#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RERE	473	hgsc.bcm.edu	37	1	8422892	8422892	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:8422892G>T	ENST00000337907.3	-	17	2387	c.1753C>A	c.(1753-1755)Cgc>Agc	p.R585S	RERE_ENST00000377464.1_Missense_Mutation_p.R317S|RERE_ENST00000476556.1_Missense_Mutation_p.R31S|RERE_ENST00000400908.2_Missense_Mutation_p.R585S|RERE_ENST00000400907.2_Intron	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	585					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CGACCACTGCGTAGTGTCGAC	0.617																																					p.R585S		Atlas-SNP	.											.	RERE	129	.	0			c.C1753A						PASS	.						95.0	83.0	87.0					1																	8422892		2203	4300	6503	SO:0001583	missense	473	exon17			CACTGCGTAGTGT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1753C>A	chr1.hg19:g.8422892G>T	ENSP00000338629:p.Arg585Ser	120.0	0.0	.		92.0	29.0	.	NM_012102	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	hg19	CCDS95.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444981	0.83993	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908;ENST00000505225	T;T;T;T	0.05025	3.51;3.51;3.51;3.51	5.8	5.8	0.92144	.	.	.	.	.	T	0.21509	0.0518	M	0.67953	2.075	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.07481	-1.0770	9	0.06891	T	0.86	-30.1132	19.0501	0.93039	0.0:0.0:1.0:0.0	.	317;585	B1AKN3;Q9P2R6	.;RERE_HUMAN	S	585;317;31;585;5	ENSP00000338629:R585S;ENSP00000366684:R317S;ENSP00000422246:R31S;ENSP00000383700:R585S	ENSP00000338629:R585S	R	-	1	0	RERE	8345479	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.407000	0.97325	2.730000	0.93505	0.563000	0.77884	CGC	.	.	.	none		0.617	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
MAST2	23139	hgsc.bcm.edu	37	1	46290209	46290209	+	Silent	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:46290209T>C	ENST00000361297.2	+	2	565	c.282T>C	c.(280-282)gaT>gaC	p.D94D	MAST2_ENST00000372009.2_Silent_p.D94D	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					TGAGTCAGGATGATTGTAAGT	0.398																																					p.D94D		Atlas-SNP	.											.	MAST2	136	.	0			c.T282C						PASS	.						166.0	149.0	154.0					1																	46290209		1856	4094	5950	SO:0001819	synonymous_variant	23139	exon2			TCAGGATGATTGT	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.282T>C	chr1.hg19:g.46290209T>C		282.0	0.0	.		265.0	88.0	.	NM_015112		Silent	SNP	ENST00000361297.2	hg19	CCDS41326.1																																																																																			.	.	.	none		0.398	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
WDR3	10885	hgsc.bcm.edu	37	1	118502024	118502024	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:118502024A>G	ENST00000349139.5	+	27	2833	c.2786A>G	c.(2785-2787)aAg>aGg	p.K929R	SPAG17_ENST00000336338.5_Intron	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	929						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		GAAGagaagaagaggaagagg	0.378																																					p.K929R		Atlas-SNP	.											.	WDR3	81	.	0			c.A2786G						PASS	.						70.0	77.0	74.0					1																	118502024		2203	4300	6503	SO:0001583	missense	10885	exon27			AGAAGAAGAGGAA	AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.2786A>G	chr1.hg19:g.118502024A>G	ENSP00000308179:p.Lys929Arg	50.0	0.0	.		66.0	24.0	.	NM_006784		Missense_Mutation	SNP	ENST00000349139.5	hg19	CCDS898.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.502821	0.44558	.	.	ENSG00000065183	ENST00000349139	T	0.54479	0.57	5.47	4.35	0.52113	.	0.188191	0.56097	D	0.000032	T	0.15782	0.0380	N	0.08118	0	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.06734	-1.0810	10	0.28530	T	0.3	-11.5094	10.512	0.44868	0.9233:0.0:0.0767:0.0	.	929	Q9UNX4	WDR3_HUMAN	R	929	ENSP00000308179:K929R	ENSP00000308179:K929R	K	+	2	0	WDR3	118303547	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.417000	0.44653	2.091000	0.63221	0.496000	0.49642	AAG	.	.	.	none		0.378	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033720.2	NM_006784	
ASH1L	55870	hgsc.bcm.edu	37	1	155491175	155491175	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:155491175C>T	ENST00000368346.3	-	2	775	c.136G>A	c.(136-138)Gaa>Aaa	p.E46K	ASH1L_ENST00000548830.1_Missense_Mutation_p.E46K|ASH1L_ENST00000392403.3_Missense_Mutation_p.E46K			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	46					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AGGTCCTCTTCCTCCTTTGTG	0.418																																					p.E46K		Atlas-SNP	.											.	ASH1L	279	.	0			c.G136A						PASS	.						302.0	301.0	301.0					1																	155491175		2203	4300	6503	SO:0001583	missense	55870	exon2			CCTCTTCCTCCTT	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.136G>A	chr1.hg19:g.155491175C>T	ENSP00000357330:p.Glu46Lys	518.0	0.0	.		495.0	164.0	.	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.771812	0.96922	.	.	ENSG00000116539	ENST00000368346;ENST00000392403;ENST00000548830	D;D	0.89875	-2.58;-2.58	5.51	5.51	0.81932	.	0.134693	0.48286	N	0.000192	T	0.73776	0.3630	N	0.08118	0	0.46874	D	0.999234	B;B	0.30281	0.18;0.275	B;B	0.28232	0.04;0.087	T	0.76487	-0.2941	10	0.72032	D	0.01	.	19.2027	0.93717	0.0:1.0:0.0:0.0	.	46;46	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	K	46	ENSP00000357330:E46K;ENSP00000376204:E46K	ENSP00000357330:E46K	E	-	1	0	ASH1L	153757799	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.059000	0.76684	2.868000	0.98415	0.557000	0.71058	GAA	.	.	.	none		0.418	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
SLC41A1	254428	hgsc.bcm.edu	37	1	205770146	205770146	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:205770146C>T	ENST00000367137.3	-	3	1429	c.415G>A	c.(415-417)Gtg>Atg	p.V139M	SLC41A1_ENST00000468057.1_5'UTR	NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	139					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			AGCGCAGGCACTAGGATGAAG	0.562																																					p.V139M		Atlas-SNP	.											.	SLC41A1	46	.	0			c.G415A						PASS	.						109.0	105.0	106.0					1																	205770146		2203	4300	6503	SO:0001583	missense	254428	exon3			CAGGCACTAGGAT	AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.415G>A	chr1.hg19:g.205770146C>T	ENSP00000356105:p.Val139Met	151.0	0.0	.		133.0	39.0	.	NM_173854	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	ENST00000367137.3	hg19	CCDS30988.1	.	.	.	.	.	.	.	.	.	.	C	32	5.182269	0.94885	.	.	ENSG00000133065	ENST00000367137	T	0.29917	1.55	5.78	5.78	0.91487	MgtE magnesium transporter, integral membrane (1);	0.000000	0.85682	D	0.000000	T	0.68091	0.2963	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73538	-0.3951	10	0.51188	T	0.08	-13.616	19.9618	0.97254	0.0:1.0:0.0:0.0	.	139	Q8IVJ1	S41A1_HUMAN	M	139	ENSP00000356105:V139M	ENSP00000356105:V139M	V	-	1	0	SLC41A1	204036769	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.768000	0.85345	2.894000	0.99253	0.655000	0.94253	GTG	.	.	.	none		0.562	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087731.1		
PIGR	5284	hgsc.bcm.edu	37	1	207109097	207109097	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:207109097C>T	ENST00000356495.4	-	5	1295	c.1112G>A	c.(1111-1113)tGc>tAc	p.C371Y		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	371	Ig-like V-type 4.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTTGTAGGGGCAGAGCACGGC	0.622											OREG0014186	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C371Y		Atlas-SNP	.											.	PIGR	98	.	0			c.G1112A						PASS	.						33.0	37.0	36.0					1																	207109097		2203	4300	6503	SO:0001583	missense	5284	exon5			TAGGGGCAGAGCA		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1112G>A	chr1.hg19:g.207109097C>T	ENSP00000348888:p.Cys371Tyr	41.0	0.0	.	2165	43.0	17.0	.	NM_002644	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	hg19	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956538	0.53293	.	.	ENSG00000162896	ENST00000356495	T	0.40476	1.03	5.55	5.55	0.83447	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.75882	0.3910	H	0.96518	3.835	0.53005	D	0.999964	D	0.89917	1.0	D	0.97110	1.0	D	0.83757	0.0212	10	0.87932	D	0	-23.806	16.2203	0.82255	0.0:1.0:0.0:0.0	.	371	P01833	PIGR_HUMAN	Y	371	ENSP00000348888:C371Y	ENSP00000348888:C371Y	C	-	2	0	PIGR	205175720	1.000000	0.71417	0.930000	0.37139	0.097000	0.18754	4.383000	0.59600	2.614000	0.88457	0.655000	0.94253	TGC	.	.	.	none		0.622	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
IRF6	3664	hgsc.bcm.edu	37	1	209974723	209974723	+	Silent	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:209974723G>A	ENST00000367021.3	-	3	208	c.36C>T	c.(34-36)ccC>ccT	p.P12P	IRF6_ENST00000542854.1_Intron	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	12					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		CCACCAGCCAGGGCTTTAGCC	0.607										HNSCC(57;0.16)																											p.P12P		Atlas-SNP	.											.	IRF6	65	.	0			c.C36T						PASS	.						55.0	63.0	60.0					1																	209974723		2202	4300	6502	SO:0001819	synonymous_variant	3664	exon3			CAGCCAGGGCTTT	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.36C>T	chr1.hg19:g.209974723G>A		161.0	0.0	.		151.0	46.0	.	NM_006147	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Silent	SNP	ENST00000367021.3	hg19	CCDS1492.1																																																																																			.	.	.	none		0.607	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147	
EXOC8	149371	hgsc.bcm.edu	37	1	231472205	231472205	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:231472205C>A	ENST00000360394.2	-	1	1373	c.1287G>T	c.(1285-1287)gaG>gaT	p.E429D	SPRTN_ENST00000008440.9_5'Flank|SPRTN_ENST00000391858.4_5'Flank|SPRTN_ENST00000295050.7_5'Flank|EXOC8_ENST00000366645.1_Missense_Mutation_p.E425D	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	429					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				TCAAAAATAGCTCACAGGCCT	0.527																																					p.E429D		Atlas-SNP	.											.	EXOC8	42	.	0			c.G1287T						PASS	.						48.0	49.0	49.0					1																	231472205		2203	4300	6503	SO:0001583	missense	149371	exon1			AAATAGCTCACAG	AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.1287G>T	chr1.hg19:g.231472205C>A	ENSP00000353564:p.Glu429Asp	95.0	0.0	.		86.0	18.0	.	NM_175876	B3KU33|Q5TE82	Missense_Mutation	SNP	ENST00000360394.2	hg19	CCDS1593.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657151	0.29425	.	.	ENSG00000116903	ENST00000360394;ENST00000366645	T;T	0.77098	-1.07;-1.07	5.97	5.05	0.67936	Cullin repeat-like-containing domain (1);	0.052227	0.85682	D	0.000000	T	0.67297	0.2878	L	0.31526	0.94	0.58432	D	0.999998	P	0.45957	0.869	B	0.43754	0.43	T	0.62431	-0.6856	10	0.15066	T	0.55	-29.5152	12.807	0.57619	0.0:0.8715:0.0:0.1285	.	429	Q8IYI6	EXOC8_HUMAN	D	429;425	ENSP00000353564:E429D;ENSP00000355605:E425D	ENSP00000353564:E429D	E	-	3	2	EXOC8	229538828	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.827000	0.55745	2.837000	0.97791	0.655000	0.94253	GAG	.	.	.	none		0.527	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_175876	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234744251	234744251	+	Silent	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr1:234744251G>T	ENST00000366609.3	-	1	1020	c.990C>A	c.(988-990)gcC>gcA	p.A330A	IRF2BP2_ENST00000491430.1_5'Flank|IRF2BP2_ENST00000366610.3_Silent_p.A330A|RP4-781K5.2_ENST00000436039.1_RNA	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CTGCAGTCAGGGCCGGCTCCT	0.637																																					p.A330A		Atlas-SNP	.											.	IRF2BP2	37	.	0			c.C990A						PASS	.						22.0	21.0	21.0					1																	234744251		2201	4300	6501	SO:0001819	synonymous_variant	359948	exon1			AGTCAGGGCCGGC	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.990C>A	chr1.hg19:g.234744251G>T		36.0	0.0	.		39.0	15.0	.	NM_182972	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	hg19	CCDS1602.1																																																																																			.	.	.	none		0.637	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
OTOF	9381	hgsc.bcm.edu	37	2	26700635	26700635	+	Intron	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr2:26700635G>C	ENST00000272371.2	-	19	2341				OTOF_ENST00000403946.3_Intron|OTOF_ENST00000338581.6_Intron|OTOF_ENST00000339598.3_Intron|OTOF_ENST00000402415.3_Missense_Mutation_p.H43D	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin						membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAGGAGTGTGGGTGATGCTG	0.602																																					p.H43D	GBM(102;732 1451 20652 24062 31372)	Atlas-SNP	.											.	OTOF	524	.	0			c.C127G						PASS	.						53.0	41.0	45.0					2																	26700635		2194	4294	6488	SO:0001627	intron_variant	9381	exon1			GAGTGTGGGTGAT	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2215-18C>G	chr2.hg19:g.26700635G>C		43.0	0.0	.		36.0	16.0	.	NM_194322	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	hg19	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	G	7.354	0.623380	0.14193	.	.	ENSG00000115155	ENST00000402415	T	0.76709	-1.04	3.28	-1.12	0.09808	.	.	.	.	.	T	0.59307	0.2184	.	.	.	0.09310	N	1	B	0.15473	0.013	B	0.16289	0.015	T	0.36138	-0.9760	7	.	.	.	.	6.8786	0.24160	0.2752:0.1313:0.5935:0.0	.	43	Q9HC10-3	.	D	43	ENSP00000383906:H43D	.	H	-	1	0	OTOF	26554139	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.033000	0.13754	-0.801000	0.04427	-1.268000	0.01426	CAC	.	.	.	none		0.602	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
C2orf73	129852	hgsc.bcm.edu	37	2	54587528	54587528	+	Silent	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr2:54587528G>T	ENST00000398634.2	+	5	735	c.693G>T	c.(691-693)ctG>ctT	p.L231L	C2orf73_ENST00000405749.1_Intron|C2orf73_ENST00000491538.1_Intron	NM_001100396.1	NP_001093866.1	Q8N5S3	CB073_HUMAN	chromosome 2 open reading frame 73	231										breast(2)	2						CTCAGGAGCTGTTAGAGCCTA	0.493																																					p.L231L		Atlas-SNP	.											.	C2orf73	17	.	0			c.G693T						PASS	.						35.0	34.0	35.0					2																	54587528		1907	4128	6035	SO:0001819	synonymous_variant	129852	exon5			GGAGCTGTTAGAG	BC031669, AK097617	CCDS46285.1	2p16.2	2008-07-07			ENSG00000177994	ENSG00000177994			26861	protein-coding gene	gene with protein product						14702039	Standard	NM_001100396		Approved	FLJ40298	uc002rxt.1	Q8N5S3	OTTHUMG00000151826	ENST00000398634.2:c.693G>T	chr2.hg19:g.54587528G>T		19.0	0.0	.		31.0	8.0	.	NM_001100396	A0AV79|A0AV81|Q8N7V4	Silent	SNP	ENST00000398634.2	hg19	CCDS46285.1																																																																																			.	.	.	none		0.493	C2orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324075.2	NM_001100396	
ZAP70	7535	hgsc.bcm.edu	37	2	98341626	98341626	+	Missense_Mutation	SNP	C	C	A	rs56404668	byFrequency	TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr2:98341626C>A	ENST00000264972.5	+	4	689	c.474C>A	c.(472-474)caC>caA	p.H158Q	ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.H32Q	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	158	Interdomain A.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CGACGGCCCACGAGCGGATGC	0.637																																					p.H158Q		Atlas-SNP	.											.	ZAP70	77	.	0			c.C474A						PASS	.						48.0	43.0	45.0					2																	98341626		2203	4300	6503	SO:0001583	missense	7535	exon4			GGCCCACGAGCGG	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.474C>A	chr2.hg19:g.98341626C>A	ENSP00000264972:p.His158Gln	82.0	0.0	.		75.0	36.0	.	NM_001079	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	hg19	CCDS33254.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642553	0.67244	.	.	ENSG00000115085	ENST00000264972;ENST00000442208	D;D	0.92858	-3.12;-3.12	5.37	1.01	0.19927	SH2 motif (1);	0.000000	0.50627	D	0.000112	D	0.93262	0.7853	L	0.58810	1.83	0.51012	D	0.999903	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	D	0.90788	0.4684	10	0.62326	D	0.03	.	6.7946	0.23719	0.0:0.491:0.0:0.509	.	158;32;158	B4E0E2;P43403-3;P43403	.;.;ZAP70_HUMAN	Q	158;32	ENSP00000264972:H158Q;ENSP00000411141:H32Q	ENSP00000264972:H158Q	H	+	3	2	ZAP70	97708058	0.004000	0.15560	1.000000	0.80357	0.763000	0.43281	-1.323000	0.02692	0.354000	0.24105	-0.216000	0.12614	CAC	.	C|0.998;T|0.002	.	alt		0.637	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1		
SUMF1	285362	hgsc.bcm.edu	37	3	4490972	4490972	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:4490972A>C	ENST00000272902.5	-	3	532	c.497T>G	c.(496-498)gTg>gGg	p.V166G	SUMF1_ENST00000405420.2_Missense_Mutation_p.V166G|SUMF1_ENST00000458465.2_Intron|SUMF1_ENST00000383843.5_Intron|SUMF1_ENST00000534863.1_Missense_Mutation_p.V166G	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1	166					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		ATTGGTCTTCACTTGCTCACT	0.393																																					p.V166G		Atlas-SNP	.											.	SUMF1	23	.	0			c.T497G						PASS	.						172.0	171.0	171.0					3																	4490972		2203	4300	6503	SO:0001583	missense	285362	exon3			GTCTTCACTTGCT	BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.497T>G	chr3.hg19:g.4490972A>C	ENSP00000272902:p.Val166Gly	235.0	0.0	.		260.0	84.0	.	NM_001164675	B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Missense_Mutation	SNP	ENST00000272902.5	hg19	CCDS2564.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002331	0.74932	.	.	ENSG00000144455	ENST00000534982;ENST00000534863;ENST00000272902;ENST00000405420	D;D;D	0.97553	-4.43;-4.43;-4.43	5.53	5.53	0.82687	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.000000	0.85682	D	0.000000	D	0.97002	0.9021	L	0.41824	1.3	0.80722	D	1	D;P	0.67145	0.996;0.541	D;P	0.65684	0.937;0.566	D	0.96392	0.9290	10	0.32370	T	0.25	-14.8274	14.671	0.68945	1.0:0.0:0.0:0.0	.	166;166	E9PGL0;Q8NBK3	.;SUMF1_HUMAN	G	166	ENSP00000440421:V166G;ENSP00000272902:V166G;ENSP00000384977:V166G	ENSP00000272902:V166G	V	-	2	0	SUMF1	4465972	1.000000	0.71417	0.989000	0.46669	0.926000	0.56050	7.392000	0.79840	2.100000	0.63781	0.533000	0.62120	GTG	.	.	.	none		0.393	SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206591.2	NM_182760	
ANO10	55129	hgsc.bcm.edu	37	3	43618738	43618738	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:43618738T>A	ENST00000292246.3	-	6	778	c.608A>T	c.(607-609)tAc>tTc	p.Y203F	ANO10_ENST00000396091.3_Missense_Mutation_p.Y137F|ANO10_ENST00000414522.2_Missense_Mutation_p.Y203F|ANO10_ENST00000350459.4_Intron|ANO10_ENST00000451430.2_Missense_Mutation_p.Y92F	NM_018075.3	NP_060545.3	Q9NW15	ANO10_HUMAN	anoctamin 10	203					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell death (GO:0008219)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(3)|skin(3)	29						TTCCCCAAAGTAGCCACGAAT	0.343																																					p.Y203F		Atlas-SNP	.											.	ANO10	70	.	0			c.A608T						PASS	.						20.0	22.0	21.0					3																	43618738		2189	4296	6485	SO:0001583	missense	55129	exon6			CCAAAGTAGCCAC	AL832508	CCDS2710.2, CCDS56247.1, CCDS56248.1, CCDS56249.1, CCDS56250.1	3p22.1-p21.33	2014-04-09	2008-08-28	2008-08-28	ENSG00000160746	ENSG00000160746		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25519	protein-coding gene	gene with protein product		613726	"""transmembrane protein 16K"""	TMEM16K		12477932, 24692353	Standard	NM_001204831		Approved	FLJ10375, MGC47890, SCAR10	uc003cmv.3	Q9NW15	OTTHUMG00000133044	ENST00000292246.3:c.608A>T	chr3.hg19:g.43618738T>A	ENSP00000292246:p.Tyr203Phe	42.0	0.0	.		51.0	18.0	.	NM_018075	A8K8K3|A8MV74|B3KTZ1|B3KY93|B4DJ83|B4DNK2|B7WP12|C9JHS1|Q8IXX9	Missense_Mutation	SNP	ENST00000292246.3	hg19	CCDS2710.2	.	.	.	.	.	.	.	.	.	.	T	24.3	4.511689	0.85389	.	.	ENSG00000160746	ENST00000292246;ENST00000396091;ENST00000414522;ENST00000451430;ENST00000428472	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.87577	0.6212	M	0.91354	3.2	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.90259	0.4299	10	0.87932	D	0	.	16.3127	0.82898	0.0:0.0:0.0:1.0	.	92;203;137;203	Q9NW15-4;C9JHS1;Q9NW15-3;Q9NW15	.;.;.;ANO10_HUMAN	F	203;137;203;92;92	ENSP00000292246:Y203F;ENSP00000379398:Y137F;ENSP00000396990:Y203F;ENSP00000394119:Y92F;ENSP00000416266:Y92F	ENSP00000292246:Y203F	Y	-	2	0	ANO10	43593742	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	8.040000	0.89188	2.246000	0.74042	0.533000	0.62120	TAC	.	.	.	none		0.343	ANO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256649.2	NM_018075	
ARHGEF3	50650	hgsc.bcm.edu	37	3	56787577	56787577	+	Silent	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:56787577G>C	ENST00000296315.3	-	4	561	c.393C>G	c.(391-393)tcC>tcG	p.S131S	ARHGEF3_ENST00000498517.1_5'UTR|ARHGEF3_ENST00000413728.2_Silent_p.S137S|ARHGEF3_ENST00000338458.4_Silent_p.S163S|ARHGEF3_ENST00000496106.1_Silent_p.S137S|ARHGEF3_ENST00000497267.1_Silent_p.S102S|ARHGEF3_ENST00000495373.1_Silent_p.S131S	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	131	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CTTCTCCTTGGGAAAGCTCAA	0.363																																					p.S163S		Atlas-SNP	.											.	ARHGEF3	128	.	0			c.C489G						PASS	.						116.0	120.0	118.0					3																	56787577		2203	4300	6503	SO:0001819	synonymous_variant	50650	exon7			TCCTTGGGAAAGC	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.393C>G	chr3.hg19:g.56787577G>C		137.0	0.0	.		93.0	20.0	.	NM_001128615	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Silent	SNP	ENST00000296315.3	hg19	CCDS2878.1																																																																																			.	.	.	none		0.363	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
EAF2	55840	hgsc.bcm.edu	37	3	121591418	121591418	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:121591418G>A	ENST00000273668.2	+	5	590	c.519G>A	c.(517-519)atG>atA	p.M173I	EAF2_ENST00000451944.2_Missense_Mutation_p.M173I	NM_018456.4	NP_060926.2	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	173					apoptotic process (GO:0006915)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	ELL-EAF complex (GO:0032783)|transcription elongation factor complex (GO:0008023)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)	9				GBM - Glioblastoma multiforme(114;0.0972)		TGGACCAGATGAGTAGTTGTG	0.313																																					p.M173I	Esophageal Squamous(194;1942 2097 24663 29345 31866)	Atlas-SNP	.											.	EAF2	26	.	0			c.G519A						PASS	.						120.0	123.0	122.0					3																	121591418		2203	4300	6503	SO:0001583	missense	55840	exon5			CCAGATGAGTAGT	AF517829	CCDS3006.1	3q21.1	2007-08-01			ENSG00000145088	ENSG00000145088			23115	protein-coding gene	gene with protein product		607659				12446457, 12907652	Standard	NM_018456		Approved	BM040, TRAITS, U19	uc003een.3	Q96CJ1	OTTHUMG00000159424	ENST00000273668.2:c.519G>A	chr3.hg19:g.121591418G>A	ENSP00000273668:p.Met173Ile	184.0	0.0	.		288.0	154.0	.	NM_018456	Q9NZ82	Missense_Mutation	SNP	ENST00000273668.2	hg19	CCDS3006.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127060	0.56721	.	.	ENSG00000145088	ENST00000273668;ENST00000451944	.	.	.	4.74	4.74	0.60224	.	0.135191	0.64402	D	0.000004	T	0.62258	0.2413	M	0.77820	2.39	0.47862	D	0.999539	B	0.30406	0.278	B	0.27887	0.084	T	0.62243	-0.6895	9	0.29301	T	0.29	-9.0448	15.2478	0.73521	0.0:0.0:1.0:0.0	.	173	Q96CJ1	EAF2_HUMAN	I	173	.	ENSP00000273668:M173I	M	+	3	0	EAF2	123074108	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.397000	0.79903	2.456000	0.83038	0.305000	0.20034	ATG	.	.	.	none		0.313	EAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355247.1	NM_018456	
COL6A6	131873	hgsc.bcm.edu	37	3	130287032	130287032	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:130287032G>A	ENST00000358511.6	+	5	2016	c.1985G>A	c.(1984-1986)gGt>gAt	p.G662D	COL6A6_ENST00000453409.2_Missense_Mutation_p.G662D	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	662	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GTGCAAATTGGTGTAGTCCAG	0.408																																					p.G662D		Atlas-SNP	.											.	COL6A6	497	.	0			c.G1985A						PASS	.						176.0	171.0	173.0					3																	130287032		1915	4119	6034	SO:0001583	missense	131873	exon5			AAATTGGTGTAGT	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1985G>A	chr3.hg19:g.130287032G>A	ENSP00000351310:p.Gly662Asp	184.0	0.0	.		297.0	79.0	.	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	hg19	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654369	0.47467	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.82711	-1.64;-1.64	5.53	5.53	0.82687	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000018	D	0.93350	0.7880	H	0.94886	3.595	0.54753	D	0.999986	D	0.89917	1.0	D	0.87578	0.998	D	0.94709	0.7890	10	0.87932	D	0	.	14.6487	0.68780	0.0:0.1454:0.8546:0.0	.	662	A6NMZ7	CO6A6_HUMAN	D	662	ENSP00000351310:G662D;ENSP00000399236:G662D	ENSP00000351310:G662D	G	+	2	0	COL6A6	131769722	1.000000	0.71417	0.353000	0.25747	0.014000	0.08584	5.227000	0.65305	2.616000	0.88540	0.655000	0.94253	GGT	.	.	.	none		0.408	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
CP	1356	hgsc.bcm.edu	37	3	148930432	148930432	+	Missense_Mutation	SNP	T	T	C	rs141532762		TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:148930432T>C	ENST00000264613.6	-	2	462	c.200A>G	c.(199-201)tAt>tGt	p.Y67C		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	67	F5/8 type A 1.|Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GGCCTTCTTATATAGTCTCCC	0.388																																					p.Y67C		Atlas-SNP	.											.	CP	112	.	0			c.A200G						PASS	.	T	CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	74.0	73.0	73.0		200	5.4	0.5	3	dbSNP_134	73	0,8600		0,0,4300	no	missense	CP	NM_000096.3	194	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging	67/1066	148930432	1,13005	2203	4300	6503	SO:0001583	missense	1356	exon2			TTCTTATATAGTC	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.200A>G	chr3.hg19:g.148930432T>C	ENSP00000264613:p.Tyr67Cys	56.0	0.0	.		66.0	29.0	.	NM_000096	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	hg19	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	T	18.49	3.636271	0.67130	2.27E-4	0.0	ENSG00000047457	ENST00000264613;ENST00000455472	D;D	0.99277	-5.67;-5.67	5.42	5.42	0.78866	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99530	0.9832	M	0.92784	3.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.984;0.993	D	0.98194	1.0464	10	0.87932	D	0	-24.6173	15.6278	0.76874	0.0:0.0:0.0:1.0	.	67;67	A8K5A4;P00450	.;CERU_HUMAN	C	67;107	ENSP00000264613:Y67C;ENSP00000426888:Y107C	ENSP00000264613:Y67C	Y	-	2	0	CP	150413122	1.000000	0.71417	0.500000	0.27589	0.701000	0.40568	7.525000	0.81892	2.280000	0.76307	0.460000	0.39030	TAT	.	T|1.000;C|0.000	0.000	weak		0.388	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
HTT	3064	hgsc.bcm.edu	37	4	3156098	3156098	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr4:3156098C>A	ENST00000355072.5	+	27	3722	c.3577C>A	c.(3577-3579)Caa>Aaa	p.Q1193K		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1193					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		ACCAGGAGAACAAGCATCTGT	0.498																																					p.Q1193K		Atlas-SNP	.											.	HTT	221	.	0			c.C3577A						PASS	.						55.0	53.0	54.0					4																	3156098		2049	4207	6256	SO:0001583	missense	3064	exon27			GGAGAACAAGCAT	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3577C>A	chr4.hg19:g.3156098C>A	ENSP00000347184:p.Gln1193Lys	43.0	0.0	.		33.0	9.0	.	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	hg19	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.061554	0.36373	.	.	ENSG00000197386	ENST00000355072	T	0.05081	3.5	5.2	5.2	0.72013	.	0.378699	0.27906	N	0.017370	T	0.07683	0.0193	L	0.43152	1.355	0.27971	N	0.936396	B	0.20887	0.049	B	0.19148	0.024	T	0.21143	-1.0254	10	0.17832	T	0.49	.	16.9201	0.86162	0.0:1.0:0.0:0.0	.	1193	P42858	HD_HUMAN	K	1193	ENSP00000347184:Q1193K	ENSP00000347184:Q1193K	Q	+	1	0	HTT	3125896	0.989000	0.36119	0.644000	0.29465	0.961000	0.63080	3.195000	0.51013	2.430000	0.82344	0.557000	0.71058	CAA	.	.	.	none		0.498	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
TECRL	253017	hgsc.bcm.edu	37	4	65180367	65180367	+	Splice_Site	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr4:65180367G>A	ENST00000381210.3	-	5	660	c.550C>T	c.(550-552)Cac>Tac	p.H184Y	TECRL_ENST00000513125.1_5'UTR|TECRL_ENST00000507440.1_Splice_Site_p.H184Y	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	184					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						ATCACTTACTGTACCACTGGG	0.428																																					p.H184Y		Atlas-SNP	.											.	TECRL	106	.	0			c.C550T						PASS	.						83.0	76.0	78.0					4																	65180367		2203	4300	6503	SO:0001630	splice_region_variant	253017	exon5			CTTACTGTACCAC	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.551+1C>T	chr4.hg19:g.65180367G>A		51.0	0.0	.		33.0	10.0	.	NM_001010874		Missense_Mutation	SNP	ENST00000381210.3	hg19	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191677	0.78902	.	.	ENSG00000205678	ENST00000507440;ENST00000381210	T;T	0.42900	0.96;0.96	5.7	5.7	0.88788	.	0.124523	0.52532	D	0.000077	T	0.64832	0.2634	M	0.85777	2.775	0.80722	D	1	D;D	0.67145	0.996;0.993	D;P	0.78314	0.991;0.866	T	0.63537	-0.6615	10	0.07644	T	0.81	-12.79	16.5536	0.84479	0.0:0.0:1.0:0.0	.	184;184	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	Y	184	ENSP00000426043:H184Y;ENSP00000370607:H184Y	ENSP00000370607:H184Y	H	-	1	0	TECRL	64862962	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	4.899000	0.63245	2.689000	0.91719	0.591000	0.81541	CAC	.	.	.	none		0.428	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874	Missense_Mutation
SEPT11	55752	hgsc.bcm.edu	37	4	77941678	77941678	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr4:77941678T>G	ENST00000264893.6	+	7	1009	c.808T>G	c.(808-810)Ttt>Gtt	p.F270V	SEPT11_ENST00000512575.1_Intron|SEPT11_ENST00000510515.1_Missense_Mutation_p.F280V|SEPT11_ENST00000502584.1_Missense_Mutation_p.F270V|SEPT11_ENST00000541121.1_Missense_Mutation_p.F280V|SEPT11_ENST00000505788.1_Missense_Mutation_p.F270V	NM_018243.2	NP_060713.1	Q9NVA2	SEP11_HUMAN	septin 11	270	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|protein heterooligomerization (GO:0051291)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|septin complex (GO:0031105)|stress fiber (GO:0001725)|synapse (GO:0045202)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	11						TCATTGCGATTTTGTGAAACT	0.468																																					p.F270V		Atlas-SNP	.											.	SEPT11	31	.	0			c.T808G						PASS	.						96.0	93.0	94.0					4																	77941678		2203	4300	6503	SO:0001583	missense	55752	exon7			TGCGATTTTGTGA	AK001711	CCDS34018.1	4q21.1	2013-01-21			ENSG00000138758	ENSG00000138758		"""Septins"""	25589	protein-coding gene	gene with protein product		612887				14999297, 15140406	Standard	NM_018243		Approved	FLJ10849	uc003hkj.3	Q9NVA2	OTTHUMG00000160854	ENST00000264893.6:c.808T>G	chr4.hg19:g.77941678T>G	ENSP00000264893:p.Phe270Val	127.0	0.0	.		157.0	52.0	.	NM_018243	B7Z7Z6|E9KL32|Q4W5G1|Q7L4N1|Q96SP1|Q9UFY9	Missense_Mutation	SNP	ENST00000264893.6	hg19	CCDS34018.1	.	.	.	.	.	.	.	.	.	.	T	29.5	5.015347	0.93404	.	.	ENSG00000138758	ENST00000264893;ENST00000502584;ENST00000510641;ENST00000505788;ENST00000510515;ENST00000541121	T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.88724	0.6514	H	0.98388	4.22	0.58432	D	0.999996	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.99;0.989;0.994	D	0.93076	0.6487	10	0.87932	D	0	.	15.1435	0.72630	0.0:0.0:0.0:1.0	.	280;262;270	Q9NVA2-2;D6RDU5;Q9NVA2	.;.;SEP11_HUMAN	V	270;270;262;270;280;280	ENSP00000264893:F270V;ENSP00000426344:F270V;ENSP00000420839:F262V;ENSP00000424925:F270V;ENSP00000422896:F280V;ENSP00000443701:F280V	ENSP00000264893:F270V	F	+	1	0	SEPT11	78160702	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.698000	0.84413	1.975000	0.57531	0.482000	0.46254	TTT	.	.	.	none		0.468	SEPT11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362676.1	NM_018243	
SKP2	6502	hgsc.bcm.edu	37	5	36163851	36163851	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr5:36163851C>A	ENST00000274255.6	+	3	581	c.385C>A	c.(385-387)Cgc>Agc	p.R129S	SKP2_ENST00000274254.5_Missense_Mutation_p.R129S|SKP2_ENST00000508514.1_Intron|SKP2_ENST00000546211.1_Intron	NM_005983.3	NP_005974.2	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2, E3 ubiquitin protein ligase	129	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|cellular response to cell-matrix adhesion (GO:0071460)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	identical protein binding (GO:0042802)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|ovary(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GAGGTGGTATCGCCTAGCGTA	0.468																																					p.R129S		Atlas-SNP	.											.	SKP2	70	.	0			c.C385A						PASS	.						139.0	119.0	126.0					5																	36163851		2203	4300	6503	SO:0001583	missense	6502	exon3			TGGTATCGCCTAG	U33761	CCDS3915.1, CCDS3916.1, CCDS58944.1	5p13	2012-02-23	2012-02-23		ENSG00000145604	ENSG00000145604		"""F-boxes / Leucine-rich repeats"""	10901	protein-coding gene	gene with protein product		601436	"""S-phase kinase-associated protein 2 (p45)"""			8646875	Standard	NM_005983		Approved	FBXL1, FBL1, p45	uc003jkc.2	Q13309	OTTHUMG00000131106	ENST00000274255.6:c.385C>A	chr5.hg19:g.36163851C>A	ENSP00000274255:p.Arg129Ser	82.0	0.0	.		82.0	5.0	.	NM_032637	A8K5E0|B4DJT4|Q8TDZ0|Q8TDZ1|Q9BV69	Missense_Mutation	SNP	ENST00000274255.6	hg19	CCDS3916.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365916	0.41902	.	.	ENSG00000145604	ENST00000274254;ENST00000274255;ENST00000308927;ENST00000513151	T;T;T	0.42513	0.97;0.97;0.97	4.92	0.0927	0.14474	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.302114	0.42548	N	0.000698	T	0.29288	0.0729	L	0.48362	1.52	0.80722	D	1	B;B	0.23249	0.082;0.077	B;B	0.25291	0.021;0.059	T	0.04090	-1.0978	10	0.29301	T	0.29	-0.2876	5.0024	0.14271	0.1582:0.6121:0.0:0.2297	.	129;129	Q13309-2;Q13309	.;SKP2_HUMAN	S	129;129;95;129	ENSP00000274254:R129S;ENSP00000274255:R129S;ENSP00000423188:R129S	ENSP00000274254:R129S	R	+	1	0	SKP2	36199608	0.912000	0.30974	0.985000	0.45067	0.998000	0.95712	0.041000	0.13927	-0.102000	0.12197	0.650000	0.86243	CGC	.	.	.	none		0.468	SKP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253769.2	NM_005983	
NIPBL	25836	hgsc.bcm.edu	37	5	36984988	36984988	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr5:36984988A>T	ENST00000282516.8	+	10	2205	c.1706A>T	c.(1705-1707)gAa>gTa	p.E569V	NIPBL_ENST00000448238.2_Missense_Mutation_p.E569V|NIPBL_ENST00000504430.1_3'UTR	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	569					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AAGCCTGAAGAAATCAAACAA	0.393																																					p.E569V		Atlas-SNP	.											.	NIPBL	513	.	0			c.A1706T						PASS	.						92.0	96.0	94.0					5																	36984988		2203	4300	6503	SO:0001583	missense	25836	exon10			CTGAAGAAATCAA	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1706A>T	chr5.hg19:g.36984988A>T	ENSP00000282516:p.Glu569Val	143.0	0.0	.		179.0	72.0	.	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	hg19	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	12.56	1.974280	0.34848	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.94417	-3.41;-3.42	5.98	5.98	0.97165	.	0.120361	0.64402	D	0.000018	D	0.90933	0.7150	N	0.19112	0.55	0.42318	D	0.992241	P;P	0.48503	0.856;0.911	B;P	0.44561	0.266;0.453	D	0.91908	0.5537	10	0.49607	T	0.09	.	16.4781	0.84144	1.0:0.0:0.0:0.0	.	569;569	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	V	569	ENSP00000282516:E569V;ENSP00000406266:E569V	ENSP00000282516:E569V	E	+	2	0	NIPBL	37020745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.883000	0.69721	2.288000	0.76882	0.528000	0.53228	GAA	.	.	.	none		0.393	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
ARHGAP26	23092	hgsc.bcm.edu	37	5	142416823	142416823	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr5:142416823A>G	ENST00000274498.4	+	13	1585	c.1207A>G	c.(1207-1209)Aga>Gga	p.R403G	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.R403G	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	403	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTGGAAACCAGAGGTAAAGT	0.468																																					p.R403G		Atlas-SNP	.											.	ARHGAP26	57	.	0			c.A1207G						PASS	.						127.0	106.0	113.0					5																	142416823		2203	4300	6503	SO:0001583	missense	23092	exon13			GAAACCAGAGGTA	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.1207A>G	chr5.hg19:g.142416823A>G	ENSP00000274498:p.Arg403Gly	59.0	0.0	.		81.0	41.0	.	NM_015071	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	hg19	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.144516	0.77888	.	.	ENSG00000145819	ENST00000274498;ENST00000378004	T;T	0.21031	2.03;2.03	5.84	4.64	0.57946	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.42268	0.1195	M	0.85945	2.785	0.58432	D	0.999996	P;D	0.53619	0.924;0.961	P;P	0.54590	0.508;0.756	T	0.42241	-0.9463	10	0.49607	T	0.09	.	12.0971	0.53761	0.856:0.144:0.0:0.0	.	403;403	Q9UNA1;Q9UNA1-2	RHG26_HUMAN;.	G	403	ENSP00000274498:R403G;ENSP00000367243:R403G	ENSP00000274498:R403G	R	+	1	2	ARHGAP26	142397016	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.389000	0.52516	0.988000	0.38734	0.455000	0.32223	AGA	.	.	.	none		0.468	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
JAKMIP2	9832	hgsc.bcm.edu	37	5	147000262	147000262	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr5:147000262G>T	ENST00000265272.5	-	18	2576	c.2109C>A	c.(2107-2109)gaC>gaA	p.D703E	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.D661E|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.D682E	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	703						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTTTCTGTAGTCTAGTTCTT	0.388																																					p.D703E		Atlas-SNP	.											.	JAKMIP2	154	.	0			c.C2109A						PASS	.						308.0	258.0	275.0					5																	147000262		2203	4300	6503	SO:0001583	missense	9832	exon18			TCTGTAGTCTAGT	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.2109C>A	chr5.hg19:g.147000262G>T	ENSP00000265272:p.Asp703Glu	105.0	0.0	.		176.0	85.0	.	NM_001270941	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	hg19	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287394	0.59976	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.25912	1.8;1.77;1.78	5.66	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.41558	0.1164	M	0.64404	1.975	0.49389	D	0.999788	D;D;D;D	0.61697	0.99;0.99;0.99;0.99	D;D;D;D	0.70935	0.971;0.971;0.971;0.971	T	0.22347	-1.0219	10	0.15952	T	0.53	.	10.5305	0.44973	0.1413:0.0:0.8587:0.0	.	661;703;682;703	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	E	682;703;661;682	ENSP00000421398:D682E;ENSP00000265272:D703E;ENSP00000328989:D661E	ENSP00000265272:D703E	D	-	3	2	JAKMIP2	146980455	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.966000	0.40481	0.817000	0.34445	0.591000	0.81541	GAC	.	.	.	none		0.388	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
CREBRF	153222	hgsc.bcm.edu	37	5	172518026	172518026	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr5:172518026C>G	ENST00000296953.2	+	4	1163	c.844C>G	c.(844-846)Ctt>Gtt	p.L282V	CREBRF_ENST00000540014.1_Missense_Mutation_p.L282V|CREBRF_ENST00000520420.1_Missense_Mutation_p.L282V|CREBRF_ENST00000522692.1_Missense_Mutation_p.L282V	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	282					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GATGGAGCCTCTTCAAGGTCA	0.522																																					p.L282V		Atlas-SNP	.											.	.	.	.	0			c.C844G						PASS	.						60.0	61.0	60.0					5																	172518026		2203	4300	6503	SO:0001583	missense	153222	exon4			GAGCCTCTTCAAG	AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.844C>G	chr5.hg19:g.172518026C>G	ENSP00000296953:p.Leu282Val	91.0	0.0	.		96.0	26.0	.	NM_153607	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	ENST00000296953.2	hg19	CCDS34293.1	.	.	.	.	.	.	.	.	.	.	C	3.060	-0.193550	0.06259	.	.	ENSG00000164463	ENST00000522692;ENST00000296953;ENST00000540014;ENST00000520420;ENST00000538538;ENST00000393776	T;T	0.43294	0.95;0.95	5.29	2.49	0.30216	.	0.733387	0.13308	N	0.397700	T	0.23766	0.0575	N	0.24115	0.695	0.09310	N	1	B;B	0.25609	0.039;0.13	B;B	0.24269	0.052;0.043	T	0.27191	-1.0081	10	0.07482	T	0.82	.	8.0149	0.30374	0.1291:0.7322:0.0:0.1387	.	282;282	Q8IUR6;Q8IUR6-2	CE041_HUMAN;.	V	282	ENSP00000296953:L282V;ENSP00000440075:L282V	ENSP00000296953:L282V	L	+	1	0	C5orf41	172450632	0.996000	0.38824	0.050000	0.19076	0.931000	0.56810	3.394000	0.52551	0.215000	0.20761	0.563000	0.77884	CTT	.	.	.	none		0.522	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372667.1	NM_153607	
SPDEF	25803	hgsc.bcm.edu	37	6	34512076	34512076	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr6:34512076G>T	ENST00000374037.3	-	2	571	c.157C>A	c.(157-159)Cag>Aag	p.Q53K	SPDEF_ENST00000544425.1_Missense_Mutation_p.Q53K	NM_012391.2	NP_036523.1	O95238	SPDEF_HUMAN	SAM pointed domain containing ETS transcription factor	53					cell differentiation (GO:0030154)|intestinal epithelial cell development (GO:0060576)|lung goblet cell differentiation (GO:0060480)|multicellular organismal development (GO:0007275)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)	15						GACAGGCCCTGCTCGGGCGTG	0.687																																					p.Q53K		Atlas-SNP	.											.	SPDEF	34	.	0			c.C157A						PASS	.						35.0	40.0	38.0					6																	34512076		2203	4300	6503	SO:0001583	missense	25803	exon2			GGCCCTGCTCGGG	AF071538	CCDS4794.1, CCDS59013.1	6p21.3	2013-08-07	2013-08-07		ENSG00000124664	ENSG00000124664			17257	protein-coding gene	gene with protein product		608144	"""SAM pointed domain containing ets transcription factor"""			10625666, 6857767	Standard	NM_012391		Approved	PDEF, bA375E1.3	uc003ojq.2	O95238	OTTHUMG00000014548	ENST00000374037.3:c.157C>A	chr6.hg19:g.34512076G>T	ENSP00000363149:p.Gln53Lys	87.0	0.0	.		79.0	18.0	.	NM_001252294	B4DWH8|F5H778	Missense_Mutation	SNP	ENST00000374037.3	hg19	CCDS4794.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534021	0.45073	.	.	ENSG00000124664	ENST00000374037;ENST00000544425	T;T	0.14022	2.54;2.73	4.97	4.97	0.65823	.	0.498805	0.17278	N	0.180107	T	0.04452	0.0122	L	0.27053	0.805	0.28482	N	0.914903	B;B	0.25904	0.137;0.085	B;B	0.25140	0.058;0.026	T	0.26121	-1.0112	10	0.35671	T	0.21	.	13.5867	0.61935	0.0:0.1561:0.8439:0.0	.	53;53	F5H778;O95238	.;SPDEF_HUMAN	K	53	ENSP00000363149:Q53K;ENSP00000442715:Q53K	ENSP00000363149:Q53K	Q	-	1	0	SPDEF	34620054	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	4.798000	0.62510	2.286000	0.76751	0.591000	0.81541	CAG	.	.	.	none		0.687	SPDEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040246.1	NM_012391	
SNX9	51429	hgsc.bcm.edu	37	6	158288583	158288583	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr6:158288583G>A	ENST00000392185.3	+	2	188	c.17G>A	c.(16-18)cGg>cAg	p.R6Q		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	6	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		TGATAGGCTCGGGTTATGTAT	0.393																																					p.R6Q		Atlas-SNP	.											.	SNX9	43	.	0			c.G17A						PASS	.						171.0	140.0	150.0					6																	158288583		2203	4300	6503	SO:0001583	missense	51429	exon2			AGGCTCGGGTTAT	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.17G>A	chr6.hg19:g.158288583G>A	ENSP00000376024:p.Arg6Gln	99.0	0.0	.		72.0	23.0	.	NM_016224	Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	ENST00000392185.3	hg19	CCDS5253.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908097	0.52333	.	.	ENSG00000130340	ENST00000539592;ENST00000392185	T	0.24350	1.86	5.22	4.33	0.51752	Src homology-3 domain (3);	0.434714	0.25546	N	0.029934	T	0.11281	0.0275	L	0.42686	1.345	0.80722	D	1	B	0.29936	0.262	B	0.26770	0.073	T	0.03514	-1.1029	10	0.45353	T	0.12	-7.1352	12.8925	0.58080	0.0:0.164:0.836:0.0	.	6	Q9Y5X1	SNX9_HUMAN	Q	6	ENSP00000376024:R6Q	ENSP00000376024:R6Q	R	+	2	0	SNX9	158208571	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.078000	0.57606	1.204000	0.43247	0.655000	0.94253	CGG	.	.	.	none		0.393	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042856.1		
MET	4233	hgsc.bcm.edu	37	7	116417463	116417463	+	Missense_Mutation	SNP	C	C	T	rs121913244		TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr7:116417463C>T	ENST00000318493.6	+	16	3521	c.3334C>T	c.(3334-3336)Cat>Tat	p.H1112Y	MET_ENST00000397752.3_Missense_Mutation_p.H1094Y|MET_ENST00000539704.1_5'UTR			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.H1112Y(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTGTGTATATCATGGGACTTT	0.343			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.H1112Y		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,colon,carcinoma,0,2	MET	412	.	1	Substitution - Missense(1)	kidney(1)	c.C3334T	GRCh37	CM993668	MET	M	rs121913244	PASS	.						188.0	175.0	179.0					7																	116417463		1832	4086	5918	SO:0001583	missense	4233	exon16	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GTATATCATGGGA	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3334C>T	chr7.hg19:g.116417463C>T	ENSP00000317272:p.His1112Tyr	199.0	0.0	.		276.0	144.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615896	0.87359	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	T;T	0.33654	1.4;1.4	5.29	5.29	0.74685	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43919	0.1269	N	0.11364	0.135	0.80722	D	1	P;D	0.89917	0.937;1.0	P;D	0.91635	0.854;0.999	T	0.52711	-0.8539	10	0.51188	T	0.08	-16.8984	19.2953	0.94119	0.0:1.0:0.0:0.0	.	1112;1094	P08581-2;P08581	.;MET_HUMAN	Y	1094;1112	ENSP00000380860:H1094Y;ENSP00000317272:H1112Y	ENSP00000317272:H1112Y	H	+	1	0	MET	116204699	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.776000	0.85560	2.628000	0.89032	0.655000	0.94253	CAT	.	.	.	weak		0.343	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
CTTNBP2	83992	hgsc.bcm.edu	37	7	117365303	117365303	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr7:117365303G>C	ENST00000160373.3	-	18	4155	c.4064C>G	c.(4063-4065)tCt>tGt	p.S1355C		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1355					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CCACAGCTTAGACATCCACCT	0.468																																					p.S1355C		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.C4064G						PASS	.						138.0	134.0	135.0					7																	117365303		2203	4300	6503	SO:0001583	missense	83992	exon18			AGCTTAGACATCC		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4064C>G	chr7.hg19:g.117365303G>C	ENSP00000160373:p.Ser1355Cys	192.0	0.0	.		326.0	72.0	.	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	hg19	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864762	0.51482	.	.	ENSG00000077063	ENST00000160373	D	0.91068	-2.78	5.72	5.72	0.89469	.	0.267144	0.43416	D	0.000578	D	0.87557	0.6207	L	0.41824	1.3	0.80722	D	1	B	0.14012	0.009	B	0.15484	0.013	T	0.81274	-0.1007	10	0.23891	T	0.37	9.6033	20.244	0.98389	0.0:0.0:1.0:0.0	.	1355	Q8WZ74	CTTB2_HUMAN	C	1355	ENSP00000160373:S1355C	ENSP00000160373:S1355C	S	-	2	0	CTTNBP2	117152539	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.149000	0.71795	2.865000	0.98341	0.655000	0.94253	TCT	.	.	.	none		0.468	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
KMT2C	58508	hgsc.bcm.edu	37	7	151917756	151917756	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr7:151917756C>A	ENST00000262189.6	-	23	3782	c.3564G>T	c.(3562-3564)caG>caT	p.Q1188H	KMT2C_ENST00000355193.2_Missense_Mutation_p.Q1188H	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1188					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CTGTGAGGCTCTGTAACTGAG	0.408																																					p.Q1188H		Atlas-SNP	.											.	MLL3	1564	.	0			c.G3564T						PASS	.						72.0	69.0	70.0					7																	151917756		2203	4298	6501	SO:0001583	missense	58508	exon23			GAGGCTCTGTAAC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3564G>T	chr7.hg19:g.151917756C>A	ENSP00000262189:p.Gln1188His	118.0	0.0	.		163.0	71.0	.	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.948672	0.53186	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.85171	-1.95;-1.95	4.44	3.56	0.40772	.	0.000000	0.41605	U	0.000856	D	0.89763	0.6809	L	0.56769	1.78	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.75484	0.986;0.971	D	0.89849	0.4008	10	0.66056	D	0.02	.	12.545	0.56195	0.0:0.9173:0.0:0.0827	.	1188;249	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	H	1188	ENSP00000262189:Q1188H;ENSP00000347325:Q1188H	ENSP00000262189:Q1188H	Q	-	3	2	MLL3	151548689	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.614000	0.61183	0.976000	0.38417	0.484000	0.47621	CAG	.	.	.	none		0.408	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
CDH17	1015	hgsc.bcm.edu	37	8	95201459	95201459	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr8:95201459A>C	ENST00000027335.3	-	3	230	c.106T>G	c.(106-108)Ttt>Gtt	p.F36V	CDH17_ENST00000450165.2_Missense_Mutation_p.F36V|CDH17_ENST00000441892.2_Missense_Mutation_p.F36V	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	36	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TAAATAGAAAATGTCATGGGT	0.403																																					p.F36V		Atlas-SNP	.											.	CDH17	119	.	0			c.T106G						PASS	.						118.0	120.0	119.0					8																	95201459		2203	4300	6503	SO:0001583	missense	1015	exon3			TAGAAAATGTCAT	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.106T>G	chr8.hg19:g.95201459A>C	ENSP00000027335:p.Phe36Val	102.0	0.0	.		97.0	76.0	.	NM_004063	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	hg19	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	A	9.966	1.224134	0.22457	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165;ENST00000521491	T;T;T;T	0.60040	0.26;0.26;0.26;0.22	5.43	5.43	0.79202	Cadherin (1);Cadherin-like (1);	0.000000	0.49305	D	0.000150	T	0.59959	0.2232	L	0.39514	1.22	0.47374	D	0.999407	D;D	0.62365	0.979;0.991	P;P	0.56042	0.622;0.79	T	0.57365	-0.7824	10	0.30854	T	0.27	-19.528	11.8845	0.52594	1.0:0.0:0.0:0.0	.	36;36	E7EN24;Q12864	.;CAD17_HUMAN	V	36	ENSP00000027335:F36V;ENSP00000392811:F36V;ENSP00000401468:F36V;ENSP00000428189:F36V	ENSP00000027335:F36V	F	-	1	0	CDH17	95270635	0.957000	0.32711	0.996000	0.52242	0.606000	0.37113	2.732000	0.47352	2.057000	0.61298	0.482000	0.46254	TTT	.	.	.	none		0.403	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
BNC2	54796	hgsc.bcm.edu	37	9	16419221	16419221	+	Silent	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr9:16419221A>G	ENST00000380672.4	-	7	3123	c.3066T>C	c.(3064-3066)tcT>tcC	p.S1022S	BNC2_ENST00000545497.1_Silent_p.S927S|BNC2_ENST00000380667.2_Silent_p.S955S	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TGAACATAAGAGATCCTGAAA	0.547																																					p.S1022S		Atlas-SNP	.											.	BNC2	166	.	0			c.T3066C						PASS	.						81.0	72.0	75.0					9																	16419221		2203	4300	6503	SO:0001819	synonymous_variant	54796	exon7			CATAAGAGATCCT	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.3066T>C	chr9.hg19:g.16419221A>G		100.0	0.0	.		96.0	29.0	.	NM_017637		Silent	SNP	ENST00000380672.4	hg19	CCDS6482.2																																																																																			.	.	.	none		0.547	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
GRIN3A	116443	hgsc.bcm.edu	37	9	104449145	104449145	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr9:104449145C>G	ENST00000361820.3	-	2	1637	c.1037G>C	c.(1036-1038)gGg>gCg	p.G346A		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	346					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GGGCATGACCCCAAACTGGGT	0.507																																					p.G346A		Atlas-SNP	.											.	GRIN3A	186	.	0			c.G1037C						PASS	.						66.0	64.0	65.0					9																	104449145		2203	4300	6503	SO:0001583	missense	116443	exon2			ATGACCCCAAACT		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1037G>C	chr9.hg19:g.104449145C>G	ENSP00000355155:p.Gly346Ala	54.0	0.0	.		68.0	33.0	.	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	hg19	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.696202	0.48202	.	.	ENSG00000198785	ENST00000361820	D	0.90732	-2.72	5.83	4.92	0.64577	.	0.942080	0.09021	N	0.860194	D	0.90017	0.6883	L	0.59436	1.845	0.58432	D	0.999992	B	0.28419	0.211	B	0.26864	0.074	D	0.83443	0.0044	10	0.66056	D	0.02	.	15.7632	0.78103	0.1471:0.8529:0.0:0.0	.	346	Q8TCU5	NMD3A_HUMAN	A	346	ENSP00000355155:G346A	ENSP00000355155:G346A	G	-	2	0	GRIN3A	103488966	1.000000	0.71417	0.885000	0.34714	0.653000	0.38743	4.782000	0.62396	1.403000	0.46800	0.563000	0.77884	GGG	.	.	.	none		0.507	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
MASTL	84930	hgsc.bcm.edu	37	10	27459483	27459483	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr10:27459483T>C	ENST00000375940.4	+	8	1652	c.1595T>C	c.(1594-1596)cTt>cCt	p.L532P	MASTL_ENST00000375946.4_Missense_Mutation_p.L532P|MASTL_ENST00000477034.1_3'UTR|MASTL_ENST00000342386.6_Missense_Mutation_p.L532P			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	532	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCAAAAAACCTTATGTGTGAA	0.313																																					p.L532P		Atlas-SNP	.											.	MASTL	81	.	0			c.T1595C						PASS	.						89.0	92.0	91.0					10																	27459483		2203	4300	6503	SO:0001583	missense	84930	exon8			AAAACCTTATGTG	BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.1595T>C	chr10.hg19:g.27459483T>C	ENSP00000365107:p.Leu532Pro	122.0	0.0	.		132.0	46.0	.	NM_032844	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	ENST00000375940.4	hg19	CCDS53502.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.985988	0.53934	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.33654	1.4;1.4;1.4	5.67	5.67	0.87782	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	M	0.75264	2.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.65957	-0.6042	10	0.87932	D	0	-17.4573	15.9272	0.79628	0.0:0.0:0.0:1.0	.	532;532;532	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	P	532	ENSP00000365113:L532P;ENSP00000343446:L532P;ENSP00000365107:L532P	ENSP00000343446:L532P	L	+	2	0	MASTL	27499489	1.000000	0.71417	0.861000	0.33841	0.432000	0.31715	6.170000	0.71920	2.153000	0.67306	0.533000	0.62120	CTT	.	.	.	none		0.313	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844	
UNC5B	219699	hgsc.bcm.edu	37	10	73055666	73055666	+	Silent	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr10:73055666C>T	ENST00000335350.6	+	14	2690	c.2274C>T	c.(2272-2274)ctC>ctT	p.L758L	UNC5B_ENST00000373192.4_Silent_p.L747L	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	758	UPA domain. {ECO:0000250}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GCCTCTCCCTCCATGACCTCC	0.612																																					p.L758L		Atlas-SNP	.											.	UNC5B	123	.	0			c.C2274T						PASS	.						133.0	105.0	115.0					10																	73055666		2203	4300	6503	SO:0001819	synonymous_variant	219699	exon14			CTCCCTCCATGAC	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.2274C>T	chr10.hg19:g.73055666C>T		116.0	0.0	.		116.0	46.0	.	NM_170744	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Silent	SNP	ENST00000335350.6	hg19	CCDS7309.1																																																																																			.	.	.	none		0.612	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
PIK3C2A	5286	hgsc.bcm.edu	37	11	17124313	17124313	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr11:17124313A>C	ENST00000265970.7	-	23	3746	c.3747T>G	c.(3745-3747)tgT>tgG	p.C1249W	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Missense_Mutation_p.C869W	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1249	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TGTGTCGATCACAGATGCCTA	0.383																																					p.C1249W		Atlas-SNP	.											.	PIK3C2A	148	.	0			c.T3747G						PASS	.						102.0	88.0	93.0					11																	17124313		2200	4293	6493	SO:0001583	missense	5286	exon23			TCGATCACAGATG	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.3747T>G	chr11.hg19:g.17124313A>C	ENSP00000265970:p.Cys1249Trp	110.0	0.0	.		103.0	37.0	.	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	hg19	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	A	17.56	3.420006	0.62622	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	T;T	0.80909	-1.43;-1.43	5.45	4.32	0.51571	Protein kinase-like domain (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.89199	0.6647	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89599	0.3833	10	0.72032	D	0.01	-12.9025	11.3328	0.49485	0.9285:0.0:0.0715:0.0	.	1249	O00443	P3C2A_HUMAN	W	1249;869	ENSP00000265970:C1249W;ENSP00000438687:C869W	ENSP00000265970:C1249W	C	-	3	2	PIK3C2A	17080889	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.320000	0.51991	1.021000	0.39600	0.533000	0.62120	TGT	.	.	.	none		0.383	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
ENDOD1	23052	hgsc.bcm.edu	37	11	94823276	94823276	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr11:94823276C>T	ENST00000278505.4	+	1	303	c.185C>T	c.(184-186)gCt>gTt	p.A62V		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	62						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				GCGGAGGGTGCTGAGCGCTTC	0.716																																					p.A62V		Atlas-SNP	.											.	ENDOD1	26	.	0			c.C185T						PASS	.						12.0	17.0	15.0					11																	94823276		1882	4102	5984	SO:0001583	missense	23052	exon1			AGGGTGCTGAGCG	BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.185C>T	chr11.hg19:g.94823276C>T	ENSP00000278505:p.Ala62Val	15.0	0.0	.		17.0	7.0	.	NM_015036	A8K6K8|Q6GQY5|Q8TAQ8	Missense_Mutation	SNP	ENST00000278505.4	hg19	CCDS41699.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399463	0.42512	.	.	ENSG00000149218	ENST00000278505	T	0.69306	-0.39	4.43	1.23	0.21249	DNA/RNA non-specific endonuclease (1);Extracellular Endonuclease, subunit A (2);	1.135320	0.06834	N	0.794557	T	0.55800	0.1943	L	0.36672	1.1	0.09310	N	0.999999	B	0.33413	0.411	B	0.40165	0.321	T	0.50206	-0.8855	10	0.28530	T	0.3	-13.357	2.0739	0.03619	0.3599:0.396:0.1335:0.1106	.	62	O94919	ENDD1_HUMAN	V	62	ENSP00000278505:A62V	ENSP00000278505:A62V	A	+	2	0	ENDOD1	94462924	0.076000	0.21285	0.977000	0.42913	0.495000	0.33615	0.653000	0.24902	0.848000	0.35191	0.585000	0.79938	GCT	.	.	.	none		0.716	ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036	
ATM	472	hgsc.bcm.edu	37	11	108155202	108155202	+	Splice_Site	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr11:108155202T>C	ENST00000452508.2	+	27	4182		c.e27+2		ATM_ENST00000278616.4_Splice_Site			Q13315	ATM_HUMAN	ATM serine/threonine kinase						brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGAAAACAGGTATGGCTTCAA	0.348			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											.		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	ATM_ENST00000278616,colon,carcinoma,0,2	ATM	1657	.	0			c.3993+2T>C						PASS	.						93.0	90.0	91.0					11																	108155202		2201	4298	6499	SO:0001630	splice_region_variant	472	exon26	Familial Cancer Database	AT, Louis-Bar syndrome	AACAGGTATGGCT	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3993+2T>C	chr11.hg19:g.108155202T>C		107.0	0.0	.		96.0	34.0	.	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Splice_Site	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311730	0.60414	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508;ENST00000531525	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4694	0.75429	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATM	107660412	1.000000	0.71417	0.998000	0.56505	0.827000	0.46813	7.450000	0.80656	2.070000	0.61991	0.455000	0.32223	.	.	.	.	none		0.348	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	Intron
VWF	7450	hgsc.bcm.edu	37	12	6138619	6138619	+	Silent	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:6138619G>A	ENST00000261405.5	-	22	3110	c.2856C>T	c.(2854-2856)caC>caT	p.H952H		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	952	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CCACCTCAAAGTGAGTCTCAT	0.572																																					p.H952H		Atlas-SNP	.											.	VWF	338	.	0			c.C2856T						PASS	.						108.0	95.0	99.0					12																	6138619		2203	4300	6503	SO:0001819	synonymous_variant	7450	exon22			CTCAAAGTGAGTC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2856C>T	chr12.hg19:g.6138619G>A		108.0	0.0	.		126.0	76.0	.	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	hg19	CCDS8539.1																																																																																			.	.	.	none		0.572	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
LRRC23	10233	hgsc.bcm.edu	37	12	7014840	7014840	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:7014840G>C	ENST00000007969.8	+	2	263	c.43G>C	c.(43-45)Gat>Cat	p.D15H	LRRC23_ENST00000433346.1_Missense_Mutation_p.D15H|LRRC23_ENST00000449039.1_3'UTR|LRRC23_ENST00000443597.2_Missense_Mutation_p.D15H|LRRC23_ENST00000436789.1_Missense_Mutation_p.D15H|LRRC23_ENST00000429740.1_Missense_Mutation_p.D15H|LRRC23_ENST00000323702.5_Missense_Mutation_p.D15H	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	15										NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						GCCAGACCAGGATGATTCTga	0.498																																					p.D15H		Atlas-SNP	.											.	LRRC23	46	.	0			c.G43C						PASS	.						70.0	74.0	73.0					12																	7014840		2203	4300	6503	SO:0001583	missense	10233	exon2			GACCAGGATGATT	BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.43G>C	chr12.hg19:g.7014840G>C	ENSP00000007969:p.Asp15His	120.0	0.0	.		148.0	43.0	.	NM_001135217	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	ENST00000007969.8	hg19	CCDS8569.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906459	0.33628	.	.	ENSG00000010626	ENST00000433346;ENST00000007969;ENST00000323702;ENST00000443597;ENST00000415834;ENST00000436789;ENST00000429740	T;T;T;T;T;T;T	0.71461	1.55;-0.26;-0.57;-0.26;0.55;1.6;1.19	4.74	4.74	0.60224	.	.	.	.	.	T	0.79088	0.4387	L	0.60455	1.87	0.47698	D	0.999497	D;D;D;D	0.69078	0.997;0.997;0.984;0.991	D;P;P;P	0.63877	0.919;0.884;0.769;0.769	T	0.80533	-0.1340	9	0.62326	D	0.03	-12.2314	13.0943	0.59182	0.0:0.0:1.0:0.0	.	15;15;15;15	E9PDZ4;Q53EV4-2;Q53EV4;C9JKE8	.;.;LRC23_HUMAN;.	H	15	ENSP00000402554:D15H;ENSP00000007969:D15H;ENSP00000317464:D15H;ENSP00000390932:D15H;ENSP00000408066:D15H;ENSP00000396049:D15H;ENSP00000397192:D15H	ENSP00000007969:D15H	D	+	1	0	LRRC23	6885101	0.995000	0.38212	0.960000	0.40013	0.183000	0.23260	2.632000	0.46511	2.452000	0.82932	0.561000	0.74099	GAT	.	.	.	none		0.498	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992	
SPX	80763	hgsc.bcm.edu	37	12	21679409	21679409	+	Start_Codon_SNP	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:21679409G>A	ENST00000256969.2	+	1	169	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_030572.2	NP_085049.1	Q9BT56	SPXN_HUMAN		1					long-chain fatty acid import (GO:0044539)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of renal sodium excretion (GO:0035814)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of sensory perception of pain (GO:0051930)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			endometrium(3)|large_intestine(1)|lung(2)|urinary_tract(1)	7						CGCAGAACATGAAGGTAAGTA	0.303																																					p.M1I		Atlas-SNP	.											.	C12orf39	18	.	0			c.G3A						PASS	.						75.0	76.0	76.0					12																	21679409		2203	4300	6503	SO:0001582	initiator_codon_variant	80763	exon1			GAACATGAAGGTA																												ENST00000256969.2:c.3G>A	chr12.hg19:g.21679409G>A	ENSP00000256969:p.Met1Ile	49.0	0.0	.		43.0	13.0	.	NM_030572	B3KND6	Missense_Mutation	SNP	ENST00000256969.2	hg19	CCDS31757.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533648	0.27387	.	.	ENSG00000134548	ENST00000256969	.	.	.	5.04	5.04	0.67666	.	0.205916	0.42821	D	0.000641	T	0.78375	0.4273	.	.	.	0.80722	D	1	D	0.61080	0.989	D	0.72982	0.979	T	0.80493	-0.1358	8	0.87932	D	0	-8.2451	14.0663	0.64831	0.0:0.0:1.0:0.0	.	1	Q9BT56	SPXN_HUMAN	I	1	.	ENSP00000256969:M1I	M	+	3	0	C12orf39	21570676	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	4.712000	0.61888	2.780000	0.95670	0.585000	0.79938	ATG	.	.	.	none		0.303	C12orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402389.1		Missense_Mutation
KMT2D	8085	hgsc.bcm.edu	37	12	49416134	49416134	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:49416134A>C	ENST00000301067.7	-	52	16340	c.16341T>G	c.(16339-16341)aaT>aaG	p.N5447K		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5447	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGATGCCTCGATTCTAGAAAG	0.512																																					p.N5447K		Atlas-SNP	.											.	MLL2	1173	.	0			c.T16341G						PASS	.						45.0	44.0	44.0					12																	49416134		2076	4217	6293	SO:0001583	missense	8085	exon52			GCCTCGATTCTAG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.16341T>G	chr12.hg19:g.49416134A>C	ENSP00000301067:p.Asn5447Lys	21.0	0.0	.		26.0	14.0	.	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	A	13.01	2.109690	0.37242	.	.	ENSG00000167548	ENST00000301067;ENST00000526209	T;T	0.80824	-1.42;-1.42	5.11	0.159	0.14968	SET domain (3);	0.000000	0.38326	N	0.001723	D	0.85013	0.5600	L	0.60067	1.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82888	-0.0234	10	0.87932	D	0	.	10.057	0.42250	0.4781:0.0:0.5219:0.0	.	5447	O14686	MLL2_HUMAN	K	5447;128	ENSP00000301067:N5447K;ENSP00000435714:N128K	ENSP00000301067:N5447K	N	-	3	2	MLL2	47702401	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	1.117000	0.31234	-0.129000	0.11620	-0.256000	0.11100	AAT	.	.	.	none		0.512	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
ULK1	8408	hgsc.bcm.edu	37	12	132405713	132405713	+	Silent	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr12:132405713C>G	ENST00000321867.4	+	27	3381	c.3030C>G	c.(3028-3030)gcC>gcG	p.A1010A	ULK1_ENST00000540647.1_Silent_p.A255A	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	1010					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		ACCACAAGGCCCTGCTGCTCC	0.677																																					p.A1010A		Atlas-SNP	.											.	ULK1	92	.	0			c.C3030G						PASS	.						54.0	52.0	53.0					12																	132405713		2203	4299	6502	SO:0001819	synonymous_variant	8408	exon27			CAAGGCCCTGCTG	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.3030C>G	chr12.hg19:g.132405713C>G		89.0	0.0	.		96.0	53.0	.	NM_003565	Q9UQ28	Silent	SNP	ENST00000321867.4	hg19	CCDS9274.1																																																																																			.	.	.	none		0.677	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		
SSTR1	6751	hgsc.bcm.edu	37	14	38678657	38678657	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr14:38678657C>G	ENST00000267377.2	+	3	680	c.63C>G	c.(61-63)tgC>tgG	p.C21W		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	21					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.C21C(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	CGGGCAGCTGCGGCGAAGGCG	0.736																																					p.C21W		Atlas-SNP	.											SSTR1,brain,glioma,0,1	SSTR1	66	.	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C63G						PASS	.						12.0	13.0	13.0					14																	38678657		2183	4234	6417	SO:0001583	missense	6751	exon3			CAGCTGCGGCGAA		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.63C>G	chr14.hg19:g.38678657C>G	ENSP00000267377:p.Cys21Trp	28.0	0.0	.		13.0	2.0	.	NM_001049		Missense_Mutation	SNP	ENST00000267377.2	hg19	CCDS9666.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.608924	0.28623	.	.	ENSG00000139874	ENST00000267377	T	0.70045	-0.45	5.17	1.05	0.20165	.	0.310059	0.23375	N	0.048870	T	0.36496	0.0969	N	0.08118	0	0.39683	D	0.970939	P	0.35700	0.516	B	0.24541	0.054	T	0.12528	-1.0544	10	0.37606	T	0.19	.	8.1652	0.31222	0.0:0.6547:0.0:0.3453	.	21	P30872	SSR1_HUMAN	W	21	ENSP00000267377:C21W	ENSP00000267377:C21W	C	+	3	2	SSTR1	37748408	0.002000	0.14202	0.877000	0.34402	0.931000	0.56810	0.205000	0.17356	0.016000	0.14998	0.563000	0.77884	TGC	.	.	.	none		0.736	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2		
ARID4A	5926	hgsc.bcm.edu	37	14	58827680	58827680	+	Missense_Mutation	SNP	G	G	C	rs145426502		TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr14:58827680G>C	ENST00000355431.3	+	19	2373	c.2000G>C	c.(1999-2001)gGa>gCa	p.G667A	ARID4A_ENST00000348476.3_Missense_Mutation_p.G667A|ARID4A_ENST00000395168.3_Missense_Mutation_p.G667A|ARID4A_ENST00000431317.2_Missense_Mutation_p.G667A	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	667					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TCAAAACGGGGACGACCTCCT	0.443																																					p.G667A		Atlas-SNP	.											.	ARID4A	222	.	0			c.G2000C						PASS	.						172.0	159.0	163.0					14																	58827680		2203	4300	6503	SO:0001583	missense	5926	exon19			AACGGGGACGACC	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2000G>C	chr14.hg19:g.58827680G>C	ENSP00000347602:p.Gly667Ala	105.0	0.0	.		99.0	14.0	.	NM_002892	Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	hg19	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723941	0.89298	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	5.71	5.71	0.89125	Chromo domain-like (1);	0.105040	0.64402	D	0.000004	T	0.56124	0.1964	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.49790	-0.8902	10	0.35671	T	0.21	-26.8249	19.8505	0.96738	0.0:0.0:1.0:0.0	.	667;667;667	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	A	667;667;667;667;345	ENSP00000347602:G667A;ENSP00000344556:G667A;ENSP00000378597:G667A;ENSP00000397368:G667A;ENSP00000416053:G345A	ENSP00000344556:G667A	G	+	2	0	ARID4A	57897433	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.225000	0.78051	2.688000	0.91661	0.655000	0.94253	GGA	.	G|1.000;A|0.000	.	alt		0.443	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
CDAN1	146059	hgsc.bcm.edu	37	15	43023981	43023981	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr15:43023981C>T	ENST00000356231.3	-	11	1599	c.1576G>A	c.(1576-1578)Gag>Aag	p.E526K		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	526					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		TCTGGGGCCTCGCCCAAGACG	0.587																																					p.E526K		Atlas-SNP	.											.	CDAN1	70	.	0			c.G1576A						PASS	.						38.0	42.0	41.0					15																	43023981		2203	4299	6502	SO:0001583	missense	146059	exon11			GGGCCTCGCCCAA	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.1576G>A	chr15.hg19:g.43023981C>T	ENSP00000348564:p.Glu526Lys	102.0	0.0	.		103.0	35.0	.	NM_138477	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	hg19	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.074758	0.76415	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.90324	-2.65	5.9	4.99	0.66335	.	0.297879	0.39020	N	0.001487	D	0.92708	0.7682	M	0.65975	2.015	0.44432	D	0.997352	D	0.71674	0.998	P	0.54312	0.748	D	0.93041	0.6457	10	0.59425	D	0.04	-19.189	15.0277	0.71682	0.0:0.9321:0.0:0.0679	.	526	Q8IWY9	CDAN1_HUMAN	K	526;524	ENSP00000348564:E526K	ENSP00000267892:E524K	E	-	1	0	CDAN1	40811273	1.000000	0.71417	0.246000	0.24233	0.217000	0.24651	7.039000	0.76544	1.511000	0.48818	0.651000	0.88453	GAG	.	.	.	none		0.587	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
GNB5	10681	hgsc.bcm.edu	37	15	52446239	52446239	+	Silent	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr15:52446239C>T	ENST00000261837.7	-	4	338	c.273G>A	c.(271-273)ggG>ggA	p.G91G	GNB5_ENST00000560116.1_Silent_p.G49G|GNB5_ENST00000396335.4_Silent_p.G49G|GNB5_ENST00000358784.7_Silent_p.G49G	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	91					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		TGACAAACTGCCCCAGGGCCT	0.572																																					p.G91G		Atlas-SNP	.											.	GNB5	28	.	0			c.G273A						PASS	.						115.0	95.0	102.0					15																	52446239		2195	4293	6488	SO:0001819	synonymous_variant	10681	exon4			AAACTGCCCCAGG	AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.273G>A	chr15.hg19:g.52446239C>T		80.0	0.0	.		57.0	17.0	.	NM_016194	B2RBR5|Q9HAU9|Q9UFT3	Silent	SNP	ENST00000261837.7	hg19	CCDS10149.1																																																																																			.	.	.	none		0.572	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254842.1		
HERC1	8925	hgsc.bcm.edu	37	15	64021464	64021464	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr15:64021464C>T	ENST00000443617.2	-	16	3212	c.3125G>A	c.(3124-3126)tGg>tAg	p.W1042*		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1042					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						ACTGCCATTCCAAGGACTTTC	0.363																																					p.W1042X		Atlas-SNP	.											.	HERC1	624	.	0			c.G3125A						PASS	.						43.0	40.0	41.0					15																	64021464		1833	4095	5928	SO:0001587	stop_gained	8925	exon16			CCATTCCAAGGAC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.3125G>A	chr15.hg19:g.64021464C>T	ENSP00000390158:p.Trp1042*	40.0	0.0	.		25.0	4.0	.	NM_003922	Q8IW65	Nonsense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	41	8.909842	0.99000	.	.	ENSG00000103657	ENST00000443617	.	.	.	5.6	5.6	0.85130	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	19.6131	0.95618	0.0:1.0:0.0:0.0	.	.	.	.	X	1042	.	ENSP00000390158:W1042X	W	-	2	0	HERC1	61808517	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.840000	0.69402	2.652000	0.90054	0.561000	0.74099	TGG	.	.	.	none		0.363	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
AXIN1	8312	hgsc.bcm.edu	37	16	396884	396884	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:396884T>G	ENST00000262320.3	-	2	513	c.142A>C	c.(142-144)Aaa>Caa	p.K48Q	AXIN1_ENST00000354866.3_Missense_Mutation_p.K48Q|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	48					activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CCAACACCTTTCCCGGAGCAG	0.627											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.K48Q		Atlas-SNP	.											.	AXIN1	290	.	0			c.A142C						PASS	.						44.0	44.0	44.0					16																	396884		2202	4300	6502	SO:0001583	missense	8312	exon2			CACCTTTCCCGGA	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.142A>C	chr16.hg19:g.396884T>G	ENSP00000262320:p.Lys48Gln	59.0	0.0	.	588	70.0	39.0	.	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449477	0.63178	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.61980	0.06;0.07	5.34	5.34	0.76211	.	0.138741	0.64402	D	0.000005	T	0.77143	0.4087	M	0.74258	2.255	0.58432	D	0.999991	D;D	0.69078	0.997;0.996	D;P	0.63703	0.917;0.894	T	0.80051	-0.1544	10	0.62326	D	0.03	-17.2364	15.3197	0.74112	0.0:0.0:0.0:1.0	.	48;48	O15169-2;O15169	.;AXIN1_HUMAN	Q	48	ENSP00000262320:K48Q;ENSP00000346935:K48Q	ENSP00000262320:K48Q	K	-	1	0	AXIN1	336885	1.000000	0.71417	0.998000	0.56505	0.388000	0.30384	5.889000	0.69766	2.039000	0.60335	0.533000	0.62120	AAA	.	.	.	none		0.627	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
HAGH	3029	hgsc.bcm.edu	37	16	1869997	1869997	+	Silent	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:1869997A>G	ENST00000397356.3	-	4	739	c.333T>C	c.(331-333)aaT>aaC	p.N111N	HAGH_ENST00000455446.2_Silent_p.N111N|HAGH_ENST00000397353.2_Silent_p.N63N|HAGH_ENST00000566709.1_Silent_p.N63N	NM_005326.4	NP_005317.2	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase	111					glutathione biosynthetic process (GO:0006750)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			kidney(2)|lung(1)|ovary(1)|skin(1)	5		Hepatocellular(780;0.00335)			Glutathione(DB00143)	CCAGTTTCTCATTCCCGCCAG	0.617																																					p.N111N	Pancreas(55;1048 1176 25227 40124 41333)	Atlas-SNP	.											.	HAGH	20	.	0			c.T333C						PASS	.						95.0	78.0	83.0					16																	1869997		2199	4300	6499	SO:0001819	synonymous_variant	3029	exon4			TTTCTCATTCCCG	X90999	CCDS32366.1, CCDS10447.2, CCDS66900.1	16p13.3	2012-10-02	2003-11-04		ENSG00000063854	ENSG00000063854	3.1.2.6		4805	protein-coding gene	gene with protein product		138760	"""hydroxyacyl glutathione hydrolase"""			3025077, 7327557	Standard	NM_001286249		Approved	GLO2, GLXII, HAGH1	uc002cna.3	Q16775	OTTHUMG00000128662	ENST00000397356.3:c.333T>C	chr16.hg19:g.1869997A>G		122.0	0.0	.		135.0	26.0	.	NM_005326	A8K290|B4DP33|B4DRA7|E7EN93	Silent	SNP	ENST00000397356.3	hg19	CCDS10447.2																																																																																			.	.	.	none		0.617	HAGH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250548.2	NM_005326	
CREBBP	1387	hgsc.bcm.edu	37	16	3807907	3807907	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:3807907G>A	ENST00000262367.5	-	18	4321	c.3512C>T	c.(3511-3513)aCa>aTa	p.T1171I	CREBBP_ENST00000382070.3_Missense_Mutation_p.T1133I	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1171	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.|Interaction with ASF1A. {ECO:0000269|PubMed:24616510}.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GACTCGGGATGTCTTGCGATT	0.502			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.T1171I		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.C3512T	GRCh37	CI084721	CREBBP	I		PASS	.						148.0	125.0	133.0					16																	3807907		2197	4300	6497	SO:0001583	missense	1387	exon18			CGGGATGTCTTGC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3512C>T	chr16.hg19:g.3807907G>A	ENSP00000262367:p.Thr1171Ile	111.0	0.0	.		147.0	39.0	.	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	hg19	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279568	0.59758	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	T;T	0.19669	2.13;2.13	5.59	5.59	0.84812	Bromodomain (6);	0.000000	0.85682	D	0.000000	T	0.45236	0.1332	L	0.56199	1.76	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.83275	0.996;0.996	T	0.26608	-1.0098	10	0.62326	D	0.03	-14.9891	19.5896	0.95503	0.0:0.0:1.0:0.0	.	1201;1171	Q4LE28;Q92793	.;CBP_HUMAN	I	1171;1201;1133	ENSP00000262367:T1171I;ENSP00000371502:T1133I	ENSP00000262367:T1171I	T	-	2	0	CREBBP	3747908	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	9.731000	0.98807	2.632000	0.89209	0.585000	0.79938	ACA	.	.	.	none		0.502	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
GLYR1	84656	hgsc.bcm.edu	37	16	4895118	4895118	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:4895118C>G	ENST00000321919.9	-	3	188	c.112G>C	c.(112-114)Gga>Cga	p.G38R	UBN1_ENST00000262376.6_5'Flank|GLYR1_ENST00000436648.5_Missense_Mutation_p.G38R|UBN1_ENST00000545171.1_5'Flank|GLYR1_ENST00000381983.3_Missense_Mutation_p.G38R|GLYR1_ENST00000591451.1_Missense_Mutation_p.G38R	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	38	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						CATTTCTTTCCGCGAGGTTTC	0.463																																					p.G38R		Atlas-SNP	.											.	GLYR1	49	.	0			c.G112C						PASS	.						107.0	118.0	115.0					16																	4895118		2197	4300	6497	SO:0001583	missense	84656	exon3			TCTTTCCGCGAGG	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.112G>C	chr16.hg19:g.4895118C>G	ENSP00000322716:p.Gly38Arg	235.0	0.0	.		241.0	118.0	.	NM_032569	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	hg19	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062788	0.76187	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.70045	-0.45;-0.45;-0.45	5.25	5.25	0.73442	PWWP (2);	0.000000	0.85682	D	0.000000	T	0.72787	0.3504	N	0.25647	0.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.72424	-0.4298	10	0.37606	T	0.19	-9.014	17.6028	0.88030	0.0:1.0:0.0:0.0	.	38;38;38	Q49A26-5;Q49A26-3;Q49A26	.;.;GLYR1_HUMAN	R	38	ENSP00000322716:G38R;ENSP00000371413:G38R;ENSP00000390276:G38R	ENSP00000322716:G38R	G	-	1	0	GLYR1	4835119	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.931000	0.70113	2.451000	0.82905	0.491000	0.48974	GGA	.	.	.	none		0.463	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569	
PALB2	79728	hgsc.bcm.edu	37	16	23646368	23646368	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:23646368G>A	ENST00000261584.4	-	4	1651	c.1499C>T	c.(1498-1500)tCt>tTt	p.S500F		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	500	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		TGCCTTCCTAGACAAGTCATT	0.473			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.S500F		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	PALB2	108	.	0			c.C1499T						PASS	.						146.0	143.0	144.0					16																	23646368		2197	4300	6497	SO:0001583	missense	79728	exon4			TTCCTAGACAAGT		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1499C>T	chr16.hg19:g.23646368G>A	ENSP00000261584:p.Ser500Phe	194.0	0.0	.		242.0	64.0	.	NM_024675	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	hg19	CCDS32406.1	.	.	.	.	.	.	.	.	.	.	g	17.98	3.521575	0.64747	.	.	ENSG00000083093	ENST00000261584	T	0.17691	2.26	5.27	1.12	0.20585	.	0.782893	0.11510	N	0.556845	T	0.15955	0.0384	L	0.57536	1.79	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.27606	-1.0069	10	0.46703	T	0.11	-0.048	4.9673	0.14096	0.2567:0.1532:0.5902:0.0	.	500	Q86YC2	PALB2_HUMAN	F	500	ENSP00000261584:S500F	ENSP00000261584:S500F	S	-	2	0	PALB2	23553869	0.000000	0.05858	0.000000	0.03702	0.614000	0.37383	0.098000	0.15189	0.057000	0.16193	-0.121000	0.15023	TCT	.	.	.	none		0.473	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
CENPT	80152	hgsc.bcm.edu	37	16	67863889	67863889	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr16:67863889T>A	ENST00000562787.1	-	12	1513	c.965A>T	c.(964-966)gAa>gTa	p.E322V	CENPT_ENST00000440851.2_Missense_Mutation_p.E322V|CENPT_ENST00000219172.3_Missense_Mutation_p.E322V|CENPT_ENST00000562947.1_5'Flank|CENPT_ENST00000564817.1_Missense_Mutation_p.E322V	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	322	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GGGCTCTACTTCATCTTCTCC	0.532																																					p.E322V		Atlas-SNP	.											.	CENPT	26	.	0			c.A965T						PASS	.						189.0	187.0	188.0					16																	67863889		2040	4195	6235	SO:0001583	missense	80152	exon12			TCTACTTCATCTT	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.965A>T	chr16.hg19:g.67863889T>A	ENSP00000457810:p.Glu322Val	290.0	0.0	.		314.0	79.0	.	NM_025082	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	hg19	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502660	0.26949	.	.	ENSG00000102901	ENST00000440851;ENST00000436104;ENST00000219172	T;T	0.43294	0.95;0.95	4.08	-1.05	0.10036	.	0.294496	0.23852	N	0.043925	T	0.23249	0.0562	L	0.29908	0.895	0.26493	N	0.974919	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.004;0.002;0.001	T	0.07635	-1.0762	10	0.42905	T	0.14	.	3.7971	0.08744	0.1696:0.5023:0.0:0.3281	.	80;322;322	F5H5A6;Q96BT3;B3KPB2	.;CENPT_HUMAN;.	V	322;80;322	ENSP00000400140:E322V;ENSP00000219172:E322V	ENSP00000219172:E322V	E	-	2	0	CENPT	66421390	0.000000	0.05858	0.023000	0.16930	0.019000	0.09904	-1.893000	0.01609	0.003000	0.14656	-0.313000	0.08912	GAA	.	.	.	none		0.532	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
KDM6B	23135	hgsc.bcm.edu	37	17	7755333	7755333	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr17:7755333G>C	ENST00000448097.2	+	18	4561	c.4230G>C	c.(4228-4230)tgG>tgC	p.W1410C	KDM6B_ENST00000254846.5_Missense_Mutation_p.W1410C			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1410	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						ACTGCGAGTGGTTCGCGGTGC	0.627											OREG0024145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W1410C		Atlas-SNP	.											.	KDM6B	95	.	0			c.G4230C						PASS	.						93.0	80.0	84.0					17																	7755333		2203	4300	6503	SO:0001583	missense	23135	exon18			CGAGTGGTTCGCG	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.4230G>C	chr17.hg19:g.7755333G>C	ENSP00000412513:p.Trp1410Cys	86.0	0.0	.	644	71.0	14.0	.	NM_001080424	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	hg19		.	.	.	.	.	.	.	.	.	.	G	14.04	2.416033	0.42817	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	D;D	0.86230	-2.09;-2.09	4.99	3.95	0.45737	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.062767	0.64402	D	0.000002	D	0.95194	0.8442	H	0.95780	3.72	0.80722	D	1	D;B	0.89917	1.0;0.058	D;B	0.97110	1.0;0.064	D	0.95975	0.8973	10	0.87932	D	0	-8.7797	15.1416	0.72615	0.0:0.1428:0.8572:0.0	.	1410;1410	O15054;O15054-1	KDM6B_HUMAN;.	C	1410	ENSP00000254846:W1410C;ENSP00000412513:W1410C	ENSP00000254846:W1410C	W	+	3	0	KDM6B	7696058	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.404000	0.79996	2.769000	0.95229	0.561000	0.74099	TGG	.	.	.	none		0.627	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
KRT33A	3883	hgsc.bcm.edu	37	17	39505660	39505660	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr17:39505660C>G	ENST00000007735.3	-	2	413	c.369G>C	c.(367-369)gaG>gaC	p.E123D		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	123	Coil 1B.|Rod.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				GCCTGGCATTCTCAGACTTGC	0.478																																					p.E123D		Atlas-SNP	.											.	KRT33A	53	.	0			c.G369C						PASS	.						110.0	100.0	104.0					17																	39505660		2203	4300	6503	SO:0001583	missense	3883	exon2			GGCATTCTCAGAC	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.369G>C	chr17.hg19:g.39505660C>G	ENSP00000007735:p.Glu123Asp	70.0	0.0	.		74.0	32.0	.	NM_004138	B2RA87|Q6NTB9|Q6ZZB9	Missense_Mutation	SNP	ENST00000007735.3	hg19	CCDS11388.1	.	.	.	.	.	.	.	.	.	.	C	12.38	1.920429	0.33908	.	.	ENSG00000006059	ENST00000007735	D	0.89617	-2.54	4.8	4.8	0.61643	Filament (1);	0.000000	0.64402	D	0.000019	D	0.84750	0.5541	L	0.42744	1.35	0.31832	N	0.624605	B	0.22211	0.066	B	0.34385	0.181	T	0.80443	-0.1380	10	0.27082	T	0.32	.	8.7524	0.34626	0.1523:0.572:0.2757:0.0	.	123	O76009	KT33A_HUMAN	D	123	ENSP00000007735:E123D	ENSP00000007735:E123D	E	-	3	2	KRT33A	36759186	0.937000	0.31787	1.000000	0.80357	0.994000	0.84299	0.006000	0.13152	2.643000	0.89663	0.655000	0.94253	GAG	.	.	.	none		0.478	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	NM_004138	
SCRN2	90507	hgsc.bcm.edu	37	17	45916322	45916322	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr17:45916322C>A	ENST00000290216.9	-	5	732	c.607G>T	c.(607-609)Gcc>Tcc	p.A203S	SCRN2_ENST00000584123.1_Missense_Mutation_p.A211S|SCRN2_ENST00000407215.3_Missense_Mutation_p.A203S	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	203						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						GGGTGTTGGGCCGAGATGTCC	0.592																																					p.A203S		Atlas-SNP	.											.	SCRN2	35	.	0			c.G607T						PASS	.						85.0	89.0	88.0					17																	45916322		2203	4300	6503	SO:0001583	missense	90507	exon5			GTTGGGCCGAGAT	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.607G>T	chr17.hg19:g.45916322C>A	ENSP00000290216:p.Ala203Ser	219.0	0.0	.		177.0	57.0	.	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	hg19	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	C	1.216	-0.628224	0.03610	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.20881	2.04;2.04	5.52	5.52	0.82312	.	0.215480	0.47455	D	0.000225	T	0.15392	0.0371	L	0.37630	1.12	0.09310	N	1	B;B;B	0.25850	0.051;0.136;0.051	B;B;B	0.27608	0.081;0.081;0.081	T	0.25606	-1.0127	10	0.07482	T	0.82	-11.1584	11.6628	0.51356	0.0:0.9174:0.0:0.0825	.	203;203;203	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	S	203	ENSP00000290216:A203S;ENSP00000383935:A203S	ENSP00000290216:A203S	A	-	1	0	SCRN2	43271321	0.000000	0.05858	0.026000	0.17262	0.066000	0.16364	0.485000	0.22324	2.588000	0.87417	0.655000	0.94253	GCC	.	.	.	none		0.592	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
NARF	26502	hgsc.bcm.edu	37	17	80443450	80443450	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr17:80443450G>A	ENST00000309794.11	+	10	1247	c.1049G>A	c.(1048-1050)cGa>cAa	p.R350Q	NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000457415.3_Missense_Mutation_p.R396Q|NARF_ENST00000345415.7_Missense_Mutation_p.R302Q|NARF_ENST00000390006.4_Missense_Mutation_p.R291Q	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	350						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TATGGCTTTCGAAACATCCAG	0.493																																					p.R350Q		Atlas-SNP	.											.	NARF	51	.	0			c.G1049A						PASS	.						151.0	133.0	139.0					17																	80443450		2203	4300	6503	SO:0001583	missense	26502	exon10			GCTTTCGAAACAT	BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.1049G>A	chr17.hg19:g.80443450G>A	ENSP00000309899:p.Arg350Gln	156.0	0.0	.		142.0	18.0	.	NM_012336	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	ENST00000309794.11	hg19	CCDS32777.1	.	.	.	.	.	.	.	.	.	.	.	16.94	3.261532	0.59431	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.47177	0.85;0.85;0.85	5.32	5.32	0.75619	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.63355	0.2504	M	0.77406	2.37	0.80722	D	1	D;D;D;P	0.55605	0.972;0.972;0.961;0.895	P;P;P;P	0.54140	0.743;0.743;0.727;0.473	T	0.63332	-0.6661	10	0.33940	T	0.23	-19.4724	17.9724	0.89117	0.0:0.0:1.0:0.0	.	396;302;397;350	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	Q	291;397;350;302	ENSP00000374656:R291Q;ENSP00000309899:R350Q;ENSP00000283996:R302Q	ENSP00000309899:R350Q	R	+	2	0	NARF	78036739	1.000000	0.71417	0.941000	0.38009	0.854000	0.48673	9.273000	0.95719	2.480000	0.83734	0.561000	0.74099	CGA	.	.	.	none		0.493	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2	NM_031968	
EPB41L3	23136	hgsc.bcm.edu	37	18	5394764	5394764	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr18:5394764T>G	ENST00000341928.2	-	22	3522	c.3182A>C	c.(3181-3183)aAa>aCa	p.K1061T	EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000540638.2_Missense_Mutation_p.K839T|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000427684.2_Missense_Mutation_p.K358T|EPB41L3_ENST00000400111.3_Missense_Mutation_p.K839T|EPB41L3_ENST00000542146.1_Missense_Mutation_p.K366T|EPB41L3_ENST00000342933.3_Missense_Mutation_p.K1061T	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	1061	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GTGCTGCTCTTTGGCCTCTTT	0.498																																					p.K1061T		Atlas-SNP	.											.	EPB41L3	222	.	0			c.A3182C						PASS	.						208.0	171.0	184.0					18																	5394764		2203	4300	6503	SO:0001583	missense	23136	exon22			TGCTCTTTGGCCT	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.3182A>C	chr18.hg19:g.5394764T>G	ENSP00000343158:p.Lys1061Thr	133.0	0.0	.		125.0	46.0	.	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	hg19	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.858556	0.91433	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;D;T;T;T;T	0.85339	-1.48;-1.97;-1.48;-1.48;-1.48;-1.48	5.82	5.82	0.92795	Band 4.1, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89996	0.6877	L	0.49126	1.545	0.80722	D	1	D;D;D;D;P;D;P	0.89917	1.0;1.0;1.0;1.0;0.66;1.0;0.887	D;D;D;D;B;D;P	0.91635	0.996;0.99;0.994;0.998;0.376;0.999;0.809	D	0.88953	0.3388	10	0.36615	T	0.2	.	16.1814	0.81903	0.0:0.0:0.0:1.0	.	358;366;453;730;839;1061;296	E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;E41L3_HUMAN;.	T	1061;730;730;358;366;1061;839	ENSP00000343158:K1061T;ENSP00000442091:K730T;ENSP00000392195:K358T;ENSP00000442233:K366T;ENSP00000341138:K1061T;ENSP00000382981:K839T	ENSP00000343158:K1061T	K	-	2	0	EPB41L3	5384764	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.991000	0.88244	2.234000	0.73211	0.533000	0.62120	AAA	.	.	.	none		0.498	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
STK11	6794	hgsc.bcm.edu	37	19	1223168	1223168	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:1223168C>T	ENST00000326873.7	+	8	2278	c.1105C>T	c.(1105-1107)Ccc>Tcc	p.P369S		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	369					activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCACGGTGCCCGGTGAGTC	0.642		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																											p.P369S		Atlas-SNP	.	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	.	STK11	410	.	20	Whole gene deletion(20)	cervix(14)|lung(2)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	c.C1105T						PASS	.						36.0	45.0	42.0					19																	1223168		2094	4215	6309	SO:0001583	missense	6794	exon8	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	ACGGTGCCCGGTG	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.1105C>T	chr19.hg19:g.1223168C>T	ENSP00000324856:p.Pro369Ser	26.0	0.0	.		23.0	10.0	.	NM_000455	B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	hg19	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	.	15.23	2.770635	0.49680	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	T	0.68181	-0.31	3.66	3.66	0.41972	.	0.115197	0.64402	N	0.000011	T	0.62889	0.2465	M	0.71581	2.175	0.80722	D	1	P	0.40398	0.716	B	0.39339	0.297	T	0.62728	-0.6793	10	0.10636	T	0.68	-19.522	14.5402	0.67987	0.0:1.0:0.0:0.0	.	369	Q15831	STK11_HUMAN	S	369	ENSP00000324856:P369S	ENSP00000324856:P369S	P	+	1	0	STK11	1174168	1.000000	0.71417	1.000000	0.80357	0.216000	0.24613	7.025000	0.76449	1.884000	0.54569	0.313000	0.20887	CCC	.	.	.	none		0.642	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	
ZNF433	163059	hgsc.bcm.edu	37	19	12126384	12126384	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:12126384G>T	ENST00000344980.6	-	4	1468	c.1298C>A	c.(1297-1299)tCt>tAt	p.S433Y	CTD-2006C1.2_ENST00000406892.2_RNA|CTD-2006C1.2_ENST00000495324.1_RNA|ZNF433_ENST00000419886.2_Missense_Mutation_p.S398Y|CTD-2006C1.2_ENST00000476474.1_RNA	NM_001080411.1	NP_001073880.1	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|skin(1)	14						GAGTGAGGCAGATCTGAAGGC	0.418																																					p.S433Y		Atlas-SNP	.											.	ZNF433	49	.	0			c.C1298A						PASS	.						93.0	97.0	96.0					19																	12126384		2202	4300	6502	SO:0001583	missense	163059	exon4			GAGGCAGATCTGA	AK098300	CCDS45983.1	19p13.13	2013-01-08			ENSG00000197647	ENSG00000197647		"""Zinc fingers, C2H2-type"", ""-"""	20811	protein-coding gene	gene with protein product							Standard	NM_001080411		Approved	FLJ40981	uc002msy.1	Q8N7K0	OTTHUMG00000156427	ENST00000344980.6:c.1298C>A	chr19.hg19:g.12126384G>T	ENSP00000339767:p.Ser433Tyr	128.0	0.0	.		118.0	34.0	.	NM_001080411	Q86VX3	Missense_Mutation	SNP	ENST00000344980.6	hg19	CCDS45983.1	.	.	.	.	.	.	.	.	.	.	G	1.694	-0.503274	0.04261	.	.	ENSG00000197647	ENST00000419886;ENST00000344980	T;T	0.06608	3.28;3.28	1.18	-2.37	0.06643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06462	0.0166	L	0.45744	1.44	0.09310	N	1	D	0.56746	0.977	P	0.53224	0.721	T	0.16217	-1.0410	9	0.02654	T	1	.	0.9392	0.01351	0.1557:0.2904:0.2991:0.2549	.	433	Q8N7K0	ZN433_HUMAN	Y	398;433	ENSP00000393416:S398Y;ENSP00000339767:S433Y	ENSP00000339767:S433Y	S	-	2	0	ZNF433	11987384	0.000000	0.05858	0.000000	0.03702	0.881000	0.50899	-3.866000	0.00347	-1.541000	0.01727	0.298000	0.19748	TCT	.	.	.	none		0.418	ZNF433-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403716.1	NM_152602	
KIAA1683	80726	hgsc.bcm.edu	37	19	18368726	18368726	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:18368726C>G	ENST00000600328.3	-	4	3000	c.2807G>C	c.(2806-2808)gGc>gCc	p.G936A	PDE4C_ENST00000596647.1_5'Flank|KIAA1683_ENST00000392413.4_Missense_Mutation_p.G1123A|KIAA1683_ENST00000600359.3_Missense_Mutation_p.G890A|PDE4C_ENST00000355502.3_5'Flank			Q9H0B3	K1683_HUMAN	KIAA1683	936	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GCCACGGACGCCCGCCTGGAT	0.672																																					p.G1123A		Atlas-SNP	.											.	KIAA1683	190	.	0			c.G3368C						PASS	.						51.0	53.0	52.0					19																	18368726		2201	4295	6496	SO:0001583	missense	80726	exon4			CGGACGCCCGCCT	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.2807G>C	chr19.hg19:g.18368726C>G	ENSP00000470780:p.Gly936Ala	121.0	0.0	.		127.0	41.0	.	NM_001145304	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	hg19	CCDS32958.1	.	.	.	.	.	.	.	.	.	.	C	8.574	0.880834	0.17467	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000411671	T;T;T	0.21932	1.98;1.98;1.98	4.33	-0.667	0.11395	.	0.473857	0.15866	N	0.240773	T	0.09992	0.0245	N	0.10972	0.075	0.09310	N	1	B;P	0.38148	0.101;0.62	B;P	0.45610	0.073;0.487	T	0.16988	-1.0384	10	0.16896	T	0.51	-0.3503	0.5212	0.00612	0.1866:0.3422:0.2124:0.2589	.	1123;936	E9PDE0;Q9H0B3	.;K1683_HUMAN	A	1123;936;890;200;550	ENSP00000376213:G1123A;ENSP00000352774:G936A;ENSP00000404501:G890A	ENSP00000352774:G936A	G	-	2	0	KIAA1683	18229726	0.000000	0.05858	0.002000	0.10522	0.074000	0.17049	0.457000	0.21875	0.249000	0.21456	0.313000	0.20887	GGC	.	.	.	none		0.672	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3		
ZNF681	148213	hgsc.bcm.edu	37	19	23927146	23927146	+	Silent	SNP	A	A	G			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:23927146A>G	ENST00000402377.3	-	4	1347	c.1206T>C	c.(1204-1206)gcT>gcC	p.A402A	ZNF681_ENST00000395385.3_Silent_p.A333A	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ACTTGTTAAAAGCTTTGCCAC	0.398																																					p.A402A		Atlas-SNP	.											ZNF681,bladder,carcinoma,0,8	ZNF681	76	.	0			c.T1206C						PASS	.						69.0	74.0	72.0					19																	23927146		2203	4300	6503	SO:0001819	synonymous_variant	148213	exon4			GTTAAAAGCTTTG	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1206T>C	chr19.hg19:g.23927146A>G		72.0	2.0	.		74.0	3.0	.	NM_138286	B3KVF7	Silent	SNP	ENST00000402377.3	hg19	CCDS12414.2																																																																																			.	.	.	none		0.398	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
U2AF2	11338	hgsc.bcm.edu	37	19	56180114	56180114	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr19:56180114G>A	ENST00000308924.4	+	9	941	c.901G>A	c.(901-903)Ggc>Agc	p.G301S	CTD-2537I9.13_ENST00000592252.1_RNA|U2AF2_ENST00000590551.1_Missense_Mutation_p.G137S|U2AF2_ENST00000450554.2_Missense_Mutation_p.G301S|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	301	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GCTCTCCAAGGGCTACGCCTT	0.617																																					p.G301S		Atlas-SNP	.											.	U2AF2	62	.	0			c.G901A						PASS	.						68.0	65.0	66.0					19																	56180114		2203	4300	6503	SO:0001583	missense	11338	exon9			TCCAAGGGCTACG	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.901G>A	chr19.hg19:g.56180114G>A	ENSP00000307863:p.Gly301Ser	148.0	0.0	.		91.0	30.0	.	NM_001012478	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	hg19	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	G	35	5.448539	0.96205	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	D;T	0.83419	-1.72;0.1	4.4	4.4	0.53042	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.94683	0.8285	H	0.98646	4.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96949	0.9693	10	0.87932	D	0	-32.268	16.1527	0.81634	0.0:0.0:1.0:0.0	.	301;301	P26368;P26368-2	U2AF2_HUMAN;.	S	301	ENSP00000307863:G301S;ENSP00000388475:G301S	ENSP00000307863:G301S	G	+	1	0	U2AF2	60871926	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.145000	0.94634	2.184000	0.69523	0.655000	0.94253	GGC	.	.	.	none		0.617	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279	
TBC1D20	128637	hgsc.bcm.edu	37	20	419913	419913	+	Silent	SNP	G	G	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:419913G>T	ENST00000354200.4	-	7	942	c.795C>A	c.(793-795)gtC>gtA	p.V265V	TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20	265					acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				CACAGTCCAGGACTTCCTGCT	0.562																																					p.V265V		Atlas-SNP	.											.	TBC1D20	34	.	0			c.C795A						PASS	.						137.0	118.0	124.0					20																	419913		2203	4300	6503	SO:0001819	synonymous_variant	128637	exon7			GTCCAGGACTTCC	AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.795C>A	chr20.hg19:g.419913G>T		82.0	0.0	.		81.0	48.0	.	NM_144628	A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	Silent	SNP	ENST00000354200.4	hg19	CCDS13002.1																																																																																			.	.	.	none		0.562	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251397.2	NM_144628	
NCOA6	23054	hgsc.bcm.edu	37	20	33345756	33345756	+	Silent	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:33345756T>C	ENST00000374796.2	-	8	3365	c.795A>G	c.(793-795)caA>caG	p.Q265Q	NCOA6_ENST00000359003.2_Silent_p.Q265Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	265	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q265Q(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gttgttgttgttgctgctgct	0.537																																					p.Q265Q		Atlas-SNP	.											NCOA6,bladder,carcinoma,0,2	NCOA6	219	.	1	Substitution - coding silent(1)	central_nervous_system(1)	c.A795G						PASS	.						62.0	52.0	55.0					20																	33345756		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			TTGTTGTTGCTGC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.795A>G	chr20.hg19:g.33345756T>C		59.0	0.0	.		95.0	5.0	.	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	hg19	CCDS13241.1																																																																																			.	.	.	none		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
FAM65C	140876	hgsc.bcm.edu	37	20	49219116	49219116	+	Silent	SNP	G	G	A			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:49219116G>A	ENST00000327979.2	-	13	1551	c.1140C>T	c.(1138-1140)ctC>ctT	p.L380L	FAM65C_ENST00000535356.1_Silent_p.L384L|FAM65C_ENST00000045083.2_Silent_p.L380L			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	380										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACAGGTAGCTGAGGATGGAGG	0.637																																					p.L380L		Atlas-SNP	.											.	FAM65C	87	.	0			c.C1140T						PASS	.						26.0	28.0	27.0					20																	49219116		2061	4109	6170	SO:0001819	synonymous_variant	140876	exon13			GTAGCTGAGGATG	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.1140C>T	chr20.hg19:g.49219116G>A		90.0	0.0	.		115.0	24.0	.	NM_080829	Q5QPB6|Q9NQQ2	Silent	SNP	ENST00000327979.2	hg19	CCDS13431.2																																																																																			.	.	.	none		0.637	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
CYP24A1	1591	hgsc.bcm.edu	37	20	52773943	52773943	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr20:52773943T>C	ENST00000216862.3	-	10	1811	c.1418A>G	c.(1417-1419)cAt>cGt	p.H473R	CYP24A1_ENST00000395955.3_Intron|CYP24A1_ENST00000460643.1_5'Flank|CYP24A1_ENST00000395954.3_Missense_Mutation_p.H331R	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	473					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	AAGAGCCAAATGCAGTTGAAG	0.423																																					p.H473R		Atlas-SNP	.											.	CYP24A1	75	.	0			c.A1418G						PASS	.						81.0	76.0	78.0					20																	52773943		2203	4300	6503	SO:0001583	missense	1591	exon10			GCCAAATGCAGTT	U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.1418A>G	chr20.hg19:g.52773943T>C	ENSP00000216862:p.His473Arg	74.0	0.0	.		85.0	42.0	.	NM_000782	Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	ENST00000216862.3	hg19	CCDS33491.1	.	.	.	.	.	.	.	.	.	.	t	15.34	2.805491	0.50315	.	.	ENSG00000019186	ENST00000216862;ENST00000395954	T;T	0.67345	-0.26;-0.26	5.2	4.06	0.47325	.	0.101356	0.64402	D	0.000001	T	0.63698	0.2533	N	0.25992	0.78	0.41376	D	0.987529	D;P	0.54964	0.969;0.934	P;B	0.55161	0.77;0.424	T	0.60979	-0.7155	10	0.33141	T	0.24	-19.4807	11.563	0.50788	0.0:0.0:0.1498:0.8502	.	473;331	Q07973;Q5I2W7	CP24A_HUMAN;.	R	473;331	ENSP00000216862:H473R;ENSP00000379284:H331R	ENSP00000216862:H473R	H	-	2	0	CYP24A1	52207350	1.000000	0.71417	0.969000	0.41365	0.303000	0.27691	4.744000	0.62118	0.884000	0.36064	0.451000	0.29950	CAT	.	.	.	none		0.423	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079769.2		
APP	351	hgsc.bcm.edu	37	21	27348294	27348294	+	Silent	SNP	A	A	C			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr21:27348294A>C	ENST00000346798.3	-	10	1305	c.1272T>G	c.(1270-1272)ccT>ccG	p.P424P	APP_ENST00000359726.3_Silent_p.P368P|APP_ENST00000357903.3_Silent_p.P405P|APP_ENST00000440126.3_Silent_p.P400P|APP_ENST00000439274.2_Silent_p.P368P|APP_ENST00000348990.5_Silent_p.P349P|APP_ENST00000358918.3_Silent_p.P424P|APP_ENST00000448388.2_Silent_p.P314P|APP_ENST00000354192.3_Silent_p.P293P	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	424					adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				TATCAGCTTTAGGCAAGTTCT	0.383																																					p.P424P		Atlas-SNP	.											.	APP	90	.	0			c.T1272G						PASS	.						249.0	199.0	216.0					21																	27348294		2203	4300	6503	SO:0001819	synonymous_variant	351	exon10			AGCTTTAGGCAAG	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1272T>G	chr21.hg19:g.27348294A>C		94.0	0.0	.		96.0	28.0	.	NM_000484	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Silent	SNP	ENST00000346798.3	hg19	CCDS13576.1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.472507	0.26423	.	.	ENSG00000142192	ENST00000448850;ENST00000415997	.	.	.	5.11	-5.12	0.02893	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.1356	2.2262	0.03985	0.1134:0.1931:0.3431:0.3504	.	.	.	.	E	327;159	.	.	X	-	1	0	APP	26270165	0.085000	0.21516	0.973000	0.42090	0.999000	0.98932	-0.688000	0.05150	-0.726000	0.04895	0.529000	0.55759	TAA	.	.	.	none		0.383	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484	
WNK3	65267	hgsc.bcm.edu	37	X	54259340	54259340	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chrX:54259340A>T	ENST00000375159.2	-	20	4741	c.4742T>A	c.(4741-4743)tTg>tAg	p.L1581*	WNK3_ENST00000375169.3_Nonsense_Mutation_p.L1534*|WNK3_ENST00000354646.2_Nonsense_Mutation_p.L1581*			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1581					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TGCAGGTGGCAAAGGAATCTC	0.473																																					p.L1581X		Atlas-SNP	.											.	WNK3	218	.	0			c.T4742A						PASS	.						161.0	143.0	149.0					X																	54259340		2203	4300	6503	SO:0001587	stop_gained	65267	exon21			GGTGGCAAAGGAA	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.4742T>A	chrX.hg19:g.54259340A>T	ENSP00000364301:p.Leu1581*	91.0	0.0	.		99.0	4.0	.	NM_020922	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Nonsense_Mutation	SNP	ENST00000375159.2	hg19	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	A	44	10.908169	0.99487	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	.	.	.	5.69	3.25	0.37280	.	0.330632	0.21916	N	0.067229	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0621	4.1221	0.10109	0.6809:0.0:0.1657:0.1534	.	.	.	.	X	1534;1581;1581	.	ENSP00000346667:L1581X	L	-	2	0	WNK3	54276065	0.522000	0.26266	0.845000	0.33349	0.967000	0.64934	1.485000	0.35519	0.262000	0.21774	0.481000	0.45027	TTG	.	.	.	none		0.473	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
TMF1	7110	hgsc.bcm.edu	37	3	69096768	69096770	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr3:69096768_69096770delGAA	ENST00000398559.2	-	2	1302_1304	c.1086_1088delTTC	c.(1084-1089)tcttca>tca	p.362_363SS>S	MIR3136_ENST00000583498.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|TMF1_ENST00000543976.1_In_Frame_Del_p.362_363SS>S|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	362					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CTTTGGAGTTGAAGAATTAACTA	0.355																																					p.363_363del		Atlas-INDEL	.											.	TMF1	77	.	0			c.1087_1089del						PASS	.																																			SO:0001651	inframe_deletion	7110	exon2			.		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.1086_1088delTTC	chr3.hg19:g.69096771_69096773delGAA	ENSP00000381567:p.Ser363del	88.0	0.0	0		98.0	27.0	0.27551	NM_007114	B7ZLJ2|Q17R87|Q59GK0	In_Frame_Del	DEL	ENST00000398559.2	hg19	CCDS43105.1																																																																																			.	.	.	none		0.355	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
GPR113	165082	hgsc.bcm.edu	37	2	26533773	26533773	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-7997-01A-11D-2201-08	TCGA-A4-7997-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af158dec-5dad-4b6e-ad38-057aa9b6203c	df84187c-0ad5-45ed-9df9-6402364de115	g.chr2:26533773delC	ENST00000311519.1	-	11	2822	c.2823delG	c.(2821-2823)gggfs	p.G941fs	GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000333478.6_Frame_Shift_Del_p.G742fs|GPR113_ENST00000541401.1_Frame_Shift_Del_p.G544fs|GPR113_ENST00000421160.2_Frame_Shift_Del_p.G872fs	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	941					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTAGTACCAGCCCATTCACGC	0.597																																					p.L942fs		Atlas-INDEL	.											.	GPR113	134	.	0			c.2824delC						PASS	.						58.0	51.0	53.0					2																	26533773		2203	4300	6503	SO:0001589	frameshift_variant	165082	exon11			.	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.2823delG	chr2.hg19:g.26533773delC	ENSP00000307831:p.Gly941fs	36.0	0.0	0		39.0	18.0	0.461538	NM_001145168	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Frame_Shift_Del	DEL	ENST00000311519.1	hg19	CCDS46239.1																																																																																			.	.	.	none		0.597	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
