#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SSU72	29101	hgsc.bcm.edu	37	1	1480325	1480325	+	Silent	SNP	C	C	T	rs138912153		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:1480325C>T	ENST00000291386.3	-	3	593	c.282G>A	c.(280-282)cgG>cgA	p.R94R		NM_014188.2	NP_054907.1	Q9NP77	SSU72_HUMAN	SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)	94					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|mRNA polyadenylation (GO:0006378)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)			large_intestine(2)|lung(5)	7	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		ATCTTTCTGGCCGGGGCTTGA	0.478																																					p.R94R		Atlas-SNP	.											.	SSU72	15	.	0			c.G282A						PASS	.						183.0	192.0	189.0					1																	1480325		2203	4300	6503	SO:0001819	synonymous_variant	29101	exon3			TTCTGGCCGGGGC	AJ276409	CCDS32.1	1p36	2010-03-24	2006-04-04		ENSG00000160075	ENSG00000160075			25016	protein-coding gene	gene with protein product			"""Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)"""			15125841, 15659578	Standard	NM_014188		Approved	HSPC182	uc001agd.3	Q9NP77	OTTHUMG00000000576	ENST00000291386.3:c.282G>A	chr1.hg19:g.1480325C>T		265.0	0.0	.		197.0	71.0	.	NM_014188	Q9BZS6|Q9H933	Silent	SNP	ENST00000291386.3	hg19	CCDS32.1																																																																																			.	C|1.000;A|0.000	.	alt		0.478	SSU72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001366.1	NM_014188	
CELA3B	23436	hgsc.bcm.edu	37	1	22310247	22310247	+	Silent	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:22310247C>T	ENST00000337107.6	+	5	442	c.423C>T	c.(421-423)ctC>ctT	p.L141L		NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	141	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						CCGTCCAGCTCGCCTCACTCC	0.632																																					p.L141L		Atlas-SNP	.											.	CELA3B	24	.	0			c.C423T						PASS	.						96.0	77.0	83.0					1																	22310247		2203	4300	6503	SO:0001819	synonymous_variant	23436	exon5			CCAGCTCGCCTCA	M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.423C>T	chr1.hg19:g.22310247C>T		136.0	0.0	.		119.0	38.0	.	NM_007352	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Silent	SNP	ENST00000337107.6	hg19	CCDS219.1																																																																																			.	.	.	none		0.632	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007797.1	NM_007352	
ASAP3	55616	hgsc.bcm.edu	37	1	23759922	23759922	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:23759922T>A	ENST00000336689.3	-	21	2167	c.2123A>T	c.(2122-2124)gAg>gTg	p.E708V	ASAP3_ENST00000437606.2_Missense_Mutation_p.E699V|ASAP3_ENST00000495646.1_Missense_Mutation_p.E212V	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	708					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						ACCCACCTTCTCTTCCTCATC	0.622																																					p.E708V		Atlas-SNP	.											.	ASAP3	65	.	0			c.A2123T						PASS	.						73.0	72.0	72.0					1																	23759922		2203	4300	6503	SO:0001583	missense	55616	exon21			ACCTTCTCTTCCT	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.2123A>T	chr1.hg19:g.23759922T>A	ENSP00000338769:p.Glu708Val	119.0	0.0	.		90.0	47.0	.	NM_017707	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Missense_Mutation	SNP	ENST00000336689.3	hg19	CCDS235.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.453556	0.84209	.	.	ENSG00000088280	ENST00000538685;ENST00000495646;ENST00000336689;ENST00000465372;ENST00000437606	T;T;T	0.56941	1.77;0.43;0.43	4.69	4.69	0.59074	.	3.712730	0.00567	N	0.000291	T	0.65228	0.2671	L	0.27053	0.805	0.58432	D	0.999999	D;D;D;D	0.76494	0.996;0.996;0.981;0.999	P;D;P;P	0.65874	0.892;0.939;0.77;0.905	T	0.50215	-0.8854	10	0.72032	D	0.01	.	13.4102	0.60938	0.0:0.0:0.0:1.0	.	699;577;231;708	Q8TDY4-3;B4DRP2;Q9NXH7;Q8TDY4	.;.;.;ASAP3_HUMAN	V	231;212;708;35;699	ENSP00000436150:E212V;ENSP00000338769:E708V;ENSP00000408826:E699V	ENSP00000338769:E708V	E	-	2	0	ASAP3	23632509	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	7.415000	0.80131	2.104000	0.64026	0.459000	0.35465	GAG	.	.	.	none		0.622	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707	
CSMD2	114784	hgsc.bcm.edu	37	1	33985175	33985175	+	Silent	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:33985175T>A	ENST00000373381.4	-	70	11015	c.10839A>T	c.(10837-10839)acA>acT	p.T3613T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3469						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCATGATGTCTGTGGGCTGGA	0.592																																					p.T3469T		Atlas-SNP	.											.	CSMD2	946	.	0			c.A10407T						PASS	.						287.0	241.0	256.0					1																	33985175		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon69			GATGTCTGTGGGC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10839A>T	chr1.hg19:g.33985175T>A		330.0	0.0	.		235.0	90.0	.	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	hg19																																																																																				.	.	.	none		0.592	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
TTF2	8458	hgsc.bcm.edu	37	1	117618867	117618867	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:117618867C>G	ENST00000369466.4	+	6	1385	c.1341C>G	c.(1339-1341)atC>atG	p.I447M		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	447					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TCAAACAAATCCAGGAGCTGG	0.478																																					p.I447M		Atlas-SNP	.											.	TTF2	92	.	0			c.C1341G						PASS	.						101.0	95.0	97.0					1																	117618867		2203	4300	6503	SO:0001583	missense	8458	exon6			ACAAATCCAGGAG	AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.1341C>G	chr1.hg19:g.117618867C>G	ENSP00000358478:p.Ile447Met	75.0	0.0	.		48.0	19.0	.	NM_003594	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	ENST00000369466.4	hg19	CCDS892.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109329	0.37242	.	.	ENSG00000116830	ENST00000369466	D	0.88975	-2.45	5.41	-4.64	0.03349	.	0.000000	0.37906	N	0.001883	D	0.84379	0.5459	M	0.70595	2.14	0.34103	D	0.662138	D;D	0.67145	0.996;0.979	P;P	0.61800	0.894;0.857	T	0.77988	-0.2380	10	0.72032	D	0.01	-12.3789	1.4425	0.02357	0.2154:0.3707:0.1077:0.3062	.	447;447	Q9UNY4;Q9UNY4-2	TTF2_HUMAN;.	M	447	ENSP00000358478:I447M	ENSP00000358478:I447M	I	+	3	3	TTF2	117420390	0.918000	0.31147	0.794000	0.32065	0.071000	0.16799	-0.183000	0.09712	-0.727000	0.04888	0.561000	0.74099	ATC	.	.	.	none		0.478	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033277.3		
RRNAD1	51093	hgsc.bcm.edu	37	1	156706431	156706431	+	Silent	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:156706431T>C	ENST00000368216.4	+	8	1944	c.1314T>C	c.(1312-1314)caT>caC	p.H438H	RRNAD1_ENST00000476229.1_Missense_Mutation_p.C154R|RRNAD1_ENST00000368218.4_Missense_Mutation_p.C277R|RRNAD1_ENST00000481920.1_Intron|MRPL24_ENST00000478899.1_5'Flank	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	438						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						CAGGTTTCCATGCTGAGCTCC	0.532																																					p.C277R		Atlas-SNP	.											RRNAD1,NS,carcinoma,0,1	RRNAD1	39	.	0			c.T829C						PASS	.						132.0	123.0	126.0					1																	156706431		2203	4300	6503	SO:0001819	synonymous_variant	51093	exon7			TTTCCATGCTGAG	BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.1314T>C	chr1.hg19:g.156706431T>C		154.0	0.0	.		135.0	52.0	.	NM_001142560	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Missense_Mutation	SNP	ENST00000368216.4	hg19	CCDS1154.1	.	.	.	.	.	.	.	.	.	.	T	13.71	2.319855	0.41096	.	.	ENSG00000143303	ENST00000368218;ENST00000476229	.	.	.	5.87	0.792	0.18625	.	.	.	.	.	T	0.25232	0.0613	.	.	.	0.36802	D	0.885409	B	0.06786	0.001	B	0.01281	0.0	T	0.08638	-1.0712	7	0.87932	D	0	-4.8252	4.626	0.12479	0.0:0.2522:0.2302:0.5176	.	277	Q4VX71	.	R	277;154	.	ENSP00000357201:C277R	C	+	1	0	RRNAD1	154973055	0.996000	0.38824	1.000000	0.80357	0.386000	0.30323	0.158000	0.16422	0.158000	0.19367	0.533000	0.62120	TGC	.	.	.	none		0.532	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098973.1	NM_015997	
PRRC2C	23215	hgsc.bcm.edu	37	1	171482181	171482181	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:171482181C>G	ENST00000338920.4	+	3	391	c.154C>G	c.(154-156)Cgg>Ggg	p.R52G	PRRC2C_ENST00000367742.3_Missense_Mutation_p.R54G|PRRC2C_ENST00000476522.1_3'UTR|PRRC2C_ENST00000392078.3_Missense_Mutation_p.R54G|PRRC2C_ENST00000426496.2_Missense_Mutation_p.R52G	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	52					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										CGGTATTTCACGGCGTATGCC	0.403																																					p.R52G		Atlas-SNP	.											.	.	.	.	0			c.C154G						PASS	.						115.0	110.0	112.0					1																	171482181		2203	4300	6503	SO:0001583	missense	23215	exon3			ATTTCACGGCGTA	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.154C>G	chr1.hg19:g.171482181C>G	ENSP00000343629:p.Arg52Gly	65.0	0.0	.		56.0	20.0	.	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	hg19	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993708	0.35131	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.82	2.79	0.32731	BAT2, N-terminal (1);	0.000000	0.43579	D	0.000551	T	0.61110	0.2321	M	0.81341	2.54	0.54753	D	0.999983	D;D;D	0.89917	0.999;1.0;0.98	D;D;P	0.79108	0.943;0.992;0.749	T	0.69665	-0.5084	10	0.87932	D	0	.	15.4227	0.75025	0.5817:0.4183:0.0:0.0	.	52;54;52	Q9Y520-4;E7EPN9;Q9Y520	.;.;PRC2C_HUMAN	G	54;52;52;54;52	ENSP00000375928:R54G;ENSP00000410219:R52G;ENSP00000356716:R54G;ENSP00000343629:R52G	ENSP00000343629:R52G	R	+	1	2	PRRC2C	169748805	0.984000	0.35163	0.999000	0.59377	0.992000	0.81027	2.586000	0.46119	0.312000	0.23038	-0.169000	0.13324	CGG	.	.	.	none		0.403	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
TRIM11	81559	hgsc.bcm.edu	37	1	228584695	228584695	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:228584695G>T	ENST00000284551.6	-	5	1090	c.812C>A	c.(811-813)aCc>aAc	p.T271N	RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000460651.1_5'UTR|TRIM11_ENST00000493030.2_Missense_Mutation_p.T146N|TRIM11_ENST00000366699.3_Missense_Mutation_p.T271N	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	271	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				CCTGCACACGGTCCTCAGCTC	0.627																																					p.T271N		Atlas-SNP	.											.	TRIM11	38	.	0			c.C812A						PASS	.						85.0	85.0	85.0					1																	228584695		2203	4300	6503	SO:0001583	missense	81559	exon5			CACACGGTCCTCA	AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.812C>A	chr1.hg19:g.228584695G>T	ENSP00000284551:p.Thr271Asn	101.0	0.0	.		80.0	35.0	.	NM_145214	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	ENST00000284551.6	hg19	CCDS31048.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.549179	0.65311	.	.	ENSG00000154370	ENST00000284551;ENST00000366699	T;T	0.06768	3.26;3.26	4.97	4.97	0.65823	B30.2/SPRY domain (1);	0.000000	0.41605	D	0.000853	T	0.19127	0.0459	L	0.41079	1.255	0.34988	D	0.754698	D;D;P	0.89917	1.0;1.0;0.781	D;D;B	0.97110	1.0;1.0;0.248	T	0.11108	-1.0601	10	0.26408	T	0.33	.	14.103	0.65070	0.0:0.0:1.0:0.0	.	270;271;271	Q96F44-3;Q96F44-2;Q96F44	.;.;TRI11_HUMAN	N	271	ENSP00000284551:T271N;ENSP00000355660:T271N	ENSP00000284551:T271N	T	-	2	0	TRIM11	226651318	0.932000	0.31603	0.909000	0.35828	0.546000	0.35178	1.634000	0.37123	2.482000	0.83794	0.313000	0.20887	ACC	.	.	.	none		0.627	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095995.3	NM_145214	
SLC8A1	6546	hgsc.bcm.edu	37	2	40405590	40405590	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr2:40405590T>C	ENST00000403092.1	-	3	1885	c.1852A>G	c.(1852-1854)Aaa>Gaa	p.K618E	SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1_ENST00000408028.2_Intron|SLC8A1_ENST00000406785.2_Intron|SLC8A1_ENST00000406391.2_Intron|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1_ENST00000542756.1_Missense_Mutation_p.K618E|SLC8A1_ENST00000405901.3_Missense_Mutation_p.K618E|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000542024.1_Intron|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000405269.1_Intron|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1_ENST00000332839.4_Missense_Mutation_p.K618E|SLC8A1_ENST00000402441.1_Intron			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	618	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GTCTTGTTTTTCTCATACTCC	0.468																																					p.K618E		Atlas-SNP	.											SLC8A1,NS,carcinoma,0,1	SLC8A1	221	.	0			c.A1852G						PASS	.						239.0	235.0	237.0					2																	40405590		2203	4300	6503	SO:0001583	missense	6546	exon2			TGTTTTTCTCATA		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1852A>G	chr2.hg19:g.40405590T>C	ENSP00000384763:p.Lys618Glu	270.0	0.0	.		241.0	108.0	.	NM_021097	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	hg19	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338174	0.81911	.	.	ENSG00000183023	ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000332839	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.39	5.39	0.77823	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.49423	0.1556	L	0.52011	1.625	0.80722	D	1	P;D	0.89917	0.917;1.0	P;D	0.91635	0.721;0.999	T	0.50800	-0.8785	10	0.87932	D	0	.	13.3557	0.60627	0.0:0.0:0.0:1.0	.	618;618	F6VPY9;P32418	.;NAC1_HUMAN	E	618	ENSP00000440727:K618E;ENSP00000384763:K618E;ENSP00000385678:K618E;ENSP00000332931:K618E	ENSP00000332931:K618E	K	-	1	0	SLC8A1	40259094	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.587000	0.82613	2.028000	0.59812	0.482000	0.46254	AAA	.	.	.	none		0.468	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
FBXO11	80204	hgsc.bcm.edu	37	2	48049436	48049436	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr2:48049436A>C	ENST00000403359.3	-	13	1695	c.1623T>G	c.(1621-1623)aaT>aaG	p.N541K	FBXO11_ENST00000402508.1_Missense_Mutation_p.N457K|FBXO11_ENST00000316377.4_Missense_Mutation_p.N457K|FBXO11_ENST00000434523.2_5'UTR	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	541					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TAAATATAGAATTTCCCCTAT	0.343			"""Mis, F, D"""		DLBCL																																p.N541K		Atlas-SNP	.		Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	FBXO11	127	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.T1623G						PASS	.						51.0	51.0	51.0					2																	48049436		2202	4298	6500	SO:0001583	missense	80204	exon13			TATAGAATTTCCC	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.1623T>G	chr2.hg19:g.48049436A>C	ENSP00000384823:p.Asn541Lys	54.0	0.0	.		54.0	19.0	.	NM_001190274	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	hg19	CCDS54357.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.6|20.6	4.023026|4.023026	0.75275|0.75275	.|.	.|.	ENSG00000138081|ENSG00000138081	ENST00000493962|ENST00000402508;ENST00000403359;ENST00000316377	.|D;D;D	.|0.89485	.|-2.52;-1.81;-2.52	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Pectin lyase fold/virulence factor (1);Carbohydrate-binding/sugar hydrolysis domain (1);F-box domain, Skp2-like (1);Pectin lyase fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93135|0.93135	0.7814|0.7814	M|M	0.92459|0.92459	3.31|3.31	0.80722|0.80722	D|D	1|1	.|B	.|0.26258	.|0.145	.|B	.|0.37304	.|0.246	D|D	0.92695|0.92695	0.6170|0.6170	5|10	.|0.66056	.|D	.|0.02	-16.8508|-16.8508	15.4471|15.4471	0.75238|0.75238	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|541	.|Q86XK2	.|FBX11_HUMAN	V|K	333|457;541;457	.|ENSP00000385398:N457K;ENSP00000384823:N541K;ENSP00000323822:N457K	.|ENSP00000323822:N457K	F|N	-|-	1|3	0|2	FBXO11|FBXO11	47902940|47902940	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	4.344000|4.344000	0.59354|0.59354	2.039000|2.039000	0.60335|0.60335	0.533000|0.533000	0.62120|0.62120	TTC|AAT	.	.	.	none		0.343	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133	
ATG7	10533	hgsc.bcm.edu	37	3	11600049	11600049	+	IGR	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr3:11600049G>A	ENST00000354449.3	+	0	4959				VGLL4_ENST00000424529.2_Missense_Mutation_p.S201F|VGLL4_ENST00000404339.1_Missense_Mutation_p.S290F|VGLL4_ENST00000451674.2_Missense_Mutation_p.S205F|VGLL4_ENST00000273038.3_Missense_Mutation_p.S285F|VGLL4_ENST00000413604.1_Missense_Mutation_p.S226F|VGLL4_ENST00000430365.2_Missense_Mutation_p.S291F	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7						adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						CACAGAGGGGGAGTGACTGTG	0.572																																					p.S291F		Atlas-SNP	.											.	VGLL4	47	.	0			c.C872T						PASS	.						43.0	49.0	47.0					3																	11600049		2203	4299	6502	SO:0001628	intergenic_variant	9686	exon5			GAGGGGGAGTGAC	AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740		chr3.hg19:g.11600049G>A		97.0	0.0	.		101.0	18.0	.	NM_001128219	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	ENST00000354449.3	hg19	CCDS2605.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347047	0.61183	.	.	ENSG00000144560	ENST00000273038;ENST00000413604;ENST00000451674;ENST00000424529;ENST00000430365;ENST00000404339	T;T;T	0.60672	0.23;0.26;0.17	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.74696	0.3750	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.998;0.998	T	0.77851	-0.2434	10	0.87932	D	0	-39.5652	18.3059	0.90180	0.0:0.0:1.0:0.0	.	291;205;201;290;285	G5E9M7;Q14135-6;Q14135-5;G5E9F4;Q14135	.;.;.;.;VGLL4_HUMAN	F	285;226;205;201;291;290	ENSP00000273038:S285F;ENSP00000404251:S291F;ENSP00000384705:S290F	ENSP00000273038:S285F	S	-	2	0	VGLL4	11575049	1.000000	0.71417	0.967000	0.41034	0.519000	0.34347	7.672000	0.83956	2.321000	0.78463	0.563000	0.77884	TCC	.	.	.	none		0.572	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251951.3	NM_006395	
B4GALT4	8702	hgsc.bcm.edu	37	3	118945881	118945881	+	Silent	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr3:118945881C>T	ENST00000483209.1	-	4	902	c.261G>A	c.(259-261)caG>caA	p.Q87Q	B4GALT4_ENST00000393765.2_Silent_p.Q87Q|B4GALT4_ENST00000460321.1_5'UTR|B4GALT4-AS1_ENST00000470790.1_RNA|B4GALT4_ENST00000471675.1_Silent_p.Q40Q|B4GALT4_ENST00000467604.1_Silent_p.Q87Q|B4GALT4_ENST00000359213.3_Silent_p.Q87Q			O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4	87					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|membrane lipid metabolic process (GO:0006643)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			breast(2)|endometrium(1)|large_intestine(1)|lung(6)|skin(2)|stomach(2)	14				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)	TGAGCTTGCTCTGGCCTCCTA	0.443																																					p.Q87Q		Atlas-SNP	.											.	B4GALT4	30	.	0			c.G261A						PASS	.						91.0	90.0	90.0					3																	118945881		2203	4300	6503	SO:0001819	synonymous_variant	8702	exon5			CTTGCTCTGGCCT	AF022367	CCDS2986.1	3q13.3	2013-02-19			ENSG00000121578	ENSG00000121578		"""Beta 4-glycosyltransferases"""	927	protein-coding gene	gene with protein product		604015				9597550	Standard	NM_003778		Approved	beta4Gal-T4	uc003eci.3	O60513	OTTHUMG00000159358	ENST00000483209.1:c.261G>A	chr3.hg19:g.118945881C>T		67.0	0.0	.		81.0	4.0	.	NM_212543	Q68D68|Q9BSW3|Q9C078	Silent	SNP	ENST00000483209.1	hg19	CCDS2986.1																																																																																			.	.	.	none		0.443	B4GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354925.2	NM_003778	
ITGB5	3693	hgsc.bcm.edu	37	3	124487860	124487860	+	Splice_Site	SNP	C	C	T	rs375122712		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr3:124487860C>T	ENST00000296181.4	-	12	2313	c.2017G>A	c.(2017-2019)Gtg>Atg	p.V673M	ITGB5_ENST00000461306.1_5'UTR	NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	673					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		GCACACTCACCGATGGTGTCC	0.587																																					p.V673M		Atlas-SNP	.											.	ITGB5	66	.	0			c.G2017A						PASS	.	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	131.0	113.0	119.0		2017	4.3	1.0	3		119	0,8600		0,0,4300	no	missense-near-splice	ITGB5	NM_002213.3	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	673/800	124487860	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	3693	exon12			ACTCACCGATGGT	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.2017+1G>A	chr3.hg19:g.124487860C>T		71.0	0.0	.		101.0	29.0	.	NM_002213	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	hg19	CCDS3030.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633900	0.47049	2.27E-4	0.0	ENSG00000082781	ENST00000296181	D	0.90261	-2.64	5.29	4.34	0.51931	Integrin beta subunit, tail (2);	0.762691	0.12573	N	0.457111	D	0.83151	0.5192	L	0.29908	0.895	0.38470	D	0.94744	B	0.20052	0.041	B	0.18561	0.022	T	0.76046	-0.3102	9	.	.	.	.	8.2832	0.31913	0.0:0.8282:0.0:0.1718	.	673	P18084	ITB5_HUMAN	M	673	ENSP00000296181:V673M	.	V	-	1	0	ITGB5	125970550	0.915000	0.31059	1.000000	0.80357	0.994000	0.84299	1.262000	0.32992	2.761000	0.94854	0.655000	0.94253	GTG	.	.	.	weak		0.587	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	Missense_Mutation
FGFR3	2261	hgsc.bcm.edu	37	4	1807787	1807787	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr4:1807787A>G	ENST00000260795.2	+	13	1948	c.1846A>G	c.(1846-1848)Agg>Ggg	p.R616G	FGFR3_ENST00000340107.4_Missense_Mutation_p.R618G|FGFR3_ENST00000481110.2_Missense_Mutation_p.R617G|FGFR3_ENST00000440486.2_Missense_Mutation_p.R616G|FGFR3_ENST00000412135.2_Missense_Mutation_p.R504G|FGFR3_ENST00000352904.1_Missense_Mutation_p.R504G			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	616	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	GTGCATCCACAGGGACCTGGC	0.642		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.R618G		Atlas-SNP	.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3	3320	.	0			c.A1852G						PASS	.						39.0	39.0	39.0					4																	1807787		2202	4300	6502	SO:0001583	missense	2261	exon14	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	ATCCACAGGGACC	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1846A>G	chr4.hg19:g.1807787A>G	ENSP00000260795:p.Arg616Gly	59.0	0.0	.		27.0	11.0	.	NM_001163213	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	hg19	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	a	13.53	2.264914	0.40095	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904	D;D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37;-2.37	4.18	1.28	0.21552	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93559	0.7944	M	0.82433	2.59	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.998	D;D;D;D	0.97110	1.0;0.997;1.0;0.973	D	0.93158	0.6555	10	0.87932	D	0	.	11.472	0.50275	0.5856:0.4144:0.0:0.0	.	618;504;616;617	P22607-2;P22607-3;P22607;F8W9L4	.;.;FGFR3_HUMAN;.	G	617;618;616;504;616;504	ENSP00000420533:R617G;ENSP00000339824:R618G;ENSP00000414914:R616G;ENSP00000412903:R504G;ENSP00000260795:R616G;ENSP00000231803:R504G	ENSP00000260795:R616G	R	+	1	2	FGFR3	1777585	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	1.293000	0.33353	0.540000	0.28808	0.241000	0.17934	AGG	.	.	.	none		0.642	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
SLAIN2	57606	hgsc.bcm.edu	37	4	48384849	48384849	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr4:48384849T>A	ENST00000264313.6	+	5	1545	c.1127T>A	c.(1126-1128)gTg>gAg	p.V376E	SLAIN2_ENST00000512093.1_Missense_Mutation_p.V183E	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	376					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						TATAGTAGAGTGTCCCCACAG	0.473																																					p.V376E		Atlas-SNP	.											.	SLAIN2	31	.	0			c.T1127A						PASS	.						89.0	89.0	89.0					4																	48384849		1998	4164	6162	SO:0001583	missense	57606	exon5			GTAGAGTGTCCCC	BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.1127T>A	chr4.hg19:g.48384849T>A	ENSP00000264313:p.Val376Glu	57.0	0.0	.		46.0	23.0	.	NM_020846	A8K4P1|Q8N5R3	Missense_Mutation	SNP	ENST00000264313.6	hg19	CCDS47051.1	.	.	.	.	.	.	.	.	.	.	T	4.898	0.166911	0.09339	.	.	ENSG00000109171	ENST00000264313;ENST00000512093	.	.	.	5.77	3.24	0.37175	.	0.222330	0.45867	D	0.000335	T	0.39306	0.1073	N	0.24115	0.695	0.43000	D	0.994515	B;B	0.25609	0.13;0.096	B;B	0.23574	0.047;0.026	T	0.24548	-1.0157	9	0.42905	T	0.14	-4.6941	7.659	0.28392	0.0:0.0736:0.141:0.7854	.	46;376	Q9H705;Q9P270	.;SLAI2_HUMAN	E	376;183	.	ENSP00000264313:V376E	V	+	2	0	SLAIN2	48079606	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	1.779000	0.38624	1.026000	0.39733	0.533000	0.62120	GTG	.	.	.	none		0.473	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365807.4	NM_020846	
TBCK	93627	hgsc.bcm.edu	37	4	106967781	106967781	+	Silent	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr4:106967781G>A	ENST00000273980.5	-	27	3075	c.2628C>T	c.(2626-2628)ggC>ggT	p.G876G	TBCK_ENST00000394708.2_Silent_p.G876G|TBCK_ENST00000394706.3_Silent_p.G837G|TBCK_ENST00000432496.2_Silent_p.G876G|TBCK_ENST00000361687.4_Silent_p.G813G					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						TTTTATTAATGCCACCATCTA	0.393																																					p.G876G		Atlas-SNP	.											.	TBCK	89	.	0			c.C2628T						PASS	.						120.0	116.0	117.0					4																	106967781		2203	4300	6503	SO:0001819	synonymous_variant	93627	exon26			ATTAATGCCACCA		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.2628C>T	chr4.hg19:g.106967781G>A		66.0	0.0	.		50.0	15.0	.	NM_001163436		Silent	SNP	ENST00000273980.5	hg19	CCDS54788.1																																																																																			.	.	.	none		0.393	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
JMY	133746	hgsc.bcm.edu	37	5	78610483	78610483	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr5:78610483C>T	ENST00000396137.4	+	9	2930	c.2468C>T	c.(2467-2469)cCa>cTa	p.P823L	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	823	Pro-rich.				'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		cccccaccaccaccacctcTG	0.547																																					p.P823L		Atlas-SNP	.											.	JMY	82	.	0			c.C2468T						PASS	.						17.0	17.0	17.0					5																	78610483		1826	4036	5862	SO:0001583	missense	133746	exon9			CACCACCACCACC	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2468C>T	chr5.hg19:g.78610483C>T	ENSP00000379441:p.Pro823Leu	41.0	0.0	.		20.0	7.0	.	NM_152405	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	hg19	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	C	13.78	2.340022	0.41398	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.33654	1.4	4.69	3.8	0.43715	.	0.871791	0.09687	N	0.768999	T	0.55065	0.1897	L	0.54323	1.7	0.52099	D	0.999943	D	0.89917	1.0	D	0.91635	0.999	T	0.29458	-1.0011	10	0.25106	T	0.35	.	13.6524	0.62318	0.1565:0.8435:0.0:0.0	.	823	Q8N9B5	JMY_HUMAN	L	812;823	ENSP00000379441:P823L	ENSP00000282259:P812L	P	+	2	0	JMY	78646239	0.992000	0.36948	0.018000	0.16275	0.297000	0.27493	7.110000	0.77069	0.928000	0.37168	0.650000	0.86243	CCA	.	.	.	none		0.547	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405	
RAD50	10111	hgsc.bcm.edu	37	5	131953819	131953819	+	Silent	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr5:131953819A>G	ENST00000265335.6	+	21	3609	c.3222A>G	c.(3220-3222)gcA>gcG	p.A1074A	RAD50_ENST00000378823.3_Silent_p.A935A			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1074					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATAATTTGGCATTAGGGCGAC	0.318								Homologous recombination																													p.A1074A		Atlas-SNP	.											.	RAD50	246	.	0			c.A3222G						PASS	.						140.0	163.0	155.0					5																	131953819		2203	4299	6502	SO:0001819	synonymous_variant	10111	exon21			TTTGGCATTAGGG	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3222A>G	chr5.hg19:g.131953819A>G		226.0	0.0	.		249.0	110.0	.	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Silent	SNP	ENST00000265335.6	hg19	CCDS34233.1																																																																																			.	.	.	none		0.318	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
ZNF346	23567	hgsc.bcm.edu	37	5	176471535	176471535	+	Splice_Site	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr5:176471535G>C	ENST00000358149.3	+	4	560		c.e4+1		ZNF346_ENST00000506693.1_Intron|ZNF346_ENST00000512315.1_Intron|ZNF346_ENST00000503425.1_Splice_Site|ZNF346_ENST00000261948.4_Splice_Site|ZNF346_ENST00000511834.1_Splice_Site|ZNF346_ENST00000503039.1_Splice_Site	NM_012279.2	NP_036411.1	Q9UL40	ZN346_HUMAN	zinc finger protein 346						positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	14	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGGTGGAAGGTACTGGTTTT	0.552																																					.		Atlas-SNP	.											.	ZNF346	24	.	0			c.517+1G>C						PASS	.						117.0	109.0	112.0					5																	176471535		2203	4300	6503	SO:0001630	splice_region_variant	23567	exon4			TGGAAGGTACTGG	AF083340	CCDS4409.1	5q35.3	2012-10-05			ENSG00000113761	ENSG00000113761			16403	protein-coding gene	gene with protein product		605308				10488071	Standard	NM_012279		Approved	JAZ, Zfp346	uc003mfi.3	Q9UL40	OTTHUMG00000130848	ENST00000358149.3:c.517+1G>C	chr5.hg19:g.176471535G>C		81.0	0.0	.		80.0	28.0	.	NM_012279	B7Z367|Q68CV9|Q6ZMW1	Splice_Site	SNP	ENST00000358149.3	hg19	CCDS4409.1	.	.	.	.	.	.	.	.	.	.	G	5.228	0.227622	0.09916	.	.	ENSG00000113761	ENST00000358149;ENST00000503425;ENST00000261948;ENST00000511834;ENST00000503039	.	.	.	4.55	3.68	0.42216	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8977	0.35474	0.1045:0.0:0.8955:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF346	176404141	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.687000	0.84139	1.051000	0.40369	-0.160000	0.13428	.	.	.	.	none		0.552	ZNF346-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253415.2	NM_012279	Intron
ECI2	10455	hgsc.bcm.edu	37	6	4117677	4117677	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr6:4117677C>G	ENST00000380118.3	-	9	930	c.894G>C	c.(892-894)gaG>gaC	p.E298D	ECI2_ENST00000465828.1_Missense_Mutation_p.E268D|ECI2_ENST00000361538.2_Missense_Mutation_p.E268D|C6orf201_ENST00000333388.5_Intron|C6orf201_ENST00000380175.4_Intron|C6orf201_ENST00000430835.2_Intron|ECI2_ENST00000413766.2_Missense_Mutation_p.E131D|ECI2_ENST00000380125.2_Missense_Mutation_p.E268D			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	298	ECH-like.				fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						AAATAAGCATCTCTGTTGCCT	0.393																																					p.E298D		Atlas-SNP	.											.	ECI2	59	.	0			c.G894C						PASS	.						86.0	90.0	89.0					6																	4117677		2203	4300	6503	SO:0001583	missense	10455	exon9			AAGCATCTCTGTT	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.894G>C	chr6.hg19:g.4117677C>G	ENSP00000369461:p.Glu298Asp	105.0	0.0	.		83.0	29.0	.	NM_206836	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Missense_Mutation	SNP	ENST00000380118.3	hg19	CCDS43420.2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129965	0.77549	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000413766;ENST00000361538;ENST00000465828	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	6.16	4.39	0.52855	Crotonase, core (1);	0.145207	0.64402	D	0.000008	T	0.63498	0.2516	M	0.74389	2.26	0.80722	D	1	P	0.41524	0.753	P	0.47705	0.555	T	0.68965	-0.5270	10	0.54805	T	0.06	.	11.2609	0.49083	0.0:0.8536:0.0:0.1464	.	298	O75521	ECI2_HUMAN	D	298;268;131;268;268	ENSP00000369461:E298D;ENSP00000369468:E268D;ENSP00000406969:E131D;ENSP00000354737:E268D;ENSP00000420309:E268D	ENSP00000354737:E268D	E	-	3	2	ECI2	4062676	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.699000	0.37804	1.627000	0.50400	0.650000	0.86243	GAG	.	.	.	none		0.393	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039716.4	NM_006117	
CCDC146	57639	hgsc.bcm.edu	37	7	76866323	76866323	+	Silent	SNP	C	C	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr7:76866323C>G	ENST00000285871.4	+	3	343	c.216C>G	c.(214-216)acC>acG	p.T72T	CCDC146_ENST00000431197.1_5'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	72										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				CCAAGTATACCTTGCTGCATG	0.403																																					p.T72T		Atlas-SNP	.											.	CCDC146	87	.	0			c.C216G						PASS	.						194.0	144.0	161.0					7																	76866323		2203	4300	6503	SO:0001819	synonymous_variant	57639	exon3			GTATACCTTGCTG	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.216C>G	chr7.hg19:g.76866323C>G		54.0	0.0	.		98.0	4.0	.	NM_020879	A8K8X6|Q9P223	Silent	SNP	ENST00000285871.4	hg19	CCDS34671.1																																																																																			.	.	.	none		0.403	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879	
HSF1	3297	hgsc.bcm.edu	37	8	145535422	145535422	+	Missense_Mutation	SNP	G	G	A	rs201143946		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr8:145535422G>A	ENST00000528838.1	+	8	920	c.760G>A	c.(760-762)Gcc>Acc	p.A254T	GS1-393G12.12_ENST00000525023.1_RNA|HSF1_ENST00000400780.4_Missense_Mutation_p.A189T	NM_005526.2	NP_005517.1	Q00613	HSF1_HUMAN	heat shock transcription factor 1	254	Regulatory domain.				cellular response to heat (GO:0034605)|defense response (GO:0006952)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|female meiotic division (GO:0007143)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)|response to lipopolysaccharide (GO:0032496)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pronucleus (GO:0045120)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)|urinary_tract(2)	11	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			CAGCCTCTACGCCCCTGATGC	0.677																																					p.A254T		Atlas-SNP	.											.	HSF1	29	.	0			c.G760A						PASS	.	G	THR/ALA	0,4406		0,0,2203	40.0	41.0	41.0		760	-9.2	0.0	8		41	1,8591	1.2+/-3.3	0,1,4295	yes	missense	HSF1	NM_005526.2	58	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	benign	254/530	145535422	1,12997	2203	4296	6499	SO:0001583	missense	3297	exon8			CTCTACGCCCCTG	M64673	CCDS6419.1	8q24.3	2014-04-10			ENSG00000185122	ENSG00000185122			5224	protein-coding gene	gene with protein product		140580				1871105	Standard	NM_005526		Approved	HSTF1	uc003zbt.4	Q00613	OTTHUMG00000174604	ENST00000528838.1:c.760G>A	chr8.hg19:g.145535422G>A	ENSP00000431512:p.Ala254Thr	77.0	0.0	.		86.0	4.0	.	NM_005526	A8K4L0|A8MW26|Q53XT4	Missense_Mutation	SNP	ENST00000528838.1	hg19	CCDS6419.1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.287380	0.23478	0.0	1.16E-4	ENSG00000185122	ENST00000528838;ENST00000400780	.	.	.	5.3	-9.22	0.00675	Vertebrate heat shock transcription factor (1);	0.615854	0.16090	N	0.230092	T	0.06462	0.0166	N	0.02539	-0.55	0.09310	N	0.999999	B	0.09022	0.002	B	0.06405	0.002	T	0.12218	-1.0556	9	0.25106	T	0.35	-20.7374	0.7851	0.01047	0.1584:0.2577:0.2439:0.34	.	254	Q00613	HSF1_HUMAN	T	254;189	.	ENSP00000383590:A189T	A	+	1	0	HSF1	145506230	0.003000	0.15002	0.004000	0.12327	0.095000	0.18619	-0.084000	0.11268	-1.940000	0.01043	-0.502000	0.04539	GCC	.	.	.	weak		0.677	HSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382053.1	NM_005526	
AGTPBP1	23287	hgsc.bcm.edu	37	9	88284416	88284416	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr9:88284416T>G	ENST00000357081.3	-	8	790	c.646A>C	c.(646-648)Aat>Cat	p.N216H	AGTPBP1_ENST00000376083.3_Missense_Mutation_p.N216H|AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000337006.4_Missense_Mutation_p.N158H|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.N54H|AGTPBP1_ENST00000376080.1_Missense_Mutation_p.N158H|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.N268H|AGTPBP1_ENST00000376081.4_Missense_Mutation_p.N216H			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	216					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						AGACTGGAATTCTTCTTACTA	0.368																																					p.N216H		Atlas-SNP	.											.	AGTPBP1	128	.	0			c.A646C						PASS	.						94.0	86.0	89.0					9																	88284416		2203	4298	6501	SO:0001583	missense	23287	exon8			TGGAATTCTTCTT	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.646A>C	chr9.hg19:g.88284416T>G	ENSP00000349592:p.Asn216His	63.0	0.0	.		65.0	26.0	.	NM_015239	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	hg19		.	.	.	.	.	.	.	.	.	.	T	12.67	2.007766	0.35415	.	.	ENSG00000135049	ENST00000337006;ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218;ENST00000376081;ENST00000376080	T;T;T;T;T;T;T	0.52754	1.94;1.94;0.65;0.65;1.94;1.94;1.94	5.76	5.76	0.90799	Armadillo-like helical (1);Armadillo-type fold (1);	0.081135	0.85682	D	0.000000	T	0.54886	0.1886	L	0.32530	0.975	0.54753	D	0.999983	D;D;D;B	0.89917	0.998;1.0;1.0;0.235	D;D;D;B	0.77004	0.949;0.962;0.989;0.102	T	0.46830	-0.9163	10	0.08837	T	0.75	-33.4404	16.087	0.81065	0.0:0.0:0.0:1.0	.	268;216;54;216	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	H	158;216;216;268;54;216;158	ENSP00000338512:N158H;ENSP00000349592:N216H;ENSP00000365251:N216H;ENSP00000365277:N268H;ENSP00000402804:N54H;ENSP00000365249:N216H;ENSP00000365248:N158H	ENSP00000338512:N158H	N	-	1	0	AGTPBP1	87474236	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.376000	0.79658	2.202000	0.70862	0.533000	0.62120	AAT	.	.	.	none		0.368	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
CCBL1	883	hgsc.bcm.edu	37	9	131597888	131597888	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr9:131597888T>A	ENST00000302586.3	-	10	1076	c.914A>T	c.(913-915)tAc>tTc	p.Y305F	CCBL1_ENST00000436267.2_Missense_Mutation_p.Y399F|CCBL1_ENST00000320665.6_Missense_Mutation_p.Y255F|CCBL1_ENST00000483599.1_5'UTR	NM_001122671.1|NM_004059.4	NP_001116143.1|NP_004050.3	Q16773	KAT1_HUMAN	cysteine conjugate-beta lyase, cytoplasmic	305					cellular amino acid biosynthetic process (GO:0008652)|cellular modified amino acid metabolic process (GO:0006575)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine catabolic process (GO:0097053)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|glutamine-phenylpyruvate transaminase activity (GO:0047316)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-glutamine:pyruvate aminotransferase activity (GO:0047945)|L-phenylalanine-oxaloacetate transaminase activity (GO:0036141)|L-phenylalanine:pyruvate aminotransferase activity (GO:0047312)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)	18					L-Glutamine(DB00130)	CTGCACAAAGTAGCTGCTGGG	0.597																																					p.Y305F		Atlas-SNP	.											.	CCBL1	36	.	0			c.A914T						PASS	.						56.0	58.0	57.0					9																	131597888		2103	4222	6325	SO:0001583	missense	883	exon10			ACAAAGTAGCTGC	Y17448	CCDS43884.1, CCDS48038.1, CCDS75915.1	9q34.11	2008-03-11	2008-03-11		ENSG00000171097	ENSG00000171097	2.6.1.64		1564	protein-coding gene	gene with protein product	"""glutamine transaminase K"", ""kyneurenine aminotransferase"""	600547	"""cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)"""			7883047	Standard	NM_001122671		Approved	KATI, GTK	uc004bwh.3	Q16773	OTTHUMG00000020767	ENST00000302586.3:c.914A>T	chr9.hg19:g.131597888T>A	ENSP00000302227:p.Tyr305Phe	63.0	0.0	.		57.0	23.0	.	NM_001122671	Q5T275|Q8N191	Missense_Mutation	SNP	ENST00000302586.3	hg19	CCDS43884.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.960807	0.74016	.	.	ENSG00000171097	ENST00000302586;ENST00000320665;ENST00000436267	D;D;D	0.90261	-2.64;-2.64;-2.64	5.3	5.3	0.74995	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.93304	0.7866	L	0.52364	1.645	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.999	D	0.92808	0.6262	10	0.40728	T	0.16	-2.7503	14.4079	0.67096	0.0:0.0:0.0:1.0	.	399;305;255;305	B7Z4W5;A8K563;Q16773-2;Q16773	.;.;.;KAT1_HUMAN	F	305;255;399	ENSP00000302227:Y305F;ENSP00000317342:Y255F;ENSP00000399415:Y399F	ENSP00000302227:Y305F	Y	-	2	0	CCBL1	130637709	1.000000	0.71417	1.000000	0.80357	0.429000	0.31625	7.196000	0.77805	1.997000	0.58415	0.358000	0.22013	TAC	.	.	.	none		0.597	CCBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054521.2		
NFKB2	4791	hgsc.bcm.edu	37	10	104158555	104158555	+	Missense_Mutation	SNP	G	G	A	rs45580031		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr10:104158555G>A	ENST00000369966.3	+	12	1301	c.1051G>A	c.(1051-1053)Ggg>Agg	p.G351R	NFKB2_ENST00000336486.5_3'UTR|NFKB2_ENST00000428099.1_Missense_Mutation_p.G351R|NFKB2_ENST00000189444.6_Missense_Mutation_p.G351R	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	351	GRR.|Gly-rich.		G -> R (in dbSNP:rs45580031). {ECO:0000269|Ref.7}.		extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCAGCCCTTCGGGGGTGGCTC	0.627			T	IGH@	B-NHL																																p.G351R		Atlas-SNP	.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2	48	.	0			c.G1051A						PASS	.						23.0	25.0	24.0					10																	104158555		1910	4115	6025	SO:0001583	missense	4791	exon12			CCCTTCGGGGGTG	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1051G>A	chr10.hg19:g.104158555G>A	ENSP00000358983:p.Gly351Arg	54.0	0.0	.		35.0	16.0	.	NM_001077494	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	hg19	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691545	0.48097	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	D;D;D	0.86164	-2.08;-2.08;-2.08	4.56	4.56	0.56223	Immunoglobulin E-set (1);	0.220426	0.45126	D	0.000387	D	0.90686	0.7078	L	0.42245	1.32	0.48341	D	0.999631	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.89788	0.3966	10	0.36615	T	0.2	.	17.5171	0.87777	0.0:0.0:1.0:0.0	.	351;351;351	D3DR86;Q00653;A8K9D9	.;NFKB2_HUMAN;.	R	351	ENSP00000410256:G351R;ENSP00000358983:G351R;ENSP00000189444:G351R	ENSP00000189444:G351R	G	+	1	0	NFKB2	104148545	1.000000	0.71417	0.993000	0.49108	0.956000	0.61745	4.681000	0.61663	2.387000	0.81309	0.561000	0.74099	GGG	.	G|0.993;C|0.007	.	alt		0.627	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
CTSC	1075	hgsc.bcm.edu	37	11	88045694	88045694	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr11:88045694G>C	ENST00000227266.5	-	3	461	c.347C>G	c.(346-348)aCt>aGt	p.T116S		NM_001814.4	NP_001805	P53634	CATC_HUMAN	cathepsin C	116					aging (GO:0007568)|immune response (GO:0006955)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of proteolysis involved in cellular protein catabolic process (GO:1903052)|proteolysis (GO:0006508)|response to organic substance (GO:0010033)|T cell mediated cytotoxicity (GO:0001913)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	chaperone binding (GO:0051087)|chloride ion binding (GO:0031404)|cysteine-type peptidase activity (GO:0008234)|peptidase activator activity involved in apoptotic process (GO:0016505)|phosphatase binding (GO:0019902)|serine-type endopeptidase activity (GO:0004252)			large_intestine(7)|lung(8)|ovary(2)|prostate(3)|skin(2)	22		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTTGCAGTAAGTGGTCACCTT	0.458																																					p.T116S		Atlas-SNP	.											.	CTSC	46	.	0			c.C347G						PASS	.						204.0	192.0	196.0					11																	88045694		2201	4299	6500	SO:0001583	missense	1075	exon3			CAGTAAGTGGTCA	AK223038	CCDS8282.1, CCDS31654.1, CCDS44693.1	11q14.2	2014-09-17			ENSG00000109861	ENSG00000109861	3.4.14.1	"""Cathepsins"""	2528	protein-coding gene	gene with protein product	"""dipeptidyl peptidase 1"""	602365		PLS, PALS		7649281, 9092576	Standard	NM_148170		Approved	DPP1	uc001pck.4	P53634	OTTHUMG00000167290	ENST00000227266.5:c.347C>G	chr11.hg19:g.88045694G>C	ENSP00000227266:p.Thr116Ser	316.0	0.0	.		283.0	119.0	.	NM_001814	A8K7V2|B5MDD5|Q2HIY8|Q53G93|Q71E75|Q71E76|Q7M4N9|Q7Z3G7|Q7Z5U7|Q8WY99|Q8WYA7|Q8WYA8	Missense_Mutation	SNP	ENST00000227266.5	hg19	CCDS8282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.162|0.162	-1.079798|-1.079798	0.01888|0.01888	.|.	.|.	ENSG00000109861|ENSG00000109861	ENST00000527018|ENST00000393302;ENST00000227266	.|D	.|0.84442	.|-1.85	5.97|5.97	4.11|4.11	0.48088|0.48088	.|Cathepsin C exclusion (1);	.|0.073747	.|0.85682	.|N	.|0.000000	T|T	0.48259|0.48259	0.1490|0.1490	N|N	0.00050|0.00050	-2.41|-2.41	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.54036|0.54036	-0.8353|-0.8353	5|9	.|.	.|.	.|.	.|.	12.6204|12.6204	0.56600|0.56600	0.1313:0.7414:0.1273:0.0|0.1313:0.7414:0.1273:0.0	.|.	.|116	.|P53634	.|CATC_HUMAN	V|S	73|99;116	.|ENSP00000227266:T116S	.|.	L|T	-|-	1|2	0|0	CTSC|CTSC	87685342|87685342	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.133000|0.133000	0.20885|0.20885	3.944000|3.944000	0.56629|0.56629	0.878000|0.878000	0.35920|0.35920	-0.783000|-0.783000	0.03347|0.03347	CTT|ACT	.	.	.	none		0.458	CTSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394019.2	NM_001814	
NELL2	4753	hgsc.bcm.edu	37	12	44915902	44915902	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:44915902G>C	ENST00000429094.2	-	18	2560	c.2056C>G	c.(2056-2058)Ctt>Gtt	p.L686V	NELL2_ENST00000551601.1_Missense_Mutation_p.L638V|NELL2_ENST00000549027.1_Missense_Mutation_p.L685V|NELL2_ENST00000437801.2_Missense_Mutation_p.L736V|NELL2_ENST00000395487.2_Missense_Mutation_p.L685V|NELL2_ENST00000452445.2_Missense_Mutation_p.L686V|NELL2_ENST00000333837.4_Missense_Mutation_p.L709V	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	686	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.L686I(1)|p.L736I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		CAGCAAAAAAGATCAACTGTG	0.428																																					p.L736V		Atlas-SNP	.											NELL2_ENST00000437801,rectum,carcinoma,0,2	NELL2	286	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2206G						PASS	.						122.0	111.0	115.0					12																	44915902		2203	4300	6503	SO:0001583	missense	4753	exon19			AAAAAAGATCAAC	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.2056C>G	chr12.hg19:g.44915902G>C	ENSP00000390680:p.Leu686Val	76.0	0.0	.		50.0	2.0	.	NM_001145107	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	hg19	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.224335	0.39300	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801	D;D;T;D;D;T;D	0.82433	-1.56;-1.54;-1.24;-1.54;-1.56;-1.49;-1.61	5.7	5.7	0.88788	von Willebrand factor, type C (2);	0.063717	0.64402	D	0.000004	T	0.74619	0.3740	L	0.39020	1.185	0.51012	D	0.999902	B;P;B;B;B	0.36282	0.355;0.546;0.165;0.038;0.296	B;B;B;B;B	0.35312	0.1;0.2;0.069;0.018;0.125	T	0.71269	-0.4643	10	0.17369	T	0.5	-14.6968	14.0416	0.64678	0.0717:0.0:0.9283:0.0	.	709;736;638;686;685	B7Z2U7;B7Z9U3;F8VVB6;Q99435;Q96JS2	.;.;.;NELL2_HUMAN;.	V	685;686;638;686;685;709;736	ENSP00000378866:L685V;ENSP00000390680:L686V;ENSP00000449332:L638V;ENSP00000394612:L686V;ENSP00000447927:L685V;ENSP00000327988:L709V;ENSP00000416341:L736V	ENSP00000327988:L709V	L	-	1	0	NELL2	43202169	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.482000	0.66833	2.683000	0.91414	0.650000	0.86243	CTT	.	.	.	none		0.428	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
DIP2B	57609	hgsc.bcm.edu	37	12	51102296	51102296	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:51102296C>A	ENST00000301180.5	+	22	2634	c.2600C>A	c.(2599-2601)cCt>cAt	p.P867H		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	867						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						GAACAAAGACCTGATGCTTCT	0.502																																					p.P867H		Atlas-SNP	.											.	DIP2B	167	.	0			c.C2600A						PASS	.						262.0	192.0	215.0					12																	51102296		2203	4300	6503	SO:0001583	missense	57609	exon22			AAAGACCTGATGC	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2600C>A	chr12.hg19:g.51102296C>A	ENSP00000301180:p.Pro867His	15.0	0.0	.		17.0	9.0	.	NM_173602	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	hg19	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337555	0.81911	.	.	ENSG00000066084	ENST00000301180	T	0.12465	2.68	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.44953	0.1318	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48581	-0.9023	10	0.66056	D	0.02	-15.6463	18.0462	0.89332	0.0:1.0:0.0:0.0	.	867	Q9P265	DIP2B_HUMAN	H	867	ENSP00000301180:P867H	ENSP00000301180:P867H	P	+	2	0	DIP2B	49388563	1.000000	0.71417	0.968000	0.41197	0.855000	0.48748	5.912000	0.69948	2.826000	0.97356	0.491000	0.48974	CCT	.	.	.	none		0.502	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
LETMD1	25875	hgsc.bcm.edu	37	12	51450186	51450186	+	Silent	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:51450186G>A	ENST00000262055.4	+	7	855	c.816G>A	c.(814-816)ttG>ttA	p.L272L	LETMD1_ENST00000418425.2_Silent_p.L285L|LETMD1_ENST00000380123.2_3'UTR|LETMD1_ENST00000548516.1_3'UTR|LETMD1_ENST00000550929.1_Silent_p.L216L|LETMD1_ENST00000552739.1_Silent_p.L155L|LETMD1_ENST00000547008.1_Silent_p.L148L	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	272	LETM1.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						CTCCCTTGTTGAGACATCGTT	0.493																																					p.L285L		Atlas-SNP	.											.	LETMD1	33	.	0			c.G855A						PASS	.						174.0	148.0	156.0					12																	51450186		2203	4300	6503	SO:0001819	synonymous_variant	25875	exon7			CTTGTTGAGACAT	AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.816G>A	chr12.hg19:g.51450186G>A		230.0	0.0	.		171.0	71.0	.	NM_001243689	A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Silent	SNP	ENST00000262055.4	hg19	CCDS8806.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347756	0.61183	.	.	ENSG00000050426	ENST00000553043	.	.	.	5.49	3.69	0.42338	.	.	.	.	.	T	0.47192	0.1432	.	.	.	0.80722	D	1	B;B	0.14438	0.01;0.001	B;B	0.14578	0.011;0.004	T	0.44345	-0.9334	7	0.87932	D	0	-8.0385	7.6315	0.28243	0.3175:0.0:0.6825:0.0	.	110;110	B7Z9A7;F8W6J0	.;.	K	41	.	ENSP00000369478:E110K	E	+	1	0	LETMD1	49736453	1.000000	0.71417	0.675000	0.29917	0.599000	0.36880	1.036000	0.30228	0.822000	0.34565	-0.137000	0.14449	GAG	.	.	.	none		0.493	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404710.1	NM_015416	
PTPN11	5781	hgsc.bcm.edu	37	12	112892458	112892458	+	Silent	SNP	T	T	C	rs78376169		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr12:112892458T>C	ENST00000351677.2	+	5	814	c.616T>C	c.(616-618)Ttg>Ctg	p.L206L	PTPN11_ENST00000392597.1_Silent_p.L206L	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	206	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.L206L(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGTGGAAACATTGGGTACAGT	0.373			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.L206L		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	PTPN11,NS,carcinoma,0,2	PTPN11	623	.	1	Substitution - coding silent(1)	stomach(1)	c.T616C						PASS	.						87.0	82.0	84.0					12																	112892458		2203	4300	6503	SO:0001819	synonymous_variant	5781	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GAAACATTGGGTA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.616T>C	chr12.hg19:g.112892458T>C		64.0	0.0	.		58.0	4.0	.	NM_080601	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	hg19	CCDS9163.1																																																																																			.	.	.	weak		0.373	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
TDRD3	81550	hgsc.bcm.edu	37	13	61034625	61034625	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr13:61034625G>A	ENST00000196169.3	+	4	813	c.25G>A	c.(25-27)Ggt>Agt	p.G9S	TDRD3_ENST00000535286.1_Missense_Mutation_p.G102S|TDRD3_ENST00000377894.2_Missense_Mutation_p.G9S|TDRD3_ENST00000463109.1_3'UTR|TDRD3_ENST00000377881.2_Missense_Mutation_p.G9S	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	9					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		GATGACTGATGGTCATATAAG	0.358																																					p.G102S	Colon(36;164 906 35820 50723)	Atlas-SNP	.											.	TDRD3	123	.	0			c.G304A						PASS	.						123.0	111.0	115.0					13																	61034625		2203	4300	6503	SO:0001583	missense	81550	exon4			ACTGATGGTCATA	AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.25G>A	chr13.hg19:g.61034625G>A	ENSP00000196169:p.Gly9Ser	89.0	0.0	.		111.0	23.0	.	NM_001146070	B2MWP9|Q53XA6|Q6P992	Missense_Mutation	SNP	ENST00000196169.3	hg19	CCDS9441.1	.	.	.	.	.	.	.	.	.	.	G	36	5.652402	0.96724	.	.	ENSG00000083544	ENST00000196169;ENST00000377881;ENST00000377894;ENST00000535286;ENST00000377882	D;D;D;D	0.99924	-7.4;-7.4;-7.4;-8.02	6.06	6.06	0.98353	.	0.048957	0.85682	N	0.000000	D	0.99937	0.9972	M	0.91920	3.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96414	0.9306	10	0.87932	D	0	-15.3725	20.6397	0.99537	0.0:0.0:1.0:0.0	.	102;9;9	Q9H7E2-3;Q9H7E2-2;Q9H7E2	.;.;TDRD3_HUMAN	S	9;9;9;102;9	ENSP00000196169:G9S;ENSP00000367113:G9S;ENSP00000367126:G9S;ENSP00000440190:G102S	ENSP00000196169:G9S	G	+	1	0	TDRD3	59932626	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.880000	0.98712	0.650000	0.86243	GGT	.	.	.	none		0.358	TDRD3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045175.2	NM_030794	
RALGAPA1	253959	hgsc.bcm.edu	37	14	36104756	36104756	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr14:36104756G>C	ENST00000389698.3	-	31	4597	c.4207C>G	c.(4207-4209)Cct>Gct	p.P1403A	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.P1416A|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.P1450A|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.P1403A	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1403	Minimal domain that binds to TCF3/E12. {ECO:0000250}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GTCTTTAGAGGTAAGGCCATG	0.363																																					p.P1403A		Atlas-SNP	.											.	RALGAPA1	289	.	0			c.C4207G						PASS	.						49.0	46.0	47.0					14																	36104756		2203	4296	6499	SO:0001583	missense	253959	exon31			TTAGAGGTAAGGC	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.4207C>G	chr14.hg19:g.36104756G>C	ENSP00000374348:p.Pro1403Ala	51.0	0.0	.		33.0	15.0	.	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	hg19	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520063	0.85495	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;1.52;-0.2;-0.2	5.41	5.41	0.78517	.	0.100260	0.64402	D	0.000001	T	0.81187	0.4770	M	0.81112	2.525	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;0.98;0.855	D;D;P;P	0.91635	0.999;0.999;0.885;0.667	T	0.81604	-0.0857	10	0.51188	T	0.08	-15.3316	19.5739	0.95434	0.0:0.0:1.0:0.0	.	1450;1416;1403;1403	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	A	1403;1403;1403;1450;41;1416;1450	ENSP00000374348:P1403A;ENSP00000302647:P1403A;ENSP00000258840:P1450A;ENSP00000451133:P41A;ENSP00000371803:P1416A;ENSP00000451877:P1450A	ENSP00000258840:P1450A	P	-	1	0	RALGAPA1	35174507	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.934000	0.92915	2.691000	0.91804	0.563000	0.77884	CCT	.	.	.	none		0.363	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
DUOXA2	405753	hgsc.bcm.edu	37	15	45410080	45410080	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr15:45410080C>A	ENST00000323030.5	+	6	1221	c.936C>A	c.(934-936)gaC>gaA	p.D312E	DUOXA1_ENST00000558996.1_3'UTR|DUOXA1_ENST00000559014.1_Intron|DUOXA1_ENST00000430224.2_Intron|DUOXA1_ENST00000267803.4_Intron	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	312					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		CTCTCCCAGACTTAAAATGTA	0.627											OREG0023102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D312E		Atlas-SNP	.											.	DUOXA2	38	.	0			c.C936A						PASS	.						56.0	67.0	63.0					15																	45410080		2198	4298	6496	SO:0001583	missense	405753	exon6			CCCAGACTTAAAA	BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.936C>A	chr15.hg19:g.45410080C>A	ENSP00000319705:p.Asp312Glu	140.0	0.0	.	931	113.0	48.0	.	NM_207581	B2RPI9|H0YNQ6	Missense_Mutation	SNP	ENST00000323030.5	hg19	CCDS10118.2	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747884	0.30955	.	.	ENSG00000140274	ENST00000323030	T	0.58060	0.36	4.74	1.8	0.24995	.	0.658067	0.14730	N	0.301826	T	0.27278	0.0669	N	0.08118	0	0.09310	N	0.999998	B	0.06786	0.001	B	0.08055	0.003	T	0.13737	-1.0498	10	0.44086	T	0.13	-18.3106	4.3109	0.10971	0.1793:0.6307:0.0:0.19	.	312	Q1HG44	DOXA2_HUMAN	E	312	ENSP00000319705:D312E	ENSP00000319705:D312E	D	+	3	2	DUOXA2	43197372	0.001000	0.12720	0.004000	0.12327	0.047000	0.14425	0.068000	0.14531	0.310000	0.22990	0.561000	0.74099	GAC	.	.	.	none		0.627	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254142.1	NM_207581	
MYO9A	4649	hgsc.bcm.edu	37	15	72172105	72172105	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr15:72172105T>C	ENST00000356056.5	-	30	6168	c.5696A>G	c.(5695-5697)gAa>gGa	p.E1899G	MYO9A_ENST00000444904.1_Missense_Mutation_p.E1880G|MYO9A_ENST00000424560.1_Missense_Mutation_p.E1970G|MYO9A_ENST00000564571.1_Missense_Mutation_p.E1899G	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1899	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CTGCCGAAATTCCTTCAGGGC	0.363																																					p.E1899G		Atlas-SNP	.											.	MYO9A	203	.	0			c.A5696G						PASS	.						108.0	106.0	107.0					15																	72172105		2199	4297	6496	SO:0001583	missense	4649	exon30			CGAAATTCCTTCA	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.5696A>G	chr15.hg19:g.72172105T>C	ENSP00000348349:p.Glu1899Gly	88.0	0.0	.		76.0	35.0	.	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	hg19	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.414821	0.83449	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	T;T;T	0.14893	2.47;2.47;2.47	4.73	4.73	0.59995	.	.	.	.	.	T	0.42899	0.1223	M	0.79258	2.445	0.58432	D	0.999997	D;D	0.89917	1.0;0.997	D;P	0.79108	0.992;0.848	T	0.43956	-0.9359	9	0.62326	D	0.03	.	14.5012	0.67722	0.0:0.0:0.0:1.0	.	1970;1899	B2RTY4-4;B2RTY4	.;MYO9A_HUMAN	G	1899;1970;1880	ENSP00000348349:E1899G;ENSP00000399162:E1970G;ENSP00000398250:E1880G	ENSP00000348349:E1899G	E	-	2	0	MYO9A	69959159	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.593000	0.82686	1.903000	0.55091	0.528000	0.53228	GAA	.	.	.	none		0.363	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
TMEM204	79652	hgsc.bcm.edu	37	16	1604905	1604905	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr16:1604905A>T	ENST00000566264.1	+	3	1262	c.559A>T	c.(559-561)Atc>Ttc	p.I187F	IFT140_ENST00000439987.2_Intron|TMEM204_ENST00000253934.5_Missense_Mutation_p.I187F|IFT140_ENST00000426508.2_Intron	NM_024600.5	NP_078876.2	Q9BSN7	TM204_HUMAN	transmembrane protein 204	187					lymph vessel development (GO:0001945)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to stress (GO:0006950)|smooth muscle cell differentiation (GO:0051145)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|cervix(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Hepatocellular(780;0.219)				AGCCATGCTCATCTGGAACAT	0.597																																					p.I187F		Atlas-SNP	.											.	TMEM204	29	.	0			c.A559T						PASS	.						57.0	62.0	60.0					16																	1604905		2025	4177	6202	SO:0001583	missense	79652	exon3			ATGCTCATCTGGA		CCDS42098.1	16p13.3	2008-02-05	2008-01-08	2008-01-08		ENSG00000131634			14158	protein-coding gene	gene with protein product		611002	"""chromosome 16 open reading frame 30"""	C16orf30			Standard	NM_024600		Approved	FLJ20898	uc002cmc.3	Q9BSN7		ENST00000566264.1:c.559A>T	chr16.hg19:g.1604905A>T	ENSP00000454945:p.Ile187Phe	74.0	0.0	.		85.0	23.0	.	NM_024600	D3DU76|Q3KRC1|Q9H7G5	Missense_Mutation	SNP	ENST00000566264.1	hg19	CCDS42098.1	.	.	.	.	.	.	.	.	.	.	a	19.43	3.826453	0.71143	.	.	ENSG00000131634	ENST00000253934	T	0.56275	0.47	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.63212	0.2492	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66925	-0.5800	10	0.87932	D	0	-17.5451	16.269	0.82606	1.0:0.0:0.0:0.0	.	187	Q9BSN7	TM204_HUMAN	F	187	ENSP00000253934:I187F	ENSP00000253934:I187F	I	+	1	0	TMEM204	1544906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.882000	0.92420	2.241000	0.73720	0.529000	0.55759	ATC	.	.	.	none		0.597	TMEM204-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432610.1	NM_024600	
SCNN1B	6338	hgsc.bcm.edu	37	16	23387095	23387095	+	Missense_Mutation	SNP	C	C	T	rs372303239		TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr16:23387095C>T	ENST00000343070.2	+	8	1365	c.1189C>T	c.(1189-1191)Cgt>Tgt	p.R397C	SCNN1B_ENST00000568085.1_Missense_Mutation_p.R361C|SCNN1B_ENST00000568923.1_Missense_Mutation_p.R370C|SCNN1B_ENST00000307331.5_Missense_Mutation_p.R442C	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	397					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	CCACATGATCCGTAACTGCAA	0.597																																					p.R397C		Atlas-SNP	.											.	SCNN1B	81	.	0			c.C1189T						PASS	.		CYS/ARG	1,4393	2.1+/-5.4	0,1,2196	191.0	152.0	165.0		1189	2.5	0.7	16		165	0,8600		0,0,4300	no	missense	SCNN1B	NM_000336.2	180	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	possibly-damaging	397/641	23387095	1,12993	2197	4300	6497	SO:0001583	missense	6338	exon8			ATGATCCGTAACT	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.1189C>T	chr16.hg19:g.23387095C>T	ENSP00000345751:p.Arg397Cys	124.0	0.0	.		179.0	42.0	.	NM_000336	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	hg19	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	c	11.77	1.739120	0.30774	2.28E-4	0.0	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.64618	-0.11;-0.11	4.65	2.53	0.30540	Na+ channel, amiloride-sensitive, conserved site (1);	1.865040	0.02752	N	0.117609	T	0.67832	0.2935	L	0.48642	1.525	0.09310	N	1	P	0.36171	0.541	P	0.46275	0.51	T	0.58031	-0.7708	10	0.87932	D	0	-11.3583	9.6889	0.40116	0.0:0.7032:0.2048:0.0921	.	397	P51168	SCNNB_HUMAN	C	397;442	ENSP00000345751:R397C;ENSP00000302874:R442C	ENSP00000302874:R442C	R	+	1	0	SCNN1B	23294596	0.007000	0.16637	0.690000	0.30148	0.144000	0.21451	1.280000	0.33202	1.065000	0.40693	0.651000	0.88453	CGT	.	.	.	weak		0.597	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
ELMO3	79767	hgsc.bcm.edu	37	16	67236622	67236622	+	Silent	SNP	T	T	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr16:67236622T>A	ENST00000360833.1	+	14	1656	c.1599T>A	c.(1597-1599)acT>acA	p.T533T	ELMO3_ENST00000477898.1_Silent_p.T384T|MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000393997.2_Silent_p.T550T			Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	497					apoptotic process (GO:0006915)|phagocytosis (GO:0006909)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				cervix(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		ATGCGCTCACTTATGGGGAGG	0.647																																					p.T550T		Atlas-SNP	.											.	ELMO3	41	.	0			c.T1650A						PASS	.						42.0	49.0	46.0					16																	67236622		2076	4215	6291	SO:0001819	synonymous_variant	79767	exon15			GCTCACTTATGGG		CCDS10833.2	16q22.1	2010-03-18	2006-01-20		ENSG00000102890	ENSG00000102890		"""Engulfment and cell motility proteins"""	17289	protein-coding gene	gene with protein product		606422	"""engulfment and cell motility 3 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_024712		Approved	FLJ13824, CED12, ELMO-3, CED-12	uc002esa.3	Q96BJ8	OTTHUMG00000133570	ENST00000360833.1:c.1599T>A	chr16.hg19:g.67236622T>A		91.0	0.0	.		69.0	44.0	.	NM_024712	B4DV86|Q9H8A5	Silent	SNP	ENST00000360833.1	hg19																																																																																				.	.	.	none		0.647	ELMO3-001	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000257667.2	NM_024712	
TEKT1	83659	hgsc.bcm.edu	37	17	6703554	6703554	+	Splice_Site	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:6703554C>A	ENST00000338694.2	-	8	1179		c.e8-1		TEKT1_ENST00000535086.1_Splice_Site	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1							cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				TTCCTTCAATCTAGGAGAAAG	0.463																																					.		Atlas-SNP	.											.	TEKT1	49	.	0			c.1050-1G>T						PASS	.						55.0	53.0	53.0					17																	6703554		2203	4300	6503	SO:0001630	splice_region_variant	83659	exon9			TTCAATCTAGGAG		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.1050-1G>T	chr17.hg19:g.6703554C>A		82.0	0.0	.		101.0	29.0	.	NM_053285	D3DTM7	Splice_Site	SNP	ENST00000338694.2	hg19	CCDS11083.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.558722	0.45590	.	.	ENSG00000167858	ENST00000338694;ENST00000535086	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8163	0.88635	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TEKT1	6644278	1.000000	0.71417	0.148000	0.22405	0.065000	0.16274	5.783000	0.68982	2.885000	0.99019	0.655000	0.94253	.	.	.	.	none		0.463	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285	Intron
RAI1	10743	hgsc.bcm.edu	37	17	17701717	17701717	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:17701717G>A	ENST00000353383.1	+	3	5924	c.5455G>A	c.(5455-5457)Gcc>Acc	p.A1819T	RAI1_ENST00000261641.6_Intron	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1819					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CGGCGGGGAGGCCCAGGAGCA	0.692																																					p.A1819T		Atlas-SNP	.											.	RAI1	121	.	0			c.G5455A						PASS	.						15.0	17.0	16.0					17																	17701717		2196	4296	6492	SO:0001583	missense	10743	exon3			GGGGAGGCCCAGG	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.5455G>A	chr17.hg19:g.17701717G>A	ENSP00000323074:p.Ala1819Thr	37.0	0.0	.		26.0	17.0	.	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	hg19	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	G	3.249	-0.153699	0.06585	.	.	ENSG00000108557	ENST00000353383;ENST00000395776	T	0.65364	-0.15	4.42	0.819	0.18785	.	0.164676	0.41605	N	0.000849	T	0.24928	0.0605	N	0.01576	-0.805	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04900	-1.0919	10	0.09843	T	0.71	.	5.4772	0.16702	0.6904:0.146:0.1635:0.0	.	1819	Q7Z5J4	RAI1_HUMAN	T	1819	ENSP00000323074:A1819T	ENSP00000323074:A1819T	A	+	1	0	RAI1	17642442	1.000000	0.71417	0.989000	0.46669	0.093000	0.18481	3.093000	0.50217	-0.047000	0.13423	-0.367000	0.07326	GCC	.	.	.	none		0.692	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
ALDH3A2	224	hgsc.bcm.edu	37	17	19566808	19566808	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:19566808A>G	ENST00000176643.6	+	7	1549	c.1103A>G	c.(1102-1104)cAt>cGt	p.H368R	SNORA31_ENST00000516540.1_RNA|ALDH3A2_ENST00000339618.4_Missense_Mutation_p.H368R|ALDH3A2_ENST00000581518.1_Missense_Mutation_p.H368R|ALDH3A2_ENST00000579855.1_Missense_Mutation_p.H368R|ALDH3A2_ENST00000395575.2_Missense_Mutation_p.H368R|ALDH3A2_ENST00000571163.1_Missense_Mutation_p.H41R			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	368					cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					TCGCATAACCATAAGGTAAGC	0.358																																					p.H368R		Atlas-SNP	.											.	ALDH3A2	41	.	0			c.A1103G						PASS	.						77.0	76.0	76.0					17																	19566808		2203	4300	6503	SO:0001583	missense	224	exon7			ATAACCATAAGGT	L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.1103A>G	chr17.hg19:g.19566808A>G	ENSP00000176643:p.His368Arg	78.0	0.0	.		82.0	37.0	.	NM_001031806	Q6I9T3|Q93011|Q96J37	Missense_Mutation	SNP	ENST00000176643.6	hg19	CCDS11210.1	.	.	.	.	.	.	.	.	.	.	A	6.134	0.392977	0.11638	.	.	ENSG00000072210	ENST00000176643;ENST00000395575;ENST00000339618	T;T;T	0.75367	-0.93;-0.93;-0.93	5.12	2.89	0.33648	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.561400	0.20786	N	0.085705	T	0.41581	0.1165	N	0.01003	-1.06	0.09310	N	0.99999	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.33163	-0.9879	10	0.33141	T	0.24	-1.3235	7.2008	0.25879	0.7763:0.147:0.0766:0.0	.	368;368	P51648;P51648-2	AL3A2_HUMAN;.	R	368	ENSP00000176643:H368R;ENSP00000378942:H368R;ENSP00000345774:H368R	ENSP00000176643:H368R	H	+	2	0	ALDH3A2	19507400	0.592000	0.26832	0.274000	0.24659	0.402000	0.30811	2.992000	0.49417	0.289000	0.22422	0.455000	0.32223	CAT	.	.	.	none		0.358	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132268.1		
TAF15	8148	hgsc.bcm.edu	37	17	34171754	34171754	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:34171754G>A	ENST00000588240.1	+	15	1566	c.1451G>A	c.(1450-1452)gGt>gAt	p.G484D	TAF15_ENST00000592237.1_Intron|TAF15_ENST00000311979.3_Missense_Mutation_p.G481D	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		ggagatcgaggtggctatgga	0.617			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																p.G484D		Atlas-SNP	.		Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	.	TAF15	46	.	0			c.G1451A						PASS	.						69.0	59.0	62.0					17																	34171754		2203	4300	6503	SO:0001583	missense	8148	exon15			ATCGAGGTGGCTA	U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.1451G>A	chr17.hg19:g.34171754G>A	ENSP00000466950:p.Gly484Asp	21.0	0.0	.		36.0	17.0	.	NM_139215	D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	ENST00000588240.1	hg19	CCDS32623.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613730	0.46631	.	.	ENSG00000172660	ENST00000311979;ENST00000536077	D	0.95171	-3.63	4.33	3.36	0.38483	.	.	.	.	.	D	0.88250	0.6386	N	0.22421	0.69	0.35491	D	0.798963	P;P	0.39282	0.536;0.666	B;B	0.35240	0.097;0.198	D	0.89286	0.3615	9	0.87932	D	0	.	9.8408	0.40998	0.1042:0.0:0.8958:0.0	.	484;481	Q92804;Q92804-2	RBP56_HUMAN;.	D	484;287	ENSP00000309558:G484D	ENSP00000309558:G484D	G	+	2	0	TAF15	31195867	0.956000	0.32656	0.753000	0.31225	0.954000	0.61252	3.509000	0.53386	0.943000	0.37553	0.467000	0.42956	GGT	.	.	.	none		0.617	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1	NM_139215	
HELZ	9931	hgsc.bcm.edu	37	17	65074431	65074431	+	Silent	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr17:65074431G>A	ENST00000358691.5	-	33	5932	c.5766C>T	c.(5764-5766)ctC>ctT	p.L1922L	HELZ_ENST00000580168.1_Silent_p.L1923L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1922						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GTTCCTGGAAGAGAGACAGAG	0.522																																					p.L1922L		Atlas-SNP	.											.	HELZ	160	.	0			c.C5766T						PASS	.						44.0	46.0	45.0					17																	65074431		1860	4094	5954	SO:0001819	synonymous_variant	9931	exon33			CTGGAAGAGAGAC	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.5766C>T	chr17.hg19:g.65074431G>A		128.0	0.0	.		124.0	35.0	.	NM_014877	I6L9H4	Silent	SNP	ENST00000358691.5	hg19	CCDS42374.1																																																																																			.	.	.	none		0.522	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
SMCHD1	23347	hgsc.bcm.edu	37	18	2718194	2718194	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr18:2718194C>T	ENST00000320876.6	+	18	2637	c.2299C>T	c.(2299-2301)Caa>Taa	p.Q767*	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Nonsense_Mutation_p.Q767*	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	767					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GCATATTAGTCAACATGGAGG	0.284																																					p.Q767X		Atlas-SNP	.											.	SMCHD1	88	.	0			c.C2299T						PASS	.						91.0	85.0	87.0					18																	2718194		1809	4065	5874	SO:0001587	stop_gained	23347	exon18			ATTAGTCAACATG	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.2299C>T	chr18.hg19:g.2718194C>T	ENSP00000326603:p.Gln767*	46.0	0.0	.		46.0	19.0	.	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Nonsense_Mutation	SNP	ENST00000320876.6	hg19	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313068	0.81358	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	.	.	.	5.62	5.62	0.85841	.	0.063495	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-12.072	19.6473	0.95784	0.0:1.0:0.0:0.0	.	.	.	.	X	767	.	ENSP00000261598:Q767X	Q	+	1	0	SMCHD1	2708194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.933000	0.70130	2.650000	0.89964	0.591000	0.81541	CAA	.	.	.	none		0.284	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
TCF4	6925	hgsc.bcm.edu	37	18	52921812	52921812	+	Silent	SNP	A	A	G			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr18:52921812A>G	ENST00000356073.4	-	15	1877	c.1266T>C	c.(1264-1266)atT>atC	p.I422I	TCF4_ENST00000568673.1_Silent_p.I398I|TCF4_ENST00000570287.2_Silent_p.I262I|TCF4_ENST00000561831.3_Silent_p.I262I|TCF4_ENST00000566279.1_Silent_p.I362I|TCF4_ENST00000398339.1_Silent_p.I524I|TCF4_ENST00000537578.1_Silent_p.I398I|TCF4_ENST00000567880.1_Silent_p.I362I|TCF4_ENST00000457482.3_Silent_p.I262I|TCF4_ENST00000561992.1_Silent_p.I292I|TCF4_ENST00000564403.2_Silent_p.I428I|TCF4_ENST00000564999.1_Silent_p.I422I|TCF4_ENST00000565018.2_Silent_p.I422I|TCF4_ENST00000570177.2_Silent_p.I292I|TCF4_ENST00000544241.2_Silent_p.I351I|TCF4_ENST00000563760.1_5'UTR|TCF4_ENST00000564228.1_Silent_p.I351I|TCF4_ENST00000566286.1_Silent_p.I419I|TCF4_ENST00000568740.1_Silent_p.I397I|TCF4_ENST00000537856.3_Silent_p.I292I|TCF4_ENST00000540999.1_Silent_p.I398I|TCF4_ENST00000543082.1_Silent_p.I380I|TCF4_ENST00000354452.3_Silent_p.I422I	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	422					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GAGAAGGTCCAATGATTCCAT	0.493																																					p.I524I		Atlas-SNP	.											.	TCF4	178	.	0			c.T1572C						PASS	.						118.0	106.0	110.0					18																	52921812		2203	4300	6503	SO:0001819	synonymous_variant	6925	exon16			AGGTCCAATGATT	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1266T>C	chr18.hg19:g.52921812A>G		52.0	0.0	.		53.0	22.0	.	NM_001243226	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Silent	SNP	ENST00000356073.4	hg19	CCDS11960.1																																																																																			.	.	.	none		0.493	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199	
MUC16	94025	hgsc.bcm.edu	37	19	9056220	9056220	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:9056220G>C	ENST00000397910.4	-	3	31429	c.31226C>G	c.(31225-31227)aCa>aGa	p.T10409R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10411	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACTTGTCACTGTTCCCAGCTC	0.473																																					p.T10409R		Atlas-SNP	.											.	MUC16	4315	.	0			c.C31226G						PASS	.						201.0	199.0	200.0					19																	9056220		2020	4181	6201	SO:0001583	missense	94025	exon3			GTCACTGTTCCCA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31226C>G	chr19.hg19:g.9056220G>C	ENSP00000381008:p.Thr10409Arg	268.0	0.0	.		246.0	94.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	7.773	0.707853	0.15239	.	.	ENSG00000181143	ENST00000397910	T	0.02525	4.26	3.94	-6.08	0.02151	.	.	.	.	.	T	0.01489	0.0048	N	0.19112	0.55	.	.	.	B	0.33044	0.395	B	0.27076	0.076	T	0.43798	-0.9369	8	0.87932	D	0	.	0.9223	0.01318	0.1739:0.2499:0.196:0.3802	.	10409	B5ME49	.	R	10409	ENSP00000381008:T10409R	ENSP00000381008:T10409R	T	-	2	0	MUC16	8917220	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.198000	0.01239	-1.038000	0.03279	-0.181000	0.13052	ACA	.	.	.	none		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CHERP	10523	hgsc.bcm.edu	37	19	16640580	16640580	+	Silent	SNP	T	T	C	rs528619775	byFrequency	TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:16640580T>C	ENST00000198939.6	-	8	1077	c.1041A>G	c.(1039-1041)caA>caG	p.Q347Q	CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000546361.2_Silent_p.Q336Q					calcium homeostasis endoplasmic reticulum protein									p.Q336Q(2)		endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						gctgctgctgttgctgctgct	0.667													T|||	23	0.00459265	0.0129	0.0043	5008	,	,		16097	0.001		0.001	False		,,,				2504	0.001				p.Q336Q		Atlas-SNP	.											CHERP,NS,carcinoma,0,2	CHERP	70	.	2	Substitution - coding silent(2)	lung(2)	c.A1008G						PASS	.						21.0	29.0	26.0					19																	16640580		2193	4293	6486	SO:0001819	synonymous_variant	10523	exon8			CTGCTGTTGCTGC	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.1041A>G	chr19.hg19:g.16640580T>C		36.0	1.0	.		38.0	2.0	.	NM_006387		Silent	SNP	ENST00000198939.6	hg19																																																																																				.	.	.	none		0.667	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000403372.1	NM_006387	
ZNF93	81931	hgsc.bcm.edu	37	19	20044771	20044771	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:20044771C>T	ENST00000343769.5	+	4	1035	c.1007C>T	c.(1006-1008)aCt>aTt	p.T336I	AC007204.2_ENST00000592245.1_lincRNA	NM_031218.3	NP_112495.2	P35789	ZNF93_HUMAN	zinc finger protein 93	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(2)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	24						AGAATTCATACTGGAGAGAAA	0.378																																					p.T336I		Atlas-SNP	.											.	ZNF93	81	.	0			c.C1007T						PASS	.						57.0	57.0	57.0					19																	20044771		2203	4300	6503	SO:0001583	missense	81931	exon4			TTCATACTGGAGA	M61873	CCDS32973.1	19p12	2014-02-12	2006-05-12		ENSG00000184635	ENSG00000184635		"""Zinc fingers, C2H2-type"", ""-"""	13169	protein-coding gene	gene with protein product		603975	"""zinc finger protein 505"", ""zinc finger protein 93 (HTF34)"""	ZNF505		8467795, 2023909	Standard	NM_031218		Approved	HPF34, TF34, FLJ12488	uc002non.3	P35789	OTTHUMG00000182371	ENST00000343769.5:c.1007C>T	chr19.hg19:g.20044771C>T	ENSP00000342002:p.Thr336Ile	53.0	0.0	.		53.0	21.0	.	NM_031218	A6NMY2|B9EGT2|Q8N8Q4|Q9H9X5|Q9Y2N8	Missense_Mutation	SNP	ENST00000343769.5	hg19	CCDS32973.1	.	.	.	.	.	.	.	.	.	.	c	17.57	3.422998	0.62733	.	.	ENSG00000184635	ENST00000343769;ENST00000427325	T	0.25749	1.78	0.85	0.85	0.18980	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46521	0.1397	M	0.77103	2.36	0.28256	N	0.925036	D	0.71674	0.998	D	0.76575	0.988	T	0.30208	-0.9986	9	0.87932	D	0	.	6.9971	0.24789	0.0:1.0:0.0:0.0	.	336	P35789	ZNF93_HUMAN	I	336	ENSP00000342002:T336I	ENSP00000342002:T336I	T	+	2	0	ZNF93	19905771	0.931000	0.31567	0.796000	0.32109	0.795000	0.44927	1.895000	0.39778	0.192000	0.20272	0.195000	0.17529	ACT	.	.	.	none		0.378	ZNF93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460808.2	NM_031218	
ZNF585A	199704	hgsc.bcm.edu	37	19	37642653	37642653	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr19:37642653C>A	ENST00000356958.4	-	5	2406	c.2148G>T	c.(2146-2148)aaG>aaT	p.K716N	ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000392157.2_Missense_Mutation_p.K661N|ZNF585A_ENST00000355533.2_Missense_Mutation_p.K353N|ZNF585A_ENST00000292841.5_Missense_Mutation_p.K661N			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	716					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACACGTAAGGCTTCTCTCCAG	0.453																																					p.K661N		Atlas-SNP	.											.	ZNF585A	117	.	0			c.G1983T						PASS	.						120.0	99.0	106.0					19																	37642653		2203	4300	6503	SO:0001583	missense	199704	exon6			GTAAGGCTTCTCT	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.2148G>T	chr19.hg19:g.37642653C>A	ENSP00000349440:p.Lys716Asn	153.0	0.0	.		106.0	46.0	.	NM_199126	Q8TE95|Q96MV3	Missense_Mutation	SNP	ENST00000356958.4	hg19		.	.	.	.	.	.	.	.	.	.	C	14.78	2.637787	0.47049	.	.	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157;ENST00000355533	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	3.05	-1.58	0.08479	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.194401	0.25332	N	0.031425	T	0.42177	0.1191	.	.	.	0.34425	D	0.697868	D	0.61080	0.989	D	0.71184	0.972	T	0.52852	-0.8520	9	0.87932	D	0	.	7.5181	0.27612	0.0:0.29:0.0:0.71	.	716	Q6P3V2	Z585A_HUMAN	N	716;661;661;353	ENSP00000349440:K716N;ENSP00000292841:K661N;ENSP00000375998:K661N;ENSP00000347724:K353N	ENSP00000292841:K661N	K	-	3	2	ZNF585A	42334493	0.000000	0.05858	0.987000	0.45799	0.987000	0.75469	-2.016000	0.01446	-0.115000	0.11915	-0.136000	0.14681	AAG	.	.	.	none		0.453	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	NM_152655	
SBF1	6305	hgsc.bcm.edu	37	22	50903300	50903300	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr22:50903300G>A	ENST00000390679.3	-	13	1563	c.1379C>T	c.(1378-1380)cCc>cTc	p.P460L	SBF1_ENST00000348911.6_Missense_Mutation_p.P461L|SBF1_ENST00000380817.3_Missense_Mutation_p.P460L			O95248	MTMR5_HUMAN	SET binding factor 1	460					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GACACGCTGGGGGTGGTTCTC	0.642																																					p.P460L		Atlas-SNP	.											.	SBF1	211	.	0			c.C1379T						PASS	.						46.0	51.0	49.0					22																	50903300		2127	4220	6347	SO:0001583	missense	6305	exon13			CGCTGGGGGTGGT	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.1379C>T	chr22.hg19:g.50903300G>A	ENSP00000375097:p.Pro460Leu	78.0	0.0	.		68.0	25.0	.	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	hg19		.	.	.	.	.	.	.	.	.	.	G	19.24	3.789727	0.70337	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	D;D;D	0.86769	-2.16;-2.16;-2.17	4.17	4.17	0.49024	.	0.269330	0.29767	N	0.011248	D	0.87822	0.6274	L	0.49126	1.545	0.58432	D	0.999996	B;P;D	0.56746	0.021;0.873;0.977	B;P;P	0.55923	0.029;0.466;0.787	D	0.86760	0.1966	10	0.44086	T	0.13	.	9.8481	0.41039	0.0:0.0:0.6463:0.3537	.	460;461;460	O95248;G5E933;O95248-4	MTMR5_HUMAN;.;.	L	460;461;471;470;460	ENSP00000370196:P460L;ENSP00000252027:P461L;ENSP00000375097:P460L	ENSP00000336522:P470L	P	-	2	0	SBF1	49250166	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.603000	0.54074	2.156000	0.67533	0.591000	0.81541	CCC	.	.	.	none		0.642	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
TTN	7273	hgsc.bcm.edu	37	2	179429832	179429834	+	In_Frame_Del	DEL	AAT	AAT	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	AAT	AAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr2:179429832_179429834delAAT	ENST00000591111.1	-	276	76326_76328	c.76102_76104delATT	c.(76102-76104)attdel	p.I25368del	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_In_Frame_Del_p.I18069del|TTN_ENST00000460472.2_In_Frame_Del_p.I17944del|TTN_ENST00000342992.6_In_Frame_Del_p.I24441del|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000589042.1_In_Frame_Del_p.I27009del|TTN_ENST00000342175.6_In_Frame_Del_p.I18136del			Q8WZ42	TITIN_HUMAN	titin	25368	Fibronectin type-III 84. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTCTCTACAATGTAGTTGCTT	0.443																																					p.27009_27010del		Atlas-INDEL	.											.	TTN	18412	.	0			c.81026_81028del						PASS	.																																			SO:0001651	inframe_deletion	7273	exon326			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76102_76104delATT	chr2.hg19:g.179429832_179429834delAAT	ENSP00000465570:p.Ile25368del	158.0	0.0	0		138.0	58.0	0.42029	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Del	DEL	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ADAM7	8756	hgsc.bcm.edu	37	8	24339727	24339728	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr8:24339727_24339728insTA	ENST00000175238.6	+	9	861_862	c.778_779insTA	c.(778-780)ctafs	p.L260fs	ADAM7_ENST00000380789.1_Frame_Shift_Ins_p.L260fs|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000520720.1_Frame_Shift_Ins_p.L32fs|RP11-624C23.1_ENST00000523578.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	260	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TAAAATAGAACTATATTCAAAT	0.307																																					p.L260fs		Atlas-INDEL	.											.	ADAM7	165	.	0			c.778_779insTA						PASS	.																																			SO:0001589	frameshift_variant	8756	exon9			.	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.781_782dupTA	chr8.hg19:g.24339730_24339731dupTA	ENSP00000175238:p.Leu260fs	57.0	0.0	0		101.0	27.0	0.267327	NM_003817	A8K8X7|O75959|Q6PEJ6	Frame_Shift_Ins	INS	ENST00000175238.6	hg19	CCDS6045.1																																																																																			.	.	.	none		0.307	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
ASNS	440	hgsc.bcm.edu	37	7	97482647	97482647	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr7:97482647delC	ENST00000394309.3	-	11	1761	c.1290delG	c.(1288-1290)ttgfs	p.L430fs	ASNS_ENST00000437628.1_Frame_Shift_Del_p.L347fs|ASNS_ENST00000444334.1_Frame_Shift_Del_p.L409fs|ASNS_ENST00000455086.1_Frame_Shift_Del_p.L347fs|ASNS_ENST00000394308.3_Frame_Shift_Del_p.L430fs|ASNS_ENST00000422745.1_Frame_Shift_Del_p.L409fs|ASNS_ENST00000175506.4_Frame_Shift_Del_p.L430fs	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	430	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GTGGCAGAGACAAGTAATAGG	0.343																																					p.S431fs	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	Atlas-INDEL	.											.	ASNS	97	.	0			c.1291delT						PASS	.						73.0	75.0	75.0					7																	97482647		2203	4300	6503	SO:0001589	frameshift_variant	440	exon11			.	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1290delG	chr7.hg19:g.97482647delC	ENSP00000377846:p.Leu430fs	72.0	0.0	0		109.0	25.0	0.229358	NM_001673	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Frame_Shift_Del	DEL	ENST00000394309.3	hg19	CCDS5652.1																																																																																			.	.	.	none		0.343	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
SMG5	23381	hgsc.bcm.edu	37	1	156221203	156221203	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr1:156221203delG	ENST00000361813.5	-	20	2963	c.2819delC	c.(2818-2820)gcafs	p.A940fs	SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	940	PINc.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CCAGGCATCTGCATCCTGCCT	0.552																																					p.A940fs		Atlas-INDEL	.											.	SMG5	98	.	0			c.2820delA						PASS	.						224.0	214.0	217.0					1																	156221203		2203	4300	6503	SO:0001589	frameshift_variant	23381	exon20			.	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2819delC	chr1.hg19:g.156221203delG	ENSP00000355261:p.Ala940fs	226.0	0.0	0		197.0	69.0	0.350254	NM_015327	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Frame_Shift_Del	DEL	ENST00000361813.5	hg19	CCDS1137.1																																																																																			.	.	.	none		0.552	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
AMPH	273	hgsc.bcm.edu	37	7	38431574	38431574	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr7:38431574delA	ENST00000356264.2	-	19	1868	c.1653delT	c.(1651-1653)catfs	p.H551fs	AMPH_ENST00000325590.5_Frame_Shift_Del_p.H509fs|AMPH_ENST00000471913.1_5'Flank|AMPH_ENST00000428293.2_Frame_Shift_Del_p.H509fs	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	551					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						CTTCCTCTTCATGGTTGGAGG	0.587																																					p.E552fs		Atlas-INDEL	.											.	AMPH	157	.	0			c.1654delG						PASS	.						66.0	65.0	66.0					7																	38431574		2203	4300	6503	SO:0001589	frameshift_variant	273	exon19			.		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1653delT	chr7.hg19:g.38431574delA	ENSP00000348602:p.His551fs	85.0	0.0	0		90.0	55.0	0.611111	NM_001635	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Frame_Shift_Del	DEL	ENST00000356264.2	hg19	CCDS5456.1																																																																																			.	.	.	none		0.587	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
SUPT16H	11198	hgsc.bcm.edu	37	14	21821646	21821648	+	Splice_Site	DEL	CCT	CCT	-			TCGA-A4-8630-01A-11D-2396-08	TCGA-A4-8630-10A-01D-2396-08	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80f06506-7e60-402b-8286-dca976db7c76	72b037be-7e9f-4a16-8d05-ee2a4a58247d	g.chr14:21821646_21821648delCCT	ENST00000216297.2	-	25	3335_3337	c.2997_2999delAGG	c.(2995-3000)aaaggg>aag	p.G1000del		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	1000	Glu-rich (acidic).				DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TTTTTAAAAACCTTTTCGGGCTT	0.34																																					p.1000_1000del		Atlas-INDEL	.											.	SUPT16H	84	.	0			c.2998_2998del						PASS	.																																			SO:0001630	splice_region_variant	11198	exon25			.	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.2998+1AGG>-	chr14.hg19:g.21821646_21821648delCCT		109.0	0.0	0		62.0	24.0	0.387097	NM_007192	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Frame_Shift_Del	DEL	ENST00000216297.2	hg19	CCDS9569.1																																																																																			.	.	.	none		0.340	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074025.2		In_Frame_Del
