368P	ENSP00000305077:S368P	S	+	1	0	ZNF439	11839986	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-1.393000	0.02521	0.485000	0.27652	0.163000	0.16589	TCA	.	.	.	none		0.383	ZNF439-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344513.1		
KPTN	11133	hgsc.bcm.edu	37	19	47987312	47987312	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr19:47987312C>T	ENST00000338134.3	-	1	213	c.106G>A	c.(106-108)Ggc>Agc	p.G36S	NAPA-AS1_ENST00000594367.1_RNA|KPTN_ENST00000536339.1_5'UTR|NAPA-AS1_ENST00000593284.1_RNA|KPTN_ENST00000595484.1_5'UTR	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	36					actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		ccgcgcccgccggcgccgccT	0.697											OREG0025593	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G36S		Atlas-SNP	.											.	KPTN	34	.	0			c.G106A						PASS	.						16.0	20.0	19.0					19																	47987312		1778	3946	5724	SO:0001583	missense	11133	exon1			GCCCGCCGGCGCC	AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.106G>A	chr19.hg19:g.47987312C>T	ENSP00000337850:p.Gly36Ser	64.0	0.0	.	951	43.0	17.0	.	NM_007059	B3KN86|B4DQ76|Q96GT1	Missense_Mutation	SNP	ENST00000338134.3	hg19	CCDS42583.1	.	.	.	.	.	.	.	.	.	.	C	5.953	0.359822	0.11296	.	.	ENSG00000118162	ENST00000338134	.	.	.	4.59	1.01	0.19927	.	0.822214	0.11218	N	0.586992	T	0.16041	0.0386	N	0.10874	0.06	0.22968	N	0.998498	B	0.12013	0.005	B	0.10450	0.005	T	0.30060	-0.9991	9	0.15952	T	0.53	-4.8928	5.1034	0.14772	0.0:0.5015:0.17:0.3285	.	36	Q9Y664	KPTN_HUMAN	S	36	.	ENSP00000337850:G36S	G	-	1	0	KPTN	52679124	0.103000	0.21917	0.979000	0.43373	0.439000	0.31926	1.690000	0.37711	0.509000	0.28195	0.313000	0.20887	GGC	.	.	.	none		0.697	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466672.2		
MKKS	8195	hgsc.bcm.edu	37	20	10385928	10385928	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr20:10385928C>A	ENST00000347364.3	-	6	2442	c.1680G>T	c.(1678-1680)ttG>ttT	p.L560F	MKKS_ENST00000399054.2_Missense_Mutation_p.L560F	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	560					artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						ATGAAAGATCCAAAATCAAAT	0.393																																					p.L560F	Melanoma(79;1979 2212 6640)	Atlas-SNP	.											.	MKKS	35	.	0			c.G1680T						PASS	.						32.0	31.0	31.0					20																	10385928		2203	4300	6503	SO:0001583	missense	8195	exon6			AAGATCCAAAATC	AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.1680G>T	chr20.hg19:g.10385928C>A	ENSP00000246062:p.Leu560Phe	44.0	0.0	.		32.0	9.0	.	NM_170784	A8K7B0|D3DW18	Missense_Mutation	SNP	ENST00000347364.3	hg19	CCDS13111.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843811	0.71488	.	.	ENSG00000125863	ENST00000347364;ENST00000399054	D;D	0.87966	-2.32;-2.32	6.07	2.82	0.32997	.	0.000000	0.64402	D	0.000001	D	0.91791	0.7403	M	0.77616	2.38	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.90008	0.4119	10	0.87932	D	0	-8.0737	8.1919	0.31374	0.0:0.6163:0.0:0.3837	.	560	Q9NPJ1	MKKS_HUMAN	F	560	ENSP00000246062:L560F;ENSP00000382008:L560F	ENSP00000246062:L560F	L	-	3	2	MKKS	10333928	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.884000	0.28214	0.279000	0.22186	0.655000	0.94253	TTG	.	.	.	none		0.393	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077991.3		
GYG2	8908	hgsc.bcm.edu	37	X	2772026	2772026	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chrX:2772026T>A	ENST00000381163.3	+	5	530	c.248T>A	c.(247-249)aTc>aAc	p.I83N	GYG2_ENST00000542787.1_Missense_Mutation_p.I83N|GYG2-AS1_ENST00000445107.1_RNA|GYG2_ENST00000338623.5_Missense_Mutation_p.I83N|GYG2_ENST00000398806.3_Missense_Mutation_p.I52N|GYG2_ENST00000381161.1_3'UTR	NM_001079855.1|NM_001184702.1|NM_003918.2	NP_001073324.1|NP_001171631.1|NP_003909.2	O15488	GLYG2_HUMAN	glycogenin 2	83					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	glycogenin glucosyltransferase activity (GO:0008466)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCCAGGGTCATCCTCTCGAAG	0.507																																					p.I83N		Atlas-SNP	.											.	GYG2	39	.	0			c.T248A						PASS	.						126.0	99.0	108.0					X																	2772026		2203	4298	6501	SO:0001583	missense	8908	exon5			GGGTCATCCTCTC	U94361	CCDS14121.1, CCDS48074.1	Xp22.3	2013-02-22			ENSG00000056998	ENSG00000056998	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4700	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	300198				9857012	Standard	NM_001079855		Approved	GN-2	uc004cqs.1	O15488	OTTHUMG00000021079	ENST00000381163.3:c.248T>A	chrX.hg19:g.2772026T>A	ENSP00000370555:p.Ile83Asn	47.0	0.0	.		47.0	43.0	.	NM_003918	B7WNN6|O15485|O15486|O15487|O15489|O15490	Missense_Mutation	SNP	ENST00000381163.3	hg19	CCDS14121.1	.	.	.	.	.	.	.	.	.	.	T	11.25	1.584140	0.28268	.	.	ENSG00000056998	ENST00000398806;ENST00000381163;ENST00000338623;ENST00000542787;ENST00000520904	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	3.59	2.41	0.29592	.	0.614533	0.14619	N	0.308517	T	0.37999	0.1024	L	0.39898	1.24	0.25836	N	0.984116	P;D;P;B;P	0.54964	0.731;0.969;0.847;0.378;0.489	P;P;P;B;P	0.49887	0.477;0.558;0.625;0.3;0.522	T	0.12016	-1.0564	10	0.41790	T	0.15	.	6.5	0.22164	0.0:0.2109:0.0:0.7891	.	83;43;52;52;83	O15488-4;O15488-3;A8K8Y1;O15488-2;O15488	.;.;.;.;GLYG2_HUMAN	N	52;83;83;83;52	ENSP00000381786:I52N;ENSP00000370555:I83N;ENSP00000341273:I83N;ENSP00000446092:I83N;ENSP00000430764:I52N	ENSP00000341273:I83N	I	+	2	0	GYG2	2782026	0.959000	0.32827	0.051000	0.19133	0.019000	0.09904	1.290000	0.33319	1.271000	0.44313	0.481000	0.45027	ATC	.	.	.	none		0.507	GYG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055645.1	NM_003918	
PHKA1	5255	hgsc.bcm.edu	37	X	71829514	71829514	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chrX:71829514C>T	ENST00000373542.4	-	23	2725	c.2566G>A	c.(2566-2568)Gta>Ata	p.V856I	PHKA1_ENST00000541944.1_Missense_Mutation_p.V797I|PHKA1_ENST00000373545.3_Missense_Mutation_p.V797I|PHKA1_ENST00000339490.3_Missense_Mutation_p.V856I|PHKA1_ENST00000373539.3_Missense_Mutation_p.V856I	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	856					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GGAAGTCCTACTGTCAAATGT	0.453																																					p.V856I		Atlas-SNP	.											.	PHKA1	129	.	0			c.G2566A						PASS	.						226.0	193.0	204.0					X																	71829514		2203	4300	6503	SO:0001583	missense	5255	exon23			GTCCTACTGTCAA		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2566G>A	chrX.hg19:g.71829514C>T	ENSP00000362643:p.Val856Ile	80.0	0.0	.		53.0	47.0	.	NM_002637	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	hg19	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.271260	0.80469	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98;-2.98	5.65	5.65	0.86999	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.95172	0.8435	M	0.84082	2.675	0.54753	D	0.999987	B;B;B	0.33637	0.118;0.389;0.42	B;P;B	0.48627	0.21;0.584;0.421	D	0.94813	0.7980	10	0.52906	T	0.07	-4.9016	15.893	0.79315	0.0:1.0:0.0:0.0	.	797;856;856	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	I	797;856;797;856;856	ENSP00000362646:V797I;ENSP00000362643:V856I;ENSP00000441251:V797I;ENSP00000342469:V856I;ENSP00000362640:V856I	ENSP00000342469:V856I	V	-	1	0	PHKA1	71746239	0.999000	0.42202	0.998000	0.56505	0.964000	0.63967	4.396000	0.59684	2.353000	0.79882	0.544000	0.68410	GTA	.	.	.	none		0.453	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
NCAPH	23397	hgsc.bcm.edu	37	2	97017659	97017669	+	Frame_Shift_Del	DEL	AGAAGTGAACT	AGAAGTGAACT	-			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	AGAAGTGAACT	AGAAGTGAACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr2:97017659_97017669delAGAAGTGAACT	ENST00000240423.4	+	7	854_864	c.811_821delAGAAGTGAACT	c.(811-822)agaagtgaactgfs	p.RSEL271fs	NCAPH_ENST00000455200.1_Frame_Shift_Del_p.RSEL260fs|NCAPH_ENST00000427946.1_Frame_Shift_Del_p.RSEL135fs	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	271					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				CCAGGACTACAGAAGTGAACTGCTGTTTCCC	0.479																																					p.270_274del		Atlas-INDEL	.											.	NCAPH	67	.	0			c.810_820del						PASS	.																																			SO:0001589	frameshift_variant	23397	exon7			.	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.811_821delAGAAGTGAACT	chr2.hg19:g.97017659_97017669delAGAAGTGAACT	ENSP00000240423:p.Arg271fs	112.0	0.0	0		55.0	17.0	0.309091	NM_015341	B4E189|Q8TB87	Frame_Shift_Del	DEL	ENST00000240423.4	hg19	CCDS2021.1																																																																																			.	.	.	none		0.479	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	NM_015341	
TRIO	7204	hgsc.bcm.edu	37	5	14387672	14387672	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr5:14387672delT	ENST00000344204.4	+	22	3720	c.3696delT	c.(3694-3696)tctfs	p.S1232fs	TRIO_ENST00000537187.1_Frame_Shift_Del_p.S1232fs|TRIO_ENST00000509967.2_Frame_Shift_Del_p.S1183fs	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1232					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GAGATTTCTCTCTGCGGATGG	0.433																																					p.S1232fs		Atlas-INDEL	.											.	TRIO	305	.	0			c.3695delC						PASS	.						118.0	132.0	127.0					5																	14387672		2203	4300	6503	SO:0001589	frameshift_variant	7204	exon22			.	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3696delT	chr5.hg19:g.14387672delT	ENSP00000339299:p.Ser1232fs	193.0	0.0	0		94.0	38.0	0.404255	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Frame_Shift_Del	DEL	ENST00000344204.4	hg19	CCDS3883.1																																																																																			.	.	.	none		0.433	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
CRNN	49860	hgsc.bcm.edu	37	1	152382377	152382391	+	In_Frame_Del	DEL	TCAGGGTTGCTCACT	TCAGGGTTGCTCACT	-			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	TCAGGGTTGCTCACT	TCAGGGTTGCTCACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr1:152382377_152382391delTCAGGGTTGCTCACT	ENST00000271835.3	-	3	1229_1243	c.1167_1181delAGTGAGCAACCCTGA	c.(1165-1182)caagtgagcaaccctgag>cag	p.VSNPE390del	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	390					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTCCTGCCTCAGGGTTGCTCACTTGCATCCATC	0.595																																					p.390_394del		Atlas-INDEL	.											.	CRNN	78	.	0			c.1168_1182del						PASS	.																																			SO:0001651	inframe_deletion	49860	exon3			.	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1167_1181delAGTGAGCAACCCTGA	chr1.hg19:g.152382377_152382391delTCAGGGTTGCTCACT	ENSP00000271835:p.Val390_Glu394del	149.0	0.0	0		73.0	23.0	0.315068	NM_016190	B2RE60|Q8N613	In_Frame_Del	DEL	ENST00000271835.3	hg19	CCDS1010.1																																																																																			.	.	.	none		0.595	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190	
ZNF226	7769	hgsc.bcm.edu	37	19	44680650	44680650	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chr19:44680650delT	ENST00000590089.1	+	7	1602	c.1235delT	c.(1234-1236)gttfs	p.V412fs	ZNF226_ENST00000337433.5_Frame_Shift_Del_p.V412fs|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Frame_Shift_Del_p.V412fs			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				CATCAAAGAGTTCATACAGGA	0.433																																					p.V412fs	Pancreas(115;581 1665 13228 19278 50070)	Atlas-INDEL	.											.	.	.	.	0			c.1234delG						PASS	.						62.0	66.0	65.0					19																	44680650		2197	4300	6497	SO:0001589	frameshift_variant	7769	exon6			.	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.1235delT	chr19.hg19:g.44680650delT	ENSP00000465121:p.Val412fs	68.0	0.0	0		46.0	19.0	0.413043	NM_001032372	Q8WWE6|Q96TE6|Q9NS44	Frame_Shift_Del	DEL	ENST00000590089.1	hg19	CCDS46102.1																																																																																			.	.	.	none		0.433	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
SYP	6855	hgsc.bcm.edu	37	X	49050637	49050638	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-A4-7732-01A-11D-2136-08	TCGA-A4-7732-10A-01D-2136-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f779f68-566c-4996-8aab-4ca7af95061c	b7fc117a-dadb-4f07-8dce-04bf472d7559	g.chrX:49050637_49050638delTG	ENST00000263233.4	-	4	480_481	c.408_409delCA	c.(406-411)aacaaafs	p.N136fs	SYP_ENST00000479808.1_Frame_Shift_Del_p.N136fs|SYP_ENST00000538567.1_Frame_Shift_Del_p.N18fs	NM_003179.2	NP_003170.1	P08247	SYPH_HUMAN	synaptophysin	136	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular response to organic substance (GO:0071310)|endocytosis (GO:0006897)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle membrane organization (GO:0048499)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	cholesterol binding (GO:0015485)|protein self-association (GO:0043621)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)	15		all_lung(315;0.00016)				ATGGGCCCTTTGTTATTCTCTC	0.564																																					p.137_137del		Atlas-INDEL	.											.	SYP	71	.	0			c.409_410del						PASS	.																																			SO:0001589	frameshift_variant	6855	exon4			.	X06389	CCDS14321.1	Xp11.23-p11.22	2014-02-19			ENSG00000102003	ENSG00000102003			11506	protein-coding gene	gene with protein product		313475				3120152, 19377476	Standard	NM_003179		Approved	MRX96	uc004dmz.1	P08247	OTTHUMG00000034557	ENST00000263233.4:c.408_409delCA	chrX.hg19:g.49050637_49050638delTG	ENSP00000263233:p.Asn136fs	51.0	0.0	0		27.0	20.0	0.740741	NM_003179	B2R7L6|B7Z359|Q6P2F7	Frame_Shift_Del	DEL	ENST00000263233.4	hg19	CCDS14321.1																																																																																			.	.	.	none		0.564	SYP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083625.2	NM_003179	
