#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R1	80835	hgsc.bcm.edu	37	1	6639633	6639633	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:6639633G>A	ENST00000333172.6	+	6	2708	c.2515G>A	c.(2515-2517)Ggc>Agc	p.G839S	TAS1R1_ENST00000328191.4_3'UTR|TAS1R1_ENST00000351136.3_Missense_Mutation_p.G585S|ZBTB48_ENST00000377674.4_5'Flank	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	839					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GAGGCGCTGCGGCTCCACCTG	0.632																																					p.G839S		Atlas-SNP	.											.	TAS1R1	76	.	0			c.G2515A						PASS	.						41.0	41.0	41.0					1																	6639633		2203	4299	6502	SO:0001583	missense	80835	exon6			CGCTGCGGCTCCA		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.2515G>A	chr1.hg19:g.6639633G>A	ENSP00000331867:p.Gly839Ser	32.0	0.0	.		32.0	12.0	.	NM_138697	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Missense_Mutation	SNP	ENST00000333172.6	hg19	CCDS81.1	.	.	.	.	.	.	.	.	.	.	G	2.898	-0.228154	0.06022	.	.	ENSG00000173662	ENST00000333172;ENST00000351136	D;D	0.90900	-2.37;-2.75	5.18	-0.747	0.11091	.	0.840078	0.10725	N	0.641242	T	0.80188	0.4577	N	0.22421	0.69	0.18873	N	0.999982	B;B	0.18310	0.027;0.003	B;B	0.12156	0.007;0.004	T	0.64050	-0.6498	10	0.25751	T	0.34	.	5.538	0.17021	0.3891:0.1411:0.4698:0.0	.	585;839	Q7RTX1-2;Q7RTX1	.;TS1R1_HUMAN	S	839;585	ENSP00000331867:G839S;ENSP00000312558:G585S	ENSP00000331867:G839S	G	+	1	0	TAS1R1	6562220	0.000000	0.05858	0.059000	0.19551	0.071000	0.16799	-0.005000	0.12855	-0.027000	0.13873	-0.216000	0.12614	GGC	.	.	.	none		0.632	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
HIVEP3	59269	hgsc.bcm.edu	37	1	41978641	41978641	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:41978641G>A	ENST00000372583.1	-	8	7136	c.6251C>T	c.(6250-6252)gCg>gTg	p.A2084V	HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000372584.1_Missense_Mutation_p.A2084V|HIVEP3_ENST00000247584.5_Missense_Mutation_p.A2084V|HIVEP3_ENST00000429157.2_Missense_Mutation_p.A2084V	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2084	6 X 4 AA tandem repeats of S-P-X-[RK].				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CCCTGGCGGCGCTGACCGTGG	0.701																																					p.A2084V		Atlas-SNP	.											.	HIVEP3	235	.	0			c.C6251T						PASS	.						25.0	23.0	23.0					1																	41978641		2203	4299	6502	SO:0001583	missense	59269	exon8			GGCGGCGCTGACC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.6251C>T	chr1.hg19:g.41978641G>A	ENSP00000361664:p.Ala2084Val	59.0	0.0	.		98.0	4.0	.	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	hg19	CCDS463.1	.	.	.	.	.	.	.	.	.	.	G	11.10	1.539774	0.27563	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.05258	3.5;3.47;3.47;3.5	4.65	-2.36	0.06663	.	0.979219	0.08323	N	0.963534	T	0.02571	0.0078	N	0.12182	0.205	0.21416	N	0.999695	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.001	T	0.45644	-0.9247	10	0.02654	T	1	-1.2588	4.8403	0.13487	0.3916:0.0:0.4715:0.1369	.	2084;2084	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	V	2084	ENSP00000361665:A2084V;ENSP00000361664:A2084V;ENSP00000247584:A2084V;ENSP00000410828:A2084V	ENSP00000247584:A2084V	A	-	2	0	HIVEP3	41751228	0.084000	0.21492	0.951000	0.38953	0.992000	0.81027	0.117000	0.15583	-0.322000	0.08615	0.655000	0.94253	GCG	.	.	.	none		0.701	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
RORC	6097	hgsc.bcm.edu	37	1	151785765	151785765	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:151785765G>A	ENST00000318247.6	-	8	1231	c.1124C>T	c.(1123-1125)aCg>aTg	p.T375M	RORC_ENST00000480719.1_5'UTR|RORC_ENST00000356728.6_Missense_Mutation_p.T354M|RORC_ENST00000392697.3_Missense_Mutation_p.T429M	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	375	Ligand-binding.				adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAAAAAGACCGTGCGGTTGTC	0.557																																					p.T375M		Atlas-SNP	.											.	RORC	70	.	0			c.C1124T						PASS	.						236.0	234.0	235.0					1																	151785765		2203	4300	6503	SO:0001583	missense	6097	exon8			AAGACCGTGCGGT	U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.1124C>T	chr1.hg19:g.151785765G>A	ENSP00000327025:p.Thr375Met	79.0	0.0	.		97.0	41.0	.	NM_005060	Q5SZR9|Q8N5V7|Q8NCY8	Missense_Mutation	SNP	ENST00000318247.6	hg19	CCDS1004.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.478730	0.84747	.	.	ENSG00000143365	ENST00000356728;ENST00000392697;ENST00000318247	D;D;D	0.96427	-4.01;-4.01;-4.01	4.62	4.62	0.57501	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.64402	U	0.000012	D	0.97532	0.9192	M	0.71920	2.185	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.98360	1.0548	10	0.87932	D	0	.	16.1933	0.82006	0.0:0.0:1.0:0.0	.	375;429;375;354	B6ZGS6;B4DPR1;P51449;F1D8P6	.;.;RORG_HUMAN;.	M	354;429;375	ENSP00000349164:T354M;ENSP00000376461:T429M;ENSP00000327025:T375M	ENSP00000327025:T375M	T	-	2	0	RORC	150052389	1.000000	0.71417	0.997000	0.53966	0.914000	0.54420	9.469000	0.97679	2.391000	0.81399	0.563000	0.77884	ACG	.	.	.	none		0.557	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036626.1		
FASLG	356	hgsc.bcm.edu	37	1	172634980	172634980	+	Missense_Mutation	SNP	A	A	G	rs111238176		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:172634980A>G	ENST00000367721.2	+	4	854	c.670A>G	c.(670-672)Atg>Gtg	p.M224V	FASLG_ENST00000340030.3_3'UTR	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	224					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						GGATCTGGTGATGATGGAGGG	0.507																																					p.M224V	Ovarian(28;486 876 30334 44033)	Atlas-SNP	.											.	FASLG	44	.	0			c.A670G						PASS	.						107.0	102.0	104.0					1																	172634980		2203	4300	6503	SO:0001583	missense	356	exon4			CTGGTGATGATGG	U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.670A>G	chr1.hg19:g.172634980A>G	ENSP00000356694:p.Met224Val	94.0	0.0	.		103.0	46.0	.	NM_000639	Q9BZP9	Missense_Mutation	SNP	ENST00000367721.2	hg19	CCDS1304.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.431408	0.43122	.	.	ENSG00000117560	ENST00000367721	D	0.94457	-3.43	5.34	4.41	0.53225	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.257132	0.32624	N	0.005854	T	0.78033	0.4220	N	0.02539	-0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.75068	-0.3448	10	0.66056	D	0.02	-4.9683	13.2687	0.60150	0.1797:0.8202:0.0:0.0	.	224	P48023	TNFL6_HUMAN	V	224	ENSP00000356694:M224V	ENSP00000356694:M224V	M	+	1	0	FASLG	170901603	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	0.680000	0.25306	1.203000	0.43233	0.528000	0.53228	ATG	.	A|0.500;G|0.500	0.500	weak		0.507	FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084276.1		
PIGR	5284	hgsc.bcm.edu	37	1	207112530	207112530	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:207112530A>G	ENST00000356495.4	-	3	505	c.322T>C	c.(322-324)Tac>Cac	p.Y108H		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	108	Ig-like V-type 1.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCACACTTGTAGCGCCCGGAG	0.577																																					p.Y108H		Atlas-SNP	.											.	PIGR	98	.	0			c.T322C						PASS	.						75.0	64.0	68.0					1																	207112530		2203	4300	6503	SO:0001583	missense	5284	exon3			ACTTGTAGCGCCC		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.322T>C	chr1.hg19:g.207112530A>G	ENSP00000348888:p.Tyr108His	149.0	0.0	.		158.0	56.0	.	NM_002644	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	hg19	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.035080	0.75617	.	.	ENSG00000162896	ENST00000356495	D	0.94537	-3.45	5.67	5.67	0.87782	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000008	D	0.97939	0.9322	H	0.95004	3.61	0.44890	D	0.997906	D	0.89917	1.0	D	0.97110	1.0	D	0.98953	1.0795	10	0.87932	D	0	-20.6353	13.9439	0.64073	1.0:0.0:0.0:0.0	.	108	P01833	PIGR_HUMAN	H	108	ENSP00000348888:Y108H	ENSP00000348888:Y108H	Y	-	1	0	PIGR	205179153	1.000000	0.71417	0.979000	0.43373	0.686000	0.39977	5.514000	0.67043	2.288000	0.76882	0.533000	0.62120	TAC	.	.	.	none		0.577	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
PPM1B	5495	hgsc.bcm.edu	37	2	44457731	44457731	+	Silent	SNP	T	T	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr2:44457731T>C	ENST00000282412.4	+	6	1726	c.1314T>C	c.(1312-1314)tcT>tcC	p.S438S	PPM1B_ENST00000345249.4_Silent_p.S151S|PPM1B_ENST00000378551.2_Intron|PPM1B_ENST00000378540.4_Intron|PPM1B_ENST00000409432.3_3'UTR	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	438					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CAGCTACTTCTTCGAACAGTG	0.473																																					p.S438S		Atlas-SNP	.											.	PPM1B	97	.	0			c.T1314C						PASS	.						76.0	74.0	75.0					2																	44457731		2203	4300	6503	SO:0001819	synonymous_variant	5495	exon6			TACTTCTTCGAAC	AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.1314T>C	chr2.hg19:g.44457731T>C		150.0	0.0	.		197.0	131.0	.	NM_002706	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Silent	SNP	ENST00000282412.4	hg19	CCDS1817.1																																																																																			.	.	.	none		0.473	PPM1B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250672.1	NM_002706	
PRKCE	5581	hgsc.bcm.edu	37	2	45879246	45879246	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr2:45879246G>C	ENST00000306156.3	+	1	334	c.7G>C	c.(7-9)Gtg>Ctg	p.V3L		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	3	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	GACCATGGTAGTGTTCAATGG	0.652																																					p.V3L		Atlas-SNP	.											.	PRKCE	58	.	0			c.G7C						PASS	.						31.0	36.0	35.0					2																	45879246		2196	4297	6493	SO:0001583	missense	5581	exon1			ATGGTAGTGTTCA		CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.7G>C	chr2.hg19:g.45879246G>C	ENSP00000306124:p.Val3Leu	33.0	0.0	.		55.0	28.0	.	NM_005400	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	ENST00000306156.3	hg19	CCDS1824.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.565679	0.65651	.	.	ENSG00000171132	ENST00000421201;ENST00000306156	T;T	0.08458	3.09;3.09	4.71	4.71	0.59529	C2 membrane targeting protein (1);C2 calcium/lipid-binding domain, CaLB (1);	0.080242	0.47852	D	0.000211	T	0.09202	0.0227	L	0.40543	1.245	0.80722	D	1	B	0.13145	0.007	B	0.09377	0.004	T	0.19192	-1.0313	10	0.20519	T	0.43	.	17.673	0.88224	0.0:0.0:1.0:0.0	.	3	Q02156	KPCE_HUMAN	L	3	ENSP00000394574:V3L;ENSP00000306124:V3L	ENSP00000306124:V3L	V	+	1	0	PRKCE	45732750	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.766000	0.98957	2.152000	0.67230	0.561000	0.74099	GTG	.	.	.	none		0.652	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2		
ABCA12	26154	hgsc.bcm.edu	37	2	215865727	215865727	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr2:215865727G>C	ENST00000272895.7	-	22	3100	c.2881C>G	c.(2881-2883)Cct>Gct	p.P961A	ABCA12_ENST00000389661.4_Missense_Mutation_p.P643A	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	961					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTGTTAGAAGGAAGCTTAAAA	0.403																																					p.P961A	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.C2881G						PASS	.						55.0	58.0	57.0					2																	215865727		2202	4300	6502	SO:0001583	missense	26154	exon22			TAGAAGGAAGCTT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2881C>G	chr2.hg19:g.215865727G>C	ENSP00000272895:p.Pro961Ala	46.0	0.0	.		51.0	18.0	.	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749673	0.69533	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.86627	-2.15;-2.15	5.9	5.9	0.94986	.	0.627251	0.15788	N	0.244589	D	0.92221	0.7533	L	0.46947	1.48	0.80722	D	1	D;D	0.89917	1.0;0.984	D;P	0.87578	0.998;0.885	D	0.91505	0.5222	10	0.59425	D	0.04	.	20.2664	0.98460	0.0:0.0:1.0:0.0	.	961;643	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	A	961;643	ENSP00000272895:P961A;ENSP00000374312:P643A	ENSP00000272895:P961A	P	-	1	0	ABCA12	215573972	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.627000	0.67784	2.786000	0.95864	0.561000	0.74099	CCT	.	.	.	none		0.403	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
TNS1	7145	hgsc.bcm.edu	37	2	218713569	218713569	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr2:218713569C>G	ENST00000171887.4	-	17	1748	c.1296G>C	c.(1294-1296)ttG>ttC	p.L432F	TNS1_ENST00000430930.1_Missense_Mutation_p.L432F|TNS1_ENST00000419504.1_Missense_Mutation_p.L432F|TNS1_ENST00000480665.1_5'UTR	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	432					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CCTGGGGACTCAAGGCAGCAG	0.642																																					p.L432F		Atlas-SNP	.											.	TNS1	251	.	0			c.G1296C						PASS	.						64.0	67.0	66.0					2																	218713569		2203	4300	6503	SO:0001583	missense	7145	exon17			GGGACTCAAGGCA	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1296G>C	chr2.hg19:g.218713569C>G	ENSP00000171887:p.Leu432Phe	98.0	0.0	.		125.0	47.0	.	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	hg19	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.454564	0.43634	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903	D;D;D;D	0.95447	-3.48;-3.47;-3.49;-3.71	4.79	3.9	0.45041	.	0.172150	0.40469	N	0.001094	D	0.96929	0.8997	M	0.76328	2.33	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.996;1.0;0.999;0.999	D;D;D;D;D	0.85130	0.997;0.943;0.974;0.994;0.981	D	0.96213	0.9154	10	0.46703	T	0.11	.	10.7558	0.46237	0.0:0.8443:0.0:0.1557	.	432;486;432;432;432	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	F	432;432;432;557	ENSP00000171887:L432F;ENSP00000408724:L432F;ENSP00000406016:L432F;ENSP00000405460:L557F	ENSP00000171887:L432F	L	-	3	2	TNS1	218421814	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	1.405000	0.34635	1.227000	0.43598	0.561000	0.74099	TTG	.	.	.	none		0.642	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
NISCH	11188	hgsc.bcm.edu	37	3	52526011	52526011	+	Missense_Mutation	SNP	C	C	T	rs369447186		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr3:52526011C>T	ENST00000479054.1	+	22	4100	c.4028C>T	c.(4027-4029)cCa>cTa	p.P1343L	NISCH_ENST00000345716.4_Missense_Mutation_p.P1343L			Q9Y2I1	NISCH_HUMAN	nischarin	1343					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GAGAAGGCCCCAGCCCTCAGC	0.627																																					p.P1343L		Atlas-SNP	.											.	NISCH	97	.	0			c.C4028T						PASS	.	C	LEU/PRO	0,4406		0,0,2203	71.0	73.0	72.0		4028	4.7	0.1	3		72	2,8598	2.2+/-6.3	0,2,4298	no	missense	NISCH	NM_007184.3	98	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	1343/1505	52526011	2,13004	2203	4300	6503	SO:0001583	missense	11188	exon21			AGGCCCCAGCCCT	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.4028C>T	chr3.hg19:g.52526011C>T	ENSP00000418232:p.Pro1343Leu	107.0	0.0	.		137.0	36.0	.	NM_007184	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	hg19	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744827	0.49151	0.0	2.33E-4	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000414197	T;T	0.07908	3.15;3.15	5.6	4.7	0.59300	.	0.353140	0.30277	N	0.009998	T	0.07458	0.0188	N	0.24115	0.695	0.09310	N	0.999995	B	0.06786	0.001	B	0.09377	0.004	T	0.24728	-1.0152	10	0.62326	D	0.03	-9.2061	14.0883	0.64973	0.4654:0.5346:0.0:0.0	.	1343	Q9Y2I1	NISCH_HUMAN	L	1343;1343;267;687	ENSP00000418232:P1343L;ENSP00000339958:P1343L	ENSP00000339958:P1343L	P	+	2	0	NISCH	52501051	0.002000	0.14202	0.052000	0.19188	0.991000	0.79684	1.108000	0.31123	1.309000	0.44985	0.491000	0.48974	CCA	.	.	.	weak		0.627	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
IL6ST	3572	hgsc.bcm.edu	37	5	55237637	55237637	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr5:55237637T>A	ENST00000381298.2	-	17	2342	c.2030A>T	c.(2029-2031)aAt>aTt	p.N677I	IL6ST_ENST00000336909.5_Missense_Mutation_p.N677I|IL6ST_ENST00000381294.3_Missense_Mutation_p.N616I|IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000502326.3_Missense_Mutation_p.N677I|IL6ST_ENST00000536319.1_3'UTR|CTD-2031P19.5_ENST00000576302.1_RNA|IL6ST_ENST00000381286.3_Missense_Mutation_p.I53F|IL6ST_ENST00000381293.2_Missense_Mutation_p.I190F	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	677					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				ATCTTTTGAATTAAAATTGTG	0.343			O		hepatocellular ca																																p.N677I		Atlas-SNP	.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	75	.	0			c.A2030T						PASS	.						43.0	47.0	46.0					5																	55237637		2199	4298	6497	SO:0001583	missense	3572	exon17			TTTGAATTAAAAT	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.2030A>T	chr5.hg19:g.55237637T>A	ENSP00000370698:p.Asn677Ile	170.0	0.0	.		135.0	55.0	.	NM_002184	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	ENST00000381298.2	hg19	CCDS3971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.125|9.125	1.009945|1.009945	0.19277|0.19277	.|.	.|.	ENSG00000134352|ENSG00000134352	ENST00000381293;ENST00000381286|ENST00000381298;ENST00000336909;ENST00000381294	T;T|T;T;T	0.56611|0.40225	1.87;0.45|1.31;1.31;1.04	5.68|5.68	1.97|1.97	0.26223|0.26223	.|.	.|0.501171	.|0.23920	.|N	.|0.043246	T|T	0.37732|0.37732	0.1014|0.1014	N|N	0.19112|0.19112	0.55|0.55	0.41896|0.41896	D|D	0.990396|0.990396	P|P;D;P	0.39216|0.60160	0.664|0.822;0.987;0.822	B|B;P;P	0.36030|0.56216	0.216|0.406;0.794;0.534	T|T	0.03608|0.03608	-1.1020|-1.1020	9|10	0.87932|0.22706	D|T	0|0.39	.|.	11.3078|11.3078	0.49345|0.49345	0.0:0.2696:0.0:0.7304|0.0:0.2696:0.0:0.7304	.|.	190|677;616;677	Q5FC05|Q17RA0;Q5FC04;P40189	.|.;.;IL6RB_HUMAN	F|I	190;53|677;677;616	ENSP00000370693:I190F;ENSP00000370686:I53F|ENSP00000370698:N677I;ENSP00000338799:N677I;ENSP00000370694:N616I	ENSP00000370686:I53F|ENSP00000338799:N677I	I|N	-|-	1|2	0|0	IL6ST|IL6ST	55273394|55273394	0.905000|0.905000	0.30787|0.30787	0.932000|0.932000	0.37286|0.37286	0.603000|0.603000	0.37013|0.37013	0.092000|0.092000	0.15066|0.15066	-0.059000|-0.059000	0.13154|0.13154	-1.162000|-1.162000	0.01777|0.01777	ATT|AAT	.	.	.	none		0.343	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
FHL5	9457	hgsc.bcm.edu	37	6	97051597	97051597	+	Silent	SNP	A	A	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr6:97051597A>G	ENST00000326771.2	+	3	488	c.108A>G	c.(106-108)gtA>gtG	p.V36V	FHL5_ENST00000541107.1_Silent_p.V36V	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	36					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		ATGATCGTGTATTTTCTAACT	0.363																																					p.V36V		Atlas-SNP	.											FHL5,NS,carcinoma,+1,1	FHL5	73	.	0			c.A108G						PASS	.						166.0	146.0	153.0					6																	97051597		2203	4300	6503	SO:0001819	synonymous_variant	9457	exon3			TCGTGTATTTTCT	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.108A>G	chr6.hg19:g.97051597A>G		85.0	0.0	.		73.0	28.0	.	NM_020482	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Silent	SNP	ENST00000326771.2	hg19	CCDS5035.1																																																																																			.	.	.	none		0.363	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482	
ZMIZ2	83637	hgsc.bcm.edu	37	7	44796552	44796552	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr7:44796552G>A	ENST00000309315.4	+	4	295	c.172G>A	c.(172-174)Ggg>Agg	p.G58R	ZMIZ2_ENST00000413916.1_Intron|ZMIZ2_ENST00000441627.1_Missense_Mutation_p.G58R|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.G58R|ZMIZ2_ENST00000433667.1_Intron	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	58	Gly-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						ATAGGTTTTGGGGAACCCCAT	0.592																																					p.G58R	NSCLC(20;604 852 1948 16908 50522)	Atlas-SNP	.											.	ZMIZ2	82	.	0			c.G172A						PASS	.						112.0	114.0	113.0					7																	44796552		1971	4146	6117	SO:0001583	missense	83637	exon3			GTTTTGGGGAACC	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.172G>A	chr7.hg19:g.44796552G>A	ENSP00000311778:p.Gly58Arg	63.0	0.0	.		97.0	43.0	.	NM_174929	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	hg19	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707309	0.89018	.	.	ENSG00000122515	ENST00000457123;ENST00000309315;ENST00000441627;ENST00000265346;ENST00000414051	D;D;D;D	0.97731	-4.51;-4.51;-4.51;-4.51	4.8	4.8	0.61643	.	0.000000	0.56097	D	0.000030	D	0.98466	0.9489	M	0.71036	2.16	0.54753	D	0.999989	D;D	0.89917	0.999;1.0	D;D	0.79108	0.962;0.992	D	0.99771	1.1024	10	0.87932	D	0	-8.5125	17.6515	0.88165	0.0:0.0:1.0:0.0	.	58;58	Q8NF64-2;Q8NF64	.;ZMIZ2_HUMAN	R	58	ENSP00000415501:G58R;ENSP00000311778:G58R;ENSP00000414723:G58R;ENSP00000265346:G58R	ENSP00000265346:G58R	G	+	1	0	ZMIZ2	44763077	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.810000	0.91950	2.485000	0.83878	0.655000	0.94253	GGG	.	.	.	none		0.592	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
PON2	5445	hgsc.bcm.edu	37	7	95040981	95040981	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr7:95040981G>T	ENST00000222572.3	-	5	724	c.478C>A	c.(478-480)Cat>Aat	p.H160N	PON2_ENST00000483292.1_5'UTR|PON2_ENST00000433091.2_Missense_Mutation_p.H148N|PON2_ENST00000536183.1_Missense_Mutation_p.H181N			Q15165	PON2_HUMAN	paraoxonase 2	160					aromatic compound catabolic process (GO:0019439)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arylesterase activity (GO:0004064)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_cancers(62;9.35e-11)|all_epithelial(64;3.37e-09)		STAD - Stomach adenocarcinoma(171;0.0151)			AGAAGCTCATGTTTGACTGTT	0.358																																					p.H160N	GBM(42;803 823 13649 23368 31463)	Atlas-SNP	.											.	PON2	32	.	0			c.C478A						PASS	.						76.0	78.0	78.0					7																	95040981		2203	4300	6503	SO:0001583	missense	5445	exon5			GCTCATGTTTGAC	M63012, AF001601	CCDS5640.1, CCDS47644.1	7q21.3	2014-03-14			ENSG00000105854	ENSG00000105854	3.1.1.2	"""Paraoxonases"""	9205	protein-coding gene	gene with protein product	"""paraoxonase nirs"", ""arylesterase 2"""	602447				8661009, 9714608	Standard	XM_005250453		Approved		uc003unv.3	Q15165	OTTHUMG00000153948	ENST00000222572.3:c.478C>A	chr7.hg19:g.95040981G>T	ENSP00000222572:p.His160Asn	99.0	0.0	.		98.0	47.0	.	NM_000305	A4D1H7|B2RCP9|B4DJD5|O15114|O15115|O75856|Q5FBX7|Q86YL0	Missense_Mutation	SNP	ENST00000222572.3	hg19	CCDS5640.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921121	0.33908	.	.	ENSG00000105854	ENST00000536183;ENST00000355659;ENST00000433091;ENST00000222572	T;T;T	0.40476	2.34;1.03;2.34	4.94	3.1	0.35709	Six-bladed beta-propeller, TolB-like (1);	0.093511	0.85682	D	0.000000	T	0.60077	0.2241	M	0.83118	2.625	0.52501	D	0.999956	D;D	0.76494	0.998;0.999	D;D	0.69824	0.946;0.966	T	0.60944	-0.7162	10	0.14252	T	0.57	-9.4713	10.7179	0.46023	0.0717:0.132:0.7963:0.0	.	160;160	A4D1H7;Q15165	.;PON2_HUMAN	N	181;158;148;160	ENSP00000440282:H181N;ENSP00000404622:H148N;ENSP00000222572:H160N	ENSP00000222572:H160N	H	-	1	0	PON2	94878917	1.000000	0.71417	0.894000	0.35097	0.062000	0.15995	7.184000	0.77705	0.774000	0.33427	-0.157000	0.13467	CAT	.	.	.	none		0.358	PON2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333142.1	NM_000305	
PDP1	54704	hgsc.bcm.edu	37	8	94934633	94934633	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr8:94934633C>T	ENST00000297598.4	+	2	615	c.346C>T	c.(346-348)Cag>Tag	p.Q116*	PDP1_ENST00000517764.1_Nonsense_Mutation_p.Q116*|PDP1_ENST00000520728.1_Nonsense_Mutation_p.Q116*|PDP1_ENST00000396200.3_Nonsense_Mutation_p.Q141*	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	116				NVSSILGFDSNQ -> MSVLSLDLTAIK (in Ref. 1; AAF67480). {ECO:0000305}.	cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						TGACAGCAATCAGCTGCCTGC	0.463																																					p.Q141X		Atlas-SNP	.											.	PDP1	97	.	0			c.C421T						PASS	.						88.0	92.0	90.0					8																	94934633		2203	4300	6503	SO:0001587	stop_gained	54704	exon3			AGCAATCAGCTGC	AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.346C>T	chr8.hg19:g.94934633C>T	ENSP00000297598:p.Gln116*	95.0	0.0	.		81.0	37.0	.	NM_001161780	B3KX71|J3KPU0|Q5U5K1	Nonsense_Mutation	SNP	ENST00000297598.4	hg19	CCDS6259.1	.	.	.	.	.	.	.	.	.	.	C	33	5.196332	0.94960	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000518573;ENST00000517764;ENST00000518827;ENST00000521144	.	.	.	6.03	6.03	0.97812	.	0.120323	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-14.0857	20.5753	0.99366	0.0:1.0:0.0:0.0	.	.	.	.	X	116;116;141;116;116;116;116	.	ENSP00000297598:Q116X	Q	+	1	0	PDP1	95003809	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.792000	0.85828	2.868000	0.98415	0.557000	0.71058	CAG	.	.	.	none		0.463	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378415.2	NM_018444	
DDX50	79009	hgsc.bcm.edu	37	10	70670106	70670106	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr10:70670106C>A	ENST00000373585.3	+	3	535	c.428C>A	c.(427-429)cCt>cAt	p.P143H	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	143						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						TCCAATTTTCCTATTTCTGAA	0.378																																					p.P143H		Atlas-SNP	.											.	DDX50	65	.	0			c.C428A						PASS	.						129.0	133.0	132.0					10																	70670106		2203	4300	6503	SO:0001583	missense	79009	exon3			ATTTTCCTATTTC	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.428C>A	chr10.hg19:g.70670106C>A	ENSP00000362687:p.Pro143His	72.0	0.0	.		39.0	11.0	.	NM_024045	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	hg19	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489203	0.64074	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.21543	2.0	5.23	5.23	0.72850	RNA helicase, DEAD-box type, Q motif (1);	0.210307	0.43110	D	0.000611	T	0.19005	0.0456	L	0.32530	0.975	0.35802	D	0.82318	P;P	0.48016	0.904;0.604	B;B	0.42882	0.401;0.396	T	0.11891	-1.0569	10	0.48119	T	0.1	-3.6785	13.2098	0.59817	0.1588:0.8412:0.0:0.0	.	143;143	Q9BQ39;B4DED6	DDX50_HUMAN;.	H	143	ENSP00000362687:P143H	ENSP00000362687:P143H	P	+	2	0	DDX50	70340112	0.366000	0.25014	1.000000	0.80357	0.993000	0.82548	1.963000	0.40452	2.585000	0.87301	0.555000	0.69702	CCT	.	.	.	none		0.378	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
RBM20	282996	hgsc.bcm.edu	37	10	112540726	112540726	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr10:112540726T>C	ENST00000369519.3	+	2	417	c.359T>C	c.(358-360)cTg>cCg	p.L120P		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	120					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						GCCACAGTCCTGAACCAAGTC	0.612																																					p.L120P		Atlas-SNP	.											.	RBM20	50	.	0			c.T359C						PASS	.						67.0	79.0	76.0					10																	112540726		692	1591	2283	SO:0001583	missense	282996	exon2			CAGTCCTGAACCA	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.359T>C	chr10.hg19:g.112540726T>C	ENSP00000358532:p.Leu120Pro	90.0	0.0	.		87.0	30.0	.	NM_001134363	A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	hg19	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	T	19.03	3.747988	0.69533	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	D	0.96774	-4.12	5.85	4.71	0.59529	.	0.397222	0.23640	N	0.046035	D	0.91851	0.7421	L	0.29908	0.895	0.80722	D	1	P	0.38110	0.618	B	0.32211	0.142	D	0.90678	0.4603	10	0.87932	D	0	.	11.9472	0.52934	0.0:0.0678:0.0:0.9322	.	120	Q5T481	RBM20_HUMAN	P	120	ENSP00000358532:L120P	ENSP00000358532:L120P	L	+	2	0	RBM20	112530716	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.673000	0.83973	1.036000	0.39998	0.533000	0.62120	CTG	.	.	.	none		0.612	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
INCENP	3619	hgsc.bcm.edu	37	11	61897408	61897408	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr11:61897408G>A	ENST00000394818.3	+	4	611	c.409G>A	c.(409-411)Gca>Aca	p.A137T	INCENP_ENST00000278849.4_Missense_Mutation_p.A137T	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	137			A -> V (in dbSNP:rs34441559).		chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GGCTACCATGGCATTGGCTGC	0.627																																					p.A137T		Atlas-SNP	.											.	INCENP	122	.	0			c.G409A						PASS	.						60.0	60.0	60.0					11																	61897408		2201	4299	6500	SO:0001583	missense	3619	exon4			ACCATGGCATTGG	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.409G>A	chr11.hg19:g.61897408G>A	ENSP00000378295:p.Ala137Thr	77.0	0.0	.		72.0	29.0	.	NM_001040694	A8MQD2|Q5Y192	Missense_Mutation	SNP	ENST00000394818.3	hg19	CCDS44624.1	.	.	.	.	.	.	.	.	.	.	G	9.095	1.002664	0.19121	.	.	ENSG00000149503	ENST00000394818;ENST00000533896;ENST00000278849	T;T;T	0.23754	2.52;1.89;2.51	3.14	-3.13	0.05266	.	2.075460	0.02904	N	0.135798	T	0.13884	0.0336	N	0.22421	0.69	0.09310	N	1	B;B;B	0.11235	0.004;0.0;0.0	B;B;B	0.08055	0.003;0.002;0.001	T	0.14671	-1.0464	10	0.10636	T	0.68	.	4.1359	0.10170	0.3443:0.3363:0.3194:0.0	.	137;137;137	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	T	137	ENSP00000378295:A137T;ENSP00000433100:A137T;ENSP00000278849:A137T	ENSP00000278849:A137T	A	+	1	0	INCENP	61653984	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-0.779000	0.04659	-0.725000	0.04901	-0.459000	0.05422	GCA	.	.	.	none		0.627	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
ARHGAP42	143872	hgsc.bcm.edu	37	11	100641096	100641096	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr11:100641096A>T	ENST00000298815.8	+	2	180	c.177A>T	c.(175-177)aaA>aaT	p.K59N	ARHGAP42_ENST00000524892.2_Missense_Mutation_p.K59N|ARHGAP42_ENST00000534060.1_3'UTR	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	59	BAR.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						CAGTGCAGAAATTTTCCCAGT	0.343																																					p.K59N		Atlas-SNP	.											.	ARHGAP42	32	.	0			c.A177T						PASS	.						107.0	100.0	102.0					11																	100641096		692	1591	2283	SO:0001583	missense	143872	exon2			GCAGAAATTTTCC			11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.177A>T	chr11.hg19:g.100641096A>T	ENSP00000298815:p.Lys59Asn	61.0	0.0	.		47.0	22.0	.	NM_152432	Q96M56	Missense_Mutation	SNP	ENST00000298815.8	hg19		.	.	.	.	.	.	.	.	.	.	A	20.5	4.009102	0.75046	.	.	ENSG00000165895	ENST00000524892;ENST00000298815	T;T	0.33438	1.41;1.41	5.89	-0.0565	0.13805	IRSp53/MIM homology domain (IMD) (1);	0.000000	0.56097	U	0.000035	T	0.37865	0.1019	L	0.52364	1.645	0.53005	D	0.999963	P	0.46656	0.882	P	0.54759	0.76	T	0.08086	-1.0739	10	0.51188	T	0.08	.	10.5006	0.44804	0.4519:0.0:0.5481:0.0	.	59	A6NI28	RHG42_HUMAN	N	59	ENSP00000431776:K59N;ENSP00000298815:K59N	ENSP00000298815:K59N	K	+	3	2	ARHGAP42	100146306	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	2.099000	0.41767	-0.241000	0.09681	0.459000	0.35465	AAA	.	.	.	none		0.343	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152432	
GXYLT1	283464	hgsc.bcm.edu	37	12	42481670	42481670	+	Missense_Mutation	SNP	C	C	T	rs200973030		TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr12:42481670C>T	ENST00000398675.3	-	8	1473	c.1241G>A	c.(1240-1242)tGt>tAt	p.C414Y	GXYLT1_ENST00000280876.6_Missense_Mutation_p.C383Y	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	414					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						AATTTTTCCACAGTATGTATG	0.313																																					p.C414Y		Atlas-SNP	.											Q8IXV1_HUMAN,NS,carcinoma,-1,2	GXYLT1	47	.	0			c.G1241A						PASS	.						86.0	77.0	80.0					12																	42481670		1809	4072	5881	SO:0001583	missense	283464	exon8			TTTCCACAGTATG	BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.1241G>A	chr12.hg19:g.42481670C>T	ENSP00000381666:p.Cys414Tyr	50.0	1.0	.		40.0	3.0	.	NM_173601	B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	ENST00000398675.3	hg19	CCDS41772.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.903071	0.72754	.	.	ENSG00000151233	ENST00000398675;ENST00000280876	.	.	.	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.84083	0.5394	M	0.85197	2.74	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87025	0.2131	9	0.87932	D	0	-22.3783	18.4282	0.90615	0.0:1.0:0.0:0.0	.	383;414	Q4G148-2;Q4G148	.;GXLT1_HUMAN	Y	414;383	.	ENSP00000280876:C383Y	C	-	2	0	GXYLT1	40767937	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.785000	0.62418	2.435000	0.82474	0.655000	0.94253	TGT	.	.	.	weak		0.313	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403778.1	XM_290597	
SLC25A3	5250	hgsc.bcm.edu	37	12	98995295	98995295	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr12:98995295T>A	ENST00000228318.3	+	8	1198	c.1078T>A	c.(1078-1080)Tta>Ata	p.L360I	SLC25A3_ENST00000552981.1_Missense_Mutation_p.L359I|SLC25A3_ENST00000401722.3_Missense_Mutation_p.L359I|SLC25A3_ENST00000548847.1_Missense_Mutation_p.L322I|SNORA53_ENST00000391141.1_RNA|SLC25A3_ENST00000188376.5_Missense_Mutation_p.L359I|SLC25A3_ENST00000549338.1_Missense_Mutation_p.L359I|SLC25A3_ENST00000551917.1_Missense_Mutation_p.L360I	NM_005888.3	NP_005879.1	Q00325	MPCP_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3	360					generation of precursor metabolites and energy (GO:0006091)|phosphate ion transmembrane transport (GO:0035435)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	phosphate ion carrier activity (GO:0015320)|protein complex binding (GO:0032403)|symporter activity (GO:0015293)			breast(1)|endometrium(2)|large_intestine(4)|lung(8)|prostate(1)	16		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		GAAGCTTGGGTTAACTCAGTA	0.433																																					p.L360I		Atlas-SNP	.											.	SLC25A3	95	.	0			c.T1078A						PASS	.						83.0	79.0	80.0					12																	98995295		2203	4300	6503	SO:0001583	missense	5250	exon8			CTTGGGTTAACTC		CCDS9065.1, CCDS9066.1	12q23.1	2013-05-22			ENSG00000075415	ENSG00000075415		"""Solute carriers"""	10989	protein-coding gene	gene with protein product		600370		PHC		8168843	Standard	NM_213611		Approved		uc001tfo.3	Q00325	OTTHUMG00000170212	ENST00000228318.3:c.1078T>A	chr12.hg19:g.98995295T>A	ENSP00000228318:p.Leu360Ile	72.0	0.0	.		76.0	48.0	.	NM_005888	B3KS34|Q7Z7N7|Q96A03	Missense_Mutation	SNP	ENST00000228318.3	hg19	CCDS9066.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008501	0.75046	.	.	ENSG00000075415	ENST00000401722;ENST00000188376;ENST00000228318;ENST00000551917;ENST00000552981;ENST00000549338;ENST00000548847	T;T;T;T;T;T;T	0.78126	-1.15;-1.15;-0.89;-0.89;-1.15;-1.15;-1.13	5.48	3.14	0.36123	.	0.132239	0.49305	D	0.000142	T	0.72112	0.3420	N	0.17674	0.51	0.51012	D	0.999902	B;P;P;B	0.52842	0.135;0.956;0.598;0.135	B;D;B;B	0.65010	0.121;0.931;0.19;0.145	T	0.66324	-0.5952	10	0.09590	T	0.72	-0.9242	7.4149	0.27038	0.0:0.3411:0.0:0.6589	.	322;359;360;359	F8VVM2;B2RE88;Q00325;Q00325-2	.;.;MPCP_HUMAN;.	I	359;359;360;360;359;359;322	ENSP00000383898:L359I;ENSP00000188376:L359I;ENSP00000228318:L360I;ENSP00000447310:L360I;ENSP00000448708:L359I;ENSP00000447740:L359I;ENSP00000449166:L322I	ENSP00000188376:L359I	L	+	1	2	SLC25A3	97519426	0.996000	0.38824	1.000000	0.80357	0.956000	0.61745	0.932000	0.28884	1.022000	0.39626	0.533000	0.62120	TTA	.	.	.	none		0.433	SLC25A3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407989.1	NM_005888	
C12orf45	121053	hgsc.bcm.edu	37	12	105385505	105385505	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr12:105385505A>T	ENST00000552951.1	+	3	261	c.218A>T	c.(217-219)cAg>cTg	p.Q73L	C12orf45_ENST00000280749.5_Intron	NM_152318.2	NP_689531.2	Q8N5I9	CL045_HUMAN	chromosome 12 open reading frame 45	73										large_intestine(1)|lung(2)	3						GACCAGGTACAGACATTTCTC	0.398																																					p.Q73L		Atlas-SNP	.											.	C12orf45	14	.	0			c.A218T						PASS	.						98.0	91.0	93.0					12																	105385505		1855	4099	5954	SO:0001583	missense	121053	exon3			AGGTACAGACATT	BC032326	CCDS41825.1	12q23.3	2012-05-30			ENSG00000151131	ENSG00000151131			28628	protein-coding gene	gene with protein product						12477932	Standard	NM_152318		Approved	MGC40397	uc001tlb.3	Q8N5I9	OTTHUMG00000169822	ENST00000552951.1:c.218A>T	chr12.hg19:g.105385505A>T	ENSP00000447057:p.Gln73Leu	63.0	0.0	.		82.0	4.0	.	NM_152318		Missense_Mutation	SNP	ENST00000552951.1	hg19	CCDS41825.1	.	.	.	.	.	.	.	.	.	.	A	12.99	2.103577	0.37145	.	.	ENSG00000151131	ENST00000552951	T	0.37058	1.22	5.09	3.94	0.45596	.	0.176887	0.51477	D	0.000095	T	0.39517	0.1081	M	0.77820	2.39	0.43372	D	0.995466	P	0.37330	0.59	B	0.37943	0.261	T	0.32955	-0.9887	10	0.72032	D	0.01	.	8.5681	0.33552	0.9109:0.0:0.0891:0.0	.	73	Q8N5I9	CL045_HUMAN	L	73	ENSP00000447057:Q73L	ENSP00000447057:Q73L	Q	+	2	0	C12orf45	103909635	1.000000	0.71417	0.962000	0.40283	0.510000	0.34073	3.094000	0.50227	0.799000	0.34018	0.482000	0.46254	CAG	.	.	.	none		0.398	C12orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406076.1	NM_152318	
RPGRIP1	57096	hgsc.bcm.edu	37	14	21793036	21793036	+	Silent	SNP	C	C	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr14:21793036C>T	ENST00000400017.2	+	14	2022	c.2022C>T	c.(2020-2022)ccC>ccT	p.P674P	RPGRIP1_ENST00000206660.6_Silent_p.P674P|RPGRIP1_ENST00000382933.4_Intron|RPGRIP1_ENST00000307974.4_Silent_p.P33P|RPGRIP1_ENST00000556336.1_Intron|RPGRIP1_ENST00000557771.1_Silent_p.P636P|RPGRIP1_ENST00000553500.1_Intron	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	674					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		GGCCACAGCCCCTCTATGACT	0.512																																					p.P674P		Atlas-SNP	.											.	RPGRIP1	213	.	0			c.C2022T						PASS	.						169.0	159.0	162.0					14																	21793036		1949	4136	6085	SO:0001819	synonymous_variant	57096	exon14			ACAGCCCCTCTAT	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.2022C>T	chr14.hg19:g.21793036C>T		109.0	0.0	.		126.0	46.0	.	NM_020366	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Silent	SNP	ENST00000400017.2	hg19	CCDS45080.1																																																																																			.	.	.	none		0.512	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	
FAM98B	283742	hgsc.bcm.edu	37	15	38776827	38776827	+	IGR	SNP	T	T	A			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr15:38776827T>A	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Silent_p.G423G	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		gtggtggtggtggtggtggag	0.443																																					p.G423G		Atlas-SNP	.											FAM98B_ENST00000397609,NS,carcinoma,0,1	FAM98B	53	.	0			c.T1269A						PASS	.						19.0	18.0	18.0					15																	38776827		1515	3413	4928	SO:0001628	intergenic_variant	283742	exon8			TGGTGGTGGTGGT		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		chr15.hg19:g.38776827T>A		21.0	0.0	.		27.0	4.0	.	NM_173611	A8MUW5|Q8N935	Silent	SNP	ENST00000491535.1	hg19	CCDS42015.1																																																																																			.	.	.	none		0.443	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252071.2	NM_173611	
CEMIP	57214	hgsc.bcm.edu	37	15	81181040	81181040	+	Splice_Site	SNP	A	A	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr15:81181040A>T	ENST00000394685.3	+	9	1287		c.e9-1		KIAA1199_ENST00000220244.3_Splice_Site|KIAA1199_ENST00000356249.5_Splice_Site			Q8WUJ3	CEMIP_HUMAN							hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TTTCTCTGACAGGACATCGAG	0.498																																					.		Atlas-SNP	.											.	KIAA1199	118	.	0			c.869-2A>T						PASS	.						101.0	99.0	100.0					15																	81181040		2203	4300	6503	SO:0001630	splice_region_variant	57214	exon8			TCTGACAGGACAT																												ENST00000394685.3:c.869-1A>T	chr15.hg19:g.81181040A>T		57.0	0.0	.		52.0	27.0	.	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Splice_Site	SNP	ENST00000394685.3	hg19	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	A	11.13	1.547385	0.27652	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6315	0.68660	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1199	78968095	1.000000	0.71417	0.786000	0.31890	0.035000	0.12851	6.504000	0.73704	2.046000	0.60703	0.455000	0.32223	.	.	.	.	none		0.498	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		Intron
GLTPD2	388323	hgsc.bcm.edu	37	17	4693110	4693110	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr17:4693110A>G	ENST00000331264.7	+	4	448	c.395A>G	c.(394-396)aAg>aGg	p.K132R		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	132						cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GCCTTCACCAAGGTGACAGAC	0.672																																					p.K132R		Atlas-SNP	.											.	GLTPD2	15	.	0			c.A395G						PASS	.						16.0	17.0	16.0					17																	4693110		2178	4256	6434	SO:0001583	missense	388323	exon4			TCACCAAGGTGAC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.395A>G	chr17.hg19:g.4693110A>G	ENSP00000328070:p.Lys132Arg	86.0	0.0	.		157.0	88.0	.	NM_001014985	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	hg19	CCDS32534.1	.	.	.	.	.	.	.	.	.	.	A	32	5.182952	0.94885	.	.	ENSG00000182327	ENST00000331264	.	.	.	4.55	4.55	0.56014	Glycolipid transfer protein domain (3);	0.000000	0.85682	D	0.000000	T	0.81312	0.4796	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84725	0.0742	9	0.66056	D	0.02	-15.1395	11.95	0.52950	1.0:0.0:0.0:0.0	.	132	A6NH11	GLTD2_HUMAN	R	132	.	ENSP00000328070:K132R	K	+	2	0	GLTPD2	4639850	1.000000	0.71417	0.999000	0.59377	0.879000	0.50718	5.451000	0.66632	1.924000	0.55735	0.454000	0.30748	AAG	.	.	.	none		0.672	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
CDC37	11140	hgsc.bcm.edu	37	19	10506875	10506875	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr19:10506875C>T	ENST00000222005.2	-	2	160	c.107G>A	c.(106-108)cGg>cAg	p.R36Q		NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	36					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		GCGTTCCACCCGGGCCTGCGG	0.632																																					p.R36Q		Atlas-SNP	.											.	CDC37	32	.	0			c.G107A						PASS	.						39.0	42.0	41.0					19																	10506875		2203	4300	6503	SO:0001583	missense	11140	exon2			TCCACCCGGGCCT	U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.107G>A	chr19.hg19:g.10506875C>T	ENSP00000222005:p.Arg36Gln	128.0	0.0	.		141.0	69.0	.	NM_007065	Q53YA2	Missense_Mutation	SNP	ENST00000222005.2	hg19	CCDS12237.1	.	.	.	.	.	.	.	.	.	.	C	33	5.265565	0.95399	.	.	ENSG00000105401	ENST00000222005	T	0.57436	0.4	4.19	4.19	0.49359	Cdc37, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.68568	0.3015	M	0.83852	2.665	0.80722	D	1	D;D	0.71674	0.998;0.998	P;P	0.56216	0.794;0.794	T	0.76130	-0.3072	10	0.87932	D	0	.	14.3942	0.67001	0.0:1.0:0.0:0.0	.	36;36	Q6FG59;Q16543	.;CDC37_HUMAN	Q	36	ENSP00000222005:R36Q	ENSP00000222005:R36Q	R	-	2	0	CDC37	10367875	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.268000	0.78473	2.058000	0.61347	0.555000	0.69702	CGG	.	.	.	none		0.632	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451987.1	NM_007065	
GATA5	140628	hgsc.bcm.edu	37	20	61050059	61050059	+	Silent	SNP	G	G	T			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr20:61050059G>T	ENST00000252997.2	-	2	580	c.519C>A	c.(517-519)acC>acA	p.T173T	RP13-379O24.3_ENST00000606283.1_lincRNA	NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	173					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			ACTCACCGAAGGTGGGCCTGC	0.721																																					p.T173T		Atlas-SNP	.											.	GATA5	22	.	0			c.C519A						PASS	.						3.0	4.0	3.0					20																	61050059		1891	3784	5675	SO:0001819	synonymous_variant	140628	exon2			ACCGAAGGTGGGC	BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.519C>A	chr20.hg19:g.61050059G>T		11.0	0.0	.		83.0	5.0	.	NM_080473	D9ZGF7|Q17RE2|Q86VU4	Silent	SNP	ENST00000252997.2	hg19	CCDS13499.1																																																																																			.	.	.	none		0.721	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080038.2	NM_080473	
ACO2	50	hgsc.bcm.edu	37	22	41911896	41911896	+	Silent	SNP	T	T	C			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr22:41911896T>C	ENST00000216254.4	+	6	832	c.810T>C	c.(808-810)ccT>ccC	p.P270P	ACO2_ENST00000396512.3_Silent_p.P270P|ACO2_ENST00000466237.1_3'UTR	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	270				P -> H (in Ref. 6; AAH26196). {ECO:0000305}.	cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)			breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						ACCACGGGCCTGGTGTAGACT	0.607																																					p.P270P		Atlas-SNP	.											.	ACO2	58	.	0			c.T810C						PASS	.						63.0	48.0	53.0					22																	41911896		2203	4300	6503	SO:0001819	synonymous_variant	50	exon6			CGGGCCTGGTGTA	AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.810T>C	chr22.hg19:g.41911896T>C		114.0	0.0	.		124.0	69.0	.	NM_001098	O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Silent	SNP	ENST00000216254.4	hg19	CCDS14017.1																																																																																			.	.	.	none		0.607	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259151.1	NM_001098	
DSPP	1834	hgsc.bcm.edu	37	4	88537224	88537232	+	In_Frame_Del	DEL	ACAGCAGCA	ACAGCAGCA	-	rs201608130|rs140656082|rs200679221|rs564674887	byFrequency	TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	ACAGCAGCA	ACAGCAGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr4:88537224_88537232delACAGCAGCA	ENST00000282478.7	+	4	3443_3451	c.3410_3418delACAGCAGCA	c.(3409-3420)gacagcagcaac>gac	p.SSN1138del	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_In_Frame_Del_p.SSN1138del			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1138	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gatagcagtgacagcagcaacagcagtga	0.569																																					p.1137_1139del		Atlas-INDEL	.											.	DSPP	174	.	0			c.3409_3417del						PASS	.																																			SO:0001651	inframe_deletion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3410_3418delACAGCAGCA	chr4.hg19:g.88537224_88537232delACAGCAGCA	ENSP00000282478:p.Ser1138_Asn1140del	190.0	0.0	0		250.0	114.0	0.456	NM_014208	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.	.	none		0.569	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
ZNF721	170960	hgsc.bcm.edu	37	4	436799	436801	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr4:436799_436801delGAG	ENST00000338977.5	-	2	1467_1469	c.1419_1421delCTC	c.(1417-1422)tcctca>tca	p.473_474SS>S	ZNF721_ENST00000507078.1_Intron|ZNF721_ENST00000506646.1_Intron|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000511833.2_In_Frame_Del_p.485_486SS>S			Q8TF20	ZN721_HUMAN	zinc finger protein 721	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						AGCAAAGCTTGAGGATGAGGTAA	0.369																																					p.486_486del		Atlas-Indel,Pindel	.											.	ZNF721	205	.	0			c.1456_1458del						PASS	.			2,3976		1,0,1988						0.4	0.1			78	1,8109		0,1,4054	no	coding	ZNF721	NM_133474.2		1,1,6042	A1A1,A1R,RR		0.0123,0.0503,0.0248				3,12085				SO:0001651	inframe_deletion	170960	exon3			.	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1419_1421delCTC	chr4.hg19:g.436799_436801delGAG	ENSP00000340524:p.Ser475del	81.0	0.0	0		80.0	23.0	0.2875	NM_133474	Q69YG7	In_Frame_Del	DEL	ENST00000338977.5	hg19																																																																																				.	.	.	none		0.369	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
DISC1	27185	hgsc.bcm.edu	37	1	231931003	231931003	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5DU-01A-11D-A28G-10	TCGA-A4-A5DU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4423a137-3e9c-4910-bff6-0f282d79e89a	61c2e34f-6a63-434c-becd-e6537a9b7df9	g.chr1:231931003delA	ENST00000602281.1	+	7	1703	c.1650delA	c.(1648-1650)atafs	p.I550fs	TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000535983.1_Frame_Shift_Del_p.I550fs|DISC1_ENST00000602873.1_Intron|DISC1_ENST00000439617.2_Frame_Shift_Del_p.I550fs|DISC1_ENST00000366633.3_Frame_Shift_Del_p.I550fs|DISC1_ENST00000366636.4_Frame_Shift_Del_p.I550fs|DISC1_ENST00000539444.1_Frame_Shift_Del_p.I550fs|DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000537876.1_Intron	NM_001164542.1|NM_001164544.1	NP_001158014.1|NP_001158016.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	550	Interaction with TRAF3IP1.|Necessary and sufficient for interaction with PCNT and localization at the centrosome.|Required for localization to punctate cytoplasmic foci.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				AGGAAAGAATAAAATCCCTCA	0.358																																					p.I582fs		Atlas-Indel,Pindel	.											.	DISC1	207	.	0			c.1745delT						PASS	.						84.0	85.0	85.0					1																	231931003		2203	4300	6503	SO:0001589	frameshift_variant	27185	exon8			.	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000602281.1:c.1650delA	chr1.hg19:g.231931003delA	ENSP00000473425:p.Ile550fs	59.0	0.0	0		59.0	27.0	0.457627	NM_001164537	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Frame_Shift_Del	DEL	ENST00000602281.1	hg19	CCDS59205.1																																																																																			.	.	.	none		0.358	DISC1-019	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467451.1	NM_018662	
