#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LDLRAP1	26119	hgsc.bcm.edu	37	1	25889193	25889193	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:25889193A>G	ENST00000374338.4	+	5	637	c.518A>G	c.(517-519)cAg>cGg	p.Q173R	LDLRAP1_ENST00000488127.1_3'UTR	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1	173	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		GAGTTTTGGCAGGTGTCCAAG	0.572																																					p.Q173R		Atlas-SNP	.											.	LDLRAP1	28	.	0			c.A518G						PASS	.						139.0	124.0	129.0					1																	25889193		2203	4300	6503	SO:0001583	missense	26119	exon5			TTTGGCAGGTGTC	BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.518A>G	chr1.hg19:g.25889193A>G	ENSP00000363458:p.Gln173Arg	77.0	0.0	.		68.0	28.0	.	NM_015627	A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	Missense_Mutation	SNP	ENST00000374338.4	hg19	CCDS30639.1	.	.	.	.	.	.	.	.	.	.	A	19.60	3.858315	0.71834	.	.	ENSG00000157978	ENST00000374338	T	0.64260	-0.09	5.56	5.56	0.83823	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.65101	0.2659	L	0.49350	1.555	0.58432	D	0.999998	B	0.25105	0.118	B	0.39339	0.297	T	0.63950	-0.6521	10	0.45353	T	0.12	-17.9581	14.8888	0.70590	1.0:0.0:0.0:0.0	.	173	Q5SW96	ARH_HUMAN	R	173	ENSP00000363458:Q173R	ENSP00000363458:Q173R	Q	+	2	0	LDLRAP1	25761780	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.809000	0.91944	2.117000	0.64856	0.454000	0.30748	CAG	.	.	.	none		0.572	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019350.3	NM_015627	
GTF2B	2959	hgsc.bcm.edu	37	1	89325567	89325567	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:89325567T>C	ENST00000370500.5	-	5	651	c.533A>G	c.(532-534)aAa>aGa	p.K178R	GTF2B_ENST00000494819.1_5'UTR	NM_001514.5	NP_001505.1	Q00403	TF2B_HUMAN	general transcription factor IIB	178					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)	core promoter binding (GO:0001047)|thyroid hormone receptor binding (GO:0046966)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		AAACTTACCTTTAAATGTCCT	0.418																																					p.K178R		Atlas-SNP	.											.	GTF2B	32	.	0			c.A533G						PASS	.						118.0	124.0	122.0					1																	89325567		2203	4300	6503	SO:0001583	missense	2959	exon5			TTACCTTTAAATG	M76766	CCDS715.1	1p22-p21	2010-03-23			ENSG00000137947	ENSG00000137947		"""General transcription factors"""	4648	protein-coding gene	gene with protein product		189963				1876184, 8162052	Standard	NM_001514		Approved	TFIIB	uc001dmo.4	Q00403	OTTHUMG00000010611	ENST00000370500.5:c.533A>G	chr1.hg19:g.89325567T>C	ENSP00000359531:p.Lys178Arg	121.0	0.0	.		101.0	46.0	.	NM_001514	A8K1A7|Q5JS30	Missense_Mutation	SNP	ENST00000370500.5	hg19	CCDS715.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.308867	0.81247	.	.	ENSG00000137947	ENST00000370500;ENST00000448623;ENST00000418217	T;T;T	0.51574	0.77;0.7;0.7	5.52	5.52	0.82312	Transcription factor TFIIB, cyclin-related (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.52933	0.1765	L	0.48174	1.505	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.50171	-0.8859	10	0.34782	T	0.22	-32.0439	15.9344	0.79691	0.0:0.0:0.0:1.0	.	178	Q00403	TF2B_HUMAN	R	178;177;173	ENSP00000359531:K178R;ENSP00000415741:K177R;ENSP00000402345:K173R	ENSP00000359531:K178R	K	-	2	0	GTF2B	89098155	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.587000	0.82613	2.214000	0.71695	0.482000	0.46254	AAA	.	.	.	none		0.418	GTF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029279.1	NM_001514	
GOLPH3L	55204	hgsc.bcm.edu	37	1	150634375	150634375	+	Silent	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:150634375A>T	ENST00000271732.3	-	4	389	c.345T>A	c.(343-345)ggT>ggA	p.G115G	GOLPH3L_ENST00000540514.1_Silent_p.G71G	NM_018178.5	NP_060648.2	Q9H4A5	GLP3L_HUMAN	golgi phosphoprotein 3-like	115					Golgi organization (GO:0007030)|positive regulation of protein secretion (GO:0050714)	Golgi membrane (GO:0000139)|trans-Golgi network membrane (GO:0032588)	phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			GTAAAACATCACCTGTTGGGC	0.383																																					p.G115G		Atlas-SNP	.											.	GOLPH3L	20	.	0			c.T345A						PASS	.						167.0	160.0	162.0					1																	150634375		2203	4300	6503	SO:0001819	synonymous_variant	55204	exon4			AACATCACCTGTT	AJ296153	CCDS966.1	1q21	2008-02-05			ENSG00000143457	ENSG00000143457			24882	protein-coding gene	gene with protein product		612208					Standard	NM_018178		Approved	GPP34R	uc001evj.2	Q9H4A5	OTTHUMG00000035009	ENST00000271732.3:c.345T>A	chr1.hg19:g.150634375A>T		92.0	0.0	.		110.0	39.0	.	NM_018178	B1AN09|B7Z6N3|Q9NVK0	Silent	SNP	ENST00000271732.3	hg19	CCDS966.1																																																																																			.	.	.	none		0.383	GOLPH3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084734.1	NM_018178	
DENND4B	9909	hgsc.bcm.edu	37	1	153915526	153915526	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:153915526A>T	ENST00000361217.4	-	3	816	c.398T>A	c.(397-399)cTg>cAg	p.L133Q		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	133	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGGAGGGGCCAGGTTTGCTGA	0.637																																					p.L133Q		Atlas-SNP	.											.	DENND4B	210	.	0			c.T398A						PASS	.						62.0	73.0	70.0					1																	153915526		1957	4140	6097	SO:0001583	missense	9909	exon3			GGGGCCAGGTTTG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.398T>A	chr1.hg19:g.153915526A>T	ENSP00000354597:p.Leu133Gln	103.0	0.0	.		74.0	26.0	.	NM_014856	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	hg19	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.259272	0.80246	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.24908	1.83;1.83	4.69	4.69	0.59074	MABP domain (1);	.	.	.	.	T	0.36690	0.0976	L	0.61218	1.895	0.58432	D	0.999992	D	0.76494	0.999	D	0.68765	0.96	T	0.28004	-1.0057	9	0.87932	D	0	-3.5699	13.2559	0.60079	1.0:0.0:0.0:0.0	.	133	O75064	DEN4B_HUMAN	Q	133;144	ENSP00000354597:L133Q;ENSP00000357635:L144Q	ENSP00000354597:L133Q	L	-	2	0	DENND4B	152182150	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.891000	0.92485	1.946000	0.56461	0.460000	0.39030	CTG	.	.	.	none		0.637	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
BRINP3	339479	hgsc.bcm.edu	37	1	190068039	190068039	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:190068039G>C	ENST00000367462.3	-	8	1641	c.1410C>G	c.(1408-1410)agC>agG	p.S470R	BRINP3_ENST00000534846.1_Missense_Mutation_p.S368R	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	470					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AGAGCCCCTGGCTGAGCATGT	0.577																																					p.S470R		Atlas-SNP	.											.	FAM5C	343	.	0			c.C1410G						PASS	.						100.0	101.0	101.0					1																	190068039		2203	4300	6503	SO:0001583	missense	339479	exon8			CCCCTGGCTGAGC	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1410C>G	chr1.hg19:g.190068039G>C	ENSP00000356432:p.Ser470Arg	244.0	0.0	.		170.0	40.0	.	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	hg19	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	9.011	0.982421	0.18889	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.42131	0.98;0.98	5.75	3.56	0.40772	Epidermal growth factor-like (1);	0.146558	0.64402	D	0.000008	T	0.35219	0.0924	L	0.53249	1.67	0.45883	D	0.998734	P;P	0.43701	0.815;0.718	B;B	0.39258	0.295;0.154	T	0.12218	-1.0556	10	0.25751	T	0.34	-10.9852	11.0596	0.47940	0.177:0.0:0.823:0.0	.	368;470	B7Z260;Q76B58	.;FAM5C_HUMAN	R	470;368	ENSP00000356432:S470R;ENSP00000438022:S368R	ENSP00000356432:S470R	S	-	3	2	FAM5C	188334662	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	1.416000	0.34759	1.440000	0.47531	-0.229000	0.12294	AGC	.	.	.	none		0.577	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
PCNXL2	80003	hgsc.bcm.edu	37	1	233190130	233190130	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:233190130T>C	ENST00000258229.9	-	25	4469	c.4235A>G	c.(4234-4236)aAc>aGc	p.N1412S	PCNXL2_ENST00000344698.2_Missense_Mutation_p.N64S	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1412						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				AGAGCTGTAGTTGCCCCAACG	0.438																																					p.N1412S		Atlas-SNP	.											.	PCNXL2	204	.	0			c.A4235G						PASS	.						67.0	65.0	66.0					1																	233190130		1887	4122	6009	SO:0001583	missense	80003	exon25			CTGTAGTTGCCCC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.4235A>G	chr1.hg19:g.233190130T>C	ENSP00000258229:p.Asn1412Ser	34.0	0.0	.		43.0	19.0	.	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	hg19	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.437330	0.62955	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.24151	1.87;3.01	4.97	2.65	0.31530	.	0.042018	0.85682	D	0.000000	T	0.23846	0.0577	L	0.42487	1.325	0.80722	D	1	B;P	0.52692	0.434;0.955	B;P	0.45449	0.263;0.481	T	0.02705	-1.1121	10	0.87932	D	0	.	8.878	0.35356	0.0:0.154:0.0:0.846	.	1412;64	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	S	64;1412	ENSP00000340759:N64S;ENSP00000258229:N1412S	ENSP00000258229:N1412S	N	-	2	0	PCNXL2	231256753	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.826000	0.62715	0.862000	0.35528	0.533000	0.62120	AAC	.	.	.	none		0.438	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
NCKAP5	344148	hgsc.bcm.edu	37	2	133721438	133721438	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:133721438T>G	ENST00000409261.1	-	8	807	c.434A>C	c.(433-435)aAg>aCg	p.K145T	NCKAP5_ENST00000409213.1_Missense_Mutation_p.K145T|NCKAP5_ENST00000317721.6_Missense_Mutation_p.K145T|NCKAP5_ENST00000405974.3_Missense_Mutation_p.K145T	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	145										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTCTGACAGCTTTTCCTGAAG	0.428																																					p.K145T		Atlas-SNP	.											.	NCKAP5	322	.	0			c.A434C						PASS	.						142.0	136.0	138.0					2																	133721438		1861	4093	5954	SO:0001583	missense	344148	exon8			GACAGCTTTTCCT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.434A>C	chr2.hg19:g.133721438T>G	ENSP00000387128:p.Lys145Thr	94.0	0.0	.		105.0	38.0	.	NM_207481	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	hg19	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.913961	0.33815	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661;ENST00000542834	T;T;T;T	0.48522	2.8;0.81;2.8;0.81	5.0	-0.271	0.12922	.	.	.	.	.	T	0.25717	0.0626	N	0.14661	0.345	0.09310	N	1	B;B;B	0.24823	0.0;0.001;0.112	B;B;B	0.24394	0.002;0.003;0.053	T	0.17440	-1.0369	9	0.38643	T	0.18	.	4.4156	0.11454	0.0:0.1923:0.3253:0.4823	.	120;145;145	O14513-3;O14513-2;O14513	.;.;NCKP5_HUMAN	T	145;145;145;145;145;120	ENSP00000387128:K145T;ENSP00000386952:K145T;ENSP00000380603:K145T;ENSP00000385692:K145T	ENSP00000380603:K145T	K	-	2	0	NCKAP5	133437908	0.968000	0.33430	0.029000	0.17559	0.554000	0.35429	1.269000	0.33074	-0.107000	0.12088	-0.321000	0.08615	AAG	.	.	.	none		0.428	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
ACVR2A	92	hgsc.bcm.edu	37	2	148677893	148677893	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:148677893G>A	ENST00000241416.7	+	8	1693	c.1057G>A	c.(1057-1059)Gca>Aca	p.A353T	ACVR2A_ENST00000535787.1_Missense_Mutation_p.A245T|ACVR2A_ENST00000404590.1_Missense_Mutation_p.A353T	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	353	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGGCAAGTCTGCAGGCGATAC	0.383																																					p.A353T		Atlas-SNP	.											ACVR2A,NS,carcinoma,0,1	ACVR2A	125	.	0			c.G1057A						PASS	.						87.0	89.0	89.0					2																	148677893		2203	4300	6503	SO:0001583	missense	92	exon8			AAGTCTGCAGGCG		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1057G>A	chr2.hg19:g.148677893G>A	ENSP00000241416:p.Ala353Thr	67.0	0.0	.		94.0	34.0	.	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	hg19	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039512	0.55003	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	T;T;T	0.65732	-0.17;-0.17;-0.17	5.42	5.42	0.78866	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.38188	0.1031	N	0.02345	-0.59	0.80722	D	1	B	0.11235	0.004	B	0.13407	0.009	T	0.26849	-1.0091	10	0.34782	T	0.22	.	15.113	0.72375	0.0:0.1411:0.8589:0.0	.	353	P27037	AVR2A_HUMAN	T	353;245;353	ENSP00000241416:A353T;ENSP00000439988:A245T;ENSP00000384338:A353T	ENSP00000241416:A353T	A	+	1	0	ACVR2A	148394363	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.587000	0.67510	2.699000	0.92147	0.655000	0.94253	GCA	.	.	.	none		0.383	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
NEB	4703	hgsc.bcm.edu	37	2	152482148	152482148	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:152482148A>G	ENST00000172853.10	-	67	9770	c.9623T>C	c.(9622-9624)tTa>tCa	p.L3208S	NEB_ENST00000427231.2_Missense_Mutation_p.L3451S|NEB_ENST00000397345.3_Missense_Mutation_p.L3451S|NEB_ENST00000409198.1_Missense_Mutation_p.L3208S|NEB_ENST00000604864.1_Missense_Mutation_p.L3451S|NEB_ENST00000603639.1_Missense_Mutation_p.L3451S			P20929	NEBU_HUMAN	nebulin	3208					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCTGTGTATAAGCGCTGTGA	0.358																																					p.L3451S		Atlas-SNP	.											.	NEB	1697	.	0			c.T10352C						PASS	.						74.0	67.0	69.0					2																	152482148		1835	4090	5925	SO:0001583	missense	4703	exon71			GTGTATAAGCGCT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9623T>C	chr2.hg19:g.152482148A>G	ENSP00000172853:p.Leu3208Ser	11.0	0.0	.		28.0	10.0	.	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	A	18.62	3.662545	0.67700	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	4.98	4.98	0.66077	.	0.086330	0.48286	D	0.000195	T	0.66366	0.2782	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.70285	-0.4914	10	0.72032	D	0.01	.	14.6222	0.68594	1.0:0.0:0.0:0.0	.	3208	P20929	NEBU_HUMAN	S	3208;3451;3451;3208	ENSP00000386259:L3208S;ENSP00000380505:L3451S;ENSP00000416578:L3451S;ENSP00000172853:L3208S	ENSP00000172853:L3208S	L	-	2	0	NEB	152190394	0.060000	0.20803	1.000000	0.80357	0.993000	0.82548	2.165000	0.42396	1.996000	0.58369	0.455000	0.32223	TTA	.	.	.	none		0.358	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
ICOS	29851	hgsc.bcm.edu	37	2	204822592	204822592	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:204822592A>C	ENST00000316386.6	+	4	639	c.572A>C	c.(571-573)aAa>aCa	p.K191T	ICOS_ENST00000435193.1_Intron	NM_012092.3	NP_036224.1	Q9Y6W8	ICOS_HUMAN	inducible T-cell co-stimulator	191					immune response (GO:0006955)|single organismal cell-cell adhesion (GO:0016337)|T cell costimulation (GO:0031295)|T cell tolerance induction (GO:0002517)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6						ACAGCCAAAAAATCTAGACTC	0.388																																					p.K191T		Atlas-SNP	.											.	ICOS	20	.	0			c.A572C						PASS	.						86.0	85.0	86.0					2																	204822592		2203	4300	6503	SO:0001583	missense	29851	exon4			CCAAAAAATCTAG	AB023135	CCDS2363.1	2q33	2014-09-17			ENSG00000163600	ENSG00000163600		"""CD molecules"""	5351	protein-coding gene	gene with protein product	"""activation-inducible lymphocyte immunomediatory molecule"""	604558				9930702, 10617205	Standard	NM_012092		Approved	AILIM, CD278	uc002vam.3	Q9Y6W8	OTTHUMG00000132880	ENST00000316386.6:c.572A>C	chr2.hg19:g.204822592A>C	ENSP00000319476:p.Lys191Thr	45.0	0.0	.		86.0	36.0	.	NM_012092	Q8N6W8	Missense_Mutation	SNP	ENST00000316386.6	hg19	CCDS2363.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.581135	0.65992	.	.	ENSG00000163600	ENST00000316386	.	.	.	5.73	3.24	0.37175	.	0.180516	0.37577	N	0.002037	T	0.41696	0.1170	M	0.72118	2.19	0.09310	N	0.999993	B;B	0.19583	0.037;0.037	B;B	0.17433	0.018;0.018	T	0.33979	-0.9847	9	0.30078	T	0.28	-32.144	5.7144	0.17952	0.6551:0.157:0.0:0.188	.	191;191	Q53QY6;Q9Y6W8	.;ICOS_HUMAN	T	191	.	ENSP00000319476:K191T	K	+	2	0	ICOS	204530837	0.794000	0.28838	0.002000	0.10522	0.508000	0.34012	1.387000	0.34430	0.383000	0.24910	0.383000	0.25322	AAA	.	.	.	none		0.388	ICOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256369.1	NM_012092	
DNPEP	23549	hgsc.bcm.edu	37	2	220239739	220239739	+	Silent	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:220239739G>A	ENST00000273075.4	-	14	1465	c.1245C>T	c.(1243-1245)ctC>ctT	p.L415L	DNPEP_ENST00000523282.1_Silent_p.L423L|DNPEP_ENST00000373972.1_Silent_p.L340L|DNPEP_ENST00000490371.1_5'UTR	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	405					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCGGACCATGAGATCCTAGG	0.582																																					p.L415L		Atlas-SNP	.											.	DNPEP	40	.	0			c.C1245T						PASS	.						54.0	57.0	56.0					2																	220239739		1995	4197	6192	SO:0001819	synonymous_variant	23549	exon14			GACCATGAGATCC		CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.1245C>T	chr2.hg19:g.220239739G>A		56.0	0.0	.		60.0	23.0	.	NM_012100	Q9BW44|Q9NUV5	Silent	SNP	ENST00000273075.4	hg19	CCDS42823.1	.	.	.	.	.	.	.	.	.	.	G	9.087	1.000674	0.19121	.	.	ENSG00000123992	ENST00000337010	.	.	.	5.38	4.5	0.54988	.	.	.	.	.	T	0.72518	0.3470	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72830	-0.4174	4	.	.	.	-23.6962	16.3965	0.83607	0.0:0.1313:0.8686:0.0	.	.	.	.	L	415	.	.	S	-	2	0	DNPEP	219947983	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	3.609000	0.54117	1.492000	0.48499	0.655000	0.94253	TCA	.	.	.	none		0.582	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000130212.1	NM_012100	
GOLGB1	2804	hgsc.bcm.edu	37	3	121433805	121433805	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr3:121433805G>A	ENST00000340645.5	-	10	1417	c.1292C>T	c.(1291-1293)tCc>tTc	p.S431F	GOLGB1_ENST00000393667.3_Missense_Mutation_p.S436F	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	431					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AATTTCTTTGGATTTTTGCTG	0.328																																					p.S436F		Atlas-SNP	.											.	GOLGB1	319	.	0			c.C1307T						PASS	.						121.0	122.0	122.0					3																	121433805		2203	4300	6503	SO:0001583	missense	2804	exon10			TCTTTGGATTTTT	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.1292C>T	chr3.hg19:g.121433805G>A	ENSP00000341848:p.Ser431Phe	55.0	0.0	.		64.0	32.0	.	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.900|8.900	0.956079|0.956079	0.18507|0.18507	.|.	.|.	ENSG00000173230|ENSG00000173230	ENST00000489400|ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	.|T;T;T	.|0.25414	.|2.39;2.39;1.8	4.95|4.95	2.09|2.09	0.27110|0.27110	.|.	.|0.423391	.|0.20726	.|N	.|0.086819	T|T	0.43787|0.43787	0.1263|0.1263	M|M	0.68317|0.68317	2.08|2.08	0.25739|0.25739	N|N	0.985181|0.985181	.|D;D;D;D;D	.|0.89917	.|1.0;0.999;1.0;0.999;1.0	.|D;D;D;D;D	.|0.87578	.|0.998;0.996;0.998;0.996;0.998	T|T	0.18053|0.18053	-1.0349|-1.0349	5|10	.|0.51188	.|T	.|0.08	.|.	8.2496|8.2496	0.31708|0.31708	0.0:0.3271:0.5037:0.1692|0.0:0.3271:0.5037:0.1692	.|.	.|356;395;436;436;431	.|F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.|.;.;.;.;GOGB1_HUMAN	S|F	302|431;436;395;243	.|ENSP00000341848:S431F;ENSP00000377275:S436F;ENSP00000418231:S395F	.|ENSP00000341848:S431F	P|S	-|-	1|2	0|0	GOLGB1|GOLGB1	122916495|122916495	0.949000|0.949000	0.32298|0.32298	0.256000|0.256000	0.24389|0.24389	0.478000|0.478000	0.33099|0.33099	1.453000|1.453000	0.35167|0.35167	0.231000|0.231000	0.21079|0.21079	-0.188000|-0.188000	0.12872|0.12872	CCA|TCC	.	.	.	none		0.328	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
TNIP2	79155	hgsc.bcm.edu	37	4	2746482	2746482	+	Missense_Mutation	SNP	G	G	A	rs150823075		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:2746482G>A	ENST00000315423.7	-	4	934	c.848C>T	c.(847-849)gCg>gTg	p.A283V	TNIP2_ENST00000503235.1_Intron|TNIP2_ENST00000510267.1_Missense_Mutation_p.A176V|TNIP2_ENST00000505186.1_5'UTR	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCTGGAGGCCGCCAGCTCCTG	0.607																																					p.A283V		Atlas-SNP	.											.	TNIP2	28	.	0			c.C848T						PASS	.	G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	44.0	50.0	48.0		527,848	2.7	0.6	4	dbSNP_134	48	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TNIP2	NM_001161527.1,NM_024309.3	64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	176/323,283/430	2746482	1,13005	2203	4300	6503	SO:0001583	missense	79155	exon4			GAGGCCGCCAGCT	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.848C>T	chr4.hg19:g.2746482G>A	ENSP00000321203:p.Ala283Val	124.0	0.0	.		107.0	46.0	.	NM_024309		Missense_Mutation	SNP	ENST00000315423.7	hg19	CCDS3362.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.671911	0.29693	0.0	1.16E-4	ENSG00000168884	ENST00000510267;ENST00000315423	T;T	0.46063	0.88;0.88	5.66	2.71	0.32032	.	0.165365	0.52532	D	0.000076	T	0.24928	0.0605	L	0.35723	1.085	0.80722	D	1	P	0.35155	0.487	B	0.19666	0.026	T	0.05435	-1.0885	10	0.42905	T	0.14	-8.1276	7.0861	0.25257	0.0878:0.0:0.3927:0.5195	.	283	Q8NFZ5	TNIP2_HUMAN	V	176;283	ENSP00000427613:A176V;ENSP00000321203:A283V	ENSP00000321203:A283V	A	-	2	0	TNIP2	2716280	0.729000	0.28090	0.600000	0.28864	0.114000	0.19823	1.029000	0.30140	0.754000	0.32968	0.555000	0.69702	GCG	.	G|1.000;A|0.000	0.000	weak		0.607	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309	
DCUN1D4	23142	hgsc.bcm.edu	37	4	52765463	52765463	+	Silent	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:52765463T>C	ENST00000334635.5	+	8	714	c.534T>C	c.(532-534)aaT>aaC	p.N178N	DCUN1D4_ENST00000381441.3_Silent_p.N178N|DCUN1D4_ENST00000451288.2_Silent_p.N222N|DCUN1D4_ENST00000381437.4_Silent_p.N118N	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	178	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					nucleus (GO:0005634)				endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			AACTCAGAAATACTTTGGATT	0.299																																					p.N178N		Atlas-SNP	.											.	DCUN1D4	26	.	0			c.T534C						PASS	.						39.0	41.0	41.0					4																	52765463		2201	4297	6498	SO:0001819	synonymous_variant	23142	exon8			CAGAAATACTTTG	D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.534T>C	chr4.hg19:g.52765463T>C		17.0	0.0	.		25.0	10.0	.	NM_015115	B4DH25|Q7Z3F3|Q7Z6B8	Silent	SNP	ENST00000334635.5	hg19	CCDS33982.1																																																																																			.	.	.	none		0.299	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250599.2	NM_015115	
HMGB2	3148	hgsc.bcm.edu	37	4	174254247	174254247	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:174254247T>C	ENST00000296503.5	-	3	1142	c.269A>G	c.(268-270)aAg>aGg	p.K90R	HMGB2_ENST00000438704.2_Missense_Mutation_p.K90R|HMGB2_ENST00000446922.2_Missense_Mutation_p.K90R			P26583	HMGB2_HUMAN	high mobility group box 2	90					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cell chemotaxis (GO:0060326)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to lipopolysaccharide (GO:0071222)|chromatin organization (GO:0006325)|DNA ligation involved in DNA repair (GO:0051103)|DNA topological change (GO:0006265)|male gonad development (GO:0008584)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive chemotaxis (GO:0050918)|positive regulation of DNA binding (GO:0043388)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of nuclease activity (GO:0032075)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to steroid hormone (GO:0048545)|spermatid nucleus differentiation (GO:0007289)|V(D)J recombination (GO:0033151)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	chemoattractant activity (GO:0042056)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription regulatory region DNA binding (GO:0044212)	p.K90R(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(3)	14		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		ATTGGGGTCCTTTTTCTTCCC	0.398																																					p.K90R		Atlas-SNP	.											HMGB2,NS,carcinoma,0,1	HMGB2	24	.	1	Substitution - Missense(1)	endometrium(1)	c.A269G						PASS	.						222.0	233.0	229.0					4																	174254247		2203	4300	6503	SO:0001583	missense	3148	exon2			GGGTCCTTTTTCT		CCDS3816.1	4q31	2011-07-01	2011-04-05	2002-08-16	ENSG00000164104	ENSG00000164104		"""High-mobility group / Canonical"""	5000	protein-coding gene	gene with protein product		163906	"""high-mobility group (nonhistone chromosomal) protein 2"", ""high-mobility group box 2"""	HMG2		1754403	Standard	NM_002129		Approved		uc011ckc.1	P26583	OTTHUMG00000160799	ENST00000296503.5:c.269A>G	chr4.hg19:g.174254247T>C	ENSP00000296503:p.Lys90Arg	226.0	0.0	.		276.0	104.0	.	NM_001130689	B2R4K8|D3DP37|Q5U072	Missense_Mutation	SNP	ENST00000296503.5	hg19	CCDS3816.1	.	.	.	.	.	.	.	.	.	.	T	14.16	2.451760	0.43531	.	.	ENSG00000164104	ENST00000296503;ENST00000446922;ENST00000438704;ENST00000506267	D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49	5.06	5.06	0.68205	High mobility group, superfamily (1);	0.000000	0.64402	D	0.000001	D	0.96883	0.8982	M	0.81802	2.56	0.58432	D	0.99999	P	0.48350	0.909	D	0.65987	0.94	D	0.96930	0.9680	10	0.51188	T	0.08	.	14.1447	0.65344	0.0:0.0:0.0:1.0	.	90	P26583	HMGB2_HUMAN	R	90	ENSP00000296503:K90R;ENSP00000393448:K90R;ENSP00000404912:K90R;ENSP00000423001:K90R	ENSP00000296503:K90R	K	-	2	0	HMGB2	174490822	1.000000	0.71417	1.000000	0.80357	0.122000	0.20287	7.626000	0.83164	2.122000	0.65172	0.460000	0.39030	AAG	.	.	.	none		0.398	HMGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362362.1	NM_001130688	
SNX25	83891	hgsc.bcm.edu	37	4	186188140	186188140	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr4:186188140G>A	ENST00000504273.1	+	5	724	c.430G>A	c.(430-432)Gag>Aag	p.E144K	SNX25_ENST00000264694.8_Missense_Mutation_p.E144K			Q9H3E2	SNX25_HUMAN	sorting nexin 25	144	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.E144Q(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GCCGGTAGTGGAGTTACTGAG	0.423																																					p.E144K		Atlas-SNP	.											SNX25,NS,carcinoma,0,1	SNX25	100	.	1	Substitution - Missense(1)	lung(1)	c.G430A						PASS	.						78.0	72.0	74.0					4																	186188140		2203	4300	6503	SO:0001583	missense	83891	exon5			GTAGTGGAGTTAC	AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.430G>A	chr4.hg19:g.186188140G>A	ENSP00000426255:p.Glu144Lys	74.0	0.0	.		95.0	39.0	.	NM_031953	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	hg19	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860679	0.51482	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.10192	2.9;2.9	5.16	4.32	0.51571	Phox-associated domain (2);	0.188926	0.44688	D	0.000437	T	0.14227	0.0344	L	0.53249	1.67	0.42561	D	0.993145	P	0.35493	0.505	B	0.38803	0.282	T	0.04140	-1.0974	10	0.36615	T	0.2	-5.5611	13.8858	0.63708	0.0734:0.0:0.9266:0.0	.	144	Q9H3E2	SNX25_HUMAN	K	144	ENSP00000426255:E144K;ENSP00000264694:E144K	ENSP00000264694:E144K	E	+	1	0	SNX25	186425134	1.000000	0.71417	0.427000	0.26684	0.993000	0.82548	7.437000	0.80417	1.402000	0.46780	0.591000	0.81541	GAG	.	.	.	none		0.423	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
CLPTM1L	81037	hgsc.bcm.edu	37	5	1323010	1323010	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:1323010T>C	ENST00000320895.5	-	13	1554	c.1297A>G	c.(1297-1299)Atc>Gtc	p.I433V	CLPTM1L_ENST00000506641.1_5'UTR|CLPTM1L_ENST00000507807.1_Missense_Mutation_p.I264V|CLPTM1L_ENST00000320927.6_Missense_Mutation_p.I397V	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	433					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		AAGCTGTTGATTAACCAGGAG	0.388																																					p.I433V		Atlas-SNP	.											.	CLPTM1L	60	.	0			c.A1297G						PASS	.						152.0	150.0	151.0					5																	1323010		2203	4300	6503	SO:0001583	missense	81037	exon13			TGTTGATTAACCA	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.1297A>G	chr5.hg19:g.1323010T>C	ENSP00000313854:p.Ile433Val	111.0	0.0	.		143.0	42.0	.	NM_030782	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	hg19	CCDS3862.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.947015	0.34377	.	.	ENSG00000049656	ENST00000320895;ENST00000507807;ENST00000320927	T;T;T	0.51817	0.69;0.8;0.78	4.58	3.39	0.38822	.	0.047837	0.85682	D	0.000000	T	0.32556	0.0833	N	0.26042	0.785	0.54753	D	0.999983	B;B	0.06786	0.001;0.001	B;B	0.14023	0.005;0.01	T	0.07009	-1.0795	10	0.35671	T	0.21	-39.5635	9.5543	0.39328	0.0:0.087:0.0:0.913	.	433;264	Q96KA5;G5E9Z2	CLP1L_HUMAN;.	V	433;264;397	ENSP00000313854:I433V;ENSP00000423321:I264V;ENSP00000315196:I397V	ENSP00000313854:I433V	I	-	1	0	CLPTM1L	1376010	1.000000	0.71417	0.825000	0.32803	0.932000	0.56968	4.256000	0.58810	0.694000	0.31654	0.402000	0.26972	ATC	.	.	.	none		0.388	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5240027	5240027	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:5240027C>G	ENST00000274181.7	+	16	2650	c.2512C>G	c.(2512-2514)Ctg>Gtg	p.L838V		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	838	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CAACGAGACACTGATTGTGGA	0.478																																					p.L838V		Atlas-SNP	.											.	ADAMTS16	543	.	0			c.C2512G						PASS	.						86.0	83.0	84.0					5																	5240027		1878	4117	5995	SO:0001583	missense	170690	exon16			GAGACACTGATTG	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2512C>G	chr5.hg19:g.5240027C>G	ENSP00000274181:p.Leu838Val	127.0	0.0	.		135.0	15.0	.	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	hg19	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.325582	0.41197	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.61742	0.08	5.56	3.45	0.39498	ADAM-TS Spacer 1 (1);	0.000000	0.64402	D	0.000013	T	0.70325	0.3211	M	0.62266	1.93	0.48452	D	0.999658	D;D	0.89917	1.0;0.991	D;D	0.87578	0.998;0.919	T	0.69450	-0.5142	10	0.36615	T	0.2	.	12.5248	0.56079	0.0:0.8343:0.0:0.1657	.	838;838	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	V	838	ENSP00000274181:L838V	ENSP00000274181:L838V	L	+	1	2	ADAMTS16	5293027	0.864000	0.29904	0.134000	0.22075	0.299000	0.27559	1.676000	0.37565	1.352000	0.45808	0.655000	0.94253	CTG	.	.	.	none		0.478	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
PDZD2	23037	hgsc.bcm.edu	37	5	32059458	32059458	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:32059458C>A	ENST00000438447.1	+	13	2702	c.2314C>A	c.(2314-2316)Ctg>Atg	p.L772M	PDZD2_ENST00000282493.3_Missense_Mutation_p.L772M			O15018	PDZD2_HUMAN	PDZ domain containing 2	772	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGAGAGCAACCTGAGGTTTGT	0.448																																					p.L772M		Atlas-SNP	.											.	PDZD2	306	.	0			c.C2314A						PASS	.						102.0	88.0	93.0					5																	32059458		2203	4300	6503	SO:0001583	missense	23037	exon12			AGCAACCTGAGGT	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2314C>A	chr5.hg19:g.32059458C>A	ENSP00000402033:p.Leu772Met	50.0	0.0	.		53.0	20.0	.	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	hg19	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930044	0.73327	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.50001	0.76;0.76	5.79	3.98	0.46160	PDZ/DHR/GLGF (4);	0.000000	0.36268	N	0.002696	T	0.71896	0.3394	M	0.91249	3.19	0.40854	D	0.983775	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77292	-0.2642	10	0.72032	D	0.01	.	10.7091	0.45973	0.0:0.8633:0.0:0.1367	.	598;772	B4E3P2;O15018	.;PDZD2_HUMAN	M	772;591;772	ENSP00000402033:L772M;ENSP00000282493:L772M	ENSP00000282493:L772M	L	+	1	2	PDZD2	32095215	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	2.741000	0.47426	2.726000	0.93360	0.655000	0.94253	CTG	.	.	.	none		0.448	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
C5orf42	65250	hgsc.bcm.edu	37	5	37181023	37181023	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:37181023C>T	ENST00000508244.1	-	26	5599	c.5506G>A	c.(5506-5508)Gta>Ata	p.V1836I	C5orf42_ENST00000274258.7_Missense_Mutation_p.V717I|C5orf42_ENST00000425232.2_Missense_Mutation_p.V1836I			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1836						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GGAGTTGCTACTGCAACTGAA	0.403																																					p.V1836I		Atlas-SNP	.											.	C5orf42	422	.	0			c.G5506A						PASS	.						72.0	67.0	69.0					5																	37181023		2203	4300	6503	SO:0001583	missense	65250	exon27			TTGCTACTGCAAC		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.5506G>A	chr5.hg19:g.37181023C>T	ENSP00000421690:p.Val1836Ile	55.0	0.0	.		65.0	24.0	.	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	C	12.91	2.078569	0.36662	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	5.91	1.94	0.25998	.	2.430320	0.01888	N	0.038363	T	0.19604	0.0471	L	0.40543	1.245	0.09310	N	1	P;B	0.34724	0.465;0.386	B;B	0.31101	0.124;0.124	T	0.29119	-1.0022	10	0.26408	T	0.33	.	9.6655	0.39981	0.0:0.5185:0.4071:0.0744	.	1836;717	E9PH94;Q9H799	.;CE042_HUMAN	I	1836;1836;717;884;717	ENSP00000421690:V1836I;ENSP00000389014:V1836I;ENSP00000274258:V717I;ENSP00000424223:V884I	ENSP00000274258:V717I	V	-	1	0	C5orf42	37216780	0.021000	0.18746	0.000000	0.03702	0.019000	0.09904	0.036000	0.13819	0.067000	0.16545	0.655000	0.94253	GTA	.	.	.	none		0.403	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
DAB2	1601	hgsc.bcm.edu	37	5	39390645	39390645	+	Silent	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:39390645A>G	ENST00000320816.6	-	5	830	c.363T>C	c.(361-363)atT>atC	p.I121I	DAB2_ENST00000545653.1_Silent_p.I121I|DAB2_ENST00000512525.1_5'UTR|DAB2_ENST00000509337.1_Silent_p.I121I|DAB2_ENST00000339788.6_Silent_p.I121I	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	121	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			CAATGAAAGAAATCTTATTTA	0.398																																					p.I121I		Atlas-SNP	.											.	DAB2	124	.	0			c.T363C						PASS	.						74.0	78.0	76.0					5																	39390645		2203	4300	6503	SO:0001819	synonymous_variant	1601	exon5			GAAAGAAATCTTA	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.363T>C	chr5.hg19:g.39390645A>G		62.0	0.0	.		78.0	34.0	.	NM_001343	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	hg19	CCDS34149.1																																																																																			.	.	.	none		0.398	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
DAB2	1601	hgsc.bcm.edu	37	5	39394411	39394411	+	Silent	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:39394411T>C	ENST00000320816.6	-	2	479	c.12A>G	c.(10-12)gaA>gaG	p.E4E	DAB2_ENST00000545653.1_Silent_p.E4E|DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000509337.1_Silent_p.E4E|DAB2_ENST00000339788.6_Silent_p.E4E	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	4					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			TTGTTTCTACTTCGTTAGACA	0.478																																					p.E4E		Atlas-SNP	.											.	DAB2	124	.	0			c.A12G						PASS	.						147.0	131.0	137.0					5																	39394411		2203	4300	6503	SO:0001819	synonymous_variant	1601	exon2			TTCTACTTCGTTA	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.12A>G	chr5.hg19:g.39394411T>C		66.0	0.0	.		81.0	32.0	.	NM_001343	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	hg19	CCDS34149.1																																																																																			.	.	.	none		0.478	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
PLK2	10769	hgsc.bcm.edu	37	5	57753133	57753133	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:57753133C>T	ENST00000274289.3	-	7	1183	c.883G>A	c.(883-885)Gca>Aca	p.A295T	PLK2_ENST00000502671.1_5'UTR	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	295	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		GTATACCTTGCTTCCCTTATG	0.433																																					p.A295T		Atlas-SNP	.											.	PLK2	71	.	0			c.G883A						PASS	.						79.0	76.0	77.0					5																	57753133		2203	4300	6503	SO:0001583	missense	10769	exon7			ACCTTGCTTCCCT		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.883G>A	chr5.hg19:g.57753133C>T	ENSP00000274289:p.Ala295Thr	40.0	0.0	.		48.0	14.0	.	NM_006622	O60679|Q96CV7|Q9UE61	Missense_Mutation	SNP	ENST00000274289.3	hg19	CCDS3974.1	.	.	.	.	.	.	.	.	.	.	C	35	5.479369	0.96307	.	.	ENSG00000145632	ENST00000274289;ENST00000537944;ENST00000442330	T	0.64618	-0.11	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70055	0.3180	L	0.33624	1.015	0.80722	D	1	D	0.64830	0.994	D	0.65140	0.932	T	0.69363	-0.5165	10	0.40728	T	0.16	-15.6861	18.9292	0.92558	0.0:1.0:0.0:0.0	.	295	Q9NYY3	PLK2_HUMAN	T	295;295;281	ENSP00000274289:A295T	ENSP00000274289:A295T	A	-	1	0	PLK2	57788890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.388000	0.79795	2.461000	0.83175	0.655000	0.94253	GCA	.	.	.	none		0.433	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214150.1	NM_006622	
FBN2	2201	hgsc.bcm.edu	37	5	127641530	127641530	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:127641530G>C	ENST00000508053.1	-	49	6507	c.5533C>G	c.(5533-5535)Ctg>Gtg	p.L1845V	FBN2_ENST00000262464.4_Missense_Mutation_p.L1845V			P35556	FBN2_HUMAN	fibrillin 2	1845	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CAAACCAACAGCAGGTCATTG	0.363																																					p.L1845V		Atlas-SNP	.											.	FBN2	858	.	0			c.C5533G						PASS	.						123.0	118.0	120.0					5																	127641530		2203	4300	6503	SO:0001583	missense	2201	exon43			CCAACAGCAGGTC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5533C>G	chr5.hg19:g.127641530G>C	ENSP00000424571:p.Leu1845Val	88.0	0.0	.		122.0	11.0	.	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015309	0.75161	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.95554	-3.74;-3.74	5.24	5.24	0.73138	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.53938	D	0.000045	D	0.95548	0.8553	L	0.50333	1.59	0.35026	D	0.758342	D	0.55605	0.972	P	0.54346	0.749	D	0.94672	0.7857	10	0.16896	T	0.51	.	19.3745	0.94503	0.0:0.0:1.0:0.0	.	1845	P35556	FBN2_HUMAN	V	1845	ENSP00000262464:L1845V;ENSP00000424571:L1845V	ENSP00000262464:L1845V	L	-	1	2	FBN2	127669429	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.312000	0.72840	2.880000	0.98712	0.650000	0.86243	CTG	.	.	.	none		0.363	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
RUFY1	80230	hgsc.bcm.edu	37	5	178987050	178987050	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr5:178987050A>G	ENST00000319449.4	+	2	347	c.335A>G	c.(334-336)gAg>gGg	p.E112G	RUFY1_ENST00000377001.2_Missense_Mutation_p.E112G|RUFY1_ENST00000437570.2_Missense_Mutation_p.E4G|RUFY1_ENST00000393438.2_Missense_Mutation_p.E4G	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	112					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGATGGAGGAGCGTGCCAAC	0.597										HNSCC(44;0.11)																											p.E112G		Atlas-SNP	.											.	RUFY1	101	.	0			c.A335G						PASS	.						82.0	59.0	67.0					5																	178987050		2203	4300	6503	SO:0001583	missense	80230	exon2			TGGAGGAGCGTGC	AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.335A>G	chr5.hg19:g.178987050A>G	ENSP00000325594:p.Glu112Gly	38.0	0.0	.		32.0	17.0	.	NM_025158	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	ENST00000319449.4	hg19	CCDS4445.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	34|34	5.405080|5.405080	0.96051|0.96051	.|.	.|.	ENSG00000176783|ENSG00000176783	ENST00000319449;ENST00000377001;ENST00000437570;ENST00000393438|ENST00000502984	T;T;T;T|.	0.12984|.	2.63;2.63;2.63;2.63|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.098275|.	0.64402|.	D|.	0.000002|.	T|T	0.77082|0.77082	0.4078|0.4078	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.78663|0.78663	-0.2116|-0.2116	10|5	0.87932|.	D|.	0|.	-27.8219|-27.8219	15.7239|15.7239	0.77736|0.77736	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	112|.	Q96T51|.	RUFY1_HUMAN|.	G|G	112;112;4;4|70	ENSP00000325594:E112G;ENSP00000366200:E112G;ENSP00000390025:E4G;ENSP00000377087:E4G|.	ENSP00000325594:E112G|.	E|S	+|+	2|1	0|0	RUFY1|RUFY1	178919656|178919656	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.223000|7.223000	0.78033|0.78033	2.128000|2.128000	0.65567|0.65567	0.459000|0.459000	0.35465|0.35465	GAG|AGC	.	.	.	none		0.597	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	NM_001040451	
DDAH2	23564	hgsc.bcm.edu	37	6	31696435	31696435	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:31696435C>T	ENST00000375789.2	-	2	1015	c.385G>A	c.(385-387)Gtt>Att	p.V129I	DDAH2_ENST00000375792.3_Missense_Mutation_p.V129I|DDAH2_ENST00000375787.2_Missense_Mutation_p.V129I|DDAH2_ENST00000480913.1_5'UTR			O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2	129					arginine catabolic process (GO:0006527)|citrulline metabolic process (GO:0000052)|negative regulation of apoptotic process (GO:0043066)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of nitric oxide biosynthetic process (GO:0045429)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|catalytic activity (GO:0003824)|dimethylargininase activity (GO:0016403)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	11					L-Citrulline(DB00155)	GTGAAGAGAACGTCAGTGCCA	0.572																																					p.V129I		Atlas-SNP	.											.	DDAH2	15	.	0			c.G385A						PASS	.						71.0	55.0	61.0					6																	31696435		1511	2709	4220	SO:0001583	missense	23564	exon3			AGAGAACGTCAGT	AF070667	CCDS4718.1	6p21	2010-02-17			ENSG00000213722	ENSG00000213722	3.5.3.18		2716	protein-coding gene	gene with protein product		604744				10493931	Standard	XM_005248974		Approved		uc003nwq.3	O95865	OTTHUMG00000031212	ENST00000375789.2:c.385G>A	chr6.hg19:g.31696435C>T	ENSP00000364945:p.Val129Ile	53.0	0.0	.		44.0	18.0	.	NM_013974	A2BEZ7	Missense_Mutation	SNP	ENST00000375789.2	hg19	CCDS4718.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.08|13.08	2.130498|2.130498	0.37630|0.37630	.|.	.|.	ENSG00000213722|ENSG00000213722	ENST00000437288|ENST00000375789;ENST00000375787;ENST00000375792;ENST00000416410;ENST00000436437	.|.	.|.	.|.	4.99|4.99	4.99|4.99	0.66335|0.66335	.|.	.|0.130895	.|0.50627	.|D	.|0.000101	T|T	0.32041|0.32041	0.0816|0.0816	L|L	0.45051|0.45051	1.395|1.395	0.40188|0.40188	D|D	0.977377|0.977377	.|B	.|0.33477	.|0.413	.|B	.|0.31290	.|0.127	T|T	0.28808|0.28808	-1.0032|-1.0032	5|9	.|0.38643	.|T	.|0.18	-22.272|-22.272	9.2267|9.2267	0.37412|0.37412	0.0:0.9044:0.0:0.0956|0.0:0.9044:0.0:0.0956	.|.	.|129	.|O95865	.|DDAH2_HUMAN	H|I	34|129	.|.	.|ENSP00000364943:V129I	R|V	-|-	2|1	0|0	DDAH2|DDAH2	31804414|31804414	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.892000|0.892000	0.51952|0.51952	3.286000|3.286000	0.51724|0.51724	2.585000|2.585000	0.87301|0.87301	0.655000|0.655000	0.94253|0.94253	CGT|GTT	.	.	.	none		0.572	DDAH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076432.2		
DAXX	1616	hgsc.bcm.edu	37	6	33287891	33287891	+	Silent	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:33287891T>C	ENST00000374542.5	-	5	1566	c.1362A>G	c.(1360-1362)gaA>gaG	p.E454E	ZBTB22_ENST00000418724.1_5'Flank|DAXX_ENST00000414083.2_Silent_p.E379E|DAXX_ENST00000266000.6_Silent_p.E454E|DAXX_ENST00000477162.1_5'UTR|ZBTB22_ENST00000431845.2_5'Flank	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	454	Asp/Glu-rich (acidic).|Necessary for interaction with USP7.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						cctcctcctcttcttcttcct	0.552			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																p.E466E		Atlas-SNP	.		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	DAXX,NS,malignant_melanoma,0,1	DAXX	111	.	0			c.A1398G						PASS	.						135.0	104.0	114.0					6																	33287891		2203	4300	6503	SO:0001819	synonymous_variant	1616	exon5			CTCCTCTTCTTCT	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1362A>G	chr6.hg19:g.33287891T>C		41.0	0.0	.		41.0	2.0	.	NM_001141970	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Silent	SNP	ENST00000374542.5	hg19	CCDS4776.1																																																																																			.	.	.	none		0.552	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1		
GSTA1	2938	hgsc.bcm.edu	37	6	52658943	52658943	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:52658943A>G	ENST00000334575.5	-	5	549	c.394T>C	c.(394-396)Tac>Cac	p.Y132H	GSTA1_ENST00000493331.1_5'UTR	NM_145740.3	NP_665683.1	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	132	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|metabolic process (GO:0008152)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	12	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Glutathione(DB00143)	GCAGGGAAGTAGCGATTTTTT	0.433																																					p.Y132H		Atlas-SNP	.											.	GSTA1	40	.	0			c.T394C						PASS	.						249.0	246.0	247.0					6																	52658943		2203	4300	6503	SO:0001583	missense	2938	exon5			GGAAGTAGCGATT		CCDS4945.1	6p12.2	2012-06-21	2008-11-26		ENSG00000243955	ENSG00000243955	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4626	protein-coding gene	gene with protein product		138359	"""glutathione S-transferase A1"""			9503014	Standard	NM_145740		Approved		uc003paz.3	P08263	OTTHUMG00000014861	ENST00000334575.5:c.394T>C	chr6.hg19:g.52658943A>G	ENSP00000335620:p.Tyr132His	263.0	0.0	.		342.0	114.0	.	NM_145740	Q14750|Q5GHF8|Q5SZC1	Missense_Mutation	SNP	ENST00000334575.5	hg19	CCDS4945.1	.	.	.	.	.	.	.	.	.	.	a	13.85	2.359274	0.41801	.	.	ENSG00000243955	ENST00000334575	T	0.02103	4.45	2.58	2.58	0.30949	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.157818	0.43579	D	0.000559	T	0.04679	0.0127	M	0.76727	2.345	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.12811	-1.0533	10	0.87932	D	0	.	9.4793	0.38891	1.0:0.0:0.0:0.0	.	132	P08263	GSTA1_HUMAN	H	132	ENSP00000335620:Y132H	ENSP00000335620:Y132H	Y	-	1	0	GSTA1	52766902	0.951000	0.32395	0.003000	0.11579	0.017000	0.09413	5.478000	0.66806	0.928000	0.37168	0.164000	0.16699	TAC	.	.	.	none		0.433	GSTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040922.1		
IBTK	25998	hgsc.bcm.edu	37	6	82904254	82904254	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:82904254T>G	ENST00000306270.7	-	23	3829	c.3280A>C	c.(3280-3282)Att>Ctt	p.I1094L	IBTK_ENST00000503631.1_Missense_Mutation_p.I893L|IBTK_ENST00000510291.1_Missense_Mutation_p.I1079L	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	1094					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TTACTGGGAATAGGCTGTGGA	0.368																																					p.I1094L		Atlas-SNP	.											.	IBTK	128	.	0			c.A3280C						PASS	.						92.0	95.0	94.0					6																	82904254		2203	4300	6503	SO:0001583	missense	25998	exon23			TGGGAATAGGCTG	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.3280A>C	chr6.hg19:g.82904254T>G	ENSP00000305721:p.Ile1094Leu	42.0	0.0	.		49.0	21.0	.	NM_015525	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	ENST00000306270.7	hg19	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	T	19.68	3.873221	0.72180	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.38240	1.63;1.15;1.6	5.3	4.14	0.48551	.	0.226344	0.45126	D	0.000398	T	0.41511	0.1162	M	0.66939	2.045	0.45541	D	0.998499	P;P;D;D;P	0.69078	0.677;0.937;0.997;0.962;0.937	B;P;D;P;P	0.83275	0.243;0.506;0.996;0.701;0.506	T	0.30563	-0.9974	10	0.23302	T	0.38	-15.758	11.0232	0.47730	0.0:0.0732:0.0:0.9268	.	893;1079;45;1094;1094	E9PDR5;E7EPI0;B3KX60;Q9P2D0-2;Q9P2D0	.;.;.;.;IBTK_HUMAN	L	1094;893;1079	ENSP00000305721:I1094L;ENSP00000422762:I893L;ENSP00000426405:I1079L	ENSP00000305721:I1094L	I	-	1	0	IBTK	82960973	1.000000	0.71417	0.992000	0.48379	0.918000	0.54935	3.615000	0.54167	0.963000	0.38082	0.482000	0.46254	ATT	.	.	.	none		0.368	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
KLHL32	114792	hgsc.bcm.edu	37	6	97562031	97562031	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:97562031G>T	ENST00000369261.4	+	7	1363	c.1000G>T	c.(1000-1002)Gtg>Ttg	p.V334L	KLHL32_ENST00000536676.1_Missense_Mutation_p.V298L|KLHL32_ENST00000539200.1_Missense_Mutation_p.V265L|KLHL32_ENST00000544166.1_Intron	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	334										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TCCCATGCCTGTGGGAAGGAG	0.562																																					p.V334L		Atlas-SNP	.											.	KLHL32	85	.	0			c.G1000T						PASS	.						88.0	84.0	85.0					6																	97562031		2203	4300	6503	SO:0001583	missense	114792	exon7			ATGCCTGTGGGAA	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.1000G>T	chr6.hg19:g.97562031G>T	ENSP00000358265:p.Val334Leu	109.0	0.0	.		101.0	7.0	.	NM_052904	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	hg19	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750577	0.49257	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200	T;T;T	0.65916	-0.18;-0.18;-0.18	5.36	5.36	0.76844	Kelch-type beta propeller (1);	0.173711	0.52532	D	0.000077	T	0.48187	0.1486	M	0.64997	1.995	0.80722	D	1	B;B;B;B	0.11235	0.001;0.002;0.001;0.004	B;B;B;B	0.12156	0.001;0.003;0.004;0.007	T	0.48703	-0.9012	10	0.45353	T	0.12	.	14.5444	0.68017	0.0719:0.0:0.9281:0.0	.	265;298;334;334	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	L	334;298;265	ENSP00000358265:V334L;ENSP00000440382:V298L;ENSP00000441527:V265L	ENSP00000358265:V334L	V	+	1	0	KLHL32	97668752	1.000000	0.71417	0.982000	0.44146	0.985000	0.73830	4.839000	0.62810	2.763000	0.94921	0.655000	0.94253	GTG	.	.	.	none		0.562	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904	
RGS17	26575	hgsc.bcm.edu	37	6	153332802	153332802	+	Silent	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr6:153332802A>T	ENST00000367225.2	-	4	564	c.540T>A	c.(538-540)acT>acA	p.T180T	RGS17_ENST00000206262.1_Silent_p.T180T			Q9UGC6	RGS17_HUMAN	regulator of G-protein signaling 17	180	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(2)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	14		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		TGTGCATTAAAGTATATATCT	0.353																																					p.T180T	Esophageal Squamous(78;500 1236 6775 24364 49058)	Atlas-SNP	.											.	RGS17	32	.	0			c.T540A						PASS	.						59.0	60.0	59.0					6																	153332802		2203	4300	6503	SO:0001819	synonymous_variant	26575	exon5			CATTAAAGTATAT	AF202257	CCDS5244.1	6q25-q26	2009-05-29	2007-08-14		ENSG00000091844	ENSG00000091844		"""Regulators of G-protein signaling"""	14088	protein-coding gene	gene with protein product		607191	"""regulator of G-protein signalling 17"""			10419452	Standard	NM_012419		Approved	RGSZ2, RGS-17	uc003qpm.3	Q9UGC6	OTTHUMG00000015858	ENST00000367225.2:c.540T>A	chr6.hg19:g.153332802A>T		38.0	0.0	.		44.0	10.0	.	NM_012419	Q5TF49|Q8TD61|Q9UJS8	Silent	SNP	ENST00000367225.2	hg19	CCDS5244.1																																																																																			.	.	.	none		0.353	RGS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042773.2		
PPIA	5478	hgsc.bcm.edu	37	7	44839397	44839397	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr7:44839397G>T	ENST00000468812.1	+	4	331	c.286G>T	c.(286-288)Ggc>Tgc	p.G96C	PPIA_ENST00000355968.6_Missense_Mutation_p.G36C|PPIA_ENST00000480603.1_3'UTR|PPIA_ENST00000451562.1_Missense_Mutation_p.G96C|PPIA_ENST00000489459.1_Missense_Mutation_p.G36C	NM_021130.3	NP_066953.1	P62937	PPIA_HUMAN	peptidylprolyl isomerase A (cyclophilin A)	96	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				blood coagulation (GO:0007596)|entry into host cell (GO:0030260)|establishment of integrated proviral latency (GO:0075713)|leukocyte migration (GO:0050900)|lipid particle organization (GO:0034389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of protein secretion (GO:0050714)|positive regulation of viral genome replication (GO:0045070)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of viral genome replication (GO:0045069)|RNA-dependent DNA replication (GO:0006278)|uncoating of virus (GO:0019061)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral release from host cell (GO:0019076)|virion assembly (GO:0019068)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	peptide binding (GO:0042277)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)			breast(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Cyclosporine(DB00091)|L-Proline(DB00172)	TACGGGTCCTGGCATCTTGTC	0.483																																					p.G96C	Pancreas(95;605 727 734 1731 12572 23104 24406 38694 39103 44805)	Atlas-SNP	.											.	PPIA	10	.	0			c.G286T						PASS	.						85.0	81.0	82.0					7																	44839397		2203	4298	6501	SO:0001583	missense	5478	exon4			GGTCCTGGCATCT	X52851	CCDS5494.1, CCDS75592.1	7p13	2010-03-23			ENSG00000196262	ENSG00000196262	5.2.1.8		9253	protein-coding gene	gene with protein product		123840				1989998, 2197089	Standard	XM_005249791		Approved	CYPA	uc003tlw.3	P62937	OTTHUMG00000023687	ENST00000468812.1:c.286G>T	chr7.hg19:g.44839397G>T	ENSP00000419425:p.Gly96Cys	98.0	0.0	.		126.0	23.0	.	NM_021130	A8K220|P05092|Q3KQW3|Q567Q0|Q6IBU5|Q96IX3|Q9BRU4|Q9BTY9|Q9UC61	Missense_Mutation	SNP	ENST00000468812.1	hg19	CCDS5494.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909500	0.92107	.	.	ENSG00000196262	ENST00000451562;ENST00000468812;ENST00000489459;ENST00000355968;ENST00000244636	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.24	5.24	0.73138	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.000000	0.85682	U	0.000000	D	0.83027	0.5165	H	0.99425	4.56	0.80722	D	1	D	0.67145	0.996	D	0.74348	0.983	D	0.90988	0.4833	10	0.87932	D	0	.	18.4613	0.90739	0.0:0.0:1.0:0.0	.	96	P62937	PPIA_HUMAN	C	96;96;36;36;36	ENSP00000405975:G96C;ENSP00000419425:G96C;ENSP00000427976:G36C;ENSP00000430817:G36C	ENSP00000442606:G36C	G	+	1	0	PPIA	44805922	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.601000	0.98297	2.449000	0.82847	0.563000	0.77884	GGC	.	.	.	none		0.483	PPIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251293.1	NM_021130	
SLC7A2	6542	hgsc.bcm.edu	37	8	17419589	17419589	+	Silent	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:17419589G>A	ENST00000494857.1	+	11	1859	c.1641G>A	c.(1639-1641)caG>caA	p.Q547Q	SLC7A2_ENST00000004531.10_Silent_p.Q587Q|SLC7A2_ENST00000522656.1_Silent_p.Q547Q|SLC7A2_ENST00000398090.3_Silent_p.Q586Q|SLC7A2_ENST00000470360.1_Silent_p.Q586Q	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	547			Q -> L (in dbSNP:rs1981498).		amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	TCTGGAGGCAGCCCCAGAATC	0.468																																					p.Q587Q		Atlas-SNP	.											.	SLC7A2	157	.	0			c.G1761A						PASS	.						89.0	79.0	83.0					8																	17419589		2203	4300	6503	SO:0001819	synonymous_variant	6542	exon10			GAGGCAGCCCCAG	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1641G>A	chr8.hg19:g.17419589G>A		76.0	0.0	.		67.0	32.0	.	NM_001164771	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Silent	SNP	ENST00000494857.1	hg19	CCDS34852.1																																																																																			.	.	.	none		0.468	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	NM_003046	
KIAA0196	9897	hgsc.bcm.edu	37	8	126085409	126085409	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:126085409T>G	ENST00000318410.7	-	9	1485	c.1136A>C	c.(1135-1137)cAt>cCt	p.H379P	KIAA0196_ENST00000517845.1_Missense_Mutation_p.H231P	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	379					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			GTCTGCTGTATGAAGCATCAG	0.448																																					p.H379P		Atlas-SNP	.											.	KIAA0196	90	.	0			c.A1136C						PASS	.						117.0	101.0	106.0					8																	126085409		2203	4300	6503	SO:0001583	missense	9897	exon9			GCTGTATGAAGCA		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.1136A>C	chr8.hg19:g.126085409T>G	ENSP00000318016:p.His379Pro	82.0	0.0	.		90.0	39.0	.	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	ENST00000318410.7	hg19	CCDS6355.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.178175	0.78564	.	.	ENSG00000164961	ENST00000318410;ENST00000517845	D;D	0.89552	-2.53;-2.53	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.95211	0.8447	M	0.87971	2.92	0.80722	D	1	D	0.67145	0.996	D	0.78314	0.991	D	0.95703	0.8751	10	0.87932	D	0	-28.8795	16.8222	0.85835	0.0:0.0:0.0:1.0	.	379	Q12768	STRUM_HUMAN	P	379;231	ENSP00000318016:H379P;ENSP00000429676:H231P	ENSP00000318016:H379P	H	-	2	0	KIAA0196	126154591	1.000000	0.71417	0.164000	0.22755	0.692000	0.40212	7.950000	0.87804	2.371000	0.80710	0.533000	0.62120	CAT	.	.	.	none		0.448	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
ADCY8	114	hgsc.bcm.edu	37	8	132052526	132052526	+	Silent	SNP	G	G	A	rs529228094	byFrequency	TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:132052526G>A	ENST00000286355.5	-	1	2146	c.54C>T	c.(52-54)atC>atT	p.I18I	ADCY8_ENST00000377928.3_Silent_p.I18I	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	18					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCGTCGGGTGGATGGTGTAGA	0.697										HNSCC(32;0.087)																											p.I18I		Atlas-SNP	.											.	ADCY8	291	.	0			c.C54T						PASS	.						5.0	6.0	5.0					8																	132052526		2067	4086	6153	SO:0001819	synonymous_variant	114	exon1			CGGGTGGATGGTG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.54C>T	chr8.hg19:g.132052526G>A		10.0	0.0	.		7.0	4.0	.	NM_001115		Silent	SNP	ENST00000286355.5	hg19	CCDS6363.1																																																																																			.	.	.	none		0.697	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
CYP11B1	1584	hgsc.bcm.edu	37	8	143957217	143957217	+	Silent	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr8:143957217G>A	ENST00000292427.4	-	6	1064	c.1032C>T	c.(1030-1032)agC>agT	p.S344S	CYP11B1_ENST00000377675.3_Silent_p.S415S|CYP11B1_ENST00000517471.1_Silent_p.S344S	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	344					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CGGCGGCCAGGCTCTCCTGGC	0.652									Familial Hyperaldosteronism type I																												p.S344S		Atlas-SNP	.											.	CYP11B1	128	.	0			c.C1032T						PASS	.						70.0	73.0	72.0					8																	143957217		2203	4300	6503	SO:0001819	synonymous_variant	1584	exon6	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	GGCCAGGCTCTCC	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1032C>T	chr8.hg19:g.143957217G>A		267.0	0.0	.		169.0	70.0	.	NM_000497	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Silent	SNP	ENST00000292427.4	hg19	CCDS6392.1																																																																																			.	.	.	none		0.652	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
NFX1	4799	hgsc.bcm.edu	37	9	33307212	33307212	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:33307212T>C	ENST00000379540.3	+	5	1353	c.1291T>C	c.(1291-1293)Tgg>Cgg	p.W431R	NFX1_ENST00000379521.4_Missense_Mutation_p.W431R|NFX1_ENST00000318524.6_Missense_Mutation_p.W431R	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	431					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GAATCCTGAGTGGAGCAGAAA	0.413																																					p.W431R		Atlas-SNP	.											.	NFX1	85	.	0			c.T1291C						PASS	.						148.0	147.0	147.0					9																	33307212		2203	4300	6503	SO:0001583	missense	4799	exon5			CCTGAGTGGAGCA	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1291T>C	chr9.hg19:g.33307212T>C	ENSP00000368856:p.Trp431Arg	117.0	0.0	.		143.0	6.0	.	NM_147134	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	hg19	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.223848	0.79576	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.12879	2.64;2.64;2.64	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.28532	0.0706	L	0.48642	1.525	0.58432	D	0.999999	D;D;P;D;B	0.76494	0.999;0.998;0.459;0.997;0.39	D;D;B;D;B	0.71414	0.973;0.926;0.218;0.966;0.176	T	0.00975	-1.1494	10	0.33940	T	0.23	-5.1452	13.5049	0.61479	0.0:0.0:0.0:1.0	.	431;315;431;431;431	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	R	431	ENSP00000368856:W431R;ENSP00000368836:W431R;ENSP00000317695:W431R	ENSP00000317695:W431R	W	+	1	0	NFX1	33297212	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.751000	0.85126	2.092000	0.63282	0.477000	0.44152	TGG	.	.	.	none		0.413	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
PCSK5	5125	hgsc.bcm.edu	37	9	78953204	78953204	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:78953204T>C	ENST00000545128.1	+	34	5264	c.4726T>C	c.(4726-4728)Tgc>Cgc	p.C1576R		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1576	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						CTGCAAGGGGTGCCAGGGCCC	0.522																																					p.C1576R		Atlas-SNP	.											.	PCSK5	329	.	0			c.T4726C						PASS	.						34.0	32.0	32.0					9																	78953204		876	1991	2867	SO:0001583	missense	5125	exon34			AAGGGGTGCCAGG		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.4726T>C	chr9.hg19:g.78953204T>C	ENSP00000446280:p.Cys1576Arg	47.0	0.0	.		35.0	13.0	.	NM_001190482	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	hg19	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.375171	0.42105	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.74106	-0.81;-0.81	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.92577	0.7642	H	0.99391	4.545	0.80722	D	1	.	.	.	.	.	.	D	0.95696	0.8745	8	0.87932	D	0	-20.9341	15.8762	0.79166	0.0:0.0:0.0:1.0	.	.	.	.	R	1576;1306;1276	ENSP00000446280:C1576R;ENSP00000411654:C1276R	ENSP00000365945:C1306R	C	+	1	0	PCSK5	78143024	1.000000	0.71417	0.295000	0.24960	0.004000	0.04260	5.347000	0.65998	2.231000	0.72958	0.460000	0.39030	TGC	.	.	.	none		0.522	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
HNRNPK	3190	hgsc.bcm.edu	37	9	86587099	86587099	+	Silent	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr9:86587099G>T	ENST00000376264.2	-	11	909	c.651C>A	c.(649-651)ccC>ccA	p.P217P	HNRNPK_ENST00000376263.3_Silent_p.P217P|HNRNPK_ENST00000351839.3_Silent_p.P217P|HNRNPK_ENST00000376281.4_Silent_p.P217P|MIR7-1_ENST00000384871.1_RNA|HNRNPK_ENST00000360384.5_Silent_p.P217P|RP11-575L7.8_ENST00000448389.1_RNA	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	217	2 X 22 AA approximate repeats.|5 X 4 AA repeats of G-X-G-G.|Interaction with ZIK1. {ECO:0000250}.|Necessary for interaction with DDX1.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						GTCCTTTGATGGGAGACTAAA	0.403																																					p.P217P		Atlas-SNP	.											.	HNRNPK	49	.	0			c.C651A						PASS	.						48.0	47.0	48.0					9																	86587099		2203	4300	6503	SO:0001819	synonymous_variant	3190	exon11			TTTGATGGGAGAC		CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.651C>A	chr9.hg19:g.86587099G>T		60.0	0.0	.		75.0	35.0	.	NM_031262	Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Silent	SNP	ENST00000376264.2	hg19	CCDS6667.1																																																																																			.	.	.	none		0.403	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052846.2		
CUBN	8029	hgsc.bcm.edu	37	10	17157562	17157562	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr10:17157562A>G	ENST00000377833.4	-	7	693	c.628T>C	c.(628-630)Tgt>Cgt	p.C210R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	210	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTGGATGCACACTGGGGTCCG	0.542																																					p.C210R		Atlas-SNP	.											.	CUBN	515	.	0			c.T628C						PASS	.						147.0	123.0	131.0					10																	17157562		2203	4300	6503	SO:0001583	missense	8029	exon7			ATGCACACTGGGG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.628T>C	chr10.hg19:g.17157562A>G	ENSP00000367064:p.Cys210Arg	92.0	0.0	.		110.0	37.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.003508	0.54254	.	.	ENSG00000107611	ENST00000377833	D	0.91521	-2.86	5.75	5.75	0.90469	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.50627	D	0.000104	D	0.97362	0.9137	H	0.98276	4.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98939	1.0790	10	0.87932	D	0	.	15.7034	0.77558	1.0:0.0:0.0:0.0	.	210	O60494	CUBN_HUMAN	R	210	ENSP00000367064:C210R	ENSP00000367064:C210R	C	-	1	0	CUBN	17197568	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	7.574000	0.82434	2.197000	0.70478	0.533000	0.62120	TGT	.	.	.	none		0.542	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
IDE	3416	hgsc.bcm.edu	37	10	94239044	94239044	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr10:94239044T>C	ENST00000265986.6	-	15	1930	c.1874A>G	c.(1873-1875)tAt>tGt	p.Y625C	IDE_ENST00000371581.5_Missense_Mutation_p.Y70C|IDE_ENST00000496903.1_Intron	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	625					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	ATACATCCCATAGATGGTATT	0.408																																					p.Y625C		Atlas-SNP	.											.	IDE	77	.	0			c.A1874G						PASS	.						172.0	149.0	157.0					10																	94239044		2203	4300	6503	SO:0001583	missense	3416	exon15			ATCCCATAGATGG	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.1874A>G	chr10.hg19:g.94239044T>C	ENSP00000265986:p.Tyr625Cys	117.0	0.0	.		140.0	57.0	.	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	hg19	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	14.39	2.522510	0.44866	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.40756	1.02;1.02	5.64	5.64	0.86602	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.140820	0.49305	D	0.000142	T	0.40956	0.1138	M	0.64170	1.965	0.80722	D	1	P	0.38370	0.628	B	0.33890	0.172	T	0.34601	-0.9822	10	0.38643	T	0.18	-12.9568	15.5248	0.75894	0.0:0.0:0.0:1.0	.	625	P14735	IDE_HUMAN	C	625;70	ENSP00000265986:Y625C;ENSP00000360637:Y70C	ENSP00000265986:Y625C	Y	-	2	0	IDE	94229024	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.152000	0.67230	0.533000	0.62120	TAT	.	.	.	none		0.408	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
SLC22A8	9376	hgsc.bcm.edu	37	11	62782340	62782340	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr11:62782340T>C	ENST00000336232.2	-	2	226	c.91A>G	c.(91-93)Atg>Gtg	p.M31V	SLC22A8_ENST00000535878.1_Intron|SLC22A8_ENST00000311438.8_Missense_Mutation_p.M31V|SLC22A8_ENST00000430500.2_Missense_Mutation_p.M31V|SLC22A8_ENST00000545207.1_Intron	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	31					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TGGTTGGCCATGTTGAGGATC	0.617																																					p.M31V		Atlas-SNP	.											.	SLC22A8	60	.	0			c.A91G						PASS	.						183.0	179.0	181.0					11																	62782340		2201	4298	6499	SO:0001583	missense	9376	exon2			TGGCCATGTTGAG	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.91A>G	chr11.hg19:g.62782340T>C	ENSP00000337335:p.Met31Val	289.0	0.0	.		256.0	85.0	.	NM_001184732	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	ENST00000336232.2	hg19	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.009360	0.35415	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000311438;ENST00000430500	T;T;T	0.53206	0.63;0.63;0.63	4.76	2.38	0.29361	.	0.446155	0.25666	N	0.029103	T	0.26484	0.0647	N	0.21282	0.65	0.24143	N	0.995726	B;B	0.18968	0.032;0.01	B;B	0.21917	0.037;0.016	T	0.23726	-1.0180	10	0.08381	T	0.77	.	6.2794	0.20999	0.153:0.0:0.1774:0.6696	.	31;31	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	V	31	ENSP00000337335:M31V;ENSP00000311463:M31V;ENSP00000398548:M31V	ENSP00000311463:M31V	M	-	1	0	SLC22A8	62538916	0.007000	0.16637	0.736000	0.30914	0.989000	0.77384	0.313000	0.19415	0.303000	0.22785	0.533000	0.62120	ATG	.	.	.	none		0.617	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	
PITPNM1	9600	hgsc.bcm.edu	37	11	67263727	67263727	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr11:67263727T>C	ENST00000534749.1	-	14	2427	c.2239A>G	c.(2239-2241)Aag>Gag	p.K747E	PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000356404.3_Missense_Mutation_p.K747E|PITPNM1_ENST00000436757.2_Missense_Mutation_p.K746E			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	747	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						GCCTGGAACTTCGGGGCCAGC	0.642																																					p.K747E	GBM(28;144 709 4607 5525)	Atlas-SNP	.											.	PITPNM1	84	.	0			c.A2239G						PASS	.						41.0	42.0	42.0					11																	67263727		2200	4294	6494	SO:0001583	missense	9600	exon15			GGAACTTCGGGGC	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2239A>G	chr11.hg19:g.67263727T>C	ENSP00000437286:p.Lys747Glu	110.0	0.0	.		73.0	36.0	.	NM_004910	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	hg19	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.758047	0.31137	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.39787	1.06;1.06;1.06	4.43	3.29	0.37713	DDHD (2);	0.329601	0.26757	N	0.022648	T	0.26195	0.0639	N	0.13235	0.315	0.28852	N	0.896001	P;P	0.36712	0.51;0.566	B;B	0.40702	0.228;0.338	T	0.10086	-1.0645	10	0.46703	T	0.11	-28.7945	6.0013	0.19521	0.0:0.089:0.1682:0.7428	.	746;747	O00562-2;O00562	.;PITM1_HUMAN	E	747;746;747	ENSP00000437286:K747E;ENSP00000398787:K746E;ENSP00000348772:K747E	ENSP00000348772:K747E	K	-	1	0	PITPNM1	67020303	0.737000	0.28175	1.000000	0.80357	0.378000	0.30076	0.802000	0.27069	0.837000	0.34925	-0.429000	0.05907	AAG	.	.	.	none		0.642	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
ALG9	79796	hgsc.bcm.edu	37	11	111715419	111715419	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr11:111715419A>G	ENST00000531154.1	-	9	882	c.410T>C	c.(409-411)aTt>aCt	p.I137T	ALG9_ENST00000398006.2_Missense_Mutation_p.I137T|ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000524880.1_3'UTR	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	308					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		AAATCCATTAATTAAATAGAA	0.393																																					p.I308T		Atlas-SNP	.											.	ALG9	77	.	0			c.T923C						PASS	.						91.0	86.0	88.0					11																	111715419		1836	4091	5927	SO:0001583	missense	79796	exon10			CCATTAATTAAAT		CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.410T>C	chr11.hg19:g.111715419A>G	ENSP00000435517:p.Ile137Thr	80.0	0.0	.		83.0	38.0	.	NM_001077690	Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Missense_Mutation	SNP	ENST00000531154.1	hg19	CCDS41714.1	.	.	.	.	.	.	.	.	.	.	A	16.28	3.077619	0.55753	.	.	ENSG00000086848	ENST00000531154;ENST00000398006;ENST00000428306	T;T	0.63417	-0.04;-0.04	5.69	5.69	0.88448	.	0.149147	0.64402	D	0.000012	T	0.67878	0.2940	L	0.60455	1.87	0.51767	D	0.999935	P;B;B;P	0.41080	0.549;0.068;0.055;0.737	B;B;B;P	0.49301	0.272;0.068;0.076;0.606	T	0.63782	-0.6559	10	0.22109	T	0.4	-13.3791	15.9548	0.79880	1.0:0.0:0.0:0.0	.	137;308;541;308	B4DQI3;Q9H6U8-3;B4DYW0;Q9H6U8	.;.;.;ALG9_HUMAN	T	137;137;541	ENSP00000435517:I137T;ENSP00000381090:I137T	ENSP00000381090:I137T	I	-	2	0	ALG9	111220629	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.161000	0.77505	2.171000	0.68590	0.528000	0.53228	ATT	.	.	.	none		0.393	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391485.1	NM_024740	
NCAPD2	9918	hgsc.bcm.edu	37	12	6638743	6638743	+	Silent	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr12:6638743C>A	ENST00000315579.5	+	28	4436	c.3637C>A	c.(3637-3639)Cgg>Agg	p.R1213R	RP5-940J5.3_ENST00000537921.1_RNA|NCAPD2_ENST00000545962.1_Silent_p.R1168R	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1213					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						GCTGTGTCAGCGGTTCCGCAC	0.602																																					p.R1213R		Atlas-SNP	.											.	NCAPD2	99	.	0			c.C3637A						PASS	.						95.0	82.0	86.0					12																	6638743		2203	4300	6503	SO:0001819	synonymous_variant	9918	exon28			TGTCAGCGGTTCC	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.3637C>A	chr12.hg19:g.6638743C>A		116.0	0.0	.		114.0	20.0	.	NM_014865	D3DUR4|Q8N6U3	Silent	SNP	ENST00000315579.5	hg19	CCDS8548.1																																																																																			.	.	.	none		0.602	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
ESD	2098	hgsc.bcm.edu	37	13	47345616	47345616	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr13:47345616A>G	ENST00000378720.3	-	10	966	c.784T>C	c.(784-786)Tac>Cac	p.Y262H	ESD_ENST00000378697.1_Missense_Mutation_p.Y233H	NM_001984.1	NP_001975.1	P10768	ESTD_HUMAN	esterase D	262					formaldehyde catabolic process (GO:0046294)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carboxylic ester hydrolase activity (GO:0052689)|hydrolase activity, acting on ester bonds (GO:0016788)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)|S-formylglutathione hydrolase activity (GO:0018738)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	9		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)	ATGAAGTAGTAGCTATGATCA	0.328																																					p.Y262H		Atlas-SNP	.											.	ESD	23	.	0			c.T784C						PASS	.						152.0	154.0	153.0					13																	47345616		2203	4296	6499	SO:0001583	missense	2098	exon10			AGTAGTAGCTATG	M13450	CCDS9404.1	13q14.1-q14.2	2014-05-13	2010-05-07		ENSG00000139684	ENSG00000139684	3.1.2.12		3465	protein-coding gene	gene with protein product	"""S-formylglutathione hydrolase"""	133280	"""esterase D/formylglutathione hydrolase"""				Standard	NM_001984		Approved		uc001vbn.3	P10768	OTTHUMG00000016878	ENST00000378720.3:c.784T>C	chr13.hg19:g.47345616A>G	ENSP00000367992:p.Tyr262His	52.0	0.0	.		83.0	21.0	.	NM_001984	Q5TBU8|Q5TBV0|Q5TBV2|Q9BVJ2	Missense_Mutation	SNP	ENST00000378720.3	hg19	CCDS9404.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.686182	0.88639	.	.	ENSG00000139684	ENST00000378720;ENST00000378697	T;T	0.37584	1.19;1.19	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.72104	0.3419	H	0.95539	3.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81052	-0.1107	10	0.87932	D	0	-15.2421	16.0034	0.80327	1.0:0.0:0.0:0.0	.	262	P10768	ESTD_HUMAN	H	262;233	ENSP00000367992:Y262H;ENSP00000367969:Y233H	ENSP00000367969:Y233H	Y	-	1	0	ESD	46243617	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.060000	0.93907	2.371000	0.80710	0.533000	0.62120	TAC	.	.	.	none		0.328	ESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044826.1		
ATP7B	540	hgsc.bcm.edu	37	13	52511445	52511445	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr13:52511445T>G	ENST00000242839.4	-	19	4144	c.3988A>C	c.(3988-3990)Att>Ctt	p.I1330L	ATP7B_ENST00000344297.5_Missense_Mutation_p.I1123L|ATP7B_ENST00000400366.3_Missense_Mutation_p.I1219L|ATP7B_ENST00000418097.2_Missense_Mutation_p.I1265L|ATP7B_ENST00000400370.3_Missense_Mutation_p.I900L|ATP7B_ENST00000417240.2_Missense_Mutation_p.I541L|ATP7B_ENST00000448424.2_Missense_Mutation_p.I1252L	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1330					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	AGGTTATAAATCAGTGCCAGG	0.532									Wilson disease																												p.I1330L		Atlas-SNP	.											.	ATP7B	123	.	0			c.A3988C						PASS	.						104.0	109.0	107.0					13																	52511445		2043	4195	6238	SO:0001583	missense	540	exon19	Familial Cancer Database		TATAAATCAGTGC	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.3988A>C	chr13.hg19:g.52511445T>G	ENSP00000242839:p.Ile1330Leu	83.0	0.0	.		76.0	33.0	.	NM_000053	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	hg19	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459608	0.63401	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000417240;ENST00000448424;ENST00000400370;ENST00000418097	D;D;D;D;D;D;D	0.99158	-5.5;-5.5;-5.5;-2.36;-5.5;-5.5;-5.5	5.34	5.34	0.76211	HAD-like domain (1);	0.000000	0.85682	D	0.000000	D	0.98689	0.9560	L	0.42008	1.315	0.80722	D	1	D;B;D;B;D;P;D;D	0.56521	0.974;0.191;0.976;0.447;0.976;0.678;0.976;0.974	D;B;P;B;P;P;P;P	0.66716	0.946;0.145;0.741;0.285;0.741;0.646;0.741;0.677	D	0.99474	1.0946	10	0.40728	T	0.16	-22.351	15.6255	0.76851	0.0:0.0:0.0:1.0	.	1252;1282;1265;541;900;1219;1123;1330	E7ET55;B7ZLR4;F5H748;E7EQQ2;F5H562;P35670-3;P35670-2;P35670	.;.;.;.;.;.;.;ATP7B_HUMAN	L	1330;1219;1123;541;1252;900;1265	ENSP00000242839:I1330L;ENSP00000383217:I1219L;ENSP00000342559:I1123L;ENSP00000390360:I541L;ENSP00000416738:I1252L;ENSP00000383221:I900L;ENSP00000393343:I1265L	ENSP00000242839:I1330L	I	-	1	0	ATP7B	51409446	1.000000	0.71417	0.983000	0.44433	0.966000	0.64601	6.243000	0.72384	2.144000	0.66660	0.533000	0.62120	ATT	.	.	.	none		0.532	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
SERPINA10	51156	hgsc.bcm.edu	37	14	94756790	94756790	+	Silent	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr14:94756790C>T	ENST00000393096.1	-	2	606	c.141G>A	c.(139-141)gaG>gaA	p.E47E	SERPINA10_ENST00000554723.1_Silent_p.E87E|SERPINA10_ENST00000554173.1_Silent_p.E47E|SERPINA10_ENST00000261994.4_Silent_p.E47E	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	47					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		CTTCCTCTTCCTCCTTGGGAG	0.622																																					p.E47E		Atlas-SNP	.											.	SERPINA10	83	.	0			c.G141A						PASS	.						39.0	38.0	38.0					14																	94756790		2203	4300	6503	SO:0001819	synonymous_variant	51156	exon2			CTCTTCCTCCTTG	AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.141G>A	chr14.hg19:g.94756790C>T		54.0	0.0	.		33.0	13.0	.	NM_001100607	A5Z2A5|Q6UWX9|Q86U20	Silent	SNP	ENST00000393096.1	hg19	CCDS9923.1																																																																																			.	.	.	none		0.622	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413061.1	NM_016186	
RORA	6095	hgsc.bcm.edu	37	15	60849084	60849084	+	Intron	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr15:60849084T>C	ENST00000335670.6	-	3	297				RORA_ENST00000449337.2_Intron|RP11-219B17.1_ENST00000558235.1_RNA|RORA_ENST00000560004.1_Intron|RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000309157.4_Intron|RORA_ENST00000261523.5_Missense_Mutation_p.E88G	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A						angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						TTCCTTATCTTCCTTTTGTGA	0.403																																					p.E88G		Atlas-SNP	.											.	RORA	114	.	0			c.A263G						PASS	.						325.0	278.0	294.0					15																	60849084		2203	4300	6503	SO:0001627	intron_variant	6095	exon3			TTATCTTCCTTTT	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.197-25034A>G	chr15.hg19:g.60849084T>C		129.0	0.0	.		169.0	83.0	.	NM_134260	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	ENST00000335670.6	hg19	CCDS10177.1	.	.	.	.	.	.	.	.	.	.	T	11.19	1.566201	0.27915	.	.	ENSG00000069667	ENST00000261523	D	0.94457	-3.43	4.3	3.17	0.36434	.	2.259680	0.02344	N	0.075239	D	0.87815	0.6272	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.77749	-0.2471	10	0.22706	T	0.39	.	7.854	0.29472	0.0:0.0:0.2396:0.7604	.	88	P35398	RORA_HUMAN	G	88	ENSP00000261523:E88G	ENSP00000261523:E88G	E	-	2	0	RORA	58636376	0.028000	0.19301	0.012000	0.15200	0.033000	0.12548	0.610000	0.24253	0.985000	0.38656	0.533000	0.62120	GAA	.	.	.	none		0.403	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2		
GFER	2671	hgsc.bcm.edu	37	16	2035934	2035934	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:2035934A>C	ENST00000248114.6	+	3	529	c.523A>C	c.(523-525)Aat>Cat	p.N175H	AC005606.14_ENST00000564438.1_lincRNA|GFER_ENST00000569451.1_Missense_Mutation_p.Q109P|GFER_ENST00000567719.1_Missense_Mutation_p.N100H	NM_005262.2	NP_005253.3	P55789	ALR_HUMAN	growth factor, augmenter of liver regeneration	175	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|protein disulfide oxidoreductase activity (GO:0015035)|thiol oxidase activity (GO:0016972)			endometrium(1)|large_intestine(1)|lung(3)	5					Flavin adenine dinucleotide(DB03147)	CCACCTGCACAATGAAGTGAA	0.587																																					p.N175H		Atlas-SNP	.											.	GFER	8	.	0			c.A523C						PASS	.						95.0	91.0	92.0					16																	2035934		2198	4299	6497	SO:0001583	missense	2671	exon3			CTGCACAATGAAG	BC002429	CCDS32368.1	16p13.3-p13.12	2011-06-22	2008-08-01		ENSG00000127554	ENSG00000127554			4236	protein-coding gene	gene with protein product	"""ERV1 homolog (S. cerevisiae)"""	600924	"""growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration)"""			8575761	Standard	NM_005262		Approved	HSS, ERV1, ALR, HERV1, HPO1, HPO2	uc002cob.3	P55789		ENST00000248114.6:c.523A>C	chr16.hg19:g.2035934A>C	ENSP00000248114:p.Asn175His	185.0	0.0	.		201.0	121.0	.	NM_005262	Q53YM6|Q8TAH6|Q9H290|Q9UK40	Missense_Mutation	SNP	ENST00000248114.6	hg19	CCDS32368.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	19.71|19.71	3.878702|3.878702	0.72294|0.72294	.|.	.|.	ENSG00000127554|ENSG00000127554	ENST00000248114|ENST00000425414	T|.	0.79454|.	-1.27|.	4.43|4.43	4.43|4.43	0.53597|0.53597	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87799|0.87799	0.6268|0.6268	H|H	0.97852|0.97852	4.09|4.09	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.91675|0.91675	0.5353|0.5353	10|6	0.87932|0.72032	D|D	0|0.01	-22.5825|-22.5825	13.1409|13.1409	0.59434|0.59434	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	101;175|.	Q9UQK8;P55789|.	.;ALR_HUMAN|.	H|P	175|94	ENSP00000248114:N175H|.	ENSP00000248114:N175H|ENSP00000396950:Q94P	N|Q	+|+	1|2	0|0	GFER|GFER	1975935|1975935	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.444000|0.444000	0.32077|0.32077	6.743000|6.743000	0.74848|0.74848	1.763000|1.763000	0.52060|0.52060	0.418000|0.418000	0.28097|0.28097	AAT|CAA	.	.	.	none		0.587	GFER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434243.1	NM_005262	
GFER	2671	hgsc.bcm.edu	37	16	2035967	2035967	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:2035967T>A	ENST00000248114.6	+	3	562	c.556T>A	c.(556-558)Ttc>Atc	p.F186I	AC005606.14_ENST00000564438.1_lincRNA|GFER_ENST00000569451.1_3'UTR|GFER_ENST00000567719.1_Missense_Mutation_p.F111I	NM_005262.2	NP_005253.3	P55789	ALR_HUMAN	growth factor, augmenter of liver regeneration	186	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|protein disulfide oxidoreductase activity (GO:0015035)|thiol oxidase activity (GO:0016972)			endometrium(1)|large_intestine(1)|lung(3)	5					Flavin adenine dinucleotide(DB03147)	CAAGCCTGACTTCGACTGCTC	0.612																																					p.F186I		Atlas-SNP	.											.	GFER	8	.	0			c.T556A						PASS	.						93.0	87.0	89.0					16																	2035967		2198	4300	6498	SO:0001583	missense	2671	exon3			CCTGACTTCGACT	BC002429	CCDS32368.1	16p13.3-p13.12	2011-06-22	2008-08-01		ENSG00000127554	ENSG00000127554			4236	protein-coding gene	gene with protein product	"""ERV1 homolog (S. cerevisiae)"""	600924	"""growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration)"""			8575761	Standard	NM_005262		Approved	HSS, ERV1, ALR, HERV1, HPO1, HPO2	uc002cob.3	P55789		ENST00000248114.6:c.556T>A	chr16.hg19:g.2035967T>A	ENSP00000248114:p.Phe186Ile	182.0	1.0	.		171.0	101.0	.	NM_005262	Q53YM6|Q8TAH6|Q9H290|Q9UK40	Missense_Mutation	SNP	ENST00000248114.6	hg19	CCDS32368.1	.	.	.	.	.	.	.	.	.	.	t	33	5.218249	0.95104	.	.	ENSG00000127554	ENST00000248114	T	0.64803	-0.12	4.43	4.43	0.53597	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);	0.000000	0.85682	D	0.000000	D	0.84951	0.5586	H	0.97077	3.935	0.80722	D	1	D;D	0.89917	0.985;1.0	D;D	0.81914	0.982;0.995	D	0.89667	0.3881	10	0.87932	D	0	-13.6696	13.1409	0.59434	0.0:0.0:0.0:1.0	.	112;186	Q9UQK8;P55789	.;ALR_HUMAN	I	186	ENSP00000248114:F186I	ENSP00000248114:F186I	F	+	1	0	GFER	1975968	1.000000	0.71417	0.993000	0.49108	0.876000	0.50452	7.301000	0.78850	1.763000	0.52060	0.418000	0.28097	TTC	.	.	.	none		0.612	GFER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434243.1	NM_005262	
TSC2	7249	hgsc.bcm.edu	37	16	2134472	2134472	+	Missense_Mutation	SNP	C	C	T	rs137854296		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:2134472C>T	ENST00000219476.3	+	34	4879	c.4249C>T	c.(4249-4251)Cgg>Tgg	p.R1417W	TSC2_ENST00000568454.1_Missense_Mutation_p.R1361W|TSC2_ENST00000382538.6_Missense_Mutation_p.R1302W|TSC2_ENST00000401874.2_Missense_Mutation_p.R1350W|TSC2_ENST00000353929.4_Missense_Mutation_p.R1374W|TSC2_ENST00000350773.4_Missense_Mutation_p.R1394W|TSC2_ENST00000439673.2_Missense_Mutation_p.R1314W	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1417					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GGTTAAGGCCCGGTCACAGTC	0.687			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.R1417W		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.,5	TSC2	364	.	0			c.C4249T	GRCh37	CD052525	TSC2	D	rs137854055	PASS	.						20.0	21.0	21.0					16																	2134472		2177	4290	6467	SO:0001583	missense	7249	exon34	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AAGGCCCGGTCAC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4249C>T	chr16.hg19:g.2134472C>T	ENSP00000219476:p.Arg1417Trp	47.0	0.0	.		41.0	2.0	.	NM_000548	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	hg19	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.337016	0.41398	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.89552	-2.44;-2.43;-2.53;-2.49;-2.45	5.03	4.01	0.46588	.	0.484865	0.20178	N	0.097594	D	0.87900	0.6294	N	0.19112	0.55	0.23254	N	0.998035	D;D;D;D;D;D;D	0.76494	0.998;0.999;0.999;0.999;0.999;0.999;0.995	P;D;D;D;D;D;P	0.67725	0.898;0.953;0.953;0.928;0.953;0.953;0.727	T	0.78730	-0.2090	10	0.66056	D	0.02	-16.5437	8.9464	0.35762	0.2272:0.6557:0.117:0.0	.	1302;1314;1394;192;1373;1350;1417	B4DIL8;P49815-6;P49815-4;B3KSR9;P49815-3;P49815-5;P49815	.;.;.;.;.;.;TSC2_HUMAN	W	1417;1351;1374;1314;1302;1394	ENSP00000219476:R1417W;ENSP00000248099:R1374W;ENSP00000399232:R1314W;ENSP00000371978:R1302W;ENSP00000344383:R1394W	ENSP00000219476:R1417W	R	+	1	2	TSC2	2074473	0.500000	0.26091	0.892000	0.35008	0.367000	0.29736	1.806000	0.38892	2.350000	0.79820	0.484000	0.47621	CGG	.	.	.	none		0.687	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
BFAR	51283	hgsc.bcm.edu	37	16	14755823	14755823	+	Silent	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:14755823G>T	ENST00000261658.2	+	6	1135	c.858G>T	c.(856-858)ctG>ctT	p.L286L	BFAR_ENST00000426842.2_Silent_p.L158L|BFAR_ENST00000563971.1_Silent_p.L161L	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	286					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						TGCTCTACCTGTACCTGTTTG	0.567																																					p.L286L		Atlas-SNP	.											.	BFAR	38	.	0			c.G858T						PASS	.						237.0	201.0	213.0					16																	14755823		2197	4300	6497	SO:0001819	synonymous_variant	51283	exon6			CTACCTGTACCTG	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.858G>T	chr16.hg19:g.14755823G>T		211.0	0.0	.		280.0	161.0	.	NM_016561	A8K4Z9|B4DUT0|D3DUG8	Silent	SNP	ENST00000261658.2	hg19	CCDS10554.1																																																																																			.	.	.	none		0.567	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252088.1	NM_016561	
XYLT1	64131	hgsc.bcm.edu	37	16	17202725	17202725	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:17202725C>A	ENST00000261381.6	-	12	2791	c.2707G>T	c.(2707-2709)Gag>Tag	p.E903*		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	903					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.E903Q(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AGCCATCCCTCCAGCGCTGTG	0.667																																					p.E903X		Atlas-SNP	.											XYLT1,NS,carcinoma,0,1	XYLT1	147	.	2	Substitution - Missense(2)	lung(2)	c.G2707T						PASS	.						71.0	63.0	66.0					16																	17202725		2197	4300	6497	SO:0001587	stop_gained	64131	exon12			ATCCCTCCAGCGC	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2707G>T	chr16.hg19:g.17202725C>A	ENSP00000261381:p.Glu903*	98.0	0.0	.		125.0	9.0	.	NM_022166	Q9H1B6	Nonsense_Mutation	SNP	ENST00000261381.6	hg19	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	40	8.341779	0.98769	.	.	ENSG00000103489	ENST00000261381	.	.	.	5.7	5.7	0.88788	.	0.042979	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-47.0445	18.8196	0.92090	0.0:1.0:0.0:0.0	.	.	.	.	X	903	.	ENSP00000261381:E903X	E	-	1	0	XYLT1	17110226	1.000000	0.71417	0.995000	0.50966	0.811000	0.45836	5.784000	0.68990	2.675000	0.91044	0.655000	0.94253	GAG	.	.	.	none		0.667	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
SLC12A4	6560	hgsc.bcm.edu	37	16	67982000	67982000	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr16:67982000G>A	ENST00000316341.3	-	14	1951	c.1811C>T	c.(1810-1812)aCc>aTc	p.T604I	SLC12A4_ENST00000576616.1_Missense_Mutation_p.T604I|SLC12A4_ENST00000338335.3_Missense_Mutation_p.T604I|SLC12A4_ENST00000572037.1_Missense_Mutation_p.T556I|SLC12A4_ENST00000541864.2_Missense_Mutation_p.T573I|SLC12A4_ENST00000422611.2_Missense_Mutation_p.T606I|SLC12A4_ENST00000537830.2_Missense_Mutation_p.T598I	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	604					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCAGTTGGGGGTCCTCAGGAG	0.617																																					p.T606I		Atlas-SNP	.											.	SLC12A4	81	.	0			c.C1817T						PASS	.						86.0	87.0	87.0					16																	67982000		2198	4300	6498	SO:0001583	missense	6560	exon13			TTGGGGGTCCTCA		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.1811C>T	chr16.hg19:g.67982000G>A	ENSP00000318557:p.Thr604Ile	244.0	0.0	.		263.0	64.0	.	NM_001145962	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	hg19	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	G	35	5.548568	0.96488	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	D;D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98;-4.98	5.82	5.82	0.92795	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.98957	0.9645	M	0.79805	2.47	0.80722	D	1	B;P;D;P;P;P	0.69078	0.338;0.917;0.997;0.511;0.511;0.76	B;P;D;B;B;P	0.71184	0.373;0.783;0.972;0.373;0.281;0.507	D	0.99808	1.1039	10	0.87932	D	0	.	20.0953	0.97838	0.0:0.0:1.0:0.0	.	606;604;573;598;604;604	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	I	606;573;598;604;604	ENSP00000395983:T606I;ENSP00000438334:T573I;ENSP00000445962:T598I;ENSP00000343374:T604I;ENSP00000318557:T604I	ENSP00000318557:T604I	T	-	2	0	SLC12A4	66539501	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.807000	0.99171	2.767000	0.95098	0.655000	0.94253	ACC	.	.	.	none		0.617	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
CLUH	23277	hgsc.bcm.edu	37	17	2595388	2595388	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:2595388G>T	ENST00000570628.2	-	23	3552	c.3447C>A	c.(3445-3447)caC>caA	p.H1149Q	CLUH_ENST00000538975.1_Missense_Mutation_p.H1149Q|CLUH_ENST00000435359.1_Missense_Mutation_p.H1149Q			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	1149					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											CGACAAGGTGGTGGCTGCCGG	0.687																																					p.H1149Q		Atlas-SNP	.											.	.	.	.	0			c.C3447A						PASS	.						9.0	10.0	10.0					17																	2595388		1998	4151	6149	SO:0001583	missense	23277	exon23			AAGGTGGTGGCTG	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.3447C>A	chr17.hg19:g.2595388G>T	ENSP00000458986:p.His1149Gln	19.0	0.0	.		13.0	9.0	.	NM_015229	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	hg19	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989729	0.74589	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	D;D	0.93953	-3.32;-3.32	4.81	4.81	0.61882	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.94961	0.8370	L	0.49350	1.555	0.58432	D	0.999994	P;D	0.61697	0.629;0.99	P;D	0.66351	0.542;0.943	D	0.95039	0.8176	10	0.59425	D	0.04	.	15.1886	0.73025	0.0:0.0:1.0:0.0	.	1149;1150	O75153;C9J6D7	K0664_HUMAN;.	Q	1149;1150;1149	ENSP00000388872:H1149Q;ENSP00000439628:H1149Q	ENSP00000320468:H1150Q	H	-	3	2	KIAA0664	2542138	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.158000	0.50723	2.494000	0.84150	0.549000	0.68633	CAC	.	.	.	none		0.687	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
NDEL1	81565	hgsc.bcm.edu	37	17	8350137	8350137	+	Silent	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:8350137T>C	ENST00000334527.7	+	4	503	c.306T>C	c.(304-306)agT>agC	p.S102S	NDEL1_ENST00000585098.1_Intron|NDEL1_ENST00000299734.7_Silent_p.S102S|NDEL1_ENST00000402554.3_Silent_p.S102S|NDEL1_ENST00000380025.4_Silent_p.S102S	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	102	Interaction with KATNB1. {ECO:0000250}.|Self-association. {ECO:0000250}.				activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						ATGATTTAAGTCAGACTCGGG	0.463																																					p.S102S		Atlas-SNP	.											.	NDEL1	47	.	0			c.T306C						PASS	.						114.0	104.0	107.0					17																	8350137		2203	4300	6503	SO:0001819	synonymous_variant	81565	exon4			TTTAAGTCAGACT	AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.306T>C	chr17.hg19:g.8350137T>C		64.0	0.0	.		115.0	60.0	.	NM_001025579	B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Silent	SNP	ENST00000334527.7	hg19	CCDS11143.1																																																																																			.	.	.	none		0.463	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226999.2	NM_030808	
ACLY	47	hgsc.bcm.edu	37	17	40025023	40025023	+	Silent	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:40025023T>C	ENST00000352035.2	-	28	3280	c.3150A>G	c.(3148-3150)gaA>gaG	p.E1050E	ACLY_ENST00000537919.1_Silent_p.E779E|ACLY_ENST00000353196.1_Silent_p.E1040E|ACLY_ENST00000590151.1_Silent_p.E1050E|ACLY_ENST00000588779.1_5'UTR|ACLY_ENST00000393896.2_Silent_p.E1040E	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	1050					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				TGTCAATATATTCATCAGCTT	0.438																																					p.E1050E	Colon(64;807 1396 15971 30971)	Atlas-SNP	.											.	ACLY	85	.	0			c.A3150G						PASS	.						157.0	139.0	145.0					17																	40025023		2203	4300	6503	SO:0001819	synonymous_variant	47	exon28			AATATATTCATCA	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.3150A>G	chr17.hg19:g.40025023T>C		110.0	0.0	.		180.0	46.0	.	NM_001096	B4DIM0|B4E3P0|Q13037|Q9BRL0	Silent	SNP	ENST00000352035.2	hg19	CCDS11412.1																																																																																			.	.	.	none		0.438	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
CDC27	996	hgsc.bcm.edu	37	17	45216135	45216135	+	Silent	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:45216135G>A	ENST00000066544.3	-	13	1767	c.1674C>T	c.(1672-1674)gaC>gaT	p.D558D	CDC27_ENST00000531206.1_Silent_p.D564D|CDC27_ENST00000446365.2_Silent_p.D497D|CDC27_ENST00000527547.1_Silent_p.D557D	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	558					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGTCTGTTAAGTCTTTTGACA	0.353																																					p.D564D		Atlas-SNP	.											.	CDC27	337	.	0			c.C1692T						PASS	.						48.0	53.0	52.0					17																	45216135		2202	4299	6501	SO:0001819	synonymous_variant	996	exon13			TGTTAAGTCTTTT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1674C>T	chr17.hg19:g.45216135G>A		44.0	0.0	.		63.0	5.0	.	NM_001114091	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	hg19	CCDS11509.1																																																																																			.	.	.	none		0.353	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CSNK1D	1453	hgsc.bcm.edu	37	17	80202675	80202675	+	Silent	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr17:80202675C>T	ENST00000314028.6	-	9	1579	c.1230G>A	c.(1228-1230)caG>caA	p.Q410Q	CSNK1D_ENST00000398519.5_Intron|CSNK1D_ENST00000392334.2_3'UTR	NM_001893.4	NP_001884.2	P48730	KC1D_HUMAN	casein kinase 1, delta	410					circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle (GO:0005819)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			breast(2)|large_intestine(2)|lung(7)	11	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			GCACGACAGACTGAAGACCAC	0.557											OREG0024822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q410Q		Atlas-SNP	.											.	CSNK1D	118	.	0			c.G1230A						PASS	.						115.0	85.0	95.0					17																	80202675		2203	4300	6503	SO:0001819	synonymous_variant	1453	exon9			GACAGACTGAAGA		CCDS11805.1, CCDS11806.1	17q25	2013-01-17				ENSG00000141551			2452	protein-coding gene	gene with protein product		600864				7797465	Standard	NM_001893		Approved	HCKID, CKID, CKIdelta	uc002kej.3	P48730		ENST00000314028.6:c.1230G>A	chr17.hg19:g.80202675C>T		92.0	0.0	.	1196	98.0	47.0	.	NM_001893	A2I2P2|Q96KZ6|Q9BTN5	Silent	SNP	ENST00000314028.6	hg19	CCDS11805.1																																																																																			.	.	.	none		0.557	CSNK1D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442632.1	NM_139062	
SMARCA4	6597	hgsc.bcm.edu	37	19	11132430	11132430	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr19:11132430A>T	ENST00000429416.3	+	20	2927	c.2646A>T	c.(2644-2646)gaA>gaT	p.E882D	SMARCA4_ENST00000344626.4_Missense_Mutation_p.E882D|SMARCA4_ENST00000589677.1_Missense_Mutation_p.E882D|SMARCA4_ENST00000358026.2_Missense_Mutation_p.E882D|SMARCA4_ENST00000413806.3_Missense_Mutation_p.E882D|SMARCA4_ENST00000590574.1_Missense_Mutation_p.E882D|SMARCA4_ENST00000450717.3_Missense_Mutation_p.E882D|SMARCA4_ENST00000541122.2_Missense_Mutation_p.E882D|SMARCA4_ENST00000444061.3_Missense_Mutation_p.E882D	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	882	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TTGTGGACGAAGGTCACCGCA	0.632			"""F, N, Mis"""		NSCLC																																p.E882D		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	502	.	1	Unknown(1)	lung(1)	c.A2646T						PASS	.						77.0	61.0	67.0					19																	11132430		2202	4300	6502	SO:0001583	missense	6597	exon19			GGACGAAGGTCAC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2646A>T	chr19.hg19:g.11132430A>T	ENSP00000395654:p.Glu882Asp	55.0	0.0	.		34.0	11.0	.	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825530	0.71143	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.99652	-6.3;-6.3;-6.3;-6.3;-6.3;-6.3;-6.3	4.66	-2.31	0.06765	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.99778	0.9908	H	0.99825	4.815	0.50313	D	0.999868	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;0.999;1.0;0.999;0.999	D;D;D;D;D;D;D;D	0.97110	0.994;0.994;0.994;0.992;0.981;1.0;0.994;0.994	D	0.98030	1.0376	10	0.87932	D	0	-29.2033	10.9557	0.47356	0.5266:0.0:0.4734:0.0	.	882;882;882;882;882;102;882;882	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	D	882;882;946;882;882;882;882;882	ENSP00000395654:E882D;ENSP00000350720:E882D;ENSP00000343896:E882D;ENSP00000445036:E882D;ENSP00000392837:E882D;ENSP00000397783:E882D;ENSP00000414727:E882D	ENSP00000343896:E882D	E	+	3	2	SMARCA4	10993430	0.554000	0.26522	0.953000	0.39169	0.784000	0.44337	-0.089000	0.11180	-0.861000	0.04094	-0.256000	0.11100	GAA	.	.	.	none		0.632	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
HRC	3270	hgsc.bcm.edu	37	19	49657889	49657889	+	Silent	SNP	T	T	C	rs57199624|rs147238387|rs551367394|rs542091249		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr19:49657889T>C	ENST00000252825.4	-	1	792	c.606A>G	c.(604-606)gaA>gaG	p.E202E	HRC_ENST00000595625.1_Silent_p.E202E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	202	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		AGGcctcctcttcctcctcct	0.567																																					p.E202E	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											.,1	HRC	85	.	0			c.A606G						PASS	.						122.0	91.0	101.0					19																	49657889		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			CTCCTCTTCCTCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.606A>G	chr19.hg19:g.49657889T>C		59.0	0.0	.		46.0	2.0	.	NM_002152	Q504Y6	Silent	SNP	ENST00000252825.4	hg19	CCDS12759.1																																																																																			.	.	.	none		0.567	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
PPP6R1	22870	hgsc.bcm.edu	37	19	55752903	55752903	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr19:55752903A>T	ENST00000412770.2	-	8	1516	c.950T>A	c.(949-951)tTg>tAg	p.L317*	PPP6R1_ENST00000587283.1_Nonsense_Mutation_p.L317*	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	317	Interaction with PPP6C.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						TAGGGCGTGCAAGGCGCCCAC	0.672																																					p.L317X		Atlas-SNP	.											.	PPP6R1	63	.	0			c.T950A						PASS	.						16.0	20.0	19.0					19																	55752903		2009	4156	6165	SO:0001587	stop_gained	22870	exon8			GCGTGCAAGGCGC	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.950T>A	chr19.hg19:g.55752903A>T	ENSP00000414202:p.Leu317*	20.0	0.0	.		15.0	4.0	.	NM_014931	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Nonsense_Mutation	SNP	ENST00000412770.2	hg19	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	A	36	5.920878	0.97105	.	.	ENSG00000105063	ENST00000412770	.	.	.	4.31	4.31	0.51392	.	0.000000	0.41938	D	0.000783	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.1454	11.7405	0.51790	1.0:0.0:0.0:0.0	.	.	.	.	X	317	.	ENSP00000414202:L317X	L	-	2	0	PPP6R1	60444715	1.000000	0.71417	0.898000	0.35279	0.236000	0.25371	4.122000	0.57910	1.937000	0.56155	0.379000	0.24179	TTG	.	.	.	none		0.672	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	
DNMT3B	1789	hgsc.bcm.edu	37	20	31375212	31375212	+	Silent	SNP	G	G	A	rs376501500		TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr20:31375212G>A	ENST00000328111.2	+	6	930	c.609G>A	c.(607-609)ccG>ccA	p.P203P	DNMT3B_ENST00000353855.2_Silent_p.P203P|DNMT3B_ENST00000344505.4_Silent_p.P203P|DNMT3B_ENST00000443239.3_Silent_p.P161P|DNMT3B_ENST00000456297.2_Silent_p.P127P|DNMT3B_ENST00000201963.3_Silent_p.P215P|DNMT3B_ENST00000348286.2_Silent_p.P203P|DNMT3B_ENST00000375623.4_Silent_p.P161P	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	203	Interaction with DNMT1 and DNMT3A.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGGAGTCCCCGCAGGTGGAGG	0.637																																					p.P215P		Atlas-SNP	.											.	DNMT3B	196	.	0			c.G645A						PASS	.	G	,,,,,	1,4405	2.1+/-5.4	0,1,2202	52.0	51.0	51.0		483,381,609,609,609,645	-7.6	0.0	20		51	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DNMT3B	NM_001207055.1,NM_001207056.1,NM_006892.3,NM_175848.1,NM_175849.1,NM_175850.2	,,,,,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,,,,,	161/729,127/695,203/854,203/834,203/771,215/846	31375212	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1789	exon6			GTCCCCGCAGGTG		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.609G>A	chr20.hg19:g.31375212G>A		79.0	0.0	.		87.0	50.0	.	NM_175850	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Silent	SNP	ENST00000328111.2	hg19	CCDS13205.1																																																																																			.	.	.	weak		0.637	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
NCOA6	23054	hgsc.bcm.edu	37	20	33330861	33330861	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr20:33330861T>C	ENST00000374796.2	-	12	5769	c.3199A>G	c.(3199-3201)Aga>Gga	p.R1067G	NCOA6_ENST00000359003.2_Missense_Mutation_p.R1067G			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1067	NCOA1-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						ATGGGCATTCTCTGGGAGTCG	0.537																																					p.R1067G		Atlas-SNP	.											.	NCOA6	219	.	0			c.A3199G						PASS	.						112.0	117.0	115.0					20																	33330861		2203	4300	6503	SO:0001583	missense	23054	exon11			GCATTCTCTGGGA	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.3199A>G	chr20.hg19:g.33330861T>C	ENSP00000363929:p.Arg1067Gly	220.0	0.0	.		349.0	214.0	.	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	hg19	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	16.24	3.067284	0.55539	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.52526	0.66;0.66	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	T	0.56396	0.1982	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.54827	-0.8235	10	0.38643	T	0.18	-10.3259	12.8878	0.58053	0.0:0.0:0.1444:0.8556	.	1067	Q14686	NCOA6_HUMAN	G	1067	ENSP00000363929:R1067G;ENSP00000351894:R1067G	ENSP00000351894:R1067G	R	-	1	2	NCOA6	32794522	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.049000	0.57397	2.225000	0.72522	0.460000	0.39030	AGA	.	.	.	none		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47628617	47628617	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr20:47628617C>A	ENST00000371917.4	+	28	3914	c.3914C>A	c.(3913-3915)cCt>cAt	p.P1305H		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1305					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TCTGAGAGGCCTCGGGTTCGT	0.512																																					p.P1305H	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.C3914A						PASS	.						93.0	88.0	90.0					20																	47628617		2203	4300	6503	SO:0001583	missense	10564	exon28			AGAGGCCTCGGGT	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.3914C>A	chr20.hg19:g.47628617C>A	ENSP00000360985:p.Pro1305His	95.0	0.0	.		215.0	55.0	.	NM_006420	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	hg19	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.767327	0.90020	.	.	ENSG00000124198	ENST00000371917	T	0.56611	0.45	5.46	5.46	0.80206	Armadillo-type fold (1);	0.050275	0.85682	D	0.000000	T	0.77246	0.4102	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.81337	-0.0978	10	0.87932	D	0	.	19.3208	0.94237	0.0:1.0:0.0:0.0	.	1305	Q9Y6D5	BIG2_HUMAN	H	1305	ENSP00000360985:P1305H	ENSP00000360985:P1305H	P	+	2	0	ARFGEF2	47062024	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	7.747000	0.85070	2.557000	0.86248	0.561000	0.74099	CCT	.	.	.	none		0.512	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
APOL6	80830	hgsc.bcm.edu	37	22	36055131	36055131	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr22:36055131C>G	ENST00000409652.4	+	3	796	c.520C>G	c.(520-522)Ctt>Gtt	p.L174V		NM_030641.3	NP_085144.1	Q9BWW8	APOL6_HUMAN	apolipoprotein L, 6	174					lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)			haematopoietic_and_lymphoid_tissue(1)|lung(4)	5						TATCTATAATCTTAGAAACAC	0.493																																					p.L174V		Atlas-SNP	.											.	APOL6	26	.	0			c.C520G						PASS	.						61.0	63.0	62.0					22																	36055131		2203	4300	6503	SO:0001583	missense	80830	exon3			TATAATCTTAGAA	AY014879	CCDS13919.1	22q12.3	2013-01-24			ENSG00000221963	ENSG00000221963		"""Apolipoproteins"""	14870	protein-coding gene	gene with protein product		607256				11374903, 15671246	Standard	NM_030641		Approved	APOL-VI, APOLVI	uc003aoe.3	Q9BWW8	OTTHUMG00000150615	ENST00000409652.4:c.520C>G	chr22.hg19:g.36055131C>G	ENSP00000386280:p.Leu174Val	74.0	0.0	.		72.0	8.0	.	NM_030641	Q5R3S1|Q658J1|Q8IXX6|Q9UGG1	Missense_Mutation	SNP	ENST00000409652.4	hg19	CCDS13919.1	.	.	.	.	.	.	.	.	.	.	C	0.284	-0.984328	0.02180	.	.	ENSG00000221963	ENST00000409652	T	0.03124	4.04	4.05	-3.17	0.05202	.	1.542230	0.03383	N	0.200606	T	0.01489	0.0048	N	0.01482	-0.84	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46331	-0.9199	10	0.11182	T	0.66	-11.6376	7.5122	0.27579	0.0:0.1896:0.5669:0.2435	.	174	Q9BWW8	APOL6_HUMAN	V	174	ENSP00000386280:L174V	ENSP00000386280:L174V	L	+	1	0	APOL6	34385077	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.171000	0.09883	-0.392000	0.07751	-1.127000	0.01993	CTT	.	.	.	none		0.493	APOL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319081.2	NM_030641	
BCOR	54880	hgsc.bcm.edu	37	X	39932880	39932880	+	Silent	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chrX:39932880G>T	ENST00000378444.4	-	4	1947	c.1719C>A	c.(1717-1719)gcC>gcA	p.A573A	BCOR_ENST00000397354.3_Silent_p.A573A|BCOR_ENST00000378455.4_Silent_p.A573A|BCOR_ENST00000342274.4_Silent_p.A573A	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	573					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TGGCATTGGGGGCGGGTGATG	0.617			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.A573A		Atlas-SNP	.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR	351	.	0			c.C1719A						PASS	.						72.0	62.0	65.0					X																	39932880		2202	4300	6502	SO:0001819	synonymous_variant	54880	exon4			ATTGGGGGCGGGT	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.1719C>A	chrX.hg19:g.39932880G>T		70.0	0.0	.		38.0	32.0	.	NM_001123385	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	hg19	CCDS48093.1																																																																																			.	.	.	none		0.617	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
CXorf38	159013	hgsc.bcm.edu	37	X	40506303	40506303	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chrX:40506303A>G	ENST00000327877.5	-	2	333	c.307T>C	c.(307-309)Tgc>Cgc	p.C103R	CXorf38_ENST00000378426.1_5'UTR|CXorf38_ENST00000440784.2_Intron|CXorf38_ENST00000378418.2_Missense_Mutation_p.C103R|CXorf38_ENST00000378421.1_5'UTR	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	103										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						CCCGGCCGGCAGTTTCCCCAG	0.622																																					p.C103R		Atlas-SNP	.											.	CXorf38	29	.	0			c.T307C						PASS	.						26.0	27.0	26.0					X																	40506303		2202	4300	6502	SO:0001583	missense	159013	exon2			GCCGGCAGTTTCC	AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.307T>C	chrX.hg19:g.40506303A>G	ENSP00000330488:p.Cys103Arg	38.0	0.0	.		22.0	14.0	.	NM_144970	B3KW28|D3DWB5|Q5JPF5|Q8N941	Missense_Mutation	SNP	ENST00000327877.5	hg19	CCDS14253.1	.	.	.	.	.	.	.	.	.	.	a	22.0	4.230190	0.79688	.	.	ENSG00000185753	ENST00000327877;ENST00000378418	T;T	0.70516	-0.49;-0.49	5.26	4.06	0.47325	.	0.123229	0.56097	D	0.000040	T	0.79003	0.4373	M	0.66939	2.045	0.80722	D	1	D	0.55385	0.971	P	0.60473	0.875	T	0.78976	-0.1991	10	0.87932	D	0	-4.1854	10.4684	0.44622	0.8383:0.1617:0.0:0.0	.	103	Q8TB03	CX038_HUMAN	R	103	ENSP00000330488:C103R;ENSP00000367674:C103R	ENSP00000330488:C103R	C	-	1	0	CXorf38	40391247	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.258000	0.78371	0.627000	0.30340	0.483000	0.47432	TGC	.	.	.	none		0.622	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060685.3	NM_144970	
GJB1	2705	hgsc.bcm.edu	37	X	70444364	70444364	+	Silent	SNP	C	C	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chrX:70444364C>T	ENST00000374022.3	+	2	902	c.807C>T	c.(805-807)acC>acT	p.T269T	GJB1_ENST00000361726.6_Silent_p.T269T|GJB1_ENST00000374029.1_Silent_p.T269T	NM_001097642.2	NP_001091111.1	P08034	CXB1_HUMAN	gap junction protein, beta 1, 32kDa	269					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)|purine ribonucleotide transport (GO:0015868)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(1)	10	Renal(35;0.156)					GCCCTGGCACCGGGGCTGGGC	0.637																																					p.T269T		Atlas-SNP	.											.	GJB1	21	.	0			c.C807T						PASS	.						7.0	7.0	7.0					X																	70444364		2162	4203	6365	SO:0001819	synonymous_variant	2705	exon2			TGGCACCGGGGCT	X04325	CCDS14408.1	Xq13.1	2014-09-17	2007-01-16		ENSG00000169562	ENSG00000169562		"""Ion channels / Gap junction proteins (connexins)"""	4283	protein-coding gene	gene with protein product	"""Charcot-Marie-Tooth neuropathy, X-linked"", ""connexin 32"""	304040	"""gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32)"""	CMTX1, CMTX		1319395	Standard	NM_000166		Approved	CX32	uc004dzf.3	P08034	OTTHUMG00000021797	ENST00000374022.3:c.807C>T	chrX.hg19:g.70444364C>T		19.0	0.0	.		10.0	7.0	.	NM_000166	B2R8R2|D3DVV2|Q5U0S4	Silent	SNP	ENST00000374022.3	hg19	CCDS14408.1																																																																																			.	.	.	none		0.637	GJB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057133.1	NM_000166	
PASD1	139135	hgsc.bcm.edu	37	X	150828200	150828200	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chrX:150828200G>T	ENST00000370357.4	+	10	978	c.733G>T	c.(733-735)Gca>Tca	p.A245S		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	245						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					AATTGATATTGCAGAGGTTGA	0.373																																					p.A245S		Atlas-SNP	.											.	PASD1	286	.	0			c.G733T						PASS	.						200.0	160.0	173.0					X																	150828200		2203	4300	6503	SO:0001583	missense	139135	exon10			GATATTGCAGAGG	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.733G>T	chrX.hg19:g.150828200G>T	ENSP00000359382:p.Ala245Ser	32.0	0.0	.		40.0	4.0	.	NM_173493	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	hg19	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	g	8.919	0.960719	0.18583	.	.	ENSG00000166049	ENST00000370357	T	0.70399	-0.48	3.46	-4.06	0.03986	.	.	.	.	.	T	0.44850	0.1313	N	0.14661	0.345	0.09310	N	1	B	0.26876	0.162	B	0.19666	0.026	T	0.16897	-1.0387	9	0.27082	T	0.32	-10.8623	5.9292	0.19130	0.6076:0.0:0.245:0.1474	.	245	Q8IV76	PASD1_HUMAN	S	245	ENSP00000359382:A245S	ENSP00000359382:A245S	A	+	1	0	PASD1	150578856	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.030000	0.03581	-1.424000	0.01999	-0.925000	0.02716	GCA	.	.	.	none		0.373	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
MT-CO3	4514	hgsc.bcm.edu	37	M	9450	9450	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chrM:9450G>A	ENST00000362079.2	+	1	244	c.244G>A	c.(244-246)Ggg>Agg	p.G82R	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-ND5_ENST00000361567.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	82					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						GCCTTCGATACGGGATAATCC	0.478																																					p.G82X		Atlas-SNP	.											.	.	.	.	0			c.G244A						PASS	.																																			SO:0001583	missense	5742	exon1			CGATACGGGATAA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.244G>A	chrM.hg19:g.9450G>A	ENSP00000354982:p.Gly82Arg	5.0	0.0	.		14.0	10.0	.	ENST00000362079	Q14Y83	Nonsense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	C|0.942;T|0.058	.	alt		0.478	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
HECTD2	143279	hgsc.bcm.edu	37	10	93252242	93252243	+	Splice_Site	INS	-	-	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr10:93252242_93252243insT	ENST00000298068.5	+	13	1526		c.e13+1		HECTD2_ENST00000371667.1_Splice_Site|HECTD2_ENST00000536715.1_Splice_Site|HECTD2_ENST00000446394.1_Splice_Site	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						CCAGATTATGGTAAGTATGTAA	0.312																																					.	NSCLC(12;376 469 1699 39910 41417)	Atlas-INDEL	.											.	HECTD2	60	.	0			c.1432+1->T						PASS	.																																			SO:0001630	splice_region_variant	143279	exon13			.	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1432+1->T	chr10.hg19:g.93252243_93252243dupT		33.0	0.0	0		38.0	14.0	0.368421	NM_182765	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Splice_Site	INS	ENST00000298068.5	hg19	CCDS7414.1																																																																																			.	.	.	none		0.312	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		Intron
ACMSD	130013	hgsc.bcm.edu	37	2	135659397	135659398	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr2:135659397_135659398insT	ENST00000356140.5	+	10	1114_1115	c.978_979insT	c.(979-981)tttfs	p.F327fs	AC016725.4_ENST00000428857.1_RNA|AC016725.4_ENST00000413962.1_RNA|ACMSD_ENST00000283054.4_Frame_Shift_Ins_p.F269fs|AC016725.4_ENST00000537615.1_RNA|ACMSD_ENST00000392928.1_Frame_Shift_Ins_p.F269fs|AC016725.4_ENST00000392929.2_RNA	NM_138326.2	NP_612199.2	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase	327					cellular nitrogen compound metabolic process (GO:0034641)|quinolinate metabolic process (GO:0046874)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminocarboxymuconate-semialdehyde decarboxylase activity (GO:0001760)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(4)|lung(6)|skin(1)	14				BRCA - Breast invasive adenocarcinoma(221;0.115)		ATGCCCTGGCATTTTTGGGTCT	0.297																																					p.A326fs		Atlas-INDEL	.											.	ACMSD	43	.	0			c.978_979insT						PASS	.																																			SO:0001589	frameshift_variant	130013	exon10			.	AB071418	CCDS2173.2	2q21.3	2008-03-11			ENSG00000153086	ENSG00000153086	4.1.1.45		19288	protein-coding gene	gene with protein product		608889				12140278	Standard	NM_138326		Approved		uc002ttz.3	Q8TDX5	OTTHUMG00000131711	ENST00000356140.5:c.983dupT	chr2.hg19:g.135659402_135659402dupT	ENSP00000348459:p.Phe327fs	44.0	0.0	0		42.0	18.0	0.428571	NM_138326	Q3B7X3|Q53SR5|Q96KY2	Frame_Shift_Ins	INS	ENST00000356140.5	hg19	CCDS2173.2																																																																																			.	.	.	none		0.297	ACMSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254627.1		
STK24	8428	hgsc.bcm.edu	37	13	99114124	99114125	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr13:99114124_99114125insC	ENST00000376547.3	-	8	1137_1138	c.992_993insG	c.(991-993)ggcfs	p.G331fs	STK24_ENST00000397517.2_Frame_Shift_Ins_p.G319fs|STK24_ENST00000539966.1_Frame_Shift_Ins_p.G300fs	NM_003576.3	NP_003567.2	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24	331					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of cell migration (GO:0030336)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of axon regeneration (GO:0048679)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CAGAATCACTGCCCCCCGAGGC	0.535																																					p.G331fs		Atlas-INDEL	.											.,1	STK24	40	.	0			c.993_994insG						PASS	.																																			SO:0001589	frameshift_variant	8428	exon8			.	AF024636	CCDS9488.1, CCDS32001.1, CCDS66573.1	13q31.2-q32.3	2010-06-25	2010-06-25		ENSG00000102572	ENSG00000102572			11403	protein-coding gene	gene with protein product	"""STE20-like kinase 3"", ""sterile 20-like kinase 3"""	604984	"""serine/threonine kinase 24 (Ste20, yeast homolog)"""			9353338, 10644707	Standard	NM_003576		Approved	MST-3, MST3, MST3B, STK3, STE20	uc001vnn.1	Q9Y6E0	OTTHUMG00000017250	ENST00000376547.3:c.993dupG	chr13.hg19:g.99114130_99114130dupC	ENSP00000365730:p.Gly331fs	103.0	0.0	0		113.0	41.0	0.362832	NM_003576	O14840|Q5JV92	Frame_Shift_Ins	INS	ENST00000376547.3	hg19	CCDS9488.1																																																																																			.	.	.	none		0.535	STK24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045549.2	NM_003576	
ASAP3	55616	hgsc.bcm.edu	37	1	23779230	23779231	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:23779230_23779231insGG	ENST00000336689.3	-	4	426_427	c.382_383insCC	c.(382-384)ctgfs	p.L128fs	ASAP3_ENST00000437606.2_Frame_Shift_Ins_p.L128fs	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	128					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CAGACTGTCCAGGGGGAAAGAG	0.559																																					p.L128fs		Atlas-INDEL	.											.	ASAP3	65	.	0			c.383_384insCC						PASS	.																																			SO:0001589	frameshift_variant	55616	exon4			.	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.381_382dupCC	chr1.hg19:g.23779233_23779234dupGG	ENSP00000338769:p.Leu128fs	233.0	0.0	0		214.0	80.0	0.373832	NM_001143778	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Frame_Shift_Ins	INS	ENST00000336689.3	hg19	CCDS235.1																																																																																			.	.	.	none		0.559	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707	
CCDC18	343099	hgsc.bcm.edu	37	1	93680444	93680444	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:93680444delC	ENST00000343253.7	+	12	2139	c.1637delC	c.(1636-1638)gctfs	p.A546fs	CCDC18_ENST00000401026.3_Frame_Shift_Del_p.A547fs|CCDC18_ENST00000557479.1_Frame_Shift_Del_p.A665fs|CCDC18_ENST00000334652.5_5'UTR|CCDC18_ENST00000338949.4_Frame_Shift_Del_p.A346fs			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	546										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GTTAACATGGCTCACAGAACT	0.388																																					p.A547fs		Atlas-INDEL	.											CCDC18,rectum,carcinoma,0,2	CCDC18	93	.	0			c.1639delG						PASS	.						51.0	48.0	49.0					1																	93680444		1844	4098	5942	SO:0001589	frameshift_variant	343099	exon12			.			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.1637delC	chr1.hg19:g.93680444delC	ENSP00000343377:p.Ala546fs	21.0	0.0	0		33.0	11.0	0.333333	NM_206886	Q6ZU17	Frame_Shift_Del	DEL	ENST00000343253.7	hg19																																																																																				.	.	.	none		0.388	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886	
FBXO42	54455	hgsc.bcm.edu	37	1	16577319	16577320	+	Frame_Shift_Ins	INS	-	-	TATTAAA			TCGA-A4-8310-01A-11D-2396-08	TCGA-A4-8310-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6aaac72-5533-41b0-8bdb-8639f0339dd0	d8660b1d-6a91-4944-9e79-5911f80f873e	g.chr1:16577319_16577320insTATTAAA	ENST00000375592.3	-	10	2215_2216	c.1999_2000insTTTAATA	c.(1999-2001)agcfs	p.S667fs		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	667										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		CACAGAACTGCTATTAAATACT	0.475																																					p.S667_S668delinsIX		Atlas-INDEL	.											.	FBXO42	53	.	0			c.2000_2001insTTTAATA						PASS	.																																			SO:0001589	frameshift_variant	54455	exon10			.	BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1993_1999dupTTTAATA	chr1.hg19:g.16577320_16577326dupTATTAAA	ENSP00000364742:p.Ser667fs	261.0	0.0	0		217.0	30.0	0.138249	NM_018994	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Frame_Shift_Ins	INS	ENST00000375592.3	hg19	CCDS30613.1																																																																																			.	.	.	none		0.475	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1		
