#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RERE	473	hgsc.bcm.edu	37	1	8674682	8674682	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:8674682A>T	ENST00000337907.3	-	5	1094	c.460T>A	c.(460-462)Tct>Act	p.S154T	RERE_ENST00000400907.2_Missense_Mutation_p.S154T|RERE_ENST00000400908.2_Missense_Mutation_p.S154T	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	154	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		ACCGGCAGAGAGCATGCTGGG	0.498																																					p.S154T		Atlas-SNP	.											.	RERE	129	.	0			c.T460A						PASS	.						77.0	86.0	83.0					1																	8674682		2203	4300	6503	SO:0001583	missense	473	exon5			GCAGAGAGCATGC	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.460T>A	chr1.hg19:g.8674682A>T	ENSP00000338629:p.Ser154Thr	217.0	0.0	.		183.0	57.0	.	NM_012102	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	hg19	CCDS95.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.568378	0.45798	.	.	ENSG00000142599	ENST00000337907;ENST00000400907;ENST00000400908	T;T	0.43294	0.95;0.95	5.33	5.33	0.75918	Bromo adjacent homology (BAH) domain (3);	.	.	.	.	T	0.42314	0.1197	N	0.17631	0.505	0.80722	D	1	D	0.53885	0.963	D	0.67231	0.95	T	0.21827	-1.0234	9	0.07644	T	0.81	-16.2545	11.6091	0.51049	1.0:0.0:0.0:0.0	.	154	Q9P2R6	RERE_HUMAN	T	154	ENSP00000338629:S154T;ENSP00000383700:S154T	ENSP00000338629:S154T	S	-	1	0	RERE	8597269	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.525000	0.22956	2.234000	0.73211	0.533000	0.62120	TCT	.	.	.	none		0.498	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
TNFRSF1B	7133	hgsc.bcm.edu	37	1	12266986	12266986	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:12266986C>T	ENST00000376259.3	+	10	1384	c.1295C>T	c.(1294-1296)tCa>tTa	p.S432L	TNFRSF1B_ENST00000492361.1_3'UTR	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	432					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	GCCTTTCGGTCACAGCTGGAG	0.622																																					p.S432L		Atlas-SNP	.											.	TNFRSF1B	28	.	0			c.C1295T						PASS	.						100.0	96.0	98.0					1																	12266986		2203	4300	6503	SO:0001583	missense	7133	exon10			TTCGGTCACAGCT	M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.1295C>T	chr1.hg19:g.12266986C>T	ENSP00000365435:p.Ser432Leu	137.0	0.0	.		116.0	34.0	.	NM_001066	B1AJZ3|Q16042|Q6YI29|Q9UIH1	Missense_Mutation	SNP	ENST00000376259.3	hg19	CCDS145.1	.	.	.	.	.	.	.	.	.	.	C	8.806	0.934041	0.18206	.	.	ENSG00000028137	ENST00000376259	D	0.86865	-2.18	4.93	3.01	0.34805	.	3.844360	0.01082	N	0.005008	D	0.85366	0.5680	L	0.57536	1.79	0.09310	N	0.999998	B	0.30068	0.267	B	0.28139	0.086	T	0.66901	-0.5806	10	0.44086	T	0.13	-20.2744	6.4642	0.21973	0.1787:0.7264:0.0:0.0949	.	432	P20333	TNR1B_HUMAN	L	432	ENSP00000365435:S432L	ENSP00000365435:S432L	S	+	2	0	TNFRSF1B	12189573	0.043000	0.20138	0.045000	0.18777	0.005000	0.04900	2.194000	0.42668	0.564000	0.29238	0.561000	0.74099	TCA	.	.	.	none		0.622	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005133.1	NM_001066	
AGMAT	79814	hgsc.bcm.edu	37	1	15909721	15909721	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:15909721T>A	ENST00000375826.3	-	2	584	c.442A>T	c.(442-444)Att>Ttt	p.I148F	DNAJC16_ENST00000483270.1_Intron|RP4-680D5.2_ENST00000428945.1_RNA	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	148					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		GCTGCTACAATTTTCTCATAG	0.502																																					p.I148F	NSCLC(126;1678 1780 25805 43508 49531)	Atlas-SNP	.											.	AGMAT	25	.	0			c.A442T						PASS	.						60.0	62.0	61.0					1																	15909721		2203	4300	6503	SO:0001583	missense	79814	exon2			CTACAATTTTCTC	AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.442A>T	chr1.hg19:g.15909721T>A	ENSP00000364986:p.Ile148Phe	74.0	0.0	.		59.0	24.0	.	NM_024758	Q5TDH1|Q9H5J3	Missense_Mutation	SNP	ENST00000375826.3	hg19	CCDS160.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.284549	0.40394	.	.	ENSG00000116771	ENST00000375826	D	0.86097	-2.07	5.17	4.0	0.46444	Ureohydrolase domain (1);	0.051325	0.85682	D	0.000000	D	0.85864	0.5796	M	0.88241	2.94	0.49483	D	0.99979	B	0.30914	0.3	B	0.28553	0.091	D	0.83786	0.0228	10	0.62326	D	0.03	-10.0798	10.1512	0.42794	0.0:0.0812:0.0:0.9188	.	148	Q9BSE5	SPEB_HUMAN	F	148	ENSP00000364986:I148F	ENSP00000364986:I148F	I	-	1	0	AGMAT	15782308	1.000000	0.71417	0.015000	0.15790	0.482000	0.33219	3.489000	0.53237	0.768000	0.33290	0.460000	0.39030	ATT	.	.	.	none		0.502	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
SLC5A9	200010	hgsc.bcm.edu	37	1	48713171	48713171	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:48713171C>T	ENST00000438567.2	+	14	2054	c.2002C>T	c.(2002-2004)Ctt>Ttt	p.L668F	SLC5A9_ENST00000236495.5_Missense_Mutation_p.L693F|SLC5A9_ENST00000533824.1_Missense_Mutation_p.L689F|SLC5A9_ENST00000471020.1_3'UTR	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	668					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						CAATGCTGTCCTTTTGCTGGC	0.527																																					p.L693F		Atlas-SNP	.											.	SLC5A9	82	.	0			c.C2077T						PASS	.						118.0	109.0	112.0					1																	48713171		2203	4300	6503	SO:0001583	missense	200010	exon15			GCTGTCCTTTTGC	BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.2002C>T	chr1.hg19:g.48713171C>T	ENSP00000401730:p.Leu668Phe	143.0	0.0	.		131.0	36.0	.	NM_001135181	B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Missense_Mutation	SNP	ENST00000438567.2	hg19	CCDS30709.2	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633803	0.47049	.	.	ENSG00000117834	ENST00000533824;ENST00000438567;ENST00000236495	D;D;D	0.89485	-2.46;-2.45;-2.52	4.91	-2.59	0.06209	.	0.427982	0.25433	N	0.030704	D	0.85208	0.5644	L	0.43646	1.37	0.80722	D	1	P;P;P	0.52577	0.883;0.954;0.954	P;P;P	0.50617	0.459;0.526;0.646	T	0.80341	-0.1423	10	0.28530	T	0.3	.	10.552	0.45095	0.6789:0.2512:0.0:0.0699	.	689;668;693	E9PJ08;Q2M3M2;E9PAK4	.;SC5A9_HUMAN;.	F	689;668;693	ENSP00000431900:L689F;ENSP00000401730:L668F;ENSP00000236495:L693F	ENSP00000236495:L693F	L	+	1	0	SLC5A9	48485758	0.564000	0.26602	0.314000	0.25224	0.881000	0.50899	-0.070000	0.11523	-0.340000	0.08388	0.561000	0.74099	CTT	.	.	.	none		0.527	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022061.3	XM_117174	
ZYG11B	79699	hgsc.bcm.edu	37	1	53287171	53287171	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:53287171A>G	ENST00000294353.6	+	14	2250	c.2105A>G	c.(2104-2106)aAa>aGa	p.K702R	ZYG11B_ENST00000443756.2_Missense_Mutation_p.K632R	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	702										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						TACAACATCAAAGATCATGAA	0.418																																					p.K702R		Atlas-SNP	.											.	ZYG11B	61	.	0			c.A2105G						PASS	.						98.0	85.0	89.0					1																	53287171		2203	4300	6503	SO:0001583	missense	79699	exon14			ACATCAAAGATCA	AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.2105A>G	chr1.hg19:g.53287171A>G	ENSP00000294353:p.Lys702Arg	83.0	0.0	.		84.0	18.0	.	NM_024646	Q8N2X3|Q9H8L8	Missense_Mutation	SNP	ENST00000294353.6	hg19	CCDS30717.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.462431	0.26248	.	.	ENSG00000162378	ENST00000443756;ENST00000294353	T;T	0.48836	0.8;0.8	5.36	5.36	0.76844	Armadillo-like helical (1);Armadillo-type fold (1);	0.155352	0.56097	D	0.000023	T	0.25791	0.0628	N	0.08118	0	0.80722	D	1	B;B	0.16802	0.019;0.001	B;B	0.22753	0.041;0.001	T	0.13415	-1.0510	10	0.14656	T	0.56	.	9.8251	0.40908	0.9231:0.0:0.0769:0.0	.	632;702	B4DK95;Q9C0D3	.;ZY11B_HUMAN	R	632;702	ENSP00000400522:K632R;ENSP00000294353:K702R	ENSP00000294353:K702R	K	+	2	0	ZYG11B	53059759	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.218000	0.51192	2.019000	0.59389	0.482000	0.46254	AAA	.	.	.	none		0.418	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646	
USP24	23358	hgsc.bcm.edu	37	1	55612677	55612677	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:55612677A>G	ENST00000294383.6	-	19	2174	c.2175T>C	c.(2173-2175)taT>taC	p.Y725Y	USP24_ENST00000407756.1_Silent_p.Y565Y	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	725					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						TCCAGCCCAGATACAGAGTAG	0.393																																					p.Y725Y		Atlas-SNP	.											.	USP24	323	.	0			c.T2175C						PASS	.						104.0	99.0	101.0					1																	55612677		1852	4098	5950	SO:0001819	synonymous_variant	23358	exon19			GCCCAGATACAGA	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.2175T>C	chr1.hg19:g.55612677A>G		55.0	0.0	.		54.0	20.0	.	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	ENST00000294383.6	hg19	CCDS44154.2																																																																																			.	.	.	none		0.393	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
INADL	10207	hgsc.bcm.edu	37	1	62365295	62365295	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:62365295C>T	ENST00000371158.2	+	23	3286	c.3172C>T	c.(3172-3174)Cca>Tca	p.P1058S	INADL_ENST00000316485.6_Missense_Mutation_p.P1058S	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1058					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AGAAGAAACTCCAAATTTTAG	0.398																																					p.P1058S		Atlas-SNP	.											.	INADL	179	.	0			c.C3172T						PASS	.						179.0	177.0	178.0					1																	62365295		2203	4300	6503	SO:0001583	missense	10207	exon23			GAAACTCCAAATT	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3172C>T	chr1.hg19:g.62365295C>T	ENSP00000360200:p.Pro1058Ser	263.0	0.0	.		256.0	78.0	.	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	hg19	CCDS617.2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626785	0.87560	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.13307	2.74;2.6	5.26	5.26	0.73747	PDZ/DHR/GLGF (1);	0.000000	0.64402	D	0.000001	T	0.39655	0.1086	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	0.991;0.999;1.0	D;D;D	0.85130	0.98;0.997;0.994	T	0.04915	-1.0918	10	0.34782	T	0.22	.	19.2911	0.94100	0.0:1.0:0.0:0.0	.	1058;1058;1058	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	S	1058	ENSP00000360200:P1058S;ENSP00000326199:P1058S	ENSP00000255202:P1058S	P	+	1	0	INADL	62137883	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.990000	0.63876	2.636000	0.89361	0.579000	0.79373	CCA	.	.	.	none		0.398	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
TCHH	7062	hgsc.bcm.edu	37	1	152082279	152082279	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:152082279C>T	ENST00000368804.1	-	2	3413	c.3414G>A	c.(3412-3414)agG>agA	p.R1138R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1138	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			cccgatattgcctctccagct	0.612																																					p.R1138R		Atlas-SNP	.											.	TCHH	275	.	0			c.G3414A						PASS	.						91.0	90.0	90.0					1																	152082279		2000	4154	6154	SO:0001819	synonymous_variant	7062	exon3			ATATTGCCTCTCC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3414G>A	chr1.hg19:g.152082279C>T		175.0	0.0	.		139.0	39.0	.	NM_007113	Q5VUI3	Silent	SNP	ENST00000368804.1	hg19	CCDS41396.1																																																																																			.	.	.	none		0.612	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
KCNN3	3782	hgsc.bcm.edu	37	1	154841688	154841688	+	Silent	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:154841688G>A	ENST00000271915.4	-	1	1068	c.753C>T	c.(751-753)agC>agT	p.S251S	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	256					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	AGGTGGTGCTGCTGGCGGTGG	0.567																																					p.S251S		Atlas-SNP	.											.	KCNN3	141	.	0			c.C753T						PASS	.						109.0	104.0	106.0					1																	154841688		2203	4300	6503	SO:0001819	synonymous_variant	3782	exon1			GGTGCTGCTGGCG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.753C>T	chr1.hg19:g.154841688G>A		161.0	0.0	.		113.0	41.0	.	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	hg19	CCDS30880.1																																																																																			.	.	.	none		0.567	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
EFNA1	1942	hgsc.bcm.edu	37	1	155104075	155104075	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:155104075A>G	ENST00000368407.3	+	2	871	c.353A>G	c.(352-354)aAg>aGg	p.K118R	EFNA1_ENST00000469878.1_3'UTR|EFNA1_ENST00000368406.2_Missense_Mutation_p.K118R	NM_004428.2	NP_004419.2	P20827	EFNA1_HUMAN	ephrin-A1	118	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|ephrin receptor signaling pathway (GO:0048013)|mitral valve morphogenesis (GO:0003183)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|notochord formation (GO:0014028)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of angiogenesis (GO:0045765)|regulation of axonogenesis (GO:0050770)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|substrate adhesion-dependent cell spreading (GO:0034446)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ephrin receptor binding (GO:0046875)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|kidney(1)|lung(1)|skin(1)	5	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)			ACCCTGGGCAAGGAGTTCAAA	0.527																																					p.K118R		Atlas-SNP	.											.	EFNA1	10	.	0			c.A353G						PASS	.						53.0	47.0	49.0					1																	155104075		2203	4300	6503	SO:0001583	missense	1942	exon2			TGGGCAAGGAGTT		CCDS1091.1, CCDS1092.1	1q21-q22	2011-03-09			ENSG00000169242	ENSG00000169242		"""Ephrins"""	3221	protein-coding gene	gene with protein product		191164		TNFAIP4, EPLG1		2233719, 8660976	Standard	NM_182685		Approved	LERK1, ECKLG	uc001fhh.3	P20827	OTTHUMG00000035312	ENST00000368407.3:c.353A>G	chr1.hg19:g.155104075A>G	ENSP00000357392:p.Lys118Arg	65.0	0.0	.		47.0	10.0	.	NM_182685	D3DV86|Q5SR60|Q5SR61|Q6I9T9|Q8N578	Missense_Mutation	SNP	ENST00000368407.3	hg19	CCDS1091.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.554194	0.86231	.	.	ENSG00000169242	ENST00000368407;ENST00000368406	T;T	0.43294	0.95;0.95	5.22	5.22	0.72569	Ephrin, conserved site (1);Cupredoxin (2);	0.045262	0.85682	D	0.000000	T	0.51500	0.1678	M	0.71581	2.175	0.53688	D	0.999973	D;D	0.76494	0.997;0.999	P;D	0.71184	0.9;0.972	T	0.51124	-0.8745	10	0.33940	T	0.23	-2.5539	13.3345	0.60509	1.0:0.0:0.0:0.0	.	118;118	P20827-2;P20827	.;EFNA1_HUMAN	R	118	ENSP00000357392:K118R;ENSP00000357391:K118R	ENSP00000357391:K118R	K	+	2	0	EFNA1	153370699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.204000	0.51082	2.097000	0.63578	0.533000	0.62120	AAG	.	.	.	none		0.527	EFNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085428.1	NM_004428	
LRPPRC	10128	hgsc.bcm.edu	37	2	44139638	44139638	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:44139638A>G	ENST00000260665.7	-	30	3265	c.3208T>C	c.(3208-3210)Tac>Cac	p.Y1070H		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1070					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AGATTGCTGTAGGTTTCAGCA	0.313																																					p.Y1070H		Atlas-SNP	.											.	LRPPRC	105	.	0			c.T3208C						PASS	.						112.0	107.0	109.0					2																	44139638		2202	4297	6499	SO:0001583	missense	10128	exon30			TGCTGTAGGTTTC	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.3208T>C	chr2.hg19:g.44139638A>G	ENSP00000260665:p.Tyr1070His	58.0	0.0	.		86.0	33.0	.	NM_133259	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	ENST00000260665.7	hg19	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	A	18.53	3.643279	0.67244	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	T	0.13420	2.59	5.78	5.78	0.91487	.	0.065106	0.64402	D	0.000006	T	0.40272	0.1110	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.27773	-1.0064	10	0.66056	D	0.02	-5.0562	15.7709	0.78167	1.0:0.0:0.0:0.0	.	970;1070	F5H4J6;P42704	.;LPPRC_HUMAN	H	970;1070	ENSP00000260665:Y1070H	ENSP00000260665:Y1070H	Y	-	1	0	LRPPRC	43993142	1.000000	0.71417	0.283000	0.24790	0.010000	0.07245	7.018000	0.76406	2.205000	0.71048	0.533000	0.62120	TAC	.	.	.	none		0.313	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
MTHFD2	10797	hgsc.bcm.edu	37	2	74441208	74441208	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:74441208G>A	ENST00000394053.2	+	8	972	c.892G>A	c.(892-894)Gtc>Atc	p.V298I	MTHFD2_ENST00000409804.1_Missense_Mutation_p.V170I|SLC4A5_ENST00000483195.1_5'Flank|MTHFD2_ENST00000264090.4_Missense_Mutation_p.V196I|MTHFD2_ENST00000409601.1_Missense_Mutation_p.V215I|RP11-287D1.3_ENST00000451608.2_Intron|MTHFD2_ENST00000394050.3_Missense_Mutation_p.V134I	NM_006636.3	NP_006627.2	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	298					folic acid-containing compound biosynthetic process (GO:0009396)|one-carbon metabolic process (GO:0006730)|tetrahydrofolate metabolic process (GO:0046653)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	magnesium ion binding (GO:0000287)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|phosphate ion binding (GO:0042301)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6					Tetrahydrofolic acid(DB00116)	CTATGTAGGAGTCAGACAAAA	0.398																																					p.V298I		Atlas-SNP	.											.	MTHFD2	43	.	0			c.G892A						PASS	.						110.0	119.0	116.0					2																	74441208		2029	4215	6244	SO:0001583	missense	10797	exon8			GTAGGAGTCAGAC	X16396	CCDS1935.2	2p13.1	2008-05-02			ENSG00000065911	ENSG00000065911			7434	protein-coding gene	gene with protein product		604887				2587219, 8218174	Standard	NR_027405		Approved		uc002skk.3	P13995	OTTHUMG00000129814	ENST00000394053.2:c.892G>A	chr2.hg19:g.74441208G>A	ENSP00000377617:p.Val298Ile	274.0	0.0	.		244.0	71.0	.	NM_006636	Q53G90|Q53GV5|Q53S36|Q7Z650	Missense_Mutation	SNP	ENST00000394053.2	hg19	CCDS1935.2	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540151	0.85917	.	.	ENSG00000065911	ENST00000394053;ENST00000409804;ENST00000264090;ENST00000394050;ENST00000409601	T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.37	5.58	5.58	0.84498	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.114477	0.64402	D	0.000017	T	0.78291	0.4260	M	0.82323	2.585	0.80722	D	1	D;D	0.71674	0.988;0.998	D;D	0.74023	0.919;0.982	T	0.80569	-0.1324	10	0.72032	D	0.01	.	17.4533	0.87599	0.0:0.0:1.0:0.0	.	215;298	B8ZZU9;P13995	.;MTDC_HUMAN	I	298;170;196;134;215	ENSP00000377617:V298I;ENSP00000386536:V170I;ENSP00000264090:V196I;ENSP00000377614:V134I;ENSP00000386542:V215I	ENSP00000264090:V196I	V	+	1	0	MTHFD2	74294716	1.000000	0.71417	0.821000	0.32701	0.724000	0.41520	9.415000	0.97375	2.813000	0.96785	0.655000	0.94253	GTC	.	.	.	none		0.398	MTHFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252045.2		
IL1RL2	8808	hgsc.bcm.edu	37	2	102849533	102849533	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:102849533C>T	ENST00000264257.2	+	10	1372	c.1246C>T	c.(1246-1248)Caa>Taa	p.Q416*	IL1RL2_ENST00000441515.2_Nonsense_Mutation_p.Q298*|IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000539491.1_Nonsense_Mutation_p.Q416*	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	416	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						GTTGGAGAGACAATGTGGATA	0.453																																					p.Q416X		Atlas-SNP	.											.	IL1RL2	118	.	0			c.C1246T						PASS	.						116.0	111.0	113.0					2																	102849533		2203	4300	6503	SO:0001587	stop_gained	8808	exon10			GAGAGACAATGTG	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.1246C>T	chr2.hg19:g.102849533C>T	ENSP00000264257:p.Gln416*	127.0	0.0	.		128.0	38.0	.	NM_003854	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Nonsense_Mutation	SNP	ENST00000264257.2	hg19	CCDS2056.1	.	.	.	.	.	.	.	.	.	.	C	36	5.844802	0.97016	.	.	ENSG00000115598	ENST00000264257;ENST00000441515;ENST00000539491	.	.	.	6.07	6.07	0.98685	.	0.205036	0.43919	D	0.000507	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	.	.	.	X	416;298;416	.	ENSP00000264257:Q416X	Q	+	1	0	IL1RL2	102215965	0.985000	0.35326	1.000000	0.80357	0.447000	0.32167	2.970000	0.49240	2.885000	0.99019	0.655000	0.94253	CAA	.	.	.	none		0.453	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854	
IL1RN	3557	hgsc.bcm.edu	37	2	113885204	113885204	+	Start_Codon_SNP	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:113885204G>A	ENST00000409930.3	+	1	67	c.3G>A	c.(1-3)atG>atA	p.M1I	IL1RN_ENST00000361779.3_Intron|IL1RN_ENST00000354115.2_Intron|IL1RN_ENST00000409052.1_Intron|IL1RN_ENST00000259206.5_Intron	NM_173842.2	NP_776214.1	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist	1					acute-phase response (GO:0006953)|carboxylic acid metabolic process (GO:0019752)|chronic inflammatory response to antigenic stimulus (GO:0002439)|female pregnancy (GO:0007565)|fever generation (GO:0001660)|immune response (GO:0006955)|insulin secretion (GO:0030073)|lipid metabolic process (GO:0006629)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of membrane potential (GO:0045837)|positive regulation of JUN kinase activity (GO:0043507)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	interleukin-1 receptor antagonist activity (GO:0005152)|interleukin-1 receptor binding (GO:0005149)|interleukin-1 Type I receptor antagonist activity (GO:0045352)|interleukin-1 Type II receptor antagonist activity (GO:0045353)|interleukin-1, Type I receptor binding (GO:0005150)|interleukin-1, Type II receptor binding (GO:0005151)			breast(1)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	10					Rilonacept(DB06372)	GTCACAGAATGGAAATCTGCA	0.532									Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.M1I		Atlas-SNP	.											.	IL1RN	30	.	0			c.G3A						PASS	.						52.0	56.0	55.0					2																	113885204		1327	2309	3636	SO:0001582	initiator_codon_variant	3557	exon1	Familial Cancer Database	Lichen Sclerosis, Familial	CAGAATGGAAATC	M55646	CCDS2113.1, CCDS2114.1, CCDS2115.1, CCDS46396.1	2q14.2	2014-09-17			ENSG00000136689	ENSG00000136689		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	6000	protein-coding gene	gene with protein product	"""interleukin-1 receptor antagonist protein"", ""intracellular interleukin-1 receptor antagonist"""	147679				1386337, 8432529	Standard	NM_000577		Approved	IL1RA, ICIL-1RA, IL1F3, IRAP, IL-1RN, MGC10430	uc002tjb.3	P18510	OTTHUMG00000131341	ENST00000409930.3:c.3G>A	chr2.hg19:g.113885204G>A	ENSP00000387173:p.Met1Ile	60.0	0.0	.		56.0	13.0	.	NM_173842	A8K4G1|Q14628|Q53SC2|Q7RTZ4|Q96GD6|Q9UPC0	Missense_Mutation	SNP	ENST00000409930.3	hg19	CCDS46396.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.054017	0.55218	.	.	ENSG00000136689	ENST00000409930	T	0.38722	1.12	5.24	5.24	0.73138	.	.	.	.	.	T	0.62804	0.2458	.	.	.	0.48975	D	0.999733	D	0.57899	0.981	D	0.65140	0.932	T	0.66412	-0.5930	8	0.87932	D	0	.	14.6809	0.69017	0.0:0.0:1.0:0.0	.	1	P18510	IL1RA_HUMAN	I	1	ENSP00000387173:M1I	ENSP00000387173:M1I	M	+	3	0	IL1RN	113601675	1.000000	0.71417	0.771000	0.31576	0.114000	0.19823	4.363000	0.59473	2.604000	0.88044	0.655000	0.94253	ATG	.	.	.	none		0.532	IL1RN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330802.1	NM_173841	Missense_Mutation
PSMD14	10213	hgsc.bcm.edu	37	2	162227815	162227815	+	Silent	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:162227815T>C	ENST00000409682.3	+	7	1148	c.444T>C	c.(442-444)atT>atC	p.I148I		NM_005805.5	NP_005796.1	O00487	PSDE_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 14	148					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K63-linked deubiquitination (GO:0070536)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, lid subcomplex (GO:0008541)	endopeptidase activator activity (GO:0061133)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|proteasome binding (GO:0070628)|ubiquitin thiolesterase activity (GO:0004221)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	12						TGGATCCCATTCAGAGTGTAA	0.408																																					p.I148I		Atlas-SNP	.											.	PSMD14	22	.	0			c.T444C						PASS	.						121.0	120.0	121.0					2																	162227815		1930	4131	6061	SO:0001819	synonymous_variant	10213	exon7			TCCCATTCAGAGT	U86782	CCDS46437.1	2q14.3	2008-05-22			ENSG00000115233	ENSG00000115233		"""Proteasome (prosome, macropain) subunits"""	16889	protein-coding gene	gene with protein product		607173				9374539	Standard	NM_005805		Approved	POH1, pad1, Rpn11	uc002ubu.3	O00487	OTTHUMG00000153882	ENST00000409682.3:c.444T>C	chr2.hg19:g.162227815T>C		25.0	0.0	.		20.0	4.0	.	NM_005805	B3KNW2|O00176	Silent	SNP	ENST00000409682.3	hg19	CCDS46437.1																																																																																			.	.	.	none		0.408	PSMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332833.1	NM_005805	
NBEAL1	65065	hgsc.bcm.edu	37	2	204039877	204039877	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:204039877A>T	ENST00000449802.1	+	41	6577	c.6244A>T	c.(6244-6246)Aat>Tat	p.N2082Y		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2082	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.									NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CAGATATGAAAATTTTGAGGA	0.333																																					p.N2082Y		Atlas-SNP	.											.	NBEAL1	266	.	0			c.A6244T						PASS	.						66.0	66.0	66.0					2																	204039877		1802	4060	5862	SO:0001583	missense	65065	exon41			TATGAAAATTTTG	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6244A>T	chr2.hg19:g.204039877A>T	ENSP00000399903:p.Asn2082Tyr	93.0	0.0	.		83.0	27.0	.	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	hg19	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.547864	0.86022	.	.	ENSG00000144426	ENST00000449802;ENST00000340268;ENST00000414576	T;T	0.80304	-1.36;-1.36	5.92	5.92	0.95590	BEACH domain (4);	0.091060	0.85682	D	0.000000	D	0.82300	0.5007	L	0.28649	0.875	0.54753	D	0.999985	P;P	0.48016	0.904;0.904	P;P	0.57371	0.819;0.748	T	0.82971	-0.0192	10	0.48119	T	0.1	.	16.0292	0.80564	1.0:0.0:0.0:0.0	.	2082;2071	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	Y	2082;2082;97	ENSP00000399903:N2082Y;ENSP00000388466:N97Y	ENSP00000344985:N2082Y	N	+	1	0	NBEAL1	203748122	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	9.287000	0.95975	2.254000	0.74563	0.528000	0.53228	AAT	.	.	.	none		0.333	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
GIGYF2	26058	hgsc.bcm.edu	37	2	233660917	233660917	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:233660917A>G	ENST00000409547.1	+	16	1936	c.1625A>G	c.(1624-1626)cAg>cGg	p.Q542R	GIGYF2_ENST00000409480.1_Missense_Mutation_p.Q564R|GIGYF2_ENST00000452341.2_Missense_Mutation_p.Q373R|GIGYF2_ENST00000409451.3_Missense_Mutation_p.Q563R|GIGYF2_ENST00000409196.3_Missense_Mutation_p.Q536R|GIGYF2_ENST00000373566.3_Missense_Mutation_p.Q564R|GIGYF2_ENST00000373563.4_Missense_Mutation_p.Q542R	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	542	GYF. {ECO:0000255|PROSITE- ProRule:PRU00101}.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AAAGATCCTCAGGGAGAAATT	0.378																																					p.Q563R		Atlas-SNP	.											.,2	GIGYF2	288	.	0			c.A1688G						PASS	.						121.0	117.0	118.0					2																	233660917		2203	4300	6503	SO:0001583	missense	26058	exon16			ATCCTCAGGGAGA	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1625A>G	chr2.hg19:g.233660917A>G	ENSP00000386537:p.Gln542Arg	117.0	0.0	.		136.0	33.0	.	NM_001103147	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	hg19	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.654738	0.88056	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;D;T;T;T;T	0.81579	-1.35;-1.33;-1.35;-1.33;-1.51;-1.32;-1.35;-1.45;-1.27	5.68	5.68	0.88126	GYF (4);	0.000000	0.85682	D	0.000000	D	0.91529	0.7325	M	0.89658	3.05	0.80722	D	1	D;D;D;D	0.71674	0.994;0.998;0.997;0.969	D;D;D;D	0.83275	0.986;0.996;0.992;0.968	D	0.93157	0.6554	10	0.87932	D	0	-17.6236	16.2119	0.82168	1.0:0.0:0.0:0.0	.	373;563;542;536	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	R	564;485;542;564;542;542;485;536;563;536;373	ENSP00000362667:Q564R;ENSP00000362664:Q542R;ENSP00000386765:Q564R;ENSP00000386537:Q542R;ENSP00000404195:Q485R;ENSP00000387070:Q536R;ENSP00000387170:Q563R;ENSP00000410297:Q536R;ENSP00000411505:Q373R	ENSP00000362664:Q542R	Q	+	2	0	GIGYF2	233369161	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.287000	0.95975	2.288000	0.76882	0.482000	0.46254	CAG	.	.	.	none		0.378	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
CCR3	1232	hgsc.bcm.edu	37	3	46307340	46307340	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr3:46307340A>G	ENST00000357422.2	+	4	1234	c.691A>G	c.(691-693)Agt>Ggt	p.S231G	CCR3_ENST00000541018.1_Missense_Mutation_p.S231G|CCR3_ENST00000395942.2_Missense_Mutation_p.S231G|CCR3_ENST00000545097.1_Missense_Mutation_p.S252G|CCR3_ENST00000395940.2_Missense_Mutation_p.S231G			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	231					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		GAGGTGCCCCAGTAAAAAAAA	0.463																																					p.S252G		Atlas-SNP	.											.	CCR3	52	.	0			c.A754G						PASS	.						73.0	72.0	72.0					3																	46307340		2203	4300	6503	SO:0001583	missense	1232	exon3			TGCCCCAGTAAAA	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.691A>G	chr3.hg19:g.46307340A>G	ENSP00000350003:p.Ser231Gly	101.0	0.0	.		62.0	28.0	.	NM_178328	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	hg19	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.712194	0.30322	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	5.96	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.34424	0.0897	N	0.21448	0.665	0.09310	N	1	B;B	0.14805	0.009;0.011	B;B	0.23150	0.036;0.044	T	0.31166	-0.9953	9	0.66056	D	0.02	.	9.5513	0.39313	0.8017:0.0:0.1983:0.0	.	252;231	F5GWL6;P51677	.;CCR3_HUMAN	G	231;252;231;231;231	ENSP00000350003:S231G;ENSP00000441600:S252G;ENSP00000440097:S231G;ENSP00000379271:S231G;ENSP00000379273:S231G	ENSP00000350003:S231G	S	+	1	0	CCR3	46282344	0.001000	0.12720	0.041000	0.18516	0.744000	0.42396	1.757000	0.38400	0.158000	0.19367	0.533000	0.62120	AGT	.	.	.	none		0.463	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
GNAI2	2771	hgsc.bcm.edu	37	3	50294280	50294280	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr3:50294280A>C	ENST00000313601.6	+	6	1103	c.719A>C	c.(718-720)gAg>gCg	p.E240A	GNAI2_ENST00000440628.1_Missense_Mutation_p.E188A|GNAI2_ENST00000266027.5_Missense_Mutation_p.E224A|GNAI2_ENST00000536647.1_Missense_Mutation_p.E159A|GNAI2_ENST00000491100.1_3'UTR|GNAI2_ENST00000422163.1_Missense_Mutation_p.E224A|GNAI2_ENST00000451956.1_Missense_Mutation_p.E203A	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	240					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GAGGACGAGGAGATGGTGAGA	0.577																																					p.E240A		Atlas-SNP	.											.	GNAI2	42	.	0			c.A719C						PASS	.						113.0	107.0	109.0					3																	50294280		2203	4300	6503	SO:0001583	missense	2771	exon6			ACGAGGAGATGGT	X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.719A>C	chr3.hg19:g.50294280A>C	ENSP00000312999:p.Glu240Ala	105.0	0.0	.		87.0	35.0	.	NM_002070	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Missense_Mutation	SNP	ENST00000313601.6	hg19	CCDS2813.1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703847	0.68501	.	.	ENSG00000114353	ENST00000422163;ENST00000313601;ENST00000536647;ENST00000540560;ENST00000440628;ENST00000451956;ENST00000266027	T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	4.62	4.62	0.57501	.	0.117678	0.64402	D	0.000009	T	0.67924	0.2945	M	0.77103	2.36	0.80722	D	1	B;B;B;B	0.17852	0.002;0.007;0.024;0.019	B;B;B;B	0.23852	0.049;0.049;0.049;0.029	T	0.69928	-0.5012	10	0.72032	D	0.01	.	12.3095	0.54920	1.0:0.0:0.0:0.0	.	203;240;224;224	B4DYA0;P04899;B3KTZ0;P04899-2	.;GNAI2_HUMAN;.;.	A	224;240;159;240;188;203;224	ENSP00000406871:E224A;ENSP00000312999:E240A;ENSP00000444360:E159A;ENSP00000395736:E188A;ENSP00000406369:E203A;ENSP00000266027:E224A	ENSP00000266027:E224A	E	+	2	0	GNAI2	50269284	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.285000	0.78660	2.088000	0.63022	0.459000	0.35465	GAG	.	.	.	none		0.577	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346688.1	NM_002070	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376113	113376113	+	Silent	SNP	C	C	T	rs62265537|rs59601191|rs112313093|rs59990801|rs397990842|rs10606566		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr3:113376113C>T	ENST00000478658.1	-	5	4433	c.4416G>A	c.(4414-4416)caG>caA	p.Q1472Q	KIAA2018_ENST00000316407.4_Silent_p.Q1472Q|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1472	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gttgctgttgctgctgctgct	0.502																																					p.Q1472Q		Atlas-SNP	.											KIAA2018,rectum,carcinoma,0,1	KIAA2018	180	.	0			c.G4416A						PASS	.						68.0	71.0	70.0					3																	113376113		2188	4274	6462	SO:0001819	synonymous_variant	205717	exon7			CTGTTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4416G>A	chr3.hg19:g.113376113C>T		42.0	2.0	.		46.0	7.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.	.	weak		0.502	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ZXDC	79364	hgsc.bcm.edu	37	3	126194470	126194470	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr3:126194470T>C	ENST00000389709.3	-	1	292	c.239A>G	c.(238-240)gAa>gGa	p.E80G	ZXDC_ENST00000336332.5_Missense_Mutation_p.E80G	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	80					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		GTGCGGCACTTCCAGCAGCAC	0.766																																					p.E80G		Atlas-SNP	.											.	ZXDC	87	.	0			c.A239G						PASS	.						10.0	11.0	10.0					3																	126194470		1178	2759	3937	SO:0001583	missense	79364	exon1			GGCACTTCCAGCA	AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.239A>G	chr3.hg19:g.126194470T>C	ENSP00000374359:p.Glu80Gly	40.0	0.0	.		18.0	11.0	.	NM_025112	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	ENST00000389709.3	hg19	CCDS43145.1	.	.	.	.	.	.	.	.	.	.	T	7.919	0.738083	0.15574	.	.	ENSG00000070476	ENST00000389709;ENST00000336332	T;T	0.29142	1.58;1.58	3.22	1.97	0.26223	.	3.885840	0.01408	U	0.013872	T	0.25269	0.0614	L	0.40543	1.245	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.001	T	0.10800	-1.0614	10	0.23891	T	0.37	-0.3189	3.4994	0.07668	0.0:0.1312:0.2352:0.6336	.	80;80	Q2QGD7-2;Q2QGD7	.;ZXDC_HUMAN	G	80	ENSP00000374359:E80G;ENSP00000337694:E80G	ENSP00000337694:E80G	E	-	2	0	ZXDC	127677160	0.000000	0.05858	0.272000	0.24630	0.077000	0.17291	0.070000	0.14573	0.233000	0.21120	0.358000	0.22013	GAA	.	.	.	none		0.766	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370327.2	NM_025112	
C4orf36	132989	hgsc.bcm.edu	37	4	87809274	87809274	+	Splice_Site	SNP	A	A	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr4:87809274A>T	ENST00000473559.1	-	6	883	c.220T>A	c.(220-222)Tct>Act	p.S74T	C4orf36_ENST00000503001.1_5'Flank|C4orf36_ENST00000295898.3_Splice_Site_p.S74T			Q96KX1	CD036_HUMAN	chromosome 4 open reading frame 36	74										breast(1)|kidney(1)|lung(1)|prostate(1)	4		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00141)		AGGAACTTACATTCTGCAGAA	0.363																																					p.S74T		Atlas-SNP	.											.	C4orf36	10	.	0			c.T220A						PASS	.						65.0	66.0	66.0					4																	87809274		2203	4300	6503	SO:0001630	splice_region_variant	132989	exon3			ACTTACATTCTGC	BC016746	CCDS3615.1	4q21.3	2008-02-05			ENSG00000163633	ENSG00000163633			28386	protein-coding gene	gene with protein product						12477932	Standard	NM_144645		Approved	MGC26744	uc003hqe.4	Q96KX1	OTTHUMG00000130597	ENST00000473559.1:c.220+1T>A	chr4.hg19:g.87809274A>T		101.0	0.0	.		89.0	25.0	.	NM_144645		Missense_Mutation	SNP	ENST00000473559.1	hg19	CCDS3615.1	.	.	.	.	.	.	.	.	.	.	A	7.943	0.743153	0.15642	.	.	ENSG00000163633	ENST00000295898;ENST00000473559;ENST00000506308;ENST00000504008	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.13	-6.29	0.02013	.	1.537520	0.03676	N	0.244784	T	0.22003	0.0530	N	0.17082	0.46	0.23249	N	0.99805	B	0.06786	0.001	B	0.08055	0.003	T	0.13764	-1.0497	9	.	.	.	0.0079	6.0792	0.19933	0.2272:0.2261:0.0:0.5468	.	74	Q96KX1	CD036_HUMAN	T	74	ENSP00000295898:S74T;ENSP00000420949:S74T;ENSP00000421141:S74T;ENSP00000422720:S74T	.	S	-	1	0	C4orf36	88028298	0.908000	0.30866	0.122000	0.21767	0.240000	0.25518	-0.311000	0.08124	-0.602000	0.05775	0.482000	0.46254	TCT	.	.	.	none		0.363	C4orf36-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253045.2	NM_144645	Missense_Mutation
PLK4	10733	hgsc.bcm.edu	37	4	128812805	128812805	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr4:128812805C>A	ENST00000270861.5	+	9	2281	c.2007C>A	c.(2005-2007)aaC>aaA	p.N669K	PLK4_ENST00000515069.1_Missense_Mutation_p.N591K|RNU6-583P_ENST00000516012.1_RNA|PLK4_ENST00000514379.1_Missense_Mutation_p.N628K|PLK4_ENST00000507249.1_Missense_Mutation_p.N608K|PLK4_ENST00000513090.1_Missense_Mutation_p.N637K	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	669					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						CTACTGACAACATCAGTAGGT	0.318																																					p.N669K	Colon(135;508 1718 19061 31832 42879)	Atlas-SNP	.											.	PLK4	65	.	0			c.C2007A						PASS	.						89.0	97.0	94.0					4																	128812805		2203	4300	6503	SO:0001583	missense	10733	exon9			TGACAACATCAGT	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2007C>A	chr4.hg19:g.128812805C>A	ENSP00000270861:p.Asn669Lys	162.0	0.0	.		176.0	59.0	.	NM_014264	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	hg19	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.175146	0.57692	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.07	2.4	0.29515	.	0.153463	0.56097	D	0.000021	T	0.32255	0.0823	L	0.51422	1.61	0.35092	D	0.764371	P;P	0.47762	0.9;0.839	P;B	0.48400	0.576;0.372	T	0.41360	-0.9513	10	0.59425	D	0.04	-4.1709	7.6088	0.28118	0.1342:0.724:0.0:0.1418	.	637;669	O00444-2;O00444	.;PLK4_HUMAN	K	669;591;637;608;628	ENSP00000270861:N669K;ENSP00000421774:N591K;ENSP00000427554:N637K;ENSP00000423412:N608K;ENSP00000423582:N628K	ENSP00000270861:N669K	N	+	3	2	PLK4	129032255	0.963000	0.33076	0.983000	0.44433	0.892000	0.51952	0.033000	0.13754	0.309000	0.22966	0.467000	0.42956	AAC	.	.	.	none		0.318	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
FHDC1	85462	hgsc.bcm.edu	37	4	153896859	153896859	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr4:153896859G>A	ENST00000511601.1	+	12	2604	c.2416G>A	c.(2416-2418)Ggc>Agc	p.G806S	FHDC1_ENST00000260008.3_Missense_Mutation_p.G806S			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	806									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					GGAAGGGGATGGCTCCATGTC	0.652																																					p.G806S		Atlas-SNP	.											.	FHDC1	102	.	0			c.G2416A						PASS	.						51.0	61.0	58.0					4																	153896859		2203	4300	6503	SO:0001583	missense	85462	exon11			GGGGATGGCTCCA	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2416G>A	chr4.hg19:g.153896859G>A	ENSP00000427567:p.Gly806Ser	151.0	0.0	.		139.0	52.0	.	NM_033393		Missense_Mutation	SNP	ENST00000511601.1	hg19	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	G	5.523	0.281358	0.10458	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.29917	1.55;1.55	4.95	3.16	0.36331	.	0.771246	0.12008	N	0.508193	T	0.16811	0.0404	L	0.29908	0.895	0.09310	N	1	P	0.39282	0.666	B	0.33339	0.162	T	0.07947	-1.0746	10	0.02654	T	1	.	10.0533	0.42230	0.0:0.1495:0.695:0.1555	.	806	Q9C0D6	FHDC1_HUMAN	S	806	ENSP00000427567:G806S;ENSP00000260008:G806S	ENSP00000260008:G806S	G	+	1	0	FHDC1	154116309	0.062000	0.20869	0.002000	0.10522	0.222000	0.24845	2.052000	0.41316	0.455000	0.26910	0.563000	0.77884	GGC	.	.	.	none		0.652	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
SLC12A7	10723	hgsc.bcm.edu	37	5	1074691	1074691	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr5:1074691T>G	ENST00000264930.5	-	16	2106	c.2063A>C	c.(2062-2064)aAg>aCg	p.K688T		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	688					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CCTCCAGTTCTTGGTGTGGGG	0.657																																					p.K688T		Atlas-SNP	.											.	SLC12A7	97	.	0			c.A2063C						PASS	.						54.0	51.0	52.0					5																	1074691		2201	4299	6500	SO:0001583	missense	10723	exon16			CAGTTCTTGGTGT	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.2063A>C	chr5.hg19:g.1074691T>G	ENSP00000264930:p.Lys688Thr	103.0	0.0	.		100.0	31.0	.	NM_006598	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	hg19	CCDS34129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	17.74|17.74	3.464117|3.464117	0.63513|0.63513	.|.	.|.	ENSG00000113504|ENSG00000113504	ENST00000264930|ENST00000513223	D|.	0.99186|.	-5.53|.	3.81|3.81	3.81|3.81	0.43845|0.43845	Amino acid permease domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86682|0.86682	0.5991|0.5991	H|H	0.97707|0.97707	4.06|4.06	0.58432|0.58432	D|D	0.999998|0.999998	P|.	0.46912|.	0.886|.	P|.	0.46339|.	0.513|.	D|D	0.89599|0.89599	0.3833|0.3833	10|5	0.87932|.	D|.	0|.	.|.	10.8081|10.8081	0.46529|0.46529	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	688|.	Q9Y666|.	S12A7_HUMAN|.	T|H	688|45	ENSP00000264930:K688T|.	ENSP00000264930:K688T|.	K|Q	-|-	2|3	0|2	SLC12A7|SLC12A7	1127691|1127691	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.335000|0.335000	0.28730|0.28730	7.076000|7.076000	0.76806|0.76806	1.501000|1.501000	0.48654|0.48654	0.260000|0.260000	0.18958|0.18958	AAG|CAA	.	.	.	none		0.657	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
F12	2161	hgsc.bcm.edu	37	5	176831350	176831350	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr5:176831350A>G	ENST00000253496.3	-	9	913	c.865T>C	c.(865-867)Tac>Cac	p.Y289H	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	289	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	AGGTCGCAGTACTCCCAGCTC	0.697									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y289H		Atlas-SNP	.											.	F12	35	.	0			c.T865C						PASS	.						16.0	20.0	19.0					5																	176831350		2200	4296	6496	SO:0001583	missense	2161	exon9	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	CGCAGTACTCCCA	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.865T>C	chr5.hg19:g.176831350A>G	ENSP00000253496:p.Tyr289His	33.0	0.0	.	1934	36.0	15.0	.	NM_000505	P78339	Missense_Mutation	SNP	ENST00000253496.3	hg19	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.074641	0.76415	.	.	ENSG00000131187	ENST00000253496	T	0.66460	-0.21	5.45	5.45	0.79879	Kringle (5);Kringle-like fold (1);	0.000000	0.42682	D	0.000679	T	0.73497	0.3594	M	0.75150	2.29	0.80722	D	1	P	0.51537	0.946	P	0.54210	0.745	T	0.74548	-0.3629	10	0.41790	T	0.15	.	9.0885	0.36596	0.9168:0.0:0.0832:0.0	.	289	P00748	FA12_HUMAN	H	289	ENSP00000253496:Y289H	ENSP00000253496:Y289H	Y	-	1	0	F12	176763956	0.924000	0.31332	0.575000	0.28536	0.770000	0.43624	2.546000	0.45778	2.080000	0.62538	0.459000	0.35465	TAC	.	.	.	none		0.697	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
SKIV2L	6499	hgsc.bcm.edu	37	6	31927082	31927082	+	Missense_Mutation	SNP	C	C	A	rs563036739	byFrequency	TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr6:31927082C>A	ENST00000375394.2	+	2	144	c.31C>A	c.(31-33)Cct>Act	p.P11T	NELFE_ENST00000375429.3_5'Flank|NELFE_ENST00000444811.2_5'Flank|MIR1236_ENST00000408340.1_RNA|SKIV2L_ENST00000488648.1_3'UTR|NELFE_ENST00000375425.5_5'Flank|SKIV2L_ENST00000544581.1_5'UTR	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	11					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						AGTGCTACCCCCTCCAGATCC	0.602																																					p.P11T		Atlas-SNP	.											.	SKIV2L	97	.	0			c.C31A						PASS	.						221.0	230.0	227.0					6																	31927082		2203	4299	6502	SO:0001583	missense	6499	exon2			CTACCCCCTCCAG		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.31C>A	chr6.hg19:g.31927082C>A	ENSP00000364543:p.Pro11Thr	587.0	1.0	.		457.0	133.0	.	NM_006929	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	hg19	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	9.522	1.108545	0.20714	.	.	ENSG00000204351	ENST00000375394	T	0.45276	0.9	5.18	3.42	0.39159	.	0.176723	0.50627	D	0.000113	T	0.18130	0.0435	L	0.47716	1.5	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04900	-1.0919	10	0.40728	T	0.16	-13.5646	9.0377	0.36298	0.0:0.8274:0.0:0.1726	.	11	Q15477	SKIV2_HUMAN	T	11	ENSP00000364543:P11T	ENSP00000364543:P11T	P	+	1	0	SKIV2L	32035061	1.000000	0.71417	0.993000	0.49108	0.481000	0.33189	1.932000	0.40143	0.781000	0.33589	0.655000	0.94253	CCT	.	.	.	none		0.602	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
PKHD1	5314	hgsc.bcm.edu	37	6	51930865	51930865	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr6:51930865A>G	ENST00000371117.3	-	12	1064	c.789T>C	c.(787-789)tcT>tcC	p.S263S	PKHD1_ENST00000340994.4_Silent_p.S263S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	263	IPT/TIG 3.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTGGAAACACAGATAATATTT	0.328																																					p.S263S		Atlas-SNP	.											.	PKHD1	927	.	0			c.T789C						PASS	.						67.0	66.0	66.0					6																	51930865		2203	4300	6503	SO:0001819	synonymous_variant	5314	exon12			AAACACAGATAAT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.789T>C	chr6.hg19:g.51930865A>G		66.0	0.0	.		53.0	15.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	hg19	CCDS4935.1																																																																																			.	.	.	none		0.328	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
DOCK4	9732	hgsc.bcm.edu	37	7	111555869	111555869	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr7:111555869G>A	ENST00000437633.1	-	13	1413	c.1157C>T	c.(1156-1158)aCa>aTa	p.T386I	DOCK4_ENST00000428084.1_Missense_Mutation_p.T386I|DOCK4_ENST00000476846.1_5'UTR	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	386					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CAGCTTCCTTGTTATGGATAC	0.368																																					p.T386I		Atlas-SNP	.											.	DOCK4	365	.	0			c.C1157T						PASS	.						57.0	53.0	54.0					7																	111555869		1820	4078	5898	SO:0001583	missense	9732	exon13			TTCCTTGTTATGG		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.1157C>T	chr7.hg19:g.111555869G>A	ENSP00000404179:p.Thr386Ile	35.0	0.0	.		48.0	13.0	.	NM_014705	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	hg19	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.3|27.3	4.816438|4.816438	0.90790|0.90790	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000445943|ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	.|T;T	.|0.03580	.|3.88;3.88	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.19167	.|0.0460	M|M	0.74467|0.74467	2.265|2.265	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.997;0.997	.|D;D	.|0.67103	.|0.949;0.949	.|T	.|0.00003	.|-1.2602	.|10	.|0.87932	.|D	.|0	.|.	19.3311|19.3311	0.94288|0.94288	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|386;386	.|Q149N5;Q8N1I0	.|.;DOCK4_HUMAN	X|I	374|374;386;386;374;385	.|ENSP00000410746:T386I;ENSP00000404179:T386I	.|ENSP00000345432:T374I	Q|T	-|-	1|2	0|0	DOCK4|DOCK4	111343105|111343105	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.960000|0.960000	0.62799|0.62799	8.322000|8.322000	0.90000|0.90000	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	CAA|ACA	.	.	.	none		0.368	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
KIF13B	23303	hgsc.bcm.edu	37	8	28991695	28991695	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr8:28991695C>G	ENST00000524189.1	-	22	2684	c.2646G>C	c.(2644-2646)caG>caC	p.Q882H	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	882					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GGGACAGATGCTGTGGCAACC	0.488																																					p.Q882H		Atlas-SNP	.											.	KIF13B	192	.	0			c.G2646C						PASS	.						81.0	81.0	81.0					8																	28991695		1901	4128	6029	SO:0001583	missense	23303	exon22			CAGATGCTGTGGC	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.2646G>C	chr8.hg19:g.28991695C>G	ENSP00000427900:p.Gln882His	119.0	0.0	.		122.0	45.0	.	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	hg19	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.235189	0.58886	.	.	ENSG00000197892	ENST00000524189	T	0.10382	2.88	5.28	2.49	0.30216	.	0.057734	0.64402	D	0.000001	T	0.23094	0.0558	M	0.68317	2.08	0.80722	D	1	D	0.60575	0.988	P	0.59221	0.854	T	0.00992	-1.1488	10	0.45353	T	0.12	.	10.5748	0.45221	0.0:0.7286:0.0:0.2714	.	882	F8VPJ2	.	H	882	ENSP00000427900:Q882H	ENSP00000427900:Q882H	Q	-	3	2	KIF13B	29047614	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.458000	0.21892	0.810000	0.34279	0.650000	0.86243	CAG	.	.	.	none		0.488	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
C8orf46	254778	hgsc.bcm.edu	37	8	67405943	67405943	+	Silent	SNP	T	T	A	rs139160272	byFrequency	TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr8:67405943T>A	ENST00000305454.3	+	1	501	c.60T>A	c.(58-60)atT>atA	p.I20I	C8orf46_ENST00000521495.1_Silent_p.I20I|C8orf46_ENST00000480005.1_Silent_p.I20I|C8orf46_ENST00000522977.1_Silent_p.I20I|C8orf46_ENST00000482608.2_Intron	NM_152765.3	NP_689978.2	Q8TAG6	CH046_HUMAN	chromosome 8 open reading frame 46	20										endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(2)	6			Epithelial(68;0.0224)|BRCA - Breast invasive adenocarcinoma(89;0.0508)|all cancers(69;0.0558)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			CCACCGTGATTCCTTCCAAGG	0.502																																					p.I20I		Atlas-SNP	.											.	C8orf46	22	.	0			c.T60A						PASS	.						124.0	98.0	107.0					8																	67405943		2203	4300	6503	SO:0001819	synonymous_variant	254778	exon1			CGTGATTCCTTCC	BC028400	CCDS6191.2	8q13.1	2005-08-09			ENSG00000169085	ENSG00000169085			28498	protein-coding gene	gene with protein product						12477932	Standard	NM_152765		Approved	MGC33510	uc003xwg.3	Q8TAG6	OTTHUMG00000156998	ENST00000305454.3:c.60T>A	chr8.hg19:g.67405943T>A		71.0	0.0	.		76.0	22.0	.	NM_152765	B2RDC3|B4DFU4|C9J814|C9JCS3	Silent	SNP	ENST00000305454.3	hg19	CCDS6191.2																																																																																			.	T|0.999;C|0.001	.	alt		0.502	C8orf46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347010.1	NM_152765	
KCNV2	169522	hgsc.bcm.edu	37	9	2718279	2718279	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr9:2718279C>T	ENST00000382082.3	+	1	778	c.540C>T	c.(538-540)cgC>cgT	p.R180R		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	180					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		GTCCGCGCCGCTTCCTGGAGG	0.657																																					p.R180R		Atlas-SNP	.											.	KCNV2	72	.	0			c.C540T						PASS	.						19.0	17.0	18.0					9																	2718279		2200	4292	6492	SO:0001819	synonymous_variant	169522	exon1			GCGCCGCTTCCTG	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.540C>T	chr9.hg19:g.2718279C>T		34.0	0.0	.		17.0	6.0	.	NM_133497	Q5T6X0	Silent	SNP	ENST00000382082.3	hg19	CCDS6447.1																																																																																			.	.	.	none		0.657	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	NM_133497	
TLN1	7094	hgsc.bcm.edu	37	9	35699405	35699405	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr9:35699405C>A	ENST00000314888.9	-	51	7175	c.6822G>T	c.(6820-6822)aaG>aaT	p.K2274N	TLN1_ENST00000540444.1_Missense_Mutation_p.K2162N	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2274					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CAGCCACACGCTTTGAATGTC	0.562																																					p.K2274N		Atlas-SNP	.											.	TLN1	185	.	0			c.G6822T						PASS	.						158.0	127.0	137.0					9																	35699405		2203	4300	6503	SO:0001583	missense	7094	exon51			CACACGCTTTGAA	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6822G>T	chr9.hg19:g.35699405C>A	ENSP00000316029:p.Lys2274Asn	97.0	0.0	.		99.0	32.0	.	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	c	18.95	3.732220	0.69189	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.69926	-0.44;-0.44	5.79	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.79028	0.4377	M	0.81239	2.535	0.58432	D	0.999996	D	0.67145	0.996	P	0.61397	0.888	T	0.81519	-0.0896	10	0.72032	D	0.01	-23.9158	10.9276	0.47199	0.0:0.8574:0.0:0.1426	.	2274	Q9Y490	TLN1_HUMAN	N	2274;2162	ENSP00000316029:K2274N;ENSP00000442981:K2162N	ENSP00000316029:K2274N	K	-	3	2	TLN1	35689405	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.766000	0.38491	1.472000	0.48140	0.651000	0.88453	AAG	.	.	.	none		0.562	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
OLFML2A	169611	hgsc.bcm.edu	37	9	127572163	127572163	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr9:127572163C>T	ENST00000373580.3	+	8	1431	c.1431C>T	c.(1429-1431)taC>taT	p.Y477Y	OLFML2A_ENST00000288815.5_Silent_p.Y263Y	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	477	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						GCGCCTTCTACTACAACCGCG	0.602																																					p.Y477Y		Atlas-SNP	.											.	OLFML2A	61	.	0			c.C1431T						PASS	.						124.0	99.0	108.0					9																	127572163		2203	4300	6503	SO:0001819	synonymous_variant	169611	exon8			CTTCTACTACAAC	AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.1431C>T	chr9.hg19:g.127572163C>T		114.0	0.0	.		96.0	32.0	.	NM_182487	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Silent	SNP	ENST00000373580.3	hg19	CCDS6857.2																																																																																			.	.	.	none		0.602	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487	
CCBL1	883	hgsc.bcm.edu	37	9	131607633	131607633	+	Splice_Site	SNP	A	A	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr9:131607633A>T	ENST00000302586.3	-	2	214	c.52T>A	c.(52-54)Tgg>Agg	p.W18R	CCBL1_ENST00000320665.6_Splice_Site_p.W18R|CCBL1_ENST00000483599.1_5'UTR|CCBL1_ENST00000436267.2_Splice_Site_p.W112R	NM_001122671.1|NM_004059.4	NP_001116143.1|NP_004050.3	Q16773	KAT1_HUMAN	cysteine conjugate-beta lyase, cytoplasmic	18					cellular amino acid biosynthetic process (GO:0008652)|cellular modified amino acid metabolic process (GO:0006575)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine catabolic process (GO:0097053)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|glutamine-phenylpyruvate transaminase activity (GO:0047316)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-glutamine:pyruvate aminotransferase activity (GO:0047945)|L-phenylalanine-oxaloacetate transaminase activity (GO:0036141)|L-phenylalanine:pyruvate aminotransferase activity (GO:0047312)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)	18					L-Glutamine(DB00130)	CTGGCTCACCAGGGGTTGTAG	0.602																																					p.W18R		Atlas-SNP	.											.	CCBL1	36	.	0			c.T52A						PASS	.						53.0	62.0	59.0					9																	131607633		2053	4192	6245	SO:0001630	splice_region_variant	883	exon2			CTCACCAGGGGTT	Y17448	CCDS43884.1, CCDS48038.1, CCDS75915.1	9q34.11	2008-03-11	2008-03-11		ENSG00000171097	ENSG00000171097	2.6.1.64		1564	protein-coding gene	gene with protein product	"""glutamine transaminase K"", ""kyneurenine aminotransferase"""	600547	"""cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)"""			7883047	Standard	NM_001122671		Approved	KATI, GTK	uc004bwh.3	Q16773	OTTHUMG00000020767	ENST00000302586.3:c.53+1T>A	chr9.hg19:g.131607633A>T		88.0	0.0	.		48.0	8.0	.	NM_001122672	Q5T275|Q8N191	Missense_Mutation	SNP	ENST00000302586.3	hg19	CCDS43884.1	.	.	.	.	.	.	.	.	.	.	A	17.72	3.458148	0.63401	.	.	ENSG00000171097	ENST00000302586;ENST00000372610;ENST00000320665;ENST00000436267;ENST00000451800;ENST00000416084;ENST00000427720	T;D;T;T;T	0.83075	-0.95;-1.68;-1.0;-0.87;0.85	5.28	5.28	0.74379	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.81917	0.4924	M	0.66378	2.025	0.80722	D	1	B;B;B;B;B	0.26081	0.141;0.047;0.018;0.047;0.019	B;B;B;B;B	0.24974	0.046;0.02;0.057;0.02;0.02	T	0.81256	-0.1015	10	0.72032	D	0.01	-3.8485	14.326	0.66521	1.0:0.0:0.0:0.0	.	112;18;18;18;18	B7Z4W5;A8K563;Q16773-2;Q16773;Q5T278	.;.;.;KAT1_HUMAN;.	R	18;19;18;112;18;18;19	ENSP00000302227:W18R;ENSP00000317342:W18R;ENSP00000399415:W112R;ENSP00000390377:W18R;ENSP00000412402:W18R	ENSP00000302227:W18R	W	-	1	0	CCBL1	130647454	0.996000	0.38824	0.998000	0.56505	0.955000	0.61496	3.509000	0.53386	2.120000	0.65058	0.460000	0.39030	TGG	.	.	.	none		0.602	CCBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054521.2		Missense_Mutation
PTCHD3	374308	hgsc.bcm.edu	37	10	27687708	27687708	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:27687708A>G	ENST00000438700.3	-	4	1936	c.1819T>C	c.(1819-1821)Ttt>Ctt	p.F607L		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	607					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						ACATATATAAAGACTACAAAA	0.383																																					p.F607L		Atlas-SNP	.											.	PTCHD3	140	.	0			c.T1819C						PASS	.						64.0	65.0	64.0					10																	27687708		2203	4300	6503	SO:0001583	missense	374308	exon4			ATATAAAGACTAC	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1819T>C	chr10.hg19:g.27687708A>G	ENSP00000417658:p.Phe607Leu	92.0	0.0	.		95.0	63.0	.	NM_001034842	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	hg19	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-2.996644	0.00044	.	.	ENSG00000182077	ENST00000438700	D	0.83914	-1.78	4.05	-0.446	0.12238	.	0.493132	0.20919	N	0.083307	T	0.41650	0.1168	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.48410	-0.9038	10	0.02654	T	1	-5.7246	0.1591	0.00101	0.2673:0.2583:0.2122:0.2622	.	607	Q3KNS1	PTHD3_HUMAN	L	607	ENSP00000417658:F607L	ENSP00000417658:F607L	F	-	1	0	PTCHD3	27727714	0.012000	0.17670	0.007000	0.13788	0.009000	0.06853	-0.796000	0.04575	-0.287000	0.09064	-0.425000	0.05940	TTT	.	.	.	none		0.383	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
NCOA4	8031	hgsc.bcm.edu	37	10	51585156	51585156	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:51585156G>T	ENST00000443446.1	+	8	1484	c.1255G>T	c.(1255-1257)Gat>Tat	p.D419Y	NCOA4_ENST00000430396.2_Missense_Mutation_p.D319Y|NCOA4_ENST00000414907.2_Missense_Mutation_p.D253Y|NCOA4_ENST00000452682.1_Missense_Mutation_p.D435Y|NCOA4_ENST00000374082.1_Missense_Mutation_p.D419Y|NCOA4_ENST00000344348.6_Missense_Mutation_p.D419Y|NCOA4_ENST00000438493.1_Missense_Mutation_p.D435Y|NCOA4_ENST00000374087.4_Missense_Mutation_p.D419Y	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	419					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						GTGTGTGTGTGATGAGAATTG	0.483			T	RET	papillary thyroid																																p.D435Y		Atlas-SNP	.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4	58	.	0			c.G1303T						PASS	.						71.0	74.0	73.0					10																	51585156		2203	4300	6503	SO:0001583	missense	8031	exon9			GTGTGTGATGAGA	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1255G>T	chr10.hg19:g.51585156G>T	ENSP00000390713:p.Asp419Tyr	99.0	0.0	.		104.0	69.0	.	NM_001145261	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	hg19	CCDS7237.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878324	0.91740	.	.	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	T;T;T;T;T;T;T;T	0.30981	1.99;2.0;1.7;2.0;1.51;2.0;1.7;2.0	5.6	5.6	0.85130	.	0.334273	0.35805	N	0.002979	T	0.54983	0.1892	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.76494	0.999;0.994;0.994;0.997	D;P;P;P	0.63488	0.915;0.87;0.87;0.819	T	0.51593	-0.8686	9	.	.	.	-20.3172	19.608	0.95587	0.0:0.0:1.0:0.0	.	319;435;435;419	B4DF87;B4E260;E9PAV7;Q13772	.;.;.;NCOA4_HUMAN	Y	435;435;319;419;253;419;419;419	ENSP00000405146:D435Y;ENSP00000395465:D435Y;ENSP00000393053:D319Y;ENSP00000363200:D419Y;ENSP00000411018:D253Y;ENSP00000344552:D419Y;ENSP00000363195:D419Y;ENSP00000390713:D419Y	.	D	+	1	0	NCOA4	51255162	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.392000	0.97252	2.647000	0.89833	0.650000	0.86243	GAT	.	.	.	none		0.483	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
WAPAL	23063	hgsc.bcm.edu	37	10	88259986	88259986	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:88259986C>A	ENST00000298767.5	-	3	1486	c.1014G>T	c.(1012-1014)aaG>aaT	p.K338N		NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	338	Mediates interaction with the cohesin complex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						CACCCCCTTTCTTTGCCTGAT	0.448																																					p.K338N		Atlas-SNP	.											.	WAPAL	81	.	0			c.G1014T						PASS	.						182.0	152.0	162.0					10																	88259986		2203	4300	6503	SO:0001583	missense	23063	exon3			CCCTTTCTTTGCC	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.1014G>T	chr10.hg19:g.88259986C>A	ENSP00000298767:p.Lys338Asn	190.0	0.0	.		166.0	117.0	.	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	hg19	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	C	11.49	1.653403	0.29425	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.29397	1.57	5.77	0.75	0.18387	.	0.497401	0.21168	N	0.079024	T	0.20901	0.0503	L	0.36672	1.1	0.80722	D	1	B;B;B	0.26809	0.099;0.099;0.16	B;B;B	0.28232	0.017;0.027;0.087	T	0.04708	-1.0932	10	0.52906	T	0.07	.	5.8006	0.18412	0.126:0.4044:0.0:0.4696	.	338;338;381	B2RTX8;Q7Z5K2;Q7Z5K2-2	.;WAPL_HUMAN;.	N	423;338;423	ENSP00000298767:K338N	ENSP00000298767:K338N	K	-	3	2	WAPAL	88249966	0.994000	0.37717	0.998000	0.56505	0.897000	0.52465	0.251000	0.18257	0.097000	0.17492	-0.145000	0.13849	AAG	.	.	.	none		0.448	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
PAPSS2	9060	hgsc.bcm.edu	37	10	89503313	89503313	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:89503313C>T	ENST00000361175.4	+	10	1760	c.1391C>T	c.(1390-1392)gCt>gTt	p.A464V	PAPSS2_ENST00000456849.1_Missense_Mutation_p.A469V|PAPSS2_ENST00000427144.2_Missense_Mutation_p.A468V	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	464					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		CAGCACGCGGCTGTGCTCGAG	0.587																																					p.A469V		Atlas-SNP	.											.	PAPSS2	46	.	0			c.C1406T						PASS	.						105.0	91.0	96.0					10																	89503313		2203	4300	6503	SO:0001583	missense	9060	exon11			ACGCGGCTGTGCT	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.1391C>T	chr10.hg19:g.89503313C>T	ENSP00000354436:p.Ala464Val	108.0	0.0	.		91.0	47.0	.	NM_001015880	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Missense_Mutation	SNP	ENST00000361175.4	hg19	CCDS7385.1	.	.	.	.	.	.	.	.	.	.	C	31	5.099439	0.94197	.	.	ENSG00000198682	ENST00000361175;ENST00000456849;ENST00000427144;ENST00000371981	T;T;T	0.34472	1.36;1.36;1.36	5.33	5.33	0.75918	Sulphate adenylyltransferase (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.047627	0.85682	D	0.000000	T	0.56441	0.1985	M	0.62154	1.92	0.80722	D	1	D;D	0.63880	0.991;0.993	P;P	0.61201	0.885;0.773	T	0.54043	-0.8352	10	0.49607	T	0.09	-17.1332	19.2123	0.93760	0.0:1.0:0.0:0.0	.	464;469	O95340;O95340-2	PAPS2_HUMAN;.	V	464;469;468;468	ENSP00000354436:A464V;ENSP00000406157:A469V;ENSP00000397123:A468V	ENSP00000354436:A464V	A	+	2	0	PAPSS2	89493293	1.000000	0.71417	0.889000	0.34880	0.628000	0.37860	7.315000	0.78998	2.771000	0.95319	0.561000	0.74099	GCT	.	.	.	none		0.587	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1		
OR52K1	390036	hgsc.bcm.edu	37	11	4510932	4510932	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:4510932C>T	ENST00000307632.3	+	1	824	c.802C>T	c.(802-804)Cgc>Tgc	p.R268C		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R268S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCGTGTAGCCCGCCATGCTGC	0.507																																					p.R268C		Atlas-SNP	.											.	OR52K1	70	.	1	Substitution - Missense(1)	lung(1)	c.C802T						PASS	.						213.0	192.0	199.0					11																	4510932		2201	4298	6499	SO:0001583	missense	390036	exon1			GTAGCCCGCCATG	AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.802C>T	chr11.hg19:g.4510932C>T	ENSP00000302422:p.Arg268Cys	300.0	0.0	.		230.0	66.0	.	NM_001005171	B9EH54|Q6IFK5	Missense_Mutation	SNP	ENST00000307632.3	hg19	CCDS31352.1	.	.	.	.	.	.	.	.	.	.	C	3.130	-0.178651	0.06380	.	.	ENSG00000196778	ENST00000307632	T	0.37411	1.2	4.5	3.59	0.41128	GPCR, rhodopsin-like superfamily (1);	0.429234	0.17846	N	0.160035	T	0.28896	0.0717	L	0.42529	1.33	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.25328	-1.0135	10	0.87932	D	0	.	6.8973	0.24262	0.1728:0.7359:0.0:0.0912	.	268	Q8NGK4	O52K1_HUMAN	C	268	ENSP00000302422:R268C	ENSP00000302422:R268C	R	+	1	0	OR52K1	4467508	0.000000	0.05858	0.723000	0.30687	0.076000	0.17211	-0.593000	0.05740	1.235000	0.43724	0.411000	0.27672	CGC	.	.	.	none		0.507	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385846.1	NM_001005171	
SLC25A45	283130	hgsc.bcm.edu	37	11	65144060	65144060	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:65144060T>C	ENST00000527174.1	-	6	740	c.685A>G	c.(685-687)Atg>Gtg	p.M229V	SLC25A45_ENST00000526432.1_Missense_Mutation_p.M167V|SLC25A45_ENST00000360662.3_Missense_Mutation_p.M205V|SLC25A45_ENST00000294187.6_Missense_Mutation_p.M187V|SLC25A45_ENST00000534028.1_Missense_Mutation_p.M205V|SLC25A45_ENST00000417511.2_Missense_Mutation_p.M187V|RP11-867O8.5_ENST00000533886.1_RNA|SLC25A45_ENST00000398802.1_Missense_Mutation_p.M229V|SLC25A45_ENST00000377152.2_Missense_Mutation_p.M125V			Q8N413	S2545_HUMAN	solute carrier family 25, member 45	229					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14						TCCATCTGCATCCGGGACTTG	0.617																																					p.M229V		Atlas-SNP	.											.	SLC25A45	23	.	0			c.A685G						PASS	.						92.0	97.0	95.0					11																	65144060		2158	4257	6415	SO:0001583	missense	283130	exon7			TCTGCATCCGGGA	BC041100	CCDS41670.1, CCDS41671.1, CCDS60850.1	11q13.1	2013-05-22			ENSG00000162241	ENSG00000162241		"""Solute carriers"""	27442	protein-coding gene	gene with protein product		610825				16949250	Standard	XM_006718507		Approved		uc001odr.1	Q8N413	OTTHUMG00000166255	ENST00000527174.1:c.685A>G	chr11.hg19:g.65144060T>C	ENSP00000435489:p.Met229Val	150.0	0.0	.		121.0	33.0	.	NM_182556	Q6PL49|Q8IW29	Missense_Mutation	SNP	ENST00000527174.1	hg19	CCDS41670.1	.	.	.	.	.	.	.	.	.	.	T	17.61	3.433016	0.62844	.	.	ENSG00000162241	ENST00000527174;ENST00000534028;ENST00000398802;ENST00000360662;ENST00000377152;ENST00000294187;ENST00000417511;ENST00000526432	T;T;T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32	4.58	3.41	0.39046	Mitochondrial carrier domain (2);	.	.	.	.	T	0.72566	0.3476	L	0.37630	1.12	0.37087	D	0.899261	B;B;B	0.31256	0.316;0.056;0.122	B;B;B	0.35470	0.203;0.139;0.156	T	0.73943	-0.3823	9	0.72032	D	0.01	-0.0527	8.8454	0.35168	0.0:0.0:0.3728:0.6272	.	167;205;229	E9PJQ3;Q8N413-4;Q8N413	.;.;S2545_HUMAN	V	229;205;229;205;125;187;187;167	ENSP00000435489:M229V;ENSP00000431769:M205V;ENSP00000381782:M229V;ENSP00000353879:M205V;ENSP00000366357:M125V;ENSP00000294187:M187V;ENSP00000407530:M187V;ENSP00000435547:M167V	ENSP00000294187:M187V	M	-	1	0	SLC25A45	64900636	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.144000	0.42197	0.866000	0.35629	0.459000	0.35465	ATG	.	.	.	none		0.617	SLC25A45-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388744.3	NM_182556	
RELA	5970	hgsc.bcm.edu	37	11	65423175	65423175	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:65423175A>G	ENST00000406246.3	-	10	1278	c.1017T>C	c.(1015-1017)gcT>gcC	p.A339A	RELA_ENST00000525693.1_Silent_p.A339A|RELA_ENST00000308639.9_Silent_p.A336A	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	339					acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						TGGGGACAGAAGCTGAGCTGC	0.607																																					p.A339A		Atlas-SNP	.											.	RELA	44	.	0			c.T1017C						PASS	.						79.0	75.0	77.0					11																	65423175		2201	4297	6498	SO:0001819	synonymous_variant	5970	exon10			GACAGAAGCTGAG	Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.1017T>C	chr11.hg19:g.65423175A>G		74.0	0.0	.		67.0	16.0	.	NM_021975	Q6GTV1|Q6SLK1	Silent	SNP	ENST00000406246.3	hg19	CCDS31609.1	.	.	.	.	.	.	.	.	.	.	A	1.229	-0.624695	0.03636	.	.	ENSG00000173039	ENST00000426617	.	.	.	4.46	0.645	0.17782	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.817	0.18497	0.5244:0.0:0.4756:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RELA	65179751	0.675000	0.27558	0.008000	0.14137	0.234000	0.25298	0.116000	0.15561	0.141000	0.18875	0.454000	0.30748	.	.	.	.	none		0.607	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390457.2	NM_021975	
ANO1	55107	hgsc.bcm.edu	37	11	69951883	69951883	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:69951883C>T	ENST00000355303.5	+	5	1041	c.736C>T	c.(736-738)Cgg>Tgg	p.R246W	ANO1_ENST00000531349.1_5'Flank|ANO1_ENST00000538023.1_Missense_Mutation_p.R246W|ANO1_ENST00000530676.1_Missense_Mutation_p.R130W|ANO1_ENST00000316296.5_Missense_Mutation_p.R218W|ANO1_ENST00000398543.2_Missense_Mutation_p.R130W	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	246					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	CAGCAAAACCCGGAGCACGAT	0.488																																					p.R246W		Atlas-SNP	.											ANO1_ENST00000355303,colon,carcinoma,0,2	ANO1	156	.	0			c.C736T						PASS	.						91.0	90.0	91.0					11																	69951883		1928	4129	6057	SO:0001583	missense	55107	exon5			AAAACCCGGAGCA	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.736C>T	chr11.hg19:g.69951883C>T	ENSP00000347454:p.Arg246Trp	94.0	0.0	.		47.0	15.0	.	NM_018043	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	hg19	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621448	0.46736	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000531604;ENST00000316296;ENST00000530676	T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.86965	0.6060	M	0.93720	3.45	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89503	0.3765	9	.	.	.	.	11.6143	0.51080	0.2839:0.7161:0.0:0.0	.	218;246	Q5XXA6-3;Q5XXA6	.;ANO1_HUMAN	W	246;246;130;30;213;218;130	ENSP00000347454:R246W;ENSP00000444689:R246W;ENSP00000381551:R130W;ENSP00000436392:R213W;ENSP00000319477:R218W;ENSP00000435797:R130W	.	R	+	1	2	ANO1	69629531	0.996000	0.38824	1.000000	0.80357	0.109000	0.19521	3.489000	0.53237	2.437000	0.82529	0.650000	0.86243	CGG	.	.	.	none		0.488	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043	
ZC3H12C	85463	hgsc.bcm.edu	37	11	110007683	110007683	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:110007683T>C	ENST00000278590.3	+	2	368	c.317T>C	c.(316-318)aTt>aCt	p.I106T	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.I107T|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.I75T	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	106							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TTGGGTAGCATTTCAGTAGAG	0.448																																					p.I106T		Atlas-SNP	.											.	ZC3H12C	83	.	0			c.T317C						PASS	.						42.0	41.0	41.0					11																	110007683		1893	4130	6023	SO:0001583	missense	85463	exon2			GTAGCATTTCAGT		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.317T>C	chr11.hg19:g.110007683T>C	ENSP00000278590:p.Ile106Thr	33.0	0.0	.		27.0	15.0	.	NM_033390	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	hg19	CCDS44727.1	.	.	.	.	.	.	.	.	.	.	t	0.015	-1.546583	0.00926	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.29917	1.55;1.55;1.56	5.42	4.29	0.51040	.	.	.	.	.	T	0.18759	0.0450	N	0.25647	0.755	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.003	B;B;B	0.11329	0.005;0.006;0.006	T	0.31475	-0.9942	9	0.13853	T	0.58	-1.7133	6.4988	0.22158	0.0:0.1421:0.1326:0.7254	.	107;106;106	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	T	106;107;75	ENSP00000278590:I106T;ENSP00000431821:I107T;ENSP00000413094:I75T	ENSP00000278590:I106T	I	+	2	0	ZC3H12C	109512893	0.003000	0.15002	0.297000	0.24988	0.069000	0.16628	0.578000	0.23773	0.902000	0.36520	0.528000	0.53228	ATT	.	.	.	none		0.448	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390	
DRD2	1813	hgsc.bcm.edu	37	11	113295344	113295344	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:113295344A>G	ENST00000362072.3	-	2	374	c.30T>C	c.(28-30)gaT>gaC	p.D10D	DRD2_ENST00000538967.1_Silent_p.D10D|DRD2_ENST00000542968.1_Silent_p.D10D|DRD2_ENST00000355319.2_Silent_p.D10D|DRD2_ENST00000346454.3_Silent_p.D10D|DRD2_ENST00000535984.1_5'Flank|DRD2_ENST00000544518.1_Silent_p.D10D	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	10					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CCAGATCATCATCATACCAGG	0.587																																					p.D10D		Atlas-SNP	.											.	DRD2	98	.	0			c.T30C						PASS	.						116.0	103.0	107.0					11																	113295344		2201	4296	6497	SO:0001819	synonymous_variant	1813	exon2			ATCATCATCATAC	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.30T>C	chr11.hg19:g.113295344A>G		132.0	0.0	.		107.0	27.0	.	NM_016574	Q9NZR3|Q9UPA9	Silent	SNP	ENST00000362072.3	hg19	CCDS8361.1																																																																																			.	.	.	none		0.587	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795	
PCED1B	91523	hgsc.bcm.edu	37	12	47628909	47628909	+	Silent	SNP	G	G	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr12:47628909G>T	ENST00000546455.1	+	4	794	c.63G>T	c.(61-63)ctG>ctT	p.L21L	PCED1B_ENST00000432328.1_Silent_p.L21L|RP11-493L12.3_ENST00000547748.1_RNA			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	21							hydrolase activity (GO:0016787)										TGGTCATCCTGGGGGACTCTG	0.602																																					p.L21L		Atlas-SNP	.											.	.	.	.	0			c.G63T						PASS	.						73.0	71.0	72.0					12																	47628909		2203	4300	6503	SO:0001819	synonymous_variant	91523	exon2			CATCCTGGGGGAC	BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.63G>T	chr12.hg19:g.47628909G>T		89.0	0.0	.		74.0	24.0	.	NM_138371	Q96B20	Silent	SNP	ENST00000546455.1	hg19	CCDS8752.1																																																																																			.	.	.	none		0.602	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1	NM_138371	
TMEM120B	144404	hgsc.bcm.edu	37	12	122190050	122190050	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr12:122190050G>A	ENST00000449592.2	+	5	483	c.382G>A	c.(382-384)Gaa>Aaa	p.E128K	TMEM120B_ENST00000540377.1_5'UTR	NM_001080825.2	NP_001074294.2	A0PK00	T120B_HUMAN	transmembrane protein 120B	128						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		CTACAAGGACGAATATGAGAA	0.577																																					p.E128K		Atlas-SNP	.											.	TMEM120B	43	.	0			c.G382A						PASS	.						111.0	130.0	124.0					12																	122190050		2155	4240	6395	SO:0001583	missense	144404	exon5			AAGGACGAATATG	BC127768	CCDS41852.1	12q24.31	2007-08-01			ENSG00000188735	ENSG00000188735			32008	protein-coding gene	gene with protein product							Standard	NM_001080825		Approved		uc001ubc.4	A0PK00	OTTHUMG00000169076	ENST00000449592.2:c.382G>A	chr12.hg19:g.122190050G>A	ENSP00000404991:p.Glu128Lys	129.0	0.0	.		120.0	40.0	.	NM_001080825	A0PK01|B3KX33	Missense_Mutation	SNP	ENST00000449592.2	hg19	CCDS41852.1	.	.	.	.	.	.	.	.	.	.	G	32	5.129163	0.94473	.	.	ENSG00000188735	ENST00000449592;ENST00000541467	T;T	0.42513	0.97;0.97	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.73133	0.3548	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81391	-0.0954	10	0.87932	D	0	-29.3312	15.8383	0.78818	0.0:0.0:1.0:0.0	.	128	A0PK00	T120B_HUMAN	K	128;107	ENSP00000404991:E128K;ENSP00000442105:E107K	ENSP00000345152:E128K	E	+	1	0	TMEM120B	120674433	1.000000	0.71417	0.995000	0.50966	0.953000	0.61014	9.405000	0.97313	2.387000	0.81309	0.491000	0.48974	GAA	.	.	.	none		0.577	TMEM120B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402158.1	NM_001080825	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102500785	102500785	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr14:102500785A>G	ENST00000360184.4	+	56	10914	c.10750A>G	c.(10750-10752)Aat>Gat	p.N3584D	DYNC1H1_ENST00000556791.1_3'UTR|RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3584	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GAAACGATTCAATAGGTATGA	0.473																																					p.N3584D		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.A10750G						PASS	.						94.0	85.0	88.0					14																	102500785		2203	4300	6503	SO:0001583	missense	1778	exon56			CGATTCAATAGGT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10750A>G	chr14.hg19:g.102500785A>G	ENSP00000348965:p.Asn3584Asp	186.0	0.0	.		137.0	39.0	.	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	hg19	CCDS9966.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.89|14.89	2.671516|2.671516	0.47781|0.47781	.|.	.|.	ENSG00000197102|ENSG00000197102	ENST00000360184|ENST00000553423	T|.	0.52057|.	0.68|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72358|0.72358	0.3450|0.3450	M|M	0.68728|0.68728	2.09|2.09	0.80722|0.80722	D|D	1|1	D|.	0.60160|.	0.987|.	D|.	0.63488|.	0.915|.	T|T	0.72491|0.72491	-0.4277|-0.4277	10|5	0.41790|.	T|.	0.15|.	.|.	15.2984|15.2984	0.73928|0.73928	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	3584|.	Q14204|.	DYHC1_HUMAN|.	D|R	3584|59	ENSP00000348965:N3584D|.	ENSP00000348965:N3584D|.	N|Q	+|+	1|2	0|0	DYNC1H1|DYNC1H1	101570538|101570538	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.411000|0.411000	0.31082|0.31082	7.417000|7.417000	0.80156|0.80156	2.090000|2.090000	0.63153|0.63153	0.482000|0.482000	0.46254|0.46254	AAT|CAA	.	.	.	none		0.473	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
NTRK3	4916	hgsc.bcm.edu	37	15	88679229	88679229	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr15:88679229G>C	ENST00000360948.2	-	8	969	c.808C>G	c.(808-810)Ctg>Gtg	p.L270V	NTRK3_ENST00000317501.3_Missense_Mutation_p.L270V|NTRK3_ENST00000557856.1_Missense_Mutation_p.L270V|NTRK3_ENST00000355254.2_Missense_Mutation_p.L270V|NTRK3_ENST00000542733.2_Missense_Mutation_p.L172V|NTRK3_ENST00000540489.2_Missense_Mutation_p.L270V|NTRK3_ENST00000558676.1_Missense_Mutation_p.L270V|NTRK3_ENST00000394480.2_Missense_Mutation_p.L270V|NTRK3_ENST00000357724.2_Missense_Mutation_p.L270V	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	270	Ig-like C2-type 1.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L270M(1)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			ACATTCACCAGCGTCAAGTTG	0.478			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.L270V		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	NTRK3_ENST00000360948,caecum,carcinoma,+2,1	NTRK3	587	.	1	Substitution - Missense(1)	lung(1)	c.C808G						PASS	.						241.0	164.0	190.0					15																	88679229		2201	4299	6500	SO:0001583	missense	4916	exon9			TCACCAGCGTCAA	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.808C>G	chr15.hg19:g.88679229G>C	ENSP00000354207:p.Leu270Val	164.0	0.0	.		136.0	42.0	.	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	hg19	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422428	0.62622	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.51	4.6	0.57074	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.072619	0.56097	D	0.000024	T	0.75982	0.3924	L	0.57536	1.79	0.47819	D	0.999528	D;D;P;D;D;P	0.71674	0.967;0.969;0.87;0.998;0.969;0.87	P;P;P;D;P;P	0.69824	0.808;0.645;0.777;0.966;0.594;0.718	T	0.76515	-0.2931	10	0.54805	T	0.06	.	10.3176	0.43747	0.1599:0.0:0.8401:0.0	.	172;270;270;270;270;270	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	V	270;270;270;270;172;270;270	ENSP00000377990:L270V;ENSP00000354207:L270V;ENSP00000350356:L270V;ENSP00000347397:L270V;ENSP00000437773:L172V;ENSP00000444673:L270V;ENSP00000318328:L270V	ENSP00000318328:L270V	L	-	1	2	NTRK3	86480233	1.000000	0.71417	0.940000	0.37924	0.891000	0.51852	4.245000	0.58734	1.336000	0.45506	-0.253000	0.11424	CTG	.	.	.	none		0.478	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
ACAN	176	hgsc.bcm.edu	37	15	89398462	89398462	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr15:89398462C>T	ENST00000561243.1	+	11	2646	c.2646C>T	c.(2644-2646)ttC>ttT	p.F882F	ACAN_ENST00000559004.1_Silent_p.F882F|ACAN_ENST00000439576.2_Silent_p.F882F|ACAN_ENST00000352105.7_Silent_p.F882F			P16112	PGCA_HUMAN	aggrecan	881	CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			ACCTTGACTTCAGTGGGCAGC	0.597																																					p.F882F		Atlas-SNP	.											.	ACAN	220	.	0			c.C2646T						PASS	.						59.0	65.0	63.0					15																	89398462		2009	4185	6194	SO:0001819	synonymous_variant	176	exon12			TGACTTCAGTGGG	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2646C>T	chr15.hg19:g.89398462C>T		101.0	0.0	.		74.0	22.0	.	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	hg19	CCDS53970.1																																																																																			.	.	.	none		0.597	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
RHCG	51458	hgsc.bcm.edu	37	15	90026327	90026327	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr15:90026327T>C	ENST00000268122.4	-	3	561	c.493A>G	c.(493-495)Aat>Gat	p.N165D	RHCG_ENST00000544600.1_Missense_Mutation_p.N165D	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	165					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					ATGAACTCATTCACAGCGAAG	0.537																																					p.N165D		Atlas-SNP	.											.	RHCG	49	.	0			c.A493G						PASS	.						68.0	51.0	57.0					15																	90026327		2200	4299	6499	SO:0001583	missense	51458	exon3			ACTCATTCACAGC	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.493A>G	chr15.hg19:g.90026327T>C	ENSP00000268122:p.Asn165Asp	67.0	0.0	.		78.0	29.0	.	NM_016321	A8K4D4|Q6X3Y4	Missense_Mutation	SNP	ENST00000268122.4	hg19	CCDS10351.1	.	.	.	.	.	.	.	.	.	.	T	19.35	3.811144	0.70797	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	T;T	0.23147	1.92;1.92	5.47	5.47	0.80525	Ammonium transporter AmtB-like (3);	0.089021	0.85682	D	0.000000	T	0.63570	0.2522	H	0.95611	3.695	0.58432	D	0.999999	D;D	0.69078	0.997;0.997	D;D	0.72075	0.976;0.976	T	0.76181	-0.3053	9	.	.	.	-18.2072	15.5452	0.76093	0.0:0.0:0.0:1.0	.	165;165	A8K4D4;Q9UBD6	.;RHCG_HUMAN	D	165;165;156	ENSP00000438123:N165D;ENSP00000268122:N165D	.	N	-	1	0	RHCG	87827331	1.000000	0.71417	0.940000	0.37924	0.612000	0.37316	5.740000	0.68629	2.076000	0.62316	0.533000	0.62120	AAT	.	.	.	none		0.537	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321	
BAIAP3	8938	hgsc.bcm.edu	37	16	1398016	1398016	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:1398016C>G	ENST00000324385.5	+	32	3410	c.3252C>G	c.(3250-3252)taC>taG	p.Y1084*	BAIAP3_ENST00000426824.3_Nonsense_Mutation_p.Y1049*|BAIAP3_ENST00000397489.1_Nonsense_Mutation_p.Y1066*|BAIAP3_ENST00000421665.2_Nonsense_Mutation_p.Y1013*|BAIAP3_ENST00000562208.1_Nonsense_Mutation_p.Y1026*|BAIAP3_ENST00000568887.1_Nonsense_Mutation_p.Y1021*|BAIAP3_ENST00000397488.2_Nonsense_Mutation_p.Y1066*	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	1084	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				AACTCTTCTACTTGTGAGTGT	0.652																																					p.Y1084X		Atlas-SNP	.											.	BAIAP3	88	.	0			c.C3252G						PASS	.						50.0	50.0	50.0					16																	1398016		2198	4300	6498	SO:0001587	stop_gained	8938	exon32			CTTCTACTTGTGA	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.3252C>G	chr16.hg19:g.1398016C>G	ENSP00000324510:p.Tyr1084*	115.0	0.0	.		66.0	6.0	.	NM_003933	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Nonsense_Mutation	SNP	ENST00000324385.5	hg19	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	C	38	6.826251	0.97865	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	.	.	.	4.65	1.6	0.23607	.	0.402932	0.24625	N	0.036938	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.1567	6.7323	0.23390	0.0:0.6052:0.0:0.3948	.	.	.	.	X	1049;1066;1084;1066;1013	.	ENSP00000324510:Y1084X	Y	+	3	2	BAIAP3	1338017	0.998000	0.40836	0.998000	0.56505	0.087000	0.18053	0.792000	0.26929	0.068000	0.16574	-0.258000	0.10820	TAC	.	.	.	none		0.652	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3		
PRSS22	64063	hgsc.bcm.edu	37	16	2905588	2905589	+	Missense_Mutation	DNP	GC	GC	AT	rs556704172		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:2905588_2905589GC>AT	ENST00000161006.3	-	4	610_611	c.545_546GC>AT	c.(544-546)aGC>aAT	p.S182N	LA16c-325D7.1_ENST00000577140.1_RNA|PRSS22_ENST00000571228.1_Intron|PRSS22_ENST00000574768.1_5'Flank	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22	182	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						CATCTTGGATGCTCCCCCAGCC	0.589																																					p.S182S|p.S182N		Atlas-SNP	.											.	PRSS22	23	.	0			c.C546T|c.G545A						PASS	.																																			SO:0001583	missense	64063	exon4			TTGGATGCTCCCC|TGGATGCTCCCCC	AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.545_546delinsAT	chr16.hg19:g.2905588_2905589delinsAT	ENSP00000161006:p.Ser182Asn	111.0|113.0	0.0	.		121.0	63.0|62.0	.	NM_022119	O43342|Q6UXE0	Silent|Missense_Mutation	SNP	ENST00000161006.3	hg19	CCDS10481.1																																																																																			.	.	.	none		0.589	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250943.1	NM_022119	
PSMB10	5699	hgsc.bcm.edu	37	16	67970649	67970649	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:67970649G>C	ENST00000358514.4	-	1	341	c.4C>G	c.(4-6)Ctg>Gtg	p.L2V	CTC-479C5.12_ENST00000573493.1_5'Flank	NM_002801.3	NP_002792.1	P40306	PSB10_HUMAN	proteasome (prosome, macropain) subunit, beta type, 10	2					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell morphogenesis (GO:0000902)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|humoral immune response (GO:0006959)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(2)|endometrium(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	Carfilzomib(DB08889)	GCTGGCTTCAGCATCTTGGGG	0.657																																					p.L2V		Atlas-SNP	.											.	PSMB10	19	.	0			c.C4G						PASS	.						6.0	9.0	8.0					16																	67970649		2068	4126	6194	SO:0001583	missense	5699	exon1			GCTTCAGCATCTT	Y13640	CCDS10853.1	16q22.1	2008-02-05			ENSG00000205220	ENSG00000205220		"""Proteasome (prosome, macropain) subunits"""	9538	protein-coding gene	gene with protein product		176847		MECL1		8268911	Standard	NM_002801		Approved	LMP10, MGC1665, beta2i	uc002eux.2	P40306	OTTHUMG00000137553	ENST00000358514.4:c.4C>G	chr16.hg19:g.67970649G>C	ENSP00000351314:p.Leu2Val	2.0	0.0	.		11.0	6.0	.	NM_002801	B2R5J4|Q5U098	Missense_Mutation	SNP	ENST00000358514.4	hg19	CCDS10853.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368139	0.61513	.	.	ENSG00000205220	ENST00000358514	T	0.29917	1.55	5.44	3.45	0.39498	.	0.789141	0.11429	N	0.564987	T	0.22322	0.0538	L	0.34521	1.04	0.31055	N	0.714774	B	0.21225	0.053	B	0.17722	0.019	T	0.14783	-1.0460	10	0.33940	T	0.23	-0.1279	7.6089	0.28118	0.1898:0.0:0.8102:0.0	.	2	P40306	PSB10_HUMAN	V	2	ENSP00000351314:L2V	ENSP00000351314:L2V	L	-	1	2	PSMB10	66528150	0.741000	0.28217	0.993000	0.49108	0.082000	0.17680	0.926000	0.28804	1.422000	0.47177	0.549000	0.68633	CTG	.	.	.	none		0.657	PSMB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268887.1	NM_002801	
SSH2	85464	hgsc.bcm.edu	37	17	27975326	27975326	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:27975326C>A	ENST00000269033.3	-	13	1333	c.1182G>T	c.(1180-1182)atG>atT	p.M394I	SSH2_ENST00000540801.1_Missense_Mutation_p.M421I|RP11-68I3.2_ENST00000581474.1_RNA|RP11-68I3.11_ENST00000582881.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	394	Tyrosine-protein phosphatase.				actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GACTCACCCCCATTTTGCAGT	0.443																																					p.M394I		Atlas-SNP	.											.	SSH2	107	.	0			c.G1182T						PASS	.						89.0	78.0	82.0					17																	27975326		2203	4300	6503	SO:0001583	missense	85464	exon13			CACCCCCATTTTG	AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.1182G>T	chr17.hg19:g.27975326C>A	ENSP00000269033:p.Met394Ile	60.0	0.0	.		85.0	46.0	.	NM_033389	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	hg19	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	C	36	5.803091	0.96960	.	.	ENSG00000141298	ENST00000269033;ENST00000540801;ENST00000394848	D;D	0.85411	-1.98;-1.98	5.95	5.95	0.96441	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.94611	0.8263	M	0.94101	3.495	0.80722	D	1	P;P;P	0.50710	0.526;0.895;0.938	P;P;D	0.65233	0.701;0.647;0.933	D	0.94987	0.8131	10	0.87932	D	0	-16.2523	20.3932	0.98965	0.0:1.0:0.0:0.0	.	421;394;394	F5H527;Q76I76-4;Q76I76	.;.;SSH2_HUMAN	I	394;421;394	ENSP00000269033:M394I;ENSP00000444743:M421I	ENSP00000269033:M394I	M	-	3	0	SSH2	24999452	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	ATG	.	.	.	none		0.443	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389	
WIPF2	147179	hgsc.bcm.edu	37	17	38416825	38416825	+	Silent	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:38416825G>A	ENST00000323571.4	+	3	342	c.102G>A	c.(100-102)caG>caA	p.Q34Q	WIPF2_ENST00000585043.1_Silent_p.Q34Q|WIPF2_ENST00000394103.3_Silent_p.Q34Q|WIPF2_ENST00000583130.1_Silent_p.Q34Q|WIPF2_ENST00000536600.1_Silent_p.Q34Q|WIPF2_ENST00000494757.1_3'UTR	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	34					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						GAGATGAGCAGCGGGGTCGAG	0.522										HNSCC(43;0.11)																											p.Q34Q		Atlas-SNP	.											.	WIPF2	55	.	0			c.G102A						PASS	.						101.0	89.0	93.0					17																	38416825		2203	4300	6503	SO:0001819	synonymous_variant	147179	exon3			TGAGCAGCGGGGT	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.102G>A	chr17.hg19:g.38416825G>A		158.0	0.0	.		161.0	38.0	.	NM_133264	A8K0L3|Q658J8|Q71RE1|Q8TE44	Silent	SNP	ENST00000323571.4	hg19	CCDS11364.1																																																																																			.	.	.	none		0.522	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264	
GAREM	64762	hgsc.bcm.edu	37	18	29867256	29867256	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr18:29867256A>G	ENST00000269209.6	-	4	1307	c.1304T>C	c.(1303-1305)tTc>tCc	p.F435S	RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000578619.1_5'Flank|GAREM_ENST00000399218.4_Missense_Mutation_p.F435S			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	435					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										AGCTTCTGGGAAAAGGTAGTC	0.557																																					p.F435S		Atlas-SNP	.											.	.	.	.	0			c.T1304C						PASS	.						103.0	109.0	107.0					18																	29867256		2203	4300	6503	SO:0001583	missense	64762	exon4			TCTGGGAAAAGGT	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1304T>C	chr18.hg19:g.29867256A>G	ENSP00000269209:p.Phe435Ser	211.0	0.0	.		210.0	69.0	.	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	hg19	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	A	0.031	-1.336778	0.01287	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.13538	2.58;2.58	5.65	5.65	0.86999	.	0.136032	0.64402	D	0.000002	T	0.09468	0.0233	N	0.12182	0.205	0.58432	D	0.99999	B;B	0.17852	0.024;0.012	B;B	0.20577	0.03;0.019	T	0.28839	-1.0031	10	0.22109	T	0.4	-29.2932	16.1512	0.81624	1.0:0.0:0.0:0.0	.	435;435	Q9H706;Q9H706-3	FA59A_HUMAN;.	S	435	ENSP00000382165:F435S;ENSP00000269209:F435S	ENSP00000269209:F435S	F	-	2	0	FAM59A	28121254	1.000000	0.71417	1.000000	0.80357	0.104000	0.19210	7.042000	0.76565	2.275000	0.75901	0.459000	0.35465	TTC	.	.	.	none		0.557	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
ZNF516	9658	hgsc.bcm.edu	37	18	74154041	74154041	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr18:74154041C>T	ENST00000443185.2	-	3	1287	c.970G>A	c.(970-972)Gag>Aag	p.E324K	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		ATCACCTCCTCCTGGACCACG	0.602																																					p.E324K		Atlas-SNP	.											.	ZNF516	102	.	0			c.G970A						PASS	.						64.0	73.0	70.0					18																	74154041		2178	4264	6442	SO:0001583	missense	9658	exon3			CCTCCTCCTGGAC	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.970G>A	chr18.hg19:g.74154041C>T	ENSP00000394757:p.Glu324Lys	98.0	0.0	.		87.0	24.0	.	NM_014643		Missense_Mutation	SNP	ENST00000443185.2	hg19		.	.	.	.	.	.	.	.	.	.	C	25.9	4.681412	0.88542	.	.	ENSG00000101493	ENST00000443185	T	0.11495	2.77	4.97	4.97	0.65823	.	0.095344	0.49916	D	0.000140	T	0.36138	0.0956	.	.	.	0.54753	D	0.999984	D	0.76494	0.999	D	0.80764	0.994	T	0.12604	-1.0541	9	0.62326	D	0.03	-3.4552	18.4275	0.90614	0.0:1.0:0.0:0.0	.	324	Q92618	ZN516_HUMAN	K	324	ENSP00000394757:E324K	ENSP00000394757:E324K	E	-	1	0	ZNF516	72283029	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.572000	0.67411	2.578000	0.87016	0.655000	0.94253	GAG	.	.	.	none		0.602	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
PTPRS	5802	hgsc.bcm.edu	37	19	5208061	5208061	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:5208061C>A	ENST00000587303.1	-	36	5749	c.5650G>T	c.(5650-5652)Gtg>Ttg	p.V1884L	PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Missense_Mutation_p.V1864L|PTPRS_ENST00000588012.1_Missense_Mutation_p.V1846L|PTPRS_ENST00000592099.1_Missense_Mutation_p.V1437L|PTPRS_ENST00000348075.2_Missense_Mutation_p.V1846L|PTPRS_ENST00000353284.2_Missense_Mutation_p.V1437L|PTPRS_ENST00000357368.4_Missense_Mutation_p.V1884L|PTPRS_ENST00000372412.4_Missense_Mutation_p.V1885L			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1884	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GTCCTGCCCACGCCGGCACTG	0.602																																					p.V1884L		Atlas-SNP	.											PTPRS,colon,carcinoma,0,2	PTPRS	169	.	0			c.G5650T						PASS	.						53.0	41.0	45.0					19																	5208061		2203	4300	6503	SO:0001583	missense	5802	exon37			TGCCCACGCCGGC	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.5650G>T	chr19.hg19:g.5208061C>A	ENSP00000467537:p.Val1884Leu	32.0	0.0	.		38.0	2.0	.	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	hg19	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070068	0.76301	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	D;D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88;-1.88	2.78	2.78	0.32641	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.56097	U	0.000021	D	0.91365	0.7276	M	0.79011	2.435	0.80722	D	1	D;D;D;D;D;D	0.67145	0.978;0.97;0.996;0.992;0.994;0.993	D;P;D;D;D;D	0.85130	0.927;0.877;0.995;0.97;0.997;0.997	D	0.92491	0.6000	10	0.87932	D	0	.	13.6312	0.62196	0.0:1.0:0.0:0.0	.	1466;1437;1441;1846;1884;1479	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	L	1479;1885;1884;1884;1875;1864;1846;1466;1441;1437	ENSP00000361489:V1885L;ENSP00000349932:V1884L;ENSP00000262963:V1864L;ENSP00000269907:V1846L;ENSP00000327313:V1437L	ENSP00000262963:V1864L	V	-	1	0	PTPRS	5159061	1.000000	0.71417	0.990000	0.47175	0.547000	0.35210	7.562000	0.82300	1.397000	0.46682	0.471000	0.43371	GTG	.	.	.	none		0.602	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
CD209	30835	hgsc.bcm.edu	37	19	7810714	7810714	+	Silent	SNP	G	G	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:7810714G>A	ENST00000315599.7	-	4	460	c.438C>T	c.(436-438)atC>atT	p.I146I	CD209_ENST00000315591.8_Silent_p.I122I|CD209_ENST00000601256.1_Silent_p.I122I|CD209_ENST00000301357.8_Intron|CD209_ENST00000204801.8_Silent_p.I102I|CD209_ENST00000394173.4_Intron|CD209_ENST00000593821.1_Silent_p.I102I|CD209_ENST00000593660.1_Silent_p.I122I|CD209_ENST00000602261.1_Silent_p.I146I|CD209_ENST00000394161.5_Intron|CD209_ENST00000354397.6_Silent_p.I146I|CD209_ENST00000601951.1_Silent_p.I122I	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	146	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)			endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GCTCCTGGTAGATCTCCTGCA	0.547																																					p.I146I		Atlas-SNP	.											.	CD209	166	.	0			c.C438T						PASS	.						106.0	105.0	105.0					19																	7810714		2197	4299	6496	SO:0001819	synonymous_variant	30835	exon4			CTGGTAGATCTCC	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.438C>T	chr19.hg19:g.7810714G>A		367.0	0.0	.		237.0	73.0	.	NM_021155	A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Silent	SNP	ENST00000315599.7	hg19	CCDS12186.1																																																																																			.	.	.	none		0.547	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462241.1	NM_021155	
BRD4	23476	hgsc.bcm.edu	37	19	15350519	15350519	+	Silent	SNP	C	C	T			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:15350519C>T	ENST00000263377.2	-	16	3617	c.3396G>A	c.(3394-3396)gaG>gaA	p.E1132E		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1132	C-terminal (CTD) region.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GCTTGGGGGGCTCCGGCCGCA	0.711			T	C15orf55	lethal midline carcinoma of young people																																p.E1132E		Atlas-SNP	.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4	172	.	0			c.G3396A						PASS	.						19.0	26.0	24.0					19																	15350519		2159	4231	6390	SO:0001819	synonymous_variant	23476	exon16			GGGGGGCTCCGGC	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3396G>A	chr19.hg19:g.15350519C>T		88.0	0.0	.		69.0	27.0	.	NM_058243	O60433|Q4G0X8|Q86YS8|Q96PD3	Silent	SNP	ENST00000263377.2	hg19	CCDS12328.1																																																																																			.	.	.	none		0.711	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
ZNF99	7652	hgsc.bcm.edu	37	19	22941279	22941279	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:22941279C>G	ENST00000596209.1	-	4	1522	c.1432G>C	c.(1432-1434)Gag>Cag	p.E478Q	ZNF99_ENST00000397104.3_Missense_Mutation_p.E387Q	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	478					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E387Q(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TAGGGTTTCTCTCCAGTATGA	0.353																																					p.E478Q		Atlas-SNP	.											ZNF99,NS,carcinoma,0,1	ZNF99	273	.	1	Substitution - Missense(1)	prostate(1)	c.G1432C						PASS	.																																			SO:0001583	missense	7652	exon4			GTTTCTCTCCAGT	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1432G>C	chr19.hg19:g.22941279C>G	ENSP00000472969:p.Glu478Gln	46.0	0.0	.		64.0	3.0	.	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	15.37	2.812264	0.50527	.	.	ENSG00000213973	ENST00000397104	T	0.25912	1.77	1.28	1.28	0.21552	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38188	0.1031	L	0.55834	1.745	0.37534	D	0.918031	D	0.65815	0.995	P	0.61328	0.887	T	0.41980	-0.9478	9	0.72032	D	0.01	.	9.4929	0.38971	0.0:1.0:0.0:0.0	.	387	A8MXY4	ZNF99_HUMAN	Q	387	ENSP00000380293:E387Q	ENSP00000380293:E387Q	E	-	1	0	ZNF99	22733119	0.013000	0.17824	0.386000	0.26170	0.619000	0.37552	0.270000	0.18607	0.675000	0.31264	0.395000	0.25975	GAG	.	.	.	none		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
FCGBP	8857	hgsc.bcm.edu	37	19	40419757	40419757	+	Silent	SNP	A	A	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:40419757A>G	ENST00000221347.6	-	6	3244	c.3237T>C	c.(3235-3237)caT>caC	p.H1079H		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1079	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCAGCTTGCTATGGCACTCCC	0.642																																					p.H1079H		Atlas-SNP	.											.	FCGBP	416	.	0			c.T3237C						PASS	.						70.0	65.0	67.0					19																	40419757		2203	4300	6503	SO:0001819	synonymous_variant	8857	exon6			CTTGCTATGGCAC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.3237T>C	chr19.hg19:g.40419757A>G		181.0	0.0	.		162.0	44.0	.	NM_003890	O95784	Silent	SNP	ENST00000221347.6	hg19	CCDS12546.1																																																																																			.	.	.	none		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
HRC	3270	hgsc.bcm.edu	37	19	49658077	49658077	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:49658077C>G	ENST00000252825.4	-	1	604	c.418G>C	c.(418-420)Gaa>Caa	p.E140Q	TRPM4_ENST00000427978.2_5'Flank|HRC_ENST00000595625.1_Missense_Mutation_p.E140Q|TRPM4_ENST00000252826.5_5'Flank	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	140	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TCCGTGTCTTCACTCCCGTGG	0.597																																					p.E140Q	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											.	HRC	85	.	0			c.G418C						PASS	.						176.0	128.0	144.0					19																	49658077		2203	4300	6503	SO:0001583	missense	3270	exon1			TGTCTTCACTCCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.418G>C	chr19.hg19:g.49658077C>G	ENSP00000252825:p.Glu140Gln	152.0	0.0	.		113.0	34.0	.	NM_002152	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	hg19	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.264155	0.59431	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.06933	3.24	2.6	2.6	0.31112	.	.	.	.	.	T	0.24624	0.0597	M	0.73217	2.22	0.23923	N	0.996455	D	0.89917	1.0	D	0.79108	0.992	T	0.03000	-1.1084	9	0.35671	T	0.21	-0.6964	11.3389	0.49520	0.0:1.0:0.0:0.0	.	140	P23327	SRCH_HUMAN	Q	140;110	ENSP00000252825:E140Q	ENSP00000252825:E140Q	E	-	1	0	HRC	54349889	0.062000	0.20869	0.037000	0.18230	0.019000	0.09904	1.982000	0.40638	1.775000	0.52247	0.462000	0.41574	GAA	.	.	.	none		0.597	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
VN1R2	317701	hgsc.bcm.edu	37	19	53762787	53762787	+	Nonsense_Mutation	SNP	C	C	T	rs374706531		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr19:53762787C>T	ENST00000341702.3	+	1	1243	c.1159C>T	c.(1159-1161)Cga>Tga	p.R387*	VN1R2_ENST00000598458.1_Intron	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	387					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		AAGAAATAGACGATTCTTTCA	0.433																																					p.R387X		Atlas-SNP	.											VN1R2,colon,carcinoma,-1,1	VN1R2	71	.	0			c.C1159T						PASS	.						105.0	103.0	104.0					19																	53762787		2203	4300	6503	SO:0001587	stop_gained	317701	exon1			AATAGACGATTCT	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.1159C>T	chr19.hg19:g.53762787C>T	ENSP00000351244:p.Arg387*	165.0	0.0	.		139.0	35.0	.	NM_173856	A1L411|Q8TDU4	Nonsense_Mutation	SNP	ENST00000341702.3	hg19	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024586	0.35701	.	.	ENSG00000196131	ENST00000341702	.	.	.	2.92	-5.84	0.02318	.	.	.	.	.	.	.	.	.	.	.	0.20764	N	0.999858	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.3458	0.04271	0.3322:0.4169:0.1115:0.1395	.	.	.	.	X	387	.	ENSP00000351244:R387X	R	+	1	2	VN1R2	58454599	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.676000	0.00396	-3.923000	0.00091	-0.582000	0.04134	CGA	.	.	.	weak		0.433	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
SLC24A3	57419	hgsc.bcm.edu	37	20	19679325	19679325	+	Splice_Site	SNP	G	G	C	rs201062990		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr20:19679325G>C	ENST00000328041.6	+	15	1916		c.e15+1		RP4-718D20.3_ENST00000600889.1_RNA|RP4-718D20.3_ENST00000435992.2_RNA|RP4-718D20.3_ENST00000598694.1_RNA|RP4-718D20.3_ENST00000609846.1_RNA|RP4-718D20.3_ENST00000593770.1_RNA	NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3						ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CGGATCCTACGTAAGTGGTTT	0.542																																					.		Atlas-SNP	.											.	SLC24A3	92	.	0			c.1719+1G>C						PASS	.						79.0	63.0	68.0					20																	19679325		2203	4299	6502	SO:0001630	splice_region_variant	57419	exon15			TCCTACGTAAGTG	AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.1719+1G>C	chr20.hg19:g.19679325G>C		14.0	0.0	.		19.0	9.0	.	NM_020689	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Splice_Site	SNP	ENST00000328041.6	hg19	CCDS13140.1	.	.	.	.	.	.	.	.	.	.	G	32	5.120039	0.94385	.	.	ENSG00000185052	ENST00000328041	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8252	0.92115	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC24A3	19627325	1.000000	0.71417	0.994000	0.49952	0.964000	0.63967	9.869000	0.99810	2.758000	0.94735	0.561000	0.74099	.	.	G|1.000;A|0.000	.	alt		0.542	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689	Intron
DPM1	8813	hgsc.bcm.edu	37	20	49576203	49576203	+	5'Flank	SNP	T	T	G			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr20:49576203T>G	ENST00000371588.5	-	0	0				DPM1_ENST00000371582.4_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.L275W|DPM1_ENST00000466152.1_5'Flank|DPM1_ENST00000371583.5_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						AGTGGCAGCTTGTTGCTCTTT	0.632																																					p.L275W		Atlas-SNP	.											.	MOCS3	44	.	0			c.T824G						PASS	.						46.0	51.0	50.0					20																	49576203		2203	4300	6503	SO:0001631	upstream_gene_variant	27304	exon1			GCAGCTTGTTGCT	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		chr20.hg19:g.49576203T>G	Exception_encountered	104.0	0.0	.		120.0	63.0	.	NM_014484	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	hg19	CCDS13434.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.243077	0.58995	.	.	ENSG00000124217	ENST00000244051	T	0.37058	1.22	5.27	5.27	0.74061	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);MoeZ/MoeB (1);	0.229560	0.37483	N	0.002066	T	0.75824	0.3902	H	0.98965	4.385	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.86356	0.1714	9	.	.	.	-5.0901	15.1888	0.73025	0.0:0.0:0.0:1.0	.	275	O95396	MOCS3_HUMAN	W	275	ENSP00000244051:L275W	.	L	+	2	0	MOCS3	49009610	1.000000	0.71417	0.918000	0.36340	0.234000	0.25298	5.437000	0.66544	1.992000	0.58205	0.459000	0.35465	TTG	.	.	.	none		0.632	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859	
ARVCF	421	hgsc.bcm.edu	37	22	19965495	19965495	+	Missense_Mutation	SNP	C	C	G	rs373958610		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr22:19965495C>G	ENST00000263207.3	-	8	1975	c.1684G>C	c.(1684-1686)Gac>Cac	p.D562H	ARVCF_ENST00000406522.1_Missense_Mutation_p.D499H|ARVCF_ENST00000406259.1_Missense_Mutation_p.D562H|ARVCF_ENST00000344269.3_Missense_Mutation_p.D499H|ARVCF_ENST00000401994.1_Missense_Mutation_p.D499H	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	562					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					TTGTCAGTGTCCTTCCGGCCC	0.652																																					p.D562H		Atlas-SNP	.											.	ARVCF	54	.	0			c.G1684C						PASS	.						61.0	50.0	54.0					22																	19965495		2203	4300	6503	SO:0001583	missense	421	exon8			CAGTGTCCTTCCG		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.1684G>C	chr22.hg19:g.19965495C>G	ENSP00000263207:p.Asp562His	77.0	0.0	.		58.0	16.0	.	NM_001670	B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	hg19	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.145373	0.77888	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54	4.03	4.03	0.46877	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88912	0.6566	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.973;0.999	D	0.89030	0.3441	9	.	.	.	-17.2062	17.0615	0.86548	0.0:1.0:0.0:0.0	.	562;84	O00192;E7EV58	ARVC_HUMAN;.	H	562;499;499;499;562	ENSP00000263207:D562H;ENSP00000342042:D499H;ENSP00000384341:D499H;ENSP00000384732:D499H;ENSP00000385444:D562H	.	D	-	1	0	ARVCF	18345495	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	5.569000	0.67391	2.541000	0.85698	0.655000	0.94253	GAC	.	.	.	alt		0.652	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670	
RGPD8	727851	hgsc.bcm.edu	37	2	113158709	113158709	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:113158709delT	ENST00000302558.3	-	12	1934	c.1743delA	c.(1741-1743)aaafs	p.K581fs	RGPD8_ENST00000330575.5_Frame_Shift_Del_p.K581fs|RGPD8_ENST00000409750.1_Frame_Shift_Del_p.K441fs	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	581					protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						TCTGAAGGTATTTTGCCCAAT	0.323																																					p.Y582fs		Atlas-INDEL	.											.	RGPD8	81	.	0			c.1744delT						PASS	.																																			SO:0001589	frameshift_variant	727851	exon12			.	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.1743delA	chr2.hg19:g.113158709delT	ENSP00000306637:p.Lys581fs	360.0	0.0	0		379.0	26.0	0.0686016	NM_001164463	Q5CZA8	Frame_Shift_Del	DEL	ENST00000302558.3	hg19	CCDS46394.1																																																																																			.	.	.	none		0.323	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279	
ZNF200	7752	hgsc.bcm.edu	37	16	3274128	3274128	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:3274128delG	ENST00000431561.3	-	5	1564	c.952delC	c.(952-954)cgtfs	p.R318fs	ZNF200_ENST00000396871.4_Frame_Shift_Del_p.R317fs|ZNF200_ENST00000396870.4_Frame_Shift_Del_p.R317fs|AJ003147.9_ENST00000576468.1_RNA|ZNF200_ENST00000575948.1_Frame_Shift_Del_p.R317fs|ZNF200_ENST00000396868.3_Frame_Shift_Del_p.R317fs|ZNF200_ENST00000414144.2_Frame_Shift_Del_p.R318fs	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						GAATTCTGACGGAAGTTTTTT	0.393																																					p.R318fs		Atlas-INDEL	.											.	ZNF200	36	.	0			c.953delG						PASS	.						110.0	110.0	110.0					16																	3274128		2197	4300	6497	SO:0001589	frameshift_variant	7752	exon5			.	AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.952delC	chr16.hg19:g.3274128delG	ENSP00000395723:p.Arg318fs	186.0	0.0	0		233.0	109.0	0.467811	NM_003454	D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Frame_Shift_Del	DEL	ENST00000431561.3	hg19	CCDS10497.1																																																																																			.	.	.	none		0.393	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000437545.1		
RGPD5	84220	hgsc.bcm.edu	37	2	110582512	110582512	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:110582512delA	ENST00000016946.3	+	12	1898	c.1740delA	c.(1738-1740)gcafs	p.A580fs	RGPD5_ENST00000393283.1_Frame_Shift_Del_p.A580fs|RGPD5_ENST00000272454.6_Frame_Shift_Del_p.A580fs	NM_005054.2	NP_005045.2	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5	580					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)				central_nervous_system(1)	1						TACATTGGGCAAAATACCTTC	0.323																																					p.A580fs		Atlas-INDEL	.											.	RGPD5	1	.	0			c.1739delC						PASS	.						1.0	1.0	1.0					2																	110582512		1	3	4	SO:0001589	frameshift_variant	84220	exon13			.	U64675	CCDS2082.1, CCDS2083.1	2q13	2013-01-10			ENSG00000015568	ENSG00000015568		"""Tetratricopeptide (TTC) repeat domain containing"""	32418	protein-coding gene	gene with protein product		612708				15710750, 15815621	Standard	NM_032260		Approved	RGP5, BS-63, DKFZp686I1842		Q99666	OTTHUMG00000130985	ENST00000016946.3:c.1740delA	chr2.hg19:g.110582512delA	ENSP00000016946:p.Ala580fs	396.0	0.0	0		362.0	26.0	0.0718232	NM_032260	Q53QN2|Q53T03|Q59GM7|Q9H0B2	Frame_Shift_Del	DEL	ENST00000016946.3	hg19	CCDS2082.1																																																																																			.	.	.	none		0.323	RGPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253599.3	NM_005054	
RGPD6	729540	hgsc.bcm.edu	37	2	111304146	111304146	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:111304146delT	ENST00000329516.3	-	12	1819	c.1743delA	c.(1741-1743)aaafs	p.K581fs	RGPD6_ENST00000330331.5_Frame_Shift_Del_p.K581fs	NM_001123363.3	NP_001116835.1	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 6	581					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)											TCTGAAGGTATTTTGCCCAAT	0.323																																					p.Y582fs		Atlas-INDEL	.											.	RGPD5	1	.	0			c.1744delT						PASS	.																																			SO:0001589	frameshift_variant	84220	exon13			.	AK056675	CCDS46388.1, CCDS42729.1	2q13	2013-01-10			ENSG00000183054	ENSG00000183054		"""Tetratricopeptide (TTC) repeat domain containing"""	32419	protein-coding gene	gene with protein product		612709				15710750, 15815621, 9480752	Standard	NM_001037866		Approved	RGP6	uc021vly.1	Q99666	OTTHUMG00000153196	ENST00000329516.3:c.1743delA	chr2.hg19:g.111304146delT	ENSP00000330842:p.Lys581fs	366.0	0.0	0		376.0	27.0	0.0718085	NM_032260	Q53QN2|Q53T03|Q59GM7|Q9H0B2	Frame_Shift_Del	DEL	ENST00000329516.3	hg19	CCDS46388.1																																																																																			.	.	.	none		0.323	RGPD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330029.5	NM_001123363	
TRAPPC9	83696	hgsc.bcm.edu	37	8	141449171	141449172	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr8:141449171_141449172delTT	ENST00000438773.2	-	3	842_843	c.709_710delAA	c.(709-711)aatfs	p.N237fs	TRAPPC9_ENST00000389327.3_Frame_Shift_Del_p.N237fs|TRAPPC9_ENST00000389328.4_Frame_Shift_Del_p.N335fs	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	237					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CAGAAAGTCATTCACAGAACGC	0.525																																					p.335_335del		Atlas-INDEL	.											.	TRAPPC9	114	.	0			c.1004_1005del						PASS	.																																			SO:0001589	frameshift_variant	83696	exon3			.	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.709_710delAA	chr8.hg19:g.141449171_141449172delTT	ENSP00000405060:p.Asn237fs	174.0	0.0	0		160.0	72.0	0.45	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Frame_Shift_Del	DEL	ENST00000438773.2	hg19	CCDS55278.1																																																																																			.	.	.	none		0.525	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
COL5A2	1290	hgsc.bcm.edu	37	2	189898818	189898819	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:189898818_189898819insTT	ENST00000374866.3	-	54	4751_4752	c.4477_4478insAA	c.(4477-4479)attfs	p.I1493fs		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1493	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			AACTGGCCCAATTTCAACGCCG	0.46																																					p.I1493fs		Atlas-INDEL	.											.	COL5A2	230	.	0			c.4478_4479insAA						PASS	.																																			SO:0001589	frameshift_variant	1290	exon54			.	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.4476_4477dupAA	chr2.hg19:g.189898819_189898820dupTT	ENSP00000364000:p.Ile1493fs	66.0	0.0	0		68.0	15.0	0.220588	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Frame_Shift_Ins	INS	ENST00000374866.3	hg19	CCDS33350.1																																																																																			.	.	.	none		0.460	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
CLTB	1212	hgsc.bcm.edu	37	5	175843340	175843342	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr5:175843340_175843342delAGA	ENST00000310418.4	-	1	228_230	c.23_25delTCT	c.(22-27)ttctcg>tcg	p.F8del	CLTB_ENST00000345807.2_In_Frame_Del_p.F8del	NM_007097.3	NP_009028.1	P09497	CLCB_HUMAN	clathrin, light chain B	8					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	ciliary membrane (GO:0060170)|clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|trans-Golgi network (GO:0005802)	peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			lung(1)	1	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		TCCGACGACGAGAAGAAGCCAAA	0.724																																					p.8_9del		Atlas-INDEL	.											.	CLTB	17	.	0			c.24_26del						PASS	.																																			SO:0001651	inframe_deletion	1212	exon1			.	M20470	CCDS4402.1, CCDS4403.1	5q35.2	2010-05-11	2010-05-11		ENSG00000175416	ENSG00000175416			2091	protein-coding gene	gene with protein product		118970	"""clathrin, light polypeptide (Lcb)"""			7713494	Standard	NM_007097		Approved	Lcb	uc003meh.4	P09497	OTTHUMG00000130662	ENST00000310418.4:c.23_25delTCT	chr5.hg19:g.175843343_175843345delAGA	ENSP00000309415:p.Phe8del	71.0	0.0	0		36.0	15.0	0.416667	NM_007097	Q53Y37|Q6FHW1	In_Frame_Del	DEL	ENST00000310418.4	hg19	CCDS4403.1																																																																																			.	.	.	none		0.724	CLTB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253153.1		
PKDREJ	10343	hgsc.bcm.edu	37	22	46655720	46655720	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr22:46655720delG	ENST00000253255.5	-	1	3499	c.3500delC	c.(3499-3501)cctfs	p.P1167fs		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1167					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CACAGGATTAGGGATCACAAT	0.493																																					p.P1167fs		Atlas-INDEL	.											.	PKDREJ	195	.	0			c.3501delT						PASS	.						160.0	152.0	155.0					22																	46655720		2203	4300	6503	SO:0001589	frameshift_variant	10343	exon1			.	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.3500delC	chr22.hg19:g.46655720delG	ENSP00000253255:p.Pro1167fs	208.0	0.0	0		205.0	50.0	0.243902	NM_006071	B1AJY3|O95850	Frame_Shift_Del	DEL	ENST00000253255.5	hg19	CCDS14073.1																																																																																			.	.	.	none		0.493	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
MPP6	51678	hgsc.bcm.edu	37	7	24727063	24727075	+	Frame_Shift_Del	DEL	GACTTGAAGAAAA	GACTTGAAGAAAA	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	GACTTGAAGAAAA	GACTTGAAGAAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr7:24727063_24727075delGACTTGAAGAAAA	ENST00000222644.5	+	12	1703_1715	c.1453_1465delGACTTGAAGAAAA	c.(1453-1467)gacttgaagaaaacafs	p.DLKKT485fs	MPP6_ENST00000409761.1_Frame_Shift_Del_p.DLKKT373fs|MPP6_ENST00000396475.2_Frame_Shift_Del_p.DLKKT485fs			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						ACAGGACTCTGACTTGAAGAAAACAGTGGATGA	0.324																																					p.484_488del		Atlas-INDEL	.											.	MPP6	62	.	0			c.1452_1464del						PASS	.																																			SO:0001589	frameshift_variant	51678	exon13			.	AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.1453_1465delGACTTGAAGAAAA	chr7.hg19:g.24727063_24727075delGACTTGAAGAAAA	ENSP00000222644:p.Asp485fs	130.0	0.0	0		142.0	50.0	0.352113	NM_016447	B2RAF0	Frame_Shift_Del	DEL	ENST00000222644.5	hg19	CCDS5388.1																																																																																			.	.	.	none		0.324	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250272.4		
MAT2B	27430	hgsc.bcm.edu	37	5	162940576	162940577	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr5:162940576_162940577insA	ENST00000321757.6	+	3	413_414	c.274_275insA	c.(274-276)catfs	p.H92fs	MAT2B_ENST00000280969.5_Frame_Shift_Ins_p.H81fs|MAT2B_ENST00000518095.1_Frame_Shift_Ins_p.H92fs	NM_013283.3	NP_037415.1	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta	92					cellular nitrogen compound metabolic process (GO:0034641)|extracellular polysaccharide biosynthetic process (GO:0045226)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|regulation of catalytic activity (GO:0050790)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|methionine adenosyltransferase complex (GO:0048269)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dTDP-4-dehydrorhamnose reductase activity (GO:0008831)|enzyme binding (GO:0019899)|methionine adenosyltransferase regulator activity (GO:0048270)			endometrium(3)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	14	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)	TGTTATAGTACATTGTGCAGCA	0.371																																					p.H92fs		Atlas-INDEL	.											.	MAT2B	42	.	0			c.274_275insA						PASS	.																																			SO:0001589	frameshift_variant	27430	exon3			.	AF182814	CCDS4364.1, CCDS4365.1	5q34-q35	2011-09-14			ENSG00000038274	ENSG00000038274		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	6905	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 23E, member 1"""	605527				9055605, 10644686, 19027726	Standard	NM_182796		Approved	MATIIbeta, SDR23E1	uc003lzk.4	Q9NZL9	OTTHUMG00000130379	ENST00000321757.6:c.275dupA	chr5.hg19:g.162940577_162940577dupA	ENSP00000325425:p.His92fs	155.0	0.0	0		104.0	37.0	0.355769	NM_013283	B2R5Y6|Q1WAI7|Q27J92|Q3LIE8|Q567T7|Q6NYC7|Q9BS89|Q9H3E1|Q9UJ54	Frame_Shift_Ins	INS	ENST00000321757.6	hg19	CCDS4365.1																																																																																			.	.	.	none		0.371	MAT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252749.2	NM_013283	
ANKZF1	55139	hgsc.bcm.edu	37	2	220099806	220099806	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr2:220099806delC	ENST00000323348.5	+	10	1637	c.1463delC	c.(1462-1464)gccfs	p.A488fs	GLB1L_ENST00000497855.1_5'Flank|ANKZF1_ENST00000410034.3_Frame_Shift_Del_p.A488fs|ANKZF1_ENST00000409849.1_Frame_Shift_Del_p.A278fs	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	488						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGGCCAAAGCCCCTGGTCAG	0.587																																					p.A488fs		Atlas-INDEL	.											.	ANKZF1	45	.	0			c.1462delG						PASS	.						49.0	53.0	51.0					2																	220099806		1987	4163	6150	SO:0001589	frameshift_variant	55139	exon10			.	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1463delC	chr2.hg19:g.220099806delC	ENSP00000321617:p.Ala488fs	83.0	0.0	0		70.0	20.0	0.285714	NM_018089	Q9NVZ4	Frame_Shift_Del	DEL	ENST00000323348.5	hg19	CCDS42821.1																																																																																			.	.	.	none		0.587	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335790.1	NM_018089	
DENND5A	23258	hgsc.bcm.edu	37	11	9173965	9173965	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr11:9173965delG	ENST00000328194.3	-	13	2781	c.2461delC	c.(2461-2463)ctgfs	p.L822fs	DENND5A_ENST00000527700.1_Frame_Shift_Del_p.L165fs|DENND5A_ENST00000530044.1_Frame_Shift_Del_p.L822fs	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	822	RUN 1. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TAATGTAACAGGTGGGACCAT	0.473																																					p.L821fs		Atlas-INDEL	.											.	DENND5A	84	.	0			c.2462delT						PASS	.						268.0	217.0	234.0					11																	9173965		2201	4296	6497	SO:0001589	frameshift_variant	23258	exon13			.	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.2461delC	chr11.hg19:g.9173965delG	ENSP00000328524:p.Leu822fs	169.0	0.0	0		188.0	58.0	0.308511	NM_001243254	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Frame_Shift_Del	DEL	ENST00000328194.3	hg19	CCDS31423.1																																																																																			.	.	.	none		0.473	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
RLIM	51132	hgsc.bcm.edu	37	X	73815805	73815805	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chrX:73815805delT	ENST00000332687.6	-	2	226	c.8delA	c.(7-9)aacfs	p.N3fs	RLIM_ENST00000349225.2_Frame_Shift_Del_p.N3fs	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	3					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGAATCTGAGTTTTCCATATT	0.358																																					p.N3fs	Esophageal Squamous(169;1899 1923 14997 18818 32118)	Atlas-INDEL	.											.	RLIM	90	.	0			c.9delC						PASS	.						53.0	49.0	50.0					X																	73815805		2203	4300	6503	SO:0001589	frameshift_variant	51132	exon3			.	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.8delA	chrX.hg19:g.73815805delT	ENSP00000328059:p.Asn3fs	87.0	0.0	0		69.0	31.0	0.449275	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Frame_Shift_Del	DEL	ENST00000332687.6	hg19	CCDS14427.1																																																																																			.	.	.	none		0.358	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
BAIAP3	8938	hgsc.bcm.edu	37	16	1398015	1398021	+	Splice_Site	DEL	ACTTGTG	ACTTGTG	-	rs112608838		TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	ACTTGTG	ACTTGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr16:1398015_1398021delACTTGTG	ENST00000324385.5	+	32	3409_3412	c.3251_3254delACTTGTG	c.(3250-3255)tacttg>tg	p.YL1084fs	BAIAP3_ENST00000426824.3_Splice_Site_p.YL1049fs|BAIAP3_ENST00000397489.1_Splice_Site_p.YL1066fs|BAIAP3_ENST00000421665.2_Splice_Site_p.YL1013fs|BAIAP3_ENST00000562208.1_Splice_Site_p.YL1026fs|BAIAP3_ENST00000568887.1_Splice_Site_p.YL1021fs|BAIAP3_ENST00000397488.2_Splice_Site_p.YL1066fs	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	1084	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				GAACTCTTCTACTTGTGAGTGTCCTAa	0.657																																					p.1084_1085del		Atlas-INDEL	.											.	BAIAP3	88	.	0			c.3250_3254del						PASS	.																																			SO:0001630	splice_region_variant	8938	exon32			.	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.3254+1ACTTGTG>-	chr16.hg19:g.1398015_1398021delACTTGTG		120.0	0.0	0		115.0	43.0	0.373913	NM_003933	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Frame_Shift_Del	DEL	ENST00000324385.5	hg19	CCDS10434.1																																																																																			.	.	.	none		0.657	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3		Frame_Shift_Del
ABCC2	1244	hgsc.bcm.edu	37	10	101606844	101606844	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:101606844delG	ENST00000370449.4	+	30	4386	c.4273delG	c.(4273-4275)gggfs	p.G1425fs		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1425	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.G1425W(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CCTGCAACTTGGGTTATCCCA	0.537																																					p.L1424fs		Atlas-INDEL	.											.	ABCC2	160	.	1	Substitution - Missense(1)	lung(1)	c.4272delT						PASS	.						104.0	97.0	99.0					10																	101606844		2203	4300	6503	SO:0001589	frameshift_variant	1244	exon30			.	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.4273delG	chr10.hg19:g.101606844delG	ENSP00000359478:p.Gly1425fs	197.0	0.0	0		150.0	101.0	0.673333	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Frame_Shift_Del	DEL	ENST00000370449.4	hg19	CCDS7484.1																																																																																			.	.	.	none		0.537	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
PTEN	5728	hgsc.bcm.edu	37	10	89717645	89717646	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:89717645_89717646delAT	ENST00000371953.3	+	7	2027_2028	c.670_671delAT	c.(670-672)atafs	p.I224fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	224	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAAGGTGAAGATATATTCCTCC	0.421		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.223_224del		Atlas-INDEL	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN	3652	.	48	Whole gene deletion(37)|Deletion - Frameshift(9)|Deletion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(10)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)	c.669_670del						PASS	.																																			SO:0001589	frameshift_variant	5728	exon7	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.670_671delAT	chr10.hg19:g.89717649_89717650delAT	ENSP00000361021:p.Ile224fs	162.0	0.0	0		150.0	84.0	0.56	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	ENST00000371953.3	hg19	CCDS31238.1																																																																																			.	.	.	none		0.421	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
FAM72A	729533	hgsc.bcm.edu	37	1	206139310	206139310	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr1:206139310delT	ENST00000367128.3	+	1	854	c.6delT	c.(4-6)tctfs	p.S2fs	FAM72A_ENST00000367129.2_Intron|FAM72A_ENST00000341209.5_Frame_Shift_Del_p.S2fs|FAM72A_ENST00000470041.1_Intron|RP11-312O7.2_ENST00000606644.1_RNA|FAM72A_ENST00000607379.1_Frame_Shift_Del_p.S2fs|RP11-312O7.2_ENST00000429210.1_RNA			Q5TYM5	FA72A_HUMAN	family with sequence similarity 72, member A	2						mitochondrion (GO:0005739)				endometrium(2)	2						ACGCCATGTCTACCAACATTT	0.438																																					p.S2fs		Atlas-INDEL	.											.	FAM72A	9	.	0			c.5delC						PASS	.						1.0	1.0	1.0					1																	206139310		212	579	791	SO:0001589	frameshift_variant	729533	exon1			.	CR407567	CCDS73016.1	1q32.1	2008-03-26			ENSG00000196550	ENSG00000196550			24044	protein-coding gene	gene with protein product		614710				12477932	Standard	NM_001123168		Approved	MGC57827, RP11-312O7.1	uc001hdr.4	Q5TYM5	OTTHUMG00000042552	ENST00000367128.3:c.6delT	chr1.hg19:g.206139310delT	ENSP00000356096:p.Ser2fs	401.0	0.0	0		359.0	47.0	0.130919	NM_001123168	B2RV15|Q5TYM4	Frame_Shift_Del	DEL	ENST00000367128.3	hg19	CCDS41458.1																																																																																			.	.	.	none		0.438	FAM72A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100825.1		
MMP21	118856	hgsc.bcm.edu	37	10	127455343	127455343	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr10:127455343delT	ENST00000368808.3	-	7	1597	c.1598delA	c.(1597-1599)aagfs	p.K533fs		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	533					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	TTGTTTGTCCTTGTCATTAAC	0.363																																					p.K533fs		Atlas-INDEL	.											.	MMP21	46	.	0			c.1599delG						PASS	.						131.0	131.0	131.0					10																	127455343		2203	4300	6503	SO:0001589	frameshift_variant	118856	exon7			.	AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.1598delA	chr10.hg19:g.127455343delT	ENSP00000357798:p.Lys533fs	138.0	0.0	0		119.0	63.0	0.529412	NM_147191	Q5VZP9|Q8NG02	Frame_Shift_Del	DEL	ENST00000368808.3	hg19	CCDS7647.1																																																																																			.	.	.	none		0.363	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050928.1		
ZMIZ2	83637	hgsc.bcm.edu	37	7	44807159	44807159	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr7:44807159delG	ENST00000309315.4	+	19	2823	c.2700delG	c.(2698-2700)ttgfs	p.L900fs	ZMIZ2_ENST00000413916.1_Frame_Shift_Del_p.L842fs|ZMIZ2_ENST00000441627.1_Frame_Shift_Del_p.L900fs|ZMIZ2_ENST00000463931.1_3'UTR|ZMIZ2_ENST00000265346.7_Frame_Shift_Del_p.L874fs|ZMIZ2_ENST00000433667.1_Frame_Shift_Del_p.L868fs	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	900	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TGTCCTACTTGGGCCCACCCG	0.552																																					p.L900fs	NSCLC(20;604 852 1948 16908 50522)	Atlas-INDEL	.											.	ZMIZ2	82	.	0			c.2699delT						PASS	.						145.0	159.0	155.0					7																	44807159		2045	4190	6235	SO:0001589	frameshift_variant	83637	exon19			.	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.2700delG	chr7.hg19:g.44807159delG	ENSP00000311778:p.Leu900fs	118.0	0.0	0		122.0	24.0	0.196721	NM_031449	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Frame_Shift_Del	DEL	ENST00000309315.4	hg19	CCDS43576.1																																																																																			.	.	.	none		0.552	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
TRAF4	9618	hgsc.bcm.edu	37	17	27074242	27074243	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A4-7996-01A-11D-2201-08	TCGA-A4-7996-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8cf8d4b0-1532-48a1-ac95-242f1fc0a867	5b059d3b-661d-4e07-b668-c140b421ade8	g.chr17:27074242_27074243insC	ENST00000262395.5	+	2	284_285	c.155_156insC	c.(154-159)ttcaagfs	p.K53fs	TRAF4_ENST00000262396.6_Frame_Shift_Ins_p.K53fs|AC010761.10_ENST00000579468.1_RNA|TRAF4_ENST00000444415.3_Frame_Shift_Ins_p.K53fs|AC010761.9_ENST00000577325.1_RNA	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	53					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			GAAGGAGTCTTCAAGTGCCCTG	0.594																																					p.F52fs		Atlas-INDEL	.											.	TRAF4	20	.	0			c.155_156insC						PASS	.																																			SO:0001589	frameshift_variant	9618	exon2			.	X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.156dupC	chr17.hg19:g.27074243_27074243dupC	ENSP00000262395:p.Lys53fs	184.0	0.0	0		158.0	82.0	0.518987	NM_004295	O75615|Q14848|Q2KJU4|Q2PJN8	Frame_Shift_Ins	INS	ENST00000262395.5	hg19	CCDS11243.1																																																																																			.	.	.	none		0.594	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255944.2	NM_145751	
