#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
H6PD	9563	hgsc.bcm.edu	37	1	9305536	9305536	+	Silent	SNP	C	C	T	rs375431974		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:9305536C>T	ENST00000377403.2	+	2	845	c.543C>T	c.(541-543)ttC>ttT	p.F181F	H6PD_ENST00000602477.1_Silent_p.F192F	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	181	Glucose 1-dehydrogenase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		ATGACCACTTCTCAGCCCAGC	0.587																																					p.F181F		Atlas-SNP	.											.	H6PD	71	.	0			c.C543T						PASS	.						47.0	52.0	50.0					1																	9305536		2203	4300	6503	SO:0001819	synonymous_variant	9563	exon2			CCACTTCTCAGCC	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.543C>T	chr1.hg19:g.9305536C>T		108.0	0.0	.		101.0	39.0	.	NM_004285	Q4TT33|Q66I35|Q68DT3	Silent	SNP	ENST00000377403.2	hg19	CCDS101.1																																																																																			.	.	.	none		0.587	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285	
RABGGTB	5876	hgsc.bcm.edu	37	1	76253203	76253203	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:76253203A>G	ENST00000319942.3	+	2	96	c.25A>G	c.(25-27)Att>Gtt	p.I9V	SNORD45A_ENST00000384512.1_RNA|RABGGTB_ENST00000496055.1_3'UTR|SNORD45B_ENST00000364617.1_RNA|SNORD45C_ENST00000383893.1_RNA|RABGGTB_ENST00000370826.3_Missense_Mutation_p.I9V|RABGGTB_ENST00000535300.1_5'UTR	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit	9					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						GAAGGATGTTATTATCAAGTC	0.368																																					p.I9V		Atlas-SNP	.											.	RABGGTB	37	.	0			c.A25G						PASS	.						147.0	134.0	139.0					1																	76253203		2203	4300	6503	SO:0001583	missense	5876	exon2			GATGTTATTATCA	U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.25A>G	chr1.hg19:g.76253203A>G	ENSP00000317473:p.Ile9Val	127.0	0.0	.		162.0	72.0	.	NM_004582	Q92697	Missense_Mutation	SNP	ENST00000319942.3	hg19	CCDS669.1	.	.	.	.	.	.	.	.	.	.	A	9.952	1.220540	0.22457	.	.	ENSG00000137955	ENST00000319942;ENST00000370824;ENST00000370826	.	.	.	5.05	0.547	0.17202	.	0.830524	0.11309	N	0.577349	T	0.07683	0.0193	N	0.05199	-0.095	0.18873	N	0.999984	B	0.02656	0.0	B	0.01281	0.0	T	0.39292	-0.9621	9	0.29301	T	0.29	-8.2035	10.2082	0.43126	0.5747:0.0:0.4253:0.0	.	9	P53611	PGTB2_HUMAN	V	9	.	ENSP00000317473:I9V	I	+	1	0	RABGGTB	76025791	0.001000	0.12720	0.210000	0.23637	0.847000	0.48162	0.335000	0.19806	0.044000	0.15775	0.533000	0.62120	ATT	.	.	.	none		0.368	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026972.1	NM_004582	
OVGP1	5016	hgsc.bcm.edu	37	1	111957940	111957940	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:111957940A>C	ENST00000369732.3	-	11	1238	c.1183T>G	c.(1183-1185)Ttt>Gtt	p.F395V	OVGP1_ENST00000540696.1_3'UTR	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	395					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GACAGCCAAAATTGTGGTAAA	0.433																																					p.F395V		Atlas-SNP	.											.	OVGP1	177	.	0			c.T1183G						PASS	.						48.0	46.0	47.0					1																	111957940		2203	4300	6503	SO:0001583	missense	5016	exon11			GCCAAAATTGTGG	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1183T>G	chr1.hg19:g.111957940A>C	ENSP00000358747:p.Phe395Val	91.0	0.0	.		98.0	38.0	.	NM_002557	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	ENST00000369732.3	hg19	CCDS834.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.791958	0.31685	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331	T	0.03860	3.78	4.43	0.705	0.18127	.	0.784649	0.10922	N	0.619328	T	0.00875	0.0029	L	0.36672	1.1	0.09310	N	1	B;P	0.39831	0.105;0.69	B;B	0.29598	0.014;0.104	T	0.47623	-0.9103	10	0.22109	T	0.4	-2.4013	3.3373	0.07106	0.5411:0.0:0.0994:0.3595	.	395;459	Q12889;Q59HH5	OVGP1_HUMAN;.	V	395;459;203	ENSP00000358747:F395V	ENSP00000358743:F459V	F	-	1	0	OVGP1	111759463	0.000000	0.05858	0.000000	0.03702	0.103000	0.19146	0.154000	0.16343	0.097000	0.17492	0.477000	0.44152	TTT	.	.	.	none		0.433	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
CCT3	7203	hgsc.bcm.edu	37	1	156294858	156294858	+	Silent	SNP	A	A	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:156294858A>G	ENST00000295688.3	-	6	607	c.327T>C	c.(325-327)gcT>gcC	p.A109A	CCT3_ENST00000368261.3_Silent_p.A64A|CCT3_ENST00000472765.2_Silent_p.A64A|CCT3_ENST00000368259.2_Silent_p.A71A	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	109					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GGAAGTGCTCAGCTACAGACA	0.413																																					p.A109A		Atlas-SNP	.											.	CCT3	61	.	0			c.T327C						PASS	.						92.0	84.0	87.0					1																	156294858		2203	4300	6503	SO:0001819	synonymous_variant	7203	exon6			GTGCTCAGCTACA	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.327T>C	chr1.hg19:g.156294858A>G		30.0	0.0	.		36.0	17.0	.	NM_005998	A6NE14|Q5SZY1|Q9BR64	Silent	SNP	ENST00000295688.3	hg19	CCDS1140.2																																																																																			.	.	.	none		0.413	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
HHIPL2	79802	hgsc.bcm.edu	37	1	222705394	222705394	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:222705394C>T	ENST00000343410.6	-	6	1695	c.1637G>A	c.(1636-1638)tGc>tAc	p.C546Y		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	546					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GCTGCCCAGGCAAAGATCCTG	0.428																																					p.C546Y		Atlas-SNP	.											.	HHIPL2	122	.	0			c.G1637A						PASS	.						87.0	87.0	87.0					1																	222705394		2203	4300	6503	SO:0001583	missense	79802	exon6			CCCAGGCAAAGAT	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1637G>A	chr1.hg19:g.222705394C>T	ENSP00000342118:p.Cys546Tyr	56.0	0.0	.		65.0	31.0	.	NM_024746	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	hg19	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.343683	0.82022	.	.	ENSG00000143512	ENST00000343410	T	0.13307	2.6	5.0	5.0	0.66597	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.47600	0.1454	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58532	-0.7620	10	0.51188	T	0.08	-17.4954	17.9254	0.88982	0.0:1.0:0.0:0.0	.	546	Q6UWX4	HIPL2_HUMAN	Y	546	ENSP00000342118:C546Y	ENSP00000342118:C546Y	C	-	2	0	HHIPL2	220772017	1.000000	0.71417	0.980000	0.43619	0.936000	0.57629	5.693000	0.68264	2.304000	0.77564	0.591000	0.81541	TGC	.	.	.	none		0.428	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
C1orf95	375057	hgsc.bcm.edu	37	1	226784625	226784625	+	Missense_Mutation	SNP	G	G	A	rs531129279		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:226784625G>A	ENST00000366788.3	+	2	430	c.325G>A	c.(325-327)Gtc>Atc	p.V109I	C1orf95_ENST00000366789.4_Missense_Mutation_p.V109I	NM_001003665.3	NP_001003665.1	Q69YW2	STUM_HUMAN	chromosome 1 open reading frame 95	109						integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(3)	8	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		CACTGCCATCGTCATGGTGGG	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22256	0.0		0.0	False		,,,				2504	0.0				p.V109I		Atlas-SNP	.											.	C1orf95	16	.	0			c.G325A						PASS	.						167.0	143.0	151.0					1																	226784625		2203	4300	6503	SO:0001583	missense	375057	exon2			GCCATCGTCATGG	AF035308	CCDS31044.1	1q42.12	2012-06-26			ENSG00000203685	ENSG00000203685			30491	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001003665		Approved	DKFZp761P211	uc021pjw.1	Q69YW2	OTTHUMG00000037583	ENST00000366788.3:c.325G>A	chr1.hg19:g.226784625G>A	ENSP00000355752:p.Val109Ile	84.0	0.0	.		91.0	38.0	.	NM_001003665	A6NGL2	Missense_Mutation	SNP	ENST00000366788.3	hg19	CCDS31044.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469818	0.43839	.	.	ENSG00000203685	ENST00000366788;ENST00000366789	.	.	.	5.82	5.82	0.92795	.	0.154593	0.43919	D	0.000509	T	0.34658	0.0905	N	0.03324	-0.35	0.38912	D	0.957563	B	0.24368	0.102	B	0.17979	0.02	T	0.34825	-0.9813	9	0.08599	T	0.76	1.3905	19.6956	0.96023	0.0:0.0:1.0:0.0	.	109	Q69YW2	CA095_HUMAN	I	109	.	ENSP00000355752:V109I	V	+	1	0	C1orf95	224851248	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.144000	0.71762	2.756000	0.94617	0.561000	0.74099	GTC	.	.	.	none		0.612	C1orf95-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091634.1	NM_001003665	
CTNNA2	1496	hgsc.bcm.edu	37	2	80136916	80136916	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:80136916T>C	ENST00000402739.4	+	6	1054	c.1049T>C	c.(1048-1050)aTg>aCg	p.M350T	CTNNA2_ENST00000361291.4_Missense_Mutation_p.M384T|CTNNA2_ENST00000540488.1_Missense_Mutation_p.M350T|CTNNA2_ENST00000466387.1_Missense_Mutation_p.M350T|CTNNA2_ENST00000496558.1_Missense_Mutation_p.M350T|CTNNA2_ENST00000541047.1_Missense_Mutation_p.M350T	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	350					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AGCGAGTACATGAATAATGTA	0.547																																					p.M350T		Atlas-SNP	.											.	CTNNA2	462	.	0			c.T1049C						PASS	.						37.0	42.0	40.0					2																	80136916		2057	4213	6270	SO:0001583	missense	1496	exon7			AGTACATGAATAA		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1049T>C	chr2.hg19:g.80136916T>C	ENSP00000384638:p.Met350Thr	156.0	0.0	.		169.0	70.0	.	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	hg19		.	.	.	.	.	.	.	.	.	.	T	16.91	3.252854	0.59212	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24	5.6	5.6	0.85130	.	0.283582	0.39759	N	0.001274	T	0.47673	0.1458	M	0.71581	2.175	0.80722	D	1	P;B;B	0.43231	0.801;0.23;0.111	P;B;B	0.48063	0.565;0.064;0.064	T	0.39901	-0.9591	10	0.27785	T	0.31	.	15.7808	0.78257	0.0:0.0:0.0:1.0	.	350;350;350	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	T	350;350;384;350;350;350	ENSP00000418191:M350T;ENSP00000419295:M350T;ENSP00000355398:M384T;ENSP00000384638:M350T;ENSP00000444675:M350T;ENSP00000441705:M350T	ENSP00000355398:M384T	M	+	2	0	CTNNA2	79990427	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.988000	0.88194	2.142000	0.66516	0.482000	0.46254	ATG	.	.	.	none		0.547	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
ZNF804A	91752	hgsc.bcm.edu	37	2	185802210	185802211	+	Missense_Mutation	DNP	AC	AC	CA	rs5836928|rs3046266	byFrequency	TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:185802210_185802211AC>CA	ENST00000302277.6	+	4	2681_2682	c.2087_2088AC>CA	c.(2086-2088)aAC>aCA	p.N696T		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	696							metal ion binding (GO:0046872)	p.N696K(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TGTAAAAAGAACACAATACTTT	0.292																																					p.N696T|p.N696K		Atlas-SNP	.											.|ZNF804A,NS,carcinoma,0,1	ZNF804A	322	.	1	Substitution - Missense(1)	ovary(1)	c.A2087C|c.C2088A						PASS	.																																			SO:0001583	missense	91752	exon4			AAAAGAACACAAT|AAAGAACACAATA	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	Exception_encountered	chr2.hg19:g.185802210_185802211delinsCA	ENSP00000303252:p.Asn696Thr	135.0|137.0	0.0	.		570.0	24.0|32.0	.	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	hg19	CCDS2291.1																																																																																			.	.	.	none		0.292	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
ZNF804A	91752	hgsc.bcm.edu	37	2	185802216	185802216	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:185802216T>C	ENST00000302277.6	+	4	2687	c.2093T>C	c.(2092-2094)aTa>aCa	p.I698T		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	698							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AAGAACACAATACTTTTAAAT	0.294																																					p.I698T		Atlas-SNP	.											.	ZNF804A	322	.	0			c.T2093C						PASS	.						73.0	67.0	69.0					2																	185802216		2194	4291	6485	SO:0001583	missense	91752	exon4			ACACAATACTTTT	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2093T>C	chr2.hg19:g.185802216T>C	ENSP00000303252:p.Ile698Thr	137.0	0.0	.		569.0	30.0	.	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	hg19	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	T	3.795	-0.042847	0.07452	.	.	ENSG00000170396	ENST00000302277	T	0.05258	3.47	5.63	0.374	0.16183	.	1.826620	0.02817	N	0.125135	T	0.04227	0.0117	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40776	-0.9545	10	0.27082	T	0.32	-0.3078	8.4113	0.32644	0.0:0.5963:0.0:0.4037	.	698	Q7Z570	Z804A_HUMAN	T	698	ENSP00000303252:I698T	ENSP00000303252:I698T	I	+	2	0	ZNF804A	185510461	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.483000	0.22292	0.077000	0.16863	0.533000	0.62120	ATA	.	.	.	none		0.294	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
CUL3	8452	hgsc.bcm.edu	37	2	225362540	225362540	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr2:225362540C>G	ENST00000264414.4	-	12	1975	c.1637G>C	c.(1636-1638)cGa>cCa	p.R546P	CUL3_ENST00000344951.4_Missense_Mutation_p.R480P|CUL3_ENST00000409777.1_Missense_Mutation_p.R522P|CUL3_ENST00000409096.1_Missense_Mutation_p.R522P	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	546					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TGTGAGCTGTCGACCACTGTG	0.353																																					p.R552P		Atlas-SNP	.											CUL3,NS,adenocarcinoma,0,1	CUL3	96	.	0			c.G1655C						PASS	.						150.0	140.0	143.0					2																	225362540		2203	4300	6503	SO:0001583	missense	8452	exon12			AGCTGTCGACCAC	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1637G>C	chr2.hg19:g.225362540C>G	ENSP00000264414:p.Arg546Pro	122.0	0.0	.		52.0	48.0	.	NM_001257198	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	ENST00000264414.4	hg19	CCDS2462.1	.	.	.	.	.	.	.	.	.	.	C	34	5.352209	0.95830	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	6.16	6.16	0.99307	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.96719	0.8929	H	0.98276	4.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97283	0.9919	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	480;524;546	Q13618-3;Q53S54;Q13618	.;.;CUL3_HUMAN	P	546;480;522;522	ENSP00000264414:R546P;ENSP00000343601:R480P;ENSP00000387200:R522P;ENSP00000386525:R522P	ENSP00000264414:R546P	R	-	2	0	CUL3	225070784	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.802000	0.85969	2.937000	0.99478	0.650000	0.86243	CGA	.	.	.	none		0.353	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
CISH	1154	hgsc.bcm.edu	37	3	50645901	50645901	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:50645901C>A	ENST00000348721.3	-	2	324	c.144G>T	c.(142-144)gaG>gaT	p.E48D	CISH_ENST00000443053.2_Missense_Mutation_p.E65D	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	48					intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CTGGGGTACCCTCTGCCACCT	0.642																																					p.E65D		Atlas-SNP	.											.	CISH	27	.	0			c.G195T						PASS	.						54.0	49.0	51.0					3																	50645901		2203	4300	6503	SO:0001583	missense	1154	exon3			GGTACCCTCTGCC	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.144G>T	chr3.hg19:g.50645901C>A	ENSP00000294173:p.Glu48Asp	64.0	0.0	.		49.0	28.0	.	NM_013324	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Missense_Mutation	SNP	ENST00000348721.3	hg19	CCDS2831.1	.	.	.	.	.	.	.	.	.	.	C	7.873	0.728634	0.15507	.	.	ENSG00000114737	ENST00000443053;ENST00000348721	T;T	0.47177	0.85;0.87	6.03	2.26	0.28386	.	0.367420	0.28209	N	0.016181	T	0.35885	0.0947	L	0.57536	1.79	0.28436	N	0.917019	B;B	0.28082	0.2;0.048	B;B	0.23574	0.047;0.012	T	0.21690	-1.0238	10	0.14656	T	0.56	-8.0475	6.8677	0.24102	0.0:0.587:0.119:0.294	.	65;48	G5E9R1;Q9NSE2	.;CISH_HUMAN	D	65;48	ENSP00000409346:E65D;ENSP00000294173:E48D	ENSP00000294173:E48D	E	-	3	2	CISH	50620905	0.991000	0.36638	1.000000	0.80357	0.071000	0.16799	0.437000	0.21543	0.441000	0.26529	-0.150000	0.13652	GAG	.	.	.	none		0.642	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	NM_145071	
DNAH1	25981	hgsc.bcm.edu	37	3	52380547	52380547	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:52380547C>A	ENST00000420323.2	+	11	1977	c.1716C>A	c.(1714-1716)agC>agA	p.S572R		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	572	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGCGCAGCAGCCTGCGCGACA	0.572																																					p.S572R		Atlas-SNP	.											.	DNAH1	534	.	0			c.C1716A						PASS	.						55.0	57.0	56.0					3																	52380547		2141	4243	6384	SO:0001583	missense	25981	exon11			CAGCAGCCTGCGC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.1716C>A	chr3.hg19:g.52380547C>A	ENSP00000401514:p.Ser572Arg	36.0	0.0	.		42.0	11.0	.	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	hg19	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127059	0.56721	.	.	ENSG00000114841	ENST00000420323	T	0.24350	1.86	4.53	4.53	0.55603	.	0.443881	0.19011	N	0.125064	T	0.34513	0.0900	M	0.72894	2.215	0.39055	D	0.960409	P;P	0.45957	0.713;0.869	B;P	0.47981	0.434;0.563	T	0.15263	-1.0443	10	0.23302	T	0.38	.	11.8369	0.52330	0.0:0.9149:0.0:0.0851	.	572;572	C9JXH6;Q9P2D7-3	.;.	R	572	ENSP00000401514:S572R	ENSP00000401514:S572R	S	+	3	2	DNAH1	52355587	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	2.033000	0.41136	2.085000	0.62840	0.563000	0.77884	AGC	.	.	.	none		0.572	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
A4GNT	51146	hgsc.bcm.edu	37	3	137849689	137849689	+	Splice_Site	SNP	A	A	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:137849689A>C	ENST00000236709.3	-	2	610		c.e2+1			NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase						carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						CTAAACACTTACTTGATTGTA	0.403																																					.		Atlas-SNP	.											.	A4GNT	42	.	0			c.408+2T>G						PASS	.						65.0	65.0	65.0					3																	137849689		2202	4300	6502	SO:0001630	splice_region_variant	51146	exon3			ACACTTACTTGAT	AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.408+1T>G	chr3.hg19:g.137849689A>C		136.0	0.0	.		195.0	96.0	.	NM_016161	Q0VDK1|Q0VDK2	Splice_Site	SNP	ENST00000236709.3	hg19	CCDS3097.1	.	.	.	.	.	.	.	.	.	.	A	13.58	2.279090	0.40294	.	.	ENSG00000118017	ENST00000236709	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4479	0.75248	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	A4GNT	139332379	1.000000	0.71417	0.995000	0.50966	0.387000	0.30353	6.414000	0.73318	2.046000	0.60703	0.454000	0.30748	.	.	.	.	none		0.403	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	NM_016161	Intron
WDFY3	23001	hgsc.bcm.edu	37	4	85722839	85722839	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr4:85722839C>A	ENST00000295888.4	-	17	3193	c.2786G>T	c.(2785-2787)cGa>cTa	p.R929L	WDFY3_ENST00000322366.6_Missense_Mutation_p.R929L|WDFY3_ENST00000512267.1_5'Flank|WDFY3-AS1_ENST00000510449.1_RNA	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	929					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AGAGGCTAATCGTTCAAACAT	0.493																																					p.R929L		Atlas-SNP	.											.	WDFY3	314	.	0			c.G2786T						PASS	.						109.0	112.0	111.0					4																	85722839		2203	4300	6503	SO:0001583	missense	23001	exon17			GCTAATCGTTCAA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2786G>T	chr4.hg19:g.85722839C>A	ENSP00000295888:p.Arg929Leu	24.0	0.0	.		36.0	16.0	.	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890055	0.91889	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.57107	0.42;0.42	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.73489	0.3593	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.72475	-0.4282	10	0.54805	T	0.06	.	20.4024	0.99000	0.0:1.0:0.0:0.0	.	929	Q8IZQ1	WDFY3_HUMAN	L	929	ENSP00000318466:R929L;ENSP00000295888:R929L	ENSP00000295888:R929L	R	-	2	0	WDFY3	85941863	1.000000	0.71417	0.883000	0.34634	0.737000	0.42083	7.487000	0.81328	2.827000	0.97445	0.650000	0.86243	CGA	.	.	.	none		0.493	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33534943	33534943	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr5:33534943C>A	ENST00000504830.1	-	23	4936	c.4601G>T	c.(4600-4602)aGt>aTt	p.S1534I	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.S1449I	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1534					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CCCACCGGCACTTTTCTTGCA	0.433										HNSCC(64;0.19)																											p.S1534I		Atlas-SNP	.											.	ADAMTS12	464	.	0			c.G4601T						PASS	.						130.0	124.0	126.0					5																	33534943		2203	4300	6503	SO:0001583	missense	81792	exon23			CCGGCACTTTTCT	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4601G>T	chr5.hg19:g.33534943C>A	ENSP00000422554:p.Ser1534Ile	65.0	0.0	.		91.0	44.0	.	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	hg19	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.963656	0.34659	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.60548	0.19;0.18	4.98	0.386	0.16254	.	0.588898	0.19280	N	0.118200	T	0.43366	0.1244	L	0.52364	1.645	0.53005	D	0.999961	P;B	0.36837	0.571;0.435	B;B	0.36989	0.238;0.12	T	0.14392	-1.0474	10	0.30854	T	0.27	.	3.6087	0.08052	0.0:0.3846:0.2143:0.401	.	1449;1534	P58397-3;P58397	.;ATS12_HUMAN	I	1534;1449	ENSP00000422554:S1534I;ENSP00000344847:S1449I	ENSP00000344847:S1449I	S	-	2	0	ADAMTS12	33570700	0.000000	0.05858	0.922000	0.36590	0.973000	0.67179	0.033000	0.13754	0.202000	0.20498	0.563000	0.77884	AGT	.	.	.	none		0.433	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
PCDHB14	56122	hgsc.bcm.edu	37	5	140605127	140605127	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr5:140605127G>A	ENST00000239449.4	+	1	2050	c.2050G>A	c.(2050-2052)Gac>Aac	p.D684N	PCDHB14_ENST00000515856.2_Missense_Mutation_p.D531N	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	684					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCCCAGGCCGACTCCCTCAC	0.701																																					p.D684N	Ovarian(141;50 1831 27899 33809 37648)	Atlas-SNP	.											.	PCDHB14	132	.	0			c.G2050A						PASS	.						69.0	77.0	74.0					5																	140605127		2187	4284	6471	SO:0001583	missense	56122	exon1			CAGGCCGACTCCC	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2050G>A	chr5.hg19:g.140605127G>A	ENSP00000239449:p.Asp684Asn	85.0	0.0	.		73.0	5.0	.	NM_018934	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	hg19	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	11.91	1.778390	0.31502	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.52983	0.65;0.64	4.17	4.17	0.49024	.	.	.	.	.	T	0.47135	0.1429	M	0.83483	2.645	0.09310	N	1	P	0.35575	0.51	B	0.30572	0.117	T	0.52540	-0.8562	9	0.59425	D	0.04	.	6.9347	0.24461	0.0935:0.0:0.7321:0.1744	.	684	Q9Y5E9	PCDBE_HUMAN	N	531;684	ENSP00000444518:D531N;ENSP00000239449:D684N	ENSP00000239449:D684N	D	+	1	0	PCDHB14	140585311	0.747000	0.28283	0.039000	0.18376	0.064000	0.16182	2.451000	0.44952	2.022000	0.59522	0.650000	0.86243	GAC	.	.	.	none		0.701	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
E2F3	1871	hgsc.bcm.edu	37	6	20490451	20490451	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:20490451C>G	ENST00000346618.3	+	7	1254	c.1188C>G	c.(1186-1188)aaC>aaG	p.N396K	E2F3_ENST00000535432.1_Missense_Mutation_p.N265K	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	396	Transactivation. {ECO:0000255}.				mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			CTATGGGAAACCTTTCTCCTC	0.443																																					p.N396K		Atlas-SNP	.											.	E2F3	30	.	0			c.C1188G						PASS	.						72.0	71.0	71.0					6																	20490451		2203	4300	6503	SO:0001583	missense	1871	exon7			GGGAAACCTTTCT	Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.1188C>G	chr6.hg19:g.20490451C>G	ENSP00000262904:p.Asn396Lys	83.0	0.0	.		101.0	52.0	.	NM_001949	Q15000|Q68DT0|Q9BZ44	Missense_Mutation	SNP	ENST00000346618.3	hg19	CCDS4545.1	.	.	.	.	.	.	.	.	.	.	C	0.070	-1.205397	0.01568	.	.	ENSG00000112242	ENST00000346618;ENST00000535432	T;T	0.06294	3.32;3.35	5.49	2.71	0.32032	.	0.637186	0.17731	N	0.163882	T	0.00637	0.0021	N	0.08118	0	0.20489	N	0.999892	B	0.15473	0.013	B	0.11329	0.006	T	0.46190	-0.9209	10	0.06236	T	0.91	.	3.2605	0.06846	0.2493:0.5042:0.1104:0.1361	.	396	O00716	E2F3_HUMAN	K	396;265	ENSP00000262904:N396K;ENSP00000443418:N265K	ENSP00000262904:N396K	N	+	3	2	E2F3	20598430	0.274000	0.24191	0.948000	0.38648	0.975000	0.68041	0.955000	0.29188	0.355000	0.24131	-0.224000	0.12420	AAC	.	.	.	none		0.443	E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043828.1		
HLA-A	3105	hgsc.bcm.edu	37	6	29910554	29910554	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:29910554T>G	ENST00000396634.1	+	4	435	c.94T>G	c.(94-96)Ttc>Gtc	p.F32V	HLA-A_ENST00000376809.5_Missense_Mutation_p.F32V|HLA-A_ENST00000376806.5_Missense_Mutation_p.F32V|HLA-A_ENST00000376802.2_Missense_Mutation_p.F32V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	32	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CATGAGGTATTTCTTCACATC	0.726									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.F32V		Atlas-SNP	.											.	HLA-A	89	.	0			c.T94G						PASS	.						15.0	15.0	15.0					6																	29910554		2179	4265	6444	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	AGGTATTTCTTCA	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.94T>G	chr6.hg19:g.29910554T>G	ENSP00000379873:p.Phe32Val	109.0	0.0	.		134.0	38.0	.	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	hg19	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	10.84	1.463317	0.26248	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00932	5.53;5.53;5.53;5.53	3.72	2.53	0.30540	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	0.000000	0.35349	U	0.003271	T	0.03178	0.0093	H	0.96142	3.775	0.09310	N	1	D;D;D;D;D	0.76494	0.999;0.998;0.999;0.998;0.999	D;D;D;D;D	0.91635	0.999;0.998;0.999;0.998;0.999	T	0.29971	-0.9994	10	0.87932	D	0	.	5.839	0.18623	0.0:0.1258:0.0:0.8742	.	32;32;32;32;32	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	V	32	ENSP00000379873:F32V;ENSP00000366002:F32V;ENSP00000366005:F32V;ENSP00000365998:F32V	ENSP00000348012:F32V	F	+	1	0	HLA-A	30018533	0.004000	0.15560	0.034000	0.17996	0.201000	0.24016	0.452000	0.21795	0.620000	0.30215	0.391000	0.25812	TTC	.	.	.	none		0.726	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
BRD2	6046	hgsc.bcm.edu	37	6	32944714	32944714	+	Splice_Site	SNP	G	G	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:32944714G>A	ENST00000374825.4	+	7	2901		c.e7+1		BRD2_ENST00000443797.2_Splice_Site|BRD2_ENST00000395287.1_Splice_Site|BRD2_ENST00000374831.4_Splice_Site|BRD2_ENST00000449085.2_Splice_Site|BRD2_ENST00000395289.2_Splice_Site	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2						chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)	p.?(1)		central_nervous_system(3)|stomach(2)	5						CACTGTCAAGGTACCCACTGC	0.507																																					.		Atlas-SNP	.											BRD2_ENST00000395289,mouth,carcinoma,0,1	BRD2	70	.	1	Unknown(1)	upper_aerodigestive_tract(1)	c.1200+1G>A						PASS	.						60.0	64.0	63.0					6																	32944714		1472	2670	4142	SO:0001630	splice_region_variant	6046	exon7			GTCAAGGTACCCA	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1200+1G>A	chr6.hg19:g.32944714G>A		29.0	0.0	.		42.0	21.0	.	NM_005104	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Splice_Site	SNP	ENST00000374825.4	hg19	CCDS4762.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493736	0.64186	.	.	ENSG00000204256	ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449025;ENST00000449085	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8266	0.78711	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BRD2	33052692	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.592000	0.98245	2.679000	0.91253	0.637000	0.83480	.	.	.	.	none		0.507	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		Intron
ASCC3	10973	hgsc.bcm.edu	37	6	101075824	101075824	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:101075824C>A	ENST00000369162.2	-	28	4759	c.4415G>T	c.(4414-4416)cGa>cTa	p.R1472L		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1472	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AAAATTTGTTCGAGATACAAT	0.393																																					p.R1472L		Atlas-SNP	.											.	ASCC3	205	.	0			c.G4415T						PASS	.						108.0	105.0	106.0					6																	101075824		2203	4300	6503	SO:0001583	missense	10973	exon28			TTTGTTCGAGATA	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4415G>T	chr6.hg19:g.101075824C>A	ENSP00000358159:p.Arg1472Leu	74.0	0.0	.		69.0	30.0	.	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	hg19	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	C	32	5.124487	0.94429	.	.	ENSG00000112249	ENST00000369162	T	0.14640	2.49	6.17	6.17	0.99709	DEAD-like helicase (2);ATPase, AAA+ type, core (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.52224	0.1721	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68383	-0.5423	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1472	Q8N3C0	HELC1_HUMAN	L	1472	ENSP00000358159:R1472L	ENSP00000358159:R1472L	R	-	2	0	ASCC3	101182545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CGA	.	.	.	none		0.393	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
NRCAM	4897	hgsc.bcm.edu	37	7	107807453	107807453	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr7:107807453T>C	ENST00000425651.2	-	27	3378	c.3379A>G	c.(3379-3381)Atg>Gtg	p.M1127V	NRCAM_ENST00000351718.4_Intron|NRCAM_ENST00000413765.2_Intron|NRCAM_ENST00000379024.4_Intron|NRCAM_ENST00000379022.4_Missense_Mutation_p.M1127V|NRCAM_ENST00000379028.3_Missense_Mutation_p.M1127V	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	1127	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						GTTCCTGGCATTAGACCCTTT	0.433																																					p.M1127V		Atlas-SNP	.											.	NRCAM	267	.	0			c.A3379G						PASS	.						76.0	81.0	79.0					7																	107807453		1972	4151	6123	SO:0001583	missense	4897	exon27			CTGGCATTAGACC		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.3379A>G	chr7.hg19:g.107807453T>C	ENSP00000401244:p.Met1127Val	123.0	0.0	.		133.0	50.0	.	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	hg19	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	T	9.859	1.195856	0.22037	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000425651;ENST00000379022	T;T;T	0.55760	0.5;0.5;0.5	5.67	3.17	0.36434	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.360043	0.35838	N	0.002958	T	0.29945	0.0749	N	0.14661	0.345	0.27571	N	0.949892	B	0.02656	0.0	B	0.01281	0.0	T	0.14531	-1.0469	10	0.14656	T	0.56	.	8.9597	0.35840	0.0:0.0674:0.126:0.8066	.	1127	Q92823	NRCAM_HUMAN	V	1127	ENSP00000368314:M1127V;ENSP00000401244:M1127V;ENSP00000368308:M1127V	ENSP00000368308:M1127V	M	-	1	0	NRCAM	107594689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.529000	0.60588	1.086000	0.41228	0.523000	0.50628	ATG	.	.	.	none		0.433	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
OR6V1	346517	hgsc.bcm.edu	37	7	142750247	142750247	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr7:142750247G>C	ENST00000418316.1	+	1	831	c.810G>C	c.(808-810)aaG>aaC	p.K270N		NM_001001667.1	NP_001001667.1	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V, member 1	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	20	Melanoma(164;0.059)					AAGTCAGGAAGGTCGTGGCCT	0.507																																					p.K270N		Atlas-SNP	.											.	OR6V1	77	.	0			c.G810C						PASS	.						104.0	112.0	110.0					7																	142750247		2053	4182	6235	SO:0001583	missense	346517	exon1			CAGGAAGGTCGTG		CCDS47728.1	7q34	2014-05-06			ENSG00000225781	ENSG00000225781		"""GPCR / Class A : Olfactory receptors"""	15090	protein-coding gene	gene with protein product						12732197	Standard	NM_001001667		Approved	GPR138	uc011ksv.2	Q8N148	OTTHUMG00000158385	ENST00000418316.1:c.810G>C	chr7.hg19:g.142750247G>C	ENSP00000396085:p.Lys270Asn	72.0	0.0	.		80.0	41.0	.	NM_001001667	A4D2I0|B9EH48|Q6IF70	Missense_Mutation	SNP	ENST00000418316.1	hg19	CCDS47728.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109344	0.37242	.	.	ENSG00000225781	ENST00000418316	T	0.00207	8.55	4.52	4.52	0.55395	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00666	0.0022	M	0.85041	2.73	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.48103	-0.9064	9	0.87932	D	0	.	14.772	0.69688	0.0:0.0:1.0:0.0	.	270	Q8N148	OR6V1_HUMAN	N	270	ENSP00000396085:K270N	ENSP00000396085:K270N	K	+	3	2	OR6V1	142460369	0.000000	0.05858	0.506000	0.27664	0.262000	0.26303	0.085000	0.14912	2.349000	0.79799	0.655000	0.94253	AAG	.	.	.	none		0.507	OR6V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350860.1		
SNAI2	6591	hgsc.bcm.edu	37	8	49833817	49833817	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr8:49833817C>G	ENST00000396822.1	-	2	365	c.8G>C	c.(7-9)cGc>cCc	p.R3P	SNAI2_ENST00000020945.1_Missense_Mutation_p.R3P			O43623	SNAI2_HUMAN	snail family zinc finger 2	3	SNAG domain. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CAGGAAGGAGCGCGGCATCTT	0.587																																					p.R3P		Atlas-SNP	.											SNAI2,NS,carcinoma,0,1	SNAI2	53	.	0			c.G8C						PASS	.						107.0	108.0	107.0					8																	49833817		2203	4300	6503	SO:0001583	missense	6591	exon1			AAGGAGCGCGGCA	U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.8G>C	chr8.hg19:g.49833817C>G	ENSP00000380034:p.Arg3Pro	36.0	0.0	.		38.0	22.0	.	NM_003068	B2R6P6|Q53FC1	Missense_Mutation	SNP	ENST00000396822.1	hg19	CCDS6146.1	.	.	.	.	.	.	.	.	.	.	C	32	5.143242	0.94560	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.19938	2.11;2.11	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.52885	0.1762	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.58808	-0.7571	9	.	.	.	-21.1684	18.5472	0.91052	0.0:1.0:0.0:0.0	.	3	O43623	SNAI2_HUMAN	P	3	ENSP00000020945:R3P;ENSP00000380034:R3P	.	R	-	2	0	SNAI2	49996370	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.380000	0.79704	2.377000	0.81083	0.313000	0.20887	CGC	.	.	.	none		0.587	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313873.2	NM_003068	
RFX3	5991	hgsc.bcm.edu	37	9	3301560	3301560	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr9:3301560G>A	ENST00000382004.3	-	6	846	c.535C>T	c.(535-537)Ctt>Ttt	p.L179F	RFX3_ENST00000302303.1_Missense_Mutation_p.L179F|RFX3_ENST00000358730.2_Missense_Mutation_p.L179F	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	179					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		CTGTTGAGAAGAGAGCTTCTG	0.398																																					p.L179F		Atlas-SNP	.											.	RFX3	156	.	0			c.C535T						PASS	.						157.0	135.0	143.0					9																	3301560		2203	4300	6503	SO:0001583	missense	5991	exon6			TGAGAAGAGAGCT	AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.535C>T	chr9.hg19:g.3301560G>A	ENSP00000371434:p.Leu179Phe	75.0	0.0	.		87.0	44.0	.	NM_134428	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	ENST00000382004.3	hg19	CCDS6449.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.832324	0.91036	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303;ENST00000451859	D;D;D;T	0.83075	-1.68;-1.68;-1.68;0.27	5.87	5.87	0.94306	.	0.137392	0.50627	D	0.000106	T	0.75110	0.3805	N	0.02011	-0.69	0.58432	D	0.999994	D;B;D	0.58620	0.983;0.037;0.965	P;B;P	0.55345	0.731;0.037;0.774	T	0.82536	-0.0408	10	0.56958	D	0.05	-9.8293	16.4906	0.84200	0.0:0.0:0.8686:0.1314	.	179;179;179	P48380-3;P48380-2;P48380	.;.;RFX3_HUMAN	F	179	ENSP00000371434:L179F;ENSP00000351574:L179F;ENSP00000303847:L179F;ENSP00000411756:L179F	ENSP00000303847:L179F	L	-	1	0	RFX3	3291560	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.781000	0.95711	0.655000	0.94253	CTT	.	.	.	none		0.398	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919	
ZSWIM8	23053	hgsc.bcm.edu	37	10	75561460	75561460	+	3'UTR	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr10:75561460C>T	ENST00000605216.1	+	0	5914				ZSWIM8_ENST00000603114.1_3'UTR|ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000604729.1_3'UTR|ZSWIM8_ENST00000398706.2_3'UTR|ZSWIM8_ENST00000604524.1_3'UTR	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8								zinc ion binding (GO:0008270)										AAGCCTAGGGCTGGGGGAGAC	0.512																																					p.L1869L		Atlas-SNP	.											.	.	.	.	0			c.C5605T						PASS	.																																			SO:0001624	3_prime_UTR_variant	23053	exon26			CTAGGGCTGGGGG	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.*183C>T	chr10.hg19:g.75561460C>T		5.0	0.0	.		14.0	7.0	.	NM_001242488	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Silent	SNP	ENST00000605216.1	hg19																																																																																				.	.	.	none		0.512	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487	
MUC5B	727897	hgsc.bcm.edu	37	11	1276776	1276776	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr11:1276776G>T	ENST00000529681.1	+	37	16112	c.16054G>T	c.(16054-16056)Ggt>Tgt	p.G5352C	MUC5B_ENST00000447027.1_Missense_Mutation_p.G5355C	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5352					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AGGTGCAACCGGTGGCCTGTG	0.746																																					p.G5352C		Atlas-SNP	.											.	MUC5B	473	.	0			c.G16054T						PASS	.						6.0	7.0	7.0					11																	1276776		1853	3899	5752	SO:0001583	missense	727897	exon37			GCAACCGGTGGCC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.16054G>T	chr11.hg19:g.1276776G>T	ENSP00000436812:p.Gly5352Cys	53.0	0.0	.		62.0	4.0	.	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	hg19	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	g	7.246	0.602241	0.13939	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000546052;ENST00000406844	T;T	0.17054	2.3;2.47	4.01	-2.42	0.06542	.	.	.	.	.	T	0.34513	0.0900	M	0.79475	2.455	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.977	T	0.16012	-1.0417	9	0.87932	D	0	.	5.244	0.15487	0.4649:0.181:0.3541:0.0	.	5689;5355	A7Y9J9;E9PBJ0	.;.	C	5352;5355;5296;251;5064	ENSP00000436812:G5352C;ENSP00000415793:G5355C	ENSP00000343037:G5296C	G	+	1	0	MUC5B	1233352	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-3.094000	0.00607	-0.833000	0.04245	0.448000	0.29417	GGT	.	.	.	none		0.746	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
SF3B2	10992	hgsc.bcm.edu	37	11	65826742	65826742	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr11:65826742C>T	ENST00000322535.6	+	11	1302	c.1253C>T	c.(1252-1254)gCc>gTc	p.A418V	SF3B2_ENST00000528302.1_Missense_Mutation_p.A401V	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	418					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						AACTCTGCAGCCCCCAAGAAG	0.532																																					p.A418V		Atlas-SNP	.											.	SF3B2	85	.	0			c.C1253T						PASS	.						62.0	55.0	58.0					11																	65826742		2201	4295	6496	SO:0001583	missense	10992	exon11			CTGCAGCCCCCAA	U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1253C>T	chr11.hg19:g.65826742C>T	ENSP00000318861:p.Ala418Val	132.0	0.0	.		141.0	6.0	.	NM_006842	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Missense_Mutation	SNP	ENST00000322535.6	hg19	CCDS31612.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.315405	0.23908	.	.	ENSG00000087365	ENST00000528302;ENST00000322535;ENST00000355456	.	.	.	5.06	-0.939	0.10408	.	0.379232	0.29073	N	0.013223	T	0.23289	0.0563	L	0.27053	0.805	0.19575	N	0.999966	B	0.02656	0.0	B	0.04013	0.001	T	0.20140	-1.0284	9	0.18276	T	0.48	0.0053	8.4596	0.32921	0.0:0.4852:0.0:0.5148	.	418	Q13435	SF3B2_HUMAN	V	401;418;322	.	ENSP00000318861:A418V	A	+	2	0	SF3B2	65583318	0.339000	0.24784	0.028000	0.17463	0.984000	0.73092	0.269000	0.18589	-0.516000	0.06470	0.555000	0.69702	GCC	.	.	.	none		0.532	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
TMTC2	160335	hgsc.bcm.edu	37	12	83251132	83251132	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr12:83251132G>T	ENST00000321196.3	+	2	1134	c.427G>T	c.(427-429)Ggg>Tgg	p.G143W	TMTC2_ENST00000549919.1_Missense_Mutation_p.G137W|TMTC2_ENST00000548305.1_Missense_Mutation_p.G143W	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	143					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						AGCCGATGTCGGGGCCAGTCT	0.547																																					p.G143W		Atlas-SNP	.											TMTC2,NS,carcinoma,0,1	TMTC2	100	.	0			c.G427T						PASS	.						115.0	95.0	102.0					12																	83251132		2203	4300	6503	SO:0001583	missense	160335	exon2			GATGTCGGGGCCA	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.427G>T	chr12.hg19:g.83251132G>T	ENSP00000322300:p.Gly143Trp	82.0	0.0	.		84.0	37.0	.	NM_152588	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	hg19	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146896	0.77888	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919	T;T;T	0.60797	0.82;0.16;0.72	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.78342	0.4268	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.80171	-0.1493	10	0.72032	D	0.01	-15.2295	18.1624	0.89712	0.0:0.0:1.0:0.0	.	143;143	Q8N394;F8VSH2	TMTC2_HUMAN;.	W	143;143;137	ENSP00000322300:G143W;ENSP00000448292:G143W;ENSP00000447609:G137W	ENSP00000322300:G143W	G	+	1	0	TMTC2	81775263	1.000000	0.71417	0.941000	0.38009	0.945000	0.59286	9.174000	0.94824	2.788000	0.95919	0.650000	0.86243	GGG	.	.	.	none		0.547	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
FOXA1	3169	hgsc.bcm.edu	37	14	38060788	38060788	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr14:38060788A>T	ENST00000250448.2	-	2	1262	c.1201T>A	c.(1201-1203)Tcc>Acc	p.S401T	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.S368T	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	401					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		TTGTTGATGGAGAACGGGTGG	0.602																																					p.S401T		Atlas-SNP	.											.	FOXA1	56	.	0			c.T1201A						PASS	.						109.0	78.0	89.0					14																	38060788		2203	4300	6503	SO:0001583	missense	3169	exon2			TGATGGAGAACGG	U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.1201T>A	chr14.hg19:g.38060788A>T	ENSP00000250448:p.Ser401Thr	98.0	0.0	.		116.0	63.0	.	NM_004496	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	ENST00000250448.2	hg19	CCDS9665.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.861765	0.71949	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	T;T	0.72051	-0.62;-0.62	4.29	4.29	0.51040	Forkhead box protein, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83727	0.5317	M	0.83384	2.64	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.86303	0.1681	10	0.87932	D	0	.	12.5253	0.56083	1.0:0.0:0.0:0.0	.	401	P55317	FOXA1_HUMAN	T	401;368	ENSP00000250448:S401T;ENSP00000440178:S368T	ENSP00000250448:S401T	S	-	1	0	FOXA1	37130539	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.050000	0.93843	1.798000	0.52647	0.329000	0.21502	TCC	.	.	.	none		0.602	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276735.1		
MOK	5891	hgsc.bcm.edu	37	14	102718326	102718326	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr14:102718326C>A	ENST00000361847.2	-	5	521	c.290G>T	c.(289-291)aGa>aTa	p.R97I	MOK_ENST00000193029.6_5'UTR|MOK_ENST00000522874.1_Missense_Mutation_p.R97I|MOK_ENST00000524214.1_Missense_Mutation_p.R67I	NM_014226.1	NP_055041.1	Q9UQ07	MOK_HUMAN	MOK protein kinase	97	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)										TAATGGGTATCTTCTCCCTGT	0.333																																					p.R97I		Atlas-SNP	.											.	.	.	.	0			c.G290T						PASS	.						73.0	80.0	78.0					14																	102718326		2203	4299	6502	SO:0001583	missense	5891	exon5			GGGTATCTTCTCC	AB022694	CCDS9971.1, CCDS61552.1	14q32	2014-04-23	2011-09-06	2011-09-06	ENSG00000080823	ENSG00000080823			9833	protein-coding gene	gene with protein product		605762	"""renal tumor antigen"""	RAGE		8781117, 10421840	Standard	NM_014226		Approved	RAGE1, STK30	uc001ylm.4	Q9UQ07	OTTHUMG00000164896	ENST00000361847.2:c.290G>T	chr14.hg19:g.102718326C>A	ENSP00000355304:p.Arg97Ile	124.0	0.0	.		130.0	60.0	.	NM_014226	B2R6Z4|B7Z7P6|E7ER76|E7ERR8|Q92790|Q93067	Missense_Mutation	SNP	ENST00000361847.2	hg19	CCDS9971.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703155	0.48412	.	.	ENSG00000080823	ENST00000522874;ENST00000361847;ENST00000524214	T;T;T	0.45668	0.89;0.89;0.89	5.42	4.52	0.55395	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.177262	0.50627	D	0.000113	T	0.49762	0.1576	L	0.55481	1.735	0.80722	D	1	D;D	0.53151	0.958;0.958	P;P	0.55667	0.781;0.781	T	0.51395	-0.8711	10	0.72032	D	0.01	-8.7163	8.6721	0.34156	0.0:0.765:0.154:0.081	.	67;97	E7ERR8;Q9UQ07	.;MOK_HUMAN	I	97;97;67	ENSP00000429469:R97I;ENSP00000355304:R97I;ENSP00000428942:R67I	ENSP00000355304:R97I	R	-	2	0	RAGE	101788079	1.000000	0.71417	0.988000	0.46212	0.863000	0.49368	1.056000	0.30480	1.273000	0.44346	0.650000	0.86243	AGA	.	.	.	none		0.333	MOK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380848.3		
C15orf56	644809	hgsc.bcm.edu	37	15	40544920	40544920	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr15:40544920C>T	ENST00000319503.3	-	1	191	c.170G>A	c.(169-171)cGa>cAa	p.R57Q	RP11-133K1.2_ENST00000558658.1_Intron|PAK6_ENST00000542403.2_5'Flank|PAK6_ENST00000441369.1_Intron|PAK6_ENST00000260404.4_Intron|C15orf56_ENST00000559727.1_Missense_Mutation_p.R57Q|PAK6_ENST00000455577.2_Intron|PAK6_ENST00000453867.1_Intron|PAK6_ENST00000560346.1_Intron	NM_001039905.1	NP_001034994.1	Q8N910	CO056_HUMAN	chromosome 15 open reading frame 56	57										lung(1)	1		all_cancers(109;1.62e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;3.4e-09)|all_lung(180;6.88e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.28e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0503)		CCCGGAGGTTCGCGGCGAGAG	0.756																																					p.R57Q		Atlas-SNP	.											.	C15orf56	3	.	0			c.G170A						PASS	.						4.0	5.0	5.0					15																	40544920		2008	3995	6003	SO:0001583	missense	644809	exon1			GAGGTTCGCGGCG		CCDS32197.1	15q15.1	2012-05-30			ENSG00000176753	ENSG00000176753			33868	protein-coding gene	gene with protein product							Standard	NM_001039905		Approved	FLJ38596	uc001zla.2	Q8N910	OTTHUMG00000172399	ENST00000319503.3:c.170G>A	chr15.hg19:g.40544920C>T	ENSP00000315794:p.Arg57Gln	121.0	0.0	.		137.0	59.0	.	NM_001039905		Missense_Mutation	SNP	ENST00000319503.3	hg19	CCDS32197.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440220	0.25900	.	.	ENSG00000176753	ENST00000319503	T	0.30714	1.52	2.0	-1.71	0.08133	.	.	.	.	.	T	0.10035	0.0246	N	0.08118	0	0.09310	N	0.999999	P	0.44241	0.829	B	0.29353	0.101	T	0.17868	-1.0355	9	0.87932	D	0	.	3.9423	0.09333	0.0:0.3247:0.4801:0.1952	.	57	Q8N910	CO056_HUMAN	Q	57	ENSP00000315794:R57Q	ENSP00000315794:R57Q	R	-	2	0	C15orf56	38332212	.	.	0.000000	0.03702	0.001000	0.01503	.	.	-0.435000	0.07264	-1.253000	0.01494	CGA	.	.	.	none		0.756	C15orf56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418370.2	NM_001039905	
EME2	197342	hgsc.bcm.edu	37	16	1826070	1826070	+	Splice_Site	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:1826070C>T	ENST00000568449.1	+	8	992	c.971C>T	c.(970-972)gCg>gTg	p.A324V	EME2_ENST00000307394.7_Splice_Site_p.A389V|MRPS34_ENST00000177742.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	324					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						TGCTCCTAGGCGCTGGAGGCC	0.726								Direct reversal of damage;Homologous recombination																													p.A324V		Atlas-SNP	.											.	EME2	40	.	0			c.C971T						PASS	.						20.0	23.0	22.0					16																	1826070		2187	4278	6465	SO:0001630	splice_region_variant	197342	exon8			CCTAGGCGCTGGA	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.970-1C>T	chr16.hg19:g.1826070C>T		39.0	0.0	.		62.0	22.0	.	NM_001257370	Q8TEP2|Q96RY3	Missense_Mutation	SNP	ENST00000568449.1	hg19	CCDS58404.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.716192	0.68844	.	.	ENSG00000197774	ENST00000307394;ENST00000454910	.	.	.	3.4	2.43	0.29744	ERCC4 domain (2);	0.097008	0.41396	D	0.000895	T	0.75664	0.3880	M	0.80847	2.515	0.53688	D	0.999978	D;D	0.89917	1.0;0.977	D;B	0.91635	0.999;0.425	T	0.74405	-0.3676	9	0.49607	T	0.09	-7.8093	8.3214	0.32132	0.0:0.883:0.0:0.117	.	338;190	A4GXA9;A4GXA9-2	EME2_HUMAN;.	V	389;345	.	ENSP00000303779:A389V	A	+	2	0	EME2	1766071	0.931000	0.31567	0.515000	0.27774	0.021000	0.10359	1.875000	0.39578	0.756000	0.33013	0.561000	0.74099	GCG	.	.	.	none		0.726	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	Missense_Mutation
ABCA3	21	hgsc.bcm.edu	37	16	2369834	2369834	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:2369834G>C	ENST00000301732.5	-	8	1321	c.621C>G	c.(619-621)atC>atG	p.I207M	ABCA3_ENST00000382381.3_Missense_Mutation_p.I207M	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	207					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	AGCCTTCCCGGATGTACCCTG	0.652																																					p.I207M		Atlas-SNP	.											.	ABCA3	176	.	0			c.C621G						PASS	.						71.0	62.0	65.0					16																	2369834		2198	4300	6498	SO:0001583	missense	21	exon8			TTCCCGGATGTAC	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.621C>G	chr16.hg19:g.2369834G>C	ENSP00000301732:p.Ile207Met	34.0	0.0	.		33.0	10.0	.	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	hg19	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.419127	0.25552	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.89939	-2.59	5.04	3.05	0.35203	.	0.339378	0.32314	N	0.006271	D	0.91858	0.7423	M	0.78637	2.42	0.80722	D	1	B;P;B	0.37370	0.302;0.592;0.287	B;P;B	0.54590	0.297;0.756;0.217	D	0.89048	0.3453	10	0.42905	T	0.14	.	6.8397	0.23955	0.148:0.1482:0.7038:0.0	.	207;269;207	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	M	207;269	ENSP00000301732:I207M	ENSP00000301732:I207M	I	-	3	3	ABCA3	2309835	1.000000	0.71417	0.843000	0.33291	0.138000	0.21146	3.628000	0.54259	0.688000	0.31529	0.655000	0.94253	ATC	.	.	.	none		0.652	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
PRM2	5620	hgsc.bcm.edu	37	16	11367405	11367405	+	IGR	SNP	G	G	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:11367405G>C	ENST00000241808.4	-	0	680				RMI2_ENST00000572173.1_Intron|PRM3_ENST00000327157.2_Missense_Mutation_p.H16Q|SNORA48_ENST00000390926.1_RNA	NM_002762.2	NP_002753.2	P04554	PRM2_HUMAN	protamine 2						cell differentiation (GO:0030154)|chromosome condensation (GO:0030261)|DNA packaging (GO:0006323)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.0?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)	7						ggcctgggctgtggcctgggc	0.617																																					p.H16Q		Atlas-SNP	.											.	PRM3	8	.	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)	c.C48G						PASS	.						28.0	30.0	29.0					16																	11367405		1980	4149	6129	SO:0001628	intergenic_variant	58531	exon1			TGGGCTGTGGCCT		CCDS42118.1, CCDS66944.1	16p13.13	2013-10-17			ENSG00000122304	ENSG00000122304			9448	protein-coding gene	gene with protein product	"""cancer/testis antigen family 94, member 2"""	182890				16632464	Standard	NM_001286356		Approved	CT94.2	uc002dau.1	P04554	OTTHUMG00000172317		chr16.hg19:g.11367405G>C		15.0	0.0	.		21.0	7.0	.	NM_021247	Q6ZMM0	Missense_Mutation	SNP	ENST00000241808.4	hg19	CCDS42118.1	.	.	.	.	.	.	.	.	.	.	G	2.311	-0.357977	0.05138	.	.	ENSG00000178257	ENST00000327157	T	0.53640	0.61	0.559	-1.12	0.09808	.	.	.	.	.	T	0.39963	0.1098	N	0.19112	0.55	0.09310	N	0.999999	P	0.47106	0.89	P	0.55055	0.767	T	0.31081	-0.9956	8	0.66056	D	0.02	.	.	.	.	.	16	Q9NNZ6	PRM3_HUMAN	Q	16	ENSP00000325638:H16Q	ENSP00000325638:H16Q	H	-	3	2	PRM3	11274906	0.193000	0.23313	0.002000	0.10522	0.005000	0.04900	-0.194000	0.09559	-1.041000	0.03266	-1.036000	0.02392	CAC	.	.	.	none		0.617	PRM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417808.1		
DCTPP1	79077	hgsc.bcm.edu	37	16	30435583	30435583	+	Missense_Mutation	SNP	A	A	T	rs36092481		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:30435583A>T	ENST00000319285.4	-	3	578	c.484T>A	c.(484-486)Tgt>Agt	p.C162S	DCTPP1_ENST00000568434.1_Missense_Mutation_p.C41S|ZNF771_ENST00000566625.1_Intron|DCTPP1_ENST00000568973.1_Missense_Mutation_p.C41S|DCTPP1_ENST00000565758.1_Missense_Mutation_p.C41S|DCTPP1_ENST00000567983.1_Missense_Mutation_p.C63S	NM_024096.1	NP_077001.1	Q9H773	DCTP1_HUMAN	dCTP pyrophosphatase 1	162					nucleoside triphosphate catabolic process (GO:0009143)|protein homotetramerization (GO:0051289)	cytosol (GO:0005829)	dCTP diphosphatase activity (GO:0047840)|magnesium ion binding (GO:0000287)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|pyrimidine deoxyribonucleotide binding (GO:0032556)			kidney(1)|large_intestine(3)|upper_aerodigestive_tract(1)	5						GTGGAGTCACAGGGAATGTCC	0.597																																					p.C162S		Atlas-SNP	.											.	DCTPP1	12	.	0			c.T484A						PASS	.						40.0	37.0	38.0					16																	30435583		2197	4300	6497	SO:0001583	missense	79077	exon3			AGTCACAGGGAAT	BC001344	CCDS10680.1	16p11.2	2009-02-11			ENSG00000179958	ENSG00000179958	3.6.1.12		28777	protein-coding gene	gene with protein product	"""XTP3-transactivated protein A"""	615840				15740738	Standard	NM_024096		Approved	MGC5627, RS21C6, CDA03, XTP3TPA	uc002dyf.3	Q9H773	OTTHUMG00000132416	ENST00000319285.4:c.484T>A	chr16.hg19:g.30435583A>T	ENSP00000322524:p.Cys162Ser	54.0	0.0	.		80.0	43.0	.	NM_024096		Missense_Mutation	SNP	ENST00000319285.4	hg19	CCDS10680.1	.	.	.	.	.	.	.	.	.	.	A	1.012	-0.687538	0.03328	.	.	ENSG00000179958	ENST00000319285	.	.	.	3.72	-0.855	0.10700	.	1.452180	0.04273	N	0.342559	T	0.23611	0.0571	N	0.20685	0.6	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.17531	-1.0366	9	0.05525	T	0.97	-32.526	6.9119	0.24340	0.5009:0.0:0.4991:0.0	.	162	Q9H773	DCTP1_HUMAN	S	162	.	ENSP00000322524:C162S	C	-	1	0	DCTPP1	30343084	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.017000	0.12590	-0.100000	0.12241	-0.353000	0.07706	TGT	.	.	.	none		0.597	DCTPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255553.2	NM_024096	
DHX38	9785	hgsc.bcm.edu	37	16	72142801	72142801	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:72142801C>T	ENST00000268482.3	+	24	3867	c.3358C>T	c.(3358-3360)Cac>Tac	p.H1120Y	DHX38_ENST00000536867.1_Missense_Mutation_p.H432Y	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	1120					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				CATAGTGTATCACGAGTTGGT	0.542																																					p.H1120Y	Melanoma(97;711 1442 7855 13832 28836)	Atlas-SNP	.											.	DHX38	91	.	0			c.C3358T						PASS	.						78.0	64.0	69.0					16																	72142801		2198	4300	6498	SO:0001583	missense	9785	exon24			GTGTATCACGAGT	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.3358C>T	chr16.hg19:g.72142801C>T	ENSP00000268482:p.His1120Tyr	80.0	0.0	.		62.0	23.0	.	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	ENST00000268482.3	hg19	CCDS10907.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.922424	0.92319	.	.	ENSG00000140829	ENST00000268482;ENST00000536867	T;T	0.02656	4.21;4.21	5.14	5.14	0.70334	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.22126	0.0533	M	0.91972	3.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.02683	-1.1124	10	0.52906	T	0.07	.	18.8078	0.92045	0.0:1.0:0.0:0.0	.	432;1120	B4DVG8;Q92620	.;PRP16_HUMAN	Y	1120;432	ENSP00000268482:H1120Y;ENSP00000437898:H432Y	ENSP00000268482:H1120Y	H	+	1	0	DHX38	70700302	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	7.097000	0.76967	2.677000	0.91161	0.655000	0.94253	CAC	.	.	.	none		0.542	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
NCOR1	9611	hgsc.bcm.edu	37	17	15971431	15971431	+	Silent	SNP	T	T	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:15971431T>G	ENST00000268712.3	-	32	4775	c.4518A>C	c.(4516-4518)acA>acC	p.T1506T	NCOR1_ENST00000395851.1_Silent_p.T1522T|NCOR1_ENST00000395857.3_Silent_p.T90T	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1506	Interaction with C1D. {ECO:0000250}.|Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TAGAAGAAATTGTAACTGGAA	0.403																																					p.T1522T		Atlas-SNP	.											.	NCOR1	240	.	0			c.A4566C						PASS	.						33.0	33.0	33.0					17																	15971431		2203	4300	6503	SO:0001819	synonymous_variant	9611	exon31			AGAAATTGTAACT	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.4518A>C	chr17.hg19:g.15971431T>G		90.0	0.0	.		117.0	32.0	.	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	hg19	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	T	13.19	2.162182	0.38217	.	.	ENSG00000141027	ENST00000395849	.	.	.	5.76	-9.98	0.00438	.	.	.	.	.	.	.	.	.	.	.	0.36017	D	0.8385	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.3886	0.07281	0.1594:0.3155:0.0807:0.4444	.	.	.	.	.	-1	.	.	.	-	.	.	NCOR1	15912156	0.000000	0.05858	0.041000	0.18516	0.927000	0.56198	-0.918000	0.04021	-1.256000	0.02478	0.460000	0.39030	.	.	.	.	none		0.403	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
CCR7	1236	hgsc.bcm.edu	37	17	38711306	38711306	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:38711306G>T	ENST00000246657.2	-	3	887	c.825C>A	c.(823-825)ttC>ttA	p.F275L	CCR7_ENST00000579344.1_Missense_Mutation_p.F269L	NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	275					activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				AGGGCAGCTGGAAGACTATGA	0.552																																					p.F275L		Atlas-SNP	.											.	CCR7	31	.	0			c.C825A						PASS	.						209.0	173.0	185.0					17																	38711306		2203	4300	6503	SO:0001583	missense	1236	exon3			CAGCTGGAAGACT		CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.825C>A	chr17.hg19:g.38711306G>T	ENSP00000246657:p.Phe275Leu	72.0	0.0	.		129.0	41.0	.	NM_001838		Missense_Mutation	SNP	ENST00000246657.2	hg19	CCDS11369.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286284	0.80803	.	.	ENSG00000126353	ENST00000246657	T	0.35973	1.28	5.83	5.83	0.93111	GPCR, rhodopsin-like superfamily (1);	0.225560	0.45867	D	0.000323	T	0.43033	0.1229	L	0.58669	1.825	0.80722	D	1	B	0.22541	0.071	B	0.30401	0.115	T	0.18023	-1.0350	10	0.35671	T	0.21	.	20.1082	0.97900	0.0:0.0:1.0:0.0	.	275	P32248	CCR7_HUMAN	L	275	ENSP00000246657:F275L	ENSP00000246657:F275L	F	-	3	2	CCR7	35964832	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.764000	0.94973	0.555000	0.69702	TTC	.	.	.	none		0.552	CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257222.1		
KIF2B	84643	hgsc.bcm.edu	37	17	51901648	51901648	+	Silent	SNP	C	C	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:51901648C>T	ENST00000268919.4	+	1	1410	c.1254C>T	c.(1252-1254)gtC>gtT	p.V418V		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	418	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AAACACCTGTCAACGCTCACT	0.512																																					p.V418V		Atlas-SNP	.											.	KIF2B	254	.	0			c.C1254T						PASS	.						102.0	76.0	85.0					17																	51901648		2203	4300	6503	SO:0001819	synonymous_variant	84643	exon1			ACCTGTCAACGCT	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1254C>T	chr17.hg19:g.51901648C>T		137.0	0.0	.		221.0	68.0	.	NM_032559	Q96MA2|Q9BXG6	Silent	SNP	ENST00000268919.4	hg19	CCDS32685.1																																																																																			.	.	.	none		0.512	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
ANKRD12	23253	hgsc.bcm.edu	37	18	9257703	9257703	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr18:9257703C>G	ENST00000262126.4	+	9	4678	c.4438C>G	c.(4438-4440)Cag>Gag	p.Q1480E	RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000383440.2_Missense_Mutation_p.Q1457E|ANKRD12_ENST00000400020.3_Missense_Mutation_p.Q1457E	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1480						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CTCTTGTGCTCAGGATCCGGC	0.418																																					p.Q1480E		Atlas-SNP	.											.	ANKRD12	167	.	0			c.C4438G						PASS	.						49.0	52.0	51.0					18																	9257703		2200	4299	6499	SO:0001583	missense	23253	exon9			TGTGCTCAGGATC	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.4438C>G	chr18.hg19:g.9257703C>G	ENSP00000262126:p.Gln1480Glu	118.0	0.0	.		104.0	40.0	.	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	hg19	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234306	0.39498	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.68479	-0.33;-0.33	5.69	5.69	0.88448	.	0.303615	0.32444	N	0.006084	T	0.55768	0.1941	L	0.29908	0.895	0.44946	D	0.997969	P;P	0.38195	0.571;0.622	B;B	0.31101	0.124;0.097	T	0.58967	-0.7542	10	0.48119	T	0.1	-11.1383	19.8263	0.96618	0.0:1.0:0.0:0.0	.	1457;1480	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	E	1457;1480	ENSP00000372932:Q1457E;ENSP00000262126:Q1480E	ENSP00000262126:Q1480E	Q	+	1	0	ANKRD12	9247703	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	5.359000	0.66074	2.676000	0.91093	0.655000	0.94253	CAG	.	.	.	none		0.418	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
MBP	4155	hgsc.bcm.edu	37	18	74700845	74700845	+	Silent	SNP	C	C	T	rs112511603		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr18:74700845C>T	ENST00000397869.3	-	3	352	c.306G>A	c.(304-306)ccG>ccA	p.P102P	MBP_ENST00000397865.5_Silent_p.P102P|MBP_ENST00000580402.1_Silent_p.P235P|MBP_ENST00000526111.1_Silent_p.P80P|MBP_ENST00000354542.4_Intron|MBP_ENST00000397875.3_Silent_p.P112P|MBP_ENST00000355994.2_Silent_p.P235P|MBP_ENST00000527041.1_Intron|MBP_ENST00000578193.1_Silent_p.P102P|MBP_ENST00000359645.3_Silent_p.P128P|MBP_ENST00000528160.1_Intron|MBP_ENST00000579129.1_Silent_p.P235P|MBP_ENST00000382582.3_Silent_p.P128P|MBP_ENST00000397866.4_Silent_p.P102P			P13727	PRG2_HUMAN	myelin basic protein	0					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	Sargramostim(DB00020)	TTCCCTGCGACGGGGGTGGTG	0.527																																					p.P235P	NSCLC(17;72 1131 19392)	Atlas-SNP	.											.	MBP	45	.	0			c.G705A						PASS	.						121.0	130.0	127.0					18																	74700845		2203	4300	6503	SO:0001819	synonymous_variant	4155	exon6			CTGCGACGGGGGT		CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971			6925	protein-coding gene	gene with protein product		159430				2425357	Standard	XM_005266699		Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397869.3:c.306G>A	chr18.hg19:g.74700845C>T		80.0	0.0	.		65.0	28.0	.	NM_001025101	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Silent	SNP	ENST00000397869.3	hg19																																																																																				.	C|0.500;T|0.500	0.500	weak		0.527	MBP-024	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000267964.1	NM_001025081	
XAB2	56949	hgsc.bcm.edu	37	19	7691039	7691039	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr19:7691039C>A	ENST00000358368.4	-	5	677	c.640G>T	c.(640-642)Ggc>Tgc	p.G214C	XAB2_ENST00000534844.1_Missense_Mutation_p.G211C	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	214					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G211S(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						TTGGACTTGCCGGCCTTAGAC	0.642								Direct reversal of damage;Nucleotide excision repair (NER)																													p.G214C		Atlas-SNP	.											XAB2,NS,carcinoma,0,1	XAB2	69	.	1	Substitution - Missense(1)	lung(1)	c.G640T						PASS	.						63.0	69.0	67.0					19																	7691039		2203	4299	6502	SO:0001583	missense	56949	exon5			ACTTGCCGGCCTT	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.640G>T	chr19.hg19:g.7691039C>A	ENSP00000351137:p.Gly214Cys	37.0	0.0	.		40.0	2.0	.	NM_020196	Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	ENST00000358368.4	hg19	CCDS32892.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.386274	0.61956	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.63417	-0.04;-0.04	4.84	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.81221	0.4777	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83505	0.0077	10	0.87932	D	0	-43.9904	10.2415	0.43314	0.0:0.9057:0.0:0.0943	.	214	Q9HCS7	SYF1_HUMAN	C	214;211	ENSP00000351137:G214C;ENSP00000438225:G211C	ENSP00000351137:G214C	G	-	1	0	XAB2	7597039	1.000000	0.71417	0.986000	0.45419	0.502000	0.33828	7.343000	0.79319	1.033000	0.39918	0.455000	0.32223	GGC	.	.	.	none		0.642	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1	NM_020196	
ZNF43	7594	hgsc.bcm.edu	37	19	21990696	21990696	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr19:21990696A>T	ENST00000354959.4	-	4	2312	c.2143T>A	c.(2143-2145)Ttt>Att	p.F715I	ZNF43_ENST00000598381.1_Missense_Mutation_p.F709I|ZNF43_ENST00000594012.1_Missense_Mutation_p.F709I|ZNF43_ENST00000595461.1_Missense_Mutation_p.F709I	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	715					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		GATCGGTTAAAAGCTTTGCCA	0.363																																					p.F724I		Atlas-SNP	.											.	ZNF43	152	.	0			c.T2170A						PASS	.						50.0	54.0	53.0					19																	21990696		2203	4299	6502	SO:0001583	missense	7594	exon4			GGTTAAAAGCTTT	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.2143T>A	chr19.hg19:g.21990696A>T	ENSP00000347045:p.Phe715Ile	27.0	0.0	.		37.0	20.0	.	NM_001256653	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	hg19	CCDS12413.2	.	.	.	.	.	.	.	.	.	.	A	17.13	3.311136	0.60414	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.46451	0.87	1.76	1.76	0.24704	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.66499	0.2795	M	0.91972	3.26	0.36120	D	0.845417	D	0.89917	1.0	D	0.81914	0.995	T	0.73953	-0.3820	9	0.87932	D	0	.	8.2856	0.31926	1.0:0.0:0.0:0.0	.	715	P17038	ZNF43_HUMAN	I	714;715	ENSP00000347045:F715I	ENSP00000347045:F715I	F	-	1	0	ZNF43	21782536	0.986000	0.35501	0.177000	0.23020	0.629000	0.37895	6.109000	0.71528	0.808000	0.34231	0.254000	0.18369	TTT	.	.	.	none		0.363	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423	
FBXO46	23403	hgsc.bcm.edu	37	19	46215847	46215847	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr19:46215847T>C	ENST00000317683.3	-	2	1040	c.907A>G	c.(907-909)Aag>Gag	p.K303E		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	303										breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		CATGTGATCTTGTCCTTGGCT	0.682																																					p.K303E		Atlas-SNP	.											.	FBXO46	34	.	0			c.A907G						PASS	.						31.0	36.0	34.0					19																	46215847		2004	4156	6160	SO:0001583	missense	23403	exon2			TGATCTTGTCCTT	BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.907A>G	chr19.hg19:g.46215847T>C	ENSP00000410007:p.Lys303Glu	75.0	0.0	.		101.0	47.0	.	NM_001080469		Missense_Mutation	SNP	ENST00000317683.3	hg19	CCDS46116.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.498092	0.26861	.	.	ENSG00000177051	ENST00000317683	.	.	.	4.39	3.37	0.38596	.	.	.	.	.	T	0.32194	0.0821	N	0.22421	0.69	0.38310	D	0.943215	B	0.31705	0.336	B	0.27796	0.083	T	0.12915	-1.0529	8	0.28530	T	0.3	-10.0116	6.4522	0.21910	0.0:0.1111:0.0:0.8889	.	303	Q6PJ61	FBX46_HUMAN	E	303	.	ENSP00000410007:K303E	K	-	1	0	FBXO46	50907687	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	3.177000	0.50871	0.737000	0.32582	-0.371000	0.07208	AAG	.	.	.	none		0.682	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459661.1	XM_371179	
EDN3	1908	hgsc.bcm.edu	37	20	57876603	57876603	+	Missense_Mutation	SNP	G	G	T	rs457651		TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr20:57876603G>T	ENST00000337938.2	+	2	577	c.191G>T	c.(190-192)gGg>gTg	p.G64V	EDN3_ENST00000371025.3_Missense_Mutation_p.G64V|EDN3_ENST00000395654.3_Missense_Mutation_p.G64V|EDN3_ENST00000371028.2_Missense_Mutation_p.G64V|EDN3_ENST00000311585.7_Missense_Mutation_p.G64V	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	64					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					CCTGGCGAGGGGACTGTGGCC	0.716																																					p.G64V		Atlas-SNP	.											.	EDN3	83	.	0			c.G191T						PASS	.						33.0	37.0	35.0					20																	57876603		2201	4300	6501	SO:0001583	missense	1908	exon2			GCGAGGGGACTGT	X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.191G>T	chr20.hg19:g.57876603G>T	ENSP00000337128:p.Gly64Val	77.0	0.0	.		94.0	43.0	.	NM_207034	E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Missense_Mutation	SNP	ENST00000337938.2	hg19	CCDS13477.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720028	0.30503	.	.	ENSG00000124205	ENST00000337938;ENST00000311585;ENST00000371028;ENST00000371025;ENST00000395654	D;D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22;-2.22	3.59	-7.18	0.01505	.	.	.	.	.	T	0.63105	0.2483	N	0.08118	0	0.09310	N	1	P;P;P;P	0.38110	0.618;0.543;0.483;0.51	B;B;B;B	0.33690	0.168;0.138;0.081;0.067	T	0.61053	-0.7140	9	0.36615	T	0.2	1.9985	0.3953	0.00417	0.2776:0.1274:0.2815:0.3135	.	64;64;64;64	P14138-2;Q7Z6D2;P14138;Q4FAT2	.;.;EDN3_HUMAN;.	V	64	ENSP00000337128:G64V;ENSP00000311854:G64V;ENSP00000360067:G64V;ENSP00000360064:G64V;ENSP00000379015:G64V	ENSP00000311854:G64V	G	+	2	0	EDN3	57309998	0.000000	0.05858	0.000000	0.03702	0.221000	0.24807	-0.348000	0.07740	-1.885000	0.01118	0.313000	0.20887	GGG	.	G|1.000;A|0.000	.	alt		0.716	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079919.2	NM_000114	
AR	367	hgsc.bcm.edu	37	X	66765207	66765208	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chrX:66765207_66765208GC>AG	ENST00000374690.3	+	1	743_744	c.219_220GC>AG	c.(217-222)caGCag>caAGag	p.Q74E	AR_ENST00000504326.1_Missense_Mutation_p.Q74E|AR_ENST00000396044.3_Missense_Mutation_p.Q74E|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	74	Gln-rich.|Modulating.|Poly-Gln.		Missing.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	agcagcagcagcagcagcagca	0.668									Androgen Insensitivity Syndrome																												p.Q73Q|p.Q74E		Atlas-SNP	.											.	AR	249	.	0			c.G219A|c.C220G						PASS	.																																			SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	GCAGCAGCAGCAG|CAGCAGCAGCAGC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	Exception_encountered	chrX.hg19:g.66765207_66765208delinsAG	ENSP00000363822:p.Gln74Glu	97.0	0.0	.		102.0|104.0	9.0|8.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Silent|Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1																																																																																			.	.	.	none		0.668	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
MT-CYB	4519	hgsc.bcm.edu	37	M	14889	14889	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chrM:14889G>A	ENST00000361789.2	+	1	143	c.143G>A	c.(142-144)gGa>gAa	p.G48E	MT-TH_ENST00000387441.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	48					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						AATCACCACAGGACTATTCCT	0.512																																					p.G48E		Atlas-SNP	.											.	.	.	.	0			c.G143A						PASS	.																																			SO:0001583	missense	0	exon1			CCACAGGACTATT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.143G>A	chrM.hg19:g.14889G>A	ENSP00000354554:p.Gly48Glu	175.0	0.0	.		290.0	27.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.512	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
MYH13	8735	hgsc.bcm.edu	37	17	10215392	10215392	+	Splice_Site	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr17:10215392delA	ENST00000418404.3	-	31	4530	c.4367delT	c.(4366-4368)gtc>gc	p.V1456fs	MYH13_ENST00000252172.4_Splice_Site_p.V1456fs|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1456					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTCTGCAAGGACCTGGGAGAT	0.517																																					p.V1456fs		Atlas-Indel,Pindel	.											MYH13_ENST00000252172,NS,carcinoma,0,2	MYH13	533	.	0			c.4368delC						PASS	.						56.0	54.0	55.0					17																	10215392		1981	4180	6161	SO:0001630	splice_region_variant	8735	exon32			.	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4366-1T>-	chr17.hg19:g.10215392delA		63.0	0.0	0		93.0	30.0	0.322581	NM_003802	O95252|Q9P0U8	Frame_Shift_Del	DEL	ENST00000418404.3	hg19	CCDS45613.1																																																																																			.	.	.	none		0.517	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	Frame_Shift_Del
CD83	9308	hgsc.bcm.edu	37	6	14133946	14133946	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr6:14133946delC	ENST00000379153.3	+	4	620	c.449delC	c.(448-450)gctfs	p.A150fs		NM_001040280.1|NM_001251901.1|NM_004233.3	NP_001035370.1|NP_001238830.1|NP_004224.1	Q01151	CD83_HUMAN	CD83 molecule	150					defense response (GO:0006952)|humoral immune response (GO:0006959)|negative regulation of interleukin-4 production (GO:0032713)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|response to organic cyclic compound (GO:0014070)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	12	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				CTGCTGCTGGCTCTGGTTATT	0.383																																					p.A150fs		Atlas-Indel,Pindel	.											.	CD83	23	.	0			c.448delG						PASS	.						132.0	132.0	132.0					6																	14133946		2203	4300	6503	SO:0001589	frameshift_variant	9308	exon4			.	Z11697	CCDS4532.1, CCDS75403.1	6p23	2013-01-11	2006-03-31		ENSG00000112149	ENSG00000112149		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1703	protein-coding gene	gene with protein product		604534	"""CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)"", ""CD83 molecule """			1378080, 8422464	Standard	NM_001251901		Approved	HB15, BL11	uc003nbi.3	Q01151	OTTHUMG00000014283	ENST00000379153.3:c.449delC	chr6.hg19:g.14133946delC	ENSP00000368450:p.Ala150fs	73.0	0.0	0		107.0	49.0	0.457944	NM_004233	Q5THX9	Frame_Shift_Del	DEL	ENST00000379153.3	hg19	CCDS4532.1																																																																																			.	.	.	none		0.383	CD83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039916.1		
EXOSC2	23404	hgsc.bcm.edu	37	9	133579154	133579154	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr9:133579154delA	ENST00000372358.5	+	9	946	c.875delA	c.(874-876)gagfs	p.E292fs	EXOSC2_ENST00000546165.1_Frame_Shift_Del_p.E266fs|EXOSC2_ENST00000372351.3_Frame_Shift_Del_p.E262fs|EXOSC2_ENST00000372352.3_Frame_Shift_Del_p.E284fs|EXOSC2_ENST00000467138.1_3'UTR			Q13868	EXOS2_HUMAN	exosome component 2	292					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		TTGGAACAGGAGGGATAAGGA	0.478																																					p.E292fs	Pancreas(134;1683 1824 10118 27928 31640)	Atlas-Indel,Pindel	.											.	EXOSC2	15	.	0			c.874delG						PASS	.						118.0	127.0	124.0					9																	133579154		2203	4300	6503	SO:0001589	frameshift_variant	23404	exon9			.	AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.875delA	chr9.hg19:g.133579154delA	ENSP00000361433:p.Glu292fs	67.0	0.0	0		92.0	46.0	0.5	NM_014285	A3KFL3|B4DKK6|Q9NUY4	Frame_Shift_Del	DEL	ENST00000372358.5	hg19	CCDS6935.1																																																																																			.	.	.	none		0.478	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054673.1	NM_014285	
PRKCI	5584	hgsc.bcm.edu	37	3	170020905	170020905	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:170020905delA	ENST00000295797.4	+	18	2086	c.1781delA	c.(1780-1782)gaafs	p.E594fs		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	594	AGC-kinase C-terminal.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	TCTGCAGAAGAATGTGTCTGA	0.333																																					p.E594fs		Atlas-Indel,Pindel	.											.	PRKCI	82	.	0			c.1780delG						PASS	.						154.0	140.0	145.0					3																	170020905		2203	4300	6503	SO:0001589	frameshift_variant	5584	exon18			.		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.1781delA	chr3.hg19:g.170020905delA	ENSP00000295797:p.Glu594fs	71.0	0.0	0		86.0	36.0	0.418605	NM_002740	D3DNQ4|Q8WW06	Frame_Shift_Del	DEL	ENST00000295797.4	hg19	CCDS3212.2																																																																																			.	.	.	none		0.333	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3	NM_002740	
CASC5	57082	hgsc.bcm.edu	37	15	40914359	40914359	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr15:40914359delA	ENST00000346991.5	+	11	2365	c.1975delA	c.(1975-1977)agcfs	p.S659fs	CASC5_ENST00000399668.2_Frame_Shift_Del_p.S633fs|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	659	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGCCAAAAACAGCTTAACCGA	0.388																																					p.N658fs		Atlas-Indel,Pindel	.											.	CASC5	269	.	0			c.1974delC						PASS	.						82.0	79.0	80.0					15																	40914359		1881	4102	5983	SO:0001589	frameshift_variant	57082	exon11			.	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1975delA	chr15.hg19:g.40914359delA	ENSP00000335463:p.Ser659fs	103.0	0.0	0		111.0	45.0	0.405405	NM_170589	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Frame_Shift_Del	DEL	ENST00000346991.5	hg19	CCDS42023.1																																																																																			.	.	.	none		0.388	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
IL17RB	55540	hgsc.bcm.edu	37	3	53886139	53886147	+	In_Frame_Del	DEL	CCCTCTGGT	CCCTCTGGT	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	CCCTCTGGT	CCCTCTGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:53886139_53886147delCCCTCTGGT	ENST00000288167.3	+	4	349_357	c.340_348delCCCTCTGGT	c.(340-348)ccctctggtdel	p.PSG114del		NM_018725.3	NP_061195.2	Q9NRM6	I17RB_HUMAN	interleukin 17 receptor B	114					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|regulation of cell growth (GO:0001558)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)			breast(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		TCAGACCAGACCCTCTGGTGGTAAAGTAA	0.478																																					p.113_116del		Atlas-Indel,Pindel	.											.	IL17RB	27	.	0			c.339_347del						PASS	.																																			SO:0001651	inframe_deletion	55540	exon4			.	AF212365	CCDS2874.1	3p21.1	2008-02-05		2003-07-09	ENSG00000056736	ENSG00000056736		"""Interleukins and interleukin receptors"""	18015	protein-coding gene	gene with protein product		605458	"""interleukin 17B receptor"""	IL17BR		10749887, 10815801	Standard	NM_018725		Approved	IL17RH1, EVI27, CRL4	uc003dha.3	Q9NRM6	OTTHUMG00000158280	ENST00000288167.3:c.340_348delCCCTCTGGT	chr3.hg19:g.53886139_53886147delCCCTCTGGT	ENSP00000288167:p.Pro114_Gly116del	126.0	0.0	0		103.0	35.0	0.339806	NM_018725	Q9BPZ0|Q9NRL4|Q9NRM5	In_Frame_Del	DEL	ENST00000288167.3	hg19	CCDS2874.1																																																																																			.	.	.	none		0.478	IL17RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350563.1	NM_172234	
ULK4	54986	hgsc.bcm.edu	37	3	41795965	41795965	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr3:41795965delT	ENST00000301831.4	-	22	2671	c.2209delA	c.(2209-2211)attfs	p.I738fs		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	738					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		AAACGGATAATTGTGGAGACA	0.358																																					p.I737fs		Pindel	.											.	ULK4	150	.	0			c.2210delT						PASS	.						82.0	79.0	80.0					3																	41795965		1820	4081	5901	SO:0001589	frameshift_variant	54986	exon22			.	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2209delA	chr3.hg19:g.41795965delT	ENSP00000301831:p.Ile738fs	106.0	0.0	.		123.0	42.0	0.341	NM_017886	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Frame_Shift_Del	DEL	ENST00000301831.4	hg19	CCDS43071.1																																																																																			.	.	.	none		0.358	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
MTSS1	9788	hgsc.bcm.edu	37	8	125570101	125570101	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr8:125570101delA	ENST00000518547.1	-	11	1524	c.1051delT	c.(1051-1053)tctfs	p.S351fs	MTSS1_ENST00000378017.3_Intron|MTSS1_ENST00000325064.5_Frame_Shift_Del_p.S355fs|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000431961.2_Intron|MTSS1_ENST00000354184.4_Intron|MTSS1_ENST00000395508.2_Frame_Shift_Del_p.S125fs|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000524090.1_Frame_Shift_Del_p.S241fs	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	351	Ser-rich.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CTATAGTGAGAAAACCCGTTA	0.498																																					p.S351fs	Esophageal Squamous(160;622 1893 3862 8546 12509)	Pindel	.											.	MTSS1	79	.	0			c.1052delC						PASS	.						22.0	23.0	23.0					8																	125570101		2196	4297	6493	SO:0001589	frameshift_variant	9788	exon11			.	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1051delT	chr8.hg19:g.125570101delA	ENSP00000429064:p.Ser351fs	67.0	0.0	.		56.0	17.0	0.304	NM_014751	J3KNK6|Q8TCA2|Q96RX2	Frame_Shift_Del	DEL	ENST00000518547.1	hg19	CCDS6353.1																																																																																			.	.	.	none		0.498	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
KANK4	163782	hgsc.bcm.edu	37	1	62740357	62740358	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr1:62740357_62740358delAA	ENST00000371153.4	-	3	796_797	c.418_419delTT	c.(418-420)ttgfs	p.L140fs	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	140						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						AGCAGCTTCCAACTGTCTGGTG	0.604																																					p.140_140del		Pindel	.											.	KANK4	135	.	0			c.419_420del						PASS	.																																			SO:0001589	frameshift_variant	163782	exon3			.	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.418_419delTT	chr1.hg19:g.62740357_62740358delAA	ENSP00000360195:p.Leu140fs	51.0	0.0	.		62.0	15.0	0.242	NM_181712	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Frame_Shift_Del	DEL	ENST00000371153.4	hg19	CCDS620.1																																																																																			.	.	.	none		0.604	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
ADCY9	115	hgsc.bcm.edu	37	16	4042307	4042307	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-A5Y0-01A-11D-A31X-10	TCGA-A4-A5Y0-11A-11D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	257fa140-0c01-4edc-8247-82c96ecfb384	6022828f-21e4-4e71-8abd-439d01decea4	g.chr16:4042307delC	ENST00000294016.3	-	5	2585	c.2047delG	c.(2047-2049)gagfs	p.E683fs	ADCY9_ENST00000571889.1_Intron	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	683					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GTGAGCTTCTCCTCTTGGGGA	0.582																																					p.E683fs		Pindel	.											.	ADCY9	151	.	0			c.2048delA						PASS	.						72.0	67.0	69.0					16																	4042307		2197	4300	6497	SO:0001589	frameshift_variant	115	exon5			.	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2047delG	chr16.hg19:g.4042307delC	ENSP00000294016:p.Glu683fs	69.0	0.0	.		76.0	26.0	0.342	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Frame_Shift_Del	DEL	ENST00000294016.3	hg19	CCDS32382.1																																																																																			.	.	.	none		0.582	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
