#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KCNC4	3749	hgsc.bcm.edu	37	1	110774916	110774916	+	Silent	SNP	G	G	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:110774916G>A	ENST00000369787.3	+	4	1920	c.1893G>A	c.(1891-1893)ctG>ctA	p.L631L	KCNC4_ENST00000438661.2_Intron|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000413138.3_Intron	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	631					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGGGACTCTGTTCCTGCCAC	0.562																																					p.L631L		Atlas-SNP	.											.	KCNC4	113	.	0			c.G1893A						PASS	.						74.0	54.0	61.0					1																	110774916		2203	4300	6503	SO:0001819	synonymous_variant	3749	exon4			GACTCTGTTCCTG	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1893G>A	chr1.hg19:g.110774916G>A		25.0	0.0	.		32.0	10.0	.	NM_004978	Q3MIM4|Q5TBI6	Silent	SNP	ENST00000369787.3	hg19	CCDS821.1																																																																																			.	.	.	none		0.562	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
NBPF14	25832	hgsc.bcm.edu	37	1	148015634	148015634	+	Missense_Mutation	SNP	T	T	C	rs200156420	byFrequency	TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:148015634T>C	ENST00000369219.1	-	8	1013	c.997A>G	c.(997-999)Aac>Gac	p.N333D				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	333	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.			N -> D (in Ref. 3; AAO15399). {ECO:0000305}.		cytoplasm (GO:0005737)		p.N333D(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					CCATCCATGTTAACAGCCAAG	0.463													-|||	445	0.0888578	0.146	0.0778	5008	,	,		13640	0.0675		0.0408	False		,,,				2504	0.091				p.N333D		Atlas-SNP	.											NBPF14_ENST00000310701,bladder,carcinoma,-1,2	NBPF14	107	.	1	Substitution - Missense(1)	skin(1)	c.A997G						PASS	.						4.0	3.0	4.0					1																	148015634		718	1612	2330	SO:0001583	missense	25832	exon8			CCATGTTAACAGC	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.997A>G	chr1.hg19:g.148015634T>C	ENSP00000358221:p.Asn333Asp	46.0	1.0	.		58.0	3.0	.	NM_015383	Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	ENST00000369219.1	hg19		.	.	.	.	.	.	.	.	.	.	-	0	-2.747081	0.00086	.	.	ENSG00000122497	ENST00000369219	T	0.04234	3.67	.	.	.	DUF1220 (2);	.	.	.	.	T	0.00210	0.0006	N	0.00028	-2.63	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43686	-0.9376	7	0.02654	T	1	.	.	.	.	.	333	Q5TI25	NBPFE_HUMAN	D	333	ENSP00000358221:N333D	ENSP00000358221:N333D	N	-	1	0	NBPF14	146482258	0.402000	0.25311	0.002000	0.10522	0.000000	0.00434	-1.348000	0.02629	0.357000	0.24183	0.000000	0.15137	AAC	.	.	.	weak		0.463	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
LINGO4	339398	hgsc.bcm.edu	37	1	151774638	151774638	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:151774638C>G	ENST00000368820.3	-	2	1480	c.543G>C	c.(541-543)aaG>aaC	p.K181N		NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	181						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GGGTGCTCAACTTGGCTAGCC	0.612																																					p.K181N		Atlas-SNP	.											.	LINGO4	51	.	0			c.G543C						PASS	.						37.0	43.0	41.0					1																	151774638		2203	4299	6502	SO:0001583	missense	339398	exon2			GCTCAACTTGGCT		CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.543G>C	chr1.hg19:g.151774638C>G	ENSP00000357810:p.Lys181Asn	115.0	0.0	.		101.0	6.0	.	NM_001004432		Missense_Mutation	SNP	ENST00000368820.3	hg19	CCDS30855.1	.	.	.	.	.	.	.	.	.	.	C	3.774	-0.047078	0.07407	.	.	ENSG00000213171	ENST00000368820	T	0.54071	0.59	5.13	2.23	0.28157	.	0.401034	0.21238	N	0.077871	T	0.09024	0.0223	N	0.05351	-0.065	0.20926	N	0.999823	B	0.06786	0.001	B	0.06405	0.002	T	0.39375	-0.9617	10	0.07482	T	0.82	.	8.7903	0.34845	0.0:0.748:0.0:0.252	.	181	Q6UY18	LIGO4_HUMAN	N	181	ENSP00000357810:K181N	ENSP00000357810:K181N	K	-	3	2	LINGO4	150041262	0.037000	0.19845	0.017000	0.16124	0.866000	0.49608	-0.213000	0.09305	0.328000	0.23435	0.462000	0.41574	AAG	.	.	.	none		0.612	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036639.1	XM_291387	
OBSCN	84033	hgsc.bcm.edu	37	1	228487735	228487735	+	Intron	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr1:228487735C>G	ENST00000422127.1	+	43	11703				OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000602685.1_3'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.Q4543E|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000359599.6_3'UTR|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000366707.4_Missense_Mutation_p.Q1233E	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGCCTGAAGCAGGATGGGAC	0.567																																					p.Q4543E		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C13627G						PASS	.						130.0	108.0	115.0					1																	228487735		876	1991	2867	SO:0001627	intron_variant	84033	exon51			CTGAAGCAGGATG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+4991C>G	chr1.hg19:g.228487735C>G		120.0	0.0	.		97.0	4.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444568	0.63178	.	.	ENSG00000154358	ENST00000366707	T	0.65916	-0.18	4.37	4.37	0.52481	.	.	.	.	.	T	0.49270	0.1547	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43988	-0.9357	6	0.02654	T	1	.	17.1074	0.86667	0.0:1.0:0.0:0.0	.	.	.	.	E	1233	ENSP00000355668:Q1233E	ENSP00000355668:Q1233E	Q	+	1	0	OBSCN	226554358	1.000000	0.71417	0.999000	0.59377	0.618000	0.37518	4.053000	0.57427	2.229000	0.72834	0.561000	0.74099	CAG	.	.	.	none		0.567	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
SLC16A14	151473	hgsc.bcm.edu	37	2	230910735	230910735	+	Silent	SNP	G	G	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr2:230910735G>A	ENST00000295190.4	-	4	1565	c.1107C>T	c.(1105-1107)atC>atT	p.I369I		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	369						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.I369I(1)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		TGACGCCCAGGATCACTTTTC	0.433																																					p.I369I		Atlas-SNP	.											SLC16A14,NS,carcinoma,0,1	SLC16A14	75	.	1	Substitution - coding silent(1)	ovary(1)	c.C1107T						PASS	.						98.0	87.0	91.0					2																	230910735		2203	4300	6503	SO:0001819	synonymous_variant	151473	exon4			GCCCAGGATCACT	BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.1107C>T	chr2.hg19:g.230910735G>A		101.0	1.0	.		105.0	23.0	.	NM_152527	A8KA08|Q53R92|Q96NI7	Silent	SNP	ENST00000295190.4	hg19	CCDS2473.1																																																																																			.	.	.	none		0.433	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376113	113376113	+	Silent	SNP	C	C	T	rs62265537|rs59601191|rs112313093|rs59990801|rs397990842|rs10606566		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr3:113376113C>T	ENST00000478658.1	-	5	4433	c.4416G>A	c.(4414-4416)caG>caA	p.Q1472Q	KIAA2018_ENST00000316407.4_Silent_p.Q1472Q|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1472	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gttgctgttgctgctgctgct	0.502																																					p.Q1472Q		Atlas-SNP	.											KIAA2018,rectum,carcinoma,0,1	KIAA2018	180	.	0			c.G4416A						PASS	.						68.0	71.0	70.0					3																	113376113		2188	4274	6462	SO:0001819	synonymous_variant	205717	exon7			CTGTTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4416G>A	chr3.hg19:g.113376113C>T		34.0	0.0	.		43.0	4.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.	.	weak		0.502	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
LMLN	89782	hgsc.bcm.edu	37	3	197687183	197687183	+	Missense_Mutation	SNP	T	T	A	rs375365578		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr3:197687183T>A	ENST00000330198.4	+	1	113	c.91T>A	c.(91-93)Tgg>Agg	p.W31R	IQCG_ENST00000480302.1_5'Flank|IQCG_ENST00000265239.6_5'Flank|LMLN_ENST00000482695.1_Missense_Mutation_p.L19Q|LMLN_ENST00000332636.5_Missense_Mutation_p.L19Q|LMLN_ENST00000420910.2_Missense_Mutation_p.W31R	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	31					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		CCGGTGGCGCTGGAGCGGGTC	0.687																																					p.W31R		Atlas-SNP	.											.	LMLN	53	.	0			c.T91A						PASS	.	T	ARG/TRP,ARG/TRP	1,4405	2.1+/-5.4	0,1,2202	30.0	36.0	34.0		91,91	-0.9	0.0	3		34	0,8596		0,0,4298	no	missense,missense	LMLN	NM_033029.3,NM_001136049.2	101,101	0,1,6500	AA,AT,TT		0.0,0.0227,0.0077	benign,benign	31/656,31/693	197687183	1,13001	2203	4298	6501	SO:0001583	missense	89782	exon1			TGGCGCTGGAGCG	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.91T>A	chr3.hg19:g.197687183T>A	ENSP00000328829:p.Trp31Arg	136.0	0.0	.		97.0	19.0	.	NM_001136049	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	ENST00000330198.4	hg19	CCDS3332.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.21|12.21	1.869215|1.869215	0.32977|0.32977	2.27E-4|2.27E-4	0.0|0.0	ENSG00000185621|ENSG00000185621	ENST00000482695;ENST00000332636|ENST00000330198;ENST00000420910	T;T|T;T	0.47528|0.41400	0.85;0.84|1.01;1.0	4.02|4.02	-0.95|-0.95	0.10372|0.10372	.|.	.|0.745603	.|0.11975	.|N	.|0.511342	T|T	0.22322|0.22322	0.0538|0.0538	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B|B;B	0.24963|0.02656	0.115;0.115|0.0;0.0	B;B|B;B	0.28709|0.04013	0.093;0.093|0.0;0.001	T|T	0.24512|0.24512	-1.0158|-1.0158	9|10	0.13853|0.18276	T|T	0.58|0.48	-0.5349|-0.5349	7.0655|7.0655	0.25149|0.25149	0.0:0.4606:0.0:0.5394|0.0:0.4606:0.0:0.5394	.|.	19;19|31;31	F8WCE5;Q96KR4-2|Q96KR4;F8WB28	.;.|LMLN_HUMAN;.	Q|R	19|31	ENSP00000418324:L19Q;ENSP00000328611:L19Q|ENSP00000328829:W31R;ENSP00000410926:W31R	ENSP00000328611:L19Q|ENSP00000328829:W31R	L|W	+|+	2|1	0|0	LMLN|LMLN	199171580|199171580	0.031000|0.031000	0.19500|0.19500	0.003000|0.003000	0.11579|0.11579	0.735000|0.735000	0.41995|0.41995	0.079000|0.079000	0.14782|0.14782	-0.032000|-0.032000	0.13758|0.13758	0.374000|0.374000	0.22700|0.22700	CTG|TGG	.	.	.	weak		0.687	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029	
TBC1D9B	23061	hgsc.bcm.edu	37	5	179320253	179320253	+	Silent	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr5:179320253C>G	ENST00000356834.3	-	5	829	c.792G>C	c.(790-792)ctG>ctC	p.L264L	TBC1D9B_ENST00000355235.3_Silent_p.L264L	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	264						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGGCCTAGGCAGGGCCTTGT	0.637																																					p.L264L		Atlas-SNP	.											TBC1D9B_ENST00000356834,right_upper_lobe,carcinoma,0,2	TBC1D9B	157	.	0			c.G792C						PASS	.						48.0	48.0	48.0					5																	179320253		2203	4300	6503	SO:0001819	synonymous_variant	23061	exon5			CCTAGGCAGGGCC	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.792G>C	chr5.hg19:g.179320253C>G		55.0	0.0	.		43.0	2.0	.	NM_198868	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Silent	SNP	ENST00000356834.3	hg19	CCDS43408.1																																																																																			.	.	.	none		0.637	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
KCNK5	8645	hgsc.bcm.edu	37	6	39161945	39161945	+	Splice_Site	SNP	C	C	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr6:39161945C>T	ENST00000359534.3	-	4	972	c.634G>A	c.(634-636)Ggt>Agt	p.G212S		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	212					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						AGGGACTCACCGGCCACAAAG	0.542																																					p.G212S		Atlas-SNP	.											.	KCNK5	57	.	0			c.G634A						PASS	.						92.0	79.0	84.0					6																	39161945		2203	4300	6503	SO:0001630	splice_region_variant	8645	exon4			ACTCACCGGCCAC	AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.634+1G>A	chr6.hg19:g.39161945C>T		65.0	0.0	.		78.0	20.0	.	NM_003740	B2RAQ6|B5TJL2|Q5VV76	Missense_Mutation	SNP	ENST00000359534.3	hg19	CCDS4841.1	.	.	.	.	.	.	.	.	.	.	C	34	5.402436	0.96030	.	.	ENSG00000164626	ENST00000359534	T	0.30448	1.53	5.68	5.68	0.88126	Ion transport 2 (1);	0.101608	0.64402	D	0.000002	T	0.39911	0.1096	L	0.52759	1.655	0.80722	D	1	P	0.46512	0.879	P	0.58820	0.846	T	0.01909	-1.1249	9	.	.	.	.	19.7891	0.96450	0.0:1.0:0.0:0.0	.	212	O95279	KCNK5_HUMAN	S	212	ENSP00000352527:G212S	.	G	-	1	0	KCNK5	39269923	1.000000	0.71417	0.981000	0.43875	0.542000	0.35054	7.747000	0.85070	2.692000	0.91855	0.561000	0.74099	GGT	.	.	.	none		0.542	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040449.1	NM_003740	Missense_Mutation
TDRD6	221400	hgsc.bcm.edu	37	6	46658247	46658247	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr6:46658247C>G	ENST00000316081.6	+	1	2382	c.2382C>G	c.(2380-2382)aaC>aaG	p.N794K	RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.N794K	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	794					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TGACCAGGAACATACAAGGAC	0.428																																					p.N794K		Atlas-SNP	.											.	TDRD6	205	.	0			c.C2382G						PASS	.						81.0	83.0	82.0					6																	46658247		2203	4300	6503	SO:0001583	missense	221400	exon1			CAGGAACATACAA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2382C>G	chr6.hg19:g.46658247C>G	ENSP00000346065:p.Asn794Lys	74.0	0.0	.		79.0	10.0	.	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	hg19	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444596	0.25987	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.12879	2.64;2.64	5.75	3.93	0.45458	Maternal tudor protein (1);	0.375482	0.34178	N	0.004185	T	0.07143	0.0181	L	0.41356	1.27	0.19575	N	0.999962	P;P	0.40834	0.548;0.73	B;P	0.51415	0.439;0.669	T	0.31024	-0.9958	10	0.24483	T	0.36	-13.6225	7.3207	0.26526	0.1058:0.6679:0.1027:0.1236	.	794;794	F5H5M3;O60522	.;TDRD6_HUMAN	K	794	ENSP00000443299:N794K;ENSP00000346065:N794K	ENSP00000346065:N794K	N	+	3	2	TDRD6	46766206	0.072000	0.21174	0.342000	0.25602	0.870000	0.49936	0.453000	0.21811	0.342000	0.23796	-0.797000	0.03246	AAC	.	.	.	none		0.428	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
PREX2	80243	hgsc.bcm.edu	37	8	68995502	68995502	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr8:68995502A>T	ENST00000288368.4	+	18	2183	c.1906A>T	c.(1906-1908)Att>Ttt	p.I636F	RP11-403D15.2_ENST00000526901.1_RNA|PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	636	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CGGGAAAAAGATTTTTGCTAT	0.318																																					p.I636F		Atlas-SNP	.											.	PREX2	614	.	0			c.A1906T						PASS	.						93.0	94.0	93.0					8																	68995502		2203	4300	6503	SO:0001583	missense	80243	exon18			AAAAAGATTTTTG	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1906A>T	chr8.hg19:g.68995502A>T	ENSP00000288368:p.Ile636Phe	58.0	0.0	.		78.0	6.0	.	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.358895	0.82353	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.37235	1.21	5.77	5.77	0.91146	PDZ/DHR/GLGF (3);	0.144361	0.50627	D	0.000115	T	0.50718	0.1632	L	0.52573	1.65	0.54753	D	0.999989	P;P;P	0.52692	0.906;0.955;0.906	P;P;P	0.57101	0.578;0.781;0.813	T	0.51553	-0.8691	10	0.87932	D	0	.	16.3948	0.83586	1.0:0.0:0.0:0.0	.	636;636;636	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	F	636	ENSP00000288368:I636F	ENSP00000288368:I636F	I	+	1	0	PREX2	69158056	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.744000	0.55112	2.326000	0.78906	0.533000	0.62120	ATT	.	.	.	none		0.318	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
KDM4C	23081	hgsc.bcm.edu	37	9	7015904	7015904	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr9:7015904G>A	ENST00000381309.3	+	15	2799	c.2234G>A	c.(2233-2235)cGg>cAg	p.R745Q	KDM4C_ENST00000442236.2_Missense_Mutation_p.R490Q|KDM4C_ENST00000428870.2_Missense_Mutation_p.R432Q|KDM4C_ENST00000381306.3_Missense_Mutation_p.R745Q|KDM4C_ENST00000535193.1_Missense_Mutation_p.R767Q|KDM4C_ENST00000543771.1_Missense_Mutation_p.R745Q|KDM4C_ENST00000536108.1_Missense_Mutation_p.R564Q	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	745					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						CTGTGTGCCCGGTGCAAAAGA	0.403																																					p.R767Q		Atlas-SNP	.											.	KDM4C	186	.	0			c.G2300A						PASS	.						210.0	199.0	203.0					9																	7015904		2203	4300	6503	SO:0001583	missense	23081	exon15			GTGCCCGGTGCAA	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.2234G>A	chr9.hg19:g.7015904G>A	ENSP00000370710:p.Arg745Gln	62.0	0.0	.		83.0	4.0	.	NM_001146696	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	hg19	CCDS6471.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945619	0.73672	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000536108;ENST00000428870;ENST00000420847	T;T;T;T;T;T;T;D	0.98914	-0.04;-0.04;2.21;-0.04;-0.04;1.79;-0.04;-5.23	5.37	4.45	0.53987	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);	0.122378	0.56097	D	0.000021	D	0.98785	0.9591	M	0.70595	2.14	0.58432	D	0.999998	D;D;D;P;D	0.89917	1.0;1.0;0.975;0.95;0.991	D;D;B;P;B	0.70227	0.968;0.966;0.424;0.496;0.446	D	0.98698	1.0699	10	0.72032	D	0.01	.	13.8091	0.63252	0.0743:0.0:0.9257:0.0	.	490;745;767;745;745	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	Q	767;745;745;745;490;564;432;89	ENSP00000442382:R767Q;ENSP00000445427:R745Q;ENSP00000370710:R745Q;ENSP00000370707:R745Q;ENSP00000409353:R490Q;ENSP00000440656:R564Q;ENSP00000405739:R432Q;ENSP00000400127:R89Q	ENSP00000370707:R745Q	R	+	2	0	KDM4C	7005904	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.606000	0.74159	2.654000	0.90174	0.591000	0.81541	CGG	.	.	.	none		0.403	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
MUC5B	727897	hgsc.bcm.edu	37	11	1258389	1258389	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr11:1258389T>G	ENST00000529681.1	+	25	3350	c.3292T>G	c.(3292-3294)Tcc>Gcc	p.S1098A	MUC5B_ENST00000447027.1_Missense_Mutation_p.S1101A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1098	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGCCTGCCGCTCCCAGGTGGG	0.682																																					p.S1098A		Atlas-SNP	.											MUC5B,NS,carcinoma,0,2	MUC5B	473	.	0			c.T3292G						PASS	.						10.0	15.0	13.0					11																	1258389		1897	4084	5981	SO:0001583	missense	727897	exon25			TGCCGCTCCCAGG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3292T>G	chr11.hg19:g.1258389T>G	ENSP00000436812:p.Ser1098Ala	43.0	0.0	.		24.0	2.0	.	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	hg19	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	T	5.715	0.316511	0.10845	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76839	-1.05;-1.05	4.38	-4.2	0.03823	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.59473	0.2196	N	0.10645	0.015	0.27479	N	0.952642	B;P;P	0.48089	0.026;0.905;0.905	B;P;P	0.47376	0.027;0.545;0.545	T	0.57613	-0.7781	9	0.87932	D	0	.	6.1245	0.20172	0.0:0.2029:0.3546:0.4425	.	1098;1791;1101	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	A	1098;1101;1099;1168	ENSP00000436812:S1098A;ENSP00000415793:S1101A	ENSP00000343037:S1099A	S	+	1	0	MUC5B	1214965	0.000000	0.05858	0.074000	0.20217	0.008000	0.06430	-0.169000	0.09911	-0.576000	0.05974	-0.648000	0.03929	TCC	.	.	.	none		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MRVI1	10335	hgsc.bcm.edu	37	11	10626061	10626061	+	Missense_Mutation	SNP	C	C	G	rs374023004		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr11:10626061C>G	ENST00000436272.1	-	12	1631	c.1553G>C	c.(1552-1554)aGa>aCa	p.R518T	MRVI1_ENST00000531107.1_Missense_Mutation_p.R537T|MRVI1_ENST00000534266.2_Missense_Mutation_p.R230T|MRVI1_ENST00000558540.1_Missense_Mutation_p.R230T|MRVI1_ENST00000423302.2_Missense_Mutation_p.R545T|MRVI1_ENST00000424001.1_Missense_Mutation_p.R230T|MRVI1_ENST00000527509.2_Missense_Mutation_p.R454T|MRVI1_ENST00000541483.1_Missense_Mutation_p.R339T|MRVI1_ENST00000545852.1_Missense_Mutation_p.R230T|MRVI1_ENST00000421747.1_Missense_Mutation_p.R536T|MRVI1_ENST00000552103.1_Missense_Mutation_p.R454T|MRVI1_ENST00000547195.1_Missense_Mutation_p.R454T|LYVE1_ENST00000531706.1_Intron			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	518	Interaction with ITPR1. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		GCTGTCATTTCTAAAGGCCAA	0.488																																					p.R545T		Atlas-SNP	.											MRVI1_ENST00000547195,NS,carcinoma,0,2	MRVI1	113	.	0			c.G1634C						PASS	.						173.0	166.0	168.0					11																	10626061		1964	4161	6125	SO:0001583	missense	10335	exon13			TCATTTCTAAAGG	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1553G>C	chr11.hg19:g.10626061C>G	ENSP00000412229:p.Arg518Thr	130.0	0.0	.		82.0	18.0	.	NM_130385	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	hg19		.	.	.	.	.	.	.	.	.	.	C	27.5	4.839467	0.91117	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.40956	0.1138	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.89917	0.996;1.0;1.0;1.0	D;D;D;D	0.87578	0.99;0.998;0.998;0.997	T	0.13980	-1.0489	10	0.56958	D	0.05	-13.6185	19.0062	0.92852	0.0:1.0:0.0:0.0	.	339;518;537;536	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	T	536;519;518;454;454;230;230;545;339;537;454	ENSP00000414598:R536T;ENSP00000412229:R518T;ENSP00000448278:R454T;ENSP00000446764:R454T;ENSP00000441971:R230T;ENSP00000401205:R230T;ENSP00000412130:R545T;ENSP00000437784:R339T;ENSP00000432436:R537T;ENSP00000432067:R454T	ENSP00000307885:R519T	R	-	2	0	MRVI1	10582637	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.538000	0.67193	2.553000	0.86117	0.563000	0.77884	AGA	.	.	.	alt		0.488	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
ANAPC7	51434	hgsc.bcm.edu	37	12	110813921	110813921	+	Silent	SNP	T	T	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr12:110813921T>C	ENST00000455511.3	-	10	1560	c.1560A>G	c.(1558-1560)gtA>gtG	p.V520V	ANAPC7_ENST00000450008.2_Silent_p.V520V|ANAPC7_ENST00000481473.1_5'UTR	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	520					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						CATTGACAGCTACAAGGAAAT	0.498																																					p.V520V		Atlas-SNP	.											.	ANAPC7	68	.	0			c.A1560G						PASS	.						141.0	119.0	126.0					12																	110813921		2203	4300	6503	SO:0001819	synonymous_variant	51434	exon10			GACAGCTACAAGG	AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1560A>G	chr12.hg19:g.110813921T>C		76.0	0.0	.		75.0	14.0	.	NM_016238	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Silent	SNP	ENST00000455511.3	hg19	CCDS9145.2	.	.	.	.	.	.	.	.	.	.	T	10.12	1.263642	0.23136	.	.	ENSG00000196510	ENST00000552087	.	.	.	5.55	2.43	0.29744	.	.	.	.	.	T	0.58337	0.2115	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50415	-0.8831	4	.	.	.	-22.9206	9.4319	0.38615	0.0:0.3125:0.0:0.6875	.	.	.	.	G	70	.	.	S	-	1	0	ANAPC7	109298304	0.916000	0.31088	1.000000	0.80357	0.998000	0.95712	-0.028000	0.12350	0.179000	0.19938	0.459000	0.35465	AGC	.	.	.	none		0.498	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347075.3	NM_016238	
ITGB3	3690	hgsc.bcm.edu	37	17	45361999	45361999	+	Missense_Mutation	SNP	C	C	A	rs202100960		TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr17:45361999C>A	ENST00000559488.1	+	4	568	c.552C>A	c.(550-552)gaC>gaA	p.D184E	ITGB3_ENST00000571680.1_Missense_Mutation_p.D184E|ITGB3_ENST00000560629.1_Missense_Mutation_p.Q173K|ITGB3_ENST00000435993.2_Missense_Mutation_p.D137E	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	184	VWFA.				activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	CATTTGTGGACAAGCCTGTGT	0.552																																					p.D184E		Atlas-SNP	.											.	ITGB3	157	.	0			c.C552A						PASS	.						128.0	134.0	132.0					17																	45361999		2203	4300	6503	SO:0001583	missense	3690	exon4			TGTGGACAAGCCT		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.552C>A	chr17.hg19:g.45361999C>A	ENSP00000452786:p.Asp184Glu	247.0	0.0	.		281.0	15.0	.	NM_000212	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	ENST00000559488.1	hg19	CCDS11511.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.385128	0.42308	.	.	ENSG00000178852	ENST00000262017;ENST00000435993	D	0.98400	-4.91	5.86	4.87	0.63330	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.98043	0.9355	M	0.66560	2.04	0.80722	D	1	D;D	0.64830	0.994;0.962	D;D	0.76575	0.988;0.954	D	0.97929	1.0319	10	0.02654	T	1	.	11.3787	0.49743	0.0:0.9067:0.0:0.0933	.	184;184	P05106;Q2YFE1	ITB3_HUMAN;.	E	184;137	ENSP00000407801:D137E	ENSP00000262017:D184E	D	+	3	2	C17orf57	42716998	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.226000	0.32563	1.399000	0.46721	0.655000	0.94253	GAC	.	.	.	weak		0.552	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
ZNF99	7652	hgsc.bcm.edu	37	19	22941316	22941316	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr19:22941316A>C	ENST00000596209.1	-	4	1485	c.1395T>G	c.(1393-1395)ttT>ttG	p.F465L	ZNF99_ENST00000397104.3_Missense_Mutation_p.F374L	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TAAGGGCTGAAAAATTGCTAA	0.358																																					p.F465L		Atlas-SNP	.											ZNF99,NS,carcinoma,0,1	ZNF99	273	.	0			c.T1395G						PASS	.																																			SO:0001583	missense	7652	exon4			GGCTGAAAAATTG	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1395T>G	chr19.hg19:g.22941316A>C	ENSP00000472969:p.Phe465Leu	45.0	0.0	.		50.0	2.0	.	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	0.008	-1.908376	0.00508	.	.	ENSG00000213973	ENST00000397104	T	0.07021	3.23	1.28	-2.55	0.06288	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02649	0.0080	N	0.03115	-0.41	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42749	-0.9433	9	0.11182	T	0.66	.	4.7313	0.12966	0.5088:0.3226:0.1686:0.0	.	374	A8MXY4	ZNF99_HUMAN	L	374	ENSP00000380293:F374L	ENSP00000380293:F374L	F	-	3	2	ZNF99	22733156	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.098000	0.01347	-1.992000	0.00975	-0.630000	0.03990	TTT	.	.	.	none		0.358	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
FATE1	89885	hgsc.bcm.edu	37	X	150891105	150891105	+	Nonsense_Mutation	SNP	T	T	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chrX:150891105T>G	ENST00000370350.3	+	5	511	c.426T>G	c.(424-426)taT>taG	p.Y142*		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	142						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					TGCAGCTGTATGCAGTCAACC	0.612																																					p.Y142X		Atlas-SNP	.											.	FATE1	30	.	0			c.T426G						PASS	.						57.0	64.0	62.0					X																	150891105		2203	4298	6501	SO:0001587	stop_gained	89885	exon5			GCTGTATGCAGTC	AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.426T>G	chrX.hg19:g.150891105T>G	ENSP00000359375:p.Tyr142*	84.0	0.0	.		98.0	4.0	.	NM_033085		Nonsense_Mutation	SNP	ENST00000370350.3	hg19	CCDS14700.1	.	.	.	.	.	.	.	.	.	.	T	10.36	1.329167	0.24167	.	.	ENSG00000147378	ENST00000370350	.	.	.	4.55	-9.11	0.00711	.	2.770910	0.01081	N	0.004990	.	.	.	.	.	.	0.54753	D	0.99998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	11.7727	2.708	0.05166	0.2388:0.3595:0.2921:0.1096	.	.	.	.	X	142	.	ENSP00000359375:Y142X	Y	+	3	2	FATE1	150641761	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.221000	0.00140	-4.843000	0.00030	-1.019000	0.02448	TAT	.	.	.	none		0.612	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060885.1	NM_033085	
MT-ND4	4538	hgsc.bcm.edu	37	M	11447	11447	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chrM:11447G>C	ENST00000361381.2	+	1	688	c.688G>C	c.(688-690)Gta>Cta	p.V230L	MT-ND5_ENST00000361567.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	230				V -> L (in Ref. 2). {ECO:0000305}.	cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						CTGGGTCAATAGTACTTGCCG	0.463																																					p.V230L		Atlas-SNP	.											.	.	.	.	0			c.G688C						PASS	.																																			SO:0001583	missense	0	exon1			TCAATAGTACTTG			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.688G>C	chrM.hg19:g.11447G>C	ENSP00000354961:p.Val230Leu	1.0	0.0	.		19.0	4.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.463	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
MT-ND5	4540	hgsc.bcm.edu	37	M	12403	12403	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chrM:12403C>T	ENST00000361567.2	+	1	67	c.67C>T	c.(67-69)Ctc>Ttc	p.L23F	MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	23					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCCTTACCACCCTCGTTAACC	0.403																																					p.L23F		Atlas-SNP	.											.	.	.	.	0			c.C67T						PASS	.																																			SO:0001583	missense	0	exon1			ACCACCCTCGTTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.67C>T	chrM.hg19:g.12403C>T	ENSP00000354813:p.Leu23Phe	0.0	0.0	.		19.0	19.0	.	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-CYB	4519	hgsc.bcm.edu	37	M	15247	15247	+	Silent	SNP	C	C	G			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chrM:15247C>G	ENST00000361789.2	+	1	501	c.501C>G	c.(499-501)ggC>ggG	p.G167G	MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	167					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ATCTGAGGAGGCTACTCAGTA	0.468											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.G167G		Atlas-SNP	.											.	.	.	.	0			c.C501G						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			AGGAGGCTACTCA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.501C>G	chrM.hg19:g.15247C>G		0.0	0.0	.	585	18.0	18.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Silent	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.468	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
USP19	10869	hgsc.bcm.edu	37	3	49148785	49148785	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8518-01A-11D-2396-08	TCGA-A4-8518-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f18659a-ddbf-48b6-a0b7-a17bfa7e924c	b2d31124-b2e7-4487-864e-be8baf0a8289	g.chr3:49148785delC	ENST00000398888.2	-	21	3240	c.2922delG	c.(2920-2922)gggfs	p.G974fs	USP19_ENST00000398898.2_Frame_Shift_Del_p.G1014fs|USP19_ENST00000434032.2_Frame_Shift_Del_p.G1075fs|USP19_ENST00000453664.1_Frame_Shift_Del_p.G1065fs|USP19_ENST00000398896.1_Frame_Shift_Del_p.G782fs|USP19_ENST00000398892.3_Frame_Shift_Del_p.G1014fs|USP19_ENST00000417901.1_Frame_Shift_Del_p.G1077fs	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	974	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GATGCTGGTACCCAGGCACAG	0.532																																					p.Y1078fs		Atlas-INDEL	.											.	USP19	158	.	0			c.3232delT						PASS	.						101.0	106.0	105.0					3																	49148785		2047	4201	6248	SO:0001589	frameshift_variant	10869	exon22			.	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.2922delG	chr3.hg19:g.49148785delC	ENSP00000381863:p.Gly974fs	96.0	0.0	0		105.0	20.0	0.190476	NM_001199161	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Frame_Shift_Del	DEL	ENST00000398888.2	hg19	CCDS43090.1																																																																																			.	.	.	none		0.532	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
