#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM52	339456	hgsc.bcm.edu	37	1	1850654	1850654	+	Silent	SNP	G	G	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:1850654G>C	ENST00000310991.3	-	1	58	c.51C>G	c.(49-51)ctC>ctG	p.L17L	TMEM52_ENST00000378602.3_5'Flank	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	17						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ggagcggcaggagcggcagca	0.771																																					p.L17L		Atlas-SNP	.											TMEM52,NS,carcinoma,0,1	TMEM52	21	.	0			c.C51G						PASS	.						1.0	2.0	1.0					1																	1850654		671	1684	2355	SO:0001819	synonymous_variant	339456	exon1			CGGCAGGAGCGGC	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.51C>G	chr1.hg19:g.1850654G>C		2.0	0.0	.		3.0	3.0	.	NM_178545	Q4VXS6|Q6UX25	Silent	SNP	ENST00000310991.3	hg19	CCDS35.1	.	.	.	.	.	.	.	.	.	.	.	4.530	0.098402	0.08681	.	.	ENSG00000178821	ENST00000378598	.	.	.	0.149	0.149	0.14863	.	.	.	.	.	T	0.39489	0.1080	.	.	.	0.22446	N	0.999091	.	.	.	.	.	.	T	0.39035	-0.9633	4	0.87932	D	0	.	.	.	.	.	.	.	.	C	15	.	ENSP00000367861:S15C	S	-	2	0	TMEM52	1840514	0.001000	0.12720	0.009000	0.14445	0.010000	0.07245	0.286000	0.18902	0.192000	0.20272	0.195000	0.17529	TCC	.	.	.	none		0.771	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002781.1	NM_178545	
PRKCZ	5590	hgsc.bcm.edu	37	1	2066777	2066777	+	5'UTR	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:2066777C>T	ENST00000400921.2	+	0	545				PRKCZ_ENST00000400920.1_5'UTR	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta						actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	AAGCCAAGCGCTTTAACAGGG	0.552																																					p.R137R		Atlas-SNP	.											.	PRKCZ	84	.	0			c.C411T						PASS	.						48.0	48.0	48.0					1																	2066777		2203	4300	6503	SO:0001623	5_prime_UTR_variant	5590	exon5			CAAGCGCTTTAAC	BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.-139C>T	chr1.hg19:g.2066777C>T		41.0	0.0	.		32.0	18.0	.	NM_002744	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Silent	SNP	ENST00000400921.2	hg19	CCDS41229.1																																																																																			.	.	.	none		0.552	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744	
ZNF644	84146	hgsc.bcm.edu	37	1	91403569	91403569	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:91403569G>T	ENST00000370440.1	-	4	3378	c.3161C>A	c.(3160-3162)tCa>tAa	p.S1054*	ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000337393.5_Nonsense_Mutation_p.S1054*|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	1054					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		AACATGATTTGATAATCCAAT	0.363																																					p.S1054X		Atlas-SNP	.											.	ZNF644	120	.	0			c.C3161A						PASS	.						81.0	80.0	81.0					1																	91403569		2203	4300	6503	SO:0001587	stop_gained	84146	exon4			TGATTTGATAATC	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.3161C>A	chr1.hg19:g.91403569G>T	ENSP00000359469:p.Ser1054*	38.0	0.0	.		37.0	16.0	.	NM_201269	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Nonsense_Mutation	SNP	ENST00000370440.1	hg19	CCDS731.1	.	.	.	.	.	.	.	.	.	.	G	41	9.121790	0.99073	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000536941	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.694	20.1634	0.98142	0.0:0.0:1.0:0.0	.	.	.	.	X	1054;1054;626	.	ENSP00000337008:S1054X	S	-	2	0	ZNF644	91176157	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.294000	0.96088	2.773000	0.95371	0.655000	0.94253	TCA	.	.	.	none		0.363	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
SUSD4	55061	hgsc.bcm.edu	37	1	223536686	223536686	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr1:223536686T>C	ENST00000343846.3	-	1	715	c.82A>G	c.(82-84)Aga>Gga	p.R28G	SUSD4_ENST00000344029.6_Missense_Mutation_p.R28G|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000366877.3_Missense_Mutation_p.R28G|SUSD4_ENST00000366878.4_Missense_Mutation_p.R28G|SUSD4_ENST00000494793.2_Missense_Mutation_p.R28G|SUSD4_ENST00000484758.2_Missense_Mutation_p.R28G|SUSD4_ENST00000454695.2_5'UTR			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	28						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GCCAAGAGTCTCTGGGGGGAC	0.597																																					p.R28G		Atlas-SNP	.											.	SUSD4	82	.	0			c.A82G						PASS	.						32.0	32.0	32.0					1																	223536686		2202	4299	6501	SO:0001583	missense	55061	exon2			AGAGTCTCTGGGG	AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.82A>G	chr1.hg19:g.223536686T>C	ENSP00000344219:p.Arg28Gly	142.0	0.0	.		132.0	44.0	.	NM_017982	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	ENST00000343846.3	hg19	CCDS41471.1	.	.	.	.	.	.	.	.	.	.	T	18.90	3.722459	0.68959	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000271787;ENST00000344029;ENST00000342943;ENST00000366877	T;T;T	0.38560	1.18;1.18;1.13	4.86	4.86	0.63082	.	0.000000	0.46758	D	0.000278	T	0.43322	0.1242	N	0.14661	0.345	0.31376	N	0.679575	D;D;D	0.63880	0.987;0.992;0.993	D;D;P	0.71656	0.942;0.974;0.787	T	0.50939	-0.8768	10	0.66056	D	0.02	-11.375	8.8024	0.34916	0.0:0.0:0.1902:0.8098	.	28;28;28	B7Z369;Q5VX71-3;Q5VX71	.;.;SUSD4_HUMAN	G	28	ENSP00000344219:R28G;ENSP00000355843:R28G;ENSP00000339926:R28G	ENSP00000271787:R28G	R	-	1	2	SUSD4	221603309	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.992000	0.56980	1.800000	0.52685	0.459000	0.35465	AGA	.	.	.	none		0.597	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982	
CLEC4F	165530	hgsc.bcm.edu	37	2	71036918	71036918	+	Silent	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:71036918G>A	ENST00000272367.2	-	6	1687	c.1611C>T	c.(1609-1611)tcC>tcT	p.S537S	CLEC4F_ENST00000426626.1_Silent_p.S537S	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	537	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						TCCAGCGCCAGGAGCCCTCTG	0.552																																					p.S537S	Colon(107;10 2157 6841 26035)	Atlas-SNP	.											.	CLEC4F	95	.	0			c.C1611T						PASS	.						156.0	141.0	146.0					2																	71036918		2203	4300	6503	SO:0001819	synonymous_variant	165530	exon6			GCGCCAGGAGCCC	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1611C>T	chr2.hg19:g.71036918G>A		57.0	0.0	.		88.0	25.0	.	NM_173535	A4QPA5	Silent	SNP	ENST00000272367.2	hg19	CCDS1910.1																																																																																			.	.	.	none		0.552	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	chr2.hg19:g.241696843C>A		74.0	0.0	.		98.0	5.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	hg19	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
HDLBP	3069	hgsc.bcm.edu	37	2	242196033	242196033	+	Silent	SNP	T	T	C	rs200251201		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr2:242196033T>C	ENST00000391975.1	-	6	866	c.639A>G	c.(637-639)ttA>ttG	p.L213L	HDLBP_ENST00000310931.4_Silent_p.L213L|HDLBP_ENST00000427183.2_Silent_p.L249L|HDLBP_ENST00000391976.2_Silent_p.L213L	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	213	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CAGAGATGAGTAAGACTTCAT	0.567																																					p.L249L		Atlas-SNP	.											.	HDLBP	118	.	0			c.A747G						PASS	.						176.0	156.0	163.0					2																	242196033		2203	4300	6503	SO:0001819	synonymous_variant	3069	exon7			GATGAGTAAGACT		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.639A>G	chr2.hg19:g.242196033T>C		119.0	0.0	.		131.0	35.0	.	NM_001243900	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Silent	SNP	ENST00000391975.1	hg19	CCDS2547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.630|4.630	0.117115|0.117115	0.08881|0.08881	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000373292|ENST00000453141	.|.	.|.	.|.	5.79|5.79	-0.967|-0.967	0.10316|0.10316	.|.	.|.	.|.	.|.	.|.	T|T	0.42223|0.42223	0.1193|0.1193	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.29701|0.29701	-1.0003|-1.0003	4|4	.|.	.|.	.|.	-20.9924|-20.9924	2.4822|2.4822	0.04590|0.04590	0.1601:0.3764:0.3089:0.1546|0.1601:0.3764:0.3089:0.1546	.|.	.|.	.|.	.|.	A|C	91|114	.|.	.|.	T|Y	-|-	1|2	0|0	HDLBP|HDLBP	241844706|241844706	0.522000|0.522000	0.26266|0.26266	0.991000|0.991000	0.47740|0.47740	0.427000|0.427000	0.31564|0.31564	-0.124000|-0.124000	0.10595|0.10595	0.095000|0.095000	0.17434|0.17434	-0.326000|-0.326000	0.08463|0.08463	ACT|TAC	.	T|0.999;C|0.001	0.001	weak		0.567	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
CADM2	253559	hgsc.bcm.edu	37	3	85851274	85851274	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:85851274G>C	ENST00000407528.2	+	2	201	c.139G>C	c.(139-141)Gat>Cat	p.D47H	CADM2_ENST00000405615.2_Missense_Mutation_p.D49H|CADM2-AS2_ENST00000467225.1_RNA|CADM2_ENST00000383699.3_Missense_Mutation_p.D56H	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	47	Ig-like V-type.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		CTGCAGGGTTGATCAAAATGA	0.408																																					p.D56H		Atlas-SNP	.											.	CADM2	195	.	0			c.G166C						PASS	.						90.0	75.0	80.0					3																	85851274		2203	4300	6503	SO:0001583	missense	253559	exon3			AGGGTTGATCAAA	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.139G>C	chr3.hg19:g.85851274G>C	ENSP00000384575:p.Asp47His	113.0	0.0	.		110.0	6.0	.	NM_001167675	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	hg19	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.343676	0.61073	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.64991	-0.13;-0.13;-0.13	5.27	5.27	0.74061	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.162021	0.53938	D	0.000054	T	0.64811	0.2632	L	0.35542	1.07	0.80722	D	1	P;P;P	0.50066	0.805;0.854;0.931	P;P;P	0.53689	0.591;0.517;0.732	T	0.59500	-0.7443	10	0.25751	T	0.34	.	19.2384	0.93871	0.0:0.0:1.0:0.0	.	49;56;47	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	H	56;47;49	ENSP00000373200:D56H;ENSP00000384575:D47H;ENSP00000384193:D49H	ENSP00000373200:D56H	D	+	1	0	CADM2	85933964	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	9.420000	0.97426	2.621000	0.88768	0.544000	0.68410	GAT	.	.	.	none		0.408	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
ALDH1L1	10840	hgsc.bcm.edu	37	3	125826081	125826081	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:125826081A>C	ENST00000393434.2	-	21	2705	c.2356T>G	c.(2356-2358)Ttt>Gtt	p.F786V	ALDH1L1_ENST00000273450.3_Missense_Mutation_p.F796V|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.F786V|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.F685V|ALDH1L1-AS1_ENST00000512384.1_RNA|ALDH1L1_ENST00000393431.2_3'UTR	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	786	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GTTGGCTCAAAGAAGAACCCT	0.557																																					p.F796V		Atlas-SNP	.											.	ALDH1L1	138	.	0			c.T2386G						PASS	.						130.0	115.0	120.0					3																	125826081		2203	4300	6503	SO:0001583	missense	10840	exon21			GCTCAAAGAAGAA	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.2356T>G	chr3.hg19:g.125826081A>C	ENSP00000377083:p.Phe786Val	32.0	0.0	.		56.0	36.0	.	NM_001270364	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	hg19	CCDS3034.1	.	.	.	.	.	.	.	.	.	.	A	11.51	1.660489	0.29515	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	3.98	3.98	0.46160	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.56093	0.1962	N	0.00450	-1.49	0.80722	D	1	P;D;P	0.54772	0.755;0.968;0.501	P;D;P	0.63793	0.81;0.918;0.673	T	0.65203	-0.6225	10	0.27082	T	0.32	.	10.8723	0.46891	1.0:0.0:0.0:0.0	.	685;321;786	E9PBX3;Q6ZV71;O75891	.;.;AL1L1_HUMAN	V	796;786;685;786	ENSP00000273450:F796V;ENSP00000420293:F786V;ENSP00000395881:F685V;ENSP00000377083:F786V	ENSP00000273450:F796V	F	-	1	0	ALDH1L1	127308771	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	2.579000	0.46059	1.677000	0.50941	0.260000	0.18958	TTT	.	.	.	none		0.557	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190	
DDX60L	91351	hgsc.bcm.edu	37	4	169382991	169382991	+	Silent	SNP	C	C	T	rs17612630	byFrequency	TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr4:169382991C>T	ENST00000511577.1	-	5	712	c.465G>A	c.(463-465)acG>acA	p.T155T	DDX60L_ENST00000505890.1_Silent_p.T155T|DDX60L_ENST00000260184.7_Silent_p.T155T			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	155							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TAAAAAGGTACGTTTGTAAAT	0.368																																					p.T155T		Atlas-SNP	.											.	DDX60L	116	.	0			c.G465A						PASS	.						59.0	53.0	55.0					4																	169382991		1850	4090	5940	SO:0001819	synonymous_variant	91351	exon5			AAGGTACGTTTGT	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.465G>A	chr4.hg19:g.169382991C>T		108.0	0.0	.		93.0	21.0	.	NM_001012967	Q96ND6	Silent	SNP	ENST00000511577.1	hg19																																																																																				.	C|0.904;A|0.096	.	alt		0.368	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
IK	3550	hgsc.bcm.edu	37	5	140034136	140034136	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr5:140034136A>C	ENST00000417647.2	+	7	694	c.555A>C	c.(553-555)gaA>gaC	p.E185D		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	185	Poly-Glu.				cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAAAGAGGAAGAGGAACTGA	0.388																																					p.E185D		Atlas-SNP	.											.	IK	46	.	0			c.A555C						PASS	.						44.0	44.0	44.0					5																	140034136		1831	4083	5914	SO:0001583	missense	3550	exon7			AGAGGAAGAGGAA	BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.555A>C	chr5.hg19:g.140034136A>C	ENSP00000396301:p.Glu185Asp	516.0	1.0	.		467.0	155.0	.	NM_006083	Q6IPD8	Missense_Mutation	SNP	ENST00000417647.2	hg19	CCDS47280.1	.	.	.	.	.	.	.	.	.	.	A	17.19	3.326795	0.60743	.	.	ENSG00000113141	ENST00000417647;ENST00000508301;ENST00000261812;ENST00000502899	.	.	.	5.86	1.66	0.24008	RED-like, N-terminal (1);	0.042187	0.85682	D	0.000000	T	0.32255	0.0823	N	0.17674	0.51	0.48975	D	0.999737	B;B	0.24132	0.01;0.098	B;B	0.27500	0.026;0.08	T	0.04509	-1.0946	9	0.20519	T	0.43	.	7.8062	0.29204	0.5957:0.0:0.4043:0.0	.	185;185	Q9UK43;Q13123	.;RED_HUMAN	D	185	.	ENSP00000261812:E185D	E	+	3	2	IK	140014320	0.973000	0.33851	1.000000	0.80357	0.990000	0.78478	0.251000	0.18257	0.653000	0.30826	0.460000	0.39030	GAA	.	.	.	none		0.388	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372897.1	NM_006083	
PCDHA12	56137	hgsc.bcm.edu	37	5	140256291	140256291	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr5:140256291G>A	ENST00000398631.2	+	1	1234	c.1234G>A	c.(1234-1236)Gcc>Acc	p.A412T	PCDHA4_ENST00000512229.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	412	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGACAGCGCCCTGGACCG	0.607																																					p.A412T	Pancreas(113;759 1672 13322 24104 50104)	Atlas-SNP	.											PCDHA12,NS,carcinoma,0,2	PCDHA12	196	.	0			c.G1234A						PASS	.						196.0	189.0	192.0					5																	140256291		2203	4300	6503	SO:0001583	missense	56137	exon1			GACAGCGCCCTGG	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1234G>A	chr5.hg19:g.140256291G>A	ENSP00000381628:p.Ala412Thr	171.0	0.0	.		174.0	8.0	.	NM_018903	O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	hg19	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.438589	0.25900	.	.	ENSG00000251664	ENST00000398631	T	0.02682	4.2	4.81	-1.86	0.07760	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02304	0.0071	L	0.35593	1.075	0.09310	N	1	B;B	0.33528	0.056;0.416	B;B	0.37550	0.042;0.253	T	0.45071	-0.9286	9	0.33141	T	0.24	.	0.7087	0.00920	0.22:0.1806:0.3273:0.2721	.	412;412	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	T	412	ENSP00000381628:A412T	ENSP00000381628:A412T	A	+	1	0	PCDHA12	140236475	0.000000	0.05858	0.001000	0.08648	0.862000	0.49288	-1.193000	0.03049	-0.044000	0.13491	0.655000	0.94253	GCC	.	.	.	none		0.607	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
NFYA	4800	hgsc.bcm.edu	37	6	41059422	41059422	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr6:41059422G>A	ENST00000341376.6	+	7	904	c.703G>A	c.(703-705)Ggg>Agg	p.G235R	NFYA_ENST00000353205.5_Missense_Mutation_p.G206R|OARD1_ENST00000480585.1_Intron	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	235					cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					CAATTCAGGAGGGATGGTCAT	0.418																																					p.G235R		Atlas-SNP	.											.	NFYA	33	.	0			c.G703A						PASS	.						229.0	209.0	216.0					6																	41059422		2203	4300	6503	SO:0001583	missense	4800	exon7			TCAGGAGGGATGG		CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.703G>A	chr6.hg19:g.41059422G>A	ENSP00000345702:p.Gly235Arg	58.0	0.0	.		55.0	21.0	.	NM_002505	Q8IXU0	Missense_Mutation	SNP	ENST00000341376.6	hg19	CCDS4849.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975651	0.92919	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.71702	0.3371	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.72364	-0.4316	9	0.62326	D	0.03	-10.6151	18.9483	0.92630	0.0:0.0:1.0:0.0	.	206;235	P23511-2;P23511	.;NFYA_HUMAN	R	235;206	.	ENSP00000345702:G235R	G	+	1	0	NFYA	41167400	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.760000	0.98935	2.720000	0.93068	0.655000	0.94253	GGG	.	.	.	none		0.418	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
NOD1	10392	hgsc.bcm.edu	37	7	30492406	30492406	+	Silent	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:30492406G>A	ENST00000222823.4	-	6	1152	c.627C>T	c.(625-627)tcC>tcT	p.S209S	NOD1_ENST00000423334.2_Intron	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	209	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GTAGCAGCATGGACTTGCCCA	0.612																																					p.S209S		Atlas-SNP	.											.	NOD1	79	.	0			c.C627T						PASS	.						89.0	86.0	87.0					7																	30492406		2203	4300	6503	SO:0001819	synonymous_variant	10392	exon6			CAGCATGGACTTG	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.627C>T	chr7.hg19:g.30492406G>A		53.0	0.0	.		83.0	23.0	.	NM_006092	B4DTU3|Q549U4|Q8IWF5	Silent	SNP	ENST00000222823.4	hg19	CCDS5427.1																																																																																			.	.	.	none		0.612	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2		
ZNF273	10793	hgsc.bcm.edu	37	7	64388953	64388953	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:64388953C>G	ENST00000476120.1	+	4	1318	c.1247C>G	c.(1246-1248)aCt>aGt	p.T416S	ZNF273_ENST00000319636.5_Missense_Mutation_p.T351S|ZNF273_ENST00000527278.1_3'UTR	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CGGTCCACAACTCTTACTAAA	0.348																																					p.T416S	Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)	Atlas-SNP	.											.	ZNF273	45	.	0			c.C1247G						PASS	.						40.0	44.0	42.0					7																	64388953		2203	4298	6501	SO:0001583	missense	10793	exon4			CCACAACTCTTAC	X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.1247C>G	chr7.hg19:g.64388953C>G	ENSP00000418719:p.Thr416Ser	103.0	0.0	.		169.0	77.0	.	NM_021148	B3KQZ5|Q6P3V4	Missense_Mutation	SNP	ENST00000476120.1	hg19	CCDS5528.2	.	.	.	.	.	.	.	.	.	.	.	5.424	0.263316	0.10294	.	.	ENSG00000198039	ENST00000476120;ENST00000319636	T;T	0.03358	3.96;3.96	1.16	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02230	0.0069	N	0.11724	0.165	0.09310	N	1	B	0.19445	0.036	B	0.25405	0.06	T	0.50250	-0.8850	9	0.12103	T	0.63	.	7.3527	0.26700	0.0:1.0:0.0:0.0	.	416	Q14593	ZN273_HUMAN	S	416;351	ENSP00000418719:T416S;ENSP00000324518:T351S	ENSP00000324518:T351S	T	+	2	0	ZNF273	64026388	0.000000	0.05858	0.757000	0.31301	0.755000	0.42902	-6.036000	0.00084	0.202000	0.20498	0.205000	0.17691	ACT	.	.	.	none		0.348	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313502.1		
ABCB4	5244	hgsc.bcm.edu	37	7	87049331	87049331	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:87049331T>C	ENST00000265723.4	-	19	2488	c.2377A>G	c.(2377-2379)Aaa>Gaa	p.K793E	ABCB4_ENST00000358400.3_Missense_Mutation_p.K793E|ABCB4_ENST00000359206.3_Missense_Mutation_p.K793E|ABCB4_ENST00000545634.1_Missense_Mutation_p.K793E|ABCB4_ENST00000453593.1_Missense_Mutation_p.K793E	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	793	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	AGCATTGCTTTAAAAGCCATT	0.423																																					p.K793E		Atlas-SNP	.											.	ABCB4	177	.	0			c.A2377G						PASS	.						183.0	167.0	173.0					7																	87049331		2203	4300	6503	SO:0001583	missense	5244	exon19			TTGCTTTAAAAGC	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2377A>G	chr7.hg19:g.87049331T>C	ENSP00000265723:p.Lys793Glu	111.0	0.0	.		148.0	64.0	.	NM_018850	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	hg19	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.299295	0.40694	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57	6.03	2.37	0.29283	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.390503	0.30003	N	0.010651	D	0.84543	0.5495	L	0.58101	1.795	0.31324	N	0.685702	B;B;B	0.10296	0.003;0.002;0.003	B;B;B	0.16722	0.016;0.007;0.012	T	0.80286	-0.1446	10	0.62326	D	0.03	-9.0118	6.8919	0.24234	0.0:0.1317:0.1275:0.7408	.	793;793;793	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	E	793	ENSP00000352135:K793E;ENSP00000351172:K793E;ENSP00000265723:K793E;ENSP00000392983:K793E;ENSP00000437465:K793E	ENSP00000265723:K793E	K	-	1	0	ABCB4	86887267	0.999000	0.42202	0.992000	0.48379	0.639000	0.38242	1.584000	0.36589	0.497000	0.27926	-0.256000	0.11100	AAA	.	.	.	none		0.423	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
ARHGAP22	58504	hgsc.bcm.edu	37	10	49659052	49659052	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr10:49659052C>G	ENST00000249601.4	-	9	1416	c.1120G>C	c.(1120-1122)Gag>Cag	p.E374Q	ARHGAP22_ENST00000477708.2_Missense_Mutation_p.E207Q|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.E215Q|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.E390Q|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.E380Q|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.E284Q|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.E265Q	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	374					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTGGTGACCTCCTCGGAGCCC	0.731																																					p.E390Q		Atlas-SNP	.											.	ARHGAP22	94	.	0			c.G1168C						PASS	.						8.0	9.0	9.0					10																	49659052		2008	4065	6073	SO:0001583	missense	58504	exon9			TGACCTCCTCGGA	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1120G>C	chr10.hg19:g.49659052C>G	ENSP00000249601:p.Glu374Gln	82.0	0.0	.		60.0	25.0	.	NM_001256024	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	hg19	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580505	0.65992	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000477708;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T;T	0.37915	2.7;2.36;1.17;1.51;2.34;2.66;2.7	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.62196	0.2408	M	0.81942	2.565	0.50039	D	0.999846	P;D;D;D;D;D	0.89917	0.621;1.0;0.972;1.0;0.959;1.0	B;D;P;D;P;D	0.74348	0.326;0.972;0.742;0.959;0.882;0.983	T	0.66352	-0.5945	10	0.59425	D	0.04	.	15.8862	0.79251	0.0:1.0:0.0:0.0	.	380;374;390;374;284;207	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3;D6R9V6	.;.;.;RHG22_HUMAN;.;.	Q	374;265;215;207;284;380;390	ENSP00000249601:E374Q;ENSP00000363287:E265Q;ENSP00000363285:E215Q;ENSP00000422868:E207Q;ENSP00000410054:E284Q;ENSP00000416701:E380Q;ENSP00000412461:E390Q	ENSP00000249601:E374Q	E	-	1	0	ARHGAP22	49329058	1.000000	0.71417	0.573000	0.28510	0.349000	0.29174	6.759000	0.74934	2.440000	0.82611	0.313000	0.20887	GAG	.	.	.	none		0.731	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
DDN	23109	hgsc.bcm.edu	37	12	49390815	49390815	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr12:49390815A>T	ENST00000421952.2	-	2	1865	c.1844T>A	c.(1843-1845)gTg>gAg	p.V615E	RP11-386G11.5_ENST00000552933.1_RNA|RP11-386G11.5_ENST00000547395.1_RNA|RP11-386G11.5_ENST00000547866.1_RNA|RP11-386G11.3_ENST00000549516.1_RNA|RP11-386G11.5_ENST00000552284.1_RNA	NM_015086.1	NP_055901.2	O94850	DEND_HUMAN	dendrin	615	Interaction with CD2AP and NPHS1. {ECO:0000250}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	8						GATACGGGACACGGCTTCTCG	0.721																																					p.V615E		Atlas-SNP	.											.	DDN	54	.	0			c.T1844A						PASS	.						5.0	5.0	5.0					12																	49390815		2080	4038	6118	SO:0001583	missense	23109	exon2			CGGGACACGGCTT	AB018292	CCDS31791.2	12q13	2008-02-05			ENSG00000181418	ENSG00000181418			24458	protein-coding gene	gene with protein product		610588					Standard	NM_015086		Approved	KIAA0749	uc001rsv.1	O94850	OTTHUMG00000156183	ENST00000421952.2:c.1844T>A	chr12.hg19:g.49390815A>T	ENSP00000390590:p.Val615Glu	25.0	0.0	.		28.0	13.0	.	NM_015086		Missense_Mutation	SNP	ENST00000421952.2	hg19	CCDS31791.2	.	.	.	.	.	.	.	.	.	.	A	24.9	4.581706	0.86748	.	.	ENSG00000181418	ENST00000421952	T	0.58940	0.3	4.12	4.12	0.48240	.	0.000000	0.41396	D	0.000887	T	0.63462	0.2513	L	0.32530	0.975	0.43936	D	0.99659	D	0.76494	0.999	D	0.71656	0.974	T	0.66783	-0.5836	10	0.87932	D	0	-0.1503	11.4668	0.50243	1.0:0.0:0.0:0.0	.	615	O94850	DEND_HUMAN	E	615	ENSP00000390590:V615E	ENSP00000390590:V615E	V	-	2	0	DDN	47677082	0.983000	0.35010	1.000000	0.80357	0.979000	0.70002	1.446000	0.35090	2.105000	0.64084	0.459000	0.35465	GTG	.	.	.	none		0.721	DDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343335.1		
ZIC2	7546	hgsc.bcm.edu	37	13	100635322	100635322	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr13:100635322G>A	ENST00000376335.3	+	1	1297	c.1004G>A	c.(1003-1005)tGc>tAc	p.C335Y		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	335			C -> F (in HPE5). {ECO:0000269|PubMed:19177455}.		brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCCTTCCCCTGCCCCTTCCCG	0.617																																					p.C335Y	Pancreas(97;119 1522 31925 44771 48764)	Atlas-SNP	.											.	ZIC2	25	.	0			c.G1004A						PASS	.						81.0	89.0	86.0					13																	100635322		2203	4300	6503	SO:0001583	missense	7546	exon1			TCCCCTGCCCCTT	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.1004G>A	chr13.hg19:g.100635322G>A	ENSP00000365514:p.Cys335Tyr	114.0	0.0	.		87.0	26.0	.	NM_007129	Q5VYA9|Q9H309	Missense_Mutation	SNP	ENST00000376335.3	hg19	CCDS9495.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224811	0.79576	.	.	ENSG00000043355	ENST00000376335;ENST00000397444	D	0.85088	-1.94	4.69	4.69	0.59074	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93798	0.8017	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94910	0.8064	10	0.87932	D	0	.	18.1567	0.89693	0.0:0.0:1.0:0.0	.	335	O95409	ZIC2_HUMAN	Y	335;84	ENSP00000365514:C335Y	ENSP00000365514:C335Y	C	+	2	0	ZIC2	99433323	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.601000	0.98297	2.610000	0.88304	0.561000	0.74099	TGC	.	.	.	none		0.617	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045618.2	NM_007129	
SCFD1	23256	hgsc.bcm.edu	37	14	31175075	31175075	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:31175075A>T	ENST00000458591.2	+	18	1764	c.1537A>T	c.(1537-1539)Acc>Tcc	p.T513S	SCFD1_ENST00000544052.2_Missense_Mutation_p.T446S|SCFD1_ENST00000554486.1_3'UTR|SCFD1_ENST00000541123.1_Missense_Mutation_p.T328S|SCFD1_ENST00000396629.2_Missense_Mutation_p.T421S|SCFD1_ENST00000421551.3_Missense_Mutation_p.T454S	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	513					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		TGGCAGCACTACCACTAAACC	0.373																																					p.T513S		Atlas-SNP	.											.	SCFD1	43	.	0			c.A1537T						PASS	.						84.0	87.0	86.0					14																	31175075		2203	4300	6503	SO:0001583	missense	23256	exon18			AGCACTACCACTA	AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.1537A>T	chr14.hg19:g.31175075A>T	ENSP00000390783:p.Thr513Ser	58.0	0.0	.		70.0	20.0	.	NM_016106	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	ENST00000458591.2	hg19	CCDS9639.1	.	.	.	.	.	.	.	.	.	.	A	9.070	0.996695	0.19043	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000396629	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	5.71	4.58	0.56647	.	0.244841	0.38548	N	0.001656	T	0.38188	0.1031	N	0.00985	-1.075	0.33038	D	0.531027	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.12156	0.003;0.002;0.007;0.005	T	0.43589	-0.9382	10	0.15499	T	0.54	-35.8251	3.8893	0.09111	0.7124:0.0:0.2876:0.0	.	454;446;421;513	B7Z738;B7Z4U7;B7Z594;Q8WVM8	.;.;.;SCFD1_HUMAN	S	513;446;454;328;421	ENSP00000390783:T513S;ENSP00000443010:T446S;ENSP00000388078:T454S;ENSP00000443537:T328S;ENSP00000379870:T421S	ENSP00000309417:T521S	T	+	1	0	SCFD1	30244826	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.464000	0.53057	2.175000	0.68902	0.477000	0.44152	ACC	.	.	.	none		0.373	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276612.3	NM_182835	
ZFYVE26	23503	hgsc.bcm.edu	37	14	68252617	68252617	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:68252617C>T	ENST00000347230.4	-	18	3400	c.3262G>A	c.(3262-3264)Gat>Aat	p.D1088N	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.D1088N	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1088					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AGGACCTGATCTAGCTGCTGG	0.557																																					p.D1088N		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.G3262A						PASS	.						218.0	222.0	221.0					14																	68252617		2203	4300	6503	SO:0001583	missense	23503	exon18			CCTGATCTAGCTG	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.3262G>A	chr14.hg19:g.68252617C>T	ENSP00000251119:p.Asp1088Asn	116.0	0.0	.		80.0	26.0	.	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	hg19	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817287	0.90790	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.30981	1.66;1.51	5.38	5.38	0.77491	.	0.530450	0.20377	N	0.093539	T	0.36908	0.0984	L	0.47716	1.5	0.40782	D	0.983189	P;P	0.39480	0.675;0.546	B;B	0.43658	0.426;0.164	T	0.21621	-1.0240	10	0.59425	D	0.04	0.0013	16.9198	0.86161	0.0:1.0:0.0:0.0	.	1088;1088	G3V2D8;Q68DK2	.;ZFY26_HUMAN	N	1088;1067;1088	ENSP00000251119:D1088N;ENSP00000450603:D1088N	ENSP00000251119:D1088N	D	-	1	0	ZFYVE26	67322370	0.998000	0.40836	0.480000	0.27341	0.939000	0.58152	3.840000	0.55843	2.512000	0.84698	0.655000	0.94253	GAT	.	.	.	none		0.557	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
EXD2	55218	hgsc.bcm.edu	37	14	69697234	69697234	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:69697234G>C	ENST00000409018.3	+	4	764	c.636G>C	c.(634-636)gaG>gaC	p.E212D	EXD2_ENST00000449989.1_Missense_Mutation_p.E87D|EXD2_ENST00000409242.1_Missense_Mutation_p.E87D|EXD2_ENST00000312994.5_Missense_Mutation_p.E212D|EXD2_ENST00000409014.1_Missense_Mutation_p.E87D|EXD2_ENST00000409675.1_Missense_Mutation_p.E87D|EXD2_ENST00000409949.1_Missense_Mutation_p.E87D|EXD2_ENST00000492815.1_3'UTR	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	212	3'-5' exonuclease.						3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CCCTCGCTGAGACTGTTTTGA	0.448																																					p.E212D		Atlas-SNP	.											.	EXD2	43	.	0			c.G636C						PASS	.						178.0	168.0	172.0					14																	69697234		2203	4300	6503	SO:0001583	missense	55218	exon4			CGCTGAGACTGTT	AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.636G>C	chr14.hg19:g.69697234G>C	ENSP00000387331:p.Glu212Asp	89.0	0.0	.		68.0	21.0	.	NM_001193361	B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	ENST00000409018.3	hg19	CCDS53902.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.507951	0.64410	.	.	ENSG00000081177	ENST00000409018;ENST00000193422;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000413191;ENST00000449989	T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.33	2.49	0.30216	-5&apos (1);Ribonuclease H-like (1); exonuclease (1);3&apos (1);	0.093871	0.64402	D	0.000001	T	0.70640	0.3247	M	0.75884	2.315	0.40602	D	0.981598	P;P	0.51057	0.941;0.908	P;P	0.58520	0.84;0.781	T	0.68637	-0.5356	10	0.33141	T	0.24	-25.4424	9.0491	0.36365	0.373:0.0:0.627:0.0	.	212;87	G5E947;Q9NVH0	.;EXD2_HUMAN	D	212;212;87;87;87;87;212;87;87	ENSP00000387331:E212D;ENSP00000386915:E87D;ENSP00000386762:E87D;ENSP00000386632:E87D;ENSP00000386839:E87D;ENSP00000313140:E212D;ENSP00000409089:E87D;ENSP00000392177:E87D	ENSP00000193422:E212D	E	+	3	2	EXD2	68766987	1.000000	0.71417	0.970000	0.41538	0.840000	0.47671	2.350000	0.44063	0.742000	0.32697	-0.136000	0.14681	GAG	.	.	.	none		0.448	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000335504.1		
ADAM20	8748	hgsc.bcm.edu	37	14	70989617	70989617	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:70989617A>C	ENST00000256389.3	-	2	2252	c.2008T>G	c.(2008-2010)Tgc>Ggc	p.C670G	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	620					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TTACGGATGCAGATCTTTTCT	0.463																																					p.C670G		Atlas-SNP	.											.	ADAM20	59	.	0			c.T2008G						PASS	.						416.0	313.0	348.0					14																	70989617		2203	4300	6503	SO:0001583	missense	8748	exon2			GGATGCAGATCTT	AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.2008T>G	chr14.hg19:g.70989617A>C	ENSP00000256389:p.Cys670Gly	122.0	0.0	.		103.0	36.0	.	NM_003814	Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	ENST00000256389.3	hg19	CCDS32111.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.051177	0.55218	.	.	ENSG00000134007	ENST00000256389	T	0.02763	4.17	4.67	4.67	0.58626	ADAM, cysteine-rich (1);	0.000000	0.42682	D	0.000667	T	0.17066	0.0410	M	0.86805	2.84	0.20196	N	0.999929	D	0.89917	1.0	D	0.91635	0.999	T	0.03166	-1.1065	10	0.87932	D	0	.	12.6491	0.56751	1.0:0.0:0.0:0.0	.	620	O43506	ADA20_HUMAN	G	670	ENSP00000256389:C670G	ENSP00000256389:C670G	C	-	1	0	ADAM20	70059370	0.764000	0.28473	0.184000	0.23157	0.040000	0.13550	4.075000	0.57584	1.856000	0.53863	0.460000	0.39030	TGC	.	.	.	none		0.463	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395004.2		
ELMSAN1	91748	hgsc.bcm.edu	37	14	74206660	74206660	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr14:74206660A>T	ENST00000286523.5	-	2	834	c.52T>A	c.(52-54)Ttc>Atc	p.F18I	ELMSAN1_ENST00000486739.1_5'Flank|ELMSAN1_ENST00000394071.2_Missense_Mutation_p.F18I	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	18					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										TGGCCCCCGAAGAGGCAACGC	0.652																																					p.F18I		Atlas-SNP	.											.	.	.	.	0			c.T52A						PASS	.						44.0	48.0	47.0					14																	74206660		2203	4300	6503	SO:0001583	missense	91748	exon2			CCCCGAAGAGGCA	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.52T>A	chr14.hg19:g.74206660A>T	ENSP00000286523:p.Phe18Ile	55.0	0.0	.		39.0	15.0	.	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	hg19	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824093	0.50739	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371;ENST00000421708	T;T;T;T	0.21734	2.0;2.0;2.0;1.99	4.96	4.96	0.65561	.	0.081627	0.51477	D	0.000084	T	0.15089	0.0364	N	0.24115	0.695	0.47737	D	0.999504	B;B	0.31318	0.319;0.319	B;B	0.27608	0.081;0.081	T	0.05666	-1.0871	10	0.72032	D	0.01	-4.5629	13.0167	0.58762	1.0:0.0:0.0:0.0	.	18;18	A0PJD3;Q6PJG2	.;CN043_HUMAN	I	18	ENSP00000377634:F18I;ENSP00000286523:F18I;ENSP00000407767:F18I;ENSP00000402380:F18I	ENSP00000286523:F18I	F	-	1	0	C14orf43	73276413	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	6.822000	0.75277	2.089000	0.63090	0.402000	0.26972	TTC	.	.	.	none		0.652	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
BCL2L10	10017	hgsc.bcm.edu	37	15	52404725	52404725	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr15:52404725A>T	ENST00000561198.1	-	1	240	c.199T>A	c.(199-201)Tac>Aac	p.Y67N	BCL2L10_ENST00000260442.3_Missense_Mutation_p.Y67N			Q9HD36	B2L10_HUMAN	BCL2-like 10 (apoptosis facilitator)	57					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|female gamete generation (GO:0007292)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2				all cancers(107;0.0148)		TAGCCGAGGTAGGCGGAGAAA	0.716																																					p.Y67N		Atlas-SNP	.											.	BCL2L10	10	.	0			c.T199A						PASS	.						12.0	15.0	14.0					15																	52404725		2182	4283	6465	SO:0001583	missense	10017	exon1			CGAGGTAGGCGGA	AF285092	CCDS10148.1	15q21	2007-03-02			ENSG00000137875	ENSG00000137875			993	protein-coding gene	gene with protein product		606910				9829980, 9878060	Standard	NM_020396		Approved	Diva, Boo, BCL-B	uc002abq.3	Q9HD36	OTTHUMG00000131893	ENST00000561198.1:c.199T>A	chr15.hg19:g.52404725A>T	ENSP00000453562:p.Tyr67Asn	61.0	0.0	.		31.0	12.0	.	NM_020396	Q3SX80|Q52LQ9|Q8TCS9	Missense_Mutation	SNP	ENST00000561198.1	hg19		.	.	.	.	.	.	.	.	.	.	A	16.67	3.188072	0.57909	.	.	ENSG00000137875	ENST00000260442	T	0.11930	2.73	4.61	2.26	0.28386	Apoptosis regulator, Bcl-2, BH (2);	1.152810	0.06639	N	0.760739	T	0.27559	0.0677	L	0.51422	1.61	0.09310	N	1	D	0.63880	0.993	D	0.65987	0.94	T	0.13229	-1.0517	10	0.66056	D	0.02	.	5.067	0.14587	0.7532:0.0:0.2468:0.0	.	57	Q9HD36	B2L10_HUMAN	N	67	ENSP00000260442:Y67N	ENSP00000260442:Y67N	Y	-	1	0	BCL2L10	50192017	0.000000	0.05858	0.003000	0.11579	0.015000	0.08874	0.370000	0.20433	0.800000	0.34041	0.533000	0.62120	TAC	.	.	.	none		0.716	BCL2L10-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000419386.1		
ULK3	25989	hgsc.bcm.edu	37	15	75132623	75132623	+	Silent	SNP	C	C	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr15:75132623C>T	ENST00000440863.2	-	6	739	c.648G>A	c.(646-648)agG>agA	p.R216R	ULK3_ENST00000568667.1_Silent_p.R227R|ULK3_ENST00000569437.1_Silent_p.R216R	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	216	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)	2						CCGAGAACGACCTGGAGGCAA	0.652																																					p.R216R		Atlas-SNP	.											.	ULK3	30	.	0			c.G648A						PASS	.						25.0	27.0	26.0					15																	75132623		1915	4138	6053	SO:0001819	synonymous_variant	25989	exon6			GAACGACCTGGAG	BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.648G>A	chr15.hg19:g.75132623C>T		41.0	0.0	.		40.0	16.0	.	NM_001099436	B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Silent	SNP	ENST00000440863.2	hg19	CCDS45305.1																																																																																			.	.	.	none		0.652	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421734.4	NM_015518	
CLDN9	9080	hgsc.bcm.edu	37	16	3063765	3063765	+	Silent	SNP	C	C	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr16:3063765C>A	ENST00000445369.2	+	1	1309	c.402C>A	c.(400-402)atC>atA	p.I134I		NM_020982.3	NP_066192.1	O95484	CLD9_HUMAN	claudin 9	134					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(5)|prostate(2)	10						TGGTGCTCATCCCTGTGTGCT	0.662																																					p.I134I		Atlas-SNP	.											.	CLDN9	33	.	0			c.C402A						PASS	.						82.0	80.0	81.0					16																	3063765		2198	4300	6498	SO:0001819	synonymous_variant	9080	exon1			GCTCATCCCTGTG	AJ130941	CCDS10487.1	16p13.3	2008-08-01			ENSG00000213937	ENSG00000213937		"""Claudins"""	2051	protein-coding gene	gene with protein product		615799				9441748, 18234789	Standard	NM_020982		Approved		uc010uwo.1	O95484	OTTHUMG00000129000	ENST00000445369.2:c.402C>A	chr16.hg19:g.3063765C>A		82.0	0.0	.		102.0	55.0	.	NM_020982		Silent	SNP	ENST00000445369.2	hg19	CCDS10487.1																																																																																			.	.	.	none		0.662	CLDN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250989.1	NM_020982	
SMG8	55181	hgsc.bcm.edu	37	17	57288259	57288259	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:57288259C>A	ENST00000543872.2	+	2	1111	c.847C>A	c.(847-849)Caa>Aaa	p.Q283K	SMG8_ENST00000578922.1_Missense_Mutation_p.Q283K|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000300917.5_Missense_Mutation_p.Q283K|SMG8_ENST00000580498.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	283					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						TCCTCGGAACCAAGACCCAGC	0.517																																					p.Q283K		Atlas-SNP	.											.	SMG8	79	.	0			c.C847A						PASS	.						66.0	73.0	70.0					17																	57288259		2203	4300	6503	SO:0001583	missense	55181	exon1			CGGAACCAAGACC	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.847C>A	chr17.hg19:g.57288259C>A	ENSP00000438748:p.Gln283Lys	41.0	0.0	.		74.0	5.0	.	NM_018149	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	hg19	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	C	8.062	0.768336	0.15983	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.41400	1.0;1.0	5.88	5.88	0.94601	.	0.345316	0.35179	N	0.003390	T	0.37732	0.1014	L	0.40543	1.245	0.43852	D	0.99644	B	0.19583	0.037	B	0.15052	0.012	T	0.09250	-1.0683	10	0.22706	T	0.39	-16.8779	19.2147	0.93772	0.0:1.0:0.0:0.0	.	283	Q8ND04	SMG8_HUMAN	K	283	ENSP00000300917:Q283K;ENSP00000438748:Q283K	ENSP00000300917:Q283K	Q	+	1	0	SMG8	54643041	0.999000	0.42202	1.000000	0.80357	0.961000	0.63080	3.993000	0.56987	2.769000	0.95229	0.655000	0.94253	CAA	.	.	.	none		0.517	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
POLRMT	5442	hgsc.bcm.edu	37	19	623528	623528	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr19:623528T>C	ENST00000588649.2	-	6	1300	c.1216A>G	c.(1216-1218)Atg>Gtg	p.M406V	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	406					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGCTCCATGTGGAGCTGC	0.632																																					p.M406V		Atlas-SNP	.											.	POLRMT	91	.	0			c.A1216G						PASS	.						54.0	50.0	51.0					19																	623528		2203	4300	6503	SO:0001583	missense	5442	exon6			GCTCCATGTGGAG		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.1216A>G	chr19.hg19:g.623528T>C	ENSP00000465759:p.Met406Val	71.0	0.0	.		52.0	11.0	.	NM_005035	O60370	Missense_Mutation	SNP	ENST00000588649.2	hg19	CCDS12036.1	.	.	.	.	.	.	.	.	.	.	.	0.013	-1.639596	0.00799	.	.	ENSG00000099821	ENST00000215591	T	0.39056	1.1	4.63	-4.26	0.03755	.	0.752409	0.12789	N	0.438968	T	0.08935	0.0221	N	0.01446	-0.86	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31280	-0.9949	10	0.02654	T	1	-12.8428	0.5899	0.00726	0.249:0.2907:0.1226:0.3377	.	406	O00411	RPOM_HUMAN	V	406	ENSP00000215591:M406V	ENSP00000215591:M406V	M	-	1	0	POLRMT	574528	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.196000	0.03041	-0.378000	0.07918	-2.005000	0.00442	ATG	.	.	.	none		0.632	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
KEAP1	9817	hgsc.bcm.edu	37	19	10610566	10610566	+	Silent	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr19:10610566G>T	ENST00000171111.5	-	2	691	c.144C>A	c.(142-144)ggC>ggA	p.G48G	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Silent_p.G48G	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	48					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	AGGTGCGGTTGCCATGCTGGG	0.627																																					p.G48G		Atlas-SNP	.											.	KEAP1	182	.	0			c.C144A						PASS	.						136.0	108.0	118.0					19																	10610566		2203	4300	6503	SO:0001819	synonymous_variant	9817	exon2			GCGGTTGCCATGC	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.144C>A	chr19.hg19:g.10610566G>T		62.0	0.0	.		63.0	24.0	.	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Silent	SNP	ENST00000171111.5	hg19	CCDS12239.1																																																																																			.	.	.	none		0.627	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
KMT2B	9757	hgsc.bcm.edu	37	19	36229181	36229181	+	Splice_Site	SNP	A	A	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr19:36229181A>G	ENST00000222270.7	+	37	7872		c.e37-1		IGFLR1_ENST00000587101.1_5'Flank|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Splice_Site	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B						chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCATCCCTGCAGGGCATCGGG	0.602																																					.		Atlas-SNP	.											.	MLL4	229	.	0			c.7873-2A>G						PASS	.						60.0	68.0	65.0					19																	36229181		2182	4290	6472	SO:0001630	splice_region_variant	8085	exon37			CCCTGCAGGGCAT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.7873-1A>G	chr19.hg19:g.36229181A>G		56.0	0.0	.		36.0	15.0	.	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Splice_Site	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	A	12.28	1.890467	0.33348	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4398	0.67309	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AD000671.1	40921021	1.000000	0.71417	0.916000	0.36221	0.245000	0.25701	9.339000	0.96797	2.063000	0.61619	0.379000	0.24179	.	.	.	.	none		0.602	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	Intron
COL9A3	1299	hgsc.bcm.edu	37	20	61467549	61467549	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr20:61467549G>T	ENST00000343916.3	+	28	1415	c.1412G>T	c.(1411-1413)cGa>cTa	p.R471L	COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	471	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					TCTGGCAGTCGAGGGGAGCTG	0.716																																					p.R471L		Atlas-SNP	.											.	COL9A3	70	.	0			c.G1412T						PASS	.						18.0	24.0	22.0					20																	61467549		2201	4297	6498	SO:0001583	missense	1299	exon28			GCAGTCGAGGGGA	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1412G>T	chr20.hg19:g.61467549G>T	ENSP00000341640:p.Arg471Leu	82.0	0.0	.		81.0	22.0	.	NM_001853	Q13681|Q9H4G9|Q9UPE2	Missense_Mutation	SNP	ENST00000343916.3	hg19	CCDS13505.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448038	0.84101	.	.	ENSG00000092758	ENST00000343916	D	0.93712	-3.27	4.63	4.63	0.57726	.	0.283555	0.33127	N	0.005250	D	0.95367	0.8496	L	0.53729	1.69	0.46241	D	0.998947	D	0.89917	1.0	D	0.73380	0.98	D	0.94429	0.7648	10	0.32370	T	0.25	.	17.4821	0.87675	0.0:0.0:1.0:0.0	.	471	Q14050	CO9A3_HUMAN	L	471	ENSP00000341640:R471L	ENSP00000341640:R471L	R	+	2	0	COL9A3	60937994	1.000000	0.71417	0.984000	0.44739	0.994000	0.84299	7.254000	0.78329	2.117000	0.64856	0.561000	0.74099	CGA	.	.	.	none		0.716	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853	
TANGO2	128989	hgsc.bcm.edu	37	22	20030918	20030918	+	Missense_Mutation	SNP	C	C	T	rs551072560		TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr22:20030918C>T	ENST00000327374.4	+	3	275	c.97C>T	c.(97-99)Ccc>Tcc	p.P33S	TANGO2_ENST00000401833.1_Missense_Mutation_p.P74S|TANGO2_ENST00000398042.2_Missense_Mutation_p.P33S|TANGO2_ENST00000434570.2_Missense_Mutation_p.P74S|TANGO2_ENST00000456048.1_Missense_Mutation_p.P38S|TANGO2_ENST00000432883.1_Missense_Mutation_p.P33S|TANGO2_ENST00000447208.2_Missense_Mutation_p.P33S|TANGO2_ENST00000420290.2_5'UTR|TANGO2_ENST00000401886.1_Missense_Mutation_p.P33S|TANGO2_ENST00000479679.1_3'UTR	NM_001283106.1|NM_001283116.1|NM_001283148.1|NM_001283154.1|NM_152906.4	NP_001270035.1|NP_001270045.1|NP_001270077.1|NP_001270083.1|NP_690870.3	Q6ICL3	TNG2_HUMAN	transport and golgi organization 2 homolog (Drosophila)	33																	CTACAGCCGACCCTCCAAGTT	0.542													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20269	0.0		0.0	False		,,,				2504	0.0				p.P33S		Atlas-SNP	.											.	TANGO2	4	.	0			c.C97T						PASS	.						139.0	142.0	141.0					22																	20030918		2203	4300	6503	SO:0001583	missense	128989	exon3			AGCCGACCCTCCA		CCDS13772.1, CCDS63404.1, CCDS63405.1, CCDS63406.1, CCDS63407.1, CCDS74821.1, CCDS74822.1	22q11.21	2012-12-13	2012-12-13	2012-12-13	ENSG00000183597	ENSG00000183597			25439	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 25"""	C22orf25		12477932	Standard	XM_005261222		Approved	DKFZp761P1121	uc002zrc.1	Q6ICL3	OTTHUMG00000150510	ENST00000327374.4:c.97C>T	chr22.hg19:g.20030918C>T	ENSP00000332721:p.Pro33Ser	75.0	0.0	.		95.0	28.0	.	NM_152906	A8MUE9|B7WNV6|B7Z583|B7Z730|D3DX23|Q8IW05|Q8NAL0|Q8TCS0|Q96M16	Missense_Mutation	SNP	ENST00000327374.4	hg19	CCDS13772.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320659	0.41096	.	.	ENSG00000183597	ENST00000401886;ENST00000432198;ENST00000447208;ENST00000398042;ENST00000450664;ENST00000327374;ENST00000432883;ENST00000401833;ENST00000434168;ENST00000434570;ENST00000456048	T;T;T;T;T;T;T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8	4.89	3.87	0.44632	.	0.174725	0.50627	D	0.000101	T	0.57169	0.2035	M	0.92412	3.305	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.999;0.994;0.999;0.999;0.999;0.991	D;D;D;D;D;D;D	0.74674	0.984;0.984;0.932;0.984;0.984;0.975;0.933	T	0.66456	-0.5919	10	0.72032	D	0.01	-12.9932	11.3355	0.49500	0.0:0.9094:0.0:0.0906	.	33;74;33;74;33;33;33	B7Z9Q5;B7Z730;B7Z4A5;B7WNV6;Q6AHY1;Q6ICL3;Q6ICL3-2	.;.;.;.;.;CV025_HUMAN;.	S	33;33;33;33;33;33;33;74;33;74;38	ENSP00000385662:P33S;ENSP00000413850:P33S;ENSP00000389797:P33S;ENSP00000381122:P33S;ENSP00000415450:P33S;ENSP00000332721:P33S;ENSP00000402926:P33S;ENSP00000384827:P74S;ENSP00000411602:P33S;ENSP00000391262:P74S;ENSP00000403645:P38S	ENSP00000332721:P33S	P	+	1	0	C22orf25	18410918	1.000000	0.71417	0.061000	0.19648	0.149000	0.21700	4.652000	0.61454	1.197000	0.43143	-0.258000	0.10820	CCC	.	.	.	none		0.542	TANGO2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318689.2	NM_152906	
BCOR	54880	hgsc.bcm.edu	37	X	39932148	39932148	+	Silent	SNP	A	A	G			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chrX:39932148A>G	ENST00000378444.4	-	4	2679	c.2451T>C	c.(2449-2451)acT>acC	p.T817T	BCOR_ENST00000378455.4_Silent_p.T817T|BCOR_ENST00000342274.4_Silent_p.T817T|BCOR_ENST00000397354.3_Silent_p.T817T	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	817					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CGTTTGTGTCAGTTTTAGCAT	0.547			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.T817T		Atlas-SNP	.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR	351	.	0			c.T2451C						PASS	.						89.0	87.0	88.0					X																	39932148		2202	4300	6502	SO:0001819	synonymous_variant	54880	exon4			TGTGTCAGTTTTA	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.2451T>C	chrX.hg19:g.39932148A>G		97.0	0.0	.		72.0	36.0	.	NM_001123385	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	hg19	CCDS48093.1																																																																																			.	.	.	none		0.547	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
YIPF3	25844	hgsc.bcm.edu	37	6	43483379	43483379	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr6:43483379delT	ENST00000372422.2	-	3	531	c.349delA	c.(349-351)atcfs	p.I117fs	POLR1C_ENST00000304004.3_5'Flank|POLR1C_ENST00000372344.2_5'Flank|POLR1C_ENST00000372389.3_5'Flank|YIPF3_ENST00000506469.1_Frame_Shift_Del_p.I123fs	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	117					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GGTCTGAGGATGTCGATGTTG	0.517																																					p.I117fs		Atlas-Indel,Pindel	.											.	YIPF3	20	.	0			c.350delT						PASS	.						129.0	120.0	123.0					6																	43483379		2203	4300	6503	SO:0001589	frameshift_variant	25844	exon3			.	AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.349delA	chr6.hg19:g.43483379delT	ENSP00000361499:p.Ile117fs	102.0	0.0	0		81.0	32.0	0.395062	NM_015388	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Frame_Shift_Del	DEL	ENST00000372422.2	hg19	CCDS4899.1																																																																																			.	.	.	none		0.517	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388	
OGDH	4967	hgsc.bcm.edu	37	7	44747231	44747232	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr7:44747231_44747232insA	ENST00000222673.5	+	22	2889_2890	c.2847_2848insA	c.(2848-2850)aatfs	p.N950fs	OGDH_ENST00000543843.1_Frame_Shift_Ins_p.N901fs|OGDH_ENST00000444676.1_Frame_Shift_Ins_p.N965fs|OGDH_ENST00000449767.1_Frame_Shift_Ins_p.N946fs|OGDH_ENST00000439616.2_Frame_Shift_Ins_p.N800fs|OGDH_ENST00000447398.1_Frame_Shift_Ins_p.N961fs	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	950					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	AGAAGTACCCCAATGCTGAGCT	0.574																																					p.P949fs		Atlas-Indel,Pindel	.											.	OGDH	145	.	0			c.2847_2848insA						PASS	.																																			SO:0001589	frameshift_variant	4967	exon22			.	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.2849dupA	chr7.hg19:g.44747233_44747233dupA	ENSP00000222673:p.Asn950fs	55.0	0.0	0		102.0	38.0	0.372549	NM_002541	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Frame_Shift_Ins	INS	ENST00000222673.5	hg19	CCDS34627.1																																																																																			.	.	.	none		0.574	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
FOXN1	8456	hgsc.bcm.edu	37	17	26851949	26851949	+	Frame_Shift_Del	DEL	C	C	-	rs548499213	byFrequency	TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr17:26851949delC	ENST00000226247.2	+	2	581	c.552delC	c.(550-552)ctcfs	p.L184fs	FOXN1_ENST00000579795.1_Frame_Shift_Del_p.L184fs	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	184					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					GTAACGGGCTCCCCTACCCCA	0.647																																					p.L184fs		Atlas-Indel,Pindel	.											.	FOXN1	51	.	0			c.551delT						PASS	.						25.0	27.0	26.0					17																	26851949		2202	4300	6502	SO:0001589	frameshift_variant	8456	exon2			.	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.552delC	chr17.hg19:g.26851949delC	ENSP00000226247:p.Leu184fs	25.0	0.0	0		62.0	21.0	0.33871	NM_003593	B2R9Q7|O15352	Frame_Shift_Del	DEL	ENST00000226247.2	hg19	CCDS11232.1																																																																																			.	.	.	none		0.647	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1		
ATP2B1	490	hgsc.bcm.edu	37	12	89992987	89992988	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr12:89992987_89992988insAA	ENST00000428670.3	-	20	3713_3714	c.3257_3258insTT	c.(3256-3258)ttafs	p.L1086fs	ATP2B1_ENST00000261173.2_Frame_Shift_Ins_p.L1086fs|ATP2B1_ENST00000393164.2_Frame_Shift_Ins_p.L829fs|ATP2B1_ENST00000348959.3_Frame_Shift_Ins_p.L1050fs|ATP2B1_ENST00000359142.3_Frame_Shift_Ins_p.L1086fs			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	1086					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						CATCCTCTGCTAATTCCTCCTC	0.436																																					p.L1086fs		Pindel	.											.	ATP2B1	191	.	0			c.3258_3259insTT						PASS	.																																			SO:0001589	frameshift_variant	490	exon19			.	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.3256_3257dupTT	chr12.hg19:g.89992988_89992989dupAA	ENSP00000392043:p.Leu1086fs	66.0	0.0	.		83.0	30.0	0.361	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Frame_Shift_Ins	INS	ENST00000428670.3	hg19	CCDS9035.1																																																																																			.	.	.	none		0.436	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
THSD1	55901	hgsc.bcm.edu	37	13	52971551	52971551	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr13:52971551delG	ENST00000258613.4	-	3	1015	c.837delC	c.(835-837)cccfs	p.P279fs	RNY4P24_ENST00000362735.1_RNA|THSD1_ENST00000544466.1_Intron|THSD1_ENST00000349258.4_Frame_Shift_Del_p.P279fs	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	279					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CAGGGTATCTGGGGGCCTCCT	0.537																																					p.R280fs		Pindel	.											.	THSD1	89	.	0			c.838delA						PASS	.						75.0	74.0	74.0					13																	52971551		2203	4300	6503	SO:0001589	frameshift_variant	55901	exon3			.	AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.837delC	chr13.hg19:g.52971551delG	ENSP00000258613:p.Pro279fs	84.0	0.0	.		117.0	27.0	0.231	NM_018676	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Frame_Shift_Del	DEL	ENST00000258613.4	hg19	CCDS9432.1																																																																																			.	.	.	none		0.537	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3		
ACOX2	8309	hgsc.bcm.edu	37	3	58519841	58519842	+	Frame_Shift_Ins	INS	-	-	TATATTT			TCGA-A4-A5XZ-01A-11D-A31X-10	TCGA-A4-A5XZ-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	363096af-a78b-4834-a631-bebac9ce1659	9f1e35f9-8141-463b-a1b9-3fc7a83df607	g.chr3:58519841_58519842insTATATTT	ENST00000302819.5	-	4	645_646	c.354_355insAAATATA	c.(352-357)atacacfs	p.H119fs	ACOX2_ENST00000459701.2_Frame_Shift_Ins_p.H119fs	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	119					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		AAGACTCTGTGTATATTTAAGG	0.54																																					p.H119fs		Pindel	.											.	ACOX2	53	.	0			c.355_356insAAATATA						PASS	.																																			SO:0001589	frameshift_variant	8309	exon4			.	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.348_354dupAAATATA	chr3.hg19:g.58519842_58519848dupTATATTT	ENSP00000307697:p.His119fs	81.0	0.0	.		65.0	12.0	0.185	NM_003500	A6NF16|B2R8U5	Frame_Shift_Ins	INS	ENST00000302819.5	hg19	CCDS33775.1																																																																																			.	.	.	none		0.540	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353541.1		
