#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARID1A	8289	hgsc.bcm.edu	37	1	27107195	27107195	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:27107195C>A	ENST00000324856.7	+	20	7177	c.6806C>A	c.(6805-6807)tCa>tAa	p.S2269*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.S2052*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.S597*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.S1886*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2269					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.S2269*(1)|p.S2269L(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TTGATGAACTCATTGGTTTCA	0.532			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S2269X		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,NS,carcinoma,0,2	ARID1A	842	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	urinary_tract(1)|endometrium(1)	c.C6806A						PASS	.						126.0	99.0	109.0					1																	27107195		2203	4300	6503	SO:0001587	stop_gained	8289	exon20			TGAACTCATTGGT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6806C>A	chr1.hg19:g.27107195C>A	ENSP00000320485:p.Ser2269*	198.0	0.0	.		118.0	47.0	.	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	42	9.499439	0.99187	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	.	.	.	4.6	4.6	0.57074	.	0.216209	0.40385	N	0.001101	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9686	13.6859	0.62515	0.0:0.8453:0.1547:0.0	.	.	.	.	X	2269;2052;1886;597	.	ENSP00000320485:S2269X	S	+	2	0	ARID1A	26979782	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	5.627000	0.67784	2.552000	0.86080	0.591000	0.81541	TCA	.	.	.	none		0.532	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
C1orf194	127003	hgsc.bcm.edu	37	1	109649721	109649721	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:109649721G>A	ENST00000369948.3	-	3	297	c.222C>T	c.(220-222)ttC>ttT	p.F74F	C1orf194_ENST00000369949.4_Silent_p.F62F|C1orf194_ENST00000369945.3_Silent_p.F35F			Q5T5A4	CA194_HUMAN	chromosome 1 open reading frame 194	74										large_intestine(2)|lung(2)|ovary(2)	6						CTGCTAAGCGGAAGTCCAGGT	0.483																																					p.F62F		Atlas-SNP	.											.	C1orf194	14	.	0			c.C186T						PASS	.						210.0	178.0	188.0					1																	109649721		1568	3582	5150	SO:0001819	synonymous_variant	127003	exon3			TAAGCGGAAGTCC		CCDS41364.1	1p13.3	2011-03-31			ENSG00000179902	ENSG00000179902			32331	protein-coding gene	gene with protein product							Standard	NM_001122961		Approved		uc009wew.3	Q5T5A4	OTTHUMG00000011735	ENST00000369948.3:c.222C>T	chr1.hg19:g.109649721G>A		183.0	0.0	.		217.0	93.0	.	NM_001122961	Q5T5A3	Silent	SNP	ENST00000369948.3	hg19																																																																																				.	.	.	none		0.483	C1orf194-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000032416.2	NM_001122961	
RFX5	5993	hgsc.bcm.edu	37	1	151314667	151314667	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:151314667G>T	ENST00000290524.4	-	11	2024	c.1846C>A	c.(1846-1848)Cca>Aca	p.P616T	RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000452513.2_Missense_Mutation_p.P576T|RFX5_ENST00000368870.2_Missense_Mutation_p.P616T|RFX5_ENST00000452671.2_Missense_Mutation_p.P616T|RFX5_ENST00000478564.1_5'Flank	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	616					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTGTATCATGGGGGTGTTGCT	0.453																																					p.P616T		Atlas-SNP	.											.	RFX5	69	.	0			c.C1846A						PASS	.						133.0	126.0	128.0					1																	151314667		2203	4300	6503	SO:0001583	missense	5993	exon11			ATCATGGGGGTGT		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1846C>A	chr1.hg19:g.151314667G>T	ENSP00000290524:p.Pro616Thr	129.0	0.0	.		94.0	47.0	.	NM_000449	B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	ENST00000290524.4	hg19	CCDS994.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686722	0.68157	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000452671;ENST00000452513	T;T;T;T	0.74632	-0.68;-0.68;-0.68;-0.86	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000001	T	0.76111	0.3942	L	0.36672	1.1	0.35535	D	0.8026	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.941	T	0.79593	-0.1739	10	0.87932	D	0	.	14.4852	0.67611	0.0:0.0:1.0:0.0	.	576;616	B7Z848;P48382	.;RFX5_HUMAN	T	616;616;616;576	ENSP00000290524:P616T;ENSP00000357864:P616T;ENSP00000389130:P616T;ENSP00000398388:P576T	ENSP00000290524:P616T	P	-	1	0	RFX5	149581291	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.473000	0.60196	2.806000	0.96561	0.591000	0.81541	CCA	.	.	.	none		0.453	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449	
USH2A	7399	hgsc.bcm.edu	37	1	216017693	216017693	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:216017693A>T	ENST00000307340.3	-	46	9587	c.9201T>A	c.(9199-9201)aaT>aaA	p.N3067K	USH2A_ENST00000366943.2_Missense_Mutation_p.N3067K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3067	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACCCAGGCACATTCATTCCAG	0.393										HNSCC(13;0.011)																											p.N3067K		Atlas-SNP	.											.	USH2A	1168	.	0			c.T9201A						PASS	.						98.0	99.0	99.0					1																	216017693		2203	4300	6503	SO:0001583	missense	7399	exon46			AGGCACATTCATT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9201T>A	chr1.hg19:g.216017693A>T	ENSP00000305941:p.Asn3067Lys	75.0	0.0	.		77.0	24.0	.	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	8.287	0.816795	0.16607	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53423	0.62;0.62	6.04	0.803	0.18691	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.298923	0.23197	N	0.050821	T	0.29749	0.0743	L	0.35723	1.085	0.19775	N	0.999957	B	0.13594	0.008	B	0.08055	0.003	T	0.15578	-1.0432	10	0.17832	T	0.49	.	6.0414	0.19736	0.4009:0.2965:0.3026:0.0	.	3067	O75445	USH2A_HUMAN	K	3067	ENSP00000305941:N3067K;ENSP00000355910:N3067K	ENSP00000305941:N3067K	N	-	3	2	USH2A	214084316	0.008000	0.16893	0.941000	0.38009	0.993000	0.82548	0.037000	0.13840	0.158000	0.19367	0.529000	0.55759	AAT	.	.	.	none		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
SIPA1L2	57568	hgsc.bcm.edu	37	1	232650317	232650317	+	Missense_Mutation	SNP	G	G	A	rs371322486		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:232650317G>A	ENST00000366630.1	-	2	1127	c.769C>T	c.(769-771)Cgc>Tgc	p.R257C	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.R257C			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	257					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CCTGAGATGCGGACAAATTCT	0.502																																					p.R257C		Atlas-SNP	.											.	SIPA1L2	218	.	0			c.C769T						PASS	.	G	CYS/ARG	1,3767		0,1,1883	68.0	67.0	67.0		769	5.4	1.0	1		67	0,8236		0,0,4118	no	missense	SIPA1L2	NM_020808.3	180	0,1,6001	AA,AG,GG		0.0,0.0265,0.0083	benign	257/1723	232650317	1,12003	1884	4118	6002	SO:0001583	missense	57568	exon1			AGATGCGGACAAA	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.769C>T	chr1.hg19:g.232650317G>A	ENSP00000355589:p.Arg257Cys	126.0	0.0	.		115.0	44.0	.	NM_020808	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	hg19	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588865	0.28357	2.65E-4	0.0	ENSG00000116991	ENST00000366630;ENST00000262861	T;T	0.79749	-1.3;-1.3	5.44	5.44	0.79542	.	0.117092	0.56097	D	0.000023	T	0.69187	0.3083	N	0.25647	0.755	0.49483	D	0.999794	B	0.19935	0.04	B	0.12837	0.008	T	0.63963	-0.6518	10	0.37606	T	0.19	-23.1003	12.1037	0.53798	0.0:0.0:0.7162:0.2838	.	257	Q9P2F8	SI1L2_HUMAN	C	257	ENSP00000355589:R257C;ENSP00000262861:R257C	ENSP00000262861:R257C	R	-	1	0	SIPA1L2	230716940	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.388000	0.59633	2.834000	0.97654	0.650000	0.86243	CGC	.	.	.	none		0.502	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
PELI1	57162	hgsc.bcm.edu	37	2	64323347	64323347	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr2:64323347G>A	ENST00000358912.4	-	6	1044	c.602C>T	c.(601-603)tCc>tTc	p.S201F		NM_020651.3	NP_065702.2	Q96FA3	PELI1_HUMAN	pellino E3 ubiquitin protein ligase 1	201					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|protein K48-linked ubiquitination (GO:0070936)|response to dsRNA (GO:0043331)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S201Y(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	19						TCCAGGCTTGGAGTCTTCTGT	0.453																																					p.S201F		Atlas-SNP	.											PELI1,NS,carcinoma,0,1	PELI1	34	.	1	Substitution - Missense(1)	lung(1)	c.C602T						PASS	.						166.0	151.0	156.0					2																	64323347		2203	4300	6503	SO:0001583	missense	57162	exon6			GGCTTGGAGTCTT		CCDS1876.1	2p13.3	2012-02-23	2012-02-23		ENSG00000197329	ENSG00000197329		"""Pellino homologs"""	8827	protein-coding gene	gene with protein product		614797	"""pellino (Drosophila) homolog 1"", ""pellino homolog 1 (Drosophila)"""			11306823, 16951688	Standard	NM_020651		Approved		uc002sct.4	Q96FA3	OTTHUMG00000129511	ENST00000358912.4:c.602C>T	chr2.hg19:g.64323347G>A	ENSP00000351789:p.Ser201Phe	121.0	0.0	.		124.0	45.0	.	NM_020651	Q96SM0|Q9GZY5|Q9HCX0	Missense_Mutation	SNP	ENST00000358912.4	hg19	CCDS1876.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917014	0.92249	.	.	ENSG00000197329	ENST00000358912	T	0.53423	0.62	5.65	5.65	0.86999	.	0.096296	0.64402	D	0.000001	T	0.62720	0.2451	M	0.74881	2.28	0.80722	D	1	P	0.48911	0.917	P	0.50490	0.642	T	0.66044	-0.6021	10	0.72032	D	0.01	-12.6236	20.0965	0.97849	0.0:0.0:1.0:0.0	.	201	Q96FA3	PELI1_HUMAN	F	201	ENSP00000351789:S201F	ENSP00000351789:S201F	S	-	2	0	PELI1	64176851	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.813000	0.99286	2.824000	0.97209	0.655000	0.94253	TCC	.	.	.	none		0.453	PELI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251686.1	NM_020651	
IQSEC1	9922	hgsc.bcm.edu	37	3	12957106	12957106	+	Silent	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr3:12957106C>T	ENST00000273221.4	-	7	2406	c.2190G>A	c.(2188-2190)gtG>gtA	p.V730V		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	730					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCTTTTTCCCCACAATGAGCT	0.602																																					p.V730V		Atlas-SNP	.											.	IQSEC1	88	.	0			c.G2190A						PASS	.						187.0	140.0	156.0					3																	12957106		2203	4300	6503	SO:0001819	synonymous_variant	9922	exon7			TTTCCCCACAATG	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2190G>A	chr3.hg19:g.12957106C>T		134.0	0.0	.		94.0	22.0	.	NM_014869	O94863|Q96D85	Silent	SNP	ENST00000273221.4	hg19	CCDS33703.1	.	.	.	.	.	.	.	.	.	.	C	8.705	0.910574	0.17833	.	.	ENSG00000144711	ENST00000450726	.	.	.	4.54	3.59	0.41128	.	.	.	.	.	T	0.46132	0.1377	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43393	-0.9394	4	.	.	.	.	3.2074	0.06671	0.1579:0.5539:0.1539:0.1342	.	.	.	.	R	731	.	.	G	-	1	0	IQSEC1	12932106	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	0.932000	0.28884	2.229000	0.72834	0.655000	0.94253	GGG	.	.	.	none		0.602	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	
GOLGA4	2803	hgsc.bcm.edu	37	3	37369907	37369907	+	Splice_Site	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr3:37369907A>G	ENST00000361924.2	+	15	6314	c.5940A>G	c.(5938-5940)aaA>aaG	p.K1980K	GOLGA4_ENST00000356847.4_Splice_Site_p.K2002K|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1980	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TATTACTCAGACAGGAGCAGG	0.413																																					p.K2002K		Atlas-SNP	.											.	GOLGA4	173	.	0			c.A6006G						PASS	.						152.0	156.0	155.0					3																	37369907		2203	4300	6503	SO:0001630	splice_region_variant	2803	exon16			ACTCAGACAGGAG	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.5940-1A>G	chr3.hg19:g.37369907A>G		167.0	0.0	.		185.0	8.0	.	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Silent	SNP	ENST00000361924.2	hg19	CCDS2666.1																																																																																			.	.	.	none		0.413	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	Silent
MASP1	5648	hgsc.bcm.edu	37	3	187009418	187009418	+	Start_Codon_SNP	SNP	C	C	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr3:187009418C>G	ENST00000337774.5	-	1	392	c.3G>C	c.(1-3)atG>atC	p.M1I	MASP1_ENST00000392472.2_5'UTR|MASP1_ENST00000392470.2_5'UTR|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000296280.6_Start_Codon_SNP_p.M1I|MASP1_ENST00000169293.6_Start_Codon_SNP_p.M1I	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	1					complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GCACGTACCTCATTTTCCTGC	0.602																																					p.M1I		Atlas-SNP	.											.	MASP1	240	.	0			c.G3C						PASS	.						139.0	110.0	120.0					3																	187009418		2203	4300	6503	SO:0001582	initiator_codon_variant	5648	exon1			GTACCTCATTTTC	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.3G>C	chr3.hg19:g.187009418C>G	ENSP00000336792:p.Met1Ile	178.0	0.0	.		211.0	46.0	.	NM_139125	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	hg19	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809999	0.31961	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000169293;ENST00000392475	D;D;T;T	0.82803	-1.65;-1.54;1.04;0.44	5.86	5.86	0.93980	.	1.114860	0.06594	N	0.752580	D	0.82518	0.5054	.	.	.	0.80722	D	1	B;B;B	0.19200	0.026;0.034;0.007	B;B;B	0.20767	0.031;0.014;0.009	T	0.64698	-0.6346	9	0.72032	D	0.01	.	17.3491	0.87318	0.0:1.0:0.0:0.0	.	1;1;1	P48740-3;P48740-2;P48740	.;.;MASP1_HUMAN	I	1	ENSP00000336792:M1I;ENSP00000296280:M1I;ENSP00000169293:M1I;ENSP00000376267:M1I	ENSP00000169293:M1I	M	-	3	0	MASP1	188492112	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	4.252000	0.58785	2.771000	0.95319	0.563000	0.77884	ATG	.	.	.	none		0.602	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	Missense_Mutation
UGDH	7358	hgsc.bcm.edu	37	4	39515753	39515753	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr4:39515753A>G	ENST00000316423.6	-	3	556	c.214T>C	c.(214-216)Tct>Cct	p.S72P	UGDH_ENST00000515398.1_5'UTR|UGDH_ENST00000507089.1_5'UTR|UGDH_ENST00000506179.1_Missense_Mutation_p.S72P|UGDH_ENST00000501493.2_Missense_Mutation_p.S72P	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	72					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)	p.S72fs*18(1)		breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						ATATTGGTAGAAAAAAAAAGA	0.299																																					p.S72P		Atlas-SNP	.											.,2	UGDH	52	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.T214C						PASS	.						64.0	75.0	72.0					4																	39515753		2201	4290	6491	SO:0001583	missense	7358	exon3			TGGTAGAAAAAAA	AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.214T>C	chr4.hg19:g.39515753A>G	ENSP00000319501:p.Ser72Pro	81.0	0.0	.		98.0	40.0	.	NM_003359	B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	ENST00000316423.6	hg19	CCDS3455.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.642875	0.87859	.	.	ENSG00000109814	ENST00000316423;ENST00000501493;ENST00000506179;ENST00000515021;ENST00000514106;ENST00000509391;ENST00000505698	T;T;T;T;T;T;T	0.78003	-1.14;-1.13;-1.14;-1.14;-1.14;-1.14;-1.14	5.66	5.66	0.87406	UDP-glucose/GDP-mannose dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.90700	0.7082	M	0.93197	3.39	0.80722	D	1	D;P	0.71674	0.998;0.752	D;B	0.73708	0.981;0.32	D	0.92839	0.6287	10	0.66056	D	0.02	-3.2805	15.077	0.72084	1.0:0.0:0.0:0.0	.	72;72	B3KUU2;O60701	.;UGDH_HUMAN	P	72;72;72;85;72;72;72	ENSP00000319501:S72P;ENSP00000422909:S72P;ENSP00000421757:S72P;ENSP00000421954:S85P;ENSP00000425834:S72P;ENSP00000422603:S72P;ENSP00000422565:S72P	ENSP00000319501:S72P	S	-	1	0	UGDH	39192148	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.263000	0.89864	2.148000	0.66965	0.454000	0.30748	TCT	.	.	.	none		0.299	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216818.3	NM_003359	
SORBS2	8470	hgsc.bcm.edu	37	4	186545386	186545386	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr4:186545386G>T	ENST00000284776.7	-	13	1694	c.1185C>A	c.(1183-1185)ttC>ttA	p.F395L	SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000355634.5_Missense_Mutation_p.F495L|SORBS2_ENST00000431808.1_Missense_Mutation_p.F395L|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.F299L|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000448662.2_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	395					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TCGGGTCCGGGAAGCTATCGC	0.577																																					p.F495L	Esophageal Squamous(153;41 2433 9491 36028)	Atlas-SNP	.											.	SORBS2	300	.	0			c.C1485A						PASS	.						62.0	58.0	59.0					4																	186545386		2203	4300	6503	SO:0001583	missense	8470	exon16			GTCCGGGAAGCTA		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1185C>A	chr4.hg19:g.186545386G>T	ENSP00000284776:p.Phe395Leu	96.0	0.0	.		70.0	30.0	.	NM_001270771	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	hg19	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	G	1.601	-0.526481	0.04141	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.35236	1.43;1.43;1.32;1.42	5.72	-0.19	0.13256	.	0.433914	0.25001	N	0.033913	T	0.23572	0.0570	L	0.50333	1.59	0.24909	N	0.992056	P;P;B	0.35612	0.512;0.512;0.329	B;B;B	0.35073	0.195;0.18;0.084	T	0.29822	-0.9999	10	0.10111	T	0.7	-15.4985	5.7099	0.17929	0.4632:0.2512:0.2856:0.0	.	299;495;395	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	L	395;395;299;495	ENSP00000284776:F395L;ENSP00000411764:F395L;ENSP00000397482:F299L;ENSP00000347852:F495L	ENSP00000284776:F395L	F	-	3	2	SORBS2	186782380	0.867000	0.29959	0.659000	0.29680	0.299000	0.27559	-0.021000	0.12504	-0.396000	0.07703	0.558000	0.71614	TTC	.	.	.	none		0.577	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
MTRR	4552	hgsc.bcm.edu	37	5	7886796	7886796	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr5:7886796A>G	ENST00000264668.2	+	8	1237	c.1207A>G	c.(1207-1209)Atc>Gtc	p.I403V	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Missense_Mutation_p.I376V	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	403	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	GTGTCTTGAAATCCGAGCAAT	0.363																																					p.I403V		Atlas-SNP	.											.	MTRR	74	.	0			c.A1207G						PASS	.						129.0	124.0	126.0					5																	7886796		2203	4300	6503	SO:0001583	missense	4552	exon8			CTTGAAATCCGAG	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1207A>G	chr5.hg19:g.7886796A>G	ENSP00000264668:p.Ile403Val	91.0	0.0	.		79.0	5.0	.	NM_024010	O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	hg19	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.176144	0.78564	.	.	ENSG00000124275	ENST00000264668;ENST00000440940	T;T	0.42900	0.96;0.96	5.37	5.37	0.77165	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain-3 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.047649	0.85682	D	0.000000	T	0.59851	0.2224	M	0.72353	2.195	0.80722	D	1	D	0.64830	0.994	P	0.62649	0.905	T	0.62756	-0.6787	10	0.54805	T	0.06	-26.3682	12.5449	0.56193	0.8615:0.1384:0.0:0.0	.	403	Q9UBK8	MTRR_HUMAN	V	403;376	ENSP00000264668:I403V;ENSP00000402510:I376V	ENSP00000264668:I403V	I	+	1	0	MTRR	7939796	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.194000	0.65125	2.038000	0.60285	0.533000	0.62120	ATC	.	.	.	none		0.363	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
FAM46A	55603	hgsc.bcm.edu	37	6	82461655	82461655	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:82461655C>A	ENST00000320172.6	-	2	518	c.204G>T	c.(202-204)tgG>tgT	p.W68C	FAM46A_ENST00000369756.3_Missense_Mutation_p.W149C|FAM46A_ENST00000369754.3_Missense_Mutation_p.W87C	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	68					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		GCACTTGCTCCCAGTTCAGCA	0.647																																					p.W68C		Atlas-SNP	.											.	FAM46A	37	.	0			c.G204T						PASS	.						57.0	52.0	54.0					6																	82461655		2184	4283	6467	SO:0001583	missense	55603	exon2			TTGCTCCCAGTTC	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.204G>T	chr6.hg19:g.82461655C>A	ENSP00000318298:p.Trp68Cys	197.0	0.0	.		124.0	61.0	.	NM_017633	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	ENST00000320172.6	hg19	CCDS34489.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404404	0.62288	.	.	ENSG00000112773	ENST00000369754;ENST00000320172;ENST00000369756	T;T;T	0.23147	1.92;1.92;1.92	5.44	5.44	0.79542	Domain of unknown function DUF1693 (1);	0.056200	0.85682	D	0.000000	T	0.47600	0.1454	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.36114	-0.9761	9	.	.	.	-2.8137	19.0555	0.93062	0.0:1.0:0.0:0.0	.	68;87	Q96IP4;Q96IP4-2	FA46A_HUMAN;.	C	87;68;149	ENSP00000358769:W87C;ENSP00000318298:W68C;ENSP00000358771:W149C	.	W	-	3	0	FAM46A	82518374	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	5.897000	0.69831	2.837000	0.97791	0.655000	0.94253	TGG	.	.	.	none		0.647	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
MDN1	23195	hgsc.bcm.edu	37	6	90411386	90411386	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:90411386T>A	ENST00000369393.3	-	55	8433	c.8318A>T	c.(8317-8319)gAa>gTa	p.E2773V	MDN1_ENST00000428876.1_Missense_Mutation_p.E2773V			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2773					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AGTCTGAACTTCTTTGTAATA	0.418																																					p.E2773V		Atlas-SNP	.											.	MDN1	478	.	0			c.A8318T						PASS	.						40.0	41.0	41.0					6																	90411386		2203	4300	6503	SO:0001583	missense	23195	exon55			TGAACTTCTTTGT	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.8318A>T	chr6.hg19:g.90411386T>A	ENSP00000358400:p.Glu2773Val	52.0	0.0	.		52.0	26.0	.	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	hg19	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	17.30	3.355386	0.61293	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03801	3.8;3.8	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.05686	0.0149	L	0.27053	0.805	0.53688	D	0.999978	D	0.71674	0.998	P	0.59115	0.852	T	0.49679	-0.8914	10	0.44086	T	0.13	.	16.1255	0.81392	0.0:0.0:0.0:1.0	.	2773	Q9NU22	MDN1_HUMAN	V	2773	ENSP00000358400:E2773V;ENSP00000413970:E2773V	ENSP00000358400:E2773V	E	-	2	0	MDN1	90468107	1.000000	0.71417	0.919000	0.36401	0.880000	0.50808	7.197000	0.77814	2.205000	0.71048	0.477000	0.44152	GAA	.	.	.	none		0.418	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
ECHDC1	55862	hgsc.bcm.edu	37	6	127611395	127611395	+	Silent	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:127611395T>C	ENST00000531967.1	-	6	1046	c.543A>G	c.(541-543)agA>agG	p.R181R	ECHDC1_ENST00000368289.2_3'UTR|ECHDC1_ENST00000454859.3_Silent_p.R175R|ECHDC1_ENST00000430841.2_Silent_p.R175R|ECHDC1_ENST00000528402.1_3'UTR|ECHDC1_ENST00000474289.2_Silent_p.R175R|ECHDC1_ENST00000488087.1_5'UTR|ECHDC1_ENST00000454591.2_Silent_p.R100R|ECHDC1_ENST00000368291.2_3'UTR|ECHDC1_ENST00000309620.9_Silent_p.R158R	NM_001139510.1	NP_001132982.1	Q9NTX5	ECHD1_HUMAN	enoyl CoA hydratase domain containing 1	181						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxy-lyase activity (GO:0016831)|methylmalonyl-CoA decarboxylase activity (GO:0004492)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		TGTGGACGAATCTGATCTTAC	0.408																																					p.R181R		Atlas-SNP	.											.	ECHDC1	41	.	0			c.A543G						PASS	.						65.0	58.0	60.0					6																	127611395		1869	4110	5979	SO:0001819	synonymous_variant	55862	exon6			GACGAATCTGATC	AK025796	CCDS34530.1, CCDS43504.1, CCDS47471.1, CCDS47472.1, CCDS55054.1	6q22.33	2011-12-12	2010-04-30		ENSG00000093144	ENSG00000093144			21489	protein-coding gene	gene with protein product		612136	"""enoyl Coenzyme A hydratase domain containing 1"""			22016388	Standard	NM_001002030		Approved	dJ351K20.2	uc003qax.3	Q9NTX5	OTTHUMG00000015523	ENST00000531967.1:c.543A>G	chr6.hg19:g.127611395T>C		80.0	0.0	.		93.0	37.0	.	NM_001139510	A6NFJ5|B7Z8S0|E9PEN7|E9PR31|F8W851|Q5TEF6|Q5TEF7|Q5TEG0|Q5TEG4|Q9NZ30|V9HW18	Silent	SNP	ENST00000531967.1	hg19	CCDS47471.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.430675	0.25726	.	.	ENSG00000093144	ENST00000436638;ENST00000460558	.	.	.	5.65	2.0	0.26442	.	.	.	.	.	T	0.44829	0.1312	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36578	-0.9742	4	.	.	.	.	9.6944	0.40147	0.0:0.2675:0.0:0.7325	.	.	.	.	G	189;54	.	.	D	-	2	0	ECHDC1	127653088	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.054000	0.30455	0.414000	0.25790	0.533000	0.62120	GAT	.	.	.	none		0.408	ECHDC1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042131.2		
RSPH3	83861	hgsc.bcm.edu	37	6	159401839	159401839	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:159401839C>T	ENST00000252655.1	-	6	1441	c.1252G>A	c.(1252-1254)Gat>Aat	p.D418N	RSPH3_ENST00000367069.2_Missense_Mutation_p.D276N|RSPH3_ENST00000449822.1_Missense_Mutation_p.D180N|RSPH3_ENST00000297262.3_Missense_Mutation_p.D322N	NM_031924.4	NP_114130.3	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog (Chlamydomonas)	418										endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|skin(1)|stomach(7)	23		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		TAGCCACTATCCCTGAGGCTG	0.408																																					p.D418N		Atlas-SNP	.											.	RSPH3	48	.	0			c.G1252A						PASS	.						126.0	104.0	111.0					6																	159401839		2203	4300	6503	SO:0001583	missense	83861	exon6			CACTATCCCTGAG	AF353618	CCDS5260.1	6q25.3	2014-05-16	2008-07-04	2007-06-26	ENSG00000130363	ENSG00000130363			21054	protein-coding gene	gene with protein product		615876	"""radial spokehead-like 2"""	RSHL2		12477932	Standard	NM_031924		Approved	dJ111C20.1, RSP3	uc003qrx.3	Q86UC2	OTTHUMG00000015924	ENST00000252655.1:c.1252G>A	chr6.hg19:g.159401839C>T	ENSP00000252655:p.Asp418Asn	60.0	0.0	.		44.0	18.0	.	NM_031924	Q96LQ5|Q96LX2|Q9BX75	Missense_Mutation	SNP	ENST00000252655.1	hg19	CCDS5260.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.914542	0.52546	.	.	ENSG00000130363	ENST00000367069;ENST00000449822;ENST00000252655;ENST00000297262	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	5.81	4.94	0.65067	.	0.362264	0.33938	N	0.004405	T	0.05502	0.0145	L	0.38175	1.15	0.38862	D	0.9565	P;B	0.36010	0.532;0.091	B;B	0.30943	0.122;0.065	T	0.28586	-1.0039	10	0.23302	T	0.38	-23.6685	12.7512	0.57310	0.0:0.9196:0.0:0.0804	.	322;418	Q86UC2-2;Q86UC2	.;RSPH3_HUMAN	N	276;180;418;322	ENSP00000356036:D276N;ENSP00000393195:D180N;ENSP00000252655:D418N;ENSP00000297262:D322N	ENSP00000252655:D418N	D	-	1	0	RSPH3	159321827	1.000000	0.71417	0.838000	0.33150	0.987000	0.75469	3.471000	0.53107	1.431000	0.47355	0.591000	0.81541	GAT	.	.	.	none		0.408	RSPH3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031924	
C7orf26	79034	hgsc.bcm.edu	37	7	6639468	6639468	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:6639468A>T	ENST00000344417.5	+	4	856	c.589A>T	c.(589-591)Att>Ttt	p.I197F	C7orf26_ENST00000359073.5_Missense_Mutation_p.I178F|C7orf26_ENST00000472693.1_3'UTR	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	197										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		AGATGACCTCATTCCACCTAT	0.498																																					p.I197F		Atlas-SNP	.											.	C7orf26	33	.	0			c.A589T						PASS	.						172.0	159.0	164.0					7																	6639468		2203	4300	6503	SO:0001583	missense	79034	exon4			GACCTCATTCCAC	BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.589A>T	chr7.hg19:g.6639468A>T	ENSP00000340220:p.Ile197Phe	193.0	0.0	.		218.0	126.0	.	NM_024067	Q9BQ43	Missense_Mutation	SNP	ENST00000344417.5	hg19	CCDS5353.1	.	.	.	.	.	.	.	.	.	.	A	8.056	0.767095	0.15983	.	.	ENSG00000146576	ENST00000344417;ENST00000359073	T;T	0.42900	0.96;0.96	5.08	3.89	0.44902	.	0.136974	0.64402	D	0.000003	T	0.28764	0.0713	L	0.43152	1.355	0.40382	D	0.979454	B;B	0.32160	0.358;0.358	B;B	0.30495	0.116;0.116	T	0.06789	-1.0807	10	0.17369	T	0.5	-23.9783	5.9553	0.19269	0.7464:0.1654:0.0882:0.0	.	178;197	Q96N11-2;Q96N11	.;CG026_HUMAN	F	197;178	ENSP00000340220:I197F;ENSP00000351974:I178F	ENSP00000340220:I197F	I	+	1	0	C7orf26	6605993	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	4.865000	0.62998	0.995000	0.38917	0.454000	0.30748	ATT	.	.	.	none		0.498	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246844.2	NM_024067	
HERPUD2	64224	hgsc.bcm.edu	37	7	35707133	35707133	+	Silent	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:35707133A>G	ENST00000396081.1	-	4	1209	c.405T>C	c.(403-405)ggT>ggC	p.G135G	HERPUD2_ENST00000311350.3_Silent_p.G135G|HERPUD2_ENST00000426180.1_5'UTR	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	135	Ser-rich.				response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						CTGAGGAAGAACCCACAGCTA	0.398																																					p.G135G		Atlas-SNP	.											.	HERPUD2	47	.	0			c.T405C						PASS	.						143.0	130.0	134.0					7																	35707133		2203	4300	6503	SO:0001819	synonymous_variant	64224	exon5			GGAAGAACCCACA	BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.405T>C	chr7.hg19:g.35707133A>G		133.0	0.0	.		179.0	111.0	.	NM_022373	A4D1Y8|Q9H6F9	Silent	SNP	ENST00000396081.1	hg19	CCDS5446.1																																																																																			.	.	.	none		0.398	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1	NM_022373	
MLLT3	4300	hgsc.bcm.edu	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S154S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																p.S157S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,NS,carcinoma,0,4	MLLT3	125	.	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C471T						PASS	.						9.0	14.0	12.0					9																	20414373		1757	3647	5404	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTACTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	chr9.hg19:g.20414373G>A		95.0	1.0	.		67.0	3.0	.	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	hg19	CCDS6494.1																																																																																			.	.	.	none		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
RUSC2	9853	hgsc.bcm.edu	37	9	35560975	35560975	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:35560975G>A	ENST00000455600.1	+	11	4799	c.4230G>A	c.(4228-4230)ctG>ctA	p.L1410L	FAM166B_ENST00000492890.1_5'Flank	NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1410						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CGGACTGGCTGAGCCTGGACA	0.662																																					p.L1410L		Atlas-SNP	.											.	RUSC2	88	.	0			c.G4230A						PASS	.						33.0	39.0	37.0					9																	35560975		2203	4300	6503	SO:0001819	synonymous_variant	9853	exon11			CTGGCTGAGCCTG	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.4230G>A	chr9.hg19:g.35560975G>A		76.0	0.0	.		52.0	24.0	.	NM_014806	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Silent	SNP	ENST00000455600.1	hg19	CCDS35008.1																																																																																			.	.	.	none		0.662	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
GAPVD1	26130	hgsc.bcm.edu	37	9	128117063	128117063	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:128117063G>A	ENST00000495955.1	+	24	4044	c.3754G>A	c.(3754-3756)Gtc>Atc	p.V1252I	GAPVD1_ENST00000297933.6_Missense_Mutation_p.V1234I|GAPVD1_ENST00000394105.2_Missense_Mutation_p.V1261I|GAPVD1_ENST00000394083.2_Missense_Mutation_p.V1186I|GAPVD1_ENST00000312123.9_Missense_Mutation_p.V1213I|GAPVD1_ENST00000394104.2_Missense_Mutation_p.V1252I|GAPVD1_ENST00000265956.4_Missense_Mutation_p.V1226I|GAPVD1_ENST00000470056.1_Missense_Mutation_p.V1207I			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1252					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CTTTACCACTGTCTGTGTGAG	0.423																																					p.V1261I		Atlas-SNP	.											.	GAPVD1	124	.	0			c.G3781A						PASS	.						176.0	176.0	176.0					9																	128117063		2203	4300	6503	SO:0001583	missense	26130	exon23			ACCACTGTCTGTG		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.3754G>A	chr9.hg19:g.128117063G>A	ENSP00000419063:p.Val1252Ile	159.0	0.0	.		177.0	70.0	.	NM_015635	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	hg19		.	.	.	.	.	.	.	.	.	.	G	27.7	4.856083	0.91355	.	.	ENSG00000165219	ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000297933;ENST00000312123	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.63546	0.2520	L	0.47716	1.5	0.80722	D	1	P;P;P;P;P;P	0.39404	0.542;0.604;0.672;0.672;0.672;0.528	B;B;B;B;B;B	0.42282	0.213;0.205;0.382;0.382;0.382;0.382	T	0.62124	-0.6920	9	0.48119	T	0.1	.	19.6603	0.95864	0.0:0.0:1.0:0.0	.	1252;267;1207;1213;1234;1261	Q14C86;B3KTX2;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	GAPD1_HUMAN;.;.;.;.;.	I	1207;1261;1252;1226;1186;1252;1234;1213	.	ENSP00000265956:V1226I	V	+	1	0	GAPVD1	127156884	1.000000	0.71417	0.981000	0.43875	0.965000	0.64279	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	GTC	.	.	.	none		0.423	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
ARRDC1	92714	hgsc.bcm.edu	37	9	140508526	140508526	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:140508526C>A	ENST00000371421.4	+	5	542	c.478C>A	c.(478-480)Ctg>Atg	p.L160M	ARRDC1_ENST00000491911.1_3'UTR|C9orf37_ENST00000496793.1_5'Flank	NM_152285.2	NP_689498.1	Q8N5I2	ARRD1_HUMAN	arrestin domain containing 1	160						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000273)|Epithelial(140;0.000464)		CTCCTACAAGCTGGTGAAGAC	0.637																																					p.L160M		Atlas-SNP	.											.	ARRDC1	24	.	0			c.C478A						PASS	.						99.0	95.0	96.0					9																	140508526		2203	4300	6503	SO:0001583	missense	92714	exon5			TACAAGCTGGTGA	AJ420420	CCDS7049.1	9q34.3	2013-10-11			ENSG00000197070	ENSG00000197070			28633	protein-coding gene	gene with protein product	"""alpha-arrestin 1"""					23886940	Standard	XM_005266119		Approved	MGC40555	uc004cns.3	Q8N5I2	OTTHUMG00000020993	ENST00000371421.4:c.478C>A	chr9.hg19:g.140508526C>A	ENSP00000360475:p.Leu160Met	225.0	0.0	.		183.0	61.0	.	NM_152285		Missense_Mutation	SNP	ENST00000371421.4	hg19	CCDS7049.1	.	.	.	.	.	.	.	.	.	.	c	19.88	3.909911	0.72983	.	.	ENSG00000197070	ENST00000371421;ENST00000431925	T;T	0.53206	3.16;0.63	5.47	4.38	0.52667	Immunoglobulin E-set (1);	0.141252	0.49305	D	0.000154	T	0.67411	0.2890	M	0.76838	2.35	0.51767	D	0.999938	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66756	-0.5843	10	0.36615	T	0.2	-7.9494	14.2819	0.66219	0.0:0.9154:0.0:0.0846	.	49;177;160	Q59FD7;Q5T371;Q8N5I2	.;.;ARRD1_HUMAN	M	160;177	ENSP00000360475:L160M;ENSP00000406247:L177M	ENSP00000360475:L160M	L	+	1	2	ARRDC1	139628347	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.922000	0.40045	2.582000	0.87167	0.555000	0.69702	CTG	.	.	.	none		0.637	ARRDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055358.1	NM_152285	
FNBP4	23360	hgsc.bcm.edu	37	11	47745663	47745663	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:47745663G>T	ENST00000263773.5	-	14	2393	c.2381C>A	c.(2380-2382)aCa>aAa	p.T794K	Y_RNA_ENST00000363220.1_RNA	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	794			T -> A (in dbSNP:rs35040940).			nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						GCTAATTTCTGTAGCTTTCCT	0.428																																					p.T794K		Atlas-SNP	.											.	FNBP4	99	.	0			c.C2381A						PASS	.						132.0	133.0	133.0					11																	47745663		1886	4120	6006	SO:0001583	missense	23360	exon14			ATTTCTGTAGCTT	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2381C>A	chr11.hg19:g.47745663G>T	ENSP00000263773:p.Thr794Lys	89.0	0.0	.		79.0	30.0	.	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	hg19	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.707845	0.48412	.	.	ENSG00000109920	ENST00000263773	T	0.50277	0.75	5.28	5.28	0.74379	.	0.468912	0.23563	N	0.046835	T	0.42337	0.1198	L	0.53249	1.67	0.28016	N	0.934697	B	0.31125	0.309	B	0.25140	0.058	T	0.47749	-0.9093	10	0.56958	D	0.05	-4.17	12.4896	0.55893	0.0803:0.0:0.9197:0.0	.	794	Q8N3X1	FNBP4_HUMAN	K	794	ENSP00000263773:T794K	ENSP00000263773:T794K	T	-	2	0	FNBP4	47702239	0.027000	0.19231	1.000000	0.80357	0.870000	0.49936	2.261000	0.43276	2.483000	0.83821	0.561000	0.74099	ACA	.	.	.	none		0.428	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
FNBP4	23360	hgsc.bcm.edu	37	11	47745665	47745665	+	Silent	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:47745665A>G	ENST00000263773.5	-	14	2391	c.2379T>C	c.(2377-2379)gcT>gcC	p.A793A	Y_RNA_ENST00000363220.1_RNA	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	793						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						TAATTTCTGTAGCTTTCCTCT	0.428																																					p.A793A		Atlas-SNP	.											.	FNBP4	99	.	0			c.T2379C						PASS	.						131.0	132.0	132.0					11																	47745665		1883	4121	6004	SO:0001819	synonymous_variant	23360	exon14			TTCTGTAGCTTTC	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2379T>C	chr11.hg19:g.47745665A>G		90.0	0.0	.		75.0	29.0	.	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Silent	SNP	ENST00000263773.5	hg19	CCDS41644.1																																																																																			.	.	.	none		0.428	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
PTPRJ	5795	hgsc.bcm.edu	37	11	48142761	48142761	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:48142761A>G	ENST00000418331.2	+	4	911	c.559A>G	c.(559-561)Act>Gct	p.T187A	PTPRJ_ENST00000440289.2_Missense_Mutation_p.T187A	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	187	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						ATTCTCCATCACTCCAGGAAT	0.428																																					p.T187A		Atlas-SNP	.											.	PTPRJ	225	.	0			c.A559G						PASS	.						129.0	120.0	123.0					11																	48142761		2201	4298	6499	SO:0001583	missense	5795	exon4			TCCATCACTCCAG	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.559A>G	chr11.hg19:g.48142761A>G	ENSP00000400010:p.Thr187Ala	102.0	0.0	.		69.0	20.0	.	NM_001098503	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	hg19	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	A	12.23	1.875810	0.33162	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289;ENST00000534219	T;T;T	0.76448	0.49;0.49;-1.02	5.05	0.487	0.16842	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70649	0.3248	L	0.44542	1.39	0.09310	N	1	B;P	0.36086	0.131;0.536	B;B	0.43623	0.068;0.425	T	0.57033	-0.7880	9	0.15066	T	0.55	.	8.4715	0.32988	0.4929:0.0:0.0:0.507	.	187;187	Q12913;Q6P4H4	PTPRJ_HUMAN;.	A	187;187;187;108	ENSP00000400010:T187A;ENSP00000409733:T187A;ENSP00000432686:T108A	ENSP00000278456:T187A	T	+	1	0	PTPRJ	48099337	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.045000	0.14013	0.206000	0.20587	0.482000	0.46254	ACT	.	.	.	none		0.428	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
NCAM1	4684	hgsc.bcm.edu	37	11	113103986	113103986	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:113103986G>T	ENST00000533760.1	+	12	1855	c.1256G>T	c.(1255-1257)tGg>tTg	p.W419L	NCAM1_ENST00000316851.7_Missense_Mutation_p.W537L|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Missense_Mutation_p.W546L	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	547	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		AAAGCTGAGTGGAGAGCAGTT	0.532																																					p.W573L		Atlas-SNP	.											.	NCAM1	372	.	0			c.G1718T						PASS	.						78.0	81.0	80.0					11																	113103986		2079	4205	6284	SO:0001583	missense	4684	exon15			CTGAGTGGAGAGC		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1256G>T	chr11.hg19:g.113103986G>T	ENSP00000473281:p.Trp419Leu	45.0	0.0	.		42.0	16.0	.	NM_001242607	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	hg19		.	.	.	.	.	.	.	.	.	.	G	28.8	4.953276	0.92660	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.56103	0.48;0.48	6.06	6.06	0.98353	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.75459	0.3852	.	.	.	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.73808	-0.3866	9	0.49607	T	0.09	-34.0768	20.6208	0.99490	0.0:0.0:1.0:0.0	.	547;537;547;537	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	L	419;546;537	ENSP00000384055:W546L;ENSP00000318472:W537L	ENSP00000318472:W537L	W	+	2	0	NCAM1	112609196	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.476000	0.97823	2.882000	0.98803	0.655000	0.94253	TGG	.	.	.	none		0.532	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
LAG3	3902	hgsc.bcm.edu	37	12	6886460	6886460	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:6886460C>G	ENST00000203629.2	+	6	1421	c.1088C>G	c.(1087-1089)tCc>tGc	p.S363C		NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	363	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TCACCTGGATCCCTGGGGAAG	0.517																																					p.S363C		Atlas-SNP	.											.	LAG3	35	.	0			c.C1088G						PASS	.						112.0	111.0	111.0					12																	6886460		2203	4300	6503	SO:0001583	missense	3902	exon6			CTGGATCCCTGGG		CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.1088C>G	chr12.hg19:g.6886460C>G	ENSP00000203629:p.Ser363Cys	136.0	0.0	.		158.0	67.0	.	NM_002286	A8K7T9|Q7Z643	Missense_Mutation	SNP	ENST00000203629.2	hg19	CCDS8561.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658513	0.47467	.	.	ENSG00000089692	ENST00000203629	T	0.15603	2.41	4.55	1.61	0.23674	.	0.653989	0.15030	N	0.284515	T	0.18509	0.0444	L	0.27053	0.805	0.19300	N	0.999976	D	0.71674	0.998	P	0.57371	0.819	T	0.10800	-1.0614	10	0.36615	T	0.2	-8.8465	6.2866	0.21037	0.2301:0.4544:0.3155:0.0	.	363	P18627	LAG3_HUMAN	C	363	ENSP00000203629:S363C	ENSP00000203629:S363C	S	+	2	0	LAG3	6756721	0.507000	0.26146	0.578000	0.28575	0.907000	0.53573	0.505000	0.22642	0.136000	0.18733	0.561000	0.74099	TCC	.	.	.	none		0.517	LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402846.1		
PRB4	5545	hgsc.bcm.edu	37	12	11461501	11461501	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:11461501C>A	ENST00000535904.1	-	3	449	c.416G>T	c.(415-417)gGa>gTa	p.G139V	PRB4_ENST00000445719.2_Intron|PRB4_ENST00000279575.1_Missense_Mutation_p.G139V			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	160	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).			extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						TTCTGGCTTTCCTGGAGGAGG	0.602										HNSCC(22;0.051)																											p.G139V		Atlas-SNP	.											.	PRB4	59	.	0			c.G416T						PASS	.						176.0	197.0	190.0					12																	11461501		2202	4300	6502	SO:0001583	missense	5545	exon3			GGCTTTCCTGGAG		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.416G>T	chr12.hg19:g.11461501C>A	ENSP00000442834:p.Gly139Val	531.0	0.0	.		566.0	232.0	.	NM_002723	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	hg19	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	5.316	0.243693	0.10077	.	.	ENSG00000230657	ENST00000279575;ENST00000535904	T;T	0.08546	3.08;3.08	0.849	0.849	0.18972	.	.	.	.	.	T	0.22437	0.0541	M	0.78456	2.415	0.09310	N	0.999999	D	0.89917	1.0	D	0.66979	0.948	T	0.05178	-1.0901	9	0.87932	D	0	.	5.0427	0.14467	0.0:1.0:0.0:0.0	.	139	E9PAL0	.	V	139	ENSP00000279575:G139V;ENSP00000442834:G139V	ENSP00000279575:G139V	G	-	2	0	PRB4	11352768	0.002000	0.14202	0.003000	0.11579	0.004000	0.04260	0.087000	0.14958	0.744000	0.32741	0.502000	0.49764	GGA	.	.	.	none		0.602	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
TMTC2	160335	hgsc.bcm.edu	37	12	83290130	83290130	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:83290130G>A	ENST00000321196.3	+	3	1895	c.1188G>A	c.(1186-1188)ctG>ctA	p.L396L	TMTC2_ENST00000548305.1_Silent_p.L396L|TMTC2_ENST00000549919.1_Silent_p.L390L	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	396					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						TTGTTGTTCTGTCTTTATCTT	0.393																																					p.L396L		Atlas-SNP	.											.	TMTC2	100	.	0			c.G1188A						PASS	.						191.0	193.0	192.0					12																	83290130		2203	4300	6503	SO:0001819	synonymous_variant	160335	exon3			TGTTCTGTCTTTA	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1188G>A	chr12.hg19:g.83290130G>A		214.0	0.0	.		208.0	96.0	.	NM_152588	B2RCU7|Q8N2K8	Silent	SNP	ENST00000321196.3	hg19	CCDS9025.1																																																																																			.	.	.	none		0.393	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
BTG1	694	hgsc.bcm.edu	37	12	92537939	92537939	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:92537939T>C	ENST00000256015.3	-	2	794	c.433A>G	c.(433-435)Agc>Ggc	p.S145G	C12orf79_ENST00000549802.1_5'Flank|C12orf79_ENST00000546975.1_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000551843.1_5'Flank|C12orf79_ENST00000551563.2_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	145					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CTGATTCGGCTGTCTACCATT	0.473			T	MYC	BCLL						OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S145G		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1	30	.	0			c.A433G						PASS	.						109.0	92.0	98.0					12																	92537939		2203	4300	6503	SO:0001583	missense	694	exon2			TTCGGCTGTCTAC		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.433A>G	chr12.hg19:g.92537939T>C	ENSP00000256015:p.Ser145Gly	117.0	0.0	.	1291	116.0	56.0	.	NM_001731	P31607	Missense_Mutation	SNP	ENST00000256015.3	hg19	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	T	6.001	0.368520	0.11352	.	.	ENSG00000133639	ENST00000256015;ENST00000552315	T;T	0.34275	1.79;1.37	5.8	5.8	0.92144	.	0.037276	0.85682	D	0.000000	T	0.31734	0.0806	L	0.36672	1.1	0.80722	D	1	B	0.12630	0.006	B	0.15484	0.013	T	0.04203	-1.0969	10	0.33141	T	0.24	-7.3735	16.1508	0.81622	0.0:0.0:0.0:1.0	.	145	P62324	BTG1_HUMAN	G	145;70	ENSP00000256015:S145G;ENSP00000447551:S70G	ENSP00000256015:S145G	S	-	1	0	BTG1	91062070	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.649000	0.83500	2.207000	0.71202	0.528000	0.53228	AGC	.	.	.	none		0.473	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
TMCC3	57458	hgsc.bcm.edu	37	12	94976205	94976205	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:94976205T>A	ENST00000261226.4	-	2	319	c.188A>T	c.(187-189)aAg>aTg	p.K63M	TMCC3_ENST00000551457.1_Missense_Mutation_p.K32M	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	63						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						GAGTTTGACCTTGTGGAAGTC	0.483																																					p.K63M		Atlas-SNP	.											.	TMCC3	63	.	0			c.A188T						PASS	.						150.0	147.0	148.0					12																	94976205		2203	4300	6503	SO:0001583	missense	57458	exon2			TTGACCTTGTGGA	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.188A>T	chr12.hg19:g.94976205T>A	ENSP00000261226:p.Lys63Met	166.0	0.0	.		146.0	62.0	.	NM_020698	Q8IWB2	Missense_Mutation	SNP	ENST00000261226.4	hg19	CCDS31877.1	.	.	.	.	.	.	.	.	.	.	T	17.71	3.457648	0.63401	.	.	ENSG00000057704	ENST00000261226;ENST00000551457;ENST00000548918	T;T	0.51574	1.34;0.7	5.91	5.91	0.95273	.	0.099394	0.64402	D	0.000002	T	0.67211	0.2869	M	0.61703	1.905	0.46203	D	0.998924	D	0.89917	1.0	D	0.91635	0.999	T	0.69555	-0.5114	10	0.72032	D	0.01	-45.39	16.3889	0.83525	0.0:0.0:0.0:1.0	.	63	Q9ULS5	TMCC3_HUMAN	M	63;32;32	ENSP00000261226:K63M;ENSP00000449888:K32M	ENSP00000261226:K63M	K	-	2	0	TMCC3	93500336	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	0.917000	0.28665	2.276000	0.75962	0.397000	0.26171	AAG	.	.	.	none		0.483	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
ABCC4	10257	hgsc.bcm.edu	37	13	95886864	95886865	+	Splice_Site	DNP	CT	CT	AG			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr13:95886864_95886865CT>AG	ENST00000376887.4	-	4	644_645	c.530_531AG>CT	c.(529-531)aAG>aCT	p.K177T	ABCC4_ENST00000536256.1_Intron|ABCC4_ENST00000431522.1_Splice_Site_p.K177T|ABCC4_ENST00000538287.1_3'UTR|ABCC4_ENST00000412704.1_Splice_Site_p.K177T	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	177	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	TGTCACTTACCTTCCGATAAAT	0.391																																					p.K177N|p.K177T		Atlas-SNP	.											.	ABCC4	248	.	0			c.G531T|c.A530C						PASS	.																																			SO:0001630	splice_region_variant	10257	exon4			ACTTACCTTCCGA|CTTACCTTCCGAT	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.530_531delinsAG	chr13.hg19:g.95886864_95886865delinsAG		72.0|74.0	0.0	.		44.0|47.0	19.0|20.0	.	NM_005845	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	hg19	CCDS9474.1																																																																																			.	.	.	none		0.391	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	Missense_Mutation
DENND4A	10260	hgsc.bcm.edu	37	15	66031104	66031104	+	Silent	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr15:66031104A>G	ENST00000431932.2	-	6	949	c.741T>C	c.(739-741)aaT>aaC	p.N247N	DENND4A_ENST00000443035.3_Silent_p.N247N	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	247	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GGTATTTGCTATTTGATGGCC	0.363																																					p.N247N		Atlas-SNP	.											.	DENND4A	217	.	0			c.T741C						PASS	.						117.0	113.0	114.0					15																	66031104		1819	4084	5903	SO:0001819	synonymous_variant	10260	exon6			TTTGCTATTTGAT	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.741T>C	chr15.hg19:g.66031104A>G		88.0	0.0	.		122.0	49.0	.	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	hg19	CCDS45285.1																																																																																			.	.	.	none		0.363	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
C15orf59	388135	hgsc.bcm.edu	37	15	74032301	74032301	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr15:74032301A>T	ENST00000569673.1	-	3	2043	c.839T>A	c.(838-840)cTg>cAg	p.L280Q	C15orf59_ENST00000558834.1_5'UTR|C15orf59_ENST00000379822.4_Missense_Mutation_p.L280Q			Q2T9L4	CO059_HUMAN	chromosome 15 open reading frame 59	280										breast(1)|endometrium(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGTGTAGGGCAGAACCGTCTG	0.572																																					p.L280Q		Atlas-SNP	.											.	C15orf59	38	.	0			c.T839A						PASS	.						92.0	99.0	97.0					15																	74032301		2198	4297	6495	SO:0001583	missense	388135	exon2			TAGGGCAGAACCG		CCDS32289.1	15q24.1	2012-09-27			ENSG00000205363	ENSG00000205363			33753	protein-coding gene	gene with protein product							Standard	XM_005254369		Approved	MGC131524, LOC388135	uc002avy.3	Q2T9L4	OTTHUMG00000172556	ENST00000569673.1:c.839T>A	chr15.hg19:g.74032301A>T	ENSP00000457205:p.Leu280Gln	250.0	0.0	.		163.0	72.0	.	NM_001039614		Missense_Mutation	SNP	ENST00000569673.1	hg19	CCDS32289.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.207083	0.79127	.	.	ENSG00000205363	ENST00000379822	T	0.57907	0.37	5.1	5.1	0.69264	.	0.000000	0.64402	D	0.000003	T	0.67933	0.2946	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71434	-0.4594	10	0.87932	D	0	.	14.5288	0.67909	1.0:0.0:0.0:0.0	.	280	Q2T9L4	CO059_HUMAN	Q	280	ENSP00000369150:L280Q	ENSP00000369150:L280Q	L	-	2	0	C15orf59	71819354	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	8.572000	0.90756	1.906000	0.55180	0.459000	0.35465	CTG	.	.	.	none		0.572	C15orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419077.2	NM_001039614	
ACSM1	116285	hgsc.bcm.edu	37	16	20682868	20682868	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr16:20682868G>T	ENST00000307493.4	-	4	804	c.737C>A	c.(736-738)cCc>cAc	p.P246H	ACSM1_ENST00000219151.4_5'UTR|ACSM1_ENST00000520010.1_Missense_Mutation_p.P246H	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	246					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						TGGGAAGGAGGGTTGTAAGGC	0.527																																					p.P246H		Atlas-SNP	.											.	ACSM1	118	.	0			c.C737A						PASS	.						99.0	83.0	89.0					16																	20682868		2201	4300	6501	SO:0001583	missense	116285	exon4			AAGGAGGGTTGTA	AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.737C>A	chr16.hg19:g.20682868G>T	ENSP00000301956:p.Pro246His	61.0	0.0	.		111.0	36.0	.	NM_052956	Q08AH2|Q96A20	Missense_Mutation	SNP	ENST00000307493.4	hg19	CCDS10587.1	.	.	.	.	.	.	.	.	.	.	G	2.027	-0.423437	0.04734	.	.	ENSG00000166743	ENST00000307493;ENST00000520010	T;T	0.47177	0.85;0.85	4.95	1.81	0.25067	AMP-dependent synthetase/ligase (1);	1.028510	0.07746	N	0.947678	T	0.28300	0.0699	N	0.12471	0.22	0.09310	N	0.999995	B	0.06786	0.001	B	0.08055	0.003	T	0.22556	-1.0213	10	0.45353	T	0.12	.	5.2282	0.15406	0.0815:0.1431:0.6274:0.148	.	246	Q08AH1	ACSM1_HUMAN	H	246	ENSP00000301956:P246H;ENSP00000428047:P246H	ENSP00000301956:P246H	P	-	2	0	ACSM1	20590369	0.351000	0.24887	0.000000	0.03702	0.001000	0.01503	3.098000	0.50259	0.238000	0.21222	0.603000	0.83216	CCC	.	.	.	none		0.527	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956	
WDR81	124997	hgsc.bcm.edu	37	17	1633711	1633711	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:1633711G>A	ENST00000409644.1	+	2	3705	c.3705G>A	c.(3703-3705)aaG>aaA	p.K1235K	WDR81_ENST00000437219.2_Silent_p.K32K|WDR81_ENST00000419248.1_Silent_p.K8K|WDR81_ENST00000309182.5_Silent_p.K184K|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000545662.1_5'Flank|RP11-961A15.1_ENST00000576540.1_RNA	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1235					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TGTCTGCCAAGCTCGGCCCCA	0.642																																					p.K1235K		Atlas-SNP	.											.	WDR81	180	.	0			c.G3705A						PASS	.						33.0	31.0	32.0					17																	1633711		2203	4299	6502	SO:0001819	synonymous_variant	124997	exon2			TGCCAAGCTCGGC	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.3705G>A	chr17.hg19:g.1633711G>A		67.0	0.0	.		69.0	15.0	.	NM_001163809	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Silent	SNP	ENST00000409644.1	hg19	CCDS54062.1																																																																																			.	.	.	none		0.642	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
MYBBP1A	10514	hgsc.bcm.edu	37	17	4445915	4445915	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:4445915T>C	ENST00000254718.4	-	21	3320	c.3014A>G	c.(3013-3015)cAc>cGc	p.H1005R	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.H1005R			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	1005					cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						ACTCACCGGGTGCCGGGAGAA	0.627																																					p.H1005R		Atlas-SNP	.											.	MYBBP1A	69	.	0			c.A3014G						PASS	.						99.0	98.0	98.0					17																	4445915		2203	4300	6503	SO:0001583	missense	10514	exon21			ACCGGGTGCCGGG	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.3014A>G	chr17.hg19:g.4445915T>C	ENSP00000254718:p.His1005Arg	137.0	0.0	.		189.0	115.0	.	NM_014520	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	ENST00000254718.4	hg19	CCDS11046.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.527626	0.64860	.	.	ENSG00000132382	ENST00000381556;ENST00000254718	T;T	0.19532	2.14;2.14	5.53	4.44	0.53790	Armadillo-type fold (1);	0.481948	0.24846	N	0.035136	T	0.23965	0.0580	L	0.54323	1.7	0.25888	N	0.9835	P;P	0.47106	0.824;0.89	B;P	0.46796	0.327;0.527	T	0.07309	-1.0779	10	0.26408	T	0.33	-19.5303	8.7411	0.34558	0.1687:0.0:0.0:0.8313	.	1005;1005	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	R	1005	ENSP00000370968:H1005R;ENSP00000254718:H1005R	ENSP00000254718:H1005R	H	-	2	0	MYBBP1A	4392664	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	3.604000	0.54081	0.910000	0.36722	0.533000	0.62120	CAC	.	.	.	none		0.627	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
ALOX15B	247	hgsc.bcm.edu	37	17	7948982	7948982	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:7948982C>T	ENST00000380183.4	+	8	1317	c.1178C>T	c.(1177-1179)cCc>cTc	p.P393L	ALOX15B_ENST00000573359.1_Missense_Mutation_p.P393L|ALOX15B_ENST00000380173.2_Missense_Mutation_p.P393L|ALOX15B_ENST00000572022.1_Missense_Mutation_p.P393L	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	393	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						CGTCAGCTGCCCCACTGCCAC	0.612																																					p.P393L		Atlas-SNP	.											.	ALOX15B	66	.	0			c.C1178T						PASS	.						66.0	51.0	56.0					17																	7948982		2203	4300	6503	SO:0001583	missense	247	exon8			AGCTGCCCCACTG	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1178C>T	chr17.hg19:g.7948982C>T	ENSP00000369530:p.Pro393Leu	45.0	0.0	.		78.0	38.0	.	NM_001141	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	hg19	CCDS11128.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929812	0.92389	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	D;D	0.91521	-2.86;-2.86	4.53	4.53	0.55603	Lipoxygenase, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.96062	0.8717	M	0.89658	3.05	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97047	0.9761	10	0.87932	D	0	-23.6176	16.3899	0.83531	0.0:1.0:0.0:0.0	.	393;393;393;393	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	L	393	ENSP00000369520:P393L;ENSP00000369530:P393L	ENSP00000344337:P393L	P	+	2	0	ALOX15B	7889707	1.000000	0.71417	0.989000	0.46669	0.971000	0.66376	7.516000	0.81772	2.225000	0.72522	0.563000	0.77884	CCC	.	.	.	none		0.612	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2		
MYH2	4620	hgsc.bcm.edu	37	17	10433386	10433386	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:10433386G>A	ENST00000245503.5	-	23	3087	c.2703C>T	c.(2701-2703)gcC>gcT	p.A901A	MYH2_ENST00000397183.2_Silent_p.A901A|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	901					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CCAAGCCTTCGGCTTCCTTAA	0.398																																					p.A901A		Atlas-SNP	.											.	MYH2	390	.	0			c.C2703T						PASS	.						124.0	121.0	122.0					17																	10433386		2203	4300	6503	SO:0001819	synonymous_variant	4620	exon23			GCCTTCGGCTTCC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.2703C>T	chr17.hg19:g.10433386G>A		152.0	0.0	.		254.0	82.0	.	NM_017534	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	ENST00000245503.5	hg19	CCDS11156.1																																																																																			.	.	.	none		0.398	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
EPB41L3	23136	hgsc.bcm.edu	37	18	5406855	5406855	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr18:5406855T>C	ENST00000341928.2	-	16	2610	c.2270A>G	c.(2269-2271)aAg>aGg	p.K757R	EPB41L3_ENST00000427684.2_Missense_Mutation_p.K29R|EPB41L3_ENST00000400111.3_Missense_Mutation_p.K576R|EPB41L3_ENST00000544123.1_Missense_Mutation_p.K588R|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000542146.1_Missense_Mutation_p.K29R|EPB41L3_ENST00000540638.2_Missense_Mutation_p.K576R|EPB41L3_ENST00000342933.3_Missense_Mutation_p.K757R	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	757	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GGAAAGCCTCTTCTCCCATTC	0.512																																					p.K757R		Atlas-SNP	.											.	EPB41L3	222	.	0			c.A2270G						PASS	.						179.0	143.0	155.0					18																	5406855		2203	4300	6503	SO:0001583	missense	23136	exon16			AGCCTCTTCTCCC	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2270A>G	chr18.hg19:g.5406855T>C	ENSP00000343158:p.Lys757Arg	162.0	0.0	.		116.0	49.0	.	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	hg19	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.245271	0.80024	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	D;D;D;D;D;D	0.89875	-2.12;-2.58;-1.59;-1.5;-2.12;-2.37	5.78	5.78	0.91487	SAB (1);	0.043558	0.85682	D	0.000000	D	0.93360	0.7883	M	0.62266	1.93	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	0.99;0.999;0.999;0.977;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.979;0.996;0.996;0.98;0.995;0.97;0.999;0.998	D	0.93204	0.6594	10	0.48119	T	0.1	.	16.1138	0.81283	0.0:0.0:0.0:1.0	.	588;29;29;149;467;576;757;29	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	R	757;467;588;467;29;29;757;576	ENSP00000343158:K757R;ENSP00000441174:K588R;ENSP00000392195:K29R;ENSP00000442233:K29R;ENSP00000341138:K757R;ENSP00000382981:K576R	ENSP00000343158:K757R	K	-	2	0	EPB41L3	5396855	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	7.698000	0.84413	2.220000	0.72140	0.533000	0.62120	AAG	.	.	.	none		0.512	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
DSC2	1824	hgsc.bcm.edu	37	18	28660278	28660278	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr18:28660278A>C	ENST00000280904.6	-	10	1747	c.1304T>G	c.(1303-1305)aTt>aGt	p.I435S	DSC2_ENST00000251081.6_Missense_Mutation_p.I435S	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	435	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			AACTACACCAATTTGCAAGAT	0.378																																					p.I435S		Atlas-SNP	.											.	DSC2	168	.	0			c.T1304G						PASS	.						159.0	138.0	145.0					18																	28660278		2203	4300	6503	SO:0001583	missense	1824	exon10			ACACCAATTTGCA	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1304T>G	chr18.hg19:g.28660278A>C	ENSP00000280904:p.Ile435Ser	68.0	0.0	.		70.0	30.0	.	NM_024422		Missense_Mutation	SNP	ENST00000280904.6	hg19	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	A	16.03	3.006051	0.54361	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.48836	0.8;0.8	5.92	5.92	0.95590	Cadherin (5);Cadherin-like (1);	0.000000	0.32884	N	0.005536	T	0.78997	0.4372	H	0.97491	4.015	0.54753	D	0.999989	D;D	0.69078	0.997;0.996	D;D	0.65443	0.934;0.935	D	0.86616	0.1876	10	0.87932	D	0	.	15.3456	0.74334	1.0:0.0:0.0:0.0	.	435;435	Q02487;Q02487-2	DSC2_HUMAN;.	S	435;435;201;448	ENSP00000251081:I435S;ENSP00000280904:I435S	ENSP00000251081:I435S	I	-	2	0	DSC2	26914276	1.000000	0.71417	0.226000	0.23910	0.115000	0.19883	7.733000	0.84916	2.266000	0.75297	0.533000	0.62120	ATT	.	.	.	none		0.378	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
ICAM5	7087	hgsc.bcm.edu	37	19	10403449	10403449	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr19:10403449A>G	ENST00000221980.4	+	5	1186	c.1123A>G	c.(1123-1125)Aac>Gac	p.N375D		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	375	Ig-like C2-type 4.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			TGCCACCGAGAACGACGACAG	0.622																																					p.N375D		Atlas-SNP	.											.	ICAM5	53	.	0			c.A1123G						PASS	.						52.0	54.0	53.0					19																	10403449		2203	4300	6503	SO:0001583	missense	7087	exon5			ACCGAGAACGACG	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.1123A>G	chr19.hg19:g.10403449A>G	ENSP00000221980:p.Asn375Asp	99.0	0.0	.		56.0	8.0	.	NM_003259	Q9Y6F3	Missense_Mutation	SNP	ENST00000221980.4	hg19	CCDS12233.1	.	.	.	.	.	.	.	.	.	.	A	7.911	0.736583	0.15574	.	.	ENSG00000105376	ENST00000221980	T	0.05382	3.45	5.46	-10.9	0.00192	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.463300	0.03856	N	0.273164	T	0.02230	0.0069	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34354	-0.9832	10	0.16420	T	0.52	-0.0897	4.6077	0.12385	0.1132:0.1885:0.5112:0.1871	.	375	Q9UMF0	ICAM5_HUMAN	D	375	ENSP00000221980:N375D	ENSP00000221980:N375D	N	+	1	0	ICAM5	10264449	0.000000	0.05858	0.000000	0.03702	0.137000	0.21094	-1.105000	0.03323	-3.113000	0.00241	-0.441000	0.05720	AAC	.	.	.	none		0.622	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259	
ROMO1	140823	hgsc.bcm.edu	37	20	34288799	34288799	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr20:34288799A>G	ENST00000374078.1	+	3	391	c.211A>G	c.(211-213)Atg>Gtg	p.M71V	NFS1_ENST00000540053.1_5'Flank|ROMO1_ENST00000397416.1_Missense_Mutation_p.M71V|NFS1_ENST00000306750.3_5'Flank|ROMO1_ENST00000374072.1_3'UTR|NFS1_ENST00000541387.1_5'Flank|NFS1_ENST00000374092.4_5'Flank|ROMO1_ENST00000336695.4_Missense_Mutation_p.M71V|NFS1_ENST00000374085.1_5'Flank|NFS1_ENST00000397425.1_5'Flank|ROMO1_ENST00000374077.3_Missense_Mutation_p.M71V	NM_080748.2	NP_542786.1	P60602	ROMO1_HUMAN	reactive oxygen species modulator 1	71					cellular response to reactive oxygen species (GO:0034614)|defense response to bacterium (GO:0042742)|positive regulation of cell proliferation (GO:0008284)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|replicative cell aging (GO:0001302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				cervix(1)	1						TGGCACATTCATGGCCATTGG	0.517																																					p.M71V		Atlas-SNP	.											.	ROMO1	5	.	0			c.A211G						PASS	.						124.0	86.0	99.0					20																	34288799		2203	4300	6503	SO:0001583	missense	140823	exon3			ACATTCATGGCCA	AK000548	CCDS13264.1	20q11.22	2008-09-30	2008-09-30	2008-09-30	ENSG00000125995	ENSG00000125995			16185	protein-coding gene	gene with protein product	"""mitochondrial targeting GXXXG protein"""		"""chromosome 20 open reading frame 52"""	C20orf52		18313394, 17537404, 16842742	Standard	NM_080748		Approved	bA353C18.2, MTGMP	uc002xdy.3	P60602	OTTHUMG00000032360	ENST00000374078.1:c.211A>G	chr20.hg19:g.34288799A>G	ENSP00000363191:p.Met71Val	105.0	0.0	.		127.0	49.0	.	NM_080748	A7M872|E1P5R9|E9KL28|Q3MHD5|Q5QP16|Q9CQ98|Q9H1N2	Missense_Mutation	SNP	ENST00000374078.1	hg19	CCDS13264.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.442280	0.63067	.	.	ENSG00000125995	ENST00000374078;ENST00000374077;ENST00000397416;ENST00000336695	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	4.68	4.68	0.58851	.	0.039506	0.85682	D	0.000000	T	0.48059	0.1479	.	.	.	0.80722	D	1	B	0.25351	0.124	B	0.25506	0.061	T	0.52124	-0.8617	9	0.87932	D	0	.	14.3539	0.66722	1.0:0.0:0.0:0.0	.	71	P60602	ROMO1_HUMAN	V	71	ENSP00000363191:M71V;ENSP00000363190:M71V;ENSP00000380561:M71V;ENSP00000338293:M71V	ENSP00000338293:M71V	M	+	1	0	ROMO1	33752213	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.080000	0.94040	1.982000	0.57802	0.529000	0.55759	ATG	.	.	.	none		0.517	ROMO1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000126404.1	NM_080748	
SON	6651	hgsc.bcm.edu	37	21	34948684	34948684	+	Missense_Mutation	SNP	G	G	A	rs397829693|rs34377180		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr21:34948684G>A	ENST00000356577.4	+	12	7710	c.7235G>A	c.(7234-7236)gGa>gAa	p.G2412E	DONSON_ENST00000303113.6_Intron|SON_ENST00000290239.6_3'UTR|AP000304.1_ENST00000595468.1_5'Flank|SON_ENST00000381692.2_Missense_Mutation_p.G440E|SON_ENST00000470533.1_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	2412	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TTGAGAAATGGAGCCCTTACC	0.338																																					p.G2412E		Atlas-SNP	.											.,1	SON	343	.	0			c.G7235A						PASS	.						55.0	55.0	55.0					21																	34948684		2201	4295	6496	SO:0001583	missense	6651	exon12			GAAATGGAGCCCT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.7235G>A	chr21.hg19:g.34948684G>A	ENSP00000348984:p.Gly2412Glu	32.0	2.0	.		58.0	10.0	.	NM_138927	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	hg19	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.434360	0.43224	.	.	ENSG00000159140	ENST00000356577;ENST00000381692	T;T	0.69306	-0.39;-0.39	5.42	5.42	0.78866	Double-stranded RNA-binding-like (1);	0.000000	0.51477	D	0.000097	T	0.71134	0.3304	M	0.69823	2.125	0.80722	D	1	D;P	0.59767	0.986;0.799	P;B	0.50970	0.655;0.435	T	0.75127	-0.3427	10	0.87932	D	0	.	9.3335	0.38036	0.0788:0.1457:0.7755:0.0	.	440;2412	Q6ZRV7;P18583	.;SON_HUMAN	E	2412;440	ENSP00000348984:G2412E;ENSP00000371111:G440E	ENSP00000348984:G2412E	G	+	2	0	SON	33870554	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.898000	0.48672	2.560000	0.86352	0.555000	0.69702	GGA	.	.	.	none		0.338	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24381817	24381817	+	IGR	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chrX:24381817G>T								AC004552.1 (14794 upstream) : PDK3 (101520 downstream)																							ACTTGCTAAAGGGTATCAGTC	0.537																																					p.G314W		Atlas-SNP	.											.	.	.	.	0			c.G940T						PASS	.						141.0	117.0	125.0					X																	24381817		1568	3578	5146	SO:0001628	intergenic_variant	100130302	exon1			GCTAAAGGGTATC																													chrX.hg19:g.24381817G>T		185.0	0.0	.		181.0	119.0	.	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.537								
PUS3	83480	hgsc.bcm.edu	37	11	125765906	125765922	+	Frame_Shift_Del	DEL	TCTCTTCAATGGTATTA	TCTCTTCAATGGTATTA	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	TCTCTTCAATGGTATTA	TCTCTTCAATGGTATTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:125765906_125765922delTCTCTTCAATGGTATTA	ENST00000530811.1	-	1	303_319	c.258_274delTAATACCATTGAAGAGA	c.(256-276)aataataccattgaagagaaafs	p.NNTIEE86fs	PUS3_ENST00000227474.3_Frame_Shift_Del_p.NNTIEE86fs|HYLS1_ENST00000526028.1_Intron|HYLS1_ENST00000356438.3_Intron|HYLS1_ENST00000425380.2_Intron			Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	86					tRNA pseudouridine synthesis (GO:0031119)	nucleus (GO:0005634)	pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		TCAAACAGTTTCTCTTCAATGGTATTATTTGTGTTTT	0.447																																					p.87_92del		Atlas-INDEL	.											.	PUS3	33	.	0			c.259_275del						PASS	.																																			SO:0001589	frameshift_variant	83480	exon2			.	BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05							25461	protein-coding gene	gene with protein product						12477932	Standard	NM_031307		Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.258_274delTAATACCATTGAAGAGA	chr11.hg19:g.125765906_125765922delTCTCTTCAATGGTATTA	ENSP00000432386:p.Asn86fs	236.0	0.0	0		194.0	60.0	0.309278	NM_031307	B2RAM0|Q96D17|Q96J23|Q96NB4	Frame_Shift_Del	DEL	ENST00000530811.1	hg19	CCDS8466.1																																																																																			.	.	.	none		0.447	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386783.1	NM_031307	
AMY1C	278	hgsc.bcm.edu	37	1	104299657	104299658	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:104299657_104299658insT	ENST00000370079.3	+	9	1296_1297	c.1232_1233insT	c.(1231-1236)aatttcfs	p.NF411fs		NM_001008219.1	NP_001008220.1	P04745	AMY1_HUMAN	amylase, alpha 1C (salivary)	411					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			lung(5)|skin(3)	8		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		AACATGGTTAATTTCCGCAATG	0.356																																					p.N411fs		Atlas-INDEL	.											.	AMY1C	11	.	0			c.1232_1233insT						PASS	.																																			SO:0001589	frameshift_variant	278	exon10			.		CCDS30784.1	1p21	2012-10-02	2007-05-03		ENSG00000187733	ENSG00000187733	3.2.1.1		476	protein-coding gene	gene with protein product		104702	"""amylase, alpha 1C; salivary"""	AMY1			Standard	XM_005270761		Approved			P04745	OTTHUMG00000011045	ENST00000370079.3:c.1235dupT	chr1.hg19:g.104299660_104299660dupT	ENSP00000359096:p.Asn411fs	332.0	0.0	0		398.0	43.0	0.10804	NM_001008219	A6NJS5|A8K8H6|Q13763|Q5T083	Frame_Shift_Ins	INS	ENST00000370079.3	hg19	CCDS30784.1																																																																																			.	.	.	none		0.356	AMY1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030375.1	NM_001008219	
RAD18	56852	hgsc.bcm.edu	37	3	8955405	8955406	+	Splice_Site	INS	-	-	TG			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr3:8955405_8955406insTG	ENST00000264926.2	-	8	1006		c.e8-1			NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase						DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		ATTTCAGCAGCTGTTAAAATAA	0.317								Rad6 pathway																													.		Atlas-INDEL	.											.	RAD18	52	.	0			c.890-1->CA						PASS	.																																			SO:0001630	splice_region_variant	56852	exon9			.		CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.890-1->CA	chr3.hg19:g.8955406_8955407dupTG		21.0	0.0	0		23.0	13.0	0.565217	NM_020165	Q58F55|Q9NRT6	Splice_Site	INS	ENST00000264926.2	hg19	CCDS2571.1																																																																																			.	.	.	none		0.317	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207071.2	NM_020165	Intron
ZZEF1	23140	hgsc.bcm.edu	37	17	3924472	3924472	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:3924472delT	ENST00000381638.2	-	45	7479	c.7355delA	c.(7354-7356)aagfs	p.K2452fs		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2452							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GGGGTCCAGCTTTTTCTGCTC	0.582																																					p.K2452fs		Atlas-INDEL	.											.	ZZEF1	195	.	0			c.7356delG						PASS	.						113.0	109.0	110.0					17																	3924472		2203	4300	6503	SO:0001589	frameshift_variant	23140	exon45			.	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.7355delA	chr17.hg19:g.3924472delT	ENSP00000371051:p.Lys2452fs	235.0	0.0	0		375.0	106.0	0.282667	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Frame_Shift_Del	DEL	ENST00000381638.2	hg19	CCDS11043.1																																																																																			.	.	.	none		0.582	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
C2orf71	388939	hgsc.bcm.edu	37	2	29297095	29297096	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr2:29297095_29297096insA	ENST00000331664.5	-	1	31_32	c.32_33insT	c.(31-33)gtafs	p.V11fs		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	11					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						CAACGCTGTTTACAAGGTCACT	0.45																																					p.V11fs		Atlas-INDEL	.											.	C2orf71	146	.	0			c.33_34insT						PASS	.																																			SO:0001589	frameshift_variant	388939	exon1			.		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.33dupT	chr2.hg19:g.29297096_29297096dupA	ENSP00000332809:p.Val11fs	119.0	0.0	0		93.0	48.0	0.516129	NM_001029883		Frame_Shift_Ins	INS	ENST00000331664.5	hg19	CCDS42669.1																																																																																			.	.	.	none		0.450	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
TRIM37	4591	hgsc.bcm.edu	37	17	57078973	57078974	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:57078973_57078974delTG	ENST00000262294.7	-	23	3056_3057	c.2797_2798delCA	c.(2797-2799)cagfs	p.Q933fs	TRIM37_ENST00000393065.2_Frame_Shift_Del_p.Q899fs|TRIM37_ENST00000376149.3_Intron|TRIM37_ENST00000393066.3_Frame_Shift_Del_p.Q933fs	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	933					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					ATCCGGGGGCTGTGTCATGACC	0.485									Mulibrey Nanism																												p.933_933del		Atlas-INDEL	.											.	TRIM37	105	.	0			c.2798_2799del						PASS	.																																			SO:0001589	frameshift_variant	4591	exon23	Familial Cancer Database	Perheentupa syndrome	.	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.2797_2798delCA	chr17.hg19:g.57078975_57078976delTG	ENSP00000262294:p.Gln933fs	121.0	0.0	0		188.0	20.0	0.106383	NM_015294	Q7Z3E6|Q8IYF7|Q8WYF7	Frame_Shift_Del	DEL	ENST00000262294.7	hg19	CCDS32694.1																																																																																			.	.	.	none		0.485	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	NM_015294	
AMY1B	277	hgsc.bcm.edu	37	1	104231690	104231691	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:104231690_104231691insA	ENST00000330330.5	-	10	1529_1530	c.1235_1236insT	c.(1234-1236)ttcfs	p.F412fs	AMY1B_ENST00000370080.3_Frame_Shift_Ins_p.F412fs	NM_001008218.1	NP_001008219.1	P04745	AMY1_HUMAN	amylase, alpha 1B (salivary)	412					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)	2		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		CTACATTGCGGAAATTAACCAT	0.356																																					p.F412fs		Atlas-INDEL	.											.	AMY1C	11	.	0			c.1236_1237insT						PASS	.																																			SO:0001589	frameshift_variant	278	exon10			.		CCDS30783.1	1p21	2012-10-02	2007-05-03		ENSG00000174876	ENSG00000174876	3.2.1.1		475	protein-coding gene	gene with protein product		104701	"""amylase, alpha 1B; salivary"""	AMY1			Standard	XM_005270758		Approved			P04745	OTTHUMG00000011021	ENST00000330330.5:c.1236dupT	chr1.hg19:g.104231693_104231693dupA	ENSP00000330484:p.Phe412fs	315.0	0.0	0		357.0	54.0	0.151261	NM_001008219	A6NJS5|A8K8H6|Q13763|Q5T083	Frame_Shift_Ins	INS	ENST00000330330.5	hg19	CCDS30783.1																																																																																			.	.	.	none		0.356	AMY1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030309.1	NM_001008218	
SENP8	123228	hgsc.bcm.edu	37	15	72432229	72432229	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr15:72432229delG	ENST00000542035.2	+	2	598	c.265delG	c.(265-267)gccfs	p.A89fs	SENP8_ENST00000544171.1_Frame_Shift_Del_p.A89fs|RP11-2I17.4_ENST00000568984.1_RNA|SENP8_ENST00000340912.4_Frame_Shift_Del_p.A89fs|SENP8_ENST00000544411.1_Frame_Shift_Del_p.A89fs	NM_001166340.1	NP_001159812.1	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	89	Protease.						cysteine-type peptidase activity (GO:0008234)			breast(1)|kidney(2)|lung(1)|ovary(1)|skin(1)	6						TGTATTTTTAGCCATCAATGA	0.448																																					p.L88fs		Atlas-INDEL	.											.	SENP8	18	.	0			c.264delA						PASS	.						100.0	99.0	99.0					15																	72432229		2199	4297	6496	SO:0001589	frameshift_variant	123228	exon2			.	BC031411	CCDS10240.1	15q22.33	2005-08-17	2005-08-17	2004-01-30	ENSG00000166192	ENSG00000166192			22992	protein-coding gene	gene with protein product	"""NEDD8-specific protease 1"", ""sentrin/SUMO-specific protease SENP8"", ""deneddylase 1"""	608659	"""protease, cysteine, 2 (NEDD8 specific)"", ""SUMO/sentrin specific protease family member 8"""	PRSC2		12730221, 12759362	Standard	NM_145204		Approved	NEDP1, DEN1, HsT17512	uc021spt.1	Q96LD8	OTTHUMG00000133441	ENST00000542035.2:c.265delG	chr15.hg19:g.72432229delG	ENSP00000446057:p.Ala89fs	122.0	0.0	0		114.0	53.0	0.464912	NM_001166340	Q96QA4	Frame_Shift_Del	DEL	ENST00000542035.2	hg19	CCDS10240.1																																																																																			.	.	.	none		0.448	SENP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420036.1	NM_145204	
AP1G1	164	hgsc.bcm.edu	37	16	71768532	71768533	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr16:71768532_71768533insA	ENST00000299980.4	-	22	2787_2788	c.2346_2347insT	c.(2344-2349)attaaafs	p.K783fs	AP1G1_ENST00000564155.1_Frame_Shift_Ins_p.K208fs|AP1G1_ENST00000393512.3_Frame_Shift_Ins_p.K786fs|AP1G1_ENST00000569748.1_Frame_Shift_Ins_p.K783fs|AP1G1_ENST00000423132.2_Frame_Shift_Ins_p.K786fs|AP1G1_ENST00000433195.2_Frame_Shift_Ins_p.K806fs	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	783	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TTCAGAACTTTAATGACTTGTG	0.45																																					p.K786_V787delinsX		Atlas-INDEL	.											.	AP1G1	83	.	0			c.2356_2357insT						PASS	.																																			SO:0001589	frameshift_variant	164	exon23			.	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.2347dupT	chr16.hg19:g.71768534_71768534dupA	ENSP00000299980:p.Lys783fs	376.0	0.0	0		657.0	369.0	0.561644	NM_001030007	O75709|O75842|Q9UG09|Q9Y3U4	Frame_Shift_Ins	INS	ENST00000299980.4	hg19	CCDS32480.1																																																																																			.	.	.	none		0.450	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
EPHB4	2050	hgsc.bcm.edu	37	7	100404084	100404104	+	In_Frame_Del	DEL	CATCACCTCCCACATCACAAT	CATCACCTCCCACATCACAAT	-	rs199910843		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	CATCACCTCCCACATCACAAT	CATCACCTCCCACATCACAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:100404084_100404104delCATCACCTCCCACATCACAAT	ENST00000358173.3	-	14	2890_2910	c.2422_2442delATTGTGATGTGGGAGGTGATG	c.(2422-2442)attgtgatgtgggaggtgatgdel	p.IVMWEVM808del	EPHB4_ENST00000360620.3_In_Frame_Del_p.IVMWEVM808del	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	808	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCCCAAATGACATCACCTCCCACATCACAATCCCGTAACTC	0.552																																					p.808_815del	GBM(200;2113 3072 25865 52728)	Atlas-INDEL	.											.	EPHB4	106	.	0			c.2423_2443del						PASS	.																																			SO:0001651	inframe_deletion	2050	exon14			.	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2422_2442delATTGTGATGTGGGAGGTGATG	chr7.hg19:g.100404084_100404104delCATCACCTCCCACATCACAAT	ENSP00000350896:p.Ile808_Met814del	142.0	0.0	0		161.0	14.0	0.0869565	NM_004444	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	In_Frame_Del	DEL	ENST00000358173.3	hg19	CCDS5706.1																																																																																			.	.	.	none		0.552	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
AMY1A	276	hgsc.bcm.edu	37	1	104205519	104205520	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:104205519_104205520insT	ENST00000370083.4	+	10	1452_1453	c.1232_1233insT	c.(1231-1236)aatttcfs	p.NF411fs	AMY1A_ENST00000494409.1_3'UTR	NM_001008221.1|NM_004038.3	NP_001008222.1|NP_004029.2	P04745	AMY1_HUMAN	amylase, alpha 1A (salivary)	411					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)						all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		AACATGGTTAATTTCCGCAATG	0.356																																					p.N411fs	Pancreas(131;743 2392 43382 44986)	Atlas-INDEL	.											.	AMY1C	11	.	0			c.1232_1233insT						PASS	.																																			SO:0001589	frameshift_variant	278	exon10			.		CCDS30782.1	1p21	2012-10-02	2007-05-03		ENSG00000237763	ENSG00000237763	3.2.1.1		474	protein-coding gene	gene with protein product		104700	"""amylase, alpha 1A; salivary"""	AMY1			Standard	XM_005270755		Approved		uc001duv.3	P04745	OTTHUMG00000011020	ENST00000370083.4:c.1235dupT	chr1.hg19:g.104205522_104205522dupT	ENSP00000359100:p.Asn411fs	287.0	0.0	0		381.0	55.0	0.144357	NM_001008219	A6NJS5|A8K8H6|Q13763|Q5T083	Frame_Shift_Ins	INS	ENST00000370083.4	hg19	CCDS30782.1																																																																																			.	.	.	none		0.356	AMY1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030304.2	NM_001008221	
TRIM14	9830	hgsc.bcm.edu	37	9	100862406	100862406	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:100862406delA	ENST00000341469.2	-	3	353	c.344delT	c.(343-345)ttcfs	p.F115fs	TRIM14_ENST00000342043.3_Frame_Shift_Del_p.F115fs|TRIM14_ENST00000375098.3_Frame_Shift_Del_p.F115fs	NM_014788.2	NP_055603.2	Q14142	TRI14_HUMAN	tripartite motif containing 14	115					innate immune response (GO:0045087)|negative regulation of viral transcription (GO:0032897)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|intracellular (GO:0005622)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(62;0.0559)				GAGTTCAGTGAATTTCCCCTT	0.433																																					p.F115fs	Colon(14;460 597 13826 51781)	Atlas-INDEL	.											.	TRIM14	24	.	0			c.345delC						PASS	.						113.0	105.0	108.0					9																	100862406		2203	4300	6503	SO:0001589	frameshift_variant	9830	exon3			.	AF220130	CCDS6734.1	9q31.1	2011-04-20	2011-01-25		ENSG00000106785	ENSG00000106785		"""Tripartite motif containing / Tripartite motif containing"""	16283	protein-coding gene	gene with protein product		606556	"""tripartite motif-containing 14"""			11331580	Standard	XM_005252320		Approved	KIAA0129	uc004ayd.2	Q14142	OTTHUMG00000020339	ENST00000341469.2:c.344delT	chr9.hg19:g.100862406delA	ENSP00000344208:p.Phe115fs	106.0	0.0	0		111.0	52.0	0.468468	NM_014788	A8K9W0|E7EQC4|F8W956|Q548W9|Q5TBQ8|Q6ZWL7|Q9BRD8|Q9C020	Frame_Shift_Del	DEL	ENST00000341469.2	hg19	CCDS6734.1																																																																																			.	.	.	none		0.433	TRIM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053350.1	NM_014788	
HLA-B	3106	hgsc.bcm.edu	37	6	31323288	31323288	+	Frame_Shift_Del	DEL	G	G	-	rs74428022		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:31323288delG	ENST00000412585.2	-	4	729	c.701delC	c.(700-702)cctfs	p.P234fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	234	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GATCTCCGCAGGGTAGAAACC	0.587									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.P234fs		Atlas-INDEL	.											.	HLA-B	54	.	0			c.702delT						PASS	.						83.0	82.0	82.0					6																	31323288		2203	4298	6501	SO:0001589	frameshift_variant	3106	exon4	Familial Cancer Database	;Lichen Sclerosis, Familial	.	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.701delC	chr6.hg19:g.31323288delG	ENSP00000399168:p.Pro234fs	225.0	0.0	0		162.0	72.0	0.444444	NM_005514	Q29764	Frame_Shift_Del	DEL	ENST00000412585.2	hg19	CCDS34394.1																																																																																			.	.	.	none		0.587	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
