#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGRN	375790	hgsc.bcm.edu	37	1	987003	987003	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:987003C>A	ENST00000379370.2	+	32	5591	c.5541C>A	c.(5539-5541)ttC>ttA	p.F1847L		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1851	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CCGGGGGATTCTCAGGACCGC	0.711																																					p.F1847L		Atlas-SNP	.											.	AGRN	110	.	0			c.C5541A						PASS	.						24.0	25.0	25.0					1																	987003		2199	4296	6495	SO:0001583	missense	375790	exon32			GGGATTCTCAGGA	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.5541C>A	chr1.hg19:g.987003C>A	ENSP00000368678:p.Phe1847Leu	17.0	0.0	.		54.0	19.0	.	NM_198576	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	ENST00000379370.2	hg19	CCDS30551.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.64|15.64	2.893312|2.893312	0.52121|0.52121	.|.	.|.	ENSG00000188157|ENSG00000188157	ENST00000379370;ENST00000379364|ENST00000419249	D|.	0.94000|.	-3.33|.	4.96|4.96	4.05|4.05	0.47172|0.47172	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.75177|0.75177	0.3814|0.3814	M|M	0.83118|0.83118	2.625|2.625	0.58432|0.58432	D|D	0.999995|0.999995	D|.	0.61080|.	0.989|.	P|.	0.62298|.	0.9|.	T|T	0.76782|0.76782	-0.2832|-0.2832	10|5	0.48119|.	T|.	0.1|.	-27.1498|-27.1498	12.382|12.382	0.55311|0.55311	0.0:0.9177:0.0:0.0823|0.0:0.9177:0.0:0.0823	.|.	1847|.	O00468|.	AGRIN_HUMAN|.	L|I	1847;190|150	ENSP00000368678:F1847L|.	ENSP00000368671:F190L|.	F|L	+|+	3|1	2|0	AGRN|AGRN	976866|976866	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.032000|0.032000	0.12392|0.12392	2.087000|2.087000	0.41653|0.41653	1.112000|1.112000	0.41740|0.41740	0.555000|0.555000	0.69702|0.69702	TTC|CTC	.	.	.	none		0.711	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576	
KLHL21	9903	hgsc.bcm.edu	37	1	6659179	6659179	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:6659179T>C	ENST00000377658.4	-	2	1406	c.1355A>G	c.(1354-1356)gAc>gGc	p.D452G	KLHL21_ENST00000463043.1_Missense_Mutation_p.D85G|KLHL21_ENST00000467612.1_Missense_Mutation_p.D85G|KLHL21_ENST00000377663.3_Missense_Mutation_p.D452G	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	452					chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		CTGGCCGCAGTCCACCAGCGA	0.642																																					p.D452G		Atlas-SNP	.											.	KLHL21	27	.	0			c.A1355G						PASS	.						47.0	45.0	46.0					1																	6659179		2203	4300	6503	SO:0001583	missense	9903	exon2			CCGCAGTCCACCA	AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.1355A>G	chr1.hg19:g.6659179T>C	ENSP00000366886:p.Asp452Gly	90.0	0.0	.		170.0	56.0	.	NM_014851	B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Missense_Mutation	SNP	ENST00000377658.4	hg19	CCDS30575.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.269130	0.40095	.	.	ENSG00000162413	ENST00000377658;ENST00000377663	T;T	0.74209	-0.72;-0.82	5.14	3.99	0.46301	Galactose oxidase, beta-propeller (1);	0.179251	0.64402	D	0.000019	T	0.54013	0.1832	N	0.08118	0	0.31114	N	0.70964	B;B	0.28933	0.02;0.228	B;B	0.30855	0.007;0.121	T	0.55036	-0.8203	10	0.27082	T	0.32	.	11.6365	0.51207	0.0:0.0:0.1489:0.851	.	452;452	Q9UJP4;Q9UJP4-2	KLH21_HUMAN;.	G	452	ENSP00000366886:D452G;ENSP00000366891:D452G	ENSP00000366886:D452G	D	-	2	0	KLHL21	6581766	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.336000	0.52113	0.877000	0.35895	0.533000	0.62120	GAC	.	.	.	none		0.642	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004188.1	NM_014851	
INPP5B	3633	hgsc.bcm.edu	37	1	38343988	38343988	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:38343988A>G	ENST00000373026.1	-	15	1789	c.1789T>C	c.(1789-1791)Tgc>Cgc	p.C597R	INPP5B_ENST00000373023.2_Missense_Mutation_p.C597R|INPP5B_ENST00000373024.3_Missense_Mutation_p.C517R|INPP5B_ENST00000373027.1_Missense_Mutation_p.C353R|INPP5B_ENST00000458109.2_3'UTR			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	597	5-phosphatase. {ECO:0000250}.|Substrate binding.			GSDDWDTSEKCRAPAWCDRI -> RALTTGIPVRSAVLLPG VIGF (in Ref. 5; AA sequence). {ECO:0000305}.	in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GGAGCACGGCACTTCTCACTG	0.547																																					p.C517R		Atlas-SNP	.											.	INPP5B	76	.	0			c.T1549C						PASS	.						66.0	67.0	67.0					1																	38343988		2087	4203	6290	SO:0001583	missense	3633	exon16			CACGGCACTTCTC	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.1789T>C	chr1.hg19:g.38343988A>G	ENSP00000362117:p.Cys597Arg	42.0	0.0	.		80.0	19.0	.	NM_005540	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	ENST00000373026.1	hg19		.	.	.	.	.	.	.	.	.	.	A	19.27	3.796203	0.70567	.	.	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373024	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.43	5.43	0.79202	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.83473	0.5262	L	0.33624	1.015	0.80722	D	1	D;P	0.89917	1.0;0.861	D;B	0.68765	0.96;0.31	T	0.82133	-0.0608	10	0.30854	T	0.27	.	15.4883	0.75584	1.0:0.0:0.0:0.0	.	597;517	P32019;P32019-2	I5P2_HUMAN;.	R	353;597;597;597;517	ENSP00000362118:C353R;ENSP00000362114:C597R;ENSP00000362117:C597R;ENSP00000362115:C517R	ENSP00000362114:C597R	C	-	1	0	INPP5B	38116575	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.855000	0.92236	2.078000	0.62432	0.460000	0.39030	TGC	.	.	.	none		0.547	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000012968.1	NM_005540	
PTGFR	5737	hgsc.bcm.edu	37	1	78959108	78959108	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:78959108T>C	ENST00000370757.3	+	2	917	c.680T>C	c.(679-681)cTt>cCt	p.L227P	PTGFR_ENST00000370756.3_Missense_Mutation_p.L227P|PTGFR_ENST00000370758.1_Missense_Mutation_p.L227P	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	227					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	GGAATTACACTTTTAAGAGTT	0.383																																					p.L227P		Atlas-SNP	.											.	PTGFR	121	.	0			c.T680C						PASS	.						58.0	60.0	59.0					1																	78959108		2203	4300	6503	SO:0001583	missense	5737	exon2			TTACACTTTTAAG	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.680T>C	chr1.hg19:g.78959108T>C	ENSP00000359793:p.Leu227Pro	54.0	0.0	.		133.0	39.0	.	NM_000959	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	hg19	CCDS686.1	.	.	.	.	.	.	.	.	.	.	T	19.84	3.901960	0.72754	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.52754	0.65;0.65;0.65	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.63954	0.2555	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.68685	-0.5343	10	0.87932	D	0	-21.0338	16.5479	0.84454	0.0:0.0:0.0:1.0	.	227;227	P43088;P43088-2	PF2R_HUMAN;.	P	227	ENSP00000359794:L227P;ENSP00000359793:L227P;ENSP00000359792:L227P	ENSP00000359792:L227P	L	+	2	0	PTGFR	78731696	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	CTT	.	.	.	none		0.383	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
PTGFR	5737	hgsc.bcm.edu	37	1	78959111	78959111	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:78959111T>C	ENST00000370757.3	+	2	920	c.683T>C	c.(682-684)tTa>tCa	p.L228S	PTGFR_ENST00000370756.3_Missense_Mutation_p.L228S|PTGFR_ENST00000370758.1_Missense_Mutation_p.L228S	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	228					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	ATTACACTTTTAAGAGTTAAA	0.388																																					p.L228S		Atlas-SNP	.											.	PTGFR	121	.	0			c.T683C						PASS	.						57.0	59.0	58.0					1																	78959111		2203	4300	6503	SO:0001583	missense	5737	exon2			CACTTTTAAGAGT	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.683T>C	chr1.hg19:g.78959111T>C	ENSP00000359793:p.Leu228Ser	55.0	0.0	.		131.0	38.0	.	NM_000959	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	hg19	CCDS686.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.020614	0.75275	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.39997	1.05;1.05;1.05	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.074264	0.56097	D	0.000033	T	0.50514	0.1620	L	0.52573	1.65	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.989	T	0.45731	-0.9241	10	0.40728	T	0.16	-5.6031	16.5479	0.84454	0.0:0.0:0.0:1.0	.	228;228	P43088;P43088-2	PF2R_HUMAN;.	S	228	ENSP00000359794:L228S;ENSP00000359793:L228S;ENSP00000359792:L228S	ENSP00000359792:L228S	L	+	2	0	PTGFR	78731699	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	7.643000	0.83403	2.371000	0.80710	0.533000	0.62120	TTA	.	.	.	none		0.388	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
SLC6A17	388662	hgsc.bcm.edu	37	1	110740214	110740214	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:110740214A>G	ENST00000331565.4	+	11	2293	c.1808A>G	c.(1807-1809)aAg>aGg	p.K603R		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	603					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GCCTGGATCAAGGAGGAGGTG	0.582											OREG0013652	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K603R		Atlas-SNP	.											.	SLC6A17	86	.	0			c.A1808G						PASS	.						24.0	27.0	26.0					1																	110740214		2203	4300	6503	SO:0001583	missense	388662	exon11			GGATCAAGGAGGA		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1808A>G	chr1.hg19:g.110740214A>G	ENSP00000330199:p.Lys603Arg	7.0	0.0	.	1429	22.0	11.0	.	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	hg19	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	A	11.56	1.673675	0.29693	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.74315	-0.83	5.03	2.63	0.31362	.	0.288442	0.37669	N	0.001989	T	0.23727	0.0574	N	0.04508	-0.205	0.26690	N	0.971361	B	0.02656	0.0	B	0.09377	0.004	T	0.29941	-0.9995	10	0.15066	T	0.55	.	7.503	0.27528	0.6046:0.0:0.3954:0.0	.	603	Q9H1V8	S6A17_HUMAN	R	603	ENSP00000330199:K603R	ENSP00000330199:K603R	K	+	2	0	SLC6A17	110541737	0.080000	0.21391	0.999000	0.59377	0.978000	0.69477	1.878000	0.39608	0.235000	0.21160	0.455000	0.32223	AAG	.	.	.	none		0.582	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144874782	144874782	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:144874782C>T	ENST00000369354.3	-	30	5015	c.4826G>A	c.(4825-4827)aGc>aAc	p.S1609N	RP4-791M13.5_ENST00000531288.1_RNA|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.S1745N|AL138796.1_ENST00000582173.1_RNA|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.S1609N|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.S1565N|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.S1745N			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1609	NBPF. {ECO:0000255|PROSITE- ProRule:PRU00647}.				cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GAAAGAGGTGCTGCTGGGAGA	0.537			T	PDGFRB	MPD																																p.S1609N		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.G4826A						PASS	.						253.0	241.0	245.0					1																	144874782		2203	4296	6499	SO:0001583	missense	9659	exon30			GAGGTGCTGCTGG	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.4826G>A	chr1.hg19:g.144874782C>T	ENSP00000358360:p.Ser1609Asn	92.0	0.0	.		170.0	24.0	.	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.058459	0.76074	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01767	4.65;4.76;4.76;4.73;4.78	5.91	2.8	0.32819	DUF1220 (2);	.	.	.	.	T	0.01558	0.0050	L	0.61218	1.895	0.80722	D	1	P;P	0.40970	0.634;0.734	B;B	0.43575	0.3;0.424	T	0.57046	-0.7878	9	0.56958	D	0.05	.	10.7557	0.46234	0.1347:0.622:0.2433:0.0	.	1565;1609	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	N	1565;1609;1609;1745;1745	ENSP00000327209:S1565N;ENSP00000358360:S1609N;ENSP00000358363:S1609N;ENSP00000435654:S1745N;ENSP00000358366:S1745N	ENSP00000327209:S1565N	S	-	2	0	PDE4DIP	143586139	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.387000	0.59626	0.794000	0.33899	0.650000	0.86243	AGC	.	.	.	none		0.537	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
CELF3	11189	hgsc.bcm.edu	37	1	151678722	151678722	+	Silent	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:151678722T>C	ENST00000290583.4	-	10	1897	c.1104A>G	c.(1102-1104)caA>caG	p.Q368Q	CELF3_ENST00000290585.4_Silent_p.Q318Q|CELF3_ENST00000392706.3_Silent_p.Q163Q|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000470688.1_5'UTR	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	368	Gln-rich.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						gctgctgctgttgctgctgct	0.657																																					p.Q368Q		Atlas-SNP	.											CELF3,caecum,carcinoma,0,1	CELF3	49	.	0			c.A1104G						PASS	.						19.0	20.0	20.0					1																	151678722		2200	4297	6497	SO:0001819	synonymous_variant	11189	exon10			CTGCTGTTGCTGC	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.1104A>G	chr1.hg19:g.151678722T>C		23.0	0.0	.		34.0	4.0	.	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Silent	SNP	ENST00000290583.4	hg19	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	4.938	0.174339	0.09391	.	.	ENSG00000159409	ENST00000420342	.	.	.	3.25	1.39	0.22231	.	.	.	.	.	T	0.36496	0.0969	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19943	-1.0290	4	.	.	.	-0.0118	5.4728	0.16680	0.0:0.7409:0.0:0.2591	.	.	.	.	S	369	.	.	N	-	2	0	CELF3	149945346	0.076000	0.21285	1.000000	0.80357	0.644000	0.38419	-0.812000	0.04496	0.416000	0.25844	-0.389000	0.06534	AAC	.	.	.	none		0.657	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
CR1L	1379	hgsc.bcm.edu	37	1	207881586	207881586	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:207881586C>G	ENST00000508064.2	+	10	1452	c.1392C>G	c.(1390-1392)agC>agG	p.S464R	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	464	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CCCATTGGAGCATGAAGCCAC	0.428																																					p.S464R		Atlas-SNP	.											.	CR1L	97	.	0			c.C1392G						PASS	.						268.0	258.0	261.0					1																	207881586		1901	4113	6014	SO:0001583	missense	1379	exon10			TTGGAGCATGAAG	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1392C>G	chr1.hg19:g.207881586C>G	ENSP00000421736:p.Ser464Arg	147.0	0.0	.		267.0	72.0	.	NM_175710	Q32MC9|Q8NEU7	Missense_Mutation	SNP	ENST00000508064.2	hg19	CCDS44310.1	.	.	.	.	.	.	.	.	.	.	.	5.589	0.293432	0.10567	.	.	ENSG00000197721	ENST00000508064	T	0.68765	-0.35	1.67	-3.04	0.05412	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.61110	0.2321	M	0.80332	2.49	0.09310	N	1	B	0.15473	0.013	B	0.23018	0.043	T	0.55315	-0.8160	9	0.48119	T	0.1	.	2.9622	0.05896	0.0:0.3631:0.2498:0.3871	.	464	Q2VPA4	CR1L_HUMAN	R	464	ENSP00000421736:S464R	ENSP00000421736:S464R	S	+	3	2	CR1L	205948209	0.007000	0.16637	0.000000	0.03702	0.046000	0.14306	-0.702000	0.05069	-0.814000	0.04352	0.298000	0.19748	AGC	.	.	.	none		0.428	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735	
OBSCN	84033	hgsc.bcm.edu	37	1	228520936	228520936	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:228520936G>C	ENST00000422127.1	+	58	15812	c.15768G>C	c.(15766-15768)gaG>gaC	p.E5256D	OBSCN_ENST00000366707.4_Missense_Mutation_p.E2890D|OBSCN_ENST00000570156.2_Missense_Mutation_p.E6213D|OBSCN_ENST00000366709.4_Missense_Mutation_p.E2375D|OBSCN_ENST00000284548.11_Missense_Mutation_p.E5256D	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5256					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCACTGATGAGGGCCAGCTGC	0.632																																					p.E6213D		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G18639C						PASS	.						14.0	16.0	15.0					1																	228520936		1999	4165	6164	SO:0001583	missense	84033	exon69			TGATGAGGGCCAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15768G>C	chr1.hg19:g.228520936G>C	ENSP00000409493:p.Glu5256Asp	60.0	0.0	.		140.0	50.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475444	0.63737	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.65364	0.27;-0.15;-0.1;0.41	5.29	-2.78	0.05859	.	0.204869	0.40818	N	0.001014	T	0.30039	0.0752	N	0.04880	-0.145	0.34900	D	0.746403	B;B	0.16166	0.009;0.016	B;B	0.19148	0.011;0.024	T	0.01684	-1.1296	10	0.44086	T	0.13	.	2.9874	0.05972	0.3769:0.104:0.4128:0.1063	.	5256;5256	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	D	5256;5256;2890;2375	ENSP00000284548:E5256D;ENSP00000409493:E5256D;ENSP00000355668:E2890D;ENSP00000355670:E2375D	ENSP00000284548:E5256D	E	+	3	2	OBSCN	226587559	0.939000	0.31865	0.987000	0.45799	0.212000	0.24457	-0.019000	0.12546	-0.128000	0.11641	-0.254000	0.11334	GAG	.	.	.	none		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
EML6	400954	hgsc.bcm.edu	37	2	55191764	55191764	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:55191764C>A	ENST00000356458.6	+	37	5908	c.5388C>A	c.(5386-5388)ttC>ttA	p.F1796L	EML6_ENST00000490828.1_3'UTR	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1796						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						CAGTTGACTTCTATGACCTCA	0.463																																					p.F1796L		Atlas-SNP	.											.	EML6	85	.	0			c.C5388A						PASS	.						158.0	127.0	136.0					2																	55191764		692	1591	2283	SO:0001583	missense	400954	exon37			TGACTTCTATGAC		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.5388C>A	chr2.hg19:g.55191764C>A	ENSP00000348842:p.Phe1796Leu	104.0	0.0	.		183.0	71.0	.	NM_001039753	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	hg19	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228586	0.58777	.	.	ENSG00000214595	ENST00000356458	T	0.14022	2.54	5.58	4.69	0.59074	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.102660	0.64402	N	0.000001	T	0.08891	0.0220	N	0.25060	0.705	0.36954	D	0.893	B	0.29646	0.253	B	0.32805	0.153	T	0.32107	-0.9919	10	0.19147	T	0.46	.	7.2226	0.25997	0.0:0.7029:0.151:0.1461	.	1796	Q6ZMW3	EMAL6_HUMAN	L	1796	ENSP00000348842:F1796L	ENSP00000348842:F1796L	F	+	3	2	EML6	55045268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.955000	0.29188	1.443000	0.47586	0.655000	0.94253	TTC	.	.	.	none		0.463	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
ANXA4	307	hgsc.bcm.edu	37	2	70039804	70039804	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:70039804A>T	ENST00000394295.4	+	8	745	c.497A>T	c.(496-498)aAt>aTt	p.N166I	ANXA4_ENST00000409920.1_Missense_Mutation_p.N144I|ANXA4_ENST00000536030.1_Missense_Mutation_p.N82I	NM_001153.3	NP_001144.1	P09525	ANXA4_HUMAN	annexin A4	164					epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						GATGAAGGAAATTATCTGGAC	0.443																																					p.N166I		Atlas-SNP	.											.	ANXA4	34	.	0			c.A497T						PASS	.						113.0	101.0	105.0					2																	70039804		2203	4300	6503	SO:0001583	missense	307	exon8			AAGGAAATTATCT	M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000394295.4:c.497A>T	chr2.hg19:g.70039804A>T	ENSP00000377833:p.Asn166Ile	19.0	0.0	.		78.0	28.0	.	NM_001153	B4DDF9|Q96F33|Q9BWK1	Missense_Mutation	SNP	ENST00000394295.4	hg19	CCDS1894.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.083724	0.36758	.	.	ENSG00000196975	ENST00000409920;ENST00000394295;ENST00000536030	T;T;T	0.12147	2.71;2.71;2.71	5.67	3.15	0.36227	.	0.343196	0.34268	N	0.004120	T	0.13670	0.0331	M	0.64567	1.98	0.33200	D	0.551962	B;B;B	0.33135	0.155;0.399;0.155	B;B;B	0.35039	0.105;0.194;0.105	T	0.10497	-1.0627	9	.	.	.	.	5.8848	0.18876	0.635:0.2795:0.0855:0.0	.	164;144;166	P09525;Q6P452;Q6LES2	ANXA4_HUMAN;.;.	I	144;166;82	ENSP00000386756:N144I;ENSP00000377833:N166I;ENSP00000441931:N82I	.	N	+	2	0	ANXA4	69893308	0.145000	0.22656	0.915000	0.36163	0.808000	0.45660	1.316000	0.33620	0.982000	0.38575	0.533000	0.62120	AAT	.	.	.	none		0.443	ANXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251848.2	NM_001153	
MPHOSPH10	10199	hgsc.bcm.edu	37	2	71360588	71360588	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:71360588T>G	ENST00000244230.2	+	2	1002	c.650T>G	c.(649-651)aTa>aGa	p.I217R	MPHOSPH10_ENST00000498451.2_Missense_Mutation_p.I217R	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	217					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						TTAGAAAACATAGAAAAAGAA	0.353																																					p.I217R		Atlas-SNP	.											.	MPHOSPH10	81	.	0			c.T650G						PASS	.						63.0	70.0	68.0					2																	71360588		2202	4300	6502	SO:0001583	missense	10199	exon2			AAAACATAGAAAA	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.650T>G	chr2.hg19:g.71360588T>G	ENSP00000244230:p.Ile217Arg	186.0	0.0	.		394.0	162.0	.	NM_005791	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	hg19	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.363316	0.41902	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.09817	2.94;2.94	5.04	5.04	0.67666	.	0.585812	0.20103	N	0.099190	T	0.09555	0.0235	N	0.19112	0.55	0.22389	N	0.999144	P;P	0.49696	0.927;0.655	P;B	0.46419	0.516;0.305	T	0.27434	-1.0074	10	0.17369	T	0.5	.	13.0251	0.58810	0.0:0.0:0.0:1.0	.	217;217	B3KPV5;O00566	.;MPP10_HUMAN	R	217;77	ENSP00000244230:I217R;ENSP00000393034:I77R	ENSP00000244230:I217R	I	+	2	0	MPHOSPH10	71214096	0.146000	0.22672	0.072000	0.20136	0.923000	0.55619	1.710000	0.37920	2.040000	0.60383	0.397000	0.26171	ATA	.	.	.	none		0.353	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
IMMT	10989	hgsc.bcm.edu	37	2	86371557	86371557	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:86371557T>A	ENST00000410111.3	-	15	2498	c.2111A>T	c.(2110-2112)gAg>gTg	p.E704V	IMMT_ENST00000449247.2_Missense_Mutation_p.E693V|IMMT_ENST00000254636.5_Missense_Mutation_p.E605V|IMMT_ENST00000442664.2_Missense_Mutation_p.E703V|IMMT_ENST00000409051.2_Missense_Mutation_p.E657V	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	704					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGCTGCTAGCTCCAGATCACC	0.488																																					p.E704V		Atlas-SNP	.											.	IMMT	65	.	0			c.A2111T						PASS	.						102.0	97.0	98.0					2																	86371557		1969	4166	6135	SO:0001583	missense	10989	exon15			GCTAGCTCCAGAT	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.2111A>T	chr2.hg19:g.86371557T>A	ENSP00000387262:p.Glu704Val	58.0	0.0	.		146.0	43.0	.	NM_006839	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	hg19	CCDS46355.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.501330	0.85176	.	.	ENSG00000132305	ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000398211;ENST00000409715	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.57431	0.2053	M	0.78049	2.395	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0	T	0.59820	-0.7382	10	0.51188	T	0.08	-20.9731	15.8107	0.78561	0.0:0.0:0.0:1.0	.	657;692;693;672;704	B9A067;B4DKR1;Q16891-2;Q16891-3;Q16891	.;.;.;.;IMMT_HUMAN	V	605;693;704;703;657;693;672;318;605	ENSP00000254636:E605V;ENSP00000396899:E693V;ENSP00000387262:E704V;ENSP00000407788:E703V;ENSP00000387227:E657V	ENSP00000254636:E605V	E	-	2	0	IMMT	86225068	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.868000	0.87116	2.320000	0.78422	0.529000	0.55759	GAG	.	.	.	none		0.488	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
SMPD4	55627	hgsc.bcm.edu	37	2	130912744	130912744	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:130912744G>A	ENST00000409031.1	-	15	2643	c.1495C>T	c.(1495-1497)Ccc>Tcc	p.P499S	SMPD4_ENST00000452225.2_Missense_Mutation_p.P240S|SMPD4_ENST00000426662.2_Missense_Mutation_p.P135S|SMPD4_ENST00000339679.7_Missense_Mutation_p.P357S|SMPD4_ENST00000443958.2_Missense_Mutation_p.P163S|SMPD4_ENST00000431183.2_Missense_Mutation_p.P397S|SMPD4_ENST00000453750.1_Missense_Mutation_p.P248S|SMPD4_ENST00000351288.6_Missense_Mutation_p.P470S|SMPD4_ENST00000473720.1_5'Flank	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	460					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	GCGTGCTTGGGGCTGACCAGG	0.597																																					p.P499S		Atlas-SNP	.											.	SMPD4	67	.	0			c.C1495T						PASS	.						89.0	85.0	86.0					2																	130912744		2203	4300	6503	SO:0001583	missense	55627	exon15			GCTTGGGGCTGAC	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.1495C>T	chr2.hg19:g.130912744G>A	ENSP00000386531:p.Pro499Ser	59.0	0.0	.		83.0	20.0	.	NM_017951	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	hg19	CCDS42751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	18.79|18.79	3.698485|3.698485	0.68386|0.68386	.|.	.|.	ENSG00000136699|ENSG00000136699	ENST00000430682|ENST00000351288;ENST00000409031;ENST00000431183;ENST00000453750;ENST00000443958;ENST00000339679;ENST00000452225;ENST00000426662;ENST00000457039;ENST00000449159;ENST00000451542	.|.	.|.	.|.	4.24|4.24	4.24|4.24	0.50183|0.50183	.|.	0.182604|0.182604	0.47852|0.47852	D|D	0.000216|0.000216	T|T	0.76449|0.76449	0.3989|0.3989	M|M	0.74881|0.74881	2.28|2.28	0.42852|0.42852	D|D	0.994089|0.994089	.|D;D;D;D;P;D;P;D;D	.|0.71674	.|0.997;0.967;0.988;0.988;0.793;0.975;0.939;0.99;0.998	.|D;P;P;P;B;P;P;P;D	.|0.80764	.|0.931;0.595;0.896;0.896;0.258;0.644;0.745;0.878;0.994	T|T	0.75895|0.75895	-0.3156|-0.3156	6|9	.|0.29301	.|T	.|0.29	.|.	14.1436|14.1436	0.65336|0.65336	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|135;240;397;357;248;431;460;499;506	.|B4E0L6;B4DQ31;E7ESA2;B4E0T5;B4DM23;Q9NXE4-2;Q9NXE4;B1PBA3;Q9NXE4-4	.|.;.;.;.;.;.;NSMA3_HUMAN;.;.	L|S	180|470;499;397;248;163;357;240;135;96;35;241	.|.	.|ENSP00000339721:P357S	P|P	-|-	2|1	0|0	SMPD4|SMPD4	130629214|130629214	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.637000|0.637000	0.38172|0.38172	5.392000|5.392000	0.66272|0.66272	1.886000|1.886000	0.54624|0.54624	0.305000|0.305000	0.20034|0.20034	CCC|CCC	.	.	.	none		0.597	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	NM_017751	
DNAJC10	54431	hgsc.bcm.edu	37	2	183594619	183594619	+	Silent	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:183594619G>T	ENST00000264065.7	+	8	1093	c.678G>T	c.(676-678)gtG>gtT	p.V226V	DNAJC10_ENST00000537515.1_Silent_p.V226V	NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	226	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AGAGTTTAGTGAGTTTTGCAA	0.323																																					p.V226V	Pancreas(56;860 1183 25669 35822 48585)	Atlas-SNP	.											.	DNAJC10	76	.	0			c.G678T						PASS	.						148.0	159.0	155.0					2																	183594619		2203	4300	6503	SO:0001819	synonymous_variant	54431	exon8			TTTAGTGAGTTTT		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.678G>T	chr2.hg19:g.183594619G>T		147.0	0.0	.		346.0	111.0	.	NM_001271581	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Silent	SNP	ENST00000264065.7	hg19	CCDS33345.1																																																																																			.	.	.	none		0.323	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2	NM_018981	
HSPE1	3336	hgsc.bcm.edu	37	2	198365881	198365881	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:198365881A>G	ENST00000233893.5	+	2	530	c.87A>G	c.(85-87)ggA>ggG	p.G29G	HSPD1_ENST00000345042.2_5'Flank|HSPE1_ENST00000409729.1_Intron|HSPD1_ENST00000544407.1_5'Flank|HSPE1_ENST00000409468.1_Silent_p.G29G|HSPE1-MOB4_ENST00000604458.1_Silent_p.G29G|HSPE1_ENST00000465573.1_Intron|HSPD1_ENST00000388968.3_5'Flank	NM_002157.2	NP_002148.1	P61604	CH10_HUMAN	heat shock 10kDa protein 1	29					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|osteoblast differentiation (GO:0001649)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			lung(1)	1			Epithelial(96;0.225)			TAACCAAAGGAGGCATTATGC	0.438																																					p.G29G		Atlas-SNP	.											.	HSPE1	2	.	0			c.A87G						PASS	.						59.0	60.0	60.0					2																	198365881		2203	4297	6500	SO:0001819	synonymous_variant	3336	exon2			CAAAGGAGGCATT	AF109872	CCDS2320.1	2q33.1	2013-10-17	2013-10-17		ENSG00000115541	ENSG00000115541		"""Heat Shock Proteins / Chaperonins"""	5269	protein-coding gene	gene with protein product	"""chaperonin 10"""	600141	"""heat shock 10kD protein 1 (chaperonin 10)"""			7914093, 7698325	Standard	NM_002157		Approved	CPN10, GROES		P61604	OTTHUMG00000132749	ENST00000233893.5:c.87A>G	chr2.hg19:g.198365881A>G		187.0	0.0	.		367.0	141.0	.	NM_002157	O95421|Q04984|Q53X54|Q9UDH0	Silent	SNP	ENST00000233893.5	hg19	CCDS2320.1																																																																																			.	.	.	none		0.438	HSPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256112.1	NM_002157	
NIF3L1	60491	hgsc.bcm.edu	37	2	201768315	201768315	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr2:201768315C>A	ENST00000409020.1	+	7	1342	c.1048C>A	c.(1048-1050)Ctt>Att	p.L350I	NIF3L1_ENST00000359683.4_Missense_Mutation_p.L323I|NIF3L1_ENST00000409357.1_Missense_Mutation_p.L350I|NIF3L1_ENST00000416651.1_Missense_Mutation_p.L350I|NIF3L1_ENST00000409588.1_3'UTR			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	350					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						TCTTTCTGACCTTCGAGATAT	0.423																																					p.L350I		Atlas-SNP	.											.	NIF3L1	51	.	0			c.C1048A						PASS	.						140.0	131.0	134.0					2																	201768315		1885	4113	5998	SO:0001583	missense	60491	exon7			TCTGACCTTCGAG	AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.1048C>A	chr2.hg19:g.201768315C>A	ENSP00000386394:p.Leu350Ile	106.0	0.0	.		241.0	85.0	.	NM_001136039	Q53TX4|Q6X735|Q9H2D2|Q9HC18	Missense_Mutation	SNP	ENST00000409020.1	hg19	CCDS46485.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267008	0.80469	.	.	ENSG00000196290	ENST00000416651;ENST00000409020;ENST00000359683;ENST00000409357	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.33	5.33	0.75918	.	0.052331	0.85682	D	0.000000	T	0.67618	0.2912	M	0.72624	2.21	0.46437	D	0.999043	D	0.69078	0.997	D	0.65573	0.936	T	0.65631	-0.6121	10	0.39692	T	0.17	-14.3245	19.3851	0.94553	0.0:1.0:0.0:0.0	.	350	Q9GZT8	NIF3L_HUMAN	I	350;350;323;350	ENSP00000400787:L350I;ENSP00000386394:L350I;ENSP00000352711:L323I;ENSP00000387315:L350I	ENSP00000352711:L323I	L	+	1	0	NIF3L1	201476560	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.771000	0.47670	2.656000	0.90262	0.557000	0.71058	CTT	.	.	.	none		0.423	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336201.1	NM_021824	
KLHL18	23276	hgsc.bcm.edu	37	3	47374712	47374713	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:47374712_47374713GC>TA	ENST00000232766.5	+	5	686_687	c.666_667GC>TA	c.(664-669)gaGCtg>gaTAtg	p.222_223EL>DM	KLHL18_ENST00000455924.2_Missense_Mutation_p.110_111EL>DM	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	222	BACK.									endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		ACCTGCCTGAGCTGCTGTCCAA	0.569																																					p.E222D|p.L223M		Atlas-SNP	.											.	KLHL18	46	.	0			c.G666T|c.C667A						PASS	.																																			SO:0001583	missense	23276	exon5			GCCTGAGCTGCTG|CCTGAGCTGCTGT	AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	Exception_encountered	chr3.hg19:g.47374712_47374713delinsTA	ENSP00000232766:p.E222_L223delinsDM	44.0|45.0	0.0	.		79.0|81.0	21.0|23.0	.	NM_025010	A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	ENST00000232766.5	hg19	CCDS33749.1																																																																																			.	.	.	none		0.569	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010	
TMF1	7110	hgsc.bcm.edu	37	3	69072460	69072460	+	Silent	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:69072460T>C	ENST00000398559.2	-	17	3366	c.3150A>G	c.(3148-3150)caA>caG	p.Q1050Q	CTD-2013N24.2_ENST00000599467.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000601511.1_RNA|TMF1_ENST00000489370.1_5'Flank|CTD-2013N24.2_ENST00000595925.1_RNA|TMF1_ENST00000543976.1_Silent_p.Q1053Q|CTD-2013N24.2_ENST00000597366.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	1050					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TGTTGTACCTTTGATCCAAAT	0.299																																					p.Q1050Q		Atlas-SNP	.											.	TMF1	77	.	0			c.A3150G						PASS	.						93.0	78.0	82.0					3																	69072460		1810	4067	5877	SO:0001819	synonymous_variant	7110	exon17			GTACCTTTGATCC		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.3150A>G	chr3.hg19:g.69072460T>C		80.0	0.0	.		196.0	61.0	.	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Silent	SNP	ENST00000398559.2	hg19	CCDS43105.1																																																																																			.	.	.	none		0.299	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
NDUFB4	4710	hgsc.bcm.edu	37	3	120320001	120320001	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:120320001A>G	ENST00000184266.2	+	2	275	c.224A>G	c.(223-225)aAt>aGt	p.N75S	NDUFB4_ENST00000485064.1_Missense_Mutation_p.N75S|NDUFB4_ENST00000492739.1_Intron	NM_004547.5	NP_004538.2	O95168	NDUB4_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa	75					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|large_intestine(1)|lung(3)	5				GBM - Glioblastoma multiforme(114;0.14)		AGAACAATAAATGTCTATCCT	0.363																																					p.N75S		Atlas-SNP	.											.	NDUFB4	21	.	0			c.A224G						PASS	.						132.0	142.0	139.0					3																	120320001		2203	4296	6499	SO:0001583	missense	4710	exon2			CAATAAATGTCTA	AF044957	CCDS2999.1, CCDS54630.1	3q13.33	2011-07-04	2002-08-29		ENSG00000065518	ENSG00000065518		"""Mitochondrial respiratory chain complex / Complex I"""	7699	protein-coding gene	gene with protein product	"""complex I B15 subunit"""	603840	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4 (15kD, B15)"""			9878551	Standard	NM_004547		Approved	B15	uc003edu.3	O95168	OTTHUMG00000159442	ENST00000184266.2:c.224A>G	chr3.hg19:g.120320001A>G	ENSP00000184266:p.Asn75Ser	60.0	0.0	.		179.0	71.0	.	NM_004547	B2RUY3|B9EJC7	Missense_Mutation	SNP	ENST00000184266.2	hg19	CCDS2999.1	.	.	.	.	.	.	.	.	.	.	A	11.43	1.635688	0.29068	.	.	ENSG00000065518	ENST00000184266;ENST00000485064	.	.	.	5.45	5.45	0.79879	.	0.052553	0.85682	D	0.000000	T	0.57562	0.2062	M	0.71581	2.175	0.80722	D	1	B;P	0.38129	0.103;0.619	B;B	0.38921	0.047;0.285	T	0.60929	-0.7165	9	0.45353	T	0.12	2.7254	11.8278	0.52278	1.0:0.0:0.0:0.0	.	75;75	O95168;B2RUY3	NDUB4_HUMAN;.	S	75	.	ENSP00000184266:N75S	N	+	2	0	NDUFB4	121802691	0.971000	0.33674	0.492000	0.27490	0.082000	0.17680	3.410000	0.52664	2.288000	0.76882	0.533000	0.62120	AAT	.	.	.	none		0.363	NDUFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355420.1	NM_004547	
NMD3	51068	hgsc.bcm.edu	37	3	160964158	160964158	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:160964158C>T	ENST00000460469.1	+	11	1507	c.1052C>T	c.(1051-1053)tCt>tTt	p.S351F	NMD3_ENST00000472947.1_Missense_Mutation_p.S351F|NMD3_ENST00000351193.2_Missense_Mutation_p.S351F			Q96D46	NMD3_HUMAN	NMD3 ribosome export adaptor	351					protein transport (GO:0015031)|ribosomal large subunit export from nucleus (GO:0000055)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|ribosomal large subunit binding (GO:0043023)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(10)|ovary(1)|skin(1)|urinary_tract(2)	25			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			CAGAAGACATCTGAAATGAAT	0.353																																					p.S351F		Atlas-SNP	.											.	NMD3	49	.	0			c.C1052T						PASS	.						75.0	77.0	76.0					3																	160964158		2203	4300	6503	SO:0001583	missense	51068	exon12			AGACATCTGAAAT	BC013317	CCDS3194.1	3q26.1	2013-08-06	2013-08-06		ENSG00000169251	ENSG00000169251			24250	protein-coding gene	gene with protein product		611021	"""NMD3 homolog (S. cerevisiae)"""			10810093, 23782956, 12773398	Standard	NM_015938		Approved	CGI-07	uc003feb.1	Q96D46	OTTHUMG00000159063	ENST00000460469.1:c.1052C>T	chr3.hg19:g.160964158C>T	ENSP00000419004:p.Ser351Phe	30.0	0.0	.		79.0	33.0	.	NM_015938	D3DNM7|Q9Y2Z6	Missense_Mutation	SNP	ENST00000460469.1	hg19	CCDS3194.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751897	0.89753	.	.	ENSG00000169251	ENST00000351193;ENST00000472947;ENST00000460469;ENST00000540137	T;T;T	0.24723	1.84;1.84;1.84	5.01	5.01	0.66863	.	0.055185	0.85682	D	0.000000	T	0.57388	0.2050	M	0.91354	3.2	0.80722	D	1	D;D;D	0.56968	0.972;0.978;0.976	P;P;P	0.59703	0.781;0.862;0.556	T	0.68213	-0.5468	10	0.87932	D	0	-30.719	18.1915	0.89808	0.0:1.0:0.0:0.0	.	351;351;351	B3KT11;C9JA08;Q96D46	.;.;NMD3_HUMAN	F	351;351;351;231	ENSP00000307525:S351F;ENSP00000417559:S351F;ENSP00000419004:S351F	ENSP00000307525:S351F	S	+	2	0	NMD3	162446852	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.963000	0.76055	2.709000	0.92574	0.655000	0.94253	TCT	.	.	.	none		0.353	NMD3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353114.1	NM_015938	
PARL	55486	hgsc.bcm.edu	37	3	183602604	183602604	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:183602604A>G	ENST00000317096.4	-	1	91	c.31T>C	c.(31-33)Tgg>Cgg	p.W11R	MIR4448_ENST00000584360.1_RNA|PARL_ENST00000311101.5_Missense_Mutation_p.W11R|PARL_ENST00000435888.1_Missense_Mutation_p.W11R|RP11-315J22.5_ENST00000445165.1_RNA	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	11					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CCGCAGCCCCAGCCTCTCTGC	0.697											OREG0015941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W11R		Atlas-SNP	.											.	PARL	32	.	0			c.T31C						PASS	.						10.0	11.0	11.0					3																	183602604		2174	4246	6420	SO:0001583	missense	55486	exon1			AGCCCCAGCCTCT	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.31T>C	chr3.hg19:g.183602604A>G	ENSP00000325421:p.Trp11Arg	17.0	0.0	.	1985	37.0	13.0	.	NM_018622	Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	SNP	ENST00000317096.4	hg19	CCDS3248.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650621	0.67472	.	.	ENSG00000175193	ENST00000317096;ENST00000311101;ENST00000435888	T;T;T	0.58652	0.42;0.32;0.33	4.72	4.72	0.59763	.	0.104022	0.38217	N	0.001779	T	0.51770	0.1694	L	0.40543	1.245	0.37352	D	0.910834	P;P	0.40107	0.703;0.664	B;B	0.42692	0.395;0.296	T	0.62959	-0.6743	10	0.87932	D	0	-25.2787	10.7723	0.46330	1.0:0.0:0.0:0.0	.	11;11	Q9H300-2;Q9H300	.;PARL_HUMAN	R	11	ENSP00000325421:W11R;ENSP00000310676:W11R;ENSP00000402137:W11R	ENSP00000310676:W11R	W	-	1	0	PARL	185085298	0.998000	0.40836	1.000000	0.80357	0.719000	0.41307	3.655000	0.54460	2.118000	0.64928	0.533000	0.62120	TGG	.	.	.	none		0.697	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	NM_018622	
MUC4	4585	hgsc.bcm.edu	37	3	195505787	195505787	+	Missense_Mutation	SNP	C	C	T	rs11915935		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:195505787C>T	ENST00000463781.3	-	2	13123	c.12664G>A	c.(12664-12666)Gcc>Acc	p.A4222T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A4222T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	979					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGCGTGACCTGTG	0.587																																					p.A4222T		Atlas-SNP	.											.	MUC4	1505	.	0			c.G12664A						PASS	.						27.0	28.0	27.0					3																	195505787		2081	4173	6254	SO:0001583	missense	4585	exon2			GGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12664G>A	chr3.hg19:g.195505787C>T	ENSP00000417498:p.Ala4222Thr	60.0	0.0	.		119.0	8.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	9.614	1.132017	0.21041	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.37;1.33	1.25	-1.78	0.07957	.	.	.	.	.	T	0.13030	0.0316	N	0.22421	0.69	0.09310	N	1	P	0.45986	0.87	B	0.24006	0.05	T	0.19160	-1.0314	8	.	.	.	.	2.6937	0.05128	0.3974:0.3581:0.2445:0.0	rs11915935	4094	E7ESK3	.	T	4222	ENSP00000417498:A4222T;ENSP00000420243:A4222T	.	A	-	1	0	MUC4	196990566	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.565000	0.05929	-0.465000	0.06953	0.487000	0.48397	GCC	.	.	.	weak		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195505790	195505790	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:195505790G>C	ENST00000463781.3	-	2	13120	c.12661C>G	c.(12661-12663)Cac>Gac	p.H4221D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H4221D|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	978					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGCGTGACCTGTGGAT	0.587																																					p.H4221D		Atlas-SNP	.											.	MUC4	1505	.	0			c.C12661G						PASS	.						24.0	25.0	25.0					3																	195505790		2080	4171	6251	SO:0001583	missense	4585	exon2			TGGCGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12661C>G	chr3.hg19:g.195505790G>C	ENSP00000417498:p.His4221Asp	60.0	0.0	.		120.0	9.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	7.658	0.684339	0.14907	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30182	1.55;1.54	1.25	1.25	0.21368	.	.	.	.	.	T	0.10508	0.0257	N	0.03608	-0.345	0.09310	N	1	B	0.30727	0.292	B	0.19391	0.025	T	0.24548	-1.0157	8	.	.	.	.	6.0271	0.19660	0.0:0.0:1.0:0.0	rs11928301	4093	E7ESK3	.	D	4221	ENSP00000417498:H4221D;ENSP00000420243:H4221D	.	H	-	1	0	MUC4	196990569	0.000000	0.05858	0.009000	0.14445	0.004000	0.04260	-0.034000	0.12225	1.015000	0.39444	0.482000	0.46254	CAC	.	.	.	weak		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195517971	195517971	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr3:195517971T>A	ENST00000463781.3	-	2	939	c.480A>T	c.(478-480)gaA>gaT	p.E160D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.E160D|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	165					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGTAGAACTTTCAGTTCCTG	0.458																																					p.E160D		Atlas-SNP	.											.	MUC4	1505	.	0			c.A480T						PASS	.						198.0	175.0	182.0					3																	195517971		2005	4193	6198	SO:0001583	missense	4585	exon2			AGAACTTTCAGTT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.480A>T	chr3.hg19:g.195517971T>A	ENSP00000417498:p.Glu160Asp	38.0	0.0	.		111.0	45.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	8.346	0.829900	0.16749	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.35973	1.28;1.29	3.47	-6.95	0.01628	.	11.711200	0.00166	N	0.000009	T	0.14313	0.0346	N	0.14661	0.345	0.09310	N	1	P;B	0.36354	0.549;0.016	B;B	0.30401	0.115;0.013	T	0.17561	-1.0365	10	0.15952	T	0.53	.	1.8667	0.03200	0.2254:0.1937:0.4234:0.1575	.	160;165	E7ESK3;Q99102	.;MUC4_HUMAN	D	160;160;134	ENSP00000417498:E160D;ENSP00000420243:E160D	ENSP00000376209:E134D	E	-	3	2	MUC4	197002366	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.885000	0.01620	-1.803000	0.01242	0.376000	0.23039	GAA	.	.	.	none		0.458	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZNF721	170960	hgsc.bcm.edu	37	4	436719	436719	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr4:436719A>G	ENST00000338977.5	-	2	1549	c.1501T>C	c.(1501-1503)Tcc>Ccc	p.S501P	ZNF721_ENST00000511833.2_Missense_Mutation_p.S513P|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						AGGGTTGTGGAACTAGTAAAC	0.398																																					p.G513R		Atlas-SNP	.											.	ZNF721	205	.	0			c.G1537C						PASS	.						84.0	92.0	89.0					4																	436719		2098	4242	6340	SO:0001583	missense	170960	exon3			TTGTGGAACTAGT	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1501T>C	chr4.hg19:g.436719A>G	ENSP00000340524:p.Ser501Pro	31.0	0.0	.		126.0	41.0	.	NM_133474	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	hg19		.	.	.	.	.	.	.	.	.	.	A	3.452	-0.111794	0.06881	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	T;T	0.07908	3.15;3.15	0.419	-0.837	0.10766	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13927	0.0337	L	0.55743	1.74	0.09310	N	1	P;P;P	0.45348	0.856;0.669;0.777	P;P;P	0.55112	0.592;0.592;0.769	T	0.16217	-1.0410	9	0.42905	T	0.14	.	4.3636	0.11213	0.3506:0.0:0.6494:0.0	.	501;513;513	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	P	501;513	ENSP00000340524:S501P;ENSP00000428878:S513P	ENSP00000340524:S501P	S	-	1	0	ZNF721	426719	0.000000	0.05858	0.002000	0.10522	0.089000	0.18198	-1.976000	0.01497	-0.428000	0.07339	0.155000	0.16302	TCC	.	.	.	none		0.398	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
TMEM192	201931	hgsc.bcm.edu	37	4	166000935	166000935	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr4:166000935G>T	ENST00000306480.6	-	6	836	c.691C>A	c.(691-693)Cta>Ata	p.L231I	TMEM192_ENST00000506087.1_Missense_Mutation_p.L227I	NM_001100389.1	NP_001093859.1	Q8IY95	TM192_HUMAN	transmembrane protein 192	231						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0926)		ATTTCTTCTAGGCTTGAAATA	0.388																																					p.L231I		Atlas-SNP	.											.	TMEM192	21	.	0			c.C691A						PASS	.						94.0	88.0	90.0					4																	166000935		1868	4109	5977	SO:0001583	missense	201931	exon6			CTTCTAGGCTTGA	BC036301	CCDS43279.1	4q32.3	2008-04-22			ENSG00000170088	ENSG00000170088			26775	protein-coding gene	gene with protein product						12477932	Standard	NM_001100389		Approved	FLJ38482	uc003iqz.4	Q8IY95	OTTHUMG00000161254	ENST00000306480.6:c.691C>A	chr4.hg19:g.166000935G>T	ENSP00000305069:p.Leu231Ile	36.0	0.0	.		76.0	27.0	.	NM_001100389	Q7Z3A1|Q8N928	Missense_Mutation	SNP	ENST00000306480.6	hg19	CCDS43279.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692853	0.30052	.	.	ENSG00000170088	ENST00000306480;ENST00000506087	.	.	.	5.97	3.32	0.38043	.	0.000000	0.85682	D	0.000000	T	0.59487	0.2197	M	0.73962	2.25	0.41322	D	0.987189	B	0.27997	0.197	B	0.30716	0.119	T	0.60627	-0.7226	9	0.66056	D	0.02	-38.5919	6.9529	0.24556	0.3323:0.0:0.6677:0.0	.	231	Q8IY95	TM192_HUMAN	I	231;227	.	ENSP00000305069:L231I	L	-	1	2	TMEM192	166220385	1.000000	0.71417	0.172000	0.22920	0.509000	0.34042	2.379000	0.44318	0.868000	0.35678	0.591000	0.81541	CTA	.	.	.	none		0.388	TMEM192-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364310.3	NM_152681	
PPARGC1B	133522	hgsc.bcm.edu	37	5	149213062	149213062	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr5:149213062G>A	ENST00000309241.5	+	5	1458	c.1426G>A	c.(1426-1428)Gtg>Atg	p.V476M	PPARGC1B_ENST00000360453.4_Missense_Mutation_p.V437M|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.V412M|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.V476M	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	476					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TGTGTGCCCCGTGCGGCGTTC	0.637																																					p.V476M		Atlas-SNP	.											PPARGC1B,colon,carcinoma,0,1	PPARGC1B	74	.	0			c.G1426A						PASS	.						42.0	44.0	43.0					5																	149213062		2182	4277	6459	SO:0001583	missense	133522	exon5			TGCCCCGTGCGGC	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.1426G>A	chr5.hg19:g.149213062G>A	ENSP00000312649:p.Val476Met	52.0	0.0	.		82.0	27.0	.	NM_133263	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	hg19	CCDS4298.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.80|18.80	3.700810|3.700810	0.68501|0.68501	.|.	.|.	ENSG00000155846|ENSG00000155846	ENST00000434684|ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	.|T;T;T;T	.|0.14266	.|2.53;2.52;2.54;2.52	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.29749|0.29749	0.0743|0.0743	L|L	0.36672|0.36672	1.1|1.1	0.43207|0.43207	D|D	0.995068|0.995068	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.91635	.|0.999;0.999;0.999;0.999;0.999	T|T	0.01294|0.01294	-1.1393|-1.1393	5|10	.|0.66056	.|D	.|0.02	-15.2485|-15.2485	17.3201|17.3201	0.87233|0.87233	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|455;455;437;476;476	.|Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.|.;.;.;PRGC2_HUMAN;.	H|M	162|437;476;476;412	.|ENSP00000353638:V437M;ENSP00000377855:V476M;ENSP00000312649:V476M;ENSP00000384403:V412M	.|ENSP00000312649:V476M	R|V	+|+	2|1	0|0	PPARGC1B|PPARGC1B	149193255|149193255	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.758000|0.758000	0.43043|0.43043	4.727000|4.727000	0.61993|0.61993	2.521000|2.521000	0.84997|0.84997	0.462000|0.462000	0.41574|0.41574	CGT|GTG	.	.	.	none		0.637	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263	
GALNT10	55568	hgsc.bcm.edu	37	5	153755929	153755929	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr5:153755929C>T	ENST00000297107.6	+	5	798	c.661C>T	c.(661-663)Cga>Tga	p.R221*	GALNT10_ENST00000519544.1_3'UTR|GALNT10_ENST00000425427.2_Nonsense_Mutation_p.R221*|GALNT10_ENST00000377661.2_Intron|SAP30L-AS1_ENST00000519727.1_RNA	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	221	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			GATAAGGACCCGAATGCTGGG	0.522																																					p.R221X		Atlas-SNP	.											.	GALNT10	70	.	0			c.C661T						PASS	.						90.0	89.0	90.0					5																	153755929		2203	4300	6503	SO:0001587	stop_gained	55568	exon5			AGGACCCGAATGC	AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.661C>T	chr5.hg19:g.153755929C>T	ENSP00000297107:p.Arg221*	88.0	0.0	.		159.0	61.0	.	NM_198321	B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Nonsense_Mutation	SNP	ENST00000297107.6	hg19	CCDS4325.1	.	.	.	.	.	.	.	.	.	.	C	38	7.017290	0.98006	.	.	ENSG00000164574	ENST00000425427;ENST00000297107	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	.	.	.	X	221	.	ENSP00000297107:R221X	R	+	1	2	GALNT10	153736122	0.997000	0.39634	1.000000	0.80357	0.936000	0.57629	3.644000	0.54381	2.884000	0.98904	0.655000	0.94253	CGA	.	.	.	none		0.522	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	NM_198321	
CPEB4	80315	hgsc.bcm.edu	37	5	173317154	173317154	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr5:173317154T>G	ENST00000265085.5	+	1	1872	c.418T>G	c.(418-420)Ttg>Gtg	p.L140V	CPEB4_ENST00000519835.1_Missense_Mutation_p.L140V|CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000520867.1_Missense_Mutation_p.L140V|CPEB4_ENST00000522336.1_5'Flank|CPEB4_ENST00000334035.5_Missense_Mutation_p.L140V	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	140					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATCTCCAGTGTTGACAGGGTT	0.448																																					p.L140V		Atlas-SNP	.											.	CPEB4	54	.	0			c.T418G						PASS	.						103.0	105.0	105.0					5																	173317154		2203	4300	6503	SO:0001583	missense	80315	exon1			CCAGTGTTGACAG	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.418T>G	chr5.hg19:g.173317154T>G	ENSP00000265085:p.Leu140Val	51.0	0.0	.		111.0	8.0	.	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	ENST00000265085.5	hg19	CCDS4390.1	.	.	.	.	.	.	.	.	.	.	T	14.40	2.525591	0.44969	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.96	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.59838	0.2223	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.71674	0.997;0.998;0.997;0.997	D;D;D;D	0.87578	0.996;0.998;0.996;0.996	T	0.61686	-0.7012	10	0.72032	D	0.01	-9.5609	9.6678	0.39994	0.0:0.1383:0.0:0.8617	.	140;140;140;140	B7ZLQ8;Q17RY0-2;E5RJM0;Q17RY0	.;.;.;CPEB4_HUMAN	V	140	ENSP00000265085:L140V;ENSP00000429092:L140V;ENSP00000334533:L140V;ENSP00000429048:L140V	ENSP00000265085:L140V	L	+	1	2	CPEB4	173249760	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.961000	0.40432	1.089000	0.41292	0.533000	0.62120	TTG	.	.	.	none		0.448	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
CDHR2	54825	hgsc.bcm.edu	37	5	176018324	176018324	+	Splice_Site	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr5:176018324G>A	ENST00000510636.1	+	29	3927	c.3653G>A	c.(3652-3654)cGa>cAa	p.R1218Q	CDHR2_ENST00000506348.1_Splice_Site_p.R1218Q|CDHR2_ENST00000261944.5_Splice_Site_p.R1218Q	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	1218					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						AACACTGAGCGGTGAGCAGGG	0.597																																					p.R1218Q		Atlas-SNP	.											.	CDHR2	152	.	0			c.G3653A						PASS	.						66.0	64.0	65.0					5																	176018324		2203	4300	6503	SO:0001630	splice_region_variant	54825	exon29			CTGAGCGGTGAGC	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.3653+1G>A	chr5.hg19:g.176018324G>A		52.0	0.0	.		122.0	44.0	.	NM_017675	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	hg19	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	g	12.10	1.836140	0.32421	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.56103	0.48;0.48;0.48	4.24	2.24	0.28232	.	.	.	.	.	T	0.45236	0.1332	M	0.70595	2.14	0.32458	N	0.544539	P	0.52061	0.95	B	0.38428	0.273	T	0.56378	-0.7989	9	0.25751	T	0.34	-7.212	9.1617	0.37028	0.203:0.0:0.797:0.0	.	1218	Q9BYE9	CDHR2_HUMAN	Q	1218	ENSP00000424565:R1218Q;ENSP00000261944:R1218Q;ENSP00000421078:R1218Q	ENSP00000261944:R1218Q	R	+	2	0	CDHR2	175950930	1.000000	0.71417	0.933000	0.37362	0.367000	0.29736	3.600000	0.54052	1.036000	0.39998	0.459000	0.35465	CGA	.	.	.	none		0.597	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	Missense_Mutation
DSP	1832	hgsc.bcm.edu	37	6	7583589	7583589	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:7583589G>A	ENST00000379802.3	+	24	6435	c.6094G>A	c.(6094-6096)Gta>Ata	p.V2032I	DSP_ENST00000418664.2_Missense_Mutation_p.V1433I	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2032	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATACTCTTTGGTAGAGGCCAA	0.478																																					p.V2032I		Atlas-SNP	.											.	DSP	306	.	0			c.G6094A						PASS	.						49.0	54.0	52.0					6																	7583589		2203	4300	6503	SO:0001583	missense	1832	exon24			TCTTTGGTAGAGG	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6094G>A	chr6.hg19:g.7583589G>A	ENSP00000369129:p.Val2032Ile	49.0	0.0	.		114.0	32.0	.	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	hg19	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877522	0.51801	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.67523	-0.27;-0.27	4.98	4.98	0.66077	.	0.000000	0.52532	D	0.000074	T	0.44456	0.1294	L	0.36672	1.1	0.25902	N	0.983344	P;P	0.45078	0.85;0.779	B;B	0.41236	0.278;0.351	T	0.45131	-0.9282	10	0.22109	T	0.4	.	18.6091	0.91277	0.0:0.0:1.0:0.0	.	1480;2032	Q4LE79;P15924	.;DESP_HUMAN	I	2032;1433	ENSP00000369129:V2032I;ENSP00000396591:V1433I	ENSP00000369129:V2032I	V	+	1	0	DSP	7528588	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.384000	0.59607	2.459000	0.83118	0.655000	0.94253	GTA	.	.	.	none		0.478	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
BMP6	654	hgsc.bcm.edu	37	6	7727541	7727541	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:7727541A>T	ENST00000283147.6	+	1	512	c.353A>T	c.(352-354)cAg>cTg	p.Q118L		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	118					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)	p.Q118L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					cagcagcagcagcTGCCTCGC	0.731																																					p.Q118L		Atlas-SNP	.											BMP6,NS,carcinoma,0,1	BMP6	67	.	1	Substitution - Missense(1)	lung(1)	c.A353T						PASS	.																																			SO:0001583	missense	654	exon1			AGCAGCAGCTGCC	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.353A>T	chr6.hg19:g.7727541A>T	ENSP00000283147:p.Gln118Leu	53.0	1.0	.		95.0	5.0	.	NM_001718	Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	hg19	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	A	5.648	0.304211	0.10678	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.72725	-0.68	3.64	-7.28	0.01456	Transforming growth factor-beta, N-terminal (1);	0.609742	0.13235	N	0.403351	T	0.27134	0.0665	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10382	-1.0632	10	0.41790	T	0.15	.	2.9855	0.05966	0.1788:0.4954:0.0931:0.2327	.	118	P22004	BMP6_HUMAN	L	40;118;81	ENSP00000283147:Q118L	ENSP00000283147:Q118L	Q	+	2	0	BMP6	7672540	0.177000	0.23109	0.002000	0.10522	0.071000	0.16799	-0.158000	0.10070	-1.400000	0.02061	-1.802000	0.00618	CAG	.	.	.	none		0.731	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718	
TMEM170B	100113407	hgsc.bcm.edu	37	6	11575733	11575733	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:11575733G>T	ENST00000379426.1	+	3	338	c.338G>T	c.(337-339)gGc>gTc	p.G113V	TMEM170B_ENST00000543875.1_Missense_Mutation_p.G113V	NM_001100829.1	NP_001094299.1	Q5T4T1	T170B_HUMAN	transmembrane protein 170B	113						integral component of membrane (GO:0016021)				large_intestine(3)|lung(5)	8						CTGGTATGGGGCGTTGGACAG	0.473																																					p.G113V		Atlas-SNP	.											.	TMEM170B	9	.	0			c.G338T						PASS	.						203.0	196.0	198.0					6																	11575733		1966	4141	6107	SO:0001583	missense	100113407	exon3			TATGGGGCGTTGG		CCDS43425.1	6p24.1	2008-08-08			ENSG00000205269	ENSG00000205269			34244	protein-coding gene	gene with protein product							Standard	NM_001100829		Approved		uc010jpa.4	Q5T4T1	OTTHUMG00000014259	ENST00000379426.1:c.338G>T	chr6.hg19:g.11575733G>T	ENSP00000368737:p.Gly113Val	75.0	0.0	.		134.0	36.0	.	NM_001100829		Missense_Mutation	SNP	ENST00000379426.1	hg19	CCDS43425.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373246	0.82573	.	.	ENSG00000205269	ENST00000543875;ENST00000379426	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.72859	0.3513	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.75645	-0.3246	9	0.87932	D	0	-20.3795	19.0673	0.93116	0.0:0.0:1.0:0.0	.	113	Q5T4T1	T170B_HUMAN	V	113	.	ENSP00000368737:G113V	G	+	2	0	TMEM170B	11683719	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	9.466000	0.97665	2.502000	0.84385	0.579000	0.79373	GGC	.	.	.	none		0.473	TMEM170B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000039862.1	NM_001100829	
ECT2L	345930	hgsc.bcm.edu	37	6	139135653	139135653	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:139135653T>C	ENST00000423192.1	+	3	253	c.92T>C	c.(91-93)aTa>aCa	p.I31T	ECT2L_ENST00000367682.2_Missense_Mutation_p.I31T|ECT2L_ENST00000541398.1_5'Flank			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	31							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						GTGGCTCTTATAAGTCATTGG	0.368			"""N, Splice, Mis"""		ETP ALL																																p.I31T		Atlas-SNP	.		Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	ECT2L	75	.	0			c.T92C						PASS	.						77.0	75.0	76.0					6																	139135653		1836	4092	5928	SO:0001583	missense	345930	exon3			CTCTTATAAGTCA		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.92T>C	chr6.hg19:g.139135653T>C	ENSP00000387388:p.Ile31Thr	48.0	0.0	.		112.0	45.0	.	NM_001195037	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	hg19	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.809410	0.50421	.	.	ENSG00000203734	ENST00000423192;ENST00000401414;ENST00000367682	T;T;T	0.62498	0.02;0.65;0.02	5.43	5.43	0.79202	.	.	.	.	.	T	0.44477	0.1295	L	0.33485	1.01	0.80722	D	1	D	0.54047	0.964	P	0.45310	0.476	T	0.55347	-0.8155	9	0.87932	D	0	.	13.0191	0.58775	0.0:0.0:0.0:1.0	.	31	Q008S8	ECT2L_HUMAN	T	31	ENSP00000387388:I31T;ENSP00000385187:I31T;ENSP00000356655:I31T	ENSP00000356655:I31T	I	+	2	0	ECT2L	139177346	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.876000	0.63079	2.066000	0.61787	0.533000	0.62120	ATA	.	.	.	none		0.368	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706	
CITED2	10370	hgsc.bcm.edu	37	6	139694869	139694869	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:139694869A>G	ENST00000367651.2	-	2	428	c.213T>C	c.(211-213)caT>caC	p.H71H	CITED2_ENST00000537332.1_Silent_p.H71H|CITED2_ENST00000536159.1_Silent_p.H71H	NM_006079.4	NP_006070.2	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	71					adrenal cortex formation (GO:0035802)|bone morphogenesis (GO:0060349)|cardiac neural crest cell development involved in heart development (GO:0061308)|cell aging (GO:0007569)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|cranial nerve morphogenesis (GO:0021602)|decidualization (GO:0046697)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endocardial cushion development (GO:0003197)|erythrocyte development (GO:0048821)|granulocyte differentiation (GO:0030851)|heart development (GO:0007507)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|left/right axis specification (GO:0070986)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|peripheral nervous system development (GO:0007422)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of gene expression (GO:0010628)|positive regulation of male gonad development (GO:2000020)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|pulmonary artery morphogenesis (GO:0061156)|regulation of organ formation (GO:0003156)|regulation of RNA biosynthetic process (GO:2001141)|response to estrogen (GO:0043627)|response to fluid shear stress (GO:0034405)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sex determination (GO:0007530)|skeletal muscle cell differentiation (GO:0035914)|spleen development (GO:0048536)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|LBD domain binding (GO:0050693)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(4)	5	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		GCCCCATCGCATGCCTGATGC	0.672																																					p.H76H	NSCLC(98;1219 1550 33720 43229 49330)	Atlas-SNP	.											.	CITED2	16	.	0			c.T228C						PASS	.						34.0	34.0	34.0					6																	139694869		2203	4299	6502	SO:0001819	synonymous_variant	10370	exon2			CATCGCATGCCTG	U65093	CCDS5195.1, CCDS75530.1	6q23.3	2008-08-29			ENSG00000164442	ENSG00000164442			1987	protein-coding gene	gene with protein product		602937				8901575, 10552932	Standard	NM_006079		Approved	MRG1	uc021zfz.2	Q99967	OTTHUMG00000015691	ENST00000367651.2:c.213T>C	chr6.hg19:g.139694869A>G		20.0	0.0	.		33.0	11.0	.	NM_001168389	O95426|Q5VTF4	Silent	SNP	ENST00000367651.2	hg19	CCDS5195.1																																																																																			.	.	.	none		0.672	CITED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042463.1		
RADIL	55698	hgsc.bcm.edu	37	7	4841357	4841357	+	Silent	SNP	G	G	A	rs369296363	byFrequency	TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:4841357G>A	ENST00000399583.3	-	12	2956	c.2769C>T	c.(2767-2769)ggC>ggT	p.G923G	RADIL_ENST00000536091.1_3'UTR|RADIL_ENST00000538469.1_Silent_p.G683G	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	923	Pro-rich.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CACAGGGGCCGCCGGACTCTG	0.711													G|||	2	0.000399361	0.0015	0.0	5008	,	,		14081	0.0		0.0	False		,,,				2504	0.0				p.G923G		Atlas-SNP	.											RADIL,right_upper_lobe,carcinoma,0,1	RADIL	110	.	0			c.C2769T						PASS	.	G		2,3724		0,2,1861	8.0	10.0	10.0		2769	-3.9	0.0	7		10	0,8120		0,0,4060	no	coding-synonymous	RADIL	NM_018059.4		0,2,5921	AA,AG,GG		0.0,0.0537,0.0169		923/1076	4841357	2,11844	1863	4060	5923	SO:0001819	synonymous_variant	55698	exon12			GGGGCCGCCGGAC	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.2769C>T	chr7.hg19:g.4841357G>A		111.0	0.0	.		300.0	118.0	.	NM_018059	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	ENST00000399583.3	hg19	CCDS43544.1																																																																																			.	.	.	weak		0.711	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
VWDE	221806	hgsc.bcm.edu	37	7	12375822	12375822	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:12375822A>C	ENST00000275358.3	-	27	4787	c.4599T>G	c.(4597-4599)atT>atG	p.I1533M		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1533	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TGCTGGGCGCAATGCATTCAC	0.393																																					p.I1533M		Atlas-SNP	.											.	VWDE	123	.	0			c.T4599G						PASS	.						129.0	120.0	123.0					7																	12375822		692	1591	2283	SO:0001583	missense	221806	exon27			GGGCGCAATGCAT		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.4599T>G	chr7.hg19:g.12375822A>C	ENSP00000275358:p.Ile1533Met	86.0	0.0	.		292.0	128.0	.	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	A	13.50	2.255267	0.39896	.	.	ENSG00000146530	ENST00000275358	T	0.47528	0.84	4.93	-4.32	0.03688	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.522168	0.20233	N	0.096444	T	0.41789	0.1174	M	0.69358	2.11	0.22710	N	0.99882	D	0.54397	0.966	P	0.50440	0.641	T	0.33163	-0.9879	10	0.46703	T	0.11	.	1.1097	0.01701	0.3368:0.3121:0.1346:0.2165	.	1533	Q8N2E2	VWDE_HUMAN	M	1533	ENSP00000275358:I1533M	ENSP00000275358:I1533M	I	-	3	3	VWDE	12342347	0.148000	0.22702	0.759000	0.31340	0.104000	0.19210	-0.598000	0.05706	-0.445000	0.07159	0.533000	0.62120	ATT	.	.	.	none		0.393	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
PRRT4	401399	hgsc.bcm.edu	37	7	127991277	127991277	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:127991277C>G	ENST00000446477.2	-	6	2646	c.2333G>C	c.(2332-2334)gGg>gCg	p.G778A	PRRT4_ENST00000435512.1_Missense_Mutation_p.G572A|PRRT4_ENST00000535159.1_Missense_Mutation_p.G778A|PRRT4_ENST00000489835.2_3'UTR	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	778						integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						AGAGGCCTCCCCTGATCTCTC	0.731																																					p.G778A		Atlas-SNP	.											.	PRRT4	31	.	0			c.G2333C						PASS	.						2.0	4.0	4.0					7																	127991277		565	1396	1961	SO:0001583	missense	401399	exon6			GCCTCCCCTGATC	BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.2333G>C	chr7.hg19:g.127991277C>G	ENSP00000415026:p.Gly778Ala	14.0	0.0	.		56.0	21.0	.	NM_001174164	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	hg19	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	C	4.131	0.022554	0.08006	.	.	ENSG00000224940	ENST00000446477;ENST00000480290;ENST00000535159;ENST00000435512	.	.	.	4.1	-0.845	0.10737	.	.	.	.	.	T	0.16428	0.0395	N	0.08118	0	0.20703	N	0.999864	B	0.19200	0.034	B	0.25291	0.059	T	0.36553	-0.9743	8	0.12103	T	0.63	-13.93	8.1967	0.31400	0.0:0.4475:0.0:0.5525	.	778	C9JH25	PRRT4_HUMAN	A	778;307;778;572	.	ENSP00000410779:G572A	G	-	2	0	PRRT4	127778513	0.000000	0.05858	0.628000	0.29241	0.166000	0.22503	0.116000	0.15561	-0.025000	0.13918	-0.379000	0.06801	GGG	.	.	.	none		0.731	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001114726	
POMK	84197	hgsc.bcm.edu	37	8	42977953	42977953	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr8:42977953A>G	ENST00000331373.5	+	5	1241	c.986A>G	c.(985-987)gAg>gGg	p.E329G		NM_001277971.1|NM_032237.3	NP_001264900.1|NP_115613.1	Q9H5K3	SG196_HUMAN	protein-O-mannose kinase	329	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|carbohydrate phosphorylation (GO:0046835)|learning or memory (GO:0007611)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|protein O-linked glycosylation (GO:0006493)|sensory perception of pain (GO:0019233)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|carbohydrate kinase activity (GO:0019200)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|protein kinase activity (GO:0004672)										GACGTTCTGGAGACCTACCAG	0.478																																					p.E329G		Atlas-SNP	.											.	.	.	.	0			c.A986G						PASS	.						87.0	94.0	91.0					8																	42977953		2203	4300	6503	SO:0001583	missense	0	exon5			TTCTGGAGACCTA		CCDS6141.1	8p11.21	2013-08-22			ENSG00000185900	ENSG00000185900			26267	protein-coding gene	gene with protein product		615247				16879967, 23519211	Standard	NM_001277971		Approved	FLJ23356, SgK196		Q9H5K3	OTTHUMG00000164100	ENST00000331373.5:c.986A>G	chr8.hg19:g.42977953A>G	ENSP00000331258:p.Glu329Gly	33.0	0.0	.		64.0	23.0	.	NM_032237		Missense_Mutation	SNP	ENST00000331373.5	hg19	CCDS6141.1	.	.	.	.	.	.	.	.	.	.	A	10.75	1.439110	0.25900	.	.	ENSG00000185900	ENST00000331373	T	0.23348	1.91	5.45	5.45	0.79879	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.258956	0.44483	D	0.000449	T	0.19446	0.0467	L	0.29908	0.895	0.26493	N	0.974911	B	0.22604	0.072	B	0.19391	0.025	T	0.12293	-1.0553	9	.	.	.	-20.8671	13.4611	0.61227	1.0:0.0:0.0:0.0	.	329	Q9H5K3	SG196_HUMAN	G	329	ENSP00000331258:E329G	.	E	+	2	0	AC113191.1	43097110	1.000000	0.71417	0.760000	0.31359	0.425000	0.31504	3.808000	0.55598	2.065000	0.61736	0.482000	0.46254	GAG	.	.	.	none		0.478	POMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377291.2	NM_032237	
FER1L6	654463	hgsc.bcm.edu	37	8	124992806	124992806	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr8:124992806G>A	ENST00000522917.1	+	11	1371	c.1165G>A	c.(1165-1167)Gaa>Aaa	p.E389K	FER1L6_ENST00000399018.1_Missense_Mutation_p.E389K	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	389						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AGGCTTTGGGGAAGGTGTGTC	0.512											OREG0018964	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E389K		Atlas-SNP	.											.	FER1L6	268	.	0			c.G1165A						PASS	.						161.0	159.0	160.0					8																	124992806		1882	4115	5997	SO:0001583	missense	654463	exon11			TTTGGGGAAGGTG	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.1165G>A	chr8.hg19:g.124992806G>A	ENSP00000428280:p.Glu389Lys	115.0	0.0	.	1538	278.0	93.0	.	NM_001039112		Missense_Mutation	SNP	ENST00000522917.1	hg19	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	G	35	5.527427	0.96431	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.83673	-1.75;-1.75	5.53	5.53	0.82687	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000003	D	0.91882	0.7430	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90993	0.4836	10	0.40728	T	0.16	.	19.466	0.94939	0.0:0.0:1.0:0.0	.	389	Q2WGJ9	FR1L6_HUMAN	K	389	ENSP00000428280:E389K;ENSP00000381982:E389K	ENSP00000381982:E389K	E	+	1	0	FER1L6	125061987	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.813000	0.99286	2.607000	0.88179	0.655000	0.94253	GAA	.	.	.	none		0.512	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
ZBTB5	9925	hgsc.bcm.edu	37	9	37441549	37441549	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:37441549G>T	ENST00000307750.4	-	2	1188	c.1000C>A	c.(1000-1002)Ctg>Atg	p.L334M		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	334					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		GGTGAGCTCAGGGGCTCAGAT	0.522																																					p.L334M		Atlas-SNP	.											.	ZBTB5	43	.	0			c.C1000A						PASS	.						103.0	94.0	97.0					9																	37441549		2203	4300	6503	SO:0001583	missense	9925	exon2			AGCTCAGGGGCTC	AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.1000C>A	chr9.hg19:g.37441549G>T	ENSP00000307604:p.Leu334Met	20.0	0.0	.		45.0	12.0	.	NM_014872		Missense_Mutation	SNP	ENST00000307750.4	hg19	CCDS6610.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.155723	0.38021	.	.	ENSG00000168795	ENST00000307750	T	0.16196	2.36	5.49	1.43	0.22495	.	0.167314	0.39985	N	0.001220	T	0.22360	0.0539	N	0.24115	0.695	0.48395	D	0.999648	D	0.71674	0.998	D	0.80764	0.994	T	0.01225	-1.1413	10	0.29301	T	0.29	.	10.2477	0.43352	0.3912:0.0:0.6088:0.0	.	334	O15062	ZBTB5_HUMAN	M	334	ENSP00000307604:L334M	ENSP00000307604:L334M	L	-	1	2	ZBTB5	37431549	0.995000	0.38212	0.998000	0.56505	0.932000	0.56968	1.979000	0.40608	0.457000	0.26962	-0.136000	0.14681	CTG	.	.	.	none		0.522	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052462.1	NM_014872	
ABCA1	19	hgsc.bcm.edu	37	9	107578436	107578436	+	Silent	SNP	C	C	T	rs548468204	byFrequency	TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:107578436C>T	ENST00000374736.3	-	25	4120	c.3726G>A	c.(3724-3726)acG>acA	p.T1242T		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1242					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CTTCCAGGGTCGTCTCTGAGA	0.483													C|||	4	0.000798722	0.0	0.0	5008	,	,		19115	0.0		0.0	False		,,,				2504	0.0041				p.T1242T		Atlas-SNP	.											.	ABCA1	244	.	0			c.G3726A						PASS	.						166.0	178.0	174.0					9																	107578436		2203	4300	6503	SO:0001819	synonymous_variant	19	exon25			CAGGGTCGTCTCT	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.3726G>A	chr9.hg19:g.107578436C>T		44.0	0.0	.		120.0	51.0	.	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Silent	SNP	ENST00000374736.3	hg19	CCDS6762.1																																																																																			.	.	.	none		0.483	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
COQ4	51117	hgsc.bcm.edu	37	9	131095205	131095205	+	Silent	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:131095205G>A	ENST00000300452.3	+	6	932	c.609G>A	c.(607-609)ccG>ccA	p.P203P	COQ4_ENST00000461102.1_3'UTR	NM_016035.3	NP_057119			coenzyme Q4											endometrium(4)|large_intestine(1)|lung(4)	9						TCTTTGGACCGATCCGACTTG	0.557																																					p.P203P		Atlas-SNP	.											.	COQ4	20	.	0			c.G609A						PASS	.						194.0	158.0	171.0					9																	131095205		2203	4300	6503	SO:0001819	synonymous_variant	51117	exon6			TGGACCGATCCGA	AF151850	CCDS6898.1	9q34.2	2013-10-18	2013-10-18		ENSG00000167113	ENSG00000167113			19693	protein-coding gene	gene with protein product		612898	"""coenzyme Q4 homolog (yeast)"", ""coenzyme Q4 homolog (S. cerevisiae)"""			11469793, 18474229	Standard	NM_016035		Approved	CGI-92	uc004bur.4	Q9Y3A0	OTTHUMG00000020743	ENST00000300452.3:c.609G>A	chr9.hg19:g.131095205G>A		86.0	0.0	.		184.0	68.0	.	NM_016035		Silent	SNP	ENST00000300452.3	hg19	CCDS6898.1																																																																																			.	.	.	none		0.557	COQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054427.1	NM_016035	
SURF2	6835	hgsc.bcm.edu	37	9	136227264	136227264	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:136227264G>T	ENST00000371964.4	+	5	682	c.641G>T	c.(640-642)aGg>aTg	p.R214M		NM_017503.3	NP_059973.4	Q15527	SURF2_HUMAN	surfeit 2	214						nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(145;4.87e-07)|Epithelial(140;4.02e-06)|all cancers(34;3.71e-05)		GATGAGAGCAGGAGAGAGACG	0.557																																					p.R214M		Atlas-SNP	.											.	SURF2	9	.	0			c.G641T						PASS	.						131.0	111.0	118.0					9																	136227264		2203	4300	6503	SO:0001583	missense	6835	exon5			AGAGCAGGAGAGA		CCDS6967.1	9q33-q34	2008-07-21			ENSG00000148291	ENSG00000148291			11475	protein-coding gene	gene with protein product	"""surfeit locus protein 2"""	185630					Standard	NM_017503		Approved		uc004cdi.2	Q15527	OTTHUMG00000020867	ENST00000371964.4:c.641G>T	chr9.hg19:g.136227264G>T	ENSP00000361032:p.Arg214Met	30.0	0.0	.		52.0	19.0	.	NM_017503	Q6IBP9|Q96CD1	Missense_Mutation	SNP	ENST00000371964.4	hg19	CCDS6967.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.190148	0.38707	.	.	ENSG00000148291	ENST00000371964	T	0.33216	1.42	2.84	0.71	0.18157	.	0.792035	0.11077	N	0.602308	T	0.28566	0.0707	L	0.51422	1.61	0.09310	N	1	P	0.50710	0.938	P	0.45343	0.477	T	0.14227	-1.0480	10	0.54805	T	0.06	-4.7868	5.4059	0.16320	0.1238:0.2056:0.6706:0.0	.	214	Q15527	SURF2_HUMAN	M	214	ENSP00000361032:R214M	ENSP00000361032:R214M	R	+	2	0	SURF2	135217085	0.005000	0.15991	0.000000	0.03702	0.030000	0.12068	1.572000	0.36461	0.015000	0.14971	0.462000	0.41574	AGG	.	.	.	none		0.557	SURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054883.1	NM_017503	
NOTCH1	4851	hgsc.bcm.edu	37	9	139407915	139407915	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr9:139407915G>T	ENST00000277541.6	-	14	2357	c.2282C>A	c.(2281-2283)cCt>cAt	p.P761H		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	761	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTTGACACAAGGGTTGGATTC	0.587			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.P761H		Atlas-SNP	.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1	1980	.	0			c.C2282A						PASS	.						104.0	118.0	113.0					9																	139407915		2187	4274	6461	SO:0001583	missense	4851	exon14			ACACAAGGGTTGG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2282C>A	chr9.hg19:g.139407915G>T	ENSP00000277541:p.Pro761His	30.0	0.0	.		68.0	20.0	.	NM_017617	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	hg19	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497270	0.64186	.	.	ENSG00000148400	ENST00000277541	D	0.93189	-3.18	4.76	4.76	0.60689	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.97539	0.9194	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98725	1.0710	10	0.72032	D	0.01	.	16.7491	0.85480	0.0:0.0:1.0:0.0	.	761	P46531	NOTC1_HUMAN	H	761	ENSP00000277541:P761H	ENSP00000277541:P761H	P	-	2	0	NOTCH1	138527736	1.000000	0.71417	1.000000	0.80357	0.223000	0.24884	9.349000	0.97066	2.199000	0.70637	0.455000	0.32223	CCT	.	.	.	none		0.587	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.E343E	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																					p.E422E		Atlas-SNP	.											C10orf140_ENST00000449193,rectum,carcinoma,0,4	.	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1266A						PASS	.						5.0	6.0	6.0					10																	21805486		1988	4108	6096	SO:0001819	synonymous_variant	387640	exon4			TTCCTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	chr10.hg19:g.21805486C>T		35.0	0.0	.		53.0	7.0	.	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	hg19	CCDS44363.1																																																																																			.	.	.	none		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
BMS1	9790	hgsc.bcm.edu	37	10	43294061	43294061	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr10:43294061G>T	ENST00000374518.5	+	12	2298	c.2235G>T	c.(2233-2235)tgG>tgT	p.W745C		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	745					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CCCATGACTGGGATTTAGAGG	0.428																																					p.W745C		Atlas-SNP	.											.	BMS1	132	.	0			c.G2235T						PASS	.						91.0	97.0	95.0					10																	43294061		2203	4300	6503	SO:0001583	missense	9790	exon12			TGACTGGGATTTA	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2235G>T	chr10.hg19:g.43294061G>T	ENSP00000363642:p.Trp745Cys	80.0	0.0	.		173.0	7.0	.	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	hg19	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986911	0.74589	.	.	ENSG00000165733	ENST00000374518	T	0.53857	0.6	5.92	5.92	0.95590	.	0.060191	0.64402	D	0.000001	T	0.76314	0.3970	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.77219	-0.2668	10	0.66056	D	0.02	.	20.3734	0.98896	0.0:0.0:1.0:0.0	.	745	Q14692	BMS1_HUMAN	C	745	ENSP00000363642:W745C	ENSP00000363642:W745C	W	+	3	0	BMS1	42614067	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	9.218000	0.95166	2.820000	0.97059	0.650000	0.86243	TGG	.	.	.	none		0.428	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
C10orf12	26148	hgsc.bcm.edu	37	10	98741939	98741939	+	Silent	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr10:98741939T>G	ENST00000286067.2	+	1	899	c.792T>G	c.(790-792)tcT>tcG	p.S264S		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	264										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AAATCACCTCTCACGAGGAAG	0.512																																					p.S264S		Atlas-SNP	.											.	C10orf12	94	.	0			c.T792G						PASS	.						89.0	90.0	90.0					10																	98741939		2203	4300	6503	SO:0001819	synonymous_variant	26148	exon1			CACCTCTCACGAG	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.792T>G	chr10.hg19:g.98741939T>G		65.0	0.0	.		110.0	37.0	.	NM_015652	Q9H945|Q9Y457	Silent	SNP	ENST00000286067.2	hg19	CCDS7452.1																																																																																			.	.	.	none		0.512	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
PDCD4	27250	hgsc.bcm.edu	37	10	112655819	112655819	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr10:112655819A>G	ENST00000280154.7	+	11	1597	c.1323A>G	c.(1321-1323)aaA>aaG	p.K441K	PDCD4_ENST00000393104.2_Silent_p.K430K|MIR4680_ENST00000580906.1_RNA	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	441	MI 2. {ECO:0000255|PROSITE- ProRule:PRU00698}.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		TAATTTCCAAACAACTCAGAG	0.358																																					p.K441K	Ovarian(115;1498 1603 9363 40056 40885)	Atlas-SNP	.											.	PDCD4	39	.	0			c.A1323G						PASS	.						78.0	78.0	78.0					10																	112655819		2202	4300	6502	SO:0001819	synonymous_variant	27250	exon11			TTCCAAACAACTC	U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.1323A>G	chr10.hg19:g.112655819A>G		86.0	0.0	.		205.0	64.0	.	NM_014456	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Silent	SNP	ENST00000280154.7	hg19	CCDS7567.1																																																																																			.	.	.	none		0.358	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050361.1	NM_014456	
SLC22A10	387775	hgsc.bcm.edu	37	11	63065116	63065116	+	Silent	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:63065116A>T	ENST00000332793.6	+	4	749	c.747A>T	c.(745-747)ggA>ggT	p.G249G	SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000544661.1_Silent_p.G94G|SLC22A10_ENST00000525620.1_3'UTR|SLC22A10_ENST00000535888.1_Silent_p.G39G	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	249						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	TAATCCTGGGAGGCTTGGCTT	0.463																																					p.G249G		Atlas-SNP	.											.	SLC22A10	79	.	0			c.A747T						PASS	.						159.0	149.0	152.0					11																	63065116		1933	4127	6060	SO:0001819	synonymous_variant	387775	exon4			CCTGGGAGGCTTG	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.747A>T	chr11.hg19:g.63065116A>T		85.0	0.0	.		156.0	64.0	.	NM_001039752	Q68CJ0	Silent	SNP	ENST00000332793.6	hg19	CCDS41661.1																																																																																			.	.	.	none		0.463	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
SLC22A10	387775	hgsc.bcm.edu	37	11	63071636	63071636	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:63071636A>G	ENST00000332793.6	+	8	1344	c.1342A>G	c.(1342-1344)Act>Gct	p.T448A	SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000544661.1_Silent_p.L246L|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	448						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	TTCTGCTGCTACTTTTTCCAG	0.483																																					p.T448A		Atlas-SNP	.											.	SLC22A10	79	.	0			c.A1342G						PASS	.						212.0	217.0	215.0					11																	63071636		2073	4247	6320	SO:0001583	missense	387775	exon8			GCTGCTACTTTTT	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.1342A>G	chr11.hg19:g.63071636A>G	ENSP00000327569:p.Thr448Ala	41.0	0.0	.		75.0	26.0	.	NM_001039752	Q68CJ0	Missense_Mutation	SNP	ENST00000332793.6	hg19	CCDS41661.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.853818	0.00066	.	.	ENSG00000184999	ENST00000332793	T	0.74526	-0.85	3.05	-6.11	0.02131	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.214933	0.39020	N	0.001483	T	0.27594	0.0678	N	0.00525	-1.395	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.33137	-0.9880	10	0.05351	T	0.99	.	5.742	0.18100	0.3421:0.0:0.1242:0.5336	.	448	Q63ZE4	S22AA_HUMAN	A	448	ENSP00000327569:T448A	ENSP00000327569:T448A	T	+	1	0	SLC22A10	62828212	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.437000	0.01018	-3.799000	0.00105	-1.485000	0.00982	ACT	.	.	.	none		0.483	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
MAML2	84441	hgsc.bcm.edu	37	11	95825254	95825254	+	Silent	SNP	C	C	T	rs61749250		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:95825254C>T	ENST00000524717.1	-	2	3225	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	647					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q647Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q647Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,caecum,carcinoma,0,2	MAML2	94	.	1	Substitution - coding silent(1)	endometrium(1)	c.G1941A						PASS	.	C		0,4198		0,0,2099	35.0	40.0	38.0		1941	1.7	0.1	11	dbSNP_129	38	5,8237		0,5,4116	no	coding-synonymous	MAML2	NM_032427.1		0,5,6215	TT,TC,CC		0.0607,0.0,0.0402		647/1157	95825254	5,12435	2099	4121	6220	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1941G>A	chr11.hg19:g.95825254C>T		40.0	1.0	.		76.0	4.0	.	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	hg19	CCDS44714.1																																																																																			.	.	.	weak		0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
NPAT	4863	hgsc.bcm.edu	37	11	108043550	108043550	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:108043550C>T	ENST00000278612.8	-	13	2266	c.2161G>A	c.(2161-2163)Gat>Aat	p.D721N	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	721					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		GGTTTATCATCAGTATTTTGG	0.428																																					p.D721N		Atlas-SNP	.											.	NPAT	124	.	0			c.G2161A						PASS	.						120.0	110.0	113.0					11																	108043550		1892	4120	6012	SO:0001583	missense	4863	exon13			TATCATCAGTATT	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.2161G>A	chr11.hg19:g.108043550C>T	ENSP00000278612:p.Asp721Asn	36.0	0.0	.		66.0	21.0	.	NM_002519	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	hg19	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	C	1.672	-0.508824	0.04231	.	.	ENSG00000149308	ENST00000278612	T	0.03982	3.74	5.55	-1.3	0.09259	.	1.001340	0.08051	N	0.996678	T	0.02418	0.0074	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.49204	-0.8964	10	0.18710	T	0.47	3.2313	6.8937	0.24245	0.1138:0.3772:0.0:0.509	.	721;721	B9EG70;Q14207	.;NPAT_HUMAN	N	721	ENSP00000278612:D721N	ENSP00000278612:D721N	D	-	1	0	NPAT	107548760	0.145000	0.22656	0.022000	0.16811	0.316000	0.28119	0.773000	0.26661	-0.127000	0.11661	-0.136000	0.14681	GAT	.	.	.	none		0.428	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
BCL9L	283149	hgsc.bcm.edu	37	11	118773516	118773516	+	Silent	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr11:118773516C>A	ENST00000334801.3	-	6	1900	c.936G>T	c.(934-936)ccG>ccT	p.P312P	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	312	Necessary for interaction with CTNNB1. {ECO:0000250}.|Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TGCCAGGGGCCGGGGGTGGCG	0.731																																					p.P312P		Atlas-SNP	.											.	BCL9L	254	.	0			c.G936T						PASS	.						5.0	7.0	6.0					11																	118773516		2014	4005	6019	SO:0001819	synonymous_variant	283149	exon6			AGGGGCCGGGGGT	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.936G>T	chr11.hg19:g.118773516C>A		3.0	0.0	.		10.0	5.0	.	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Silent	SNP	ENST00000334801.3	hg19	CCDS8403.1																																																																																			.	.	.	none		0.731	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
SOX5	6660	hgsc.bcm.edu	37	12	23757377	23757377	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:23757377A>G	ENST00000451604.2	-	9	1209	c.1108T>C	c.(1108-1110)Tct>Cct	p.S370P	SOX5_ENST00000545921.1_Missense_Mutation_p.S360P|SOX5_ENST00000381381.2_Missense_Mutation_p.S357P|SOX5_ENST00000537393.1_Missense_Mutation_p.S335P|SOX5_ENST00000541536.1_Missense_Mutation_p.S357P|SOX5_ENST00000546136.1_Missense_Mutation_p.S357P|SOX5_ENST00000309359.1_Missense_Mutation_p.S357P			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	370					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CTGGTAGGAGATACAGCAGCA	0.502																																					p.S370P		Atlas-SNP	.											SOX5,colon,carcinoma,0,1	SOX5	134	.	0			c.T1108C						PASS	.						164.0	133.0	144.0					12																	23757377		2203	4300	6503	SO:0001583	missense	6660	exon9			TAGGAGATACAGC	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.1108T>C	chr12.hg19:g.23757377A>G	ENSP00000398273:p.Ser370Pro	51.0	0.0	.		125.0	33.0	.	NM_006940	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	hg19	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.520861	0.85495	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921	D;D;D;D;D;D;D	0.97831	-4.54;-4.54;-4.24;-4.55;-4.56;-4.24;-4.55	6.16	6.16	0.99307	.	0.171135	0.53938	D	0.000045	D	0.98251	0.9421	M	0.64567	1.98	0.53688	D	0.999975	D;P;D	0.60160	0.987;0.945;0.978	P;D;P	0.68621	0.907;0.959;0.809	D	0.98503	1.0615	10	0.41790	T	0.15	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	335;357;370	F5H0I3;P35711-4;P35711	.;.;SOX5_HUMAN	P	357;357;357;370;322;335;357;360	ENSP00000437487:S357P;ENSP00000308927:S357P;ENSP00000370788:S357P;ENSP00000398273:S370P;ENSP00000439832:S335P;ENSP00000441973:S357P;ENSP00000443520:S360P	ENSP00000308927:S357P	S	-	1	0	SOX5	23648644	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.618000	0.67722	2.367000	0.80283	0.528000	0.53228	TCT	.	.	.	none		0.502	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940	
ADCY6	112	hgsc.bcm.edu	37	12	49168249	49168249	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:49168249G>A	ENST00000307885.4	-	13	2913	c.2219C>T	c.(2218-2220)gCa>gTa	p.A740V	ADCY6_ENST00000550422.1_Missense_Mutation_p.A740V|ADCY6_ENST00000357869.3_Missense_Mutation_p.A740V|ADCY6_ENST00000552090.1_5'UTR|MIR4701_ENST00000583094.1_RNA	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	740					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						GGTGCTATGTGCCCGTGAGCG	0.537																																					p.A740V		Atlas-SNP	.											.	ADCY6	81	.	0			c.C2219T						PASS	.						134.0	112.0	119.0					12																	49168249		2203	4300	6503	SO:0001583	missense	112	exon14			CTATGTGCCCGTG		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.2219C>T	chr12.hg19:g.49168249G>A	ENSP00000311405:p.Ala740Val	84.0	0.0	.		182.0	88.0	.	NM_020983	Q9NR75|Q9UDB0	Missense_Mutation	SNP	ENST00000307885.4	hg19	CCDS8767.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.103172	0.37145	.	.	ENSG00000174233	ENST00000357869;ENST00000550422;ENST00000307885	T;T;T	0.39787	1.06;1.06;1.06	4.42	3.51	0.40186	.	0.303154	0.30820	N	0.008801	T	0.28896	0.0717	L	0.36672	1.1	0.28148	N	0.929491	B;B	0.26041	0.14;0.004	B;B	0.28139	0.086;0.01	T	0.18618	-1.0331	10	0.13470	T	0.59	.	8.2466	0.31693	0.202:0.0:0.798:0.0	.	740;740	O43306-2;O43306	.;ADCY6_HUMAN	V	740	ENSP00000350536:A740V;ENSP00000446730:A740V;ENSP00000311405:A740V	ENSP00000311405:A740V	A	-	2	0	ADCY6	47454516	0.679000	0.27596	1.000000	0.80357	0.892000	0.51952	2.661000	0.46758	0.963000	0.38082	0.561000	0.74099	GCA	.	.	.	none		0.537	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983	
HOXC4	3221	hgsc.bcm.edu	37	12	54447788	54447788	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:54447788T>A	ENST00000430889.2	+	1	128	c.82T>A	c.(82-84)Tac>Aac	p.Y28N	HOXC4_ENST00000303406.4_Missense_Mutation_p.Y28N|HOXC4_ENST00000609810.1_Missense_Mutation_p.Y28N	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	28					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						GCAAAATAGCTACATCCCTGA	0.493																																					p.Y28N		Atlas-SNP	.											.	HOXC4	29	.	0			c.T82A						PASS	.						127.0	129.0	128.0					12																	54447788		2203	4300	6503	SO:0001583	missense	3221	exon3			AATAGCTACATCC		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.82T>A	chr12.hg19:g.54447788T>A	ENSP00000399808:p.Tyr28Asn	72.0	0.0	.		205.0	40.0	.	NM_014620		Missense_Mutation	SNP	ENST00000430889.2	hg19	CCDS8873.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.710126	0.68730	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	D;D	0.83992	-1.79;-1.79	3.41	3.41	0.39046	.	0.152719	0.44902	D	0.000404	D	0.92014	0.7470	M	0.92317	3.295	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.93212	0.6601	10	0.72032	D	0.01	.	11.785	0.52037	0.0:0.0:0.0:1.0	.	28	P09017	HXC4_HUMAN	N	28	ENSP00000305973:Y28N;ENSP00000399808:Y28N	ENSP00000305973:Y28N	Y	+	1	0	HOXC4	52734055	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.592000	0.61027	1.775000	0.52247	0.379000	0.24179	TAC	.	.	.	none		0.493	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1		
HCAR1	27198	hgsc.bcm.edu	37	12	123214112	123214112	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:123214112C>T	ENST00000436083.2	-	1	1278	c.775G>A	c.(775-777)Gcc>Acc	p.A259T	HCAR1_ENST00000432564.1_Missense_Mutation_p.A259T|HCAR1_ENST00000356987.2_Missense_Mutation_p.A259T			Q9BXC0	HCAR1_HUMAN	hydroxycarboxylic acid receptor 1	259					response to estradiol (GO:0032355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	10						ATGTGCAGGGCCCCATGGACA	0.522																																					p.A259T		Atlas-SNP	.											.	HCAR1	21	.	0			c.G775A						PASS	.						81.0	81.0	81.0					12																	123214112		2203	4300	6503	SO:0001583	missense	27198	exon1			GCAGGGCCCCATG	AF411110	CCDS9236.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000196917	ENSG00000196917		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	4532	protein-coding gene	gene with protein product	"""lactate receptor 1"""	606923	"""G protein-coupled receptor 104"", ""G protein-coupled receptor 81"""	GPR104, GPR81		11574155, 19047060, 18952058, 21454438	Standard	NM_032554		Approved	HCA1, FKSG80, TA-GPCR, LACR1	uc001ucz.3	Q9BXC0		ENST00000436083.2:c.775G>A	chr12.hg19:g.123214112C>T	ENSP00000409980:p.Ala259Thr	78.0	0.0	.		213.0	92.0	.	NM_032554	B2R9X4|Q3Y5J3|Q4VBN1|Q6NXU5	Missense_Mutation	SNP	ENST00000436083.2	hg19	CCDS9236.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864791	0.51482	.	.	ENSG00000196917	ENST00000356987;ENST00000432564;ENST00000436083	T;T;T	0.38401	1.14;1.14;1.14	5.62	4.72	0.59763	GPCR, rhodopsin-like superfamily (1);	0.162482	0.38272	N	0.001754	T	0.50292	0.1607	L	0.55481	1.735	0.37418	D	0.913513	D	0.61697	0.99	D	0.64877	0.93	T	0.49872	-0.8893	10	0.33141	T	0.24	-12.0983	12.8086	0.57628	0.0:0.9183:0.0:0.0817	.	259	Q9BXC0	HCAR1_HUMAN	T	259	ENSP00000349478:A259T;ENSP00000389255:A259T;ENSP00000409980:A259T	ENSP00000349478:A259T	A	-	1	0	HCAR1	121780065	0.985000	0.35326	0.946000	0.38457	0.043000	0.13939	2.721000	0.47260	2.653000	0.90120	0.655000	0.94253	GCC	.	.	.	none		0.522	HCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401415.1		
GPR133	283383	hgsc.bcm.edu	37	12	131471648	131471648	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr12:131471648T>G	ENST00000261654.5	+	6	1058	c.499T>G	c.(499-501)Tgg>Ggg	p.W167G	GPR133_ENST00000535015.1_Missense_Mutation_p.W199G	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	167					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		AGGCCCCTATTGGACTCATGT	0.493																																					p.W167G		Atlas-SNP	.											.	GPR133	136	.	0			c.T499G						PASS	.						59.0	57.0	58.0					12																	131471648		2203	4300	6503	SO:0001583	missense	283383	exon6			CCCTATTGGACTC	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.499T>G	chr12.hg19:g.131471648T>G	ENSP00000261654:p.Trp167Gly	46.0	0.0	.		120.0	25.0	.	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	hg19	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	T	15.41	2.826517	0.50739	.	.	ENSG00000111452	ENST00000261654;ENST00000542091;ENST00000535015	D;D;D	0.86769	-2.17;-2.17;-2.17	4.55	4.55	0.56014	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.94679	0.8284	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.99	D	0.95634	0.8692	10	0.72032	D	0.01	.	13.1073	0.59253	0.0:0.0:0.0:1.0	.	199;167	B7ZLF7;Q6QNK2	.;GP133_HUMAN	G	167;107;199	ENSP00000261654:W167G;ENSP00000442501:W107G;ENSP00000444425:W199G	ENSP00000261654:W167G	W	+	1	0	GPR133	130037601	1.000000	0.71417	1.000000	0.80357	0.406000	0.30931	7.078000	0.76821	1.685000	0.51034	0.533000	0.62120	TGG	.	.	.	none		0.493	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
COG6	57511	hgsc.bcm.edu	37	13	40251678	40251678	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr13:40251678A>G	ENST00000455146.3	+	5	552	c.502A>G	c.(502-504)Agt>Ggt	p.S168G	COG6_ENST00000416691.1_Missense_Mutation_p.S168G	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	168					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		TGATGAAATGAGTCTTCTCCG	0.348																																					p.S168G		Atlas-SNP	.											.	COG6	49	.	0			c.A502G						PASS	.						87.0	81.0	83.0					13																	40251678		2203	4300	6503	SO:0001583	missense	57511	exon5			GAAATGAGTCTTC	AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.502A>G	chr13.hg19:g.40251678A>G	ENSP00000397441:p.Ser168Gly	53.0	0.0	.		113.0	36.0	.	NM_001145079	Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	ENST00000455146.3	hg19	CCDS9370.1	.	.	.	.	.	.	.	.	.	.	A	12.40	1.927586	0.34002	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000422759;ENST00000455146	T;T;T	0.55588	0.51;0.51;0.51	5.78	-1.08	0.09936	.	0.333784	0.40640	N	0.001058	T	0.29321	0.0730	N	0.24115	0.695	0.28989	N	0.888159	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10989	-1.0606	10	0.22109	T	0.4	-11.1167	5.8826	0.18864	0.5582:0.1302:0.3116:0.0	.	189;168	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	G	168;199;168;168	ENSP00000403733:S168G;ENSP00000412877:S168G;ENSP00000397441:S168G	ENSP00000255468:S199G	S	+	1	0	COG6	39149678	1.000000	0.71417	0.941000	0.38009	0.875000	0.50365	2.795000	0.47861	-0.395000	0.07715	-0.334000	0.08254	AGT	.	.	.	none		0.348	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044622.3		
IPO5	3843	hgsc.bcm.edu	37	13	98667795	98667795	+	Silent	SNP	A	A	T	rs61750357		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr13:98667795A>T	ENST00000490680.1	+	20	2402	c.2337A>T	c.(2335-2337)gtA>gtT	p.V779V	IPO5_ENST00000539640.1_Silent_p.V654V|IPO5_ENST00000261574.5_Silent_p.V797V			O00410	IPO5_HUMAN	importin 5	779					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						GCATTGAAGTAATGGGAGATG	0.348																																					p.V797V		Atlas-SNP	.											.	IPO5	90	.	0			c.A2391T						PASS	.						108.0	107.0	107.0					13																	98667795		2203	4300	6503	SO:0001819	synonymous_variant	3843	exon23			TGAAGTAATGGGA	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.2337A>T	chr13.hg19:g.98667795A>T		85.0	0.0	.		167.0	61.0	.	NM_002271	B4DZA0|O15257|Q5T578|Q86XC7	Silent	SNP	ENST00000490680.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.56	1.383369	0.25031	.	.	ENSG00000065150	ENST00000469360	.	.	.	5.72	-3.39	0.04868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1611	7.7355	0.28812	0.295:0.5469:0.06:0.0981	.	.	.	.	L	781	.	.	X	+	2	2	IPO5	97465796	0.965000	0.33210	0.966000	0.40874	0.996000	0.88848	0.136000	0.15974	-0.832000	0.04251	0.533000	0.62120	TAA	.	.	.	alt		0.348	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	NM_002271	
Unknown	0	hgsc.bcm.edu	37	13	103401232	103401232	+	IGR	SNP	C	C	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr13:103401232C>G								LINC00283 (3658 upstream) : TEX30 (17107 downstream)																							ACTCCTTTTCCTTTTTAGTAA	0.353																																					p.K605N		Atlas-SNP	.											.	.	.	.	0			c.G1815C						PASS	.						45.0	35.0	38.0					13																	103401232		692	1588	2280	SO:0001628	intergenic_variant	643677	exon4			CTTTTCCTTTTTA																													chr13.hg19:g.103401232C>G		75.0	0.0	.		169.0	62.0	.	NM_001146197		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.353								
ATP11A	23250	hgsc.bcm.edu	37	13	113474213	113474213	+	Splice_Site	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr13:113474213G>A	ENST00000487903.1	+	8	762		c.e8-1		ATP11A_ENST00000375630.2_Splice_Site|ATP11A_ENST00000375645.3_Splice_Site|ATP11A_ENST00000283558.8_Splice_Site			P98196	AT11A_HUMAN	ATPase, class VI, type 11A						phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TCTGTCGCCAGGTTCGTGGGT	0.637																																					.		Atlas-SNP	.											.	ATP11A	225	.	0			c.675-1G>A						PASS	.						125.0	89.0	101.0					13																	113474213		2203	4300	6503	SO:0001630	splice_region_variant	23250	exon8			TCGCCAGGTTCGT	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.675-1G>A	chr13.hg19:g.113474213G>A		10.0	0.0	.		57.0	18.0	.	NM_015205	Q5VXT2	Splice_Site	SNP	ENST00000487903.1	hg19	CCDS32011.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927015	0.34002	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558;ENST00000418678	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8794	0.63674	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP11A	112522214	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	6.506000	0.73712	2.406000	0.81754	0.591000	0.81541	.	.	.	.	none		0.637	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	Intron
ZSCAN29	146050	hgsc.bcm.edu	37	15	43653718	43653718	+	Silent	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr15:43653718T>C	ENST00000396976.2	-	5	2246	c.2112A>G	c.(2110-2112)aaA>aaG	p.K704K	ZSCAN29_ENST00000568898.1_Silent_p.K314K|ZSCAN29_ENST00000562072.1_3'UTR|ZSCAN29_ENST00000396972.1_Silent_p.K315K	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	704					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		ATTTATAAGGTTTCTCTCCAG	0.438																																					p.K704K		Atlas-SNP	.											.	ZSCAN29	57	.	0			c.A2112G						PASS	.						60.0	57.0	58.0					15																	43653718		2201	4299	6500	SO:0001819	synonymous_variant	146050	exon5			ATAAGGTTTCTCT	AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.2112A>G	chr15.hg19:g.43653718T>C		64.0	0.0	.		155.0	43.0	.	NM_152455	B3KVB9|Q32M75|Q32M76|Q8NA40	Silent	SNP	ENST00000396976.2	hg19	CCDS10095.2																																																																																			.	.	.	none		0.438	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253278.1	NM_152455	
FAM154B	283726	hgsc.bcm.edu	37	15	82575198	82575198	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr15:82575198C>A	ENST00000339465.5	+	3	1061	c.992C>A	c.(991-993)aCa>aAa	p.T331K	FAM154B_ENST00000565501.1_3'UTR|FAM154B_ENST00000427381.2_Missense_Mutation_p.T316K	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B	331										autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						TTGATCCCAACAGAGAGTTGC	0.388																																					p.T331K		Atlas-SNP	.											.	FAM154B	50	.	0			c.C992A						PASS	.						74.0	74.0	74.0					15																	82575198		2203	4300	6503	SO:0001583	missense	283726	exon3			TCCCAACAGAGAG	AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.992C>A	chr15.hg19:g.82575198C>A	ENSP00000340445:p.Thr331Lys	171.0	0.0	.		402.0	132.0	.	NM_001008226	B4E2M2	Missense_Mutation	SNP	ENST00000339465.5	hg19	CCDS32310.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034412	0.35893	.	.	ENSG00000188659	ENST00000339465;ENST00000427381	T;T	0.16743	2.32;2.32	4.22	3.28	0.37604	.	0.172782	0.36628	N	0.002496	T	0.36248	0.0960	M	0.82323	2.585	0.09310	N	0.999996	D;D	0.76494	0.999;0.984	D;P	0.68765	0.96;0.881	T	0.24693	-1.0153	10	0.14656	T	0.56	-8.4012	8.8098	0.34961	0.0:0.7627:0.1525:0.0849	.	316;331	B4E2M2;Q658L1	.;F154B_HUMAN	K	331;316	ENSP00000340445:T331K;ENSP00000403743:T316K	ENSP00000340445:T331K	T	+	2	0	FAM154B	80362253	0.114000	0.22134	0.015000	0.15790	0.341000	0.28922	0.879000	0.28146	0.867000	0.35654	0.404000	0.27445	ACA	.	.	.	none		0.388	FAM154B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419644.1	NM_001008226	
ALPK3	57538	hgsc.bcm.edu	37	15	85407685	85407685	+	Silent	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr15:85407685G>A	ENST00000258888.5	+	12	5285	c.5118G>A	c.(5116-5118)ctG>ctA	p.L1706L		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1706	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TCATCCCACTGTATCTGATCT	0.512																																					p.L1706L		Atlas-SNP	.											.	ALPK3	289	.	0			c.G5118A						PASS	.						94.0	84.0	87.0					15																	85407685		2203	4299	6502	SO:0001819	synonymous_variant	57538	exon12			CCCACTGTATCTG	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.5118G>A	chr15.hg19:g.85407685G>A		55.0	0.0	.		122.0	47.0	.	NM_020778	Q9P2L6	Silent	SNP	ENST00000258888.5	hg19	CCDS10333.1																																																																																			.	.	.	none		0.512	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
NDUFB10	4716	hgsc.bcm.edu	37	16	2011289	2011289	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr16:2011289A>T	ENST00000268668.6	+	2	383	c.266A>T	c.(265-267)gAc>gTc	p.D89V	SNORA64_ENST00000384674.1_RNA|SNORA10_ENST00000384084.1_RNA|NDUFB10_ENST00000543683.2_Missense_Mutation_p.D89V|NDUFB10_ENST00000569148.1_Intron	NM_004548.2	NP_004539.1	O96000	NDUBA_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa	89					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			lung(1)|urinary_tract(1)	2						TGGAAGAGGGACTAGTACGTG	0.567																																					p.D89V		Atlas-SNP	.											.	NDUFB10	17	.	0			c.A266T						PASS	.						194.0	142.0	160.0					16																	2011289		2199	4300	6499	SO:0001583	missense	4716	exon2			AGAGGGACTAGTA	AF044954	CCDS10451.1	16p13.3	2011-07-04	2002-08-29		ENSG00000140990	ENSG00000140990		"""Mitochondrial respiratory chain complex / Complex I"""	7696	protein-coding gene	gene with protein product	"""complex I PDSW subunit"""	603843	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (22kD, PDSW)"""			9763677, 9878551	Standard	NM_004548		Approved	PDSW	uc002cni.2	O96000	OTTHUMG00000128709	ENST00000268668.6:c.266A>T	chr16.hg19:g.2011289A>T	ENSP00000268668:p.Asp89Val	38.0	0.0	.		94.0	32.0	.	NM_004548	Q96II6	Missense_Mutation	SNP	ENST00000268668.6	hg19	CCDS10451.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.519366	0.64634	.	.	ENSG00000140990	ENST00000268668;ENST00000543683	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.81767	0.4892	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85631	0.1270	9	0.87932	D	0	-38.553	14.1338	0.65273	1.0:0.0:0.0:0.0	.	89;89	Q96II6;O96000	.;NDUBA_HUMAN	V	89	.	ENSP00000268668:D89V	D	+	2	0	NDUFB10	1951290	1.000000	0.71417	1.000000	0.80357	0.253000	0.25986	8.564000	0.90726	1.936000	0.56123	0.533000	0.62120	GAC	.	.	.	none		0.567	NDUFB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250614.2	NM_004548	
TRAP1	10131	hgsc.bcm.edu	37	16	3712967	3712967	+	Splice_Site	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr16:3712967G>A	ENST00000246957.5	-	15	1798	c.1710C>T	c.(1708-1710)gcC>gcT	p.A570A	DNASE1_ENST00000575152.1_3'UTR|TRAP1_ENST00000538171.1_Splice_Site_p.A517A|DNASE1_ENST00000414110.2_Intron|TRAP1_ENST00000575671.1_Splice_Site_p.A361A	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	570					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				GGCACTCGGCGGCTGCGGAAG	0.642																																					p.A570A		Atlas-SNP	.											.	TRAP1	53	.	0			c.C1710T						PASS	.						60.0	46.0	51.0					16																	3712967		2197	4300	6497	SO:0001630	splice_region_variant	10131	exon15			CTCGGCGGCTGCG	AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.1709-1C>T	chr16.hg19:g.3712967G>A		12.0	0.0	.		27.0	10.0	.	NM_016292	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Silent	SNP	ENST00000246957.5	hg19	CCDS10508.1																																																																																			.	.	.	none		0.642	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251586.2	NM_016292	Silent
KDM6B	23135	hgsc.bcm.edu	37	17	7748926	7748926	+	Silent	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:7748926C>A	ENST00000448097.2	+	4	385	c.54C>A	c.(52-54)gcC>gcA	p.A18A	KDM6B_ENST00000254846.5_Silent_p.A18A			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	18					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						AAGCCTTTGCCCTTGGGGGCC	0.642																																					p.A18A		Atlas-SNP	.											.	KDM6B	95	.	0			c.C54A						PASS	.						56.0	59.0	58.0					17																	7748926		2203	4300	6503	SO:0001819	synonymous_variant	23135	exon4			CTTTGCCCTTGGG	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.54C>A	chr17.hg19:g.7748926C>A		72.0	0.0	.		184.0	40.0	.	NM_001080424	C9IZ40|Q96G33	Silent	SNP	ENST00000448097.2	hg19																																																																																				.	.	.	none		0.642	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
ELAC2	60528	hgsc.bcm.edu	37	17	12898190	12898190	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:12898190A>G	ENST00000338034.4	-	21	2159	c.1920T>C	c.(1918-1920)tgT>tgC	p.C640C	ELAC2_ENST00000395962.2_Silent_p.C621C|ELAC2_ENST00000426905.3_Silent_p.C600C	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	640					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						GCCGCACCAGACAGGTCTGAA	0.622																																					p.C640C		Atlas-SNP	.											.	ELAC2	48	.	0			c.T1920C						PASS	.						72.0	78.0	76.0					17																	12898190		2203	4300	6503	SO:0001819	synonymous_variant	60528	exon21			CACCAGACAGGTC	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1920T>C	chr17.hg19:g.12898190A>G		41.0	0.0	.		121.0	60.0	.	NM_018127	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Silent	SNP	ENST00000338034.4	hg19	CCDS11164.1																																																																																			.	.	.	none		0.622	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
TBC1D28	254272	hgsc.bcm.edu	37	17	18541949	18541949	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:18541949A>G	ENST00000345096.4	-	6	963	c.264T>C	c.(262-264)taT>taC	p.Y88Y	TBC1D28_ENST00000405044.1_Silent_p.Y88Y			Q2M2D7	TBC28_HUMAN	TBC1 domain family, member 28	88							Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(5)|lung(2)|ovary(1)	9						TGGTGCTCCTATATTTTGTCC	0.542																																					p.Y88Y		Atlas-SNP	.											.	TBC1D28	14	.	0			c.T264C						PASS	.						120.0	117.0	118.0					17																	18541949		1942	4126	6068	SO:0001819	synonymous_variant	254272	exon7			GCTCCTATATTTT		CCDS42273.1	17p11.2	2008-10-27			ENSG00000189375	ENSG00000189375			26858	protein-coding gene	gene with protein product							Standard	NM_001039397		Approved	FLJ40244	uc002gud.2	Q2M2D7	OTTHUMG00000059054	ENST00000345096.4:c.264T>C	chr17.hg19:g.18541949A>G		59.0	0.0	.		142.0	60.0	.	NM_001039397	Q2M2E1	Silent	SNP	ENST00000345096.4	hg19	CCDS42273.1																																																																																			.	.	.	none		0.542	TBC1D28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130672.2	NM_001039397	
MSL1	339287	hgsc.bcm.edu	37	17	38282491	38282491	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:38282491A>G	ENST00000398532.4	+	2	1139	c.824A>G	c.(823-825)aAc>aGc	p.N275S	MSL1_ENST00000578648.1_Missense_Mutation_p.N275S|MSL1_ENST00000577454.1_Missense_Mutation_p.N275S|MSL1_ENST00000579565.1_Missense_Mutation_p.N12S	NM_001012241.1	NP_001012241.1	Q68DK7	MSL1_HUMAN	male-specific lethal 1 homolog (Drosophila)	275					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	7						AAGAAGGATAACGAGAAAGAA	0.428																																					p.N12S		Atlas-SNP	.											.	MSL1	21	.	0			c.A35G						PASS	.						98.0	98.0	98.0					17																	38282491		1949	4139	6088	SO:0001583	missense	339287	exon3			AGGATAACGAGAA		CCDS45670.1	17q21.1	2011-03-21			ENSG00000188895	ENSG00000188895			27905	protein-coding gene	gene with protein product		614801				16227571, 16543150	Standard	NM_001012241		Approved	hMSL1, MSL-1, DKFZp686P24239	uc002hua.4	Q68DK7		ENST00000398532.4:c.824A>G	chr17.hg19:g.38282491A>G	ENSP00000381543:p.Asn275Ser	92.0	0.0	.		231.0	110.0	.	NM_001012241	Q0VF46|Q69Z03	Missense_Mutation	SNP	ENST00000398532.4	hg19		.	.	.	.	.	.	.	.	.	.	A	11.43	1.637733	0.29157	.	.	ENSG00000188895	ENST00000339569;ENST00000398532	.	.	.	5.79	5.79	0.91817	.	0.270557	0.44688	D	0.000434	T	0.22820	0.0551	N	0.19112	0.55	0.26940	N	0.966276	B	0.16396	0.017	B	0.18263	0.021	T	0.28776	-1.0033	9	0.05436	T	0.98	-11.0278	8.4872	0.33078	0.8546:0.0:0.1454:0.0	.	275	Q68DK7	MSL1_HUMAN	S	12;275	.	ENSP00000341409:N12S	N	+	2	0	MSL1	35536017	0.994000	0.37717	1.000000	0.80357	0.965000	0.64279	2.451000	0.44952	2.208000	0.71279	0.533000	0.62120	AAC	.	.	.	none		0.428	MSL1-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000447409.2	NM_001012241	
C17orf64	124773	hgsc.bcm.edu	37	17	58503225	58503225	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:58503225G>A	ENST00000269127.4	+	2	217	c.133G>A	c.(133-135)Gat>Aat	p.D45N		NM_181707.2	NP_859058.2	Q86WR6	CQ064_HUMAN	chromosome 17 open reading frame 64	45										breast(2)|large_intestine(1)|lung(3)	6	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			CAAGGGCCTGGATCAGGACAC	0.587																																					p.D45N		Atlas-SNP	.											.	C17orf64	19	.	0			c.G133A						PASS	.						49.0	50.0	50.0					17																	58503225		692	1591	2283	SO:0001583	missense	124773	exon2			GGCCTGGATCAGG	BC048806	CCDS32698.2	17q23.2	2005-12-16			ENSG00000141371	ENSG00000141371			26990	protein-coding gene	gene with protein product						12477932	Standard	NM_181707		Approved		uc002iyq.3	Q86WR6	OTTHUMG00000157171	ENST00000269127.4:c.133G>A	chr17.hg19:g.58503225G>A	ENSP00000269127:p.Asp45Asn	64.0	0.0	.		118.0	62.0	.	NM_181707	Q8IY87	Missense_Mutation	SNP	ENST00000269127.4	hg19	CCDS32698.2	.	.	.	.	.	.	.	.	.	.	G	8.915	0.959686	0.18507	.	.	ENSG00000141371	ENST00000428000;ENST00000269127	.	.	.	5.8	1.57	0.23409	.	1.190680	0.06014	N	0.650076	T	0.35422	0.0931	L	0.38838	1.175	0.09310	N	0.999999	B	0.22983	0.078	B	0.25614	0.062	T	0.35475	-0.9787	9	0.51188	T	0.08	0.2409	8.0582	0.30617	0.4133:0.0:0.5867:0.0	.	45	Q86WR6	CQ064_HUMAN	N	39;45	.	ENSP00000269127:D45N	D	+	1	0	C17orf64	55858007	0.078000	0.21339	0.143000	0.22291	0.070000	0.16714	0.157000	0.16402	0.087000	0.17167	-0.136000	0.14681	GAT	.	.	.	none		0.587	C17orf64-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000347743.1	NM_181707	
PIAS2	9063	hgsc.bcm.edu	37	18	44416377	44416377	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr18:44416377G>A	ENST00000585916.1	-	9	1144	c.1145C>T	c.(1144-1146)aCc>aTc	p.T382I	PIAS2_ENST00000545673.1_Missense_Mutation_p.T92I|PIAS2_ENST00000324794.7_Missense_Mutation_p.T382I	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	382					androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						ACAAATCCAGGTGGGCTTTTT	0.408																																					p.T382I		Atlas-SNP	.											.	PIAS2	85	.	0			c.C1145T						PASS	.						118.0	114.0	115.0					18																	44416377		2203	4300	6503	SO:0001583	missense	9063	exon9			ATCCAGGTGGGCT	AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.1145C>T	chr18.hg19:g.44416377G>A	ENSP00000465676:p.Thr382Ile	153.0	0.0	.		329.0	44.0	.	NM_173206	O75927|Q96BT5|Q96KE3	Missense_Mutation	SNP	ENST00000585916.1	hg19	CCDS32824.1	.	.	.	.	.	.	.	.	.	.	G	32	5.124311	0.94429	.	.	ENSG00000078043	ENST00000398654;ENST00000262161;ENST00000398651;ENST00000545673;ENST00000324794	T;T	0.53640	0.61;1.12	5.62	5.62	0.85841	Zinc finger, MIZ-type (2);	0.000000	0.85682	D	0.000000	T	0.74876	0.3774	M	0.87038	2.855	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	0.996;1.0;0.994;0.992;1.0	T	0.78971	-0.1993	10	0.87932	D	0	-11.3089	19.6407	0.95757	0.0:0.0:1.0:0.0	.	92;386;382;382;382	B4DGW0;O75928-3;Q2TA77;O75928-2;O75928	.;.;.;.;PIAS2_HUMAN	I	382;382;378;92;382	ENSP00000443238:T92I;ENSP00000317163:T382I	ENSP00000262161:T382I	T	-	2	0	PIAS2	42670375	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.864000	0.99589	2.640000	0.89533	0.460000	0.39030	ACC	.	.	.	none		0.408	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445656.2	NM_004671	
ILVBL	10994	hgsc.bcm.edu	37	19	15226103	15226103	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:15226103A>G	ENST00000263383.3	-	16	1998	c.1859T>C	c.(1858-1860)aTt>aCt	p.I620T	ILVBL_ENST00000534378.1_Missense_Mutation_p.I513T	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	620						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)			NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						CGTCCTCCCAATGAGGATGTT	0.607																																					p.I620T		Atlas-SNP	.											.	ILVBL	54	.	0			c.T1859C						PASS	.						138.0	103.0	115.0					19																	15226103		2203	4300	6503	SO:0001583	missense	10994	exon16			CTCCCAATGAGGA	U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.1859T>C	chr19.hg19:g.15226103A>G	ENSP00000263383:p.Ile620Thr	58.0	0.0	.		76.0	24.0	.	NM_006844	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Missense_Mutation	SNP	ENST00000263383.3	hg19	CCDS12325.1	.	.	.	.	.	.	.	.	.	.	A	19.86	3.905085	0.72868	.	.	ENSG00000105135	ENST00000263383	T	0.42900	0.96	5.37	5.37	0.77165	.	0.056671	0.64402	D	0.000002	T	0.58264	0.2110	M	0.68952	2.095	0.80722	D	1	D	0.71674	0.998	D	0.63877	0.919	T	0.59542	-0.7435	10	0.46703	T	0.11	-18.752	11.7697	0.51951	1.0:0.0:0.0:0.0	.	620	A1L0T0	ILVBL_HUMAN	T	620	ENSP00000263383:I620T	ENSP00000263383:I620T	I	-	2	0	ILVBL	15087103	1.000000	0.71417	0.998000	0.56505	0.840000	0.47671	6.822000	0.75277	2.044000	0.60594	0.533000	0.62120	ATT	.	.	.	none		0.607	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385439.1	NM_006844	
VSTM2B	342865	hgsc.bcm.edu	37	19	30018224	30018225	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:30018224_30018225TC>AA	ENST00000335523.7	+	2	274_275	c.189_190TC>AA	c.(187-192)atTCag>atAAag	p.Q64K	CTC-525D6.1_ENST00000582581.1_RNA|CTC-525D6.2_ENST00000579268.1_RNA	NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	64	Ig-like V-type.					integral component of membrane (GO:0016021)				breast(2)	2						CGCTGGAGATTCAGTGGTGGTA	0.653																																					p.I63I|p.Q64K		Atlas-SNP	.											.	VSTM2B	15	.	0			c.T189A|c.C190A						PASS	.																																			SO:0001583	missense	342865	exon2			GGAGATTCAGTGG|GAGATTCAGTGGT		CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		Exception_encountered	chr19.hg19:g.30018224_30018225delinsAA	ENSP00000335038:p.Gln64Lys	15.0	0.0	.		46.0|44.0	19.0|16.0	.	NM_001146339		Silent|Missense_Mutation	SNP	ENST00000335523.7	hg19	CCDS46034.1																																																																																			.	.	.	none		0.653	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458601.1	NM_001146339	
ZNF536	9745	hgsc.bcm.edu	37	19	31040126	31040126	+	Missense_Mutation	SNP	C	C	G	rs545401755		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:31040126C>G	ENST00000355537.3	+	4	3747	c.3600C>G	c.(3598-3600)gaC>gaG	p.D1200E		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1200					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TCAGCAAAGACAGCAGCAGCG	0.592																																					p.D1200E		Atlas-SNP	.											.	ZNF536	424	.	0			c.C3600G						PASS	.						62.0	63.0	63.0					19																	31040126		2203	4300	6503	SO:0001583	missense	9745	exon4			CAAAGACAGCAGC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3600C>G	chr19.hg19:g.31040126C>G	ENSP00000347730:p.Asp1200Glu	59.0	0.0	.		81.0	30.0	.	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	hg19	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	0.147	-1.095522	0.01858	.	.	ENSG00000198597	ENST00000355537	T	0.08546	3.08	5.59	3.11	0.35812	.	0.444542	0.25789	N	0.028284	T	0.03871	0.0109	N	0.12746	0.255	0.21675	N	0.999597	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.44298	-0.9337	10	0.13108	T	0.6	-38.7005	6.6261	0.22830	0.2337:0.5954:0.0:0.1709	.	1200;1200	A7E228;O15090	.;ZN536_HUMAN	E	1200	ENSP00000347730:D1200E	ENSP00000347730:D1200E	D	+	3	2	ZNF536	35731966	0.207000	0.23482	0.966000	0.40874	0.051000	0.14879	0.146000	0.16180	1.319000	0.45190	0.655000	0.94253	GAC	.	.	.	none		0.592	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF146	7705	hgsc.bcm.edu	37	19	36727612	36727612	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:36727612C>A	ENST00000443387.2	+	4	1262	c.270C>A	c.(268-270)caC>caA	p.H90Q	ZNF565_ENST00000355114.5_Intron|ZNF146_ENST00000456324.1_Missense_Mutation_p.H90Q	NM_007145.2	NP_009076.2	Q15072	OZF_HUMAN	zinc finger protein 146	90					regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11	Esophageal squamous(110;0.162)					TCCTTACGCACCAGAAAATTC	0.403																																					p.H90Q		Atlas-SNP	.											.	ZNF146	32	.	0			c.C270A						PASS	.						67.0	72.0	70.0					19																	36727612		2203	4300	6503	SO:0001583	missense	7705	exon3			TACGCACCAGAAA	X70394	CCDS12492.1	19q13.1	2013-01-08				ENSG00000167635		"""Zinc fingers, C2H2-type"""	12931	protein-coding gene	gene with protein product		601505				10449921, 8641144	Standard	NM_001099639		Approved	OZF	uc010eeu.3	Q15072		ENST00000443387.2:c.270C>A	chr19.hg19:g.36727612C>A	ENSP00000392095:p.His90Gln	90.0	0.0	.		190.0	79.0	.	NM_001099638	Q2TB94	Missense_Mutation	SNP	ENST00000443387.2	hg19	CCDS12492.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870414	0.51588	.	.	ENSG00000167635	ENST00000443387;ENST00000456324	D;D	0.86865	-2.18;-2.18	4.46	3.34	0.38264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41396	D	0.000891	D	0.94135	0.8119	H	0.95402	3.665	0.33426	D	0.580462	D	0.62365	0.991	D	0.73708	0.981	D	0.94447	0.7664	10	0.87932	D	0	-10.1539	6.9293	0.24432	0.0:0.2248:0.0:0.7752	.	90	Q15072	OZF_HUMAN	Q	90	ENSP00000392095:H90Q;ENSP00000400391:H90Q	ENSP00000392095:H90Q	H	+	3	2	ZNF146	41419452	0.874000	0.30092	1.000000	0.80357	0.991000	0.79684	-0.067000	0.11579	0.946000	0.37632	-0.355000	0.07637	CAC	.	.	.	none		0.403	ZNF146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451706.1	NM_007145	
GYS1	2997	hgsc.bcm.edu	37	19	49485593	49485593	+	Silent	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:49485593A>G	ENST00000323798.3	-	7	1177	c.981T>C	c.(979-981)ttT>ttC	p.F327F	GYS1_ENST00000541188.1_Silent_p.F247F|GYS1_ENST00000263276.6_Silent_p.F263F|GYS1_ENST00000540532.1_Missense_Mutation_p.L208S|GYS1_ENST00000544287.1_5'UTR	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	327					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GGCCGGCGATAAAGAAGTATA	0.542																																					p.F327F		Atlas-SNP	.											.	GYS1	59	.	0			c.T981C						PASS	.						88.0	79.0	82.0					19																	49485593		2203	4300	6503	SO:0001819	synonymous_variant	2997	exon7			GGCGATAAAGAAG		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.981T>C	chr19.hg19:g.49485593A>G		82.0	0.0	.		171.0	62.0	.	NM_002103	Q9BTT9	Silent	SNP	ENST00000323798.3	hg19	CCDS12747.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.821993	0.50739	.	.	ENSG00000104812	ENST00000540532	T	0.27890	1.64	5.1	-3.84	0.04256	.	.	.	.	.	T	0.34366	0.0895	.	.	.	0.22754	N	0.998773	.	.	.	.	.	.	T	0.42965	-0.9420	6	0.41790	T	0.15	-14.4659	15.6467	0.77061	0.234:0.0:0.766:0.0	.	.	.	.	S	208	ENSP00000445197:L208S	ENSP00000445197:L208S	L	-	2	0	GYS1	54177405	1.000000	0.71417	0.849000	0.33467	0.997000	0.91878	1.654000	0.37334	-0.742000	0.04790	0.528000	0.53228	TTA	.	.	.	none		0.542	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103	
TMEM86B	255043	hgsc.bcm.edu	37	19	55740079	55740079	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr19:55740079T>C	ENST00000327042.4	-	1	553	c.31A>G	c.(31-33)Aag>Gag	p.K11E	AC010327.2_ENST00000598855.1_3'UTR	NM_173804.4	NP_776165.3	Q8N661	TM86B_HUMAN	transmembrane protein 86B	11					ether lipid metabolic process (GO:0046485)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alkenylglycerophosphocholine hydrolase activity (GO:0047408)|alkenylglycerophosphoethanolamine hydrolase activity (GO:0047409)			skin(2)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0443)		CAGTGAGTCTTCAGGGTCTGC	0.672																																					p.K11E		Atlas-SNP	.											.	TMEM86B	12	.	0			c.A31G						PASS	.						25.0	26.0	26.0					19																	55740079		2203	4299	6502	SO:0001583	missense	255043	exon1			GAGTCTTCAGGGT	BC023000	CCDS12920.1	19q13.42	2011-07-12					3.3.2.2, 3.3.2.5		28448	protein-coding gene	gene with protein product						21515882	Standard	NM_173804		Approved	MGC30208	uc002qju.3	Q8N661		ENST00000327042.4:c.31A>G	chr19.hg19:g.55740079T>C	ENSP00000321038:p.Lys11Glu	68.0	0.0	.		107.0	40.0	.	NM_173804		Missense_Mutation	SNP	ENST00000327042.4	hg19	CCDS12920.1	.	.	.	.	.	.	.	.	.	.	T	8.776	0.926998	0.18056	.	.	ENSG00000180089	ENST00000327042	T	0.22743	1.94	4.76	-1.37	0.09056	.	2.056380	0.01961	N	0.043375	T	0.12944	0.0314	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31223	-0.9951	10	0.33940	T	0.23	.	11.2263	0.48886	0.0:0.5941:0.0:0.4059	.	11	Q8N661	TM86B_HUMAN	E	11	ENSP00000321038:K11E	ENSP00000321038:K11E	K	-	1	0	TMEM86B	60431891	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.228000	0.09114	-0.525000	0.06391	0.379000	0.24179	AAG	.	.	.	none		0.672	TMEM86B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452659.1	NM_173804	
AHCY	191	hgsc.bcm.edu	37	20	32878681	32878681	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:32878681C>T	ENST00000217426.2	-	6	699	c.622G>A	c.(622-624)Gat>Aat	p.D208N	AHCY_ENST00000538132.1_Missense_Mutation_p.D180N|AHCY_ENST00000468908.1_5'Flank	NM_000687.2	NP_000678.1	P23526	SAHH_HUMAN	adenosylhomocysteinase	208					cellular nitrogen compound metabolic process (GO:0034641)|chronic inflammatory response to antigenic stimulus (GO:0002439)|circadian sleep/wake cycle (GO:0042745)|homocysteine biosynthetic process (GO:0071268)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|S-adenosylhomocysteine catabolic process (GO:0019510)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	adenosylhomocysteinase activity (GO:0004013)|adenyl nucleotide binding (GO:0030554)|NAD binding (GO:0051287)			endometrium(6)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						ATCATCACATCTGTGGCCCGC	0.587																																					p.D208N		Atlas-SNP	.											.	AHCY	43	.	0			c.G622A						PASS	.						50.0	47.0	48.0					20																	32878681		2203	4300	6503	SO:0001583	missense	191	exon6			TCACATCTGTGGC	M61832	CCDS13233.1, CCDS54457.1	20q11.22	2009-06-12	2009-06-12		ENSG00000101444	ENSG00000101444	3.3.1.1		343	protein-coding gene	gene with protein product		180960	"""S-adenosylhomocysteine hydrolase"""			7079734, 6580258	Standard	NM_001161766		Approved	SAHH	uc002xai.3	P23526	OTTHUMG00000140098	ENST00000217426.2:c.622G>A	chr20.hg19:g.32878681C>T	ENSP00000217426:p.Asp208Asn	60.0	0.0	.		112.0	42.0	.	NM_000687	A8K307|B3KUN3|E1P5P2|F5H737|Q96A36	Missense_Mutation	SNP	ENST00000217426.2	hg19	CCDS13233.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766291	0.90020	.	.	ENSG00000101444	ENST00000217426;ENST00000538132	T;T	0.79352	-1.23;-1.26	4.74	3.78	0.43462	S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	0.089011	0.85682	D	0.000000	D	0.86218	0.5880	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.88144	0.2846	10	0.87932	D	0	.	15.2705	0.73696	0.0:0.859:0.141:0.0	.	208	P23526	SAHH_HUMAN	N	208;180	ENSP00000217426:D208N;ENSP00000442820:D180N	ENSP00000217426:D208N	D	-	1	0	AHCY	32342342	1.000000	0.71417	0.977000	0.42913	0.981000	0.71138	7.529000	0.81952	1.333000	0.45449	0.561000	0.74099	GAT	.	.	.	none		0.587	AHCY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078773.2	NM_000687	
KIAA1755	85449	hgsc.bcm.edu	37	20	36874404	36874404	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:36874404T>C	ENST00000279024.4	-	2	399	c.128A>G	c.(127-129)gAt>gGt	p.D43G		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	43										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GCTCAGCCCATCCCCCTGGAA	0.602																																					p.D43G		Atlas-SNP	.											.	KIAA1755	145	.	0			c.A128G						PASS	.						76.0	67.0	70.0					20																	36874404		2203	4300	6503	SO:0001583	missense	85449	exon2			AGCCCATCCCCCT	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.128A>G	chr20.hg19:g.36874404T>C	ENSP00000279024:p.Asp43Gly	41.0	0.0	.		84.0	4.0	.	NM_001029864	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	hg19	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.846553	0.91277	.	.	ENSG00000149633	ENST00000279024	T	0.39056	1.1	5.4	5.4	0.78164	.	0.000000	0.50627	D	0.000112	T	0.66607	0.2806	M	0.81942	2.565	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.71583	-0.4549	10	0.72032	D	0.01	.	14.9112	0.70758	0.0:0.0:0.0:1.0	.	43	Q5JYT7	K1755_HUMAN	G	43	ENSP00000279024:D43G	ENSP00000279024:D43G	D	-	2	0	KIAA1755	36307818	1.000000	0.71417	0.899000	0.35326	0.867000	0.49689	7.984000	0.88150	2.172000	0.68678	0.533000	0.62120	GAT	.	.	.	none		0.602	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
SLC13A3	64849	hgsc.bcm.edu	37	20	45217868	45217868	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr20:45217868A>G	ENST00000279027.4	-	7	965	c.947T>C	c.(946-948)aTa>aCa	p.I316T	SLC13A3_ENST00000464518.1_5'Flank|SLC13A3_ENST00000472148.1_Missense_Mutation_p.I269T|SLC13A3_ENST00000396360.1_Missense_Mutation_p.I269T|SLC13A3_ENST00000413164.2_Missense_Mutation_p.I266T|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000290317.5_Missense_Mutation_p.I269T|SLC13A3_ENST00000495082.1_Missense_Mutation_p.I269T|SLC13A3_ENST00000372121.1_Missense_Mutation_p.I266T	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	316					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	ATTGGTTCTTATCTCAGATTT	0.488																																					p.I316T		Atlas-SNP	.											.	SLC13A3	88	.	0			c.T947C						PASS	.						115.0	114.0	114.0					20																	45217868		2203	4300	6503	SO:0001583	missense	64849	exon7			GTTCTTATCTCAG	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.947T>C	chr20.hg19:g.45217868A>G	ENSP00000279027:p.Ile316Thr	77.0	0.0	.		152.0	35.0	.	NM_022829	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	hg19	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	A	0.563	-0.844580	0.02671	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915;ENST00000420568;ENST00000372121	T;T;T;T;T;T;T;T;T	0.10099	3.84;3.75;4.1;3.75;3.57;3.84;3.26;2.92;2.91	5.84	4.74	0.60224	.	1.055960	0.07196	N	0.856503	T	0.10981	0.0268	L	0.27053	0.805	0.28449	N	0.916409	P;B;P;P	0.42161	0.772;0.128;0.515;0.571	B;B;B;B	0.43701	0.428;0.144;0.22;0.328	T	0.15178	-1.0446	10	0.13470	T	0.59	-3.1173	10.4316	0.44411	0.9264:0.0:0.0736:0.0	.	266;269;269;316	B4DIR8;Q8WWT9-3;F6WI18;Q8WWT9	.;.;.;S13A3_HUMAN	T	269;269;316;269;266;269;269;229;266	ENSP00000290317:I269T;ENSP00000379648:I269T;ENSP00000279027:I316T;ENSP00000420177:I269T;ENSP00000415852:I266T;ENSP00000419621:I269T;ENSP00000417784:I269T;ENSP00000395095:I229T;ENSP00000361193:I266T	ENSP00000279027:I316T	I	-	2	0	SLC13A3	44651275	0.575000	0.26692	0.001000	0.08648	0.055000	0.15305	3.364000	0.52328	1.044000	0.40200	0.529000	0.55759	ATA	.	.	.	none		0.488	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
MTMR3	8897	hgsc.bcm.edu	37	22	30403186	30403186	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr22:30403186A>C	ENST00000401950.2	+	10	1097	c.755A>C	c.(754-756)cAt>cCt	p.H252P	MTMR3_ENST00000323630.5_Missense_Mutation_p.H116P|MTMR3_ENST00000333027.3_Missense_Mutation_p.H252P|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000351488.3_Missense_Mutation_p.H252P|MTMR3_ENST00000406629.1_Missense_Mutation_p.H252P	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	252	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			GATGATGAGCATCTGGTACAG	0.547																																					p.H252P		Atlas-SNP	.											.	MTMR3	106	.	0			c.A755C						PASS	.						94.0	87.0	89.0					22																	30403186		2203	4300	6503	SO:0001583	missense	8897	exon10			ATGAGCATCTGGT	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.755A>C	chr22.hg19:g.30403186A>C	ENSP00000384651:p.His252Pro	40.0	0.0	.		92.0	28.0	.	NM_153050	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	ENST00000401950.2	hg19	CCDS13870.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.872970	0.91664	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	D;D;D;D;D	0.92752	-3.1;-3.1;-3.1;-3.1;-3.1	5.87	5.87	0.94306	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.087453	0.85682	D	0.000000	D	0.95310	0.8478	M	0.69823	2.125	0.80722	D	1	D;P;D	0.69078	0.997;0.931;0.997	D;P;D	0.66847	0.947;0.781;0.947	D	0.95552	0.8621	10	0.66056	D	0.02	.	15.4554	0.75308	1.0:0.0:0.0:0.0	.	252;252;252	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	P	252;252;116;252;252	ENSP00000384651:H252P;ENSP00000331649:H252P;ENSP00000318070:H116P;ENSP00000307271:H252P;ENSP00000384077:H252P	ENSP00000318070:H116P	H	+	2	0	MTMR3	28733186	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	8.962000	0.93254	2.253000	0.74438	0.533000	0.62120	CAT	.	.	.	none		0.547	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
CARD10	29775	hgsc.bcm.edu	37	22	37898635	37898635	+	Silent	SNP	C	C	G			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr22:37898635C>G	ENST00000403299.1	-	12	1977	c.1761G>C	c.(1759-1761)cgG>cgC	p.R587R	CARD10_ENST00000406271.3_Silent_p.R301R|CARD10_ENST00000251973.5_Silent_p.R587R			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	587					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					GGCCACAGCCCCGAGCCAGGA	0.617																																					p.R587R		Atlas-SNP	.											.	CARD10	55	.	0			c.G1761C						PASS	.						54.0	48.0	50.0					22																	37898635		2203	4300	6503	SO:0001819	synonymous_variant	29775	exon11			ACAGCCCCGAGCC	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.1761G>C	chr22.hg19:g.37898635C>G		27.0	0.0	.		63.0	21.0	.	NM_014550	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Silent	SNP	ENST00000403299.1	hg19	CCDS13948.1																																																																																			.	.	.	none		0.617	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
SLC6A8	6535	hgsc.bcm.edu	37	X	152958793	152958793	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chrX:152958793T>C	ENST00000253122.5	+	6	1464	c.988T>C	c.(988-990)Tac>Cac	p.Y330H	SLC6A8_ENST00000430077.2_Missense_Mutation_p.Y215H|SLC6A8_ENST00000485324.1_3'UTR	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	330					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	CCTGGGCAGCTACAACCGCTT	0.632																																					p.Y330H		Atlas-SNP	.											.	SLC6A8	34	.	0			c.T988C						PASS	.						45.0	49.0	48.0					X																	152958793		2203	4300	6503	SO:0001583	missense	6535	exon6			GGCAGCTACAACC		CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.988T>C	chrX.hg19:g.152958793T>C	ENSP00000253122:p.Tyr330His	79.0	0.0	.		114.0	5.0	.	NM_005629	B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Missense_Mutation	SNP	ENST00000253122.5	hg19	CCDS14726.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	26.1|26.1	4.700265|4.700265	0.88924|0.88924	.|.	.|.	ENSG00000130821|ENSG00000130821	ENST00000413787|ENST00000253122;ENST00000430077;ENST00000328897	T|D;D	0.79653|0.84516	-1.29|-1.86;-1.86	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	.|0.000000	.|0.64402	.|U	.|0.000003	D|D	0.92980|0.92980	0.7766|0.7766	M|M	0.89214|0.89214	3.015|3.015	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.993	D|D	0.94080|0.94080	0.7343|0.7343	7|10	0.87932|0.87932	D|D	0|0	.|.	12.9947|12.9947	0.58640|0.58640	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|349;330	.|Q59EV7;P48029	.|.;SC6A8_HUMAN	P|H	45|330;215;336	ENSP00000400463:L45P|ENSP00000253122:Y330H;ENSP00000403041:Y215H	ENSP00000400463:L45P|ENSP00000253122:Y330H	L|Y	+|+	2|1	0|0	SLC6A8|SLC6A8	152611987|152611987	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.753000|7.753000	0.85153|0.85153	1.914000|1.914000	0.55421|0.55421	0.430000|0.430000	0.28490|0.28490	CTA|TAC	.	.	.	none		0.632	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061003.1		
RIMS1	22999	hgsc.bcm.edu	37	6	73017054	73017055	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr6:73017054_73017055delAT	ENST00000521978.1	+	27	3944_3945	c.3944_3945delAT	c.(3943-3945)gatfs	p.D1315fs	RIMS1_ENST00000517960.1_Frame_Shift_Del_p.D1107fs|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000264839.7_Frame_Shift_Del_p.D1164fs|RIMS1_ENST00000491071.2_Frame_Shift_Del_p.D1138fs|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000348717.5_Frame_Shift_Del_p.D1107fs|RIMS1_ENST00000401910.3_Frame_Shift_Del_p.D635fs|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000538414.1_Frame_Shift_Del_p.D121fs|RIMS1_ENST00000425662.2_Intron	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1315					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CAAGAACTTGATCGCGAGCAAT	0.401																																					p.1315_1315del		Atlas-Indel,Pindel	.											.	RIMS1	278	.	0			c.3943_3944del						PASS	.																																			SO:0001589	frameshift_variant	22999	exon27			.	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3944_3945delAT	chr6.hg19:g.73017054_73017055delAT	ENSP00000428417:p.Asp1315fs	64.0	0.0	0		118.0	34.0	0.288136	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Frame_Shift_Del	DEL	ENST00000521978.1	hg19	CCDS47449.1																																																																																			.	.	.	none		0.401	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
RINT1	60561	hgsc.bcm.edu	37	7	105189036	105189036	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr7:105189036delA	ENST00000257700.2	+	7	1106	c.875delA	c.(874-876)gaafs	p.E292fs		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	292	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CAACTCCCAGAAAAATACTCT	0.428																																					p.E292fs		Atlas-Indel,Pindel	.											.	RINT1	65	.	0			c.874delG						PASS	.						190.0	164.0	173.0					7																	105189036		2203	4300	6503	SO:0001589	frameshift_variant	60561	exon7			.	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.875delA	chr7.hg19:g.105189036delA	ENSP00000257700:p.Glu292fs	53.0	0.0	0		197.0	62.0	0.314721	NM_021930	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Frame_Shift_Del	DEL	ENST00000257700.2	hg19	CCDS34726.1																																																																																			.	.	.	none		0.428	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930	
ACOT11	26027	hgsc.bcm.edu	37	1	55059680	55059687	+	Frame_Shift_Del	DEL	GCCACCTT	GCCACCTT	-	rs35306628|rs370568235		TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	GCCACCTT	GCCACCTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:55059680_55059687delGCCACCTT	ENST00000371316.3	+	5	521_528	c.439_446delGCCACCTT	c.(439-447)gccaccttcfs	p.ATF147fs	ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000343744.2_Frame_Shift_Del_p.ATF147fs	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	147	Acyl coenzyme A hydrolase 1.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						CAAGGCCTTGGCCACCTTCGTGGCCCGC	0.625																																					p.146_149del	Ovarian(148;1440 1861 22015 32453 51933)	Atlas-Indel,Pindel	.											.	ACOT11	105	.	0			c.438_445del						PASS	.																																			SO:0001589	frameshift_variant	26027	exon5			.	AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.439_446delGCCACCTT	chr1.hg19:g.55059680_55059687delGCCACCTT	ENSP00000360366:p.Ala147fs	43.0	0.0	0		49.0	13.0	0.265306	NM_147161	B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Frame_Shift_Del	DEL	ENST00000371316.3	hg19	CCDS592.1																																																																																			.	.	.	none		0.625	ACOT11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027356.1	NM_015547	
RNPEP	6051	hgsc.bcm.edu	37	1	201958580	201958590	+	Frame_Shift_Del	DEL	TTCCAGATGTG	TTCCAGATGTG	-			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	TTCCAGATGTG	TTCCAGATGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr1:201958580_201958590delTTCCAGATGTG	ENST00000295640.4	+	3	701_711	c.658_668delTTCCAGATGTG	c.(658-669)ttccagatgtgtfs	p.FQMC220fs	RNPEP_ENST00000367286.3_Frame_Shift_Del_p.FQMC220fs|RNPEP_ENST00000471105.1_Intron	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	220					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		TAAGTTCTTCTTCCAGATGTGTCAGCCCATC	0.507																																					p.219_223del	GBM(19;39 479 7473 13131 19462)	Atlas-Indel,Pindel	.											.	RNPEP	39	.	0			c.657_667del						PASS	.																																			SO:0001589	frameshift_variant	6051	exon3			.	BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.658_668delTTCCAGATGTG	chr1.hg19:g.201958580_201958590delTTCCAGATGTG	ENSP00000295640:p.Phe220fs	70.0	0.0	0		161.0	36.0	0.223602	NM_020216	Q9BVM9|Q9H1D4|Q9NPT7	Frame_Shift_Del	DEL	ENST00000295640.4	hg19	CCDS1418.1																																																																																			.	.	.	none		0.507	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087345.1	NM_020216	
ZZEF1	23140	hgsc.bcm.edu	37	17	3980188	3980189	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-A6HP-01A-11D-A31X-10	TCGA-A4-A6HP-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d1845e20-13c6-473e-a607-d5010b214486	1fbfe3f1-dbc6-4e89-a9f6-0adbf2672b92	g.chr17:3980188_3980189insT	ENST00000381638.2	-	20	3208_3209	c.3084_3085insA	c.(3082-3087)tcagtgfs	p.V1029fs	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1029							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						ATTGAAAACACTGAGTTACATA	0.47																																					p.V1029fs		Atlas-Indel,Pindel	.											.	ZZEF1	195	.	0			c.3085_3086insA						PASS	.																																			SO:0001589	frameshift_variant	23140	exon20			.	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.3085dupA	chr17.hg19:g.3980189_3980189dupT	ENSP00000371051:p.Val1029fs	71.0	0.0	0		222.0	121.0	0.545045	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Frame_Shift_Ins	INS	ENST00000381638.2	hg19	CCDS11043.1																																																																																			.	.	.	none		0.470	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
