#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MOV10	4343	hgsc.bcm.edu	37	1	113236732	113236732	+	Silent	SNP	C	C	T			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr1:113236732C>T	ENST00000413052.2	+	8	1623	c.1233C>T	c.(1231-1233)atC>atT	p.I411I	MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000357443.2_Silent_p.I411I|MOV10_ENST00000369645.1_Silent_p.I411I|RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000369644.1_Silent_p.I355I	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	411					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		AGGACCCCATCACATATAAGG	0.577																																					p.I411I		Atlas-SNP	.											.	MOV10	74	.	0			c.C1233T						PASS	.						139.0	134.0	136.0					1																	113236732		2203	4300	6503	SO:0001819	synonymous_variant	4343	exon8			CCCCATCACATAT	AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.1233C>T	chr1.hg19:g.113236732C>T		97.0	0.0	.		101.0	26.0	.	NM_020963	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Silent	SNP	ENST00000413052.2	hg19	CCDS853.1																																																																																			.	.	.	none		0.577	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963	
SYCP1	6847	hgsc.bcm.edu	37	1	115488960	115488960	+	Silent	SNP	T	T	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr1:115488960T>C	ENST00000369522.3	+	26	2445	c.2205T>C	c.(2203-2205)taT>taC	p.Y735Y	SYCP1_ENST00000369518.1_Silent_p.Y735Y	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	735					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAGGACTTTATAAGAGCAAAG	0.328																																					p.Y735Y		Atlas-SNP	.											.	SYCP1	149	.	0			c.T2205C						PASS	.						67.0	70.0	69.0					1																	115488960		2203	4300	6503	SO:0001819	synonymous_variant	6847	exon26			ACTTTATAAGAGC	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2205T>C	chr1.hg19:g.115488960T>C		318.0	0.0	.		368.0	98.0	.	NM_003176	O14963|Q5VXJ6	Silent	SNP	ENST00000369522.3	hg19	CCDS879.1																																																																																			.	.	.	none		0.328	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
CFHR5	81494	hgsc.bcm.edu	37	1	196952181	196952181	+	Silent	SNP	A	A	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr1:196952181A>G	ENST00000256785.4	+	2	334	c.225A>G	c.(223-225)gaA>gaG	p.E75E	CFHR5_ENST00000367414.5_Silent_p.E99E			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	75	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						GCACAGAAGAAGGATGGTCAC	0.408																																					p.E75E		Atlas-SNP	.											.	CFHR5	150	.	0			c.A225G						PASS	.						122.0	106.0	111.0					1																	196952181		2203	4300	6503	SO:0001819	synonymous_variant	81494	exon2			AGAAGAAGGATGG	AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.225A>G	chr1.hg19:g.196952181A>G		234.0	0.0	.		209.0	53.0	.	NM_030787	Q2NKK2	Silent	SNP	ENST00000256785.4	hg19	CCDS1387.1																																																																																			.	.	.	none		0.408	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787	
ARHGEF4	50649	hgsc.bcm.edu	37	2	131803640	131803640	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr2:131803640C>A	ENST00000326016.5	+	14	2470	c.1951C>A	c.(1951-1953)Cag>Aag	p.Q651K	ARHGEF4_ENST00000525839.1_3'UTR|ARHGEF4_ENST00000409303.1_Missense_Mutation_p.Q591K|ARHGEF4_ENST00000392953.3_3'UTR|ARHGEF4_ENST00000355771.3_Missense_Mutation_p.Q580K|ARHGEF4_ENST00000428230.2_Missense_Mutation_p.Q153K	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	651					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CCTGACGCGCCAGAAGCACCC	0.677																																					p.Q651K		Atlas-SNP	.											.	ARHGEF4	89	.	0			c.C1951A						PASS	.						52.0	63.0	60.0					2																	131803640		2203	4300	6503	SO:0001583	missense	50649	exon14			ACGCGCCAGAAGC	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.1951C>A	chr2.hg19:g.131803640C>A	ENSP00000316845:p.Gln651Lys	100.0	0.0	.		68.0	19.0	.	NM_015320	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	hg19	CCDS2165.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354512	0.82243	.	.	ENSG00000136002	ENST00000326016;ENST00000438985;ENST00000428230;ENST00000409303;ENST00000355771	T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29	5.71	5.71	0.89125	.	0.059818	0.64402	D	0.000002	T	0.38878	0.1057	M	0.61703	1.905	0.80722	D	1	P;P	0.41420	0.616;0.749	B;B	0.38264	0.199;0.269	T	0.19582	-1.0301	10	0.36615	T	0.2	.	17.337	0.87285	0.0:1.0:0.0:0.0	.	591;651	E9PEM0;Q9NR80	.;ARHG4_HUMAN	K	651;333;153;591;580	ENSP00000316845:Q651K;ENSP00000389661:Q333K;ENSP00000398455:Q153K;ENSP00000387285:Q591K;ENSP00000348017:Q580K	ENSP00000316845:Q651K	Q	+	1	0	ARHGEF4	131520110	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.251000	0.78297	2.700000	0.92200	0.462000	0.41574	CAG	.	.	.	none		0.677	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
IRS1	3667	hgsc.bcm.edu	37	2	227661691	227661691	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr2:227661691T>A	ENST00000305123.5	-	1	2784	c.1764A>T	c.(1762-1764)gaA>gaT	p.E588D	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	588					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		AGGGGTGCATTTCCAGACCCT	0.687											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E588D		Atlas-SNP	.											.	IRS1	141	.	0			c.A1764T						PASS	.						33.0	35.0	34.0					2																	227661691		2203	4299	6502	SO:0001583	missense	3667	exon1			GTGCATTTCCAGA		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1764A>T	chr2.hg19:g.227661691T>A	ENSP00000304895:p.Glu588Asp	48.0	0.0	.	2321	58.0	17.0	.	NM_005544		Missense_Mutation	SNP	ENST00000305123.5	hg19	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	T	0.689	-0.795221	0.02862	.	.	ENSG00000169047	ENST00000305123	T	0.55588	0.51	4.98	-2.09	0.07232	.	0.080047	0.52532	D	0.000061	T	0.18882	0.0453	N	0.02916	-0.46	0.24828	N	0.992544	B	0.19200	0.034	B	0.14023	0.01	T	0.35624	-0.9781	10	0.02654	T	1	-14.305	9.8521	0.41064	0.0:0.5701:0.1155:0.3144	.	588	P35568	IRS1_HUMAN	D	588	ENSP00000304895:E588D	ENSP00000304895:E588D	E	-	3	2	IRS1	227369935	0.067000	0.21026	0.981000	0.43875	0.963000	0.63663	-0.781000	0.04648	-0.222000	0.09958	0.459000	0.35465	GAA	.	.	.	none		0.687	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
MLH1	4292	hgsc.bcm.edu	37	3	37092015	37092015	+	Missense_Mutation	SNP	G	G	T	rs63750978		TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr3:37092015G>T	ENST00000231790.2	+	19	2358	c.2142G>T	c.(2140-2142)tgG>tgT	p.W714C	MLH1_ENST00000539477.1_Missense_Mutation_p.W473C|MLH1_ENST00000536378.1_Intron|MLH1_ENST00000458205.2_Missense_Mutation_p.W473C|MLH1_ENST00000435176.1_Missense_Mutation_p.W616C|MLH1_ENST00000455445.2_Missense_Mutation_p.W473C	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	714					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						CCTGGAAGTGGACTGTGGAAC	0.468		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.W714C		Atlas-SNP	.	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	MLH1	226	.	1	Whole gene deletion(1)	ovary(1)	c.G2142T	GRCh37	CM960977	MLH1	M	rs63750978	PASS	.						106.0	96.0	99.0					3																	37092015		2203	4300	6503	SO:0001583	missense	4292	exon19	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	GAAGTGGACTGTG	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.2142G>T	chr3.hg19:g.37092015G>T	ENSP00000231790:p.Trp714Cys	71.0	0.0	.		65.0	18.0	.	NM_000249	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	hg19	CCDS2663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.5|24.5	4.543467|4.543467	0.86022|0.86022	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000396438;ENST00000456676;ENST00000413740|ENST00000231790;ENST00000383761;ENST00000421440;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176	D|D;D;D;D;D	0.96745|0.93906	-4.11|-3.31;-3.31;-3.31;-3.31;-3.31	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97495|0.97495	0.9180|0.9180	M|M	0.91768|0.91768	3.24|3.24	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.77557	.|0.99;0.977;0.977;0.977;0.983	D|D	0.98012|0.98012	1.0366|1.0366	7|10	0.87932|0.66056	D|D	0|0.02	-9.6335|-9.6335	19.2553|19.2553	0.93944|0.93944	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|616;714;473;714;714	.|E9PCU2;B2R6K0;B4DI13;Q53GX1;P40692	.|.;.;.;.;MLH1_HUMAN	V|C	112;637;110|714;509;132;473;473;473;616	ENSP00000416476:G110V|ENSP00000231790:W714C;ENSP00000402667:W473C;ENSP00000443665:W473C;ENSP00000398272:W473C;ENSP00000402564:W616C	ENSP00000379715:G112V|ENSP00000231790:W714C	G|W	+|+	2|3	0|0	MLH1|MLH1	37067019|37067019	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.572000|9.572000	0.98179|0.98179	2.557000|2.557000	0.86248|0.86248	0.650000|0.650000	0.86243|0.86243	GGA|TGG	.	.	.	alt		0.468	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	
DNAH1	25981	hgsc.bcm.edu	37	3	52397032	52397032	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr3:52397032A>G	ENST00000420323.2	+	32	5377	c.5116A>G	c.(5116-5118)Atg>Gtg	p.M1706V		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1706	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACCCGTGGCCATGATGGTTCC	0.552																																					p.M1706V		Atlas-SNP	.											.	DNAH1	534	.	0			c.A5116G						PASS	.						193.0	198.0	196.0					3																	52397032		2137	4254	6391	SO:0001583	missense	25981	exon32			GTGGCCATGATGG	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5116A>G	chr3.hg19:g.52397032A>G	ENSP00000401514:p.Met1706Val	80.0	0.0	.		96.0	33.0	.	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	hg19	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.439957	0.83885	.	.	ENSG00000114841	ENST00000420323	T	0.36340	1.26	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000003	T	0.65626	0.2709	M	0.88512	2.96	0.58432	D	0.999997	D	0.76494	0.999	D	0.76575	0.988	T	0.73770	-0.3878	10	0.87932	D	0	.	14.7323	0.69391	1.0:0.0:0.0:0.0	.	1706	C9JXH6	.	V	1706	ENSP00000401514:M1706V	ENSP00000401514:M1706V	M	+	1	0	DNAH1	52372072	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.147000	0.71783	2.080000	0.62538	0.533000	0.62120	ATG	.	.	.	none		0.552	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
ANKRD17	26057	hgsc.bcm.edu	37	4	73986056	73986056	+	Splice_Site	SNP	T	T	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr4:73986056T>C	ENST00000358602.4	-	21	3966		c.e21-2		ANKRD17_ENST00000514252.1_Splice_Site|ANKRD17_ENST00000330838.6_Splice_Site|ANKRD17_ENST00000509867.2_Splice_Site	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17						blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAGACCAGTCTAAGTTTAGTG	0.398																																					.		Atlas-SNP	.											.	ANKRD17	214	.	0			c.3097-2A>G						PASS	.						55.0	52.0	53.0					4																	73986056		2203	4300	6503	SO:0001630	splice_region_variant	26057	exon21			CCAGTCTAAGTTT	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.3850-2A>G	chr4.hg19:g.73986056T>C		81.0	0.0	.		92.0	4.0	.	NM_198889	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Splice_Site	SNP	ENST00000358602.4	hg19	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.294121	0.81025	.	.	ENSG00000132466	ENST00000358602;ENST00000330838;ENST00000509867	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9332	0.79683	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRD17	74204920	1.000000	0.71417	0.997000	0.53966	0.839000	0.47603	8.040000	0.89188	2.164000	0.68074	0.477000	0.44152	.	.	.	.	none		0.398	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	Intron
CENPE	1062	hgsc.bcm.edu	37	4	104064497	104064497	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr4:104064497C>G	ENST00000265148.3	-	34	5301	c.5212G>C	c.(5212-5214)Gat>Cat	p.D1738H	CENPE_ENST00000380026.3_Missense_Mutation_p.D1713H	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1738					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.D1738H(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTTAGTTTATCAATAGTTTCT	0.303																																					p.D1738H		Atlas-SNP	.											CENPE,NS,carcinoma,0,1	CENPE	253	.	1	Substitution - Missense(1)	lung(1)	c.G5212C						PASS	.						170.0	169.0	169.0					4																	104064497		2203	4298	6501	SO:0001583	missense	1062	exon34			GTTTATCAATAGT	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5212G>C	chr4.hg19:g.104064497C>G	ENSP00000265148:p.Asp1738His	314.0	1.0	.		351.0	72.0	.	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	hg19	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.706339	0.30232	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.72282	-0.64;-0.64	5.16	3.42	0.39159	.	.	.	.	.	T	0.73289	0.3568	L	0.48642	1.525	0.09310	N	1	D;B	0.57257	0.979;0.376	P;B	0.57911	0.829;0.08	T	0.61317	-0.7087	9	0.56958	D	0.05	.	7.6167	0.28163	0.0:0.8007:0.0:0.1993	.	1713;1738	Q02224-3;Q02224	.;CENPE_HUMAN	H	1738;1738;1713	ENSP00000265148:D1738H;ENSP00000369365:D1713H	ENSP00000265148:D1738H	D	-	1	0	CENPE	104283946	0.000000	0.05858	0.053000	0.19242	0.428000	0.31595	0.140000	0.16056	0.665000	0.31066	0.643000	0.83706	GAT	.	.	.	none		0.303	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
LNPEP	4012	hgsc.bcm.edu	37	5	96315035	96315035	+	Silent	SNP	G	G	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr5:96315035G>A	ENST00000231368.5	+	2	905	c.213G>A	c.(211-213)gaG>gaA	p.E71E	LNPEP_ENST00000395770.3_Silent_p.E57E	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	71					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		AGGATTATGAGTCATCAGCAA	0.547																																					p.E71E		Atlas-SNP	.											.	LNPEP	80	.	0			c.G213A						PASS	.						77.0	82.0	80.0					5																	96315035		2203	4300	6503	SO:0001819	synonymous_variant	4012	exon2			TTATGAGTCATCA	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.213G>A	chr5.hg19:g.96315035G>A		121.0	0.0	.		96.0	26.0	.	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Silent	SNP	ENST00000231368.5	hg19	CCDS4087.1																																																																																			.	.	.	none		0.547	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
LVRN	206338	hgsc.bcm.edu	37	5	115350221	115350221	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr5:115350221A>C	ENST00000357872.4	+	16	2571	c.2447A>C	c.(2446-2448)aAt>aCt	p.N816T	AQPEP_ENST00000515454.1_3'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		816						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										CATCCAGAAAATGAGTAAGAG	0.388																																					p.N816T		Atlas-SNP	.											.	.	.	.	0			c.A2447C						PASS	.						88.0	84.0	85.0					5																	115350221		2202	4300	6502	SO:0001583	missense	0	exon16			CAGAAAATGAGTA																												ENST00000357872.4:c.2447A>C	chr5.hg19:g.115350221A>C	ENSP00000350541:p.Asn816Thr	66.0	0.0	.		57.0	19.0	.	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	hg19	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	A	5.191	0.220737	0.09863	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.05447	3.44	5.37	1.42	0.22433	.	0.797068	0.10818	N	0.630826	T	0.06371	0.0164	L	0.42686	1.345	0.19300	N	0.999976	B	0.10296	0.003	B	0.10450	0.005	T	0.32561	-0.9902	10	0.54805	T	0.06	.	5.9133	0.19041	0.575:0.3337:0.0914:0.0	.	816	Q6Q4G3	AMPQ_HUMAN	T	816;805	ENSP00000350541:N816T	ENSP00000350541:N816T	N	+	2	0	AC010282.1	115378120	0.768000	0.28519	0.784000	0.31847	0.077000	0.17291	1.419000	0.34793	0.851000	0.35264	0.482000	0.46254	AAT	.	.	.	none		0.388	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
BTN3A1	11119	hgsc.bcm.edu	37	6	26411792	26411792	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr6:26411792A>G	ENST00000289361.6	+	9	1369	c.1001A>G	c.(1000-1002)aAg>aGg	p.K334R	BTN3A1_ENST00000425234.2_Missense_Mutation_p.K334R|BTN3A1_ENST00000476549.2_Missense_Mutation_p.K334R|BTN3A1_ENST00000414912.2_Missense_Mutation_p.K282R	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	334	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						GAATGGAAAAAGGCCCTCTTC	0.438																																					p.K334R		Atlas-SNP	.											.	BTN3A1	80	.	0			c.A1001G						PASS	.						185.0	156.0	166.0					6																	26411792		2203	4300	6503	SO:0001583	missense	11119	exon9			GGAAAAAGGCCCT	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.1001A>G	chr6.hg19:g.26411792A>G	ENSP00000289361:p.Lys334Arg	105.0	0.0	.		92.0	4.0	.	NM_007048	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	hg19	CCDS4608.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.703738	0.00096	.	.	ENSG00000026950	ENST00000476549;ENST00000289361;ENST00000425234;ENST00000414912	T;T;T;T	0.60424	3.8;0.19;3.71;0.19	1.32	-2.63	0.06133	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.11495	0.0280	N	0.26130	0.795	0.09310	N	1	B;B;B;B	0.13145	0.0;0.007;0.002;0.0	B;B;B;B	0.12156	0.001;0.007;0.003;0.001	T	0.23440	-1.0188	9	0.08837	T	0.75	.	2.5592	0.04768	0.3119:0.2317:0.0:0.4564	.	282;334;334;334	E9PGB4;O00481-3;O00481-2;O00481	.;.;.;BT3A1_HUMAN	R	334;334;334;282	ENSP00000420010:K334R;ENSP00000289361:K334R;ENSP00000396684:K334R;ENSP00000406667:K282R	ENSP00000289361:K334R	K	+	2	0	BTN3A1	26519771	0.003000	0.15002	0.001000	0.08648	0.050000	0.14768	-2.542000	0.00935	-1.617000	0.01570	-1.416000	0.01114	AAG	.	.	.	none		0.438	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		
OR2J2	26707	hgsc.bcm.edu	37	6	29141971	29141971	+	Missense_Mutation	SNP	C	C	T	rs371365216		TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr6:29141971C>T	ENST00000377167.2	+	1	661	c.559C>T	c.(559-561)Cgt>Tgt	p.R187C		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						AGCACTTCTGCGTTTATCATG	0.443																																					p.R187C		Atlas-SNP	.											.	OR2J2	51	.	0			c.C559T						PASS	.	C	CYS/ARG	1,3883		0,1,1941	171.0	149.0	156.0		559	-4.2	0.0	6		156	0,8302		0,0,4151	no	missense	OR2J2	NM_030905.2	180	0,1,6092	TT,TC,CC		0.0,0.0257,0.0082	probably-damaging	187/313	29141971	1,12185	1942	4151	6093	SO:0001583	missense	26707	exon1			CTTCTGCGTTTAT		CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.559C>T	chr6.hg19:g.29141971C>T	ENSP00000366372:p.Arg187Cys	172.0	0.0	.		188.0	27.0	.	NM_030905	A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	ENST00000377167.2	hg19	CCDS43434.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.328083	0.24080	2.57E-4	0.0	ENSG00000204700	ENST00000377167	T	0.00158	8.65	2.3	-4.17	0.03857	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	L	0.53671	1.685	0.09310	N	1	D	0.65815	0.995	D	0.63192	0.912	T	0.49293	-0.8955	9	0.87932	D	0	.	1.8745	0.03215	0.4347:0.2998:0.1449:0.1206	.	187	O76002	OR2J2_HUMAN	C	187	ENSP00000366372:R187C	ENSP00000366372:R187C	R	+	1	0	OR2J2	29249950	0.000000	0.05858	0.015000	0.15790	0.438000	0.31896	-1.750000	0.01822	-0.693000	0.05121	0.205000	0.17691	CGT	.	.	.	weak		0.443	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2		
GJB7	375519	hgsc.bcm.edu	37	6	87994224	87994224	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr6:87994224A>G	ENST00000525899.1	-	3	752	c.407T>C	c.(406-408)aTt>aCt	p.I136T	GJB7_ENST00000296882.3_Missense_Mutation_p.I136T	NM_198568.2	NP_940970.1	Q6PEY0	CXB7_HUMAN	gap junction protein, beta 7, 25kDa	136					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)	5		all_cancers(76;1.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;7.38e-10)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00323)		BRCA - Breast invasive adenocarcinoma(108;0.0167)		AAGGAAGCCAATTTCAAAACC	0.403																																					p.I136T		Atlas-SNP	.											.	GJB7	28	.	0			c.T407C						PASS	.						77.0	77.0	77.0					6																	87994224		2203	4300	6503	SO:0001583	missense	375519	exon3			AAGCCAATTTCAA	AJ414563	CCDS5008.1	6q15	2008-02-05	2007-11-06			ENSG00000164411		"""Ion channels / Gap junction proteins (connexins)"""	16690	protein-coding gene	gene with protein product	"""connexin 25"""	611921	"""gap junction protein, beta 7"""				Standard	NM_198568		Approved	CX25, bA136M9.1	uc003plo.2	Q6PEY0		ENST00000525899.1:c.407T>C	chr6.hg19:g.87994224A>G	ENSP00000435355:p.Ile136Thr	91.0	0.0	.		110.0	32.0	.	NM_198568	B3KXL0|Q96KP0	Missense_Mutation	SNP	ENST00000525899.1	hg19	CCDS5008.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.803020	0.31869	.	.	ENSG00000164411	ENST00000525899;ENST00000296882;ENST00000369576	D;D;D	0.95622	-3.76;-3.76;-3.76	4.71	4.71	0.59529	Gap junction protein, cysteine-rich domain (1);	0.368503	0.24240	U	0.040275	D	0.91348	0.7271	M	0.70903	2.155	0.24359	N	0.994881	B	0.19583	0.037	B	0.22152	0.038	D	0.87908	0.2695	10	0.62326	D	0.03	.	13.0176	0.58766	1.0:0.0:0.0:0.0	.	136	Q6PEY0	CXB7_HUMAN	T	136	ENSP00000435355:I136T;ENSP00000296882:I136T;ENSP00000358589:I136T	ENSP00000296882:I136T	I	-	2	0	GJB7	88050943	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	3.955000	0.56715	1.751000	0.51876	0.379000	0.24179	ATT	.	.	.	none		0.403	GJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394780.1		
CRHR2	1395	hgsc.bcm.edu	37	7	30702464	30702464	+	Splice_Site	SNP	C	C	T			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr7:30702464C>T	ENST00000471646.1	-	6	961		c.e6-1		CRHR2_ENST00000341843.4_Splice_Site|CRHR2_ENST00000506074.2_Splice_Site|CRHR2_ENST00000348438.4_Splice_Site	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GGCACCAGACCTGTGTGCAGG	0.587																																					.		Atlas-SNP	.											.	CRHR2	104	.	0			c.541-1G>A						PASS	.						84.0	61.0	69.0					7																	30702464		2203	4300	6503	SO:0001630	splice_region_variant	1395	exon7			CCAGACCTGTGTG		CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.544-1G>A	chr7.hg19:g.30702464C>T		64.0	0.0	.		79.0	16.0	.	NM_001202482	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Splice_Site	SNP	ENST00000471646.1	hg19	CCDS5429.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070432	0.76301	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0535	0.86526	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CRHR2	30668989	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	7.493000	0.81493	2.717000	0.92951	0.655000	0.94253	.	.	.	.	none		0.587	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250448.3		Intron
MUC17	140453	hgsc.bcm.edu	37	7	100692139	100692139	+	Silent	SNP	T	T	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr7:100692139T>C	ENST00000306151.4	+	5	12613	c.12549T>C	c.(12547-12549)acT>acC	p.T4183T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4183					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACCGGAGACTATCTCTGCCC	0.522																																					p.T4183T		Atlas-SNP	.											.	MUC17	804	.	0			c.T12549C						PASS	.						101.0	90.0	94.0					7																	100692139		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon5			GGAGACTATCTCT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12549T>C	chr7.hg19:g.100692139T>C		106.0	0.0	.		178.0	11.0	.	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	hg19	CCDS34711.1																																																																																			.	.	.	none		0.522	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
SYPL1	6856	hgsc.bcm.edu	37	7	105752601	105752601	+	Silent	SNP	G	G	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr7:105752601G>A	ENST00000011473.2	-	2	154	c.108C>T	c.(106-108)atC>atT	p.I36I	SYPL1_ENST00000470347.1_Silent_p.I18I|SYPL1_ENST00000455385.2_Silent_p.I18I	NM_006754.3	NP_006745.1	Q16563	SYPL1_HUMAN	synaptophysin-like 1	36	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|integral component of synaptic vesicle membrane (GO:0030285)|secretory granule (GO:0030141)	transporter activity (GO:0005215)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	7						CGAGGACCTTGATGAAGCCGA	0.697																																					p.I36I		Atlas-SNP	.											.	SYPL1	20	.	0			c.C108T						PASS	.						35.0	36.0	35.0					7																	105752601		2203	4300	6503	SO:0001819	synonymous_variant	6856	exon2			GACCTTGATGAAG		CCDS5736.1, CCDS47685.1	7q22.2	2005-05-24	2005-05-24	2005-05-24	ENSG00000008282	ENSG00000008282			11507	protein-coding gene	gene with protein product			"""synaptophysin-like protein"""	SYPL			Standard	NM_006754		Approved		uc003vdp.4	Q16563	OTTHUMG00000157587	ENST00000011473.2:c.108C>T	chr7.hg19:g.105752601G>A		18.0	0.0	.		34.0	18.0	.	NM_006754	A4D0R2|Q96AR8	Silent	SNP	ENST00000011473.2	hg19	CCDS5736.1																																																																																			.	.	.	none		0.697	SYPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349221.1		
ADAM18	8749	hgsc.bcm.edu	37	8	39468142	39468142	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr8:39468142G>C	ENST00000265707.5	+	6	484	c.439G>C	c.(439-441)Gat>Cat	p.D147H	ADAM18_ENST00000520772.1_Missense_Mutation_p.D147H|ADAM18_ENST00000541111.1_Intron|ADAM18_ENST00000379866.1_Missense_Mutation_p.D147H	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	147					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			GAAAAATAATGATCCAAATGT	0.333																																					p.D147H		Atlas-SNP	.											.	ADAM18	169	.	0			c.G439C						PASS	.						51.0	52.0	52.0					8																	39468142		2203	4298	6501	SO:0001583	missense	8749	exon6			AATAATGATCCAA	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.439G>C	chr8.hg19:g.39468142G>C	ENSP00000265707:p.Asp147His	403.0	0.0	.		379.0	86.0	.	NM_001190956	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	ENST00000265707.5	hg19	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	G	9.536	1.112036	0.20795	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000520772;ENST00000522198	T;T;T	0.12465	5.24;4.8;2.68	5.25	-2.98	0.05513	.	0.836611	0.10471	N	0.670788	T	0.05823	0.0152	N	0.08118	0	0.09310	N	1	B;B;B	0.13594	0.005;0.003;0.008	B;B;B	0.17433	0.018;0.008;0.014	T	0.35847	-0.9772	10	0.44086	T	0.13	.	5.278	0.15661	0.3482:0.3014:0.3504:0.0	.	147;147;147	Q9Y3Q7-2;Q9Y3Q7;Q6IRW9	.;ADA18_HUMAN;.	H	147;147;147;103	ENSP00000265707:D147H;ENSP00000369195:D147H;ENSP00000429908:D147H	ENSP00000265707:D147H	D	+	1	0	ADAM18	39587299	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.482000	0.22276	-0.700000	0.05070	-0.302000	0.09304	GAT	.	.	.	none		0.333	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	
IFNA2	3440	hgsc.bcm.edu	37	9	21385222	21385222	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr9:21385222C>T	ENST00000380206.2	-	1	174	c.107G>A	c.(106-108)aGg>aAg	p.R36K		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	36					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CATCAAGGTCCTCCTGCTACC	0.537																																					p.R36K		Atlas-SNP	.											.	IFNA2	32	.	0			c.G107A						PASS	.						113.0	109.0	110.0					9																	21385222		2203	4300	6503	SO:0001583	missense	3440	exon1			AAGGTCCTCCTGC		CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.107G>A	chr9.hg19:g.21385222C>T	ENSP00000369554:p.Arg36Lys	61.0	0.0	.		52.0	8.0	.	NM_000605	H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Missense_Mutation	SNP	ENST00000380206.2	hg19	CCDS6506.1	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432634	0.25813	.	.	ENSG00000188379	ENST00000380206	T	0.03242	4.0	3.24	1.01	0.19927	.	0.727652	0.13301	N	0.398209	T	0.04048	0.0113	L	0.49455	1.56	0.09310	N	1	B	0.10296	0.003	B	0.24974	0.057	T	0.40270	-0.9572	10	0.38643	T	0.18	.	3.0905	0.06293	0.0:0.4701:0.231:0.2989	.	36	Q6DJX8	.	K	36	ENSP00000369554:R36K	ENSP00000369554:R36K	R	-	2	0	IFNA2	21375222	0.000000	0.05858	0.015000	0.15790	0.209000	0.24338	-0.746000	0.04829	0.528000	0.28580	0.484000	0.47621	AGG	.	.	.	none		0.537	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051903.1	NM_000605	
RC3H2	54542	hgsc.bcm.edu	37	9	125612089	125612089	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr9:125612089T>G	ENST00000373670.1	-	20	3993	c.3393A>C	c.(3391-3393)aaA>aaC	p.K1131N	RC3H2_ENST00000357244.2_Missense_Mutation_p.K1131N			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	1131					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						GCAGAATTGTTTTTTGCTCCT	0.413																																					p.K1131N		Atlas-SNP	.											.	RC3H2	150	.	0			c.A3393C						PASS	.						53.0	51.0	52.0					9																	125612089		1849	4092	5941	SO:0001583	missense	54542	exon21			AATTGTTTTTTGC	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.3393A>C	chr9.hg19:g.125612089T>G	ENSP00000362774:p.Lys1131Asn	144.0	0.0	.		125.0	39.0	.	NM_001100588	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	ENST00000373670.1	hg19	CCDS43874.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.83|16.83	3.231922|3.231922	0.58777|0.58777	.|.	.|.	ENSG00000056586|ENSG00000056586	ENST00000373670;ENST00000357244|ENST00000454740	T;T|.	0.50277|.	0.75;0.75|.	5.57|5.57	4.42|4.42	0.53409|0.53409	.|.	0.143354|.	0.48286|.	D|.	0.000191|.	T|T	0.33118|0.33118	0.0852|0.0852	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	D|.	0.57899|.	0.981|.	D|.	0.67231|.	0.95|.	T|T	0.09465|0.09465	-1.0673|-1.0673	10|5	0.87932|.	D|.	0|.	-17.8216|-17.8216	9.2704|9.2704	0.37668|0.37668	0.0:0.0817:0.0:0.9183|0.0:0.0817:0.0:0.9183	.|.	1131|.	Q9HBD1|.	RC3H2_HUMAN|.	N|H	1131|184	ENSP00000362774:K1131N;ENSP00000349783:K1131N|.	ENSP00000349783:K1131N|.	K|N	-|-	3|1	2|0	RC3H2|RC3H2	124651910|124651910	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.894000|0.894000	0.52154|0.52154	1.967000|1.967000	0.40491|0.40491	0.939000|0.939000	0.37446|0.37446	0.460000|0.460000	0.39030|0.39030	AAA|AAC	.	.	.	none		0.413	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835	
KAZALD1	81621	hgsc.bcm.edu	37	10	102824381	102824381	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr10:102824381G>T	ENST00000370200.5	+	4	1122	c.796G>T	c.(796-798)Gct>Tct	p.A266S		NM_030929.4	NP_112191.2	Q96I82	KAZD1_HUMAN	Kazal-type serine peptidase inhibitor domain 1	266	Ig-like C2-type.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|regulation of cell growth (GO:0001558)	interstitial matrix (GO:0005614)				endometrium(1)|ovary(1)|prostate(2)	4				Epithelial(162;6.21e-09)|all cancers(201;3.14e-07)		GGAGGCCCCTGCTAGCTTGAC	0.582																																					p.A266S		Atlas-SNP	.											.	KAZALD1	14	.	0			c.G796T						PASS	.						51.0	49.0	50.0					10																	102824381		2203	4300	6503	SO:0001583	missense	81621	exon4			GCCCCTGCTAGCT	AF333487	CCDS7509.1	10q24.32	2013-01-11	2005-08-17		ENSG00000107821	ENSG00000107821		"""Immunoglobulin superfamily / I-set domain containing"""	25460	protein-coding gene	gene with protein product		609208	"""Kazal-type serine protease inhibitor domain 1"""			12975309	Standard	NM_030929		Approved	FKSG40, FKSG28	uc001ksr.3	Q96I82	OTTHUMG00000018918	ENST00000370200.5:c.796G>T	chr10.hg19:g.102824381G>T	ENSP00000359219:p.Ala266Ser	34.0	0.0	.		42.0	7.0	.	NM_030929	D3DR74|Q6ZMB1|Q9BQ73	Missense_Mutation	SNP	ENST00000370200.5	hg19	CCDS7509.1	.	.	.	.	.	.	.	.	.	.	G	34	5.318477	0.95682	.	.	ENSG00000107821	ENST00000370200	T	0.70516	-0.49	5.71	5.71	0.89125	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86121	0.5857	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86242	0.1644	10	0.52906	T	0.07	-1.6084	19.8575	0.96767	0.0:0.0:1.0:0.0	.	266	Q96I82	KAZD1_HUMAN	S	266	ENSP00000359219:A266S	ENSP00000359219:A266S	A	+	1	0	KAZALD1	102814371	1.000000	0.71417	0.959000	0.39883	0.953000	0.61014	9.821000	0.99360	2.698000	0.92095	0.561000	0.74099	GCT	.	.	.	none		0.582	KAZALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049891.2	NM_030929	
PPRC1	23082	hgsc.bcm.edu	37	10	103900008	103900008	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr10:103900008A>T	ENST00000278070.2	+	5	1782	c.1743A>T	c.(1741-1743)caA>caT	p.Q581H	PPRC1_ENST00000413464.2_Missense_Mutation_p.Q581H|PPRC1_ENST00000370012.1_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	581					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		ACTCTGCCCAAGCCAGCCCCA	0.542																																					p.Q581H		Atlas-SNP	.											.	PPRC1	151	.	0			c.A1743T						PASS	.						133.0	114.0	120.0					10																	103900008		2203	4300	6503	SO:0001583	missense	23082	exon5			TGCCCAAGCCAGC	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.1743A>T	chr10.hg19:g.103900008A>T	ENSP00000278070:p.Gln581His	112.0	0.0	.		135.0	28.0	.	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	hg19	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	A	12.76	2.034985	0.35893	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.55413	0.52;0.52	4.77	-4.45	0.03546	.	2.468930	0.01573	N	0.020686	T	0.32406	0.0828	N	0.19112	0.55	0.09310	N	1	P;B;P	0.35600	0.511;0.412;0.511	B;B;B	0.35688	0.145;0.208;0.094	T	0.12837	-1.0532	10	0.54805	T	0.06	.	0.1789	0.00121	0.2863:0.2485:0.2237:0.2416	.	581;461;581	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	H	581	ENSP00000278070:Q581H;ENSP00000399743:Q581H	ENSP00000278070:Q581H	Q	+	3	2	PPRC1	103889998	0.102000	0.21896	0.000000	0.03702	0.010000	0.07245	0.172000	0.16704	-0.920000	0.03799	-1.357000	0.01221	CAA	.	.	.	none		0.542	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
PRDX5	25824	hgsc.bcm.edu	37	11	64085710	64085710	+	Missense_Mutation	SNP	C	C	T	rs368539290		TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr11:64085710C>T	ENST00000265462.4	+	1	151	c.23C>T	c.(22-24)gCc>gTc	p.A8V	TRMT112_ENST00000535750.1_5'Flank|PRDX5_ENST00000352435.4_Missense_Mutation_p.A8V|PRDX5_ENST00000347941.4_Missense_Mutation_p.A8V|TRMT112_ENST00000535126.1_5'Flank|TRMT112_ENST00000539854.1_5'Flank|TRMT112_ENST00000544844.1_5'Flank|TRMT112_ENST00000308774.2_5'Flank	NM_012094.4	NP_036226	P30044	PRDX5_HUMAN	peroxiredoxin 5	8					cellular response to reactive oxygen species (GO:0034614)|hydrogen peroxide catabolic process (GO:0042744)|inflammatory response (GO:0006954)|NADPH oxidation (GO:0070995)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|positive regulation of collagen biosynthetic process (GO:0032967)|reactive nitrogen species metabolic process (GO:2001057)|regulation of apoptosis involved in tissue homeostasis (GO:0060785)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	antioxidant activity (GO:0016209)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|peroxidase activity (GO:0004601)|peroxiredoxin activity (GO:0051920)|peroxynitrite reductase activity (GO:0072541)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase III regulatory region DNA binding (GO:0001016)			breast(1)|kidney(1)|lung(1)|skin(1)	4					Auranofin(DB00995)	GGCGTGTGCGCCCTGAGACGC	0.697																																					p.A8V		Atlas-SNP	.											.	PRDX5	16	.	0			c.C23T						PASS	.	C	VAL/ALA,VAL/ALA,VAL/ALA	0,4400		0,0,2200	34.0	36.0	35.0		23,23,23	-2.2	0.0	11		35	1,8591	1.2+/-3.3	0,1,4295	no	missense,missense,missense	PRDX5	NM_012094.4,NM_181651.2,NM_181652.2	64,64,64	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	8/215,8/171,8/126	64085710	1,12991	2200	4296	6496	SO:0001583	missense	25824	exon1			TGTGCGCCCTGAG	AF197952	CCDS8069.1, CCDS8070.1, CCDS8071.1	11q13	2008-07-21			ENSG00000126432	ENSG00000126432			9355	protein-coding gene	gene with protein product	"""antioxidant enzyme B166"", ""thioredoxin peroxidase PMP20"", ""peroxisomal antioxidant enzyme"", ""TPx type VI"", ""liver tissue 2D-page spot 71B"", ""Alu co-repressor 1"""	606583				10514471, 10521424	Standard	NM_012094		Approved	ACR1, AOEB166, MGC142285, PRXV, PMP20, B166, PRDX6, PLP, SBBI10, MGC117264, MGC142283	uc001nzu.3	P30044	OTTHUMG00000168805	ENST00000265462.4:c.23C>T	chr11.hg19:g.64085710C>T	ENSP00000265462:p.Ala8Val	91.0	0.0	.		67.0	24.0	.	NM_181651	A6NC19|A6NG06|B7ZLJ4|B7ZVW3|Q14CK0|Q6IAF2|Q9UBU5|Q9UJU4|Q9UKX4	Missense_Mutation	SNP	ENST00000265462.4	hg19	CCDS8069.1	.	.	.	.	.	.	.	.	.	.	C	1.653	-0.513546	0.04200	0.0	1.16E-4	ENSG00000126432	ENST00000265462;ENST00000352435;ENST00000347941	T;T;T	0.42900	0.96;0.97;1.04	3.31	-2.16	0.07080	.	.	.	.	.	T	0.11452	0.0279	N	0.01874	-0.695	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.29912	-0.9996	9	0.02654	T	1	-0.1379	3.904	0.09174	0.0:0.3617:0.2031:0.4352	.	8;8;8	A6NC19;A6NG06;P30044	.;.;PRDX5_HUMAN	V	8	ENSP00000265462:A8V;ENSP00000335334:A8V;ENSP00000335363:A8V	ENSP00000265462:A8V	A	+	2	0	PRDX5	63842286	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.504000	0.06375	-0.389000	0.07786	-0.518000	0.04402	GCC	.	.	.	weak		0.697	PRDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401148.1	NM_181651	
SYVN1	84447	hgsc.bcm.edu	37	11	64897359	64897359	+	Silent	SNP	C	C	T			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr11:64897359C>T	ENST00000377190.3	-	14	1531	c.1437G>A	c.(1435-1437)gcG>gcA	p.A479A	SYVN1_ENST00000526060.1_Silent_p.A478A|SYVN1_ENST00000526121.1_5'Flank|SYVN1_ENST00000294256.8_Silent_p.A478A|SYVN1_ENST00000307289.6_Silent_p.A427A	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	479					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CAGCAAAGCCCGCAGGGGGCA	0.652																																					p.A479A		Atlas-SNP	.											.	SYVN1	55	.	0			c.G1437A						PASS	.						26.0	32.0	30.0					11																	64897359		2201	4297	6498	SO:0001819	synonymous_variant	84447	exon14			AAAGCCCGCAGGG	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.1437G>A	chr11.hg19:g.64897359C>T		41.0	0.0	.		27.0	7.0	.	NM_172230	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Silent	SNP	ENST00000377190.3	hg19	CCDS31605.1																																																																																			.	.	.	none		0.652	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	
HEPHL1	341208	hgsc.bcm.edu	37	11	93796840	93796840	+	Missense_Mutation	SNP	G	G	T	rs557063968		TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr11:93796840G>T	ENST00000315765.9	+	3	590	c.582G>T	c.(580-582)aaG>aaT	p.K194N		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	194	Plastocyanin-like 1.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				ACGCCCCAAAGGACATCTGCT	0.522																																					p.K194N		Atlas-SNP	.											.	HEPHL1	144	.	0			c.G582T						PASS	.						108.0	106.0	107.0					11																	93796840		1965	4153	6118	SO:0001583	missense	341208	exon3			CCCAAAGGACATC	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.582G>T	chr11.hg19:g.93796840G>T	ENSP00000313699:p.Lys194Asn	99.0	0.0	.		91.0	24.0	.	NM_001098672	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	hg19	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397872	0.62177	.	.	ENSG00000181333	ENST00000315765	D	0.99483	-5.99	5.33	3.47	0.39725	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.146963	0.64402	D	0.000010	D	0.98909	0.9630	L	0.49513	1.565	0.44762	D	0.99776	D	0.67145	0.996	D	0.70016	0.967	D	0.97634	1.0144	10	0.30854	T	0.27	.	6.7985	0.23738	0.3943:0.0:0.6057:0.0	.	194	Q6MZM0	HPHL1_HUMAN	N	194	ENSP00000313699:K194N	ENSP00000313699:K194N	K	+	3	2	HEPHL1	93436488	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	1.877000	0.39598	0.642000	0.30620	0.655000	0.94253	AAG	.	.	.	none		0.522	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
LIMA1	51474	hgsc.bcm.edu	37	12	50594621	50594621	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr12:50594621T>C	ENST00000341247.4	-	7	1060	c.911A>G	c.(910-912)gAg>gGg	p.E304G	LIMA1_ENST00000552491.1_Missense_Mutation_p.E2G|LIMA1_ENST00000552909.1_Missense_Mutation_p.E144G|LIMA1_ENST00000552783.1_Missense_Mutation_p.E144G|LIMA1_ENST00000394943.3_Missense_Mutation_p.E304G|LIMA1_ENST00000552823.1_Missense_Mutation_p.E144G|LIMA1_ENST00000547825.1_Missense_Mutation_p.E2G|LIMA1_ENST00000552008.1_5'UTR	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	304					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						CTCCTTTTGCTCCATTTTATG	0.408																																					p.E304G		Atlas-SNP	.											.	LIMA1	67	.	0			c.A911G						PASS	.						251.0	249.0	249.0					12																	50594621		2203	4300	6503	SO:0001583	missense	51474	exon7			TTTTGCTCCATTT	AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.911A>G	chr12.hg19:g.50594621T>C	ENSP00000340184:p.Glu304Gly	90.0	0.0	.		91.0	19.0	.	NM_016357	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	ENST00000341247.4	hg19	CCDS8802.1	.	.	.	.	.	.	.	.	.	.	T	12.71	2.020309	0.35606	.	.	ENSG00000050405	ENST00000552491;ENST00000547825;ENST00000552823;ENST00000394943;ENST00000341247;ENST00000552783;ENST00000552909;ENST00000420992	T;T;D;D;T;D;D	0.84944	-1.32;-1.32;-1.51;-1.92;-1.19;-1.51;-1.51	5.44	5.44	0.79542	.	0.394381	0.29119	N	0.013087	D	0.82724	0.5099	M	0.67953	2.075	0.43868	D	0.996471	B;B;B	0.23990	0.095;0.06;0.034	B;B;B	0.18871	0.023;0.018;0.023	T	0.78966	-0.1995	10	0.32370	T	0.25	.	13.1177	0.59309	0.0:0.0:0.0:1.0	.	313;304;144	Q59FE8;Q9UHB6;F8VQE1	.;LIMA1_HUMAN;.	G	2;2;144;304;304;144;144;223	ENSP00000448463:E2G;ENSP00000448706:E2G;ENSP00000450266:E144G;ENSP00000378400:E304G;ENSP00000340184:E304G;ENSP00000448779:E144G;ENSP00000450087:E144G	ENSP00000340184:E304G	E	-	2	0	LIMA1	48880888	0.997000	0.39634	0.995000	0.50966	0.281000	0.26958	2.852000	0.48310	2.284000	0.76573	0.528000	0.53228	GAG	.	.	.	none		0.408	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406235.2	NM_016357	
KRT3	3850	hgsc.bcm.edu	37	12	53183951	53183951	+	Missense_Mutation	SNP	C	C	T	rs570613061|rs60125653	byFrequency	TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr12:53183951C>T	ENST00000417996.2	-	9	1836	c.1762G>A	c.(1762-1764)Ggc>Agc	p.G588S	KRT3_ENST00000309505.3_Missense_Mutation_p.G589S	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	588	Gly-rich.|Tail.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GAGCCAAAgccgctgccaccg	0.697																																					p.G588S		Atlas-SNP	.											KRT3,rectum,carcinoma,0,2	KRT3	65	.	0			c.G1762A						PASS	.						14.0	31.0	25.0					12																	53183951		1574	3123	4697	SO:0001583	missense	3850	exon9			CAAAGCCGCTGCC		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1762G>A	chr12.hg19:g.53183951C>T	ENSP00000413479:p.Gly588Ser	36.0	0.0	.		68.0	13.0	.	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	hg19	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307617	0.40795	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	D;D	0.91351	-2.83;-2.83	3.4	-1.34	0.09143	.	0.507655	0.14827	N	0.296110	T	0.80149	0.4570	N	0.22421	0.69	0.09310	N	1	B	0.18166	0.026	B	0.08055	0.003	T	0.65302	-0.6201	10	0.34782	T	0.22	.	7.4497	0.27231	0.0:0.4872:0.0:0.5128	.	588	P12035	K2C3_HUMAN	S	588;589	ENSP00000413479:G588S;ENSP00000312206:G589S	ENSP00000312206:G589S	G	-	1	0	KRT3	51470218	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-1.682000	0.01935	-0.284000	0.09102	-0.258000	0.10820	GGC	.	.	.	none		0.697	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
ANO4	121601	hgsc.bcm.edu	37	12	101514351	101514351	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr12:101514351T>G	ENST00000392977.3	+	26	2834	c.2624T>G	c.(2623-2625)cTg>cGg	p.L875R	ANO4_ENST00000392979.3_Missense_Mutation_p.L840R|ANO4_ENST00000299222.9_Missense_Mutation_p.L395R|ANO4_ENST00000550015.1_Missense_Mutation_p.L395R			Q32M45	ANO4_HUMAN	anoctamin 4	875					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						GGCTACACACTGCAGTTTTGG	0.408										HNSCC(74;0.22)																											p.L840R		Atlas-SNP	.											.	ANO4	183	.	0			c.T2519G						PASS	.						160.0	138.0	145.0					12																	101514351		2203	4300	6503	SO:0001583	missense	121601	exon25			ACACACTGCAGTT	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2624T>G	chr12.hg19:g.101514351T>G	ENSP00000376703:p.Leu875Arg	178.0	0.0	.		182.0	48.0	.	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	hg19		.	.	.	.	.	.	.	.	.	.	T	24.2	4.506997	0.85282	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.69685	-0.41;-0.26;-0.42;-0.26	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000018	T	0.77089	0.4079	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.996;0.999	T	0.72207	-0.4360	10	0.16420	T	0.52	.	16.3322	0.83039	0.0:0.0:0.0:1.0	.	395;875;840	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	R	840;395;875;395	ENSP00000376705:L840R;ENSP00000299222:L395R;ENSP00000376703:L875R;ENSP00000450192:L395R	ENSP00000299222:L395R	L	+	2	0	ANO4	100038482	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.251000	0.74343	0.528000	0.53228	CTG	.	.	.	none		0.408	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
ACIN1	22985	hgsc.bcm.edu	37	14	23549896	23549896	+	Silent	SNP	C	C	T	rs398102304		TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr14:23549896C>T	ENST00000262710.1	-	6	1149	c.822G>A	c.(820-822)gaG>gaA	p.E274E	ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Silent_p.E274E|ACIN1_ENST00000605057.1_Silent_p.E216E|ACIN1_ENST00000457657.1_Silent_p.E234E	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	274	Glu-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		cctcctcctcctcttcttcct	0.473																																					p.E274E		Atlas-SNP	.											.	ACIN1	147	.	0			c.G822A						PASS	.						126.0	121.0	123.0					14																	23549896		2203	4300	6503	SO:0001819	synonymous_variant	22985	exon6			CTCCTCCTCTTCT	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.822G>A	chr14.hg19:g.23549896C>T		126.0	0.0	.		129.0	7.0	.	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Silent	SNP	ENST00000262710.1	hg19	CCDS9587.1																																																																																			.	.	.	none		0.473	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
PCNX	22990	hgsc.bcm.edu	37	14	71572155	71572155	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr14:71572155T>C	ENST00000304743.2	+	33	6745	c.6299T>C	c.(6298-6300)cTa>cCa	p.L2100P	PCNX_ENST00000439984.3_Missense_Mutation_p.L1989P|PCNX_ENST00000238570.5_Missense_Mutation_p.L2028P|PCNX_ENST00000556272.1_3'UTR	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	2100						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CCTCCAACACTAGGTAATGTG	0.448																																					p.L2100P		Atlas-SNP	.											.	PCNX	198	.	0			c.T6299C						PASS	.						91.0	80.0	84.0					14																	71572155		2203	4300	6503	SO:0001583	missense	22990	exon33			CAACACTAGGTAA	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.6299T>C	chr14.hg19:g.71572155T>C	ENSP00000304192:p.Leu2100Pro	90.0	0.0	.		75.0	13.0	.	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	hg19	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.11|13.11	2.138849|2.138849	0.37728|0.37728	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984|ENST00000554691	T;T;T|.	0.10860|.	3.25;3.28;2.83|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.505695|.	0.18696|.	N|.	0.133734|.	T|.	0.64114|.	0.2569|.	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999997|0.999997	D;D;D|.	0.76494|.	0.999;0.998;0.998|.	D;D;D|.	0.87578|.	0.998;0.995;0.995|.	T|.	0.62572|.	-0.6826|.	10|.	0.22706|.	T|.	0.39|.	.|.	14.1629|14.1629	0.65457|0.65457	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2028;1989;2100|.	Q96RV3-3;B2RTR6;Q96RV3|.	.;.;PCX1_HUMAN|.	P|Q	2100;2028;1989|1087	ENSP00000304192:L2100P;ENSP00000238570:L2028P;ENSP00000396617:L1989P|.	ENSP00000238570:L2028P|.	L|X	+|+	2|1	0|0	PCNX|PCNX	70641908|70641908	1.000000|1.000000	0.71417|0.71417	0.843000|0.843000	0.33291|0.33291	0.193000|0.193000	0.23685|0.23685	3.097000|3.097000	0.50251|0.50251	1.988000|1.988000	0.58038|0.58038	0.533000|0.533000	0.62120|0.62120	CTA|TAG	.	.	.	none		0.448	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
VWA9	81556	hgsc.bcm.edu	37	15	65892192	65892192	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr15:65892192G>C	ENST00000395644.4	-	4	741	c.406C>G	c.(406-408)Cga>Gga	p.R136G	VWA9_ENST00000567744.1_Missense_Mutation_p.R172G|VWA9_ENST00000569491.1_Missense_Mutation_p.R87G|VWA9_ENST00000431261.2_Missense_Mutation_p.R57G|VWA9_ENST00000442903.3_Missense_Mutation_p.R100G|VWA9_ENST00000313182.2_Missense_Mutation_p.R136G|VWA9_ENST00000420799.2_Missense_Mutation_p.R79G			Q96SY0	VWA9_HUMAN	von Willebrand factor A domain containing 9	136	VWFA.																CTCTCACTTCGTTGATTTTGA	0.448																																					p.R119G		Atlas-SNP	.											.	VWA9	15	.	0			c.C355G						PASS	.						163.0	121.0	136.0					15																	65892192		2201	4299	6500	SO:0001583	missense	81556	exon4			CACTTCGTTGATT	AL136662	CCDS55969.1, CCDS45283.1	15q22.31	2012-09-27	2012-09-27	2012-09-27	ENSG00000138614	ENSG00000138614			25372	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 44"""	C15orf44		11230166	Standard	NM_001136043		Approved	DKFZP564O1664	uc010uja.2	Q96SY0	OTTHUMG00000133159	ENST00000395644.4:c.406C>G	chr15.hg19:g.65892192G>C	ENSP00000379006:p.Arg136Gly	79.0	0.0	.		120.0	34.0	.	NM_001207058	B4DDI6|B4DVD5|Q49AH8|Q96HX5|Q9H0S5	Missense_Mutation	SNP	ENST00000395644.4	hg19		.	.	.	.	.	.	.	.	.	.	G	14.98	2.696264	0.48202	.	.	ENSG00000138614	ENST00000395644;ENST00000313182;ENST00000431261;ENST00000420799;ENST00000442903	T;T;T	0.67345	-0.26;-0.26;-0.26	5.79	2.77	0.32553	von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	L	0.59436	1.845	0.58432	D	0.999996	P;P;P;D;P	0.53619	0.884;0.884;0.901;0.961;0.924	B;B;B;P;B	0.48815	0.347;0.361;0.233;0.591;0.436	T	0.68187	-0.5475	10	0.44086	T	0.13	-12.6037	14.8532	0.70313	0.0:0.0:0.5019:0.4981	.	79;87;100;172;136	B4DDI6;B4DWZ3;B4DVT3;B4DJL6;Q96SY0	.;.;.;.;CO044_HUMAN	G	136;136;57;79;100	ENSP00000379006:R136G;ENSP00000326379:R136G;ENSP00000396314:R100G	ENSP00000326379:R136G	R	-	1	2	C15orf44	63679245	0.991000	0.36638	0.312000	0.25196	0.975000	0.68041	2.072000	0.41510	0.291000	0.22468	-0.127000	0.14921	CGA	.	.	.	none		0.448	VWA9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420604.3	NM_030800	
RASGRF1	5923	hgsc.bcm.edu	37	15	79265658	79265658	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr15:79265658G>C	ENST00000419573.3	-	26	3921	c.3647C>G	c.(3646-3648)tCc>tGc	p.S1216C	RASGRF1_ENST00000394745.3_Missense_Mutation_p.S432C|RASGRF1_ENST00000558480.2_Missense_Mutation_p.S1200C	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	1216	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CCTCATCTTGGAGAAGTTGAC	0.632																																					p.S1216C		Atlas-SNP	.											.	RASGRF1	168	.	0			c.C3647G						PASS	.						164.0	129.0	141.0					15																	79265658		2196	4293	6489	SO:0001583	missense	5923	exon26			ATCTTGGAGAAGT	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3647C>G	chr15.hg19:g.79265658G>C	ENSP00000405963:p.Ser1216Cys	49.0	0.0	.		50.0	14.0	.	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	hg19	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193004	0.78902	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.32753	1.44;1.44	4.08	4.08	0.47627	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine-nucleotide exchange factor, conserved site (1);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.53722	0.1814	M	0.74467	2.265	0.80722	D	1	D;B	0.69078	0.997;0.445	D;B	0.70016	0.967;0.401	T	0.59392	-0.7463	10	0.66056	D	0.02	.	14.1711	0.65510	0.0:0.0:1.0:0.0	.	1218;1200	Q13972;F8VPA5	RGRF1_HUMAN;.	C	1216;1200;432	ENSP00000405963:S1216C;ENSP00000378228:S432C	ENSP00000378224:S1200C	S	-	2	0	RASGRF1	77052713	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.359000	0.97115	2.250000	0.74265	0.591000	0.81541	TCC	.	.	.	none		0.632	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
TELO2	9894	hgsc.bcm.edu	37	16	1550652	1550653	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr16:1550652_1550653GG>AT	ENST00000262319.6	+	9	1512_1513	c.1233_1234GG>AT	c.(1231-1236)gaGGtc>gaATtc	p.V412F		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	412					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				TCGTGGCAGAGGTCGTTAGTGC	0.698																																					p.E411E|p.V412F		Atlas-SNP	.											.	TELO2	44	.	0			c.G1233A|c.G1234T						PASS	.																																			SO:0001583	missense	9894	exon9			GGCAGAGGTCGTT|GCAGAGGTCGTTA	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	Exception_encountered	chr16.hg19:g.1550652_1550653delinsAT	ENSP00000262319:p.Val412Phe	89.0	0.0	.		120.0	23.0|24.0	.	NM_016111	D3DU73|O75168|Q7LDV4|Q9BR21	Silent|Missense_Mutation	SNP	ENST00000262319.6	hg19	CCDS32363.1																																																																																			.	.	.	none		0.698	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111	
RBFOX1	54715	hgsc.bcm.edu	37	16	7703911	7703911	+	Silent	SNP	G	G	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr16:7703911G>A	ENST00000550418.1	+	12	1840	c.852G>A	c.(850-852)agG>agA	p.R284R	RBFOX1_ENST00000355637.4_Silent_p.R304R|RBFOX1_ENST00000311745.5_Silent_p.R304R|RBFOX1_ENST00000436368.2_Silent_p.R304R|RBFOX1_ENST00000552089.1_Silent_p.R301R|RBFOX1_ENST00000547372.1_Silent_p.R327R|RBFOX1_ENST00000553186.1_Silent_p.R257R|RBFOX1_ENST00000547338.1_Silent_p.R284R|RBFOX1_ENST00000422070.4_Silent_p.R327R|RBFOX1_ENST00000535565.2_Silent_p.R241R|RBFOX1_ENST00000340209.4_Silent_p.R289R	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	284					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						ACACCTTCAgggccgcggcgc	0.756																																					p.R304R	Ovarian(157;934 2567 15163 39509)	Atlas-SNP	.											.	RBFOX1	341	.	0			c.G912A						PASS	.						9.0	11.0	10.0					16																	7703911		1833	3814	5647	SO:0001819	synonymous_variant	54715	exon9			CTTCAGGGCCGCG	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.852G>A	chr16.hg19:g.7703911G>A		19.0	0.0	.		14.0	6.0	.	NM_145891	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	ENST00000550418.1	hg19	CCDS55983.1																																																																																			.	.	.	none		0.756	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
BFAR	51283	hgsc.bcm.edu	37	16	14758841	14758841	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr16:14758841C>T	ENST00000261658.2	+	7	1350	c.1073C>T	c.(1072-1074)aCa>aTa	p.T358I	BFAR_ENST00000426842.2_Missense_Mutation_p.T230I|BFAR_ENST00000563971.1_Missense_Mutation_p.T233I	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	358					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						CATTACTGGACATCACGGTTT	0.438																																					p.T358I		Atlas-SNP	.											.	BFAR	38	.	0			c.C1073T						PASS	.						248.0	206.0	220.0					16																	14758841		2197	4300	6497	SO:0001583	missense	51283	exon7			ACTGGACATCACG	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.1073C>T	chr16.hg19:g.14758841C>T	ENSP00000261658:p.Thr358Ile	258.0	0.0	.		272.0	56.0	.	NM_016561	A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	ENST00000261658.2	hg19	CCDS10554.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556706	0.86231	.	.	ENSG00000103429	ENST00000261658;ENST00000426842	T;T	0.54279	2.92;0.58	5.81	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.59404	0.2191	L	0.27053	0.805	0.58432	D	0.999999	P;D;D	0.89917	0.908;1.0;1.0	B;D;D	0.69307	0.325;0.963;0.963	T	0.64415	-0.6413	10	0.87932	D	0	.	14.1846	0.65598	0.0:0.9282:0.0:0.0718	.	230;358;358	B4DUT0;B2R9R6;Q9NZS9	.;.;BFAR_HUMAN	I	358;230	ENSP00000261658:T358I;ENSP00000400634:T230I	ENSP00000261658:T358I	T	+	2	0	BFAR	14666342	1.000000	0.71417	0.934000	0.37439	0.996000	0.88848	7.555000	0.82223	1.455000	0.47813	0.655000	0.94253	ACA	.	.	.	none		0.438	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252088.1	NM_016561	
ABCC1	4363	hgsc.bcm.edu	37	16	16228223	16228223	+	Missense_Mutation	SNP	G	G	A	rs370672850		TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr16:16228223G>A	ENST00000399410.3	+	28	4158	c.3983G>A	c.(3982-3984)cGg>cAg	p.R1328Q	ABCC1_ENST00000351154.5_Missense_Mutation_p.R1269Q|ABCC1_ENST00000349029.5_Missense_Mutation_p.R1213Q|ABCC1_ENST00000346370.5_Missense_Mutation_p.R1272Q|ABCC1_ENST00000399408.2_Missense_Mutation_p.R1338Q|ABCC1_ENST00000345148.5_Missense_Mutation_p.R1328Q	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	1328	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	ATCGTGGGGCGGACGGGAGCT	0.607																																					p.R1328Q		Atlas-SNP	.											.	ABCC1	156	.	0			c.G3983A						PASS	.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4205		0,1,2102	81.0	89.0	86.0		3983,3806,3815,3638,3983	5.8	1.0	16		86	0,8444		0,0,4222	no	missense,missense,missense,missense,missense	ABCC1	NM_004996.3,NM_019862.2,NM_019898.2,NM_019899.2,NM_019900.2	43,43,43,43,43	0,1,6324	AA,AG,GG		0.0,0.0238,0.0079	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1328/1532,1269/1473,1272/1476,1213/1417,1328/1467	16228223	1,12649	2103	4222	6325	SO:0001583	missense	4363	exon28			TGGGGCGGACGGG	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.3983G>A	chr16.hg19:g.16228223G>A	ENSP00000382342:p.Arg1328Gln	49.0	0.0	.		48.0	7.0	.	NM_004996	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	hg19	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630940	0.67015	2.38E-4	0.0	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33;-3.33;-3.33	5.81	5.81	0.92471	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96661	0.8910	M	0.76328	2.33	0.58432	D	0.999997	D;D;D;D;D;D	0.89917	0.971;1.0;1.0;1.0;1.0;1.0	P;D;D;D;D;D	0.97110	0.669;1.0;0.999;0.996;0.997;0.999	D	0.96746	0.9550	10	0.87932	D	0	-28.0643	19.0707	0.93134	0.0:0.0:1.0:0.0	.	1213;1328;1272;1269;1328;1338	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	Q	1328;1338;1272;1269;1328;1213;1012	ENSP00000382342:R1328Q;ENSP00000382340:R1338Q;ENSP00000263019:R1272Q;ENSP00000263017:R1269Q;ENSP00000263014:R1328Q;ENSP00000263016:R1213Q	ENSP00000263014:R1328Q	R	+	2	0	ABCC1	16135724	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	9.831000	0.99420	2.746000	0.94184	0.655000	0.94253	CGG	.	.	.	weak		0.607	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	
ITFG1	81533	hgsc.bcm.edu	37	16	47195736	47195736	+	Missense_Mutation	SNP	C	C	T	rs141409020		TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr16:47195736C>T	ENST00000320640.6	-	16	1814	c.1586G>A	c.(1585-1587)cGa>cAa	p.R529Q	ITFG1_ENST00000544001.2_Missense_Mutation_p.R416Q|RP11-329J18.2_ENST00000564705.1_RNA|ITFG1_ENST00000568047.1_5'UTR|RP11-329J18.2_ENST00000565694.1_RNA	NM_030790.3	NP_110417.2	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1	529						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	19		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				CTCTTGTTTTCGTATAGACTG	0.323																																					p.R529Q		Atlas-SNP	.											.	ITFG1	49	.	0			c.G1586A						PASS	.	C	GLN/ARG	0,4404		0,0,2202	180.0	166.0	171.0		1586	5.4	1.0	16	dbSNP_134	171	1,8599	1.2+/-3.3	0,1,4299	no	missense	ITFG1	NM_030790.3	43	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	529/613	47195736	1,13003	2202	4300	6502	SO:0001583	missense	81533	exon16			TGTTTTCGTATAG	AF503339	CCDS10728.1	16q12.1	2008-02-05			ENSG00000129636	ENSG00000129636			30697	protein-coding gene	gene with protein product	"""T cell immunomodulatory protein"""	611803				12598909	Standard	NM_030790		Approved	CDA08, TIP	uc002eet.3	Q8TB96	OTTHUMG00000133103	ENST00000320640.6:c.1586G>A	chr16.hg19:g.47195736C>T	ENSP00000319918:p.Arg529Gln	95.0	0.0	.		118.0	19.0	.	NM_030790	Q96SR4|Q9BRE2|Q9H2V9	Missense_Mutation	SNP	ENST00000320640.6	hg19	CCDS10728.1	.	.	.	.	.	.	.	.	.	.	C	33	5.197986	0.94997	0.0	1.16E-4	ENSG00000129636	ENST00000320640;ENST00000537184;ENST00000542691;ENST00000544001	T;T	0.63096	-0.02;-0.02	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.71779	0.3380	L	0.41824	1.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.99;0.999	T	0.64892	-0.6300	10	0.16896	T	0.51	-4.0712	19.1974	0.93695	0.0:1.0:0.0:0.0	.	416;529	F5GXC5;Q8TB96	.;TIP_HUMAN	Q	529;189;274;416	ENSP00000319918:R529Q;ENSP00000441062:R416Q	ENSP00000319918:R529Q	R	-	2	0	ITFG1	45753237	1.000000	0.71417	0.976000	0.42696	0.992000	0.81027	7.270000	0.78493	2.538000	0.85594	0.467000	0.42956	CGA	.	C|1.000;T|0.000	0.000	weak		0.323	ITFG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256768.3	NM_030790	
RBL2	5934	hgsc.bcm.edu	37	16	53504377	53504377	+	Silent	SNP	C	C	T			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr16:53504377C>T	ENST00000262133.6	+	16	2465	c.2328C>T	c.(2326-2328)tcC>tcT	p.S776S	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Intron	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	776	Pocket; binds E1A.|Spacer.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TGACAGGCTCCATCCAGCCCC	0.512																																					p.S776S		Atlas-SNP	.											.	RBL2	115	.	0			c.C2328T						PASS	.						53.0	52.0	52.0					16																	53504377		2198	4300	6498	SO:0001819	synonymous_variant	5934	exon16			AGGCTCCATCCAG	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2328C>T	chr16.hg19:g.53504377C>T		62.0	0.0	.		81.0	21.0	.	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Silent	SNP	ENST00000262133.6	hg19	CCDS10748.1																																																																																			.	.	.	none		0.512	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
ACACA	31	hgsc.bcm.edu	37	17	35620716	35620716	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr17:35620716C>G	ENST00000394406.2	-	11	1280	c.1090G>C	c.(1090-1092)Gcg>Ccg	p.A364P	ACACA_ENST00000335166.5_Missense_Mutation_p.A286P|ACACA_ENST00000353139.5_Missense_Mutation_p.A401P|ACACA_ENST00000360679.3_Missense_Mutation_p.A306P	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	364	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.			A -> V (in Ref. 2; AAP94122). {ECO:0000305}.	acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TATTGGTCCGCTAAGATCTGC	0.443																																					p.A401P	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Atlas-SNP	.											.	ACACA	395	.	0			c.G1201C						PASS	.						205.0	179.0	188.0					17																	35620716		2203	4300	6503	SO:0001583	missense	31	exon11			GGTCCGCTAAGAT	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.1090G>C	chr17.hg19:g.35620716C>G	ENSP00000377928:p.Ala364Pro	103.0	0.0	.		137.0	11.0	.	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	hg19	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.981395	0.93044	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	D;D;D;D	0.97553	-4.43;-4.43;-4.43;-4.43	5.78	5.78	0.91487	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.050076	0.85682	D	0.000000	D	0.99102	0.9691	H	0.98466	4.24	0.80722	D	1	D;D;D	0.89917	0.979;1.0;0.999	D;D;D	0.78314	0.913;0.991;0.985	D	0.99007	1.0813	10	0.87932	D	0	-14.7209	14.8047	0.69945	0.1441:0.8559:0.0:0.0	.	401;364;306	Q13085-4;Q13085;Q13085-2	.;ACACA_HUMAN;.	P	401;306;364;388;286	ENSP00000344789:A401P;ENSP00000353898:A306P;ENSP00000377928:A364P;ENSP00000335323:A286P	ENSP00000335323:A286P	A	-	1	0	ACACA	32694829	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.930000	0.70104	2.722000	0.93159	0.655000	0.94253	GCG	.	.	.	none		0.443	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
SYNRG	11276	hgsc.bcm.edu	37	17	35946557	35946557	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr17:35946557T>G	ENST00000339208.6	-	4	481	c.341A>C	c.(340-342)gAc>gCc	p.D114A	SYNRG_ENST00000346661.4_Missense_Mutation_p.D114A|SYNRG_ENST00000345615.4_Missense_Mutation_p.D114A|SYNRG_ENST00000591288.1_Missense_Mutation_p.D114A|SYNRG_ENST00000585472.1_Missense_Mutation_p.D113A|SYNRG_ENST00000502449.2_Missense_Mutation_p.D114A|SYNRG_ENST00000394378.2_Missense_Mutation_p.D114A	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	114					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CTTCTGCATGTCTGGAGTGTA	0.473																																					p.D114A		Atlas-SNP	.											.	SYNRG	101	.	0			c.A341C						PASS	.						133.0	118.0	123.0					17																	35946557		2203	4300	6503	SO:0001583	missense	11276	exon4			TGCATGTCTGGAG	AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.341A>C	chr17.hg19:g.35946557T>G	ENSP00000343610:p.Asp114Ala	139.0	0.0	.		193.0	73.0	.	NM_001163544	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	hg19	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.463539	0.84425	.	.	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378;ENST00000394379	T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6	4.74	4.74	0.60224	.	0.050722	0.85682	D	0.000000	T	0.48295	0.1492	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;0.999;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.85130	0.941;0.951;0.951;0.951;0.951;0.997;0.997	T	0.43442	-0.9391	10	0.09084	T	0.74	-4.1366	14.5161	0.67821	0.0:0.0:0.0:1.0	.	114;114;114;114;114;114;114	A8MYE0;B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;.;SYNRG_HUMAN	A	114	ENSP00000005279:D114A;ENSP00000343610:D114A;ENSP00000315722:D114A;ENSP00000424893:D114A;ENSP00000377903:D114A	ENSP00000343610:D114A	D	-	2	0	SYNRG	33020670	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.604000	0.82830	1.876000	0.54355	0.482000	0.46254	GAC	.	.	.	none		0.473	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247	
CPLX4	339302	hgsc.bcm.edu	37	18	56964141	56964141	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr18:56964141T>C	ENST00000299721.3	-	3	458	c.272A>G	c.(271-273)aAt>aGt	p.N91S	CPLX4_ENST00000587244.1_Intron	NM_181654.3	NP_857637.1	Q7Z7G2	CPLX4_HUMAN	complexin 4	91					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter secretion (GO:0046928)	cell junction (GO:0030054)|membrane (GO:0016020)|synapse (GO:0045202)				autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	16		Colorectal(73;0.175)				CTGGATTTGATTCTCATCCAT	0.318																																					p.N91S		Atlas-SNP	.											.	CPLX4	35	.	0			c.A272G						PASS	.						66.0	60.0	62.0					18																	56964141		2203	4300	6503	SO:0001583	missense	339302	exon3			ATTTGATTCTCAT	AY286502	CCDS11973.1	18q21.32	2005-08-02			ENSG00000166569	ENSG00000166569			24330	protein-coding gene	gene with protein product		609586				15911881	Standard	NM_181654		Approved	CPX-IV	uc002lhy.3	Q7Z7G2	OTTHUMG00000132756	ENST00000299721.3:c.272A>G	chr18.hg19:g.56964141T>C	ENSP00000299721:p.Asn91Ser	138.0	0.0	.		159.0	8.0	.	NM_181654	F1T0L6	Missense_Mutation	SNP	ENST00000299721.3	hg19	CCDS11973.1	.	.	.	.	.	.	.	.	.	.	T	4.797	0.148248	0.09134	.	.	ENSG00000166569	ENST00000299721	.	.	.	5.66	-1.56	0.08532	.	0.177771	0.64402	N	0.000012	T	0.47173	0.1431	L	0.50333	1.59	0.44780	D	0.997788	B	0.06786	0.001	B	0.11329	0.006	T	0.40534	-0.9558	9	0.07644	T	0.81	-7.2865	11.4238	0.49998	0.0:0.0644:0.5712:0.3644	.	91	Q7Z7G2	CPLX4_HUMAN	S	91	.	ENSP00000299721:N91S	N	-	2	0	CPLX4	55115121	1.000000	0.71417	0.969000	0.41365	0.974000	0.67602	2.143000	0.42187	-0.158000	0.11040	-0.396000	0.06452	AAT	.	.	.	none		0.318	CPLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256127.1	NM_181654	
ATP9B	374868	hgsc.bcm.edu	37	18	77013436	77013436	+	Nonsense_Mutation	SNP	T	T	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr18:77013436T>G	ENST00000426216.2	+	12	1180	c.1163T>G	c.(1162-1164)tTa>tGa	p.L388*	RP11-1136J12.1_ENST00000591742.1_RNA|ATP9B_ENST00000307671.7_Nonsense_Mutation_p.L388*	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	388					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TTTTTGGCTTTAGTTGCTCTT	0.408																																					p.L388X		Atlas-SNP	.											.	ATP9B	96	.	0			c.T1163G						PASS	.						303.0	279.0	287.0					18																	77013436		2203	4300	6503	SO:0001587	stop_gained	374868	exon12			TGGCTTTAGTTGC	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.1163T>G	chr18.hg19:g.77013436T>G	ENSP00000398076:p.Leu388*	526.0	1.0	.		550.0	128.0	.	NM_198531	O60872|Q08AD8|Q08AD9	Nonsense_Mutation	SNP	ENST00000426216.2	hg19	CCDS12014.1	.	.	.	.	.	.	.	.	.	.	T	37	6.321691	0.97471	.	.	ENSG00000166377	ENST00000426216;ENST00000307671	.	.	.	5.95	5.95	0.96441	.	0.071724	0.53938	D	0.000050	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	.	.	.	X	388	.	ENSP00000304500:L388X	L	+	2	0	ATP9B	75114424	0.426000	0.25506	0.004000	0.12327	0.963000	0.63663	3.606000	0.54095	2.279000	0.76181	0.533000	0.62120	TTA	.	.	.	none		0.408	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	
CPXM1	56265	hgsc.bcm.edu	37	20	2779177	2779177	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr20:2779177G>T	ENST00000380605.2	-	3	411	c.347C>A	c.(346-348)cCt>cAt	p.P116H		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	116	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						ACCCAAAGGAGGACAGCCTGG	0.602																																					p.P116H		Atlas-SNP	.											.	CPXM1	107	.	0			c.C347A						PASS	.						39.0	41.0	40.0					20																	2779177		2203	4300	6503	SO:0001583	missense	56265	exon3			AAAGGAGGACAGC	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.347C>A	chr20.hg19:g.2779177G>T	ENSP00000369979:p.Pro116His	19.0	0.0	.		35.0	6.0	.	NM_001184699	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	hg19	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346218	0.82022	.	.	ENSG00000088882	ENST00000380605	D	0.98914	-5.23	4.6	4.6	0.57074	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000001	D	0.98779	0.9589	M	0.64080	1.96	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.99564	1.0969	10	0.87932	D	0	-18.0862	14.9658	0.71193	0.0:0.0:1.0:0.0	.	116;116	Q8N2E1;Q96SM3	.;CPXM1_HUMAN	H	116	ENSP00000369979:P116H	ENSP00000369979:P116H	P	-	2	0	CPXM1	2727177	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.455000	0.97625	2.398000	0.81561	0.563000	0.77884	CCT	.	.	.	none		0.602	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
RBBP8NL	140893	hgsc.bcm.edu	37	20	60988918	60988918	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr20:60988918C>G	ENST00000252998.1	-	10	1645	c.1489G>C	c.(1489-1491)Ggg>Cgg	p.G497R		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	497	Pro-rich.					extracellular space (GO:0005615)											ACTCTGGTCCCCTTGGTGCCA	0.692																																					p.G497R		Atlas-SNP	.											.	.	.	.	0			c.G1489C						PASS	.						12.0	11.0	11.0					20																	60988918		2184	4286	6470	SO:0001583	missense	140893	exon10			TGGTCCCCTTGGT	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.1489G>C	chr20.hg19:g.60988918C>G	ENSP00000252998:p.Gly497Arg	106.0	0.0	.		110.0	50.0	.	NM_080833	B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Missense_Mutation	SNP	ENST00000252998.1	hg19	CCDS13498.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.525223	0.44969	.	.	ENSG00000130701	ENST00000252998	T	0.19532	2.14	3.49	1.32	0.21799	.	1.401760	0.04423	N	0.367918	T	0.24044	0.0582	L	0.43152	1.355	0.09310	N	1	D	0.60160	0.987	P	0.49012	0.598	T	0.16988	-1.0384	10	0.41790	T	0.15	-3.3453	4.3029	0.10933	0.0:0.6278:0.238:0.1342	.	497	Q8NC74	CT151_HUMAN	R	497	ENSP00000252998:G497R	ENSP00000252998:G497R	G	-	1	0	C20orf151	60422313	0.000000	0.05858	0.020000	0.16555	0.119000	0.20118	0.123000	0.15708	0.822000	0.34565	-0.339000	0.08088	GGG	.	.	.	none		0.692	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080029.1	NM_080833	
DIDO1	11083	hgsc.bcm.edu	37	20	61513486	61513486	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr20:61513486T>A	ENST00000266070.4	-	16	4147	c.3822A>T	c.(3820-3822)aaA>aaT	p.K1274N	DIDO1_ENST00000395343.1_Missense_Mutation_p.K1274N	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1274	Pro-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					ATGACAGCACTTTTAGCACCG	0.647																																					p.K1274N	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											.	DIDO1	321	.	0			c.A3822T						PASS	.						73.0	80.0	78.0					20																	61513486		2203	4300	6503	SO:0001583	missense	11083	exon16			CAGCACTTTTAGC	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3822A>T	chr20.hg19:g.61513486T>A	ENSP00000266070:p.Lys1274Asn	78.0	0.0	.		90.0	42.0	.	NM_001193369	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	hg19	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.556495	0.65425	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.09445	2.98;2.98	5.3	-3.1	0.05315	.	0.000000	0.45867	D	0.000337	T	0.17280	0.0415	M	0.76838	2.35	0.18873	N	0.999989	P	0.51933	0.949	P	0.46585	0.521	T	0.16630	-1.0396	10	0.62326	D	0.03	-20.2186	14.5469	0.68038	0.0:0.5842:0.0:0.4158	.	1274	Q9BTC0	DIDO1_HUMAN	N	1274	ENSP00000266070:K1274N;ENSP00000378752:K1274N	ENSP00000266070:K1274N	K	-	3	2	DIDO1	60983931	0.002000	0.14202	0.000000	0.03702	0.012000	0.07955	-0.248000	0.08854	-0.761000	0.04670	-0.376000	0.06991	AAA	.	.	.	none		0.647	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
KLHL34	257240	hgsc.bcm.edu	37	X	21674429	21674429	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chrX:21674429A>G	ENST00000379499.2	-	1	2019	c.1478T>C	c.(1477-1479)cTc>cCc	p.L493P		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	493						extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						TAAGTCCCGGAGGCTGCTCGC	0.697																																					p.L493P		Atlas-SNP	.											.	KLHL34	76	.	0			c.T1478C						PASS	.						30.0	18.0	22.0					X																	21674429		2201	4298	6499	SO:0001583	missense	257240	exon1			TCCCGGAGGCTGC	AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.1478T>C	chrX.hg19:g.21674429A>G	ENSP00000368813:p.Leu493Pro	55.0	0.0	.		52.0	17.0	.	NM_153270		Missense_Mutation	SNP	ENST00000379499.2	hg19	CCDS14199.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.607556	0.28623	.	.	ENSG00000185915	ENST00000379499	T	0.54675	0.56	5.54	5.54	0.83059	Kelch-type beta propeller (1);	0.486321	0.17614	N	0.167973	T	0.67711	0.2922	M	0.78916	2.43	0.49483	D	0.99979	D	0.61080	0.989	P	0.61070	0.883	T	0.70371	-0.4890	10	0.62326	D	0.03	.	8.8221	0.35032	0.8129:0.1871:0.0:0.0	.	493	Q8N239	KLH34_HUMAN	P	493	ENSP00000368813:L493P	ENSP00000368813:L493P	L	-	2	0	KLHL34	21584350	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	3.067000	0.50010	1.849000	0.53698	0.486000	0.48141	CTC	.	.	.	none		0.697	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270	
UTP14A	10813	hgsc.bcm.edu	37	X	129058817	129058817	+	Silent	SNP	G	G	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chrX:129058817G>A	ENST00000394422.3	+	12	1423	c.1395G>A	c.(1393-1395)caG>caA	p.Q465Q	UTP14A_ENST00000425117.2_Silent_p.Q413Q|UTP14A_ENST00000371042.3_Silent_p.Q297Q|UTP14A_ENST00000371051.5_Silent_p.Q411Q|RP4-537K23.4_ENST00000432062.1_RNA	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	465					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						TACTATCTCAGAAATTGAAGG	0.473																																					p.Q465Q		Atlas-SNP	.											.	UTP14A	74	.	0			c.G1395A						PASS	.						132.0	142.0	139.0					X																	129058817		2203	4300	6503	SO:0001819	synonymous_variant	10813	exon12			ATCTCAGAAATTG	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1395G>A	chrX.hg19:g.129058817G>A		83.0	0.0	.		102.0	55.0	.	NM_006649	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Silent	SNP	ENST00000394422.3	hg19	CCDS14615.1																																																																																			.	.	.	none		0.473	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649	
GTF3C1	2975	hgsc.bcm.edu	37	16	27561107	27561108	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr16:27561107_27561108insA	ENST00000356183.4	-	1	119_120	c.104_105insT	c.(103-105)ttcfs	p.F35fs	GTF3C1_ENST00000561623.1_Frame_Shift_Ins_p.F35fs|KIAA0556_ENST00000261588.4_5'Flank	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	35					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						AAGGCAGCGGGAAGGGCGGCAC	0.678																																					p.F35fs		Atlas-Indel,Pindel	.											.	GTF3C1	210	.	0			c.105_106insT						PASS	.																																			SO:0001589	frameshift_variant	2975	exon1			.	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.105dupT	chr16.hg19:g.27561109_27561109dupA	ENSP00000348510:p.Phe35fs	97.0	0.0	0		140.0	65.0	0.464286	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Frame_Shift_Ins	INS	ENST00000356183.4	hg19	CCDS32414.1																																																																																			.	.	.	none		0.678	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
PIK3C2B	5287	hgsc.bcm.edu	37	1	204433195	204433198	+	Frame_Shift_Del	DEL	CATT	CATT	-			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	CATT	CATT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr1:204433195_204433198delCATT	ENST00000367187.3	-	6	1808_1811	c.1252_1255delAATG	c.(1252-1257)aatgtgfs	p.NV418fs	PIK3C2B_ENST00000424712.2_Frame_Shift_Del_p.NV418fs	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	418	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CCCACGTCCACATTCCTCAGGTCA	0.539																																					p.418_419del		Atlas-Indel,Pindel	.											.	PIK3C2B	142	.	0			c.1253_1256del						PASS	.																																			SO:0001589	frameshift_variant	5287	exon6			.	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.1252_1255delAATG	chr1.hg19:g.204433195_204433198delCATT	ENSP00000356155:p.Asn418fs	63.0	0.0	0		69.0	12.0	0.173913	NM_002646	O95666|Q5SW99	Frame_Shift_Del	DEL	ENST00000367187.3	hg19	CCDS1446.1																																																																																			.	.	.	none		0.539	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
IL18	3606	hgsc.bcm.edu	37	11	112019383	112019384	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr11:112019383_112019384delAG	ENST00000280357.7	-	5	521_522	c.302_303delCT	c.(301-303)tctfs	p.S101fs	IL18_ENST00000524595.1_Frame_Shift_Del_p.S97fs|SDHD_ENST00000532699.1_Intron|IL18_ENST00000528832.1_Frame_Shift_Del_p.S101fs|IL18_ENST00000533858.1_5'UTR	NM_001562.3	NP_001553.1	Q14116	IL18_HUMAN	interleukin 18	101					angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|cellular response to organic cyclic compound (GO:0071407)|chemokine biosynthetic process (GO:0042033)|granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0042253)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma biosynthetic process (GO:0042095)|interleukin-13 biosynthetic process (GO:0042231)|interleukin-2 biosynthetic process (GO:0042094)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|natural killer cell activation (GO:0030101)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of tissue remodeling (GO:0034105)|regulation of cell adhesion (GO:0030155)|sleep (GO:0030431)|T-helper 1 type immune response (GO:0042088)|type 2 immune response (GO:0042092)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)						all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|Epithelial(105;8.15e-07)|all cancers(92;1.43e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.055)		CACACTTCACAGAGATAGTTAC	0.317																																					p.101_102del		Atlas-Indel,Pindel	.											.	IL18	10	.	0			c.303_304del						PASS	.																																			SO:0001589	frameshift_variant	3606	exon5			.	U90434	CCDS44731.1, CCDS58180.1	11q22.2-q22.3	2014-04-04	2014-04-04		ENSG00000150782	ENSG00000150782		"""Interleukins and interleukin receptors"""	5986	protein-coding gene	gene with protein product	"""interferon-gamma-inducing factor"""	600953	"""interleukin 18 (interferon-gamma-inducing factor)"""			7477296, 9693051	Standard	NM_001562		Approved	IGIF, IL1F4, IL-1g, IL-18	uc001pnb.2	Q14116	OTTHUMG00000167006	ENST00000280357.7:c.302_303delCT	chr11.hg19:g.112019385_112019386delAG	ENSP00000280357:p.Ser101fs	172.0	0.0	0		144.0	39.0	0.270833	NM_001562	O75599|Q6FGY3|Q6WWJ7	Frame_Shift_Del	DEL	ENST00000280357.7	hg19	CCDS44731.1																																																																																			.	.	.	none		0.317	IL18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392409.1	NM_001562	
OR9A4	130075	hgsc.bcm.edu	37	7	141619202	141619203	+	Frame_Shift_Ins	INS	-	-	T	rs562194466		TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr7:141619202_141619203insT	ENST00000548136.1	+	1	586_587	c.527_528insT	c.(526-531)aattttfs	p.NF176fs	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N176I(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					GTGGTGAACAATTTTTTTTGTG	0.381																																					p.N176fs		Atlas-Indel,Pindel	.											OR9A4,NS,carcinoma,0,1	OR9A4	58	.	1	Substitution - Missense(1)	endometrium(1)	c.527_528insT						PASS	.			0,3918		0,0,1959						2.6	0.9			152	1,8101		0,1,4050	no	frameshift	OR9A4	NM_001001656.1		0,1,6009	A1A1,A1R,RR		0.0123,0.0,0.0083				1,12019				SO:0001589	frameshift_variant	130075	exon1			.		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.535dupT	chr7.hg19:g.141619210_141619210dupT	ENSP00000448789:p.Asn176fs	86.0	0.0	0		137.0	13.0	0.0948905	NM_001001656	B9EGV6|Q6IFI4	Frame_Shift_Ins	INS	ENST00000548136.1	hg19	CCDS43661.1																																																																																			.	.	.	none		0.381	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656	
LIMA1	51474	hgsc.bcm.edu	37	12	50571415	50571415	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr12:50571415delA	ENST00000341247.4	-	11	1861	c.1712delT	c.(1711-1713)gtcfs	p.V571fs	LIMA1_ENST00000552491.1_Frame_Shift_Del_p.V268fs|LIMA1_ENST00000552909.1_Frame_Shift_Del_p.V410fs|LIMA1_ENST00000552783.1_Frame_Shift_Del_p.V412fs|LIMA1_ENST00000394943.3_Frame_Shift_Del_p.V572fs|LIMA1_ENST00000552823.1_Frame_Shift_Del_p.V411fs|LIMA1_ENST00000547825.1_Frame_Shift_Del_p.V269fs	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	571					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						ATCTAGATCGACATCCTCAGG	0.478																																					p.V572fs		Atlas-Indel,Pindel	.											LIMA1,NS,carcinoma,0,1	LIMA1	67	.	0			c.1716delC						PASS	.						123.0	123.0	123.0					12																	50571415		2203	4300	6503	SO:0001589	frameshift_variant	51474	exon11			.	AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.1712delT	chr12.hg19:g.50571415delA	ENSP00000340184:p.Val571fs	116.0	0.0	0		138.0	51.0	0.369565	NM_001113546	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Frame_Shift_Del	DEL	ENST00000341247.4	hg19	CCDS8802.1																																																																																			.	.	.	none		0.478	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406235.2	NM_016357	
ATXN2	6311	hgsc.bcm.edu	37	12	111951273	111951273	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr12:111951273delG	ENST00000377617.3	-	11	2087	c.1926delC	c.(1924-1926)tccfs	p.S642fs	ATXN2_ENST00000550104.1_Frame_Shift_Del_p.S642fs|ATXN2_ENST00000608853.1_Frame_Shift_Del_p.S482fs|ATXN2_ENST00000389153.4_Frame_Shift_Del_p.S377fs|ATXN2_ENST00000542287.2_Frame_Shift_Del_p.S377fs|ATXN2_ENST00000535949.1_Frame_Shift_Del_p.S353fs	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	642	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						CACTGGATATGGAACCCCTCC	0.532																																					p.I643fs		Atlas-Indel,Pindel	.											.	ATXN2	99	.	0			c.1927delA						PASS	.						94.0	80.0	84.0					12																	111951273		2203	4300	6503	SO:0001589	frameshift_variant	6311	exon11			.	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.1926delC	chr12.hg19:g.111951273delG	ENSP00000366843:p.Ser642fs	95.0	0.0	0		126.0	24.0	0.190476	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Frame_Shift_Del	DEL	ENST00000377617.3	hg19	CCDS31902.1																																																																																			.	.	.	none		0.532	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
NLRP1	22861	hgsc.bcm.edu	37	17	5424855	5424865	+	Frame_Shift_Del	DEL	AGCAGTCACTT	AGCAGTCACTT	-	rs556315689|rs200659907		TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	AGCAGTCACTT	AGCAGTCACTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr17:5424855_5424865delAGCAGTCACTT	ENST00000572272.1	-	13	3761_3771	c.3762_3772delAAGTGACTGCT	c.(3760-3774)ccaagtgactgctccfs	p.SDCS1255fs	NLRP1_ENST00000354411.3_Frame_Shift_Del_p.SDCS1225fs|NLRP1_ENST00000577119.1_Frame_Shift_Del_p.SDCS1225fs|NLRP1_ENST00000345221.3_Frame_Shift_Del_p.SDCS1255fs|NLRP1_ENST00000269280.4_Frame_Shift_Del_p.SDCS1255fs|NLRP1_ENST00000262467.5_Frame_Shift_Del_p.SDCS1259fs			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1255					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				TTCCGAATGGAGCAGTCACTTGGGATCAGGT	0.545																																					p.1259_1262del		Atlas-INDEL	.											.	NLRP1	358	.	0			c.3775_3785del						PASS	.																																			SO:0001589	frameshift_variant	22861	exon13			.	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3762_3772delAAGTGACTGCT	chr17.hg19:g.5424855_5424865delAGCAGTCACTT	ENSP00000460475:p.Ser1255fs	51.0	0.0	0		76.0	10.0	0.131579	NM_001033053	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Frame_Shift_Del	DEL	ENST00000572272.1	hg19	CCDS42246.1																																																																																			.	.	.	none		0.545	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
ZNF287	57336	hgsc.bcm.edu	37	17	16455883	16455885	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr17:16455883_16455885delGAA	ENST00000395824.1	-	6	2188_2190	c.1571_1573delTTC	c.(1570-1575)cttcag>cag	p.L524del	ZNF287_ENST00000395825.3_In_Frame_Del_p.L524del			Q9HBT7	ZN287_HUMAN	zinc finger protein 287	517					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|prostate(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		TTTTGATGCTGAAGAAGGTGTGT	0.35																																					p.524_525del		Atlas-Indel,Pindel	.											.	ZNF287	60	.	0			c.1572_1574del						PASS	.																																			SO:0001651	inframe_deletion	57336	exon6			.	AF217227	CCDS11179.2	17p11.2	2013-01-09			ENSG00000141040	ENSG00000141040		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13502	protein-coding gene	gene with protein product							Standard	NM_020653		Approved	ZKSCAN13, ZSCAN45	uc002gqi.2	Q9HBT7	OTTHUMG00000058993	ENST00000395824.1:c.1571_1573delTTC	chr17.hg19:g.16455886_16455888delGAA	ENSP00000379168:p.Leu524del	165.0	0.0	0		233.0	32.0	0.137339	NM_020653	Q6IAG1	In_Frame_Del	DEL	ENST00000395824.1	hg19	CCDS11179.2																																																																																			.	.	.	none		0.350	ZNF287-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130504.1		
EIF4A2	1974	hgsc.bcm.edu	37	3	186505347	186505348	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr3:186505347_186505348insA	ENST00000323963.5	+	9	1037_1038	c.973_974insA	c.(973-975)cgtfs	p.R325fs	EIF4A2_ENST00000440191.2_Frame_Shift_Ins_p.R326fs|EIF4A2_ENST00000356531.5_Frame_Shift_Ins_p.R230fs|SNORA63_ENST00000363548.1_RNA|SNORA81_ENST00000408493.2_RNA|SNORD2_ENST00000459163.1_RNA|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363450.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	325	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		AGGGTCAAGTCGTGTTCTGATC	0.396			T	BCL6	NHL																																p.R325fs		Atlas-Indel,Pindel	.		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	EIF4A2	55	.	0			c.973_974insA						PASS	.																																			SO:0001589	frameshift_variant	1974	exon9			.	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	Exception_encountered	chr3.hg19:g.186505347_186505348insA	ENSP00000326381:p.Arg325fs	174.0	0.0	0		200.0	28.0	0.14	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Frame_Shift_Ins	INS	ENST00000323963.5	hg19	CCDS3282.1																																																																																			.	.	.	none		0.396	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
OR2T4	127074	hgsc.bcm.edu	37	1	248524967	248524969	+	In_Frame_Del	DEL	ATG	ATG	-	rs200915140	byFrequency	TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	ATG	ATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr1:248524967_248524969delATG	ENST00000366475.1	+	1	85_87	c.85_87delATG	c.(85-87)atgdel	p.M29del		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAAACATCCAATGGCCAATATCA	0.498																																					p.28_29del		Atlas-INDEL	.											.	OR2T4	126	.	0			c.84_86del						PASS	.																																			SO:0001651	inframe_deletion	127074	exon1			.	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.85_87delATG	chr1.hg19:g.248524967_248524969delATG	ENSP00000355431:p.Met29del	11.0	0.0	0		15.0	14.0	0.933333	NM_001004696	Q6IEZ8	In_Frame_Del	DEL	ENST00000366475.1	hg19	CCDS31113.1																																																																																			.	.	.	none		0.498	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
ALDOB	229	hgsc.bcm.edu	37	9	104187772	104187773	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr9:104187772_104187773insA	ENST00000374855.4	-	7	885_886	c.761_762insT	c.(760-762)gtafs	p.V254fs	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	254					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				GGAGAGCTGTTACGGTGGCCAT	0.51																																					p.V254fs		Atlas-Indel,Pindel	.											.	ALDOB	69	.	0			c.762_763insT						PASS	.																																			SO:0001589	frameshift_variant	229	exon7			.	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.762dupT	chr9.hg19:g.104187773_104187773dupA	ENSP00000363988:p.Val254fs	100.0	0.0	0		110.0	26.0	0.236364	NM_000035	Q13741|Q13742|Q5T7D6	Frame_Shift_Ins	INS	ENST00000374855.4	hg19	CCDS6756.1																																																																																			.	.	.	none		0.510	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2		
DHX8	1659	hgsc.bcm.edu	37	17	41584425	41584426	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr17:41584425_41584426delAC	ENST00000262415.3	+	13	1855_1856	c.1783_1784delAC	c.(1783-1785)acafs	p.T596fs	DHX8_ENST00000540306.1_Frame_Shift_Del_p.T596fs	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	596	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		ATCTGGAAAGACAACACAGATC	0.49																																					p.594_595del	NSCLC(56;1548 1661 49258 49987)	Atlas-Indel,Pindel	.											.	DHX8	98	.	0			c.1782_1783del						PASS	.																																			SO:0001589	frameshift_variant	1659	exon13			.	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1783_1784delAC	chr17.hg19:g.41584425_41584426delAC	ENSP00000262415:p.Thr596fs	52.0	0.0	0		80.0	12.0	0.15	NM_004941		Frame_Shift_Del	DEL	ENST00000262415.3	hg19	CCDS11464.1																																																																																			.	.	.	none		0.490	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		
SUCLA2	8803	hgsc.bcm.edu	37	13	48528276	48528276	+	Splice_Site	DEL	T	T	-			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chr13:48528276delT	ENST00000378654.3	-	8	1162	c.1106delA	c.(1105-1107)aag>ag	p.K369fs	SUCLA2_ENST00000534875.1_Splice_Site_p.K311fs|SUCLA2_ENST00000544100.1_Splice_Site_p.K235fs|SUCLA2_ENST00000543413.1_Splice_Site_p.K311fs	NM_003850.2	NP_003841.1	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	369					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|succinyl-CoA pathway (GO:0006781)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(4)	15		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	TGCCCTTACCTTTTTATCTGA	0.303																																					p.K369fs		Pindel	.											.	SUCLA2	40	.	0			c.1107delG						PASS	.						36.0	36.0	36.0					13																	48528276		2203	4300	6503	SO:0001630	splice_region_variant	8803	exon8			.	AF058953	CCDS9406.1	13q12.2-q13.3	2010-04-16			ENSG00000136143	ENSG00000136143	6.2.1.5		11448	protein-coding gene	gene with protein product		603921				9765291	Standard	NM_003850		Approved		uc001vbs.3	Q9P2R7	OTTHUMG00000016889	ENST00000378654.3:c.1107+1A>-	chr13.hg19:g.48528276delT		136.0	0.0	.		140.0	15.0	0.107	NM_003850	B2RDE7|O95194|Q5T9Q4|Q5T9Q6|Q9NV21|Q9NVP7	Frame_Shift_Del	DEL	ENST00000378654.3	hg19	CCDS9406.1																																																																																			.	.	.	none		0.303	SUCLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044852.1		Frame_Shift_Del
KLHL15	80311	hgsc.bcm.edu	37	X	24024135	24024157	+	Frame_Shift_Del	DEL	AGCAAAACCGGATATTCTGAATG	AGCAAAACCGGATATTCTGAATG	-			TCGA-A4-A7UZ-01A-12D-A34Z-10	TCGA-A4-A7UZ-10A-01D-A34Z-10	AGCAAAACCGGATATTCTGAATG	AGCAAAACCGGATATTCTGAATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	991be3fd-4490-49c9-8019-27879e3192bd	fc283c2e-af56-4460-b252-9f1dc8940a6e	g.chrX:24024135_24024157delAGCAAAACCGGATATTCTGAATG	ENST00000328046.8	-	3	909_931	c.654_676delCATTCAGAATATCCGGTTTTGCT	c.(652-678)atcattcagaatatccggttttgcttgfs	p.IQNIRFCL219fs		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	219	BACK.				protein ubiquitination (GO:0016567)					autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						GGGGTCATCAAGCAAAACCGGATATTCTGAATGATGGTATCGG	0.43																																					p.219_226del		Pindel	.											.	KLHL15	50	.	0			c.655_677del						PASS	.																																			SO:0001589	frameshift_variant	80311	exon3			.	AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.654_676delCATTCAGAATATCCGGTTTTGCT	chrX.hg19:g.24024135_24024157delAGCAAAACCGGATATTCTGAATG	ENSP00000332791:p.Ile219fs	77.0	0.0	.		66.0	12.0	0.182	NM_030624	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	Frame_Shift_Del	DEL	ENST00000328046.8	hg19	CCDS35217.1																																																																																			.	.	.	none		0.430	KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056078.1	XM_040383	
