#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NRD1	4898	hgsc.bcm.edu	37	1	52260504	52260504	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr1:52260504T>C	ENST00000354831.7	-	25	3020	c.2831A>G	c.(2830-2832)tAt>tGt	p.Y944C	RP4-657D16.3_ENST00000591675.1_RNA|NRD1_ENST00000352171.7_Missense_Mutation_p.Y876C|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000544028.1_3'UTR|RP4-657D16.3_ENST00000586761.1_RNA|NRD1_ENST00000539524.1_Missense_Mutation_p.Y812C|RP4-657D16.3_ENST00000588291.1_RNA	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	875					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						CTCAACAACATATTTCAGGAA	0.368																																					p.Y944C		Atlas-SNP	.											.	NRD1	89	.	0			c.A2831G						PASS	.						84.0	88.0	87.0					1																	52260504		2203	4300	6503	SO:0001583	missense	4898	exon25			ACAACATATTTCA	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.2831A>G	chr1.hg19:g.52260504T>C	ENSP00000346890:p.Tyr944Cys	356.0	0.0	.		232.0	89.0	.	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.59|14.59	2.581623|2.581623	0.46006|0.46006	.|.	.|.	ENSG00000078618|ENSG00000078618	ENST00000440943|ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665;ENST00000546169	.|T;T;T	.|0.07800	.|3.16;3.16;3.16	5.65|5.65	4.51|4.51	0.55191|0.55191	.|Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	.|0.120475	.|0.64402	.|D	.|0.000018	T|T	0.09598|0.09598	0.0236|0.0236	L|L	0.43701|0.43701	1.375|1.375	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.27264	.|0.076;0.094;0.173	.|B;B;B	.|0.30105	.|0.037;0.063;0.111	T|T	0.10800|0.10800	-1.0614|-1.0614	5|10	.|0.40728	.|T	.|0.16	-7.7067|-7.7067	12.2317|12.2317	0.54492|0.54492	0.1275:0.0:0.0:0.8725|0.1275:0.0:0.0:0.8725	.|.	.|876;875;944	.|F5H6R2;O43847;B1AKJ5	.|.;NRDC_HUMAN;.	M|C	290|876;944;812;306;876	.|ENSP00000262679:Y876C;ENSP00000346890:Y944C;ENSP00000444416:Y812C	.|ENSP00000262679:Y876C	I|Y	-|-	3|2	3|0	NRD1|NRD1	52033092|52033092	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.993000|0.993000	0.82548|0.82548	5.393000|5.393000	0.66279|0.66279	1.134000|1.134000	0.42165|0.42165	0.533000|0.533000	0.62120|0.62120	ATA|TAT	.	.	.	none		0.368	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
MSH4	4438	hgsc.bcm.edu	37	1	76378456	76378456	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr1:76378456G>A	ENST00000263187.3	+	20	2799	c.2695G>A	c.(2695-2697)Gct>Act	p.A899T		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	899					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						TGTTCAAACTGCTCGAAACTC	0.383								Mismatch excision repair (MMR)																													p.A899T		Atlas-SNP	.											.	MSH4	147	.	0			c.G2695A						PASS	.						51.0	53.0	52.0					1																	76378456		2203	4300	6503	SO:0001583	missense	4438	exon20			CAAACTGCTCGAA	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2695G>A	chr1.hg19:g.76378456G>A	ENSP00000263187:p.Ala899Thr	214.0	0.0	.		138.0	37.0	.	NM_002440	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	ENST00000263187.3	hg19	CCDS670.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265047	0.80358	.	.	ENSG00000057468	ENST00000263187	D	0.88664	-2.41	5.2	5.2	0.72013	.	0.057075	0.64402	D	0.000001	D	0.86694	0.5994	M	0.63843	1.955	0.44155	D	0.996952	D	0.55605	0.972	P	0.50490	0.642	D	0.84547	0.0642	10	0.25751	T	0.34	-39.1665	13.9996	0.64424	0.0:0.0:0.8486:0.1514	.	899	O15457	MSH4_HUMAN	T	899	ENSP00000263187:A899T	ENSP00000263187:A899T	A	+	1	0	MSH4	76151044	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.301000	0.72782	2.582000	0.87167	0.453000	0.30009	GCT	.	.	.	none		0.383	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	
STXBP3	6814	hgsc.bcm.edu	37	1	109338883	109338883	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr1:109338883G>A	ENST00000370008.3	+	14	1188	c.1138G>A	c.(1138-1140)Gga>Aga	p.G380R		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	380					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		TGATGCAGAAGGACAGAAGGT	0.313																																					p.G380R		Atlas-SNP	.											.	STXBP3	44	.	0			c.G1138A						PASS	.						68.0	67.0	68.0					1																	109338883		2203	4300	6503	SO:0001583	missense	6814	exon14			GCAGAAGGACAGA	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1138G>A	chr1.hg19:g.109338883G>A	ENSP00000359025:p.Gly380Arg	364.0	0.0	.		258.0	82.0	.	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	hg19	CCDS790.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.823061	0.90873	.	.	ENSG00000116266	ENST00000370008	T	0.81330	-1.48	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.90256	0.6953	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89811	0.3982	10	0.54805	T	0.06	-19.5687	20.1392	0.98050	0.0:0.0:1.0:0.0	.	380	O00186	STXB3_HUMAN	R	380	ENSP00000359025:G380R	ENSP00000359025:G380R	G	+	1	0	STXBP3	109140406	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.716000	0.91420	2.751000	0.94390	0.591000	0.81541	GGA	.	.	.	none		0.313	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156911226	156911226	+	Splice_Site	SNP	C	C	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr1:156911226C>T	ENST00000361409.2	-	34	4075		c.e34-1		ARHGEF11_ENST00000315174.8_Splice_Site|ARHGEF11_ENST00000368194.3_Splice_Site|ARHGEF11_ENST00000487682.1_Splice_Site	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CAGTTCTACCCTGAGGAAGGA	0.552																																					.		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.3333-1G>A						PASS	.						98.0	86.0	90.0					1																	156911226		2203	4300	6503	SO:0001630	splice_region_variant	9826	exon35			TCTACCCTGAGGA	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3333-1G>A	chr1.hg19:g.156911226C>T		92.0	0.0	.		68.0	25.0	.	NM_014784	D3DVD0|Q5VY40|Q6PFW2	Splice_Site	SNP	ENST00000361409.2	hg19	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598788	0.66332	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.369	0.60703	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARHGEF11	155177850	0.999000	0.42202	0.986000	0.45419	0.504000	0.33889	3.269000	0.51592	2.608000	0.88229	0.462000	0.41574	.	.	.	.	none		0.552	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	Intron
SLC35F5	80255	hgsc.bcm.edu	37	2	114513036	114513036	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr2:114513036C>G	ENST00000245680.2	-	2	539	c.126G>C	c.(124-126)aaG>aaC	p.K42N	SLC35F5_ENST00000409342.1_Missense_Mutation_p.K36N	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	42					transport (GO:0006810)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						TCTACCTTGTCTTAAGAGCCC	0.383																																					p.K42N		Atlas-SNP	.											.	SLC35F5	60	.	0			c.G126C						PASS	.						104.0	102.0	102.0					2																	114513036		2203	4300	6503	SO:0001583	missense	80255	exon2			CCTTGTCTTAAGA	AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.126G>C	chr2.hg19:g.114513036C>G	ENSP00000245680:p.Lys42Asn	207.0	0.0	.		143.0	58.0	.	NM_025181	Q9H6P8|Q9H7D8	Missense_Mutation	SNP	ENST00000245680.2	hg19	CCDS2119.1	.	.	.	.	.	.	.	.	.	.	C	8.367	0.834366	0.16820	.	.	ENSG00000115084	ENST00000245680;ENST00000409106;ENST00000409342	T;T	0.50001	0.76;0.76	5.13	-1.54	0.08584	.	0.871411	0.10144	N	0.710493	T	0.28333	0.0700	N	0.22421	0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.17077	-1.0381	10	0.42905	T	0.14	-0.0951	4.9347	0.13935	0.0:0.2162:0.2783:0.5055	.	42;36;42	B2RDY0;B8ZZV6;Q8WV83	.;.;S35F5_HUMAN	N	42;36;36	ENSP00000245680:K42N;ENSP00000386754:K36N	ENSP00000245680:K42N	K	-	3	2	SLC35F5	114229506	0.041000	0.20044	0.034000	0.17996	0.117000	0.20001	0.299000	0.19138	-0.420000	0.07427	-0.903000	0.02851	AAG	.	.	.	none		0.383	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254150.1	NM_025181	
RAB3GAP1	22930	hgsc.bcm.edu	37	2	135815643	135815643	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr2:135815643A>G	ENST00000264158.8	+	3	180	c.137A>G	c.(136-138)aAg>aGg	p.K46R	RAB3GAP1_ENST00000425393.1_Missense_Mutation_p.K46R|RAB3GAP1_ENST00000539493.1_5'UTR|RAB3GAP1_ENST00000442034.1_Missense_Mutation_p.K46R	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	46					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		TCTTTGGGAAAGCCACTCGAA	0.388																																					p.K46R		Atlas-SNP	.											.	RAB3GAP1	87	.	0			c.A137G						PASS	.						93.0	88.0	90.0					2																	135815643		2203	4300	6503	SO:0001583	missense	22930	exon3			TGGGAAAGCCACT	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.137A>G	chr2.hg19:g.135815643A>G	ENSP00000264158:p.Lys46Arg	85.0	0.0	.		77.0	26.0	.	NM_001172435	A6H8Z3|C9J837|Q659F5|Q8TBB4	Missense_Mutation	SNP	ENST00000264158.8	hg19	CCDS33294.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.613130	0.46631	.	.	ENSG00000115839	ENST00000264158;ENST00000442034;ENST00000425393	T;T	0.44482	0.92;0.92	5.62	-1.08	0.09936	.	0.287773	0.36932	N	0.002336	T	0.24392	0.0591	L	0.47716	1.5	0.80722	D	1	B;P	0.38335	0.0;0.627	B;B	0.32677	0.0;0.15	T	0.07233	-1.0783	10	0.19147	T	0.46	-7.7819	5.3457	0.16008	0.5453:0.144:0.3107:0.0	.	46;46	C9J837;Q15042	.;RB3GP_HUMAN	R	46	ENSP00000264158:K46R;ENSP00000411418:K46R	ENSP00000264158:K46R	K	+	2	0	RAB3GAP1	135532113	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	0.810000	0.27183	-0.106000	0.12110	0.533000	0.62120	AAG	.	.	.	none		0.388	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233	
PKP4	8502	hgsc.bcm.edu	37	2	159488407	159488407	+	Silent	SNP	T	T	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr2:159488407T>A	ENST00000389759.3	+	8	1408	c.1296T>A	c.(1294-1296)acT>acA	p.T432T	PKP4_ENST00000389757.3_Silent_p.T432T	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	432					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						ACCATGGAACTGTGGAGCTCC	0.517										HNSCC(62;0.18)																											p.T432T		Atlas-SNP	.											.	PKP4	133	.	0			c.T1296A						PASS	.						123.0	111.0	115.0					2																	159488407		2203	4300	6503	SO:0001819	synonymous_variant	8502	exon8			TGGAACTGTGGAG	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1296T>A	chr2.hg19:g.159488407T>A		132.0	0.0	.		79.0	19.0	.	NM_001005476	Q86W91	Silent	SNP	ENST00000389759.3	hg19	CCDS33305.1																																																																																			.	.	.	none		0.517	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
KCNH7	90134	hgsc.bcm.edu	37	2	163256852	163256852	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr2:163256852C>T	ENST00000332142.5	-	10	2353	c.2254G>A	c.(2254-2256)Ggt>Agt	p.G752S		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	752					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CTAAGGCAACCTTTACTTGCC	0.478																																					p.G752S	GBM(196;1492 2208 17507 24132 45496)	Atlas-SNP	.											.	KCNH7	378	.	0			c.G2254A						PASS	.						148.0	149.0	148.0					2																	163256852		2203	4300	6503	SO:0001583	missense	90134	exon10			GGCAACCTTTACT	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2254G>A	chr2.hg19:g.163256852C>T	ENSP00000331727:p.Gly752Ser	120.0	0.0	.		85.0	26.0	.	NM_033272	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	hg19	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	C	35	5.436882	0.96168	.	.	ENSG00000184611	ENST00000332142	D	0.96427	-4.01	5.57	5.57	0.84162	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.97259	0.9104	M	0.67569	2.06	0.80722	D	1	D	0.56035	0.974	P	0.55615	0.78	D	0.97606	1.0126	10	0.72032	D	0.01	.	19.5531	0.95330	0.0:1.0:0.0:0.0	.	752	Q9NS40	KCNH7_HUMAN	S	752	ENSP00000331727:G752S	ENSP00000331727:G752S	G	-	1	0	KCNH7	162965098	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.807000	0.86032	2.628000	0.89032	0.591000	0.81541	GGT	.	.	.	none		0.478	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
FAM198A	729085	hgsc.bcm.edu	37	3	43073936	43073936	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr3:43073936C>T	ENST00000430121.2	+	2	276	c.181C>T	c.(181-183)Cgg>Tgg	p.R61W	KRBOX1_ENST00000418093.2_3'UTR|KRBOX1_ENST00000443313.1_Intron	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	61						extracellular region (GO:0005576)				endometrium(1)	1						AACCCATATCCGGCAGGCTTT	0.637																																					p.R61W		Atlas-SNP	.											.	FAM198A	23	.	0			c.C181T						PASS	.						36.0	38.0	37.0					3																	43073936		692	1591	2283	SO:0001583	missense	729085	exon2			CATATCCGGCAGG	AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.181C>T	chr3.hg19:g.43073936C>T	ENSP00000407301:p.Arg61Trp	120.0	0.0	.		152.0	8.0	.	NM_001129908	B3KR48	Missense_Mutation	SNP	ENST00000430121.2	hg19	CCDS46808.1	.	.	.	.	.	.	.	.	.	.	C	11.04	1.522081	0.27211	.	.	ENSG00000144649	ENST00000430121	T	0.23552	1.9	4.85	-2.36	0.06663	.	.	.	.	.	T	0.10337	0.0253	N	0.14661	0.345	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.32534	-0.9903	8	.	.	.	-8.5544	1.7361	0.02942	0.376:0.3385:0.1231:0.1624	.	61	Q9UFP1	F198A_HUMAN	W	61	ENSP00000407301:R61W	.	R	+	1	2	FAM198A	43048940	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-1.345000	0.02637	-0.331000	0.08501	-1.266000	0.01441	CGG	.	.	.	none		0.637	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344240.3	NM_001129908	
ACOX2	8309	hgsc.bcm.edu	37	3	58494718	58494718	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr3:58494718A>C	ENST00000302819.5	-	14	2176	c.1885T>G	c.(1885-1887)Ttc>Gtc	p.F629V	ACOX2_ENST00000481527.1_5'UTR|ACOX2_ENST00000459701.2_Missense_Mutation_p.F615V	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	629					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		TGATCGGTGAAGTCAAAAGCA	0.418																																					p.F629V		Atlas-SNP	.											.	ACOX2	53	.	0			c.T1885G						PASS	.						120.0	106.0	111.0					3																	58494718		2203	4300	6503	SO:0001583	missense	8309	exon14			CGGTGAAGTCAAA	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.1885T>G	chr3.hg19:g.58494718A>C	ENSP00000307697:p.Phe629Val	124.0	0.0	.		108.0	26.0	.	NM_003500	A6NF16|B2R8U5	Missense_Mutation	SNP	ENST00000302819.5	hg19	CCDS33775.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.408425	0.83340	.	.	ENSG00000168306	ENST00000459701;ENST00000302819	T;T	0.42900	0.96;0.96	5.43	5.43	0.79202	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (1);	0.093665	0.46442	D	0.000282	T	0.53158	0.1779	M	0.76938	2.355	0.44702	D	0.997696	P	0.46395	0.877	P	0.46885	0.53	T	0.58387	-0.7645	10	0.48119	T	0.1	-29.0011	15.5185	0.75846	1.0:0.0:0.0:0.0	.	629	Q99424	ACOX2_HUMAN	V	615;629	ENSP00000418562:F615V;ENSP00000307697:F629V	ENSP00000307697:F629V	F	-	1	0	ACOX2	58469758	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.308000	0.72820	2.088000	0.63022	0.472000	0.43445	TTC	.	.	.	none		0.418	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353541.1		
CADM2	253559	hgsc.bcm.edu	37	3	86114787	86114787	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr3:86114787G>A	ENST00000407528.2	+	9	1158	c.1096G>A	c.(1096-1098)Gac>Aac	p.D366N	CADM2_ENST00000383699.3_Missense_Mutation_p.D335N|CADM2_ENST00000405615.2_Missense_Mutation_p.D368N	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	366					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.D335H(1)|p.D368H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		GAATGGCCCTGACCATGCTCT	0.403																																					p.D368N		Atlas-SNP	.											CADM2_ENST00000383699,NS,carcinoma,0,1	CADM2	195	.	2	Substitution - Missense(2)	lung(2)	c.G1102A						PASS	.						157.0	140.0	146.0					3																	86114787		2203	4300	6503	SO:0001583	missense	253559	exon9			GGCCCTGACCATG	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.1096G>A	chr3.hg19:g.86114787G>A	ENSP00000384575:p.Asp366Asn	100.0	0.0	.		103.0	55.0	.	NM_153184	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	hg19	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	G	36	5.603574	0.96626	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.69175	-0.22;-0.38;-0.38	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.75752	0.3892	L	0.41824	1.3	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.83275	0.996;0.995;0.996	T	0.68281	-0.5450	10	0.17832	T	0.49	.	19.964	0.97260	0.0:0.0:1.0:0.0	.	368;335;366	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	N	335;366;368	ENSP00000373200:D335N;ENSP00000384575:D366N;ENSP00000384193:D368N	ENSP00000373200:D335N	D	+	1	0	CADM2	86197477	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.721000	0.93114	0.650000	0.86243	GAC	.	.	.	none		0.403	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
QTRTD1	79691	hgsc.bcm.edu	37	3	113795727	113795727	+	Silent	SNP	C	C	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr3:113795727C>T	ENST00000493014.1	+	3	434	c.366C>T	c.(364-366)acC>acT	p.T122T	QTRTD1_ENST00000485050.1_Silent_p.T240T|QTRTD1_ENST00000479882.1_Silent_p.T105T|QTRTD1_ENST00000281273.4_Silent_p.T228T	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						ATCCAACAACCCTGGAGGCTA	0.567																																					p.T240T		Atlas-SNP	.											.	QTRTD1	29	.	0			c.C720T						PASS	.						90.0	75.0	80.0					3																	113795727		2203	4300	6503	SO:0001819	synonymous_variant	79691	exon6			AACAACCCTGGAG	AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.366C>T	chr3.hg19:g.113795727C>T		152.0	0.0	.		138.0	25.0	.	NM_001256835		Silent	SNP	ENST00000493014.1	hg19	CCDS58845.1																																																																																			.	.	.	none		0.567	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000354711.1	NM_024638	
NDUFB4	4710	hgsc.bcm.edu	37	3	120321109	120321109	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr3:120321109T>A	ENST00000184266.2	+	3	433	c.382T>A	c.(382-384)Tca>Aca	p.S128T	NDUFB4_ENST00000485064.1_3'UTR|NDUFB4_ENST00000492739.1_Missense_Mutation_p.S79T	NM_004547.5	NP_004538.2	O95168	NDUB4_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa	128					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|large_intestine(1)|lung(3)	5				GBM - Glioblastoma multiforme(114;0.14)		ATTTCACCTCTCATATTAAGT	0.303																																					p.S128T		Atlas-SNP	.											.	NDUFB4	21	.	0			c.T382A						PASS	.						82.0	90.0	87.0					3																	120321109		2203	4295	6498	SO:0001583	missense	4710	exon3			CACCTCTCATATT	AF044957	CCDS2999.1, CCDS54630.1	3q13.33	2011-07-04	2002-08-29		ENSG00000065518	ENSG00000065518		"""Mitochondrial respiratory chain complex / Complex I"""	7699	protein-coding gene	gene with protein product	"""complex I B15 subunit"""	603840	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4 (15kD, B15)"""			9878551	Standard	NM_004547		Approved	B15	uc003edu.3	O95168	OTTHUMG00000159442	ENST00000184266.2:c.382T>A	chr3.hg19:g.120321109T>A	ENSP00000184266:p.Ser128Thr	118.0	0.0	.		99.0	42.0	.	NM_004547	B2RUY3|B9EJC7	Missense_Mutation	SNP	ENST00000184266.2	hg19	CCDS2999.1	.	.	.	.	.	.	.	.	.	.	T	6.494	0.459339	0.12342	.	.	ENSG00000065518	ENST00000184266;ENST00000492739	.	.	.	4.88	-0.947	0.10382	.	0.721652	0.12974	N	0.423890	T	0.39860	0.1094	M	0.64567	1.98	0.09310	N	1	B	0.22746	0.074	B	0.23574	0.047	T	0.41070	-0.9529	9	0.59425	D	0.04	-3.6658	5.2004	0.15260	0.47:0.0:0.1616:0.3683	.	128	O95168	NDUB4_HUMAN	T	128;79	.	ENSP00000184266:S128T	S	+	1	0	NDUFB4	121803799	0.001000	0.12720	0.547000	0.28179	0.010000	0.07245	0.040000	0.13905	0.054000	0.16065	-0.336000	0.08194	TCA	.	.	.	none		0.303	NDUFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355420.1	NM_004547	
EFNA5	1946	hgsc.bcm.edu	37	5	106763191	106763191	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr5:106763191G>A	ENST00000333274.6	-	2	426	c.145C>T	c.(145-147)Cat>Tat	p.H49Y	EFNA5_ENST00000509503.1_Missense_Mutation_p.H49Y	NM_001962.2	NP_001953.1	P52803	EFNA5_HUMAN	ephrin-A5	49	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell-cell adhesion (GO:0022407)|regulation of focal adhesion assembly (GO:0051893)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rho GTPase activity (GO:0032319)|retinal ganglion cell axon guidance (GO:0031290)	anchored component of external side of plasma membrane (GO:0031362)|plasma membrane (GO:0005886)	chemorepellent activity (GO:0045499)|ephrin receptor binding (GO:0046875)			large_intestine(6)	6		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		ACATCAATATGGTAGTCACCC	0.408																																					p.H49Y		Atlas-SNP	.											.	EFNA5	16	.	0			c.C145T						PASS	.						106.0	107.0	106.0					5																	106763191		2202	4300	6502	SO:0001583	missense	1946	exon2			CAATATGGTAGTC	U26403	CCDS4097.1	5q21	2011-03-09			ENSG00000184349	ENSG00000184349		"""Ephrins"""	3225	protein-coding gene	gene with protein product		601535		EPLG7		8661153, 9245480	Standard	NM_001962		Approved	AF1, LERK7	uc003kol.3	P52803	OTTHUMG00000128741	ENST00000333274.6:c.145C>T	chr5.hg19:g.106763191G>A	ENSP00000328777:p.His49Tyr	74.0	0.0	.		81.0	33.0	.	NM_001962		Missense_Mutation	SNP	ENST00000333274.6	hg19	CCDS4097.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.737704	0.30774	.	.	ENSG00000184349	ENST00000333274;ENST00000509503	D;D	0.92965	-3.14;-3.14	6.06	6.06	0.98353	Cupredoxin (2);	0.041559	0.85682	D	0.000000	D	0.89483	0.6728	L	0.40543	1.245	0.80722	D	1	P;P	0.49559	0.925;0.629	P;P	0.47915	0.561;0.478	D	0.85995	0.1491	10	0.08599	T	0.76	-23.2864	15.3505	0.74380	0.0:0.0:0.8605:0.1395	.	49;49	D6RDV5;P52803	.;EFNA5_HUMAN	Y	49	ENSP00000328777:H49Y;ENSP00000426989:H49Y	ENSP00000328777:H49Y	H	-	1	0	EFNA5	106791090	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.500000	0.81588	2.882000	0.98803	0.655000	0.94253	CAT	.	.	.	none		0.408	EFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250652.1	NM_001962	
POM121L2	94026	hgsc.bcm.edu	37	6	27277799	27277799	+	Silent	SNP	G	G	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr6:27277799G>A	ENST00000444565.1	-	1	2150	c.2151C>T	c.(2149-2151)agC>agT	p.S717S	POM121L2_ENST00000377451.2_Silent_p.S653S	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	717										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						AATTAGCAGTGCTGCTTCTAG	0.517																																					p.S717S		Atlas-SNP	.											.	POM121L2	61	.	0			c.C2151T						PASS	.						111.0	101.0	104.0					6																	27277799		692	1591	2283	SO:0001819	synonymous_variant	94026	exon1			AGCAGTGCTGCTT	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.2151C>T	chr6.hg19:g.27277799G>A		155.0	0.0	.		131.0	47.0	.	NM_033482	C9J1I7	Silent	SNP	ENST00000444565.1	hg19	CCDS59497.1																																																																																			.	.	.	none		0.517	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040143.2	NM_033482	
RING1	6015	hgsc.bcm.edu	37	6	33179580	33179580	+	Missense_Mutation	SNP	G	G	A	rs528777843		TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr6:33179580G>A	ENST00000374656.4	+	6	1128	c.920G>A	c.(919-921)cGg>cAg	p.R307Q	RING1_ENST00000478431.1_3'UTR	NM_002931.3	NP_002922.2	Q06587	RING1_HUMAN	ring finger protein 1	307	Necessary for interaction with CBX2. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|histone H2A monoubiquitination (GO:0035518)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(5)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|skin(4)	17						GCCCTCGAGCGGAGGCAACAG	0.647													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13950	0.0		0.0	False		,,,				2504	0.0				p.R307Q		Atlas-SNP	.											.	RING1	40	.	0			c.G920A						PASS	.						71.0	73.0	72.0					6																	33179580		2203	4299	6502	SO:0001583	missense	6015	exon6			TCGAGCGGAGGCA		CCDS34424.1	6p21.3	2013-01-09			ENSG00000204227	ENSG00000204227		"""RING-type (C3HC4) zinc fingers"""	10018	protein-coding gene	gene with protein product		602045				1906426	Standard	NM_002931		Approved	RNF1	uc003odk.3	Q06587	OTTHUMG00000031278	ENST00000374656.4:c.920G>A	chr6.hg19:g.33179580G>A	ENSP00000363787:p.Arg307Gln	38.0	0.0	.		51.0	20.0	.	NM_002931	A8JZZ0|Q5JP96|Q5SQW2|Q86V19	Missense_Mutation	SNP	ENST00000374656.4	hg19	CCDS34424.1	.	.	.	.	.	.	.	.	.	.	G	6.906	0.536803	0.13188	.	.	ENSG00000204227	ENST00000374656	D	0.83335	-1.71	3.89	3.89	0.44902	.	0.281756	0.28671	N	0.014523	T	0.38957	0.1060	N	0.08118	0	0.31260	N	0.693011	P	0.41420	0.749	B	0.23419	0.046	T	0.41342	-0.9514	10	0.13853	T	0.58	-20.2778	11.2237	0.48871	0.0:0.0:1.0:0.0	.	307	Q06587	RING1_HUMAN	Q	307	ENSP00000363787:R307Q	ENSP00000363787:R307Q	R	+	2	0	RING1	33287558	0.991000	0.36638	0.986000	0.45419	0.113000	0.19764	0.000000	0.12993	1.965000	0.57142	0.448000	0.29417	CGG	.	.	.	none		0.647	RING1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076609.2		
ABCA13	154664	hgsc.bcm.edu	37	7	48654963	48654963	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr7:48654963A>G	ENST00000435803.1	+	59	14851	c.14827A>G	c.(14827-14829)Atc>Gtc	p.I4943V	ABCA13_ENST00000544596.1_Missense_Mutation_p.I673V	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4943	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCCTCAGCACATCAAAAATAG	0.418																																					p.I4943V		Atlas-SNP	.											.	ABCA13	1192	.	0			c.A14827G						PASS	.						97.0	94.0	95.0					7																	48654963		1926	4132	6058	SO:0001583	missense	154664	exon59			CAGCACATCAAAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14827A>G	chr7.hg19:g.48654963A>G	ENSP00000411096:p.Ile4943Val	149.0	0.0	.		162.0	46.0	.	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	17.37	3.371572	0.61624	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.97906	-4.6;-4.6;-4.6	5.99	2.22	0.28083	ABC transporter-like (1);	0.254751	0.27469	N	0.019238	D	0.94968	0.8372	N	0.25245	0.725	0.29963	N	0.819227	P;D;P	0.58268	0.679;0.982;0.921	B;P;B	0.50934	0.264;0.654;0.401	D	0.91892	0.5524	10	0.72032	D	0.01	.	7.8742	0.29584	0.4999:0.4258:0.0743:0.0	.	673;2645;4943	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	V	4943;716;673	ENSP00000411096:I4943V;ENSP00000391042:I716V;ENSP00000442634:I673V	ENSP00000391042:I716V	I	+	1	0	ABCA13	48625509	0.221000	0.23642	0.940000	0.37924	0.947000	0.59692	0.258000	0.18387	0.492000	0.27815	-0.316000	0.08728	ATC	.	.	.	none		0.418	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
KEL	3792	hgsc.bcm.edu	37	7	142658912	142658912	+	Silent	SNP	T	T	G			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr7:142658912T>G	ENST00000355265.2	-	2	525	c.51A>C	c.(49-51)gcA>gcC	p.A17A	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	17					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CCATTCCACCTGCCTGGCTGC	0.547																																					p.A17A		Atlas-SNP	.											.	KEL	128	.	0			c.A51C						PASS	.						283.0	240.0	255.0					7																	142658912		2203	4300	6503	SO:0001819	synonymous_variant	3792	exon2			TCCACCTGCCTGG	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.51A>C	chr7.hg19:g.142658912T>G		129.0	0.0	.		143.0	77.0	.	NM_000420	B2RBV4|Q96RS8|Q99885	Silent	SNP	ENST00000355265.2	hg19	CCDS34766.1																																																																																			.	.	.	none		0.547	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
LRP12	29967	hgsc.bcm.edu	37	8	105509750	105509750	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr8:105509750C>G	ENST00000276654.5	-	5	1138	c.1030G>C	c.(1030-1032)Gtt>Ctt	p.V344L	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.V325L	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	344	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GAAGAAGAAACAACTGTAAGA	0.388																																					p.V344L		Atlas-SNP	.											.	LRP12	124	.	0			c.G1030C						PASS	.						69.0	68.0	68.0					8																	105509750		2203	4300	6503	SO:0001583	missense	29967	exon5			AAGAAACAACTGT	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1030G>C	chr8.hg19:g.105509750C>G	ENSP00000276654:p.Val344Leu	177.0	0.0	.		120.0	51.0	.	NM_013437	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	hg19	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795513	0.70452	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.27402	1.67;1.67	5.95	5.95	0.96441	CUB (5);	0.000000	0.85682	D	0.000000	T	0.45074	0.1324	L	0.35487	1.065	0.80722	D	1	D;D	0.69078	0.99;0.997	D;D	0.79108	0.98;0.992	T	0.07290	-1.0780	10	0.12766	T	0.61	-26.5114	20.3748	0.98911	0.0:1.0:0.0:0.0	.	325;344	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	L	325;344	ENSP00000399148:V325L;ENSP00000276654:V344L	ENSP00000276654:V344L	V	-	1	0	LRP12	105578926	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.263000	0.78421	2.817000	0.96982	0.563000	0.77884	GTT	.	.	.	none		0.388	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
SOHLH1	402381	hgsc.bcm.edu	37	9	138589408	138589408	+	Silent	SNP	C	C	G	rs561649799		TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr9:138589408C>G	ENST00000298466.5	-	4	471	c.411G>C	c.(409-411)tcG>tcC	p.S137S	SOHLH1_ENST00000425225.1_Silent_p.S137S	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	137					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		GAATCTGACTCGACAACGTCA	0.527																																					p.S137S		Atlas-SNP	.											.	SOHLH1	70	.	0			c.G411C						PASS	.						78.0	65.0	70.0					9																	138589408		2202	4300	6502	SO:0001819	synonymous_variant	402381	exon4			CTGACTCGACAAC	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.411G>C	chr9.hg19:g.138589408C>G		99.0	0.0	.		39.0	12.0	.	NM_001012415	C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Silent	SNP	ENST00000298466.5	hg19	CCDS35174.1																																																																																			.	.	.	none		0.527	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415	
CACNA1B	774	hgsc.bcm.edu	37	9	140952502	140952502	+	Splice_Site	SNP	G	G	C			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr9:140952502G>C	ENST00000371372.1	+	28	4253	c.4108G>C	c.(4108-4110)Gtg>Ctg	p.V1370L	CACNA1B_ENST00000371363.1_Splice_Site_p.V1370L|CACNA1B_ENST00000371355.4_Splice_Site_p.V1371L|CACNA1B_ENST00000277551.2_Splice_Site_p.V1370L|CACNA1B_ENST00000371357.1_Splice_Site_p.V1371L|CACNA1B_ENST00000277549.5_Splice_Site_p.V566L	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1370					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TTTGCCCAGGGTGCTGAAACA	0.567																																					p.V1370L		Atlas-SNP	.											.	CACNA1B	266	.	0			c.G4108C						PASS	.						119.0	112.0	114.0					9																	140952502		2003	4183	6186	SO:0001630	splice_region_variant	774	exon28			CCCAGGGTGCTGA	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4107-1G>C	chr9.hg19:g.140952502G>C		104.0	0.0	.		95.0	33.0	.	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.911067	0.92178	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4;-4.4;-4.4	5.33	5.33	0.75918	.	0.062804	0.64402	D	0.000004	D	0.97501	0.9182	L	0.51853	1.615	0.80722	D	1	B;D;D	0.76494	0.008;0.999;0.999	B;D;D	0.74348	0.016;0.983;0.983	D	0.95747	0.8788	10	0.13108	T	0.6	.	19.4443	0.94840	0.0:0.0:1.0:0.0	.	1370;1371;1370	B1AQK4;B1AQK7;B1AQK6	.;.;.	L	1370;1370;566;1370;1371;1371	ENSP00000360423:V1370L;ENSP00000277551:V1370L;ENSP00000277549:V566L;ENSP00000360414:V1370L;ENSP00000360408:V1371L;ENSP00000360406:V1371L	ENSP00000277549:V566L	V	+	1	0	CACNA1B	140072323	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.725000	0.98778	2.682000	0.91365	0.555000	0.69702	GTG	.	.	.	none		0.567	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	Missense_Mutation
KRTAP5-2	440021	hgsc.bcm.edu	37	11	1619255	1619255	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr11:1619255T>A	ENST00000412090.1	-	1	269	c.226A>T	c.(226-228)Acc>Tcc	p.T76S	KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	76	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCACAGCTGGTGCAGGAACAG	0.677																																					p.T76S		Atlas-SNP	.											KRTAP5-2,NS,malignant_melanoma,0,1	KRTAP5-2	38	.	0			c.A226T						PASS	.						79.0	101.0	94.0					11																	1619255		2202	4299	6501	SO:0001583	missense	440021	exon1			AGCTGGTGCAGGA	AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.226A>T	chr11.hg19:g.1619255T>A	ENSP00000400041:p.Thr76Ser	68.0	1.0	.		46.0	2.0	.	NM_001004325	A9JTZ1	Missense_Mutation	SNP	ENST00000412090.1	hg19	CCDS31331.1	.	.	.	.	.	.	.	.	.	.	N	7.373	0.627221	0.14257	.	.	ENSG00000205867	ENST00000412090	T	0.00603	6.28	2.65	-0.183	0.13284	.	.	.	.	.	T	0.00178	0.0005	N	0.00210	-1.845	0.09310	N	0.999993	B	0.11235	0.004	B	0.06405	0.002	T	0.34153	-0.9840	9	0.07644	T	0.81	.	3.2935	0.06957	0.5374:0.0:0.1142:0.3484	.	76	Q701N4	KRA52_HUMAN	S	76	ENSP00000400041:T76S	ENSP00000400041:T76S	T	-	1	0	KRTAP5-2	1575831	0.111000	0.22076	0.725000	0.30721	0.572000	0.35998	-0.241000	0.08940	-0.911000	0.03843	-3.088000	0.00065	ACC	.	.	.	none		0.677	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325	
CREB3L1	90993	hgsc.bcm.edu	37	11	46334184	46334184	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr11:46334184C>T	ENST00000529193.1	+	7	1376	c.925C>T	c.(925-927)Cgt>Tgt	p.R309C	CREB3L1_ENST00000288400.3_Missense_Mutation_p.R309C			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	309	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		GGAGAGCCGTCGTAAGAAGAA	0.562			T	FUS	myxofibrosarcoma																																p.R309C	Pancreas(3;159 194 19597 26278 47995)	Atlas-SNP	.		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	.	CREB3L1	30	.	0			c.C925T						PASS	.						39.0	40.0	40.0					11																	46334184		1886	4102	5988	SO:0001583	missense	90993	exon7			AGCCGTCGTAAGA		CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.925C>T	chr11.hg19:g.46334184C>T	ENSP00000434939:p.Arg309Cys	115.0	0.0	.		71.0	29.0	.	NM_052854	Q8N2D5|Q96CP0	Missense_Mutation	SNP	ENST00000529193.1	hg19	CCDS53620.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141715	0.77775	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415;ENST00000530518	T;T;T	0.77358	-1.09;-1.09;-1.09	4.69	4.69	0.59074	Basic-leucine zipper (bZIP) transcription factor (3);Eukaryotic transcription factor, Skn-1-like, DNA-binding (1);bZIP transcription factor, bZIP-1 (1);	0.168110	0.50627	D	0.000103	D	0.90376	0.6988	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.92077	0.5669	10	0.87932	D	0	-9.1036	10.8454	0.46741	0.3258:0.6742:0.0:0.0	.	309	Q96BA8	CR3L1_HUMAN	C	309;309;221;69	ENSP00000434939:R309C;ENSP00000288400:R309C;ENSP00000436574:R69C	ENSP00000288400:R309C	R	+	1	0	CREB3L1	46290760	0.997000	0.39634	1.000000	0.80357	0.970000	0.65996	3.088000	0.50175	2.439000	0.82584	0.462000	0.41574	CGT	.	.	.	none		0.562	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854	
NXF1	10482	hgsc.bcm.edu	37	11	62563986	62563986	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr11:62563986T>C	ENST00000532297.1	-	15	1861	c.1232A>G	c.(1231-1233)cAt>cGt	p.H411R	NXF1_ENST00000294172.2_Missense_Mutation_p.H411R|NXF1_ENST00000533048.1_5'UTR|NXF1_ENST00000531709.2_3'UTR			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	411	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGCCCCATCATGGTAGGCATC	0.517																																					p.H411R		Atlas-SNP	.											.	NXF1	67	.	0			c.A1232G						PASS	.						113.0	112.0	112.0					11																	62563986		2201	4299	6500	SO:0001583	missense	10482	exon14			CCATCATGGTAGG	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.1232A>G	chr11.hg19:g.62563986T>C	ENSP00000436679:p.His411Arg	113.0	0.0	.		87.0	38.0	.	NM_006362	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	hg19	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.552072	0.86127	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875	T;T;T	0.66638	-0.22;-0.22;-0.22	5.11	5.11	0.69529	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.000000	0.85682	D	0.000000	D	0.84224	0.5425	M	0.91561	3.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86541	0.1828	10	0.49607	T	0.09	-27.1453	12.906	0.58152	0.0:0.0:0.0:1.0	.	454;411	E9PIN3;Q9UBU9	.;NXF1_HUMAN	R	411;411;454	ENSP00000294172:H411R;ENSP00000436679:H411R;ENSP00000435742:H454R	ENSP00000294172:H411R	H	-	2	0	NXF1	62320562	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.548000	0.82154	2.159000	0.67721	0.443000	0.29094	CAT	.	.	.	none		0.517	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
CTSC	1075	hgsc.bcm.edu	37	11	88070840	88070840	+	Start_Codon_SNP	SNP	T	T	C			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr11:88070840T>C	ENST00000227266.5	-	1	115	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	CTSC_ENST00000529974.1_Start_Codon_SNP_p.M1V|CTSC_ENST00000524463.1_Start_Codon_SNP_p.M1V|CTSC_ENST00000393301.4_5'UTR	NM_001814.4	NP_001805	P53634	CATC_HUMAN	cathepsin C	1					aging (GO:0007568)|immune response (GO:0006955)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of proteolysis involved in cellular protein catabolic process (GO:1903052)|proteolysis (GO:0006508)|response to organic substance (GO:0010033)|T cell mediated cytotoxicity (GO:0001913)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	chaperone binding (GO:0051087)|chloride ion binding (GO:0031404)|cysteine-type peptidase activity (GO:0008234)|peptidase activator activity involved in apoptotic process (GO:0016505)|phosphatase binding (GO:0019902)|serine-type endopeptidase activity (GO:0004252)			large_intestine(7)|lung(8)|ovary(2)|prostate(3)|skin(2)	22		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCAGCACCCATGCTGCAGGGA	0.637																																					p.M1V		Atlas-SNP	.											.	CTSC	46	.	0			c.A1G						PASS	.						9.0	10.0	10.0					11																	88070840		2186	4272	6458	SO:0001582	initiator_codon_variant	1075	exon1			CACCCATGCTGCA	AK223038	CCDS8282.1, CCDS31654.1, CCDS44693.1	11q14.2	2014-09-17			ENSG00000109861	ENSG00000109861	3.4.14.1	"""Cathepsins"""	2528	protein-coding gene	gene with protein product	"""dipeptidyl peptidase 1"""	602365		PLS, PALS		7649281, 9092576	Standard	NM_148170		Approved	DPP1	uc001pck.4	P53634	OTTHUMG00000167290	ENST00000227266.5:c.1A>G	chr11.hg19:g.88070840T>C	ENSP00000227266:p.Met1Val	81.0	0.0	.		66.0	22.0	.	NM_148170	A8K7V2|B5MDD5|Q2HIY8|Q53G93|Q71E75|Q71E76|Q7M4N9|Q7Z3G7|Q7Z5U7|Q8WY99|Q8WYA7|Q8WYA8	Missense_Mutation	SNP	ENST00000227266.5	hg19	CCDS8282.1	.	.	.	.	.	.	.	.	.	.	T	11.20	1.567889	0.28003	.	.	ENSG00000109861	ENST00000393302;ENST00000227266;ENST00000524463;ENST00000529974	T	0.69306	-0.39	4.71	4.71	0.59529	.	2.712470	0.01033	N	0.004170	T	0.56688	0.2002	.	.	.	0.80722	D	1	B;B;B	0.32573	0.259;0.376;0.012	B;B;B	0.25140	0.026;0.058;0.008	T	0.20974	-1.0259	8	.	.	.	.	11.9914	0.53178	0.0:0.0:0.0:1.0	.	1;1;1	Q2HIY8;P53634-2;P53634	.;.;CATC_HUMAN	V	1	ENSP00000227266:M1V	.	M	-	1	0	CTSC	87710488	1.000000	0.71417	0.916000	0.36221	0.145000	0.21501	1.841000	0.39240	1.879000	0.54435	0.459000	0.35465	ATG	.	.	.	none		0.637	CTSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394019.2	NM_001814	Missense_Mutation
PKP2	5318	hgsc.bcm.edu	37	12	33003716	33003716	+	Silent	SNP	A	A	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr12:33003716A>T	ENST00000070846.6	-	5	1386	c.1362T>A	c.(1360-1362)acT>acA	p.T454T	PKP2_ENST00000340811.4_Silent_p.T454T	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	454					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TTTGTTTTTTAGTCTCCAAGT	0.418																																					p.T454T		Atlas-SNP	.											.	PKP2	110	.	0			c.T1362A						PASS	.						135.0	132.0	133.0					12																	33003716		2203	4300	6503	SO:0001819	synonymous_variant	5318	exon5			TTTTTTAGTCTCC	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1362T>A	chr12.hg19:g.33003716A>T		66.0	0.0	.		63.0	14.0	.	NM_004572	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Silent	SNP	ENST00000070846.6	hg19	CCDS8731.1																																																																																			.	.	.	none		0.418	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572	
UBC	7316	hgsc.bcm.edu	37	12	125397821	125397821	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr12:125397821G>A	ENST00000536769.1	-	1	2073	c.497C>T	c.(496-498)aCc>aTc	p.T166I	UBC_ENST00000538617.1_Intron|UBC_ENST00000546120.1_Intron|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000339647.5_Missense_Mutation_p.T166I|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	166	Ubiquitin-like 3. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CACCTCGAGGGTGATGGTCTT	0.517																																					p.T166I		Atlas-SNP	.											.	UBC	79	.	0			c.C497T						PASS	.						169.0	168.0	169.0					12																	125397821		2203	4298	6501	SO:0001583	missense	7316	exon2			TCGAGGGTGATGG		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.497C>T	chr12.hg19:g.125397821G>A	ENSP00000441543:p.Thr166Ile	169.0	0.0	.		161.0	7.0	.	NM_021009	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000536769.1	hg19	CCDS9260.1	.	.	.	.	.	.	.	.	.	.	-	17.15	3.316028	0.60524	.	.	ENSG00000150991	ENST00000536769;ENST00000535460;ENST00000339647	T;T	0.75477	-0.94;-0.94	3.91	3.91	0.45181	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.49305	U	0.000150	D	0.86879	0.6039	M	0.85041	2.73	0.80722	D	1	D;D;D	0.65815	0.995;0.994;0.995	D;D;D	0.87578	0.998;0.975;0.998	D	0.89541	0.3792	10	0.87932	D	0	.	14.8482	0.70275	0.0:0.0:1.0:0.0	.	255;166;166	Q66K58;F5H7K6;P0CG48	.;.;UBC_HUMAN	I	166	ENSP00000441543:T166I;ENSP00000344818:T166I	ENSP00000344818:T166I	T	-	2	0	UBC	123963774	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	8.136000	0.89610	1.897000	0.54924	0.555000	0.69702	ACC	.	.	.	none		0.517	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400177.1	NM_021009	
TMTC4	84899	hgsc.bcm.edu	37	13	101287287	101287287	+	Silent	SNP	G	G	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr13:101287287G>T	ENST00000376234.3	-	10	1497	c.1308C>A	c.(1306-1308)acC>acA	p.T436T	TMTC4_ENST00000328767.5_Silent_p.T325T|TMTC4_ENST00000342624.5_Silent_p.T455T|TMTC4_ENST00000462211.1_5'UTR	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	436						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCTTTTTCTTGGTATGTTTGC	0.502																																					p.T455T		Atlas-SNP	.											.	TMTC4	103	.	0			c.C1365A						PASS	.						86.0	81.0	82.0					13																	101287287		2203	4300	6503	SO:0001819	synonymous_variant	84899	exon11			TTTCTTGGTATGT		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1308C>A	chr13.hg19:g.101287287G>T		97.0	0.0	.		89.0	38.0	.	NM_032813	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Silent	SNP	ENST00000376234.3	hg19	CCDS41904.1																																																																																			.	.	.	none		0.502	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
SLC7A7	9056	hgsc.bcm.edu	37	14	23240318	23240318	+	IGR	SNP	T	T	C			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr14:23240318T>C	ENST00000397532.3	-	0	2447				OXA1L_ENST00000412791.1_Missense_Mutation_p.I344T|OXA1L_ENST00000285848.5_Missense_Mutation_p.I404T|SLC7A7_ENST00000554061.1_5'Flank|OXA1L_ENST00000604262.1_Missense_Mutation_p.I344T|OXA1L_ENST00000358043.5_Missense_Mutation_p.I328T			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		GTACTTAAAATCCCCCAGCGT	0.488																																					p.I404T		Atlas-SNP	.											.	OXA1L	49	.	0			c.T1211C						PASS	.						117.0	104.0	108.0					14																	23240318		2203	4300	6503	SO:0001628	intergenic_variant	5018	exon8			TTAAAATCCCCCA	AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692		chr14.hg19:g.23240318T>C		135.0	0.0	.		84.0	36.0	.	NM_005015	B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Missense_Mutation	SNP	ENST00000397532.3	hg19	CCDS9574.1	.	.	.	.	.	.	.	.	.	.	T	16.12	3.034342	0.54896	.	.	ENSG00000155463	ENST00000285848;ENST00000412791;ENST00000358043	T;T;T	0.42900	0.96;1.05;0.98	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.67449	0.2894	M	0.82630	2.6	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.987;0.991;0.975	T	0.72959	-0.4133	10	0.87932	D	0	-21.7899	14.954	0.71098	0.0:0.0:0.0:1.0	.	344;344;404	E7EVY0;Q15070;Q2M1J6	.;OXA1L_HUMAN;.	T	404;344;328	ENSP00000285848:I404T;ENSP00000387601:I344T;ENSP00000350740:I328T	ENSP00000285848:I404T	I	+	2	0	OXA1L	22310158	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	6.496000	0.73670	2.162000	0.67917	0.496000	0.49642	ATC	.	.	.	none		0.488	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3		
IPO4	79711	hgsc.bcm.edu	37	14	24656090	24656090	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr14:24656090G>T	ENST00000354464.6	-	8	926	c.750C>A	c.(748-750)tgC>tgA	p.C250*	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	250					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		TCACCTCCAGGCAGAATGTGA	0.552																																					p.C250X		Atlas-SNP	.											.	IPO4	74	.	0			c.C750A						PASS	.						56.0	62.0	60.0					14																	24656090		2120	4256	6376	SO:0001587	stop_gained	79711	exon8			CTCCAGGCAGAAT	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.750C>A	chr14.hg19:g.24656090G>T	ENSP00000346453:p.Cys250*	89.0	0.0	.		65.0	17.0	.	NM_024658	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Nonsense_Mutation	SNP	ENST00000354464.6	hg19	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	G	36	5.871003	0.97049	.	.	ENSG00000196497	ENST00000354464	.	.	.	4.96	4.07	0.47477	.	0.117958	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.6276	10.7129	0.45995	0.0895:0.0:0.9105:0.0	.	.	.	.	X	250	.	ENSP00000346453:C250X	C	-	3	2	IPO4	23725930	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.957000	0.49137	1.454000	0.47793	0.655000	0.94253	TGC	.	.	.	none		0.552	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
SERPINA5	5104	hgsc.bcm.edu	37	14	95053705	95053705	+	Silent	SNP	G	G	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr14:95053705G>A	ENST00000554866.1	+	2	120	c.6G>A	c.(4-6)caG>caA	p.Q2Q	SERPINA5_ENST00000329597.7_Silent_p.Q2Q|SERPINA5_ENST00000554276.1_Silent_p.Q2Q|SERPINA5_ENST00000553780.1_Silent_p.Q2Q			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	2					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	CCACCATGCAGCTCTTCCTCC	0.587																																					p.Q2Q		Atlas-SNP	.											.	SERPINA5	69	.	0			c.G6A						PASS	.						80.0	89.0	86.0					14																	95053705		2203	4300	6503	SO:0001819	synonymous_variant	5104	exon3			CATGCAGCTCTTC	M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.6G>A	chr14.hg19:g.95053705G>A		24.0	0.0	.		22.0	10.0	.	NM_000624	Q07616|Q9UG30	Silent	SNP	ENST00000554866.1	hg19	CCDS9928.1																																																																																			.	.	.	none		0.587	SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410726.1	NM_000624	
CLEC16A	23274	hgsc.bcm.edu	37	16	11214588	11214588	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr16:11214588G>T	ENST00000409790.1	+	20	2463	c.2233G>T	c.(2233-2235)Ggc>Tgc	p.G745C	CLEC16A_ENST00000465491.1_3'UTR|CLEC16A_ENST00000409552.3_Missense_Mutation_p.G727C	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GTCCAGGCTTGGCTGGGGAGT	0.527																																					p.G745C		Atlas-SNP	.											.	CLEC16A	101	.	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)	c.G2233T						PASS	.						112.0	115.0	114.0					16																	11214588		2054	4203	6257	SO:0001583	missense	23274	exon19			AGGCTTGGCTGGG	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.2233G>T	chr16.hg19:g.11214588G>T	ENSP00000387122:p.Gly745Cys	73.0	0.0	.		92.0	4.0	.	NM_015226		Missense_Mutation	SNP	ENST00000409790.1	hg19	CCDS45409.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592315	0.86953	.	.	ENSG00000038532	ENST00000409790;ENST00000542102;ENST00000409552	T	0.65549	-0.16	5.58	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.80099	0.4561	M	0.83118	2.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.971	T	0.83060	-0.0148	10	0.87932	D	0	-26.9241	14.9754	0.71267	0.0:0.0:0.8573:0.1427	.	745;727	Q2KHT3;Q2KHT3-2	CL16A_HUMAN;.	C	745;745;727	ENSP00000387122:G745C	ENSP00000386495:G727C	G	+	1	0	CLEC16A	11122089	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.516000	0.81772	2.640000	0.89533	0.561000	0.74099	GGC	.	.	.	none		0.527	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226	
NT5M	56953	hgsc.bcm.edu	37	17	17209883	17209883	+	Silent	SNP	A	A	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr17:17209883A>T	ENST00000389022.4	+	2	510	c.294A>T	c.(292-294)tcA>tcT	p.S98S		NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial	98					dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						TTTGGGAGTCAAAGAATTTCT	0.507																																					p.S98S		Atlas-SNP	.											.	NT5M	17	.	0			c.A294T						PASS	.						147.0	155.0	152.0					17																	17209883		2203	4300	6503	SO:0001819	synonymous_variant	56953	exon2			GGAGTCAAAGAAT	AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.294A>T	chr17.hg19:g.17209883A>T		65.0	0.0	.		68.0	15.0	.	NM_020201		Silent	SNP	ENST00000389022.4	hg19	CCDS32581.1																																																																																			.	.	.	none		0.507	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446045.1		
TBX21	30009	hgsc.bcm.edu	37	17	45822561	45822561	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr17:45822561G>C	ENST00000177694.1	+	6	1648	c.1437G>C	c.(1435-1437)gaG>gaC	p.E479D		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	479					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						TGTGGACTGAGATTGCCCCCA	0.642																																					p.E479D		Atlas-SNP	.											.	TBX21	50	.	0			c.G1437C						PASS	.						42.0	43.0	43.0					17																	45822561		2203	4300	6503	SO:0001583	missense	30009	exon6			GACTGAGATTGCC	AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.1437G>C	chr17.hg19:g.45822561G>C	ENSP00000177694:p.Glu479Asp	71.0	0.0	.		87.0	43.0	.	NM_013351		Missense_Mutation	SNP	ENST00000177694.1	hg19	CCDS11514.1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.581500	0.28180	.	.	ENSG00000073861	ENST00000177694	D	0.87179	-2.22	4.65	-0.982	0.10266	.	0.577561	0.17764	N	0.162817	T	0.76069	0.3936	L	0.47016	1.485	0.42346	D	0.99235	B	0.10296	0.003	B	0.10450	0.005	T	0.59768	-0.7392	10	0.29301	T	0.29	.	0.7332	0.00961	0.2942:0.1842:0.3602:0.1614	.	479	Q9UL17	TBX21_HUMAN	D	479	ENSP00000177694:E479D	ENSP00000177694:E479D	E	+	3	2	TBX21	43177560	0.955000	0.32602	0.856000	0.33681	0.903000	0.53119	-0.086000	0.11233	-0.012000	0.14223	-0.137000	0.14449	GAG	.	.	.	none		0.642	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
ABCC3	8714	hgsc.bcm.edu	37	17	48755182	48755182	+	Silent	SNP	G	G	A	rs142831476		TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr17:48755182G>A	ENST00000285238.8	+	24	3536	c.3456G>A	c.(3454-3456)tcG>tcA	p.S1152S		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1152	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CCCACTTTTCGGAGACAGTGA	0.542																																					p.S1152S		Atlas-SNP	.											.	ABCC3	138	.	0			c.G3456A						PASS	.	G		1,4405	2.1+/-5.4	0,1,2202	134.0	137.0	136.0		3456	-0.4	1.0	17	dbSNP_134	136	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ABCC3	NM_003786.3		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		1152/1528	48755182	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	8714	exon24			CTTTTCGGAGACA	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.3456G>A	chr17.hg19:g.48755182G>A		97.0	0.0	.		130.0	40.0	.	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Silent	SNP	ENST00000285238.8	hg19	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307492	0.23821	2.27E-4	1.16E-4	ENSG00000108846	ENST00000513745	.	.	.	5.7	-0.425	0.12317	.	.	.	.	.	T	0.40015	0.1100	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28650	-1.0037	4	.	.	.	-6.2185	1.0684	0.01616	0.2099:0.2093:0.361:0.2199	.	.	.	.	R	256	.	.	G	+	1	0	ABCC3	46110181	0.079000	0.21365	0.999000	0.59377	0.994000	0.84299	-0.672000	0.05244	0.340000	0.23745	0.655000	0.94253	GGA	.	G|1.000;A|0.000	0.000	weak		0.542	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
MED13	9969	hgsc.bcm.edu	37	17	60112944	60112944	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr17:60112944A>G	ENST00000397786.2	-	4	572	c.496T>C	c.(496-498)Ttt>Ctt	p.F166L	Y_RNA_ENST00000363972.1_RNA	NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	166					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TGCAAGAAAAAGGTGAAGGAG	0.373																																					p.F166L		Atlas-SNP	.											.	MED13	181	.	0			c.T496C						PASS	.						90.0	81.0	84.0					17																	60112944		1896	4123	6019	SO:0001583	missense	9969	exon4			AGAAAAAGGTGAA	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.496T>C	chr17.hg19:g.60112944A>G	ENSP00000380888:p.Phe166Leu	62.0	0.0	.		79.0	4.0	.	NM_005121	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	hg19	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	A	32	5.162757	0.94727	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.80653	-1.4	5.33	5.33	0.75918	Mediator complex, subunit Med13, N-terminal, metazoa/fungi (1);	0.000000	0.85682	D	0.000000	D	0.90721	0.7088	M	0.87381	2.88	0.80722	D	1	D	0.63046	0.992	D	0.76071	0.987	D	0.92397	0.5926	10	0.87932	D	0	-7.7639	15.5854	0.76479	1.0:0.0:0.0:0.0	.	166	Q9UHV7	MED13_HUMAN	L	166;165	ENSP00000380888:F166L	ENSP00000262436:F165L	F	-	1	0	MED13	57467726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.867000	0.92314	2.139000	0.66308	0.482000	0.46254	TTT	.	.	.	none		0.373	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
SLC44A2	57153	hgsc.bcm.edu	37	19	10738606	10738606	+	Silent	SNP	T	T	C	rs376552555		TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr19:10738606T>C	ENST00000335757.5	+	4	547	c.171T>C	c.(169-171)caT>caC	p.H57H	SLC44A2_ENST00000407327.4_Silent_p.H55H|SLC44A2_ENST00000586078.1_Silent_p.H57H			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	57					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	CCTGGACTCATGGAGACCCTC	0.597																																					p.H57H		Atlas-SNP	.											.	SLC44A2	56	.	0			c.T171C						PASS	.	T	,	0,4406		0,0,2203	72.0	62.0	66.0		165,171	-4.8	0.9	19		66	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SLC44A2	NM_001145056.1,NM_020428.3	,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,	55/705,57/707	10738606	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57153	exon4			GACTCATGGAGAC	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.171T>C	chr19.hg19:g.10738606T>C		188.0	0.0	.		125.0	49.0	.	NM_020428	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Silent	SNP	ENST00000335757.5	hg19	CCDS12245.1																																																																																			.	.	.	weak		0.597	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
OR10H2	26538	hgsc.bcm.edu	37	19	15838984	15838984	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr19:15838984T>G	ENST00000305899.3	+	1	151	c.131T>G	c.(130-132)cTc>cGc	p.L44R		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					GGCAACCTGCTCATCATGGCC	0.592																																					p.L44R		Atlas-SNP	.											.	OR10H2	59	.	0			c.T131G						PASS	.						210.0	173.0	186.0					19																	15838984		2203	4297	6500	SO:0001583	missense	26538	exon1			ACCTGCTCATCAT	AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.131T>G	chr19.hg19:g.15838984T>G	ENSP00000306095:p.Leu44Arg	92.0	0.0	.		95.0	41.0	.	NM_013939	Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	hg19	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	16.26	3.074499	0.55646	.	.	ENSG00000171942	ENST00000305899	T	0.02863	4.13	2.88	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	D	0.000469	T	0.17577	0.0422	H	0.94306	3.52	0.35461	D	0.796538	D	0.59357	0.985	D	0.65233	0.933	T	0.22521	-1.0214	10	0.87932	D	0	.	8.94	0.35725	0.0:0.0:0.0:1.0	.	44	O60403	O10H2_HUMAN	R	44	ENSP00000306095:L44R	ENSP00000306095:L44R	L	+	2	0	OR10H2	15699984	0.001000	0.12720	1.000000	0.80357	0.961000	0.63080	0.586000	0.23894	1.186000	0.42985	0.438000	0.28831	CTC	.	.	.	none		0.592	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
HAMP	57817	hgsc.bcm.edu	37	19	35775707	35775707	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr19:35775707G>T	ENST00000598398.1	+	3	402	c.106G>T	c.(106-108)Gag>Tag	p.E36*	HAMP_ENST00000222304.3_Nonsense_Mutation_p.E36*	NM_021175.2	NP_066998.1	P81172	HEPC_HUMAN	hepcidin antimicrobial peptide	36					cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|immune response (GO:0006955)|killing of cells of other organism (GO:0031640)	apical cortex (GO:0045179)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ACAACTTGCAGAGCTGCAACC	0.632																																					p.E36X		Atlas-SNP	.											.	HAMP	14	.	0			c.G106T						PASS	.						81.0	79.0	80.0					19																	35775707		2203	4300	6503	SO:0001587	stop_gained	57817	exon2			CTTGCAGAGCTGC	AF309489	CCDS12454.1	19q13.1	2014-09-17				ENSG00000105697			15598	protein-coding gene	gene with protein product		606464				11034317, 11113132	Standard	NM_021175		Approved	LEAP-1, HEPC, HFE2B, LEAP1	uc002nyw.3	P81172		ENST00000598398.1:c.106G>T	chr19.hg19:g.35775707G>T	ENSP00000471894:p.Glu36*	90.0	0.0	.		80.0	20.0	.	NM_021175	Q1HE14|Q9BY68	Nonsense_Mutation	SNP	ENST00000598398.1	hg19	CCDS12454.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825924	0.50739	.	.	ENSG00000105697	ENST00000222304	.	.	.	4.51	4.51	0.55191	.	0.875034	0.09823	N	0.751245	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-6.4081	12.6114	0.56554	0.0:0.0:1.0:0.0	.	.	.	.	X	36	.	ENSP00000222304:E36X	E	+	1	0	HAMP	40467547	0.001000	0.12720	0.009000	0.14445	0.004000	0.04260	0.677000	0.25262	2.348000	0.79779	0.561000	0.74099	GAG	.	.	.	none		0.632	HAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466067.1	NM_021175	
MYH7B	57644	hgsc.bcm.edu	37	20	33586408	33586408	+	Silent	SNP	G	G	T			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr20:33586408G>T	ENST00000262873.7	+	32	4187	c.4095G>T	c.(4093-4095)cgG>cgT	p.R1365R		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1323						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			AAGAGTTGCGGCGCCAGCTAG	0.632																																					p.R1365R		Atlas-SNP	.											MYH7B,NS,adenocarcinoma,0,1	MYH7B	145	.	0			c.G4095T						PASS	.						32.0	37.0	36.0					20																	33586408		2075	4214	6289	SO:0001819	synonymous_variant	57644	exon34			GTTGCGGCGCCAG	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.4095G>T	chr20.hg19:g.33586408G>T		49.0	0.0	.		33.0	15.0	.	NM_020884	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Silent	SNP	ENST00000262873.7	hg19	CCDS42869.1																																																																																			.	.	.	none		0.632	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
SLCO4A1	28231	hgsc.bcm.edu	37	20	61299155	61299155	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr20:61299155C>A	ENST00000370507.1	+	7	1627	c.1531C>A	c.(1531-1533)Cag>Aag	p.Q511K	RP11-93B14.5_ENST00000451648.1_RNA|RP11-93B14.5_ENST00000411824.1_RNA|SLCO4A1_ENST00000217159.1_Missense_Mutation_p.Q511K|RP11-93B14.5_ENST00000433126.1_RNA|SLCO4A1_ENST00000470412.1_3'UTR			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	511	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CTGCAGCTGCCAGCCAGAACA	0.652																																					p.Q511K	Pancreas(168;741 2006 10379 40139 45334)	Atlas-SNP	.											.	SLCO4A1	65	.	0			c.C1531A						PASS	.						68.0	66.0	66.0					20																	61299155		2203	4300	6503	SO:0001583	missense	28231	exon8			AGCTGCCAGCCAG	AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1531C>A	chr20.hg19:g.61299155C>A	ENSP00000359538:p.Gln511Lys	111.0	0.0	.		75.0	29.0	.	NM_016354	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	ENST00000370507.1	hg19	CCDS13501.1	.	.	.	.	.	.	.	.	.	.	C	0.994	-0.692948	0.03303	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507;ENST00000342674	T;T	0.04083	3.71;3.71	5.06	2.0	0.26442	Proteinase inhibitor I1, Kazal (1);Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Protease inhibitor, Kazal-type (1);	1.148120	0.06393	N	0.717436	T	0.03959	0.0111	L	0.33245	0.995	0.09310	N	0.999998	B	0.06786	0.001	B	0.12156	0.007	T	0.47315	-0.9127	10	0.06099	T	0.92	.	5.8255	0.18550	0.0:0.5806:0.1286:0.2908	.	511	Q96BD0	SO4A1_HUMAN	K	511;511;511;363	ENSP00000217159:Q511K;ENSP00000359538:Q511K	ENSP00000217159:Q511K	Q	+	1	0	SLCO4A1	60769600	0.000000	0.05858	0.157000	0.22605	0.015000	0.08874	-0.466000	0.06672	0.143000	0.18926	0.655000	0.94253	CAG	.	.	.	none		0.652	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354	
TRIOBP	11078	hgsc.bcm.edu	37	22	38153684	38153684	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr22:38153684G>A	ENST00000406386.3	+	16	6007	c.5752G>A	c.(5752-5754)Gca>Aca	p.A1918T	TRIOBP_ENST00000407319.2_Missense_Mutation_p.A205T|TRIOBP_ENST00000403663.2_Missense_Mutation_p.A205T	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1918					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CCCCCTGAAGGCAGGGGAGCA	0.677																																					p.A1918T		Atlas-SNP	.											.	TRIOBP	262	.	0			c.G5752A						PASS	.						14.0	15.0	14.0					22																	38153684		2184	4289	6473	SO:0001583	missense	11078	exon16			CTGAAGGCAGGGG	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.5752G>A	chr22.hg19:g.38153684G>A	ENSP00000384312:p.Ala1918Thr	41.0	0.0	.		38.0	19.0	.	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	hg19	CCDS43015.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.919|4.919	0.170774|0.170774	0.09391|0.09391	.|.	.|.	ENSG00000100106|ENSG00000100106	ENST00000406386;ENST00000407319;ENST00000403663;ENST00000418339;ENST00000417857|ENST00000428075	T|.	0.20881|.	2.04|.	5.5|5.5	2.09|2.09	0.27110|0.27110	.|.	.|.	.|.	.|.	.|.	T|T	0.34629|0.34629	0.0904|0.0904	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	0.999996|0.999996	B;B;B|.	0.25486|.	0.007;0.04;0.127|.	B;B;B|.	0.19148|.	0.007;0.009;0.024|.	T|T	0.24621|0.24621	-1.0155|-1.0155	9|5	0.15952|.	T|.	0.53|.	.|.	3.9861|3.9861	0.09516|0.09516	0.1377:0.2332:0.5093:0.1199|0.1377:0.2332:0.5093:0.1199	.|.	205;205;1918|.	F8W6V6;F2Z2W0;Q9H2D6|.	.;.;TARA_HUMAN|.	T|D	1918;205;205;164;134|158	ENSP00000384312:A1918T|.	ENSP00000386026:A205T|.	A|G	+|+	1|2	0|0	TRIOBP|TRIOBP	36483630|36483630	0.004000|0.004000	0.15560|0.15560	0.612000|0.612000	0.29024|0.29024	0.312000|0.312000	0.27988|0.27988	-0.063000|-0.063000	0.11655|0.11655	0.652000|0.652000	0.30806|0.30806	-0.315000|-0.315000	0.08773|0.08773	GCA|GGC	.	.	.	none		0.677	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
PNPLA4	8228	hgsc.bcm.edu	37	X	7894062	7894062	+	Silent	SNP	C	C	G			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chrX:7894062C>G	ENST00000381042.4	-	2	269	c.99G>C	c.(97-99)gtG>gtC	p.V33V	PNPLA4_ENST00000444736.1_Silent_p.V33V|PNPLA4_ENST00000537427.1_Intron	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	33	Patatin.				lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TGACATCCTTCACAAGTTTTT	0.458											OREG0019651	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V33V		Atlas-SNP	.											.	PNPLA4	24	.	0			c.G99C						PASS	.						94.0	78.0	84.0					X																	7894062		2203	4299	6502	SO:0001819	synonymous_variant	8228	exon2			ATCCTTCACAAGT	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.99G>C	chrX.hg19:g.7894062C>G		216.0	0.0	.	645	158.0	27.0	.	NM_004650	A8K1H3|B4E362|Q8WW83	Silent	SNP	ENST00000381042.4	hg19	CCDS14129.1																																																																																			.	.	.	none		0.458	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055687.1	NM_004650	
SLC6A6	6533	hgsc.bcm.edu	37	3	14526398	14526417	+	Frame_Shift_Del	DEL	AAGGGAACCCAACCGCTGGG	AAGGGAACCCAACCGCTGGG	-	rs376586731		TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	AAGGGAACCCAACCGCTGGG	AAGGGAACCCAACCGCTGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr3:14526398_14526417delAAGGGAACCCAACCGCTGGG	ENST00000454876.2	+	15	2075_2094	c.1746_1765delAAGGGAACCCAACCGCTGGG	c.(1744-1767)ccaagggaacccaaccgctgggctfs	p.REPNRWA583fs	SLC6A6_ENST00000360861.3_Frame_Shift_Del_p.REPNRWA583fs			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	583					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						TGCTGACCCCAAGGGAACCCAACCGCTGGGCTGTGGAGCG	0.609																																					p.582_588del		Atlas-Indel,Pindel	.											.	SLC6A6	58	.	0			c.1745_1764del						PASS	.																																			SO:0001589	frameshift_variant	6533	exon15			.		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.1746_1765delAAGGGAACCCAACCGCTGGG	chr3.hg19:g.14526398_14526417delAAGGGAACCCAACCGCTGGG	ENSP00000398063:p.Arg583fs	33.0	0.0	0		37.0	10.0	0.27027	NM_003043	B2RNU7|Q9BRI2|Q9BXB0	Frame_Shift_Del	DEL	ENST00000454876.2	hg19	CCDS33705.1																																																																																			.	.	.	none		0.609	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043	
TP53BP2	7159	hgsc.bcm.edu	37	1	223989924	223989924	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr1:223989924delC	ENST00000343537.7	-	9	1410	c.1119delG	c.(1117-1119)gtgfs	p.V373fs	TP53BP2_ENST00000391878.2_Frame_Shift_Del_p.V244fs|TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391879.2_5'Flank	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	367					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GGGCTGGCTTCACCAGCAATT	0.572																																					p.K374fs		Atlas-Indel,Pindel	.											.	TP53BP2	144	.	0			c.1120delA						PASS	.						76.0	77.0	77.0					1																	223989924		2203	4300	6503	SO:0001589	frameshift_variant	7159	exon9			.	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.1119delG	chr1.hg19:g.223989924delC	ENSP00000341957:p.Val373fs	100.0	0.0	0		90.0	26.0	0.288889	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	Frame_Shift_Del	DEL	ENST00000343537.7	hg19	CCDS44319.1																																																																																			.	.	.	none		0.572	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
FRMD3	257019	hgsc.bcm.edu	37	9	86004612	86004615	+	Frame_Shift_Del	DEL	TTTG	TTTG	-	rs145028837		TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	TTTG	TTTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr9:86004612_86004615delTTTG	ENST00000304195.3	-	2	362_365	c.156_159delCAAA	c.(154-159)accaaafs	p.TK52fs	FRMD3_ENST00000376438.1_Frame_Shift_Del_p.TK52fs	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	52	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						GAAACTGCCCTTTGGTTTCCCTCT	0.5																																					p.53_54del		Atlas-Indel,Pindel	.											.	FRMD3	96	.	0			c.157_160del						PASS	.																																			SO:0001589	frameshift_variant	257019	exon2			.	AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.156_159delCAAA	chr9.hg19:g.86004612_86004615delTTTG	ENSP00000303508:p.Thr52fs	109.0	0.0	0		80.0	30.0	0.375	NM_001244959	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Frame_Shift_Del	DEL	ENST00000304195.3	hg19	CCDS43840.1																																																																																			.	.	.	none		0.500	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157355.1	NM_174938	
SPTBN5	51332	hgsc.bcm.edu	37	15	42142086	42142086	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-A772-01A-11D-A33Q-10	TCGA-A4-A772-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e7e4d69c-b66c-4aa5-b7ac-573ab82472ff	280b0962-0e12-4148-b679-dd642d7f0b3e	g.chr15:42142086delG	ENST00000320955.6	-	67	11220	c.10993delC	c.(10993-10995)cggfs	p.R3665fs	RNA5SP393_ENST00000363423.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3665					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CATCCAGGCCGGGCATCCTTG	0.602																																					p.R3630fs		Atlas-Indel,Pindel	.											.	SPTBN5	171	.	0			c.10889delG						PASS	.						56.0	59.0	58.0					15																	42142086		1926	4125	6051	SO:0001589	frameshift_variant	51332	exon67			.	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.10993delC	chr15.hg19:g.42142086delG	ENSP00000317790:p.Arg3665fs	67.0	0.0	0		74.0	31.0	0.418919	NM_016642		Frame_Shift_Del	DEL	ENST00000320955.6	hg19																																																																																				.	.	.	none		0.602	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
