#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRDM16	63976	hgsc.bcm.edu	37	1	3342300	3342300	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:3342300A>G	ENST00000270722.5	+	13	3144	c.3095A>G	c.(3094-3096)cAc>cGc	p.H1032R	PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Missense_Mutation_p.H1032R|PRDM16_ENST00000442529.2_Missense_Mutation_p.H1031R|PRDM16_ENST00000511072.1_Missense_Mutation_p.H1033R|PRDM16_ENST00000514189.1_Missense_Mutation_p.H1032R|PRDM16_ENST00000441472.2_Missense_Mutation_p.H1031R|PRDM16_ENST00000378398.3_Missense_Mutation_p.H1032R			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	1032	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AAGCACGAGCACGAGAACGCA	0.667			T	EVI1	"""MDS, AML"""																																p.H1032R		Atlas-SNP	.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16	147	.	0			c.A3095G						PASS	.						60.0	69.0	66.0					1																	3342300		2112	4203	6315	SO:0001583	missense	63976	exon13			ACGAGCACGAGAA	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.3095A>G	chr1.hg19:g.3342300A>G	ENSP00000270722:p.His1032Arg	137.0	0.0	.		123.0	24.0	.	NM_022114	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	hg19	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904180	0.52333	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53;2.53;2.53;2.53;2.53	4.02	4.02	0.46733	Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	U	0.000113	T	0.33702	0.0872	M	0.68317	2.08	0.51012	D	0.999906	D;D;B;D	0.60575	0.973;0.988;0.369;0.979	D;D;B;D	0.72982	0.921;0.979;0.364;0.953	T	0.08659	-1.0711	10	0.66056	D	0.02	.	12.9149	0.58200	1.0:0.0:0.0:0.0	.	1032;1032;1031;1031	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	R	1033;1032;1031;1031;1032;1032;1032;848;848;840	ENSP00000426975:H1033R;ENSP00000367651:H1032R;ENSP00000407968:H1031R;ENSP00000405253:H1031R;ENSP00000367643:H1032R;ENSP00000421400:H1032R;ENSP00000270722:H1032R;ENSP00000422504:H848R;ENSP00000425796:H840R	ENSP00000270722:H1032R	H	+	2	0	PRDM16	3332160	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	7.051000	0.76627	1.451000	0.47736	0.379000	0.24179	CAC	.	.	.	none		0.667	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
TAS1R1	80835	hgsc.bcm.edu	37	1	6639491	6639491	+	Silent	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:6639491C>T	ENST00000333172.6	+	6	2566	c.2373C>T	c.(2371-2373)gcC>gcT	p.A791A	TAS1R1_ENST00000351136.3_Silent_p.A537A|TAS1R1_ENST00000328191.4_3'UTR|ZBTB48_ENST00000377674.4_5'Flank	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	791					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TGCCTGCGGCCAACATGATGG	0.587																																					p.A791A		Atlas-SNP	.											.	TAS1R1	76	.	0			c.C2373T						PASS	.						97.0	86.0	90.0					1																	6639491		2203	4300	6503	SO:0001819	synonymous_variant	80835	exon6			TGCGGCCAACATG		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.2373C>T	chr1.hg19:g.6639491C>T		105.0	0.0	.		114.0	46.0	.	NM_138697	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Silent	SNP	ENST00000333172.6	hg19	CCDS81.1																																																																																			.	.	.	none		0.587	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
COL8A2	1296	hgsc.bcm.edu	37	1	36564488	36564488	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:36564488T>C	ENST00000397799.1	-	4	1018	c.794A>G	c.(793-795)gAg>gGg	p.E265G	COL8A2_ENST00000303143.4_Missense_Mutation_p.E265G|COL8A2_ENST00000481785.1_Missense_Mutation_p.E200G			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	265	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AGCTCCTGGCTCCCCCCTGGG	0.657																																					p.E265G		Atlas-SNP	.											.	COL8A2	41	.	0			c.A794G						PASS	.						14.0	17.0	16.0					1																	36564488		2193	4289	6482	SO:0001583	missense	1296	exon2			CCTGGCTCCCCCC	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.794A>G	chr1.hg19:g.36564488T>C	ENSP00000380901:p.Glu265Gly	61.0	0.0	.		65.0	4.0	.	NM_005202	Q5JV31|Q8TEJ5	Missense_Mutation	SNP	ENST00000397799.1	hg19	CCDS403.1	.	.	.	.	.	.	.	.	.	.	T	6.827	0.521652	0.13005	.	.	ENSG00000171812	ENST00000303143;ENST00000397799;ENST00000481785	D;D;D	0.93906	-3.31;-3.31;-3.31	3.91	3.91	0.45181	.	0.198447	0.43747	D	0.000533	D	0.88742	0.6519	L	0.52206	1.635	0.46298	D	0.998977	P	0.44877	0.845	B	0.40329	0.326	D	0.84976	0.0885	10	0.18276	T	0.48	.	8.5265	0.33309	0.1725:0.0:0.0:0.8275	.	265	P25067	CO8A2_HUMAN	G	265;265;200	ENSP00000305913:E265G;ENSP00000380901:E265G;ENSP00000436433:E200G	ENSP00000305913:E265G	E	-	2	0	COL8A2	36337075	1.000000	0.71417	1.000000	0.80357	0.465000	0.32709	3.987000	0.56944	1.639000	0.50556	0.334000	0.21626	GAG	.	.	.	none		0.657	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1	NM_005202	
MCOLN2	255231	hgsc.bcm.edu	37	1	85431299	85431299	+	Missense_Mutation	SNP	C	C	A	rs527268491		TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:85431299C>A	ENST00000370608.3	-	2	237	c.170G>T	c.(169-171)cGa>cTa	p.R57L	MCOLN2_ENST00000284027.5_Missense_Mutation_p.R29L|MCOLN2_ENST00000531325.1_5'UTR	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	57					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		GCGTCTGGCTCGGTATTTTTC	0.418																																					p.R57L		Atlas-SNP	.											.	MCOLN2	60	.	0			c.G170T						PASS	.						102.0	102.0	102.0					1																	85431299		2203	4300	6503	SO:0001583	missense	255231	exon2			CTGGCTCGGTATT	AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.170G>T	chr1.hg19:g.85431299C>A	ENSP00000359640:p.Arg57Leu	111.0	0.0	.		109.0	5.0	.	NM_153259	A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	ENST00000370608.3	hg19	CCDS30762.1	.	.	.	.	.	.	.	.	.	.	C	33	5.264250	0.95399	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.57107	0.42;0.42	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.67924	0.2945	M	0.72894	2.215	0.58432	D	0.999994	D	0.89917	1.0	D	0.65987	0.94	T	0.66212	-0.5980	10	0.54805	T	0.06	-39.7485	20.5827	0.99408	0.0:1.0:0.0:0.0	.	57	Q8IZK6	MCLN2_HUMAN	L	57;29	ENSP00000359640:R57L;ENSP00000284027:R29L	ENSP00000284027:R29L	R	-	2	0	MCOLN2	85203887	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.568000	0.60857	2.941000	0.99782	0.655000	0.94253	CGA	.	.	.	none		0.418	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259	
PAPPA2	60676	hgsc.bcm.edu	37	1	176809321	176809321	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr1:176809321G>A	ENST00000367662.3	+	22	6379	c.5215G>A	c.(5215-5217)Gat>Aat	p.D1739N		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1739				D -> N (in Ref. 6; CAC11134). {ECO:0000305}.	bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CTTCCAAGCAGATGGTTGGTG	0.507																																					p.D1739N		Atlas-SNP	.											.	PAPPA2	665	.	0			c.G5215A						PASS	.						155.0	155.0	155.0					1																	176809321		2032	4183	6215	SO:0001583	missense	60676	exon22			CAAGCAGATGGTT	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5215G>A	chr1.hg19:g.176809321G>A	ENSP00000356634:p.Asp1739Asn	277.0	0.0	.		310.0	90.0	.	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	hg19	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	35	5.437435	0.96168	.	.	ENSG00000116183	ENST00000367662	D	0.91894	-2.93	5.44	5.44	0.79542	Notch domain (2);	0.000000	0.85682	D	0.000000	D	0.95674	0.8593	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95767	0.8805	10	0.66056	D	0.02	-17.6405	18.8699	0.92309	0.0:0.0:1.0:0.0	.	1739	Q9BXP8	PAPP2_HUMAN	N	1739	ENSP00000356634:D1739N	ENSP00000356634:D1739N	D	+	1	0	PAPPA2	175075944	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.729000	0.91490	2.544000	0.85801	0.655000	0.94253	GAT	.	.	.	none		0.507	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
GREB1	9687	hgsc.bcm.edu	37	2	11716612	11716612	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr2:11716612T>A	ENST00000381486.2	+	5	888	c.588T>A	c.(586-588)aaT>aaA	p.N196K	GREB1_ENST00000234142.5_Missense_Mutation_p.N196K|GREB1_ENST00000263834.5_Missense_Mutation_p.N196K|GREB1_ENST00000389825.3_Missense_Mutation_p.N86K|GREB1_ENST00000381483.2_Missense_Mutation_p.N196K	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	196						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TGGTCCGTAATGCACAAGGGA	0.478																																					p.N196K	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.T588A						PASS	.						126.0	120.0	122.0					2																	11716612		2203	4300	6503	SO:0001583	missense	9687	exon5			CCGTAATGCACAA		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.588T>A	chr2.hg19:g.11716612T>A	ENSP00000370896:p.Asn196Lys	168.0	0.0	.		192.0	8.0	.	NM_148903	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.520760	0.64747	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	T;D;D;D;T	0.82167	3.02;-1.58;-1.58;-1.58;3.02	5.08	-3.82	0.04281	.	0.000000	0.85682	D	0.000000	D	0.84428	0.5470	M	0.66939	2.045	0.58432	D	0.99999	P;D;P;D	0.54772	0.94;0.968;0.897;0.959	P;P;P;P	0.54889	0.625;0.763;0.465;0.526	T	0.82952	-0.0202	10	0.72032	D	0.01	-8.2171	13.0658	0.59032	0.0:0.4458:0.0:0.5542	.	196;86;196;196	Q4ZG55-2;F8W6E5;Q4ZG55-3;Q4ZG55	.;.;.;GREB1_HUMAN	K	196;196;86;196;196	ENSP00000370896:N196K;ENSP00000263834:N196K;ENSP00000374475:N86K;ENSP00000370892:N196K;ENSP00000234142:N196K	ENSP00000234142:N196K	N	+	3	2	GREB1	11634063	0.667000	0.27484	0.014000	0.15608	0.860000	0.49131	-0.199000	0.09491	-1.399000	0.02063	-1.139000	0.01908	AAT	.	.	.	none		0.478	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
GRM2	2912	hgsc.bcm.edu	37	3	51750001	51750001	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr3:51750001C>T	ENST00000395052.3	+	4	2446	c.2212C>T	c.(2212-2214)Ctc>Ttc	p.L738F	GRM2_ENST00000475478.1_3'UTR|GRM2_ENST00000442933.2_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	738					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CAATGTGCTCCTCATCGCGCT	0.577																																					p.L738F		Atlas-SNP	.											.	GRM2	91	.	0			c.C2212T						PASS	.						120.0	94.0	103.0					3																	51750001		2203	4300	6503	SO:0001583	missense	2912	exon4			GTGCTCCTCATCG	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.2212C>T	chr3.hg19:g.51750001C>T	ENSP00000378492:p.Leu738Phe	133.0	0.0	.		104.0	31.0	.	NM_000839	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	hg19	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937162	0.73557	.	.	ENSG00000164082	ENST00000395052	D	0.96365	-3.99	5.14	5.14	0.70334	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98604	0.9533	H	0.96604	3.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98917	1.0782	10	0.87932	D	0	.	10.6161	0.45451	0.0:0.8753:0.0:0.1247	.	738	Q14416	GRM2_HUMAN	F	738	ENSP00000378492:L738F	ENSP00000378492:L738F	L	+	1	0	GRM2	51725041	1.000000	0.71417	0.998000	0.56505	0.864000	0.49448	5.989000	0.70587	2.567000	0.86603	0.549000	0.68633	CTC	.	.	.	none		0.577	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
KIAA2018	205717	hgsc.bcm.edu	37	3	113376859	113376859	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr3:113376859C>A	ENST00000478658.1	-	5	3687	c.3670G>T	c.(3670-3672)Gca>Tca	p.A1224S	KIAA2018_ENST00000316407.4_Missense_Mutation_p.A1224S|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1224						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TGTAAAGATGCATTTGATGTT	0.418																																					p.A1224S		Atlas-SNP	.											.	KIAA2018	180	.	0			c.G3670T						PASS	.						86.0	83.0	84.0					3																	113376859		1945	4164	6109	SO:0001583	missense	205717	exon7			AAGATGCATTTGA	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3670G>T	chr3.hg19:g.113376859C>A	ENSP00000420721:p.Ala1224Ser	97.0	0.0	.		101.0	29.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	hg19	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	C	3.356	-0.131444	0.06753	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.14022	2.54;2.54	5.67	3.84	0.44239	.	0.282276	0.34386	N	0.004013	T	0.05547	0.0146	N	0.14661	0.345	0.28041	N	0.933755	B	0.15141	0.012	B	0.12156	0.007	T	0.38950	-0.9637	10	0.07030	T	0.85	-2.1301	2.9175	0.05757	0.3149:0.4409:0.1391:0.1051	.	1224	Q68DE3	K2018_HUMAN	S	1224	ENSP00000320794:A1224S;ENSP00000420721:A1224S	ENSP00000320794:A1224S	A	-	1	0	KIAA2018	114859549	0.971000	0.33674	0.911000	0.35937	0.515000	0.34225	0.248000	0.18198	0.701000	0.31803	0.561000	0.74099	GCA	.	.	.	none		0.418	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ADAD1	132612	hgsc.bcm.edu	37	4	123305047	123305047	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr4:123305047C>G	ENST00000296513.2	+	5	640	c.455C>G	c.(454-456)tCc>tGc	p.S152C	ADAD1_ENST00000388724.2_Missense_Mutation_p.S152C|ADAD1_ENST00000492454.1_3'UTR|ADAD1_ENST00000388725.2_Missense_Mutation_p.S134C	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	152	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						GAGTCTAGATCCAATGCAGCA	0.368																																					p.S152C		Atlas-SNP	.											.	ADAD1	94	.	0			c.C455G						PASS	.						123.0	120.0	121.0					4																	123305047		2203	4300	6503	SO:0001583	missense	132612	exon5			CTAGATCCAATGC	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.455C>G	chr4.hg19:g.123305047C>G	ENSP00000296513:p.Ser152Cys	99.0	0.0	.		115.0	29.0	.	NM_139243	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	ENST00000296513.2	hg19	CCDS34058.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993627	0.74703	.	.	ENSG00000164113	ENST00000446706;ENST00000296513;ENST00000439307;ENST00000388724;ENST00000388725	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	5.84	5.84	0.93424	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.354445	0.30455	N	0.009587	T	0.82181	0.4981	L	0.29908	0.895	0.33397	D	0.576823	D;D	0.69078	0.996;0.997	D;D	0.66351	0.936;0.943	D	0.85408	0.1135	10	0.54805	T	0.06	-7.2127	18.912	0.92489	0.0:1.0:0.0:0.0	.	152;152	Q96M93-2;Q96M93	.;ADAD1_HUMAN	C	152;152;152;152;134	ENSP00000390510:S152C;ENSP00000296513:S152C;ENSP00000397254:S152C;ENSP00000373376:S152C;ENSP00000373377:S134C	ENSP00000296513:S152C	S	+	2	0	ADAD1	123524497	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.447000	0.35101	2.768000	0.95171	0.579000	0.79373	TCC	.	.	.	none		0.368	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243	
FNDC9	408263	hgsc.bcm.edu	37	5	156769880	156769880	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr5:156769880C>A	ENST00000312349.4	-	2	852	c.665G>T	c.(664-666)tGt>tTt	p.C222F	CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000442283.2_Intron|CYFIP2_ENST00000318218.6_Intron|CYFIP2_ENST00000347377.6_Intron|CYFIP2_ENST00000377576.3_Intron|CYFIP2_ENST00000435847.2_Intron|CYFIP2_ENST00000521420.1_Intron|CYFIP2_ENST00000541131.1_Intron	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9	222						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						TCATTCCCCACAATGAGGCAG	0.547											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C222F		Atlas-SNP	.											.	FNDC9	22	.	0			c.G665T						PASS	.						32.0	33.0	33.0					5																	156769880		2203	4300	6503	SO:0001583	missense	408263	exon2			TCCCCACAATGAG	BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248	ENST00000312349.4:c.665G>T	chr5.hg19:g.156769880C>A	ENSP00000310594:p.Cys222Phe	98.0	0.0	.	1781	94.0	4.0	.	NM_001001343	A8K0Y6	Missense_Mutation	SNP	ENST00000312349.4	hg19	CCDS4337.1	.	.	.	.	.	.	.	.	.	.	C	1.582	-0.531287	0.04112	.	.	ENSG00000172568	ENST00000312349	T	0.22134	1.97	5.08	-2.29	0.06805	.	1.364320	0.05031	N	0.474544	T	0.08626	0.0214	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30650	-0.9971	10	0.10111	T	0.7	-9.222	4.6072	0.12383	0.4398:0.2011:0.0:0.3591	.	222	Q8TBE3	FNDC9_HUMAN	F	222	ENSP00000310594:C222F	ENSP00000310594:C222F	C	-	2	0	FNDC9	156702458	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.134000	0.03228	-0.447000	0.07138	-0.339000	0.08088	TGT	.	.	.	none		0.547	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252573.2	NM_001001343	
SLC35D3	340146	hgsc.bcm.edu	37	6	137245376	137245376	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr6:137245376G>A	ENST00000331858.4	+	2	958	c.793G>A	c.(793-795)Gcc>Acc	p.A265T		NM_001008783.1	NP_001008783.1	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	265					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	13	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		GAAGAGCATCGCCACCATCAC	0.592																																					p.A265T		Atlas-SNP	.											.	SLC35D3	33	.	0			c.G793A						PASS	.						77.0	64.0	68.0					6																	137245376		2203	4300	6503	SO:0001583	missense	340146	exon2			AGCATCGCCACCA		CCDS34544.1	6q23.2	2013-05-22			ENSG00000182747	ENSG00000182747		"""Solute carriers"""	15621	protein-coding gene	gene with protein product		612519		FRCL1			Standard	NM_001008783		Approved		uc003qhe.3	Q5M8T2	OTTHUMG00000015651	ENST00000331858.4:c.793G>A	chr6.hg19:g.137245376G>A	ENSP00000333591:p.Ala265Thr	72.0	0.0	.		76.0	12.0	.	NM_001008783	B4DI58|Q5QNZ6|Q6NX71	Missense_Mutation	SNP	ENST00000331858.4	hg19	CCDS34544.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354459	0.82243	.	.	ENSG00000182747	ENST00000331858	T	0.64085	-0.08	5.68	5.68	0.88126	Domain of unknown function DUF250 (1);	0.056787	0.64402	D	0.000001	T	0.63034	0.2477	L	0.36672	1.1	0.58432	D	0.999995	D	0.67145	0.996	P	0.60682	0.878	T	0.58713	-0.7588	10	0.34782	T	0.22	-25.1818	19.7951	0.96477	0.0:0.0:1.0:0.0	.	265	Q5M8T2	S35D3_HUMAN	T	265	ENSP00000333591:A265T	ENSP00000333591:A265T	A	+	1	0	SLC35D3	137287069	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.777000	0.85628	2.698000	0.92095	0.561000	0.74099	GCC	.	.	.	none		0.592	SLC35D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042389.2	XM_294017	
IFNGR1	3459	hgsc.bcm.edu	37	6	137519461	137519461	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr6:137519461C>A	ENST00000367739.4	-	7	1298	c.1177G>T	c.(1177-1179)Gct>Tct	p.A393S	IFNGR1_ENST00000543628.1_Missense_Mutation_p.A365S	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	393					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	GAGTTTAAAGCGATGCTGCCA	0.443																																					p.A393S		Atlas-SNP	.											.	IFNGR1	46	.	0			c.G1177T						PASS	.						88.0	88.0	88.0					6																	137519461		2203	4300	6503	SO:0001583	missense	3459	exon7			TTAAAGCGATGCT		CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.1177G>T	chr6.hg19:g.137519461C>A	ENSP00000356713:p.Ala393Ser	125.0	0.0	.		103.0	5.0	.	NM_000416	B4DFT7|E1P587|Q53Y96	Missense_Mutation	SNP	ENST00000367739.4	hg19	CCDS5185.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.776120	0.31411	.	.	ENSG00000027697	ENST00000367739;ENST00000543628	T;T	0.72394	-0.65;-0.49	6.06	-12.1	0.00011	.	2.161120	0.01880	N	0.037820	T	0.20577	0.0495	N	0.12182	0.205	0.09310	N	1	B;B	0.20164	0.031;0.042	B;B	0.22601	0.04;0.03	T	0.10917	-1.0609	10	0.27082	T	0.32	-0.1572	5.4548	0.16584	0.1953:0.5294:0.0993:0.176	.	365;393	F5H5M7;P15260	.;INGR1_HUMAN	S	393;365	ENSP00000356713:A393S;ENSP00000443282:A365S	ENSP00000356713:A393S	A	-	1	0	IFNGR1	137561154	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.897000	0.01603	-2.423000	0.00562	-1.202000	0.01658	GCT	.	.	.	none		0.443	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1		
LAMB1	3912	hgsc.bcm.edu	37	7	107572810	107572810	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr7:107572810G>A	ENST00000222399.6	-	28	4431	c.4201C>T	c.(4201-4203)Ccc>Tcc	p.P1401S	LAMB1_ENST00000474380.1_5'UTR|LAMB1_ENST00000393561.1_Missense_Mutation_p.P1425S	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1401	Domain alpha.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.P1401T(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GCCCCTGGGGGTGTTCCACAG	0.592																																					p.P1401S		Atlas-SNP	.											LAMB1,NS,carcinoma,0,1	LAMB1	185	.	1	Substitution - Missense(1)	lung(1)	c.C4201T						PASS	.						67.0	64.0	65.0					7																	107572810		2203	4300	6503	SO:0001583	missense	3912	exon28			CTGGGGGTGTTCC	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4201C>T	chr7.hg19:g.107572810G>A	ENSP00000222399:p.Pro1401Ser	132.0	1.0	.		152.0	45.0	.	NM_002291	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	hg19	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918956	0.33908	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.29917	1.55;1.55	5.28	5.28	0.74379	.	.	.	.	.	T	0.24890	0.0604	L	0.37850	1.14	0.33891	D	0.637353	B;B	0.17667	0.023;0.014	B;B	0.17098	0.017;0.016	T	0.20042	-1.0287	9	0.45353	T	0.12	.	9.8304	0.40939	0.0744:0.1405:0.7851:0.0	.	1401;1425	P07942;G3XAI2	LAMB1_HUMAN;.	S	1425;1401	ENSP00000377191:P1425S;ENSP00000222399:P1401S	ENSP00000222399:P1401S	P	-	1	0	LAMB1	107360046	0.999000	0.42202	0.979000	0.43373	0.967000	0.64934	4.639000	0.61361	2.627000	0.88993	0.655000	0.94253	CCC	.	.	.	none		0.592	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
PTPRZ1	5803	hgsc.bcm.edu	37	7	121653581	121653581	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr7:121653581G>T	ENST00000393386.2	+	12	4892	c.4481G>T	c.(4480-4482)aGt>aTt	p.S1494I	PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1494					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TCCTCAGACAGTCAAACTGGT	0.398																																					p.S1494I		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.G4481T						PASS	.						88.0	85.0	86.0					7																	121653581		2203	4300	6503	SO:0001583	missense	5803	exon12			CAGACAGTCAAAC	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.4481G>T	chr7.hg19:g.121653581G>T	ENSP00000377047:p.Ser1494Ile	78.0	0.0	.		91.0	29.0	.	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	hg19	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756857	0.49362	.	.	ENSG00000106278	ENST00000393386	T	0.54071	0.59	4.95	4.07	0.47477	.	0.299113	0.33057	N	0.005339	T	0.43456	0.1248	L	0.44542	1.39	0.80722	D	1	B	0.33379	0.41	B	0.35550	0.205	T	0.33394	-0.9870	10	0.37606	T	0.19	.	9.1534	0.36978	0.1675:0.0:0.8325:0.0	.	1494	P23471	PTPRZ_HUMAN	I	1494	ENSP00000377047:S1494I	ENSP00000377047:S1494I	S	+	2	0	PTPRZ1	121440817	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.448000	0.35112	1.215000	0.43411	0.555000	0.69702	AGT	.	.	.	none		0.398	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
SCARA5	286133	hgsc.bcm.edu	37	8	27737097	27737097	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr8:27737097C>T	ENST00000354914.3	-	8	1825	c.1340G>A	c.(1339-1341)cGa>cAa	p.R447Q	SCARA5_ENST00000380385.2_Missense_Mutation_p.R222Q	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	447	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)	p.R447P(1)		central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		TTGCCCGAATCGAGCTGTGCG	0.622																																					p.R447Q		Atlas-SNP	.											SCARA5,NS,carcinoma,0,1	SCARA5	53	.	1	Substitution - Missense(1)	lung(1)	c.G1340A						PASS	.						142.0	110.0	121.0					8																	27737097		2203	4300	6503	SO:0001583	missense	286133	exon8			CCGAATCGAGCTG	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1340G>A	chr8.hg19:g.27737097C>T	ENSP00000346990:p.Arg447Gln	171.0	0.0	.		187.0	49.0	.	NM_173833	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	hg19	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491434	0.44249	.	.	ENSG00000168079	ENST00000354914;ENST00000380385	T;T	0.44482	0.92;0.92	4.87	1.96	0.26148	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.165261	0.40554	N	0.001077	T	0.28732	0.0712	L	0.38649	1.16	0.80722	D	1	B;B	0.22851	0.003;0.076	B;B	0.15870	0.003;0.014	T	0.07501	-1.0769	10	0.46703	T	0.11	.	7.6192	0.28175	0.0:0.6991:0.0:0.3009	.	222;447	Q6ZMJ2-4;Q6ZMJ2	.;SCAR5_HUMAN	Q	447;222	ENSP00000346990:R447Q;ENSP00000369746:R222Q	ENSP00000346990:R447Q	R	-	2	0	SCARA5	27793016	0.174000	0.23070	0.360000	0.25837	0.505000	0.33919	1.411000	0.34702	0.536000	0.28733	0.591000	0.81541	CGA	.	.	.	none		0.622	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	
RAD21	5885	hgsc.bcm.edu	37	8	117862960	117862960	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr8:117862960G>A	ENST00000297338.2	-	12	1804	c.1517C>T	c.(1516-1518)cCa>cTa	p.P506L	RAD21_ENST00000523986.1_Missense_Mutation_p.P10L|RAD21_ENST00000518055.1_Missense_Mutation_p.P51L|RAD21_ENST00000517749.1_5'Flank	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	506	Pro-rich.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					AGGTTCTTCTGGGGGAAGCTC	0.378																																					p.P506L		Atlas-SNP	.											.	RAD21	95	.	0			c.C1517T						PASS	.						131.0	130.0	130.0					8																	117862960		2203	4300	6503	SO:0001583	missense	5885	exon12			TCTTCTGGGGGAA	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.1517C>T	chr8.hg19:g.117862960G>A	ENSP00000297338:p.Pro506Leu	150.0	0.0	.		173.0	7.0	.	NM_006265	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	hg19	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208572	0.58343	.	.	ENSG00000164754	ENST00000297338;ENST00000523986;ENST00000518055	T;T;T	0.80123	0.64;-1.34;-0.19	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.77585	0.4152	L	0.60455	1.87	0.80722	D	1	B	0.31318	0.319	B	0.27608	0.081	T	0.74262	-0.3722	10	0.22109	T	0.4	-6.1488	19.0827	0.93188	0.0:0.0:1.0:0.0	.	506	O60216	RAD21_HUMAN	L	506;10;51	ENSP00000297338:P506L;ENSP00000428513:P10L;ENSP00000428003:P51L	ENSP00000297338:P506L	P	-	2	0	RAD21	117932141	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.869000	0.87170	2.477000	0.83638	0.460000	0.39030	CCA	.	.	.	none		0.378	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265	
CCIN	881	hgsc.bcm.edu	37	9	36170395	36170395	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr9:36170395C>T	ENST00000335119.2	+	1	1007	c.896C>T	c.(895-897)gCt>gTt	p.A299V		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	299					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			GGAGTGTTTGCTTATATCATC	0.557																																					p.A299V		Atlas-SNP	.											.	CCIN	56	.	0			c.C896T						PASS	.						79.0	75.0	76.0					9																	36170395		2203	4300	6503	SO:0001583	missense	881	exon1			TGTTTGCTTATAT	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.896C>T	chr9.hg19:g.36170395C>T	ENSP00000334996:p.Ala299Val	169.0	0.0	.		135.0	8.0	.	NM_005893	Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	hg19	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.502198	0.64298	.	.	ENSG00000185972	ENST00000335119	T	0.65732	-0.17	5.97	5.97	0.96955	Kelch-type beta propeller (1);	0.000000	0.56097	D	0.000024	T	0.66577	0.2803	L	0.29908	0.895	0.39812	D	0.972727	D	0.63880	0.993	D	0.68192	0.956	T	0.59386	-0.7464	10	0.12766	T	0.61	.	15.9243	0.79603	0.0:1.0:0.0:0.0	.	299	Q13939	CALI_HUMAN	V	299	ENSP00000334996:A299V	ENSP00000334996:A299V	A	+	2	0	CCIN	36160395	0.997000	0.39634	1.000000	0.80357	0.954000	0.61252	4.483000	0.60264	2.839000	0.97877	0.655000	0.94253	GCT	.	.	.	none		0.557	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893	
ANO5	203859	hgsc.bcm.edu	37	11	22294380	22294380	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:22294380C>A	ENST00000324559.8	+	19	2397	c.2080C>A	c.(2080-2082)Cct>Act	p.P694T	ANO5_ENST00000532043.1_3'UTR	NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	694					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)	p.P694fs*7(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCCTTTGGCTCCTCTTCTTGC	0.378																																					p.P694T		Atlas-SNP	.											.,1	ANO5	162	.	1	Deletion - Frameshift(1)	breast(1)	c.C2080A						PASS	.						150.0	131.0	138.0					11																	22294380		2203	4300	6503	SO:0001583	missense	203859	exon19			TTGGCTCCTCTTC	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.2080C>A	chr11.hg19:g.22294380C>A	ENSP00000315371:p.Pro694Thr	98.0	1.0	.		98.0	29.0	.	NM_213599		Missense_Mutation	SNP	ENST00000324559.8	hg19	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.087948	0.76642	.	.	ENSG00000171714	ENST00000324559	T	0.68025	-0.3	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.84606	0.5509	H	0.96748	3.875	0.80722	D	1	B	0.22276	0.067	B	0.39771	0.309	D	0.85101	0.0957	10	0.87932	D	0	.	19.9071	0.97012	0.0:1.0:0.0:0.0	.	694	Q75V66	ANO5_HUMAN	T	694	ENSP00000315371:P694T	ENSP00000315371:P694T	P	+	1	0	ANO5	22250956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.767000	0.85331	2.776000	0.95493	0.651000	0.88453	CCT	.	.	.	none		0.378	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	
RCOR2	283248	hgsc.bcm.edu	37	11	63679913	63679913	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:63679913C>A	ENST00000301459.4	-	11	1508	c.1121G>T	c.(1120-1122)cGg>cTg	p.R374L	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	374	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						GAAGCGGCGCCGGTAGCTCAC	0.587																																					p.R374L		Atlas-SNP	.											.	RCOR2	43	.	0			c.G1121T						PASS	.						64.0	76.0	72.0					11																	63679913		2201	4297	6498	SO:0001583	missense	283248	exon11			CGGCGCCGGTAGC	BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.1121G>T	chr11.hg19:g.63679913C>A	ENSP00000301459:p.Arg374Leu	188.0	0.0	.		180.0	55.0	.	NM_173587	Q96FP3	Missense_Mutation	SNP	ENST00000301459.4	hg19	CCDS8052.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040706	0.93685	.	.	ENSG00000167771	ENST00000301459	T	0.37411	1.2	4.55	4.55	0.56014	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.89287	3.02	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.74237	-0.3730	10	0.87932	D	0	.	16.6282	0.84992	0.0:1.0:0.0:0.0	.	374	Q8IZ40	RCOR2_HUMAN	L	374	ENSP00000301459:R374L	ENSP00000301459:R374L	R	-	2	0	RCOR2	63436489	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.314000	0.78988	2.536000	0.85505	0.561000	0.74099	CGG	.	.	.	none		0.587	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318233.1	NM_173587	
RBM4B	83759	hgsc.bcm.edu	37	11	66444485	66444485	+	Silent	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:66444485G>A	ENST00000525754.1	-	1	734	c.66C>T	c.(64-66)ttC>ttT	p.F22F	RBM4B_ENST00000524637.1_Silent_p.F22F|RBM4B_ENST00000531969.1_Silent_p.F22F|RBM4B_ENST00000531036.2_Silent_p.F22F|RBM4B_ENST00000310046.4_Silent_p.F22F			Q9BQ04	RBM4B_HUMAN	RNA binding motif protein 4B	22	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|entrainment of circadian clock by photoperiod (GO:0043153)|mRNA processing (GO:0006397)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)|urinary_tract(2)	10						CATACTGCTCGAAGAGTGAGC	0.512																																					p.F22F		Atlas-SNP	.											.	RBM4B	27	.	0			c.C66T						PASS	.						91.0	91.0	91.0					11																	66444485		2200	4295	6495	SO:0001819	synonymous_variant	83759	exon2			CTGCTCGAAGAGT	AK095158	CCDS8149.1, CCDS66144.1	11q13	2013-02-12	2006-01-25	2006-01-25				"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	28842	protein-coding gene	gene with protein product			"""RNA binding motif protein 30"""	RBM30		12477932	Standard	XR_247213		Approved	MGC10871, ZCCHC15, RBM4L, ZCRB3B, ZCCHC21B	uc001ojb.3	Q9BQ04		ENST00000525754.1:c.66C>T	chr11.hg19:g.66444485G>A		259.0	0.0	.		235.0	52.0	.	NM_031492	B3KT83	Silent	SNP	ENST00000525754.1	hg19	CCDS8149.1																																																																																			.	.	.	none		0.512	RBM4B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393851.1	NM_031492	
SLC36A4	120103	hgsc.bcm.edu	37	11	92917687	92917687	+	Splice_Site	SNP	C	C	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr11:92917687C>A	ENST00000326402.4	-	3	310		c.e3-1		SLC36A4_ENST00000529184.1_Splice_Site	NM_152313.2	NP_689526.2	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 4						L-alanine transport (GO:0015808)|proline transport (GO:0015824)|tryptophan transport (GO:0015827)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	25		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTGTACAAATCTGAAAAGTAA	0.313																																					.		Atlas-SNP	.											.	SLC36A4	61	.	0			c.180-1G>T						PASS	.						99.0	105.0	103.0					11																	92917687		2201	4297	6498	SO:0001630	splice_region_variant	120103	exon4			ACAAATCTGAAAA	AY162216	CCDS8291.1, CCDS66202.1	11q21	2013-05-22			ENSG00000180773	ENSG00000180773		"""Solute carriers"""	19660	protein-coding gene	gene with protein product		613760					Standard	XM_005273758		Approved	PAT4, FLJ38932	uc001pdn.3	Q6YBV0	OTTHUMG00000167368	ENST00000326402.4:c.180-1G>T	chr11.hg19:g.92917687C>A		135.0	0.0	.		135.0	50.0	.	NM_152313	Q86X30|Q8IVM5|Q8N8S6	Splice_Site	SNP	ENST00000326402.4	hg19	CCDS8291.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172159	0.78452	.	.	ENSG00000180773	ENST00000326402	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2544	0.98414	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC36A4	92557335	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.132000	0.71676	2.885000	0.99019	0.655000	0.94253	.	.	.	.	none		0.313	SLC36A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394329.2		Intron
ITGAL	3683	hgsc.bcm.edu	37	16	30490672	30490672	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr16:30490672G>A	ENST00000356798.6	+	6	646	c.466G>A	c.(466-468)Gac>Aac	p.D156N	ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000358164.5_Intron|ITGAL_ENST00000454514.2_Intron|RP11-297C4.3_ENST00000562525.1_RNA|RP11-297C4.2_ENST00000569459.1_RNA	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	156	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GGGCAACGTAGACCTGGTATT	0.478																																					p.D156N	NSCLC(110;1462 1641 3311 33990 49495)	Atlas-SNP	.											.	ITGAL	149	.	0			c.G466A						PASS	.						120.0	108.0	112.0					16																	30490672		2197	4300	6497	SO:0001583	missense	3683	exon6			AACGTAGACCTGG		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.466G>A	chr16.hg19:g.30490672G>A	ENSP00000349252:p.Asp156Asn	104.0	0.0	.		101.0	43.0	.	NM_002209	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	hg19	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796940	0.90453	.	.	ENSG00000005844	ENST00000356798	D	0.92149	-2.98	5.98	5.98	0.97165	von Willebrand factor, type A (3);	0.000000	0.56097	D	0.000021	D	0.94434	0.8209	M	0.73430	2.235	0.80722	D	1	P	0.44006	0.824	P	0.51193	0.662	D	0.94464	0.7679	10	0.72032	D	0.01	.	17.3632	0.87357	0.0:0.0:1.0:0.0	.	156	P20701	ITAL_HUMAN	N	156	ENSP00000349252:D156N	ENSP00000349252:D156N	D	+	1	0	ITGAL	30398173	1.000000	0.71417	0.978000	0.43139	0.941000	0.58515	4.655000	0.61476	2.838000	0.97847	0.514000	0.50259	GAC	.	.	.	none		0.478	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
SHD	56961	hgsc.bcm.edu	37	19	4290585	4290585	+	Silent	SNP	C	C	T	rs111268424		TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr19:4290585C>T	ENST00000543264.2	+	6	2441	c.978C>T	c.(976-978)gcC>gcT	p.A326A	SHD_ENST00000599689.1_Silent_p.A286A	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	326	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.									breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCAGGGTGCCGAGCATCTGG	0.657																																					p.A326A		Atlas-SNP	.											.	SHD	33	.	0			c.C978T						PASS	.						59.0	53.0	55.0					19																	4290585		2203	4300	6503	SO:0001819	synonymous_variant	56961	exon6			GGGTGCCGAGCAT	BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.978C>T	chr19.hg19:g.4290585C>T		105.0	0.0	.		107.0	42.0	.	NM_020209	Q96NC2	Silent	SNP	ENST00000543264.2	hg19	CCDS12125.1																																																																																			.	C|0.500;T|0.500	0.500	weak		0.657	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1	NM_020209	
TP53RK	112858	hgsc.bcm.edu	37	20	45315804	45315804	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr20:45315804T>C	ENST00000372102.3	-	2	380	c.355A>G	c.(355-357)Aag>Gag	p.K119E	RP1-28H20.3_ENST00000606362.1_lincRNA			Q96S44	PRPK_HUMAN	TP53 regulating kinase	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				lipopolysaccharide biosynthetic process (GO:0009103)|protein phosphorylation (GO:0006468)|tRNA processing (GO:0008033)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|large_intestine(1)|lung(4)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				CACTGAGCCTTCAATTTCTTC	0.418																																					p.E117G		Atlas-SNP	.											.	TP53RK	13	.	0			c.A350G						PASS	.						151.0	172.0	165.0					20																	45315804		2202	4300	6502	SO:0001583	missense	112858	exon2			GAGCCTTCAATTT		CCDS13401.1	20q13.2	2014-05-14	2004-05-10	2004-05-12	ENSG00000172315	ENSG00000172315			16197	protein-coding gene	gene with protein product		608679	"""chromosome 20 open reading frame 64"""	C20orf64		11546806, 12914926	Standard	NM_033550		Approved	dJ101A2.2, prpk, Nori-2p, BUD32	uc002xsk.3	Q96S44	OTTHUMG00000085887	ENST00000372102.3:c.355A>G	chr20.hg19:g.45315804T>C	ENSP00000361174:p.Lys119Glu	408.0	1.0	.		360.0	116.0	.	NM_033550	B3KU44|Q3T977|Q5JZ01|Q6NZ60|Q96FM7|Q9NQE6	Missense_Mutation	SNP	ENST00000372102.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.74|11.74	1.727453|1.727453	0.30593|0.30593	.|.	.|.	ENSG00000172315|ENSG00000172315	ENST00000372114|ENST00000372102	T|T	0.12361|0.47869	2.69|0.83	5.38|5.38	3.04|3.04	0.35103|0.35103	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.167964|.	0.52532|.	D|.	0.000073|.	T|T	0.33731|0.33731	0.0873|0.0873	L|L	0.39898|0.39898	1.24|1.24	0.23677|0.23677	N|N	0.997139|0.997139	P|B	0.49961|0.31548	0.93|0.328	P|B	0.53224|0.34242	0.721|0.178	T|T	0.25641|0.25641	-1.0126|-1.0126	10|9	0.42905|0.07644	T|T	0.14|0.81	-10.1094|-10.1094	6.7483|6.7483	0.23474|0.23474	0.1725:0.0:0.2393:0.5882|0.1725:0.0:0.2393:0.5882	.|.	117|119	Q96S44|Q5JZ02	PRPK_HUMAN|.	G|E	117|119	ENSP00000361186:E117G|ENSP00000361174:K119E	ENSP00000361186:E117G|ENSP00000361174:K119E	E|K	-|-	2|1	0|0	TP53RK|TP53RK	44749211|44749211	0.999000|0.999000	0.42202|0.42202	0.971000|0.971000	0.41717|0.41717	0.502000|0.502000	0.33828|0.33828	1.944000|1.944000	0.40263|0.40263	0.449000|0.449000	0.26747|0.26747	-0.313000|-0.313000	0.08912|0.08912	GAA|AAG	.	.	.	none		0.418	TP53RK-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000193688.1	NM_033550	
KDELR3	11015	hgsc.bcm.edu	37	22	38877225	38877225	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr22:38877225G>A	ENST00000216014.4	+	4	532	c.360G>A	c.(358-360)tgG>tgA	p.W120*	KDELR3_ENST00000471268.1_3'UTR|KDELR3_ENST00000409006.3_Nonsense_Mutation_p.W120*	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	120					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					AGATCCTCTGGACTTTCTCTA	0.448																																					p.W120X	Ovarian(11;103 529 24120 28493 32980)	Atlas-SNP	.											.	KDELR3	39	.	0			c.G360A						PASS	.						173.0	182.0	179.0					22																	38877225		2203	4300	6503	SO:0001587	stop_gained	11015	exon4			CCTCTGGACTTTC	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.360G>A	chr22.hg19:g.38877225G>A	ENSP00000216014:p.Trp120*	285.0	0.0	.		282.0	79.0	.	NM_016657	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Nonsense_Mutation	SNP	ENST00000216014.4	hg19	CCDS13972.1	.	.	.	.	.	.	.	.	.	.	G	35	5.560833	0.96527	.	.	ENSG00000100196	ENST00000216014;ENST00000409006	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4255	0.90607	0.0:0.0:1.0:0.0	.	.	.	.	X	120	.	ENSP00000216014:W120X	W	+	3	0	KDELR3	37207171	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.657000	0.98554	2.595000	0.87683	0.650000	0.86243	TGG	.	.	.	none		0.448	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
MT-ND4L	4539	hgsc.bcm.edu	37	M	10668	10668	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chrM:10668G>A	ENST00000361335.1	+	1	199	c.199G>A	c.(199-201)Gcc>Acc	p.A67T	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank			P03901	NU4LM_HUMAN	mitochondrially encoded NADH dehydrogenase 4L	67					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(2)|kidney(2)	5						TACTAGTCTTTGCCGCCTGCG	0.453																																					p.A67T		Atlas-SNP	.											.	.	.	.	0			c.G199A						PASS	.																																			SO:0001583	missense	0	exon1			GTCTTTGCCGCCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000212907	ENSG00000212907	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7460	protein-coding gene	gene with protein product	"""complex I ND4L subunit"", ""NADH-ubiquinone oxidoreductase chain 4L"""	516004	"""NADH dehydrogenase 4L"""	MTND4L			Standard			Approved	ND4L, NAD4L		P03901		ENST00000361335.1:c.199G>A	chrM.hg19:g.10668G>A	ENSP00000354728:p.Ala67Thr	1.0	0.0	.		9.0	6.0	.	ENST00000361335		Missense_Mutation	SNP	ENST00000361335.1	hg19																																																																																				.	.	.	none		0.453	MT-ND4L-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024034	
DNAJA2	10294	hgsc.bcm.edu	37	16	47005807	47005807	+	Splice_Site	DEL	C	C	-			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr16:47005807delC	ENST00000317089.5	-	2	354		c.e2+1		RP11-169E6.1_ENST00000562536.1_RNA	NM_005880.3	NP_005871.1	O60884	DNJA2_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 2						positive regulation of cell proliferation (GO:0008284)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	14		all_cancers(37;0.00125)|all_lung(18;0.00338)|all_epithelial(9;0.00358)|Lung NSC(13;0.0309)|Breast(268;0.116)				AAATAACTTACTTTGTCTCCT	0.343																																					.		Atlas-INDEL	.											.	DNAJA2	28	.	0			c.138+2G>-						PASS	.						127.0	126.0	126.0					16																	47005807		2203	4300	6503	SO:0001630	splice_region_variant	10294	exon3			.	AF116720	CCDS10726.1	16q12.1	2011-09-02			ENSG00000069345	ENSG00000069345		"""Heat shock proteins / DNAJ (HSP40)"""	14884	protein-coding gene	gene with protein product		611322				9710638, 11147971	Standard	NM_005880		Approved	HIRIP4, DNAJ, CPR3, DNJ3	uc002eeo.2	O60884	OTTHUMG00000133104	ENST00000317089.5:c.138+1G>-	chr16.hg19:g.47005807delC		179.0	0.0	0		155.0	47.0	0.303226	NM_005880	B2R7L7|O14711	Splice_Site	DEL	ENST00000317089.5	hg19	CCDS10726.1																																																																																			.	.	.	none		0.343	DNAJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256769.2		Intron
CADPS	8618	hgsc.bcm.edu	37	3	62477094	62477096	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	AAC	AAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr3:62477094_62477096delAAC	ENST00000383710.4	-	21	3293_3295	c.2944_2946delGTT	c.(2944-2946)gttdel	p.V982del	CADPS_ENST00000283269.9_In_Frame_Del_p.V992del|CADPS_ENST00000357948.3_In_Frame_Del_p.V952del	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	982	Interaction with DRD2.|MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCACATATCTAACAACAAGTGGG	0.419																																					p.992_993del		Atlas-INDEL	.											.	CADPS	387	.	0			c.2975_2977del						PASS	.																																			SO:0001651	inframe_deletion	8618	exon20			.	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2944_2946delGTT	chr3.hg19:g.62477097_62477099delAAC	ENSP00000373215:p.Val982del	203.0	0.0	0		191.0	53.0	0.277487	NM_183394	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	In_Frame_Del	DEL	ENST00000383710.4	hg19	CCDS46858.1																																																																																			.	.	.	none		0.419	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
ARHGAP35	2909	hgsc.bcm.edu	37	19	47422875	47422875	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-7915-01A-11D-2201-08	TCGA-A4-7915-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	42528857-7966-471e-a0fe-27a109429871	e6538442-84f0-47d1-aee6-60a032d2d9d0	g.chr19:47422875delC	ENST00000404338.3	+	1	943	c.943delC	c.(943-945)cagfs	p.Q315fs		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	315	FF 1.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										GGAAGGGACTCAGAAAGCCAA	0.507																																					p.T314fs		Atlas-INDEL	.											.	.	.	.	0			c.942delT						PASS	.						32.0	32.0	32.0					19																	47422875		1979	4167	6146	SO:0001589	frameshift_variant	2909	exon1			.	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.943delC	chr19.hg19:g.47422875delC	ENSP00000385720:p.Gln315fs	55.0	0.0	0		46.0	13.0	0.282609	NM_004491	A7E2A4|Q14452|Q9C0E1	Frame_Shift_Del	DEL	ENST00000404338.3	hg19	CCDS46127.1																																																																																			.	.	.	none		0.507	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
