#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA7	10347	hgsc.bcm.edu	37	19	1049305	1049305	+	Silent	SNP	C	C	A	rs4147915	byFrequency	TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr19:1049305C>A	ENST00000263094.6	+	18	2652	c.2421C>A	c.(2419-2421)gtC>gtA	p.V807V	ABCA7_ENST00000433129.1_Silent_p.V807V|ABCA7_ENST00000435683.2_Silent_p.V669V	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	807	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCTGGCGTCTCCGTTCGCA	0.667													C|||	1001	0.19988	0.1157	0.2752	5008	,	,		9249	0.371		0.1233	False		,,,				2504	0.1626																0								C		539,3865	239.9+/-250.9	34,471,1697	53.0	61.0	59.0		2421	1.7	0.8	19	dbSNP_110	59	1175,7421	238.3+/-269.8	83,1009,3206	no	coding-synonymous	ABCA7	NM_019112.3		117,1480,4903	AA,AC,CC		13.6691,12.2389,13.1846		807/2147	1049305	1714,11286	2202	4298	6500	SO:0001819	synonymous_variant	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.2421C>A	19.37:g.1049305C>A			Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																				0.667	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1		NM_019112	
ADHFE1	137872	hgsc.bcm.edu	37	8	67380563	67380563	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr8:67380563T>A	ENST00000396623.3	+	14	1411	c.1380T>A	c.(1378-1380)ttT>ttA	p.F460L	ADHFE1_ENST00000496501.1_3'UTR|ADHFE1_ENST00000415254.1_Missense_Mutation_p.F412L|C8orf46_ENST00000482608.2_Intron	NM_144650.2	NP_653251.2	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	460					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|molecular hydrogen transport (GO:0015993)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacid-oxoacid transhydrogenase activity (GO:0047988)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	29		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			CTGCTCTGTTTGAAGCTTCAA	0.438																																																	0													92.0	86.0	88.0					8																	67380563		2203	4300	6503	SO:0001583	missense	137872			AK056992	CCDS6190.2	8q12.3	2013-05-21			ENSG00000147576	ENSG00000147576	1.1.99.24	"""Alcohol dehydrogenases"""	16354	protein-coding gene	gene with protein product	"""hydroxyacid-oxoacid transhydrogenase"""	611083				12592711	Standard	NM_144650		Approved	ADHFe1, FLJ32430	uc003xwb.4	Q8IWW8	OTTHUMG00000150215	ENST00000396623.3:c.1380T>A	8.37:g.67380563T>A	ENSP00000379865:p.Phe460Leu		B4DTJ8|Q49A19|Q68CI7|Q6P2B6|Q96MF9	Missense_Mutation	SNP	ENST00000396623.3	37	CCDS6190.2	.	.	.	.	.	.	.	.	.	.	T	15.66	2.899852	0.52227	.	.	ENSG00000147576	ENST00000396623;ENST00000415254	T;T	0.36699	1.24;1.24	5.47	1.63	0.23807	.	0.000000	0.85682	D	0.000000	T	0.31575	0.0801	L	0.39326	1.205	0.80722	D	1	B	0.34226	0.443	B	0.40285	0.325	T	0.04752	-1.0929	10	0.41790	T	0.15	-6.6939	9.6229	0.39732	0.0:0.204:0.0:0.796	.	460	Q8IWW8	HOT_HUMAN	L	460;412	ENSP00000379865:F460L;ENSP00000407115:F412L	ENSP00000379865:F460L	F	+	3	2	ADHFE1	67543117	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	1.297000	0.33400	0.037000	0.15575	0.482000	0.46254	TTT		0.438	ADHFE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316867.3		NM_144650	
AK5	26289	hgsc.bcm.edu	37	1	77759516	77759516	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr1:77759516G>T	ENST00000354567.2	+	3	549	c.286G>T	c.(286-288)Gac>Tac	p.D96Y	AK5_ENST00000344720.5_Missense_Mutation_p.D70Y|AK5_ENST00000317704.4_Intron	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	96					ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						TCGGCGGTATGACCGGCTCCC	0.408																																																	0													62.0	65.0	64.0					1																	77759516		2203	4300	6503	SO:0001583	missense	26289			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.286G>T	1.37:g.77759516G>T	ENSP00000346577:p.Asp96Tyr		Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	ENST00000354567.2	37	CCDS675.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552208	0.86127	.	.	ENSG00000154027	ENST00000354567;ENST00000344720;ENST00000478407	T;T;D	0.83755	-0.67;-0.67;-1.76	5.13	5.13	0.70059	.	0.055248	0.64402	D	0.000001	D	0.82926	0.5143	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	D	0.85790	0.1367	10	0.87932	D	0	-5.5794	18.9488	0.92632	0.0:0.0:1.0:0.0	.	96	Q9Y6K8	KAD5_HUMAN	Y	96;70;70	ENSP00000346577:D96Y;ENSP00000341430:D70Y;ENSP00000434409:D70Y	ENSP00000341430:D70Y	D	+	1	0	AK5	77532104	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.553000	0.82203	2.568000	0.86640	0.561000	0.74099	GAC		0.408	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026993.4		NM_174858	
ARHGAP12	94134	hgsc.bcm.edu;ucsc.edu	37	10	32098041	32098041	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr10:32098041A>C	ENST00000344936.2	-	18	2378	c.2144T>G	c.(2143-2145)tTg>tGg	p.L715W	ARHGAP12_ENST00000396144.4_Missense_Mutation_p.L710W|ARHGAP12_ENST00000311380.4_Missense_Mutation_p.L663W|ARHGAP12_ENST00000375250.5_Missense_Mutation_p.L685W|ARHGAP12_ENST00000492028.1_5'UTR|ARHGAP12_ENST00000375245.4_Missense_Mutation_p.L663W	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	715	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				ACTGTCATTCAAGTCCAATTT	0.308																																																	0													67.0	66.0	66.0					10																	32098041		2203	4300	6503	SO:0001583	missense	94134			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.2144T>G	10.37:g.32098041A>C	ENSP00000345808:p.Leu715Trp		B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	ENST00000344936.2	37	CCDS7170.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.645150	0.87859	.	.	ENSG00000165322	ENST00000311380;ENST00000375250;ENST00000344936;ENST00000396144;ENST00000375245	T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07	5.96	5.96	0.96718	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.64483	0.2602	H	0.98155	4.16	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	T	0.79063	-0.1957	10	0.87932	D	0	.	16.4311	0.83844	1.0:0.0:0.0:0.0	.	668;685;710;715;663;14	Q1RLN5;Q8IWW6-2;Q504X1;Q8IWW6;Q8IWW6-3;Q9NV28	.;.;.;RHG12_HUMAN;.;.	W	663;685;715;710;663	ENSP00000310984:L663W;ENSP00000364399:L685W;ENSP00000345808:L715W;ENSP00000379448:L710W;ENSP00000364394:L663W	ENSP00000310984:L663W	L	-	2	0	ARHGAP12	32138047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.169000	0.94788	2.277000	0.76020	0.528000	0.53228	TTG		0.308	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047465.1			
ARMC10	83787	hgsc.bcm.edu	37	7	102738906	102738906	+	Missense_Mutation	SNP	A	A	G	rs149661299	byFrequency	TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:102738906A>G	ENST00000323716.3	+	7	1330	c.938A>G	c.(937-939)cAt>cGt	p.H313R	ARMC10_ENST00000441711.2_Missense_Mutation_p.H278R|ARMC10_ENST00000541300.1_Missense_Mutation_p.H195R|ARMC10_ENST00000454559.1_Missense_Mutation_p.H219R|ARMC10_ENST00000425331.1_Missense_Mutation_p.H254R|ARMC10_ENST00000428183.2_Missense_Mutation_p.H254R	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	313					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						TTCCTGTTACATGGAGAAGAA	0.383													A|||	5	0.000998403	0.0008	0.0	5008	,	,		18310	0.0		0.004	False		,,,				2504	0.0																0								A	ARG/HIS,ARG/HIS,ARG/HIS,ARG/HIS,ARG/HIS,ARG/HIS	1,4403	2.1+/-5.4	0,1,2201	62.0	56.0	58.0		833,761,761,656,584,938	5.7	1.0	7	dbSNP_134	58	11,8549	7.1+/-27.0	0,11,4269	no	missense,missense,missense,missense,missense,missense	ARMC10	NM_001161009.2,NM_001161010.2,NM_001161011.2,NM_001161012.2,NM_001161013.2,NM_031905.4	29,29,29,29,29,29	0,12,6470	GG,GA,AA		0.1285,0.0227,0.0926	benign,benign,benign,benign,benign,benign	278/309,254/285,254/285,219/250,195/226,313/344	102738906	12,12952	2202	4280	6482	SO:0001583	missense	83787			AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.938A>G	7.37:g.102738906A>G	ENSP00000319412:p.His313Arg		A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Missense_Mutation	SNP	ENST00000323716.3	37	CCDS5728.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	11.26	1.587404	0.28268	2.27E-4	0.001285	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000431642	T;T;T;T;T;T;T	0.27890	1.68;1.68;1.68;1.68;1.64;1.64;1.64	5.68	5.68	0.88126	Armadillo-type fold (1);	0.250050	0.42053	D	0.000765	T	0.19805	0.0476	N	0.14661	0.345	0.21105	N	0.999788	B;P;B;B;P;P	0.41265	0.391;0.744;0.015;0.375;0.709;0.579	B;B;B;B;B;B	0.41510	0.275;0.142;0.054;0.245;0.088;0.359	T	0.14448	-1.0472	10	0.25751	T	0.34	-5.385	10.8898	0.46990	0.8591:0.0:0.0:0.1409	.	254;195;219;254;278;313	B4DWJ8;F5GX65;Q8N2F6-4;Q8N2F6-3;Q8N2F6-2;Q8N2F6	.;.;.;.;.;ARM10_HUMAN	R	313;254;278;219;254;195;155	ENSP00000319412:H313R;ENSP00000396654:H254R;ENSP00000413619:H278R;ENSP00000405612:H219R;ENSP00000397969:H254R;ENSP00000440463:H195R;ENSP00000406840:H155R	ENSP00000319412:H313R	H	+	2	0	ARMC10	102526142	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	1.954000	0.40362	2.289000	0.77006	0.482000	0.46254	CAT		0.383	ARMC10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347882.1		NM_031905	
ATRIP	84126	hgsc.bcm.edu	37	3	48506401	48506401	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr3:48506401G>T	ENST00000320211.3	+	12	2340	c.2227G>T	c.(2227-2229)Gag>Tag	p.E743*	TREX1_ENST00000422277.2_5'Flank|ATRIP_ENST00000412052.1_Nonsense_Mutation_p.E650*|ATRIP_ENST00000357105.6_Nonsense_Mutation_p.E616*|TREX1_ENST00000296443.9_5'Flank|TREX1_ENST00000456089.1_5'Flank|ATRIP_ENST00000346691.4_Nonsense_Mutation_p.E716*|TREX1_ENST00000433541.1_5'Flank|SHISA5_ENST00000465449.1_5'Flank|TREX1_ENST00000436480.2_5'Flank|TREX1_ENST00000444177.1_5'Flank	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	743					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCACTGCGTGGAGGTCCTGCA	0.612								Other conserved DNA damage response genes																																									0													120.0	110.0	114.0					3																	48506401		2203	4300	6503	SO:0001587	stop_gained	84126			AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.2227G>T	3.37:g.48506401G>T	ENSP00000323099:p.Glu743*		A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Nonsense_Mutation	SNP	ENST00000320211.3	37	CCDS2768.1	.	.	.	.	.	.	.	.	.	.	G	40	8.132604	0.98670	.	.	ENSG00000164053	ENST00000320211;ENST00000346691;ENST00000357105;ENST00000412052	.	.	.	5.51	5.51	0.81932	.	0.268514	0.41823	D	0.000818	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-16.1457	16.9018	0.86116	0.0:0.0:1.0:0.0	.	.	.	.	X	743;716;616;650	.	ENSP00000323099:E743X	E	+	1	0	ATRIP	48481405	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.108000	0.77055	2.582000	0.87167	0.655000	0.94253	GAG		0.612	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2		NM_130384	
BAIAP3	8938	hgsc.bcm.edu	37	16	1394310	1394310	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr16:1394310G>T	ENST00000324385.5	+	17	1857	c.1699G>T	c.(1699-1701)Gcc>Tcc	p.A567S	BAIAP3_ENST00000421665.2_Missense_Mutation_p.A496S|BAIAP3_ENST00000562208.1_Missense_Mutation_p.A509S|BAIAP3_ENST00000568887.1_Missense_Mutation_p.A504S|BAIAP3_ENST00000426824.3_Missense_Mutation_p.A532S|BAIAP3_ENST00000397488.2_Missense_Mutation_p.A549S|BAIAP3_ENST00000397489.1_Missense_Mutation_p.A549S	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	567					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CATTGCTGCGGCCCTGAAGGT	0.632																																																	0													78.0	76.0	77.0					16																	1394310		2199	4300	6499	SO:0001583	missense	8938			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1699G>T	16.37:g.1394310G>T	ENSP00000324510:p.Ala567Ser		A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	37	CCDS10434.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.83|13.83	2.354689|2.354689	0.41700|0.41700	.|.	.|.	ENSG00000007516|ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665|ENST00000440627	T;T;T;T;T|.	0.77620|.	-1.07;-1.11;-1.09;-1.11;-1.1|.	4.37|4.37	3.41|3.41	0.39046|0.39046	.|.	0.308317|.	0.35378|.	N|.	0.003241|.	T|T	0.63581|0.63581	0.2523|0.2523	M|M	0.71581|0.71581	2.175|2.175	0.38151|0.38151	D|D	0.938753|0.938753	D;D;D;D|.	0.76494|.	0.999;0.999;0.999;0.991|.	D;D;D;P|.	0.65573|.	0.934;0.936;0.936;0.828|.	T|T	0.65660|0.65660	-0.6114|-0.6114	10|6	0.59425|0.51188	D|T	0.04|0.08	-16.729|-16.729	6.9563|6.9563	0.24574|0.24574	0.2151:0.0:0.7849:0.0|0.2151:0.0:0.7849:0.0	.|.	496;509;567;549|.	E7EUB9;B4DIK3;O94812;A2A2B2|.	.;.;BAIP3_HUMAN;.|.	S|V	532;549;567;549;496|172	ENSP00000407242:A532S;ENSP00000380625:A549S;ENSP00000324510:A567S;ENSP00000380626:A549S;ENSP00000409533:A496S|.	ENSP00000324510:A567S|ENSP00000394174:G172V	A|G	+|+	1|2	0|0	BAIAP3|BAIAP3	1334311|1334311	0.201000|0.201000	0.23410|0.23410	0.710000|0.710000	0.30468|0.30468	0.104000|0.104000	0.19210|0.19210	1.163000|1.163000	0.31798|0.31798	0.944000|0.944000	0.37579|0.37579	0.491000|0.491000	0.48974|0.48974	GCC|GGC		0.632	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3			
BCAT1	586	hgsc.bcm.edu;ucsc.edu	37	12	24985748	24985748	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr12:24985748G>T	ENST00000261192.7	-	9	1479	c.953C>A	c.(952-954)aCa>aAa	p.T318K	BCAT1_ENST00000539282.1_Missense_Mutation_p.T330K|BCAT1_ENST00000342945.5_Missense_Mutation_p.T257K|BCAT1_ENST00000544418.1_5'Flank|BCAT1_ENST00000539780.1_Missense_Mutation_p.T281K|BCAT1_ENST00000538118.1_Missense_Mutation_p.T317K|RP11-625L16.3_ENST00000545410.1_RNA	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic	318					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	CTCCAGGGCTGTTGTCAAGTC	0.428																																																	0													111.0	109.0	110.0					12																	24985748		1922	4140	6062	SO:0001583	missense	586				CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.953C>A	12.37:g.24985748G>T	ENSP00000261192:p.Thr318Lys		B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	Missense_Mutation	SNP	ENST00000261192.7	37	CCDS44845.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.118587	0.00349	.	.	ENSG00000060982	ENST00000261192;ENST00000538118;ENST00000342945;ENST00000539282;ENST00000539780	T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11	5.0	2.69	0.31865	.	0.667699	0.15774	N	0.245276	T	0.05914	0.0154	N	0.01751	-0.74	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.08055	0.003;0.0;0.001;0.001;0.0	T	0.38045	-0.9679	10	0.11794	T	0.64	-19.4593	3.6917	0.08348	0.146:0.1443:0.5626:0.1471	.	281;330;257;318;317	B7Z5L0;F5H5E4;B3KY27;P54687;Q68DQ7	.;.;.;BCAT1_HUMAN;.	K	318;317;257;330;281	ENSP00000261192:T318K;ENSP00000440817:T317K;ENSP00000339805:T257K;ENSP00000443459:T330K;ENSP00000440827:T281K	ENSP00000261192:T318K	T	-	2	0	BCAT1	24877015	0.000000	0.05858	0.003000	0.11579	0.128000	0.20619	0.573000	0.23699	1.198000	0.43158	0.655000	0.94253	ACA		0.428	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402080.1		NM_005504	
C12orf50	160419	hgsc.bcm.edu	37	12	88388466	88388466	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr12:88388466A>G	ENST00000298699.2	-	7	716	c.536T>C	c.(535-537)aTa>aCa	p.I179T	C12orf50_ENST00000550553.1_Missense_Mutation_p.I179T	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	179										NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						TGATGTTTTTATTTCACCTTG	0.348																																																	0													170.0	154.0	159.0					12																	88388466		2202	4299	6501	SO:0001583	missense	160419			AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.536T>C	12.37:g.88388466A>G	ENSP00000298699:p.Ile179Thr		Q6P674	Missense_Mutation	SNP	ENST00000298699.2	37	CCDS9031.1	.	.	.	.	.	.	.	.	.	.	A	4.681	0.126545	0.08931	.	.	ENSG00000165805	ENST00000298699;ENST00000550553;ENST00000551944	T;T	0.33438	1.41;1.41	5.01	1.3	0.21679	.	0.556483	0.18159	N	0.149830	T	0.23133	0.0559	L	0.55103	1.725	0.21325	N	0.999726	B;B	0.10296	0.002;0.003	B;B	0.12156	0.002;0.007	T	0.21586	-1.0241	10	0.25751	T	0.34	.	4.6344	0.12518	0.6651:0.1654:0.1695:0.0	.	233;179	G3V208;Q8NA57	.;CL050_HUMAN	T	179;179;233	ENSP00000298699:I179T;ENSP00000448344:I179T	ENSP00000298699:I179T	I	-	2	0	C12orf50	86912597	1.000000	0.71417	0.842000	0.33263	0.361000	0.29550	2.467000	0.45093	0.042000	0.15717	-0.321000	0.08615	ATA		0.348	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406328.1		NM_152589	
SPATA33	124045	hgsc.bcm.edu	37	16	89735835	89735835	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr16:89735835A>C	ENST00000301031.4	+	3	350	c.350A>C	c.(349-351)gAc>gCc	p.D117A	SPATA33_ENST00000579310.1_Missense_Mutation_p.D118A	NM_001271908.1|NM_153025.1	NP_001258837.1|NP_694570.1	Q96N06	SPT33_HUMAN	spermatogenesis associated 33	117						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GAGCCGGAGGACTGGGGCCCC	0.557																																																	0													62.0	70.0	68.0					16																	89735835		2198	4300	6498	SO:0001583	missense	124045			AK056168	CCDS10983.1, CCDS62012.1, CCDS73929.1	16q24.3	2013-07-16	2013-07-05	2013-07-05	ENSG00000167523	ENSG00000167523			26463	protein-coding gene	gene with protein product		615409	"""chromosome 16 open reading frame 55"""	C16orf55		23844118	Standard	NM_153025		Approved	FLJ31606	uc010vpk.2	Q96N06	OTTHUMG00000138048	ENST00000301031.4:c.350A>C	16.37:g.89735835A>C	ENSP00000301031:p.Asp117Ala		A8WFL2|B4DZN8	Missense_Mutation	SNP	ENST00000301031.4	37	CCDS10983.1	.	.	.	.	.	.	.	.	.	.	A	9.618	1.132984	0.21041	.	.	ENSG00000167523	ENST00000301031;ENST00000457689	T	0.56103	0.48	4.5	2.2	0.27929	.	1.159430	0.06517	N	0.739076	T	0.41003	0.1140	L	0.29908	0.895	0.09310	N	1	B;P	0.37101	0.408;0.582	B;B	0.37387	0.15;0.248	T	0.35076	-0.9803	10	0.66056	D	0.02	-11.1496	4.7547	0.13077	0.7066:0.1915:0.1019:0.0	.	118;117	B4DZN8;Q96N06	.;CP055_HUMAN	A	117;118	ENSP00000301031:D117A	ENSP00000301031:D117A	D	+	2	0	C16orf55	88263336	0.000000	0.05858	0.001000	0.08648	0.209000	0.24338	0.284000	0.18864	0.211000	0.20683	0.472000	0.43445	GAC		0.557	SPATA33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269924.2		NM_153025	
MAB21L3	126868	hgsc.bcm.edu	37	1	116670806	116670806	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr1:116670806G>A	ENST00000369500.3	+	6	966	c.701G>A	c.(700-702)tGg>tAg	p.W234*	MAB21L3_ENST00000464946.1_3'UTR	NM_152367.2	NP_689580.2	Q8N8X9	MB213_HUMAN	mab-21-like 3 (C. elegans)	234										breast(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|urinary_tract(1)	19						AATTATCACTGGCAGCTGAGC	0.463																																																	0													102.0	107.0	105.0					1																	116670806		2203	4300	6503	SO:0001587	stop_gained	0			AK096035	CCDS886.1	1p13.1	2011-02-23	2011-02-23	2011-02-23	ENSG00000173212	ENSG00000173212			26787	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 161"""	C1orf161		14702039	Standard	NM_152367		Approved	FLJ38716	uc001egc.1	Q8N8X9	OTTHUMG00000012110	ENST00000369500.3:c.701G>A	1.37:g.116670806G>A	ENSP00000358512:p.Trp234*		Q5TDL7	Nonsense_Mutation	SNP	ENST00000369500.3	37	CCDS886.1	.	.	.	.	.	.	.	.	.	.	G	37	6.517354	0.97629	.	.	ENSG00000173212	ENST00000369500	.	.	.	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.4148	19.6081	0.95588	0.0:0.0:1.0:0.0	.	.	.	.	X	234	.	ENSP00000358512:W234X	W	+	2	0	MAB21L3	116472329	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.449000	0.80643	2.652000	0.90054	0.591000	0.81541	TGG		0.463	MAB21L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033486.1		NM_152367	
TMEM230	29058	hgsc.bcm.edu	37	20	5081570	5081570	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr20:5081570T>C	ENST00000379286.2	-	5	650	c.230A>G	c.(229-231)gAc>gGc	p.D77G	TMEM230_ENST00000202834.7_Missense_Mutation_p.D77G|TMEM230_ENST00000379279.2_Missense_Mutation_p.D77G|TMEM230_ENST00000492419.1_5'UTR|TMEM230_ENST00000342308.5_Missense_Mutation_p.D140G|RNA5SP474_ENST00000391234.1_RNA|TMEM230_ENST00000379283.2_Missense_Mutation_p.D77G|TMEM230_ENST00000379277.2_Missense_Mutation_p.D77G	NM_001009924.1	NP_001009924.1	Q96A57	TM230_HUMAN	transmembrane protein 230	77						integral component of membrane (GO:0016021)											AACGGCCCGGTCTGCCCCCTG	0.468											OREG0025754	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													80.0	73.0	75.0					20																	5081570		2203	4300	6503	SO:0001583	missense	0			AF161392	CCDS13086.1, CCDS33438.1	20p13	2012-03-16	2012-03-16	2012-03-16	ENSG00000089063	ENSG00000089063			15876	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 30"""	C20orf30			Standard	XM_005260713		Approved	HSPC274	uc002wlk.3	Q96A57	OTTHUMG00000031796	ENST00000379286.2:c.230A>G	20.37:g.5081570T>C	ENSP00000368588:p.Asp77Gly	623	B2RDM8|D3DVZ9|Q0VGC8|Q5TDS5|Q96ES2|Q9P0A7	Missense_Mutation	SNP	ENST00000379286.2	37	CCDS13086.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.178141	0.57692	.	.	ENSG00000089063	ENST00000379283;ENST00000342308;ENST00000379299;ENST00000202834;ENST00000379286;ENST00000379279;ENST00000379277	T	0.48201	0.82	4.81	4.81	0.61882	.	0.087252	0.85682	D	0.000000	T	0.54029	0.1833	M	0.87547	2.89	0.58432	D	0.999999	B;B	0.19331	0.003;0.035	B;B	0.18561	0.015;0.022	T	0.57883	-0.7734	10	0.48119	T	0.1	-17.9309	13.3278	0.60469	0.0:0.0:0.0:1.0	.	77;140	Q96A57;Q96A57-2	CT030_HUMAN;.	G	77;140;77;77;77;77;77	ENSP00000341364:D140G	ENSP00000202834:D77G	D	-	2	0	C20orf30	5029570	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.158000	0.77470	2.016000	0.59253	0.477000	0.44152	GAC		0.468	TMEM230-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077846.1			
CFAP61	26074	hgsc.bcm.edu;ucsc.edu	37	20	20269500	20269500	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr20:20269500A>G	ENST00000245957.5	+	23	3120	c.3044A>G	c.(3043-3045)gAt>gGt	p.D1015G	C20orf26_ENST00000377309.2_Intron	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		1015										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		CATCTCTTTGATCCAACCCTT	0.468																																																	0													66.0	57.0	60.0					20																	20269500		2203	4300	6503	SO:0001583	missense	26074																														ENST00000245957.5:c.3044A>G	20.37:g.20269500A>G	ENSP00000245957:p.Asp1015Gly		A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	A	17.17	3.320836	0.60634	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.13657	2.57	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.22068	-1.0227	10	0.39692	T	0.17	.	15.5759	0.76387	1.0:0.0:0.0:0.0	.	1015	Q8NHU2	CT026_HUMAN	G	955;981;1015	ENSP00000245957:D1015G	ENSP00000245957:D1015G	D	+	2	0	C20orf26	20217500	1.000000	0.71417	0.994000	0.49952	0.174000	0.22865	9.002000	0.93572	2.088000	0.63022	0.528000	0.53228	GAT		0.468	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3			
C9orf153	389766	hgsc.bcm.edu;ucsc.edu	37	9	88844486	88844486	+	Silent	SNP	C	C	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr9:88844486C>T	ENST00000376001.3	-	2	113	c.33G>A	c.(31-33)gaG>gaA	p.E11E	C9orf153_ENST00000469914.1_5'UTR|C9orf153_ENST00000339137.3_Silent_p.E11E	NM_001276366.1	NP_001263295.1	Q5TBE3	CI153_HUMAN	chromosome 9 open reading frame 153	11										breast(1)|lung(1)	2						CTCTATTGTCCTCAGCTGGAC	0.378																																																	0													165.0	125.0	139.0					9																	88844486		2203	4300	6503	SO:0001819	synonymous_variant	389766				CCDS35055.1, CCDS35055.2	9q22.1	2012-04-03			ENSG00000187753	ENSG00000187753			31456	protein-coding gene	gene with protein product							Standard	NM_001276366		Approved	bA507D14.1	uc031teh.1	Q5TBE3	OTTHUMG00000020134	ENST00000376001.3:c.33G>A	9.37:g.88844486C>T			Q5TBE4	Silent	SNP	ENST00000376001.3	37	CCDS35055.1																																																																																				0.378	C9orf153-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052913.1		NM_001010907	
CARD11	84433	hgsc.bcm.edu;ucsc.edu	37	7	2951854	2951854	+	Silent	SNP	G	G	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:2951854G>A	ENST00000396946.4	-	23	3499	c.3096C>T	c.(3094-3096)aaC>aaT	p.N1032N		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1032	Guanylate kinase-like.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		ATTCGAACGCGTTGGGGTTCT	0.587			Mis		DLBCL																																			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0													224.0	170.0	188.0					7																	2951854		2203	4300	6503	SO:0001819	synonymous_variant	84433			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.3096C>T	7.37:g.2951854G>A			A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	ENST00000396946.4	37	CCDS5336.2																																																																																				0.587	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4		NM_032415	
CCDC18	343099	hgsc.bcm.edu	37	1	93672722	93672722	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr1:93672722A>C	ENST00000343253.7	+	9	1478	c.976A>C	c.(976-978)Aat>Cat	p.N326H	CCDC18_ENST00000334652.5_5'UTR|CCDC18_ENST00000401026.3_Missense_Mutation_p.N326H|CCDC18_ENST00000557479.1_Missense_Mutation_p.N444H|CCDC18_ENST00000338949.4_Missense_Mutation_p.N125H			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	326				N -> T (in Ref. 1; BAC86410). {ECO:0000305}.						breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GGCAGTGAAAAATTCAGAAGT	0.294																																																	0													43.0	39.0	40.0					1																	93672722		1827	4075	5902	SO:0001583	missense	343099					1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.976A>C	1.37:g.93672722A>C	ENSP00000343377:p.Asn326His		Q6ZU17	Missense_Mutation	SNP	ENST00000343253.7	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.3|20.3	3.965113|3.965113	0.74131|0.74131	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000370276|ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000455267	.|T	.|0.17370	.|2.28	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	.|0.161555	.|0.56097	.|D	.|0.000039	T|T	0.21761|0.21761	0.0524|0.0524	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	.|P;D	.|0.53885	.|0.912;0.963	.|P;P	.|0.60473	.|0.717;0.875	T|T	0.04900|0.04900	-1.0919|-1.0919	6|10	0.46703|0.14656	T|T	0.11|0.56	.|.	14.7698|14.7698	0.69668|0.69668	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|326;444	.|Q5T9S5;G3V388	.|CCD18_HUMAN;.	N|H	379|326;326;444;125;46	.|ENSP00000391151:N46H	ENSP00000359299:K379N|ENSP00000344380:N125H	K|N	+|+	3|1	2|0	CCDC18|CCDC18	93445310|93445310	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.897000|0.897000	0.52465|0.52465	5.544000|5.544000	0.67231|0.67231	2.230000|2.230000	0.72887|0.72887	0.454000|0.454000	0.30748|0.30748	AAA|AAT		0.294	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1		NM_206886	
CCDC80	151887	hgsc.bcm.edu;ucsc.edu	37	3	112357946	112357946	+	Silent	SNP	G	G	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr3:112357946G>T	ENST00000206423.3	-	2	1760	c.807C>A	c.(805-807)atC>atA	p.I269I	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Silent_p.I269I	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	269					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						TGATCTTCTCGATCCTACGGA	0.582																																																	0													149.0	129.0	136.0					3																	112357946		2203	4300	6503	SO:0001819	synonymous_variant	151887			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.807C>A	3.37:g.112357946G>T			D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Silent	SNP	ENST00000206423.3	37	CCDS2968.1																																																																																				0.582	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1		NM_199511	
CCZ1	51622	hgsc.bcm.edu	37	7	5944844	5944844	+	Missense_Mutation	SNP	G	G	C	rs143367105		TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:5944844G>C	ENST00000325974.6	+	7	708	c.642G>C	c.(640-642)gaG>gaC	p.E214D	CCZ1_ENST00000537980.1_Missense_Mutation_p.E71D	NM_015622.5	NP_056437.4	P86791	CCZ1_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)	214						lysosome (GO:0005764)|membrane (GO:0016020)				large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	6						ATAGAATGGAGGAAAGCCTGA	0.373																																																	0													23.0	23.0	23.0					7																	5944844		2133	4264	6397	SO:0001583	missense	51622			AF151801	CCDS34597.1	7p22.1	2014-02-13	2010-06-29	2010-06-29	ENSG00000122674	ENSG00000122674			21691	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 28A"""	C7orf28A		10810093, 20305638	Standard	NM_015622		Approved	CGI-43, CCZ1A	uc003spf.3	P86791	OTTHUMG00000155502	ENST00000325974.6:c.642G>C	7.37:g.5944844G>C	ENSP00000325681:p.Glu214Asp		A2RU45|O95766|Q9UG65|Q9Y359	Missense_Mutation	SNP	ENST00000325974.6	37	CCDS34597.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012042	0.75046	.	.	ENSG00000122674	ENST00000325974;ENST00000537980	.	.	.	5.85	-1.28	0.09318	.	0.000000	0.85682	D	0.000000	T	0.60702	0.2289	L	0.46741	1.465	0.50813	D	0.999896	D	0.60575	0.988	P	0.62491	0.903	T	0.57106	-0.7868	9	0.35671	T	0.21	-24.4133	10.9601	0.47381	0.7898:0.0:0.2102:0.0	.	214	P86790	CCZ1L_HUMAN	D	214;71	.	ENSP00000325681:E214D	E	+	3	2	CCZ1	5911370	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	0.953000	0.29162	-0.118000	0.11851	0.650000	0.86243	GAG		0.373	CCZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340391.1		NM_015622	
CD97	976	hgsc.bcm.edu;ucsc.edu	37	19	14512530	14512530	+	Missense_Mutation	SNP	A	A	G	rs145167749		TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr19:14512530A>G	ENST00000242786.5	+	11	1221	c.1141A>G	c.(1141-1143)Atg>Gtg	p.M381V	CD97_ENST00000358600.3_Missense_Mutation_p.M288V|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Missense_Mutation_p.M332V	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	381					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CAGCGCACGCATGAAGCTGAA	0.627													A|||	1	0.000199681	0.0008	0.0	5008	,	,		17897	0.0		0.0	False		,,,				2504	0.0																0								A	VAL/MET,VAL/MET,VAL/MET	5,4401	11.4+/-27.6	0,5,2198	61.0	52.0	55.0		994,862,1141	0.8	0.0	19	dbSNP_134	55	0,8600		0,0,4300	yes	missense,missense,missense	CD97	NM_001025160.2,NM_001784.4,NM_078481.3	21,21,21	0,5,6498	GG,GA,AA		0.0,0.1135,0.0384	probably-damaging,probably-damaging,probably-damaging	332/787,288/743,381/836	14512530	5,13001	2203	4300	6503	SO:0001583	missense	976				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1141A>G	19.37:g.14512530A>G	ENSP00000242786:p.Met381Val		A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	A	11.80	1.746489	0.30955	0.001135	0.0	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.70986	-0.53;-0.45;-0.07	5.15	0.781	0.18561	.	.	.	.	.	T	0.67420	0.2891	M	0.81802	2.56	0.09310	N	1	B;B;B	0.33748	0.423;0.423;0.006	B;B;B	0.31946	0.138;0.138;0.004	T	0.56353	-0.7993	9	0.44086	T	0.13	.	7.2414	0.26098	0.6061:0.0:0.3938:0.0	.	288;332;381	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	V	381;332;288;331	ENSP00000242786:M381V;ENSP00000349918:M332V;ENSP00000351413:M288V	ENSP00000242786:M381V	M	+	1	0	CD97	14373530	0.430000	0.25538	0.003000	0.11579	0.177000	0.22998	0.139000	0.16036	-0.193000	0.10415	0.454000	0.30748	ATG		0.627	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2		NM_078481	
CNTRL	11064	hgsc.bcm.edu;ucsc.edu	37	9	123930585	123930585	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr9:123930585C>G	ENST00000373855.1	+	38	6316	c.6056C>G	c.(6055-6057)aCa>aGa	p.T2019R	CNTRL_ENST00000238341.5_Missense_Mutation_p.T2019R|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Missense_Mutation_p.T1467R			Q7Z7A1	CNTRL_HUMAN	centriolin	2019	Required for centrosome localization.|Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						CTGGAGAAGACACTCTCCCAA	0.488																																																	0													94.0	99.0	97.0					9																	123930585		2203	4300	6503	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6056C>G	9.37:g.123930585C>G	ENSP00000362962:p.Thr2019Arg		A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	C	8.042	0.764131	0.15914	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000394368;ENST00000373850;ENST00000373845	T;T;T	0.29397	1.88;1.88;1.57	6.16	2.07	0.26955	.	.	.	.	.	T	0.23289	0.0563	L	0.53249	1.67	0.09310	N	0.999998	P	0.46395	0.877	B	0.39299	0.296	T	0.11108	-1.0601	9	0.15952	T	0.53	.	6.3298	0.21264	0.2606:0.5973:0.0:0.1421	.	2019	Q7Z7A1	CNTRL_HUMAN	R	2019;2019;2019;775;176;1467;701	ENSP00000362962:T2019R;ENSP00000238341:T2019R;ENSP00000362956:T1467R	ENSP00000238341:T2019R	T	+	2	0	CNTRL	122970406	0.001000	0.12720	0.250000	0.24296	0.078000	0.17371	-0.077000	0.11394	0.462000	0.27095	-0.157000	0.13467	ACA		0.488	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1		NM_007018	
CERCAM	51148	hgsc.bcm.edu	37	9	131185208	131185208	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr9:131185208G>A	ENST00000372838.4	+	2	657	c.259G>A	c.(259-261)Gtg>Atg	p.V87M	CERCAM_ENST00000372842.1_Missense_Mutation_p.V9M	NM_016174.4	NP_057258.3	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule	87					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|pancreas(2)	20						GCTGGCGGCTGTGGGCGATGA	0.622																																																	0													68.0	57.0	61.0					9																	131185208		2203	4300	6503	SO:0001583	missense	51148			AB040935	CCDS6901.2, CCDS69675.1	9q34.13	2008-02-05	2007-10-17	2007-10-17	ENSG00000167123	ENSG00000167123			23723	protein-coding gene	gene with protein product	"""glycosyltransferase 25 domain containing 3"""		"""cerebral cell adhesion molecule"""	CEECAM1		10608765	Standard	NM_016174		Approved	GLT25D3, CerCAM	uc004buz.4	Q5T4B2	OTTHUMG00000020747	ENST00000372838.4:c.259G>A	9.37:g.131185208G>A	ENSP00000361929:p.Val87Met		A7MD00|C4AMA2|Q0VDF3|Q2VPJ4|Q4KMP2|Q5T4B1|Q8N107|Q96EZ5|Q9P226|Q9UMW5	Missense_Mutation	SNP	ENST00000372838.4	37	CCDS6901.2	.	.	.	.	.	.	.	.	.	.	G	14.41	2.528311	0.44969	.	.	ENSG00000167123	ENST00000420034;ENST00000372842;ENST00000447915;ENST00000420512;ENST00000372838;ENST00000411852	D;D;D	0.85013	-1.92;-1.92;-1.93	4.85	3.0	0.34707	.	0.178326	0.46758	D	0.000268	T	0.78534	0.4298	L	0.38175	1.15	0.38316	D	0.943383	P	0.36837	0.571	B	0.42163	0.378	T	0.77713	-0.2485	10	0.49607	T	0.09	.	5.942	0.19198	0.2888:0.0:0.7112:0.0	.	87	Q5T4B2	GT253_HUMAN	M	9;9;9;9;87;9	ENSP00000361933:V9M;ENSP00000416676:V9M;ENSP00000361929:V87M	ENSP00000361929:V87M	V	+	1	0	CERCAM	130225029	0.418000	0.25440	0.986000	0.45419	0.745000	0.42441	0.720000	0.25896	1.395000	0.46643	0.561000	0.74099	GTG		0.622	CERCAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054435.2		NM_016174	
CHDH	55349	hgsc.bcm.edu;ucsc.edu	37	3	53851850	53851850	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr3:53851850T>G	ENST00000315251.6	-	9	2176	c.1739A>C	c.(1738-1740)aAa>aCa	p.K580T		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	580					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	AGGGACATCTTTGTCCCAGAG	0.582																																																	0													82.0	64.0	70.0					3																	53851850		2203	4300	6503	SO:0001583	missense	55349			AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.1739A>C	3.37:g.53851850T>G	ENSP00000319851:p.Lys580Thr		Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	.	.	.	.	.	.	.	.	.	.	T	8.751	0.921284	0.17982	.	.	ENSG00000016391	ENST00000315251	T	0.22945	1.93	5.54	3.06	0.35304	.	0.758471	0.12992	N	0.422416	T	0.10937	0.0267	N	0.03238	-0.38	0.09310	N	0.999999	B	0.10296	0.003	B	0.06405	0.002	T	0.18335	-1.0340	10	0.54805	T	0.06	-10.8928	5.8069	0.18444	0.0:0.1431:0.1413:0.7156	.	580	Q8NE62	CHDH_HUMAN	T	580	ENSP00000319851:K580T	ENSP00000319851:K580T	K	-	2	0	CHDH	53826890	0.652000	0.27349	0.749000	0.31150	0.471000	0.32888	2.585000	0.46111	0.946000	0.37632	0.533000	0.62120	AAA		0.582	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2		NM_018397	
CMYA5	202333	hgsc.bcm.edu;ucsc.edu	37	5	79031960	79031960	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr5:79031960G>T	ENST00000446378.2	+	2	7403	c.7372G>T	c.(7372-7374)Gat>Tat	p.D2458Y		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2458					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGAGAAGAAAGATAATTTGGA	0.373																																																	0													43.0	43.0	43.0					5																	79031960		1811	4074	5885	SO:0001583	missense	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.7372G>T	5.37:g.79031960G>T	ENSP00000394770:p.Asp2458Tyr		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.304065	0.23736	.	.	ENSG00000164309	ENST00000446378	T	0.20738	2.05	5.85	4.8	0.61643	.	1.151050	0.06404	N	0.719358	T	0.35219	0.0924	L	0.43152	1.355	0.09310	N	1	D	0.69078	0.997	P	0.55667	0.781	T	0.29427	-1.0012	10	0.62326	D	0.03	.	12.669	0.56857	0.0905:0.0:0.9095:0.0	.	2458	Q8N3K9	CMYA5_HUMAN	Y	2458	ENSP00000394770:D2458Y	ENSP00000394770:D2458Y	D	+	1	0	CMYA5	79067716	0.515000	0.26210	0.073000	0.20177	0.018000	0.09664	1.943000	0.40253	2.753000	0.94483	0.655000	0.94253	GAT		0.373	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1		NM_153610	
CNBD1	168975	hgsc.bcm.edu;ucsc.edu	37	8	87878755	87878755	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr8:87878755T>C	ENST00000518476.1	+	1	83	c.32T>C	c.(31-33)tTg>tCg	p.L11S		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	11										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						GCAGCTATTTTGTCTCACATG	0.448																																																	0													105.0	97.0	100.0					8																	87878755		1957	4154	6111	SO:0001583	missense	168975			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.32T>C	8.37:g.87878755T>C	ENSP00000430073:p.Leu11Ser			Missense_Mutation	SNP	ENST00000518476.1	37	CCDS55259.1	.	.	.	.	.	.	.	.	.	.	T	10.31	1.314493	0.23908	.	.	ENSG00000176571	ENST00000518476	T	0.24723	1.84	4.78	4.78	0.61160	.	0.726885	0.10637	N	0.651457	T	0.35128	0.0921	L	0.44542	1.39	0.09310	N	1	P	0.51240	0.943	P	0.52909	0.713	T	0.16070	-1.0415	10	0.87932	D	0	.	10.8681	0.46866	0.0:0.0:0.0:1.0	.	11	Q8NA66	CNBD1_HUMAN	S	11	ENSP00000430073:L11S	ENSP00000430073:L11S	L	+	2	0	CNBD1	87947871	0.026000	0.19158	0.006000	0.13384	0.407000	0.30961	3.235000	0.51328	2.125000	0.65367	0.460000	0.39030	TTG		0.448	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2		NM_173538	
CNTNAP2	26047	hgsc.bcm.edu;ucsc.edu	37	7	147869410	147869410	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:147869410G>T	ENST00000361727.3	+	18	3366	c.2850G>T	c.(2848-2850)gaG>gaT	p.E950D	CNTNAP2_ENST00000538075.1_Missense_Mutation_p.E9D	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	950	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTGACCTGGAGGAAAGAGCAA	0.547										HNSCC(39;0.1)																																							0													99.0	94.0	95.0					7																	147869410		2203	4300	6503	SO:0001583	missense	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2850G>T	7.37:g.147869410G>T	ENSP00000354778:p.Glu950Asp		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	19.50	3.839085	0.71373	.	.	ENSG00000174469	ENST00000361727;ENST00000538075	T;T	0.76316	-1.01;-1.01	5.28	-1.61	0.08399	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.85682	D	0.000000	T	0.78489	0.4291	M	0.86028	2.79	0.37403	D	0.912907	P	0.43352	0.804	P	0.45071	0.468	T	0.77814	-0.2448	10	0.31617	T	0.26	.	11.1397	0.48396	0.6956:0.0:0.3044:0.0	.	950	Q9UHC6	CNTP2_HUMAN	D	950;9	ENSP00000354778:E950D;ENSP00000440732:E9D	ENSP00000354778:E950D	E	+	3	2	CNTNAP2	147500343	0.785000	0.28726	0.996000	0.52242	0.997000	0.91878	-0.032000	0.12266	-0.163000	0.10946	0.563000	0.77884	GAG		0.547	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			
DCAF13	25879	hgsc.bcm.edu	37	8	104444937	104444937	+	Silent	SNP	T	T	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr8:104444937T>C	ENST00000297579.5	+	7	1486	c.1209T>C	c.(1207-1209)gcT>gcC	p.A403A	DCAF13_ENST00000521999.1_3'UTR	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	251					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						CTATGGAAGCTTTCATTTTTA	0.323																																																	0													84.0	91.0	89.0					8																	104444937		2203	4297	6500	SO:0001819	synonymous_variant	25879			AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.1209T>C	8.37:g.104444937T>C			Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Silent	SNP	ENST00000297579.5	37	CCDS34934.1																																																																																				0.323	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380797.2		NM_015420	
DDB1	1642	hgsc.bcm.edu	37	11	61081149	61081149	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr11:61081149A>C	ENST00000301764.7	-	16	2288	c.1891T>G	c.(1891-1893)Ttg>Gtg	p.L631V	DDB1_ENST00000545930.1_5'Flank|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	631	Interaction with CDT1.|WD repeat beta-propeller B; Interaction with CUL4A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						TGGGTGCCCAAAGTCACCTTC	0.478								Nucleotide excision repair (NER)																																									0													78.0	71.0	73.0					11																	61081149		2203	4299	6502	SO:0001583	missense	1642			AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.1891T>G	11.37:g.61081149A>C	ENSP00000301764:p.Leu631Val		A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	ENST00000301764.7	37	CCDS31576.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.274822	0.80580	.	.	ENSG00000167986	ENST00000301764;ENST00000535147;ENST00000537877	T;T	0.29397	1.57;1.57	5.91	2.86	0.33363	.	0.000000	0.85682	D	0.000000	T	0.49898	0.1584	M	0.77820	2.39	0.80722	D	1	D	0.55385	0.971	P	0.62089	0.898	T	0.45920	-0.9228	10	0.56958	D	0.05	-14.0296	9.7822	0.40656	0.2463:0.0:0.7536:0.0	.	631	Q16531	DDB1_HUMAN	V	631;98;195	ENSP00000301764:L631V;ENSP00000444650:L98V	ENSP00000301764:L631V	L	-	1	2	DDB1	60837725	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	4.171000	0.58236	0.285000	0.22329	-0.274000	0.10170	TTG		0.478	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1		NM_001923	
DMTF1	9988	hgsc.bcm.edu;ucsc.edu	37	7	86802901	86802901	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:86802901A>T	ENST00000394703.5	+	8	941	c.378A>T	c.(376-378)gaA>gaT	p.E126D	DMTF1_ENST00000394702.3_Missense_Mutation_p.E126D|DMTF1_ENST00000432937.2_Missense_Mutation_p.E38D|DMTF1_ENST00000331242.7_Missense_Mutation_p.E126D|DMTF1_ENST00000413276.2_Missense_Mutation_p.E126D|DMTF1_ENST00000414194.2_5'UTR|DMTF1_ENST00000411766.2_Missense_Mutation_p.E85D	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	126	Interaction with CCND2. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.|Required for transcriptional activation. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					GTAACGAGGAAGTTTCAGCAG	0.323																																																	0													100.0	101.0	101.0					7																	86802901		2203	4300	6503	SO:0001583	missense	9988			AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.378A>T	7.37:g.86802901A>T	ENSP00000378193:p.Glu126Asp		B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Missense_Mutation	SNP	ENST00000394703.5	37	CCDS5601.1	.	.	.	.	.	.	.	.	.	.	A	16.26	3.074300	0.55646	.	.	ENSG00000135164	ENST00000331242;ENST00000394702;ENST00000413276;ENST00000447863;ENST00000425406;ENST00000411766;ENST00000430405;ENST00000432937;ENST00000394703;ENST00000412139;ENST00000425705	T;T;T;T	0.52983	0.64;0.78;0.64;0.64	5.91	0.882	0.19172	.	0.045006	0.85682	D	0.000000	T	0.31295	0.0792	L	0.29908	0.895	0.80722	D	1	B	0.23377	0.084	B	0.22880	0.042	T	0.07214	-1.0784	10	0.32370	T	0.25	-17.2774	9.2145	0.37339	0.6291:0.0:0.3709:0.0	.	126	Q9Y222	DMTF1_HUMAN	D	126;126;126;126;85;85;126;38;126;126;126	ENSP00000332171:E126D;ENSP00000402627:E126D;ENSP00000412532:E38D;ENSP00000378193:E126D	ENSP00000332171:E126D	E	+	3	2	DMTF1	86640837	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	0.992000	0.29667	0.444000	0.26612	0.377000	0.23210	GAA		0.323	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5		NM_021145	
DYNC2H1	79659	hgsc.bcm.edu;ucsc.edu	37	11	102991435	102991435	+	Silent	SNP	G	G	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr11:102991435G>C	ENST00000375735.2	+	8	1296	c.1152G>C	c.(1150-1152)gcG>gcC	p.A384A	DYNC2H1_ENST00000334267.7_Silent_p.A384A|DYNC2H1_ENST00000398093.3_Silent_p.A384A	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	384	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.A384A(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GGAAAGCTGCGGTGTCTCAAT	0.323																																																	1	Substitution - coding silent(1)	kidney(1)											45.0	44.0	45.0					11																	102991435		1816	4065	5881	SO:0001819	synonymous_variant	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.1152G>C	11.37:g.102991435G>C			O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	CCDS53701.1																																																																																				0.323	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1		XM_370652	
ERCC2	2068	hgsc.bcm.edu	37	19	45872351	45872351	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr19:45872351C>T	ENST00000391945.4	-	3	237	c.160G>A	c.(160-162)Gcc>Acc	p.A54T	ERCC2_ENST00000391944.3_Missense_Mutation_p.A54T|ERCC2_ENST00000485403.2_Missense_Mutation_p.A30T|ERCC2_ENST00000391940.4_Missense_Mutation_p.A30T|ERCC2_ENST00000221481.6_Missense_Mutation_p.A54T	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	54	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		ATGATCAGGGCCAACAGGGAT	0.582			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	0													207.0	193.0	198.0					19																	45872351		2203	4300	6503	SO:0001583	missense	2068	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.160G>A	19.37:g.45872351C>T	ENSP00000375809:p.Ala54Thr		Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.412134	0.62511	.	.	ENSG00000104884	ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940;ENST00000221481	T;T;T;T	0.74106	-0.58;-0.58;0.83;-0.81	4.98	3.92	0.45320	Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.120187	0.56097	D	0.000022	T	0.61912	0.2385	N	0.20986	0.625	0.45239	D	0.998249	B;B;B	0.20164	0.002;0.042;0.007	B;B;B	0.29524	0.001;0.103;0.006	T	0.58132	-0.7690	10	0.42905	T	0.14	-9.0048	10.5971	0.45345	0.3493:0.6507:0.0:0.0	.	54;30;54	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	T	30;54;54;30;54	ENSP00000375809:A54T;ENSP00000375808:A54T;ENSP00000375804:A30T;ENSP00000221481:A54T	ENSP00000221481:A54T	A	-	1	0	ERCC2	50564191	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	2.084000	0.41625	1.171000	0.42768	0.561000	0.74099	GCC		0.582	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2		NM_000400	
FAM160A1	729830	hgsc.bcm.edu;ucsc.edu	37	4	152577544	152577544	+	Silent	SNP	C	C	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr4:152577544C>T	ENST00000505231.1	+	10	2871	c.2712C>T	c.(2710-2712)agC>agT	p.S904S	FAM160A1_ENST00000435205.1_Silent_p.S904S			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	904										endometrium(2)|kidney(1)	3						TCCAGCCAAGCGTCCGCTCTC	0.473																																																	0													66.0	55.0	59.0					4																	152577544		692	1591	2283	SO:0001819	synonymous_variant	729830				CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.2712C>T	4.37:g.152577544C>T			Q6ZUS2	Silent	SNP	ENST00000505231.1	37	CCDS47146.1																																																																																				0.473	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365691.1		NM_001109977	
FBXO9	26268	hgsc.bcm.edu	37	6	52945852	52945852	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr6:52945852A>C	ENST00000244426.6	+	5	696	c.524A>C	c.(523-525)aAa>aCa	p.K175T	FBXO9_ENST00000323557.7_Missense_Mutation_p.K165T|FBXO9_ENST00000370939.3_Missense_Mutation_p.K131T	NM_012347.4	NP_036479.1	Q9UK97	FBX9_HUMAN	F-box protein 9	175					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|protein ubiquitination (GO:0016567)|regulation of TOR signaling (GO:0032006)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(4)|lung(1)|pancreas(2)|skin(1)	9	Lung NSC(77;0.103)					TCTGTGCTTAAACTGTGTCAG	0.393																																																	0													127.0	122.0	124.0					6																	52945852		1948	4157	6105	SO:0001583	missense	26268			AF155114	CCDS55022.1, CCDS55023.1, CCDS55024.1	6p12.3-p11.2	2004-06-15	2004-06-15		ENSG00000112146	ENSG00000112146		"""F-boxes /  ""other"""""	13588	protein-coding gene	gene with protein product		609091	"""F-box only protein 9"""			10531035, 10531037	Standard	NM_012347		Approved	FBX9, NY-REN-57	uc021zao.1	Q9UK97	OTTHUMG00000014869	ENST00000244426.6:c.524A>C	6.37:g.52945852A>C	ENSP00000244426:p.Lys175Thr		A6NFW3|B3KMM6|O75986|Q59EH8|Q6PKH7|Q9NT57|Q9Y593	Missense_Mutation	SNP	ENST00000244426.6	37	CCDS55023.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.553835	0.86231	.	.	ENSG00000112146	ENST00000498744;ENST00000370939;ENST00000323557;ENST00000244426	T;T;T	0.78003	-1.13;-1.14;-1.14	5.06	5.06	0.68205	.	0.042604	0.85682	D	0.000000	T	0.65790	0.2725	M	0.63843	1.955	0.80722	D	1	P;B;B	0.48694	0.914;0.146;0.251	B;B;B	0.42653	0.394;0.066;0.037	T	0.66504	-0.5907	10	0.21540	T	0.41	-10.7501	14.7486	0.69508	1.0:0.0:0.0:0.0	.	165;282;175	Q9UK97-2;Q59EH8;Q9UK97	.;.;FBX9_HUMAN	T	131;131;165;175	ENSP00000359977:K131T;ENSP00000326968:K165T;ENSP00000244426:K175T	ENSP00000244426:K175T	K	+	2	0	FBXO9	53053811	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.549000	0.67261	2.018000	0.59344	0.482000	0.46254	AAA		0.393	FBXO9-002	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040950.3			
FAM184A	79632	hgsc.bcm.edu	37	6	119399382	119399382	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr6:119399382T>G	ENST00000338891.7	-	1	526	c.83A>C	c.(82-84)cAg>cCg	p.Q28P	FAM184A_ENST00000368475.4_Intron|FAM184A_ENST00000522284.1_Intron|FAM184A_ENST00000352896.5_Intron|FAM184A_ENST00000521531.1_Missense_Mutation_p.Q28P	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	28						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						CCCAGCCAGCTGTGCGGTGGC	0.642																																																	0													17.0	19.0	19.0					6																	119399382		1960	4149	6109	SO:0001583	missense	79632			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.83A>C	6.37:g.119399382T>G	ENSP00000342604:p.Gln28Pro		B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	T	10.66	1.412082	0.25465	.	.	ENSG00000111879	ENST00000338891;ENST00000521531	T;T	0.24723	2.43;1.84	4.66	0.55	0.17219	.	0.395933	0.21702	N	0.070404	T	0.07503	0.0189	L	0.40543	1.245	0.23095	N	0.998308	B	0.02656	0.0	B	0.04013	0.001	T	0.37663	-0.9696	10	0.24483	T	0.36	0.3941	13.1342	0.59399	0.0:0.0:0.544:0.456	.	28	Q8NB25	F184A_HUMAN	P	28	ENSP00000342604:Q28P;ENSP00000430442:Q28P	ENSP00000342604:Q28P	Q	-	2	0	FAM184A	119441081	0.974000	0.33945	0.523000	0.27875	0.580000	0.36256	0.576000	0.23744	-0.046000	0.13446	0.260000	0.18958	CAG		0.642	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3		NM_024581	
FERMT3	83706	hgsc.bcm.edu	37	11	63979193	63979193	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr11:63979193T>G	ENST00000279227.5	+	6	855	c.760T>G	c.(760-762)Tac>Gac	p.Y254D	FERMT3_ENST00000345728.5_Missense_Mutation_p.Y254D	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	254	FERM.				integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						CTTCAAGTACTACAGCTTCTT	0.627																																																	0													109.0	99.0	103.0					11																	63979193		2201	4297	6498	SO:0001583	missense	83706			L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.760T>G	11.37:g.63979193T>G	ENSP00000279227:p.Tyr254Asp		Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	T	18.96	3.734098	0.69189	.	.	ENSG00000149781	ENST00000544997;ENST00000345728;ENST00000279227;ENST00000541252	D;T;T;T	0.82433	-1.61;-1.24;-1.24;0.43	3.6	2.43	0.29744	FERM central domain (1);Band 4.1 domain (1);	0.324779	0.29028	N	0.013368	D	0.86552	0.5960	M	0.80616	2.505	0.51233	D	0.999912	D;D	0.64830	0.994;0.966	P;P	0.53649	0.731;0.564	D	0.86073	0.1539	10	0.87932	D	0	-9.5776	9.322	0.37971	0.0:0.0:0.1815:0.8185	.	254;254	Q86UX7-2;Q86UX7	.;URP2_HUMAN	D	254;254;254;74	ENSP00000445778:Y254D;ENSP00000339950:Y254D;ENSP00000279227:Y254D;ENSP00000438885:Y74D	ENSP00000279227:Y254D	Y	+	1	0	FERMT3	63735769	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.154000	0.50693	0.557000	0.29117	0.379000	0.24179	TAC		0.627	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1		NM_031471	
FETUB	26998	hgsc.bcm.edu;ucsc.edu	37	3	186370105	186370105	+	Silent	SNP	T	T	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr3:186370105T>G	ENST00000265029.3	+	7	935	c.834T>G	c.(832-834)ctT>ctG	p.L278L	FETUB_ENST00000539949.1_Silent_p.L130L|FETUB_ENST00000450521.1_Silent_p.L278L|RP11-134F2.2_ENST00000428501.1_RNA|FETUB_ENST00000382134.3_Silent_p.L213L|FETUB_ENST00000382136.3_Silent_p.L241L|RP11-134F2.2_ENST00000455926.1_RNA	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	278					binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		CTACAAACCTTCCCAAGGTGG	0.488																																																	0													96.0	108.0	104.0					3																	186370105		2203	4300	6503	SO:0001819	synonymous_variant	26998			AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.834T>G	3.37:g.186370105T>G			B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Silent	SNP	ENST00000265029.3	37	CCDS3279.1																																																																																				0.488	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1		NM_014375	
FREM2	341640	hgsc.bcm.edu;ucsc.edu	37	13	39265788	39265788	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr13:39265788A>C	ENST00000280481.7	+	1	4523	c.4307A>C	c.(4306-4308)aAa>aCa	p.K1436T		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1436					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GAAGGTGGCAAAGTCACTCTT	0.453																																																	0													155.0	128.0	137.0					13																	39265788		2203	4300	6503	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4307A>C	13.37:g.39265788A>C	ENSP00000280481:p.Lys1436Thr		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	5.813	0.334327	0.11013	.	.	ENSG00000150893	ENST00000280481	T	0.59083	0.29	5.81	3.45	0.39498	.	0.135816	0.64402	D	0.000004	T	0.40595	0.1123	N	0.20445	0.575	0.30413	N	0.778862	P	0.34892	0.474	B	0.37601	0.254	T	0.41324	-0.9515	10	0.38643	T	0.18	.	7.9971	0.30275	0.7363:0.0:0.2637:0.0	.	1436	Q5SZK8	FREM2_HUMAN	T	1436	ENSP00000280481:K1436T	ENSP00000280481:K1436T	K	+	2	0	FREM2	38163788	0.984000	0.35163	0.325000	0.25375	0.965000	0.64279	1.525000	0.35953	1.020000	0.39573	-0.290000	0.09829	AAA		0.453	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2		NM_207361	
GBP4	115361	hgsc.bcm.edu;ucsc.edu	37	1	89656967	89656967	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr1:89656967T>A	ENST00000355754.6	-	6	990	c.893A>T	c.(892-894)gAg>gTg	p.E298V		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	298	GTPase domain (Globular). {ECO:0000250}.			E -> K (in Ref. 5; AAH70055). {ECO:0000305}.		cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		AATGATTCCCTCTCTCAGGGT	0.433																																																	0													124.0	131.0	128.0					1																	89656967		2203	4300	6503	SO:0001583	missense	115361			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.893A>T	1.37:g.89656967T>A	ENSP00000359490:p.Glu298Val		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	CCDS721.1	.	.	.	.	.	.	.	.	.	.	T	7.680	0.688813	0.14973	.	.	ENSG00000162654	ENST00000355754	T	0.02421	4.3	5.28	-3.49	0.04724	Guanylate-binding protein, C-terminal (3);	0.670897	0.14702	N	0.303540	T	0.06872	0.0175	M	0.90145	3.09	0.09310	N	1	D	0.57257	0.979	P	0.60473	0.875	T	0.01027	-1.1476	10	0.72032	D	0.01	.	13.5174	0.61549	0.0:0.6436:0.0:0.3564	.	298	Q96PP9	GBP4_HUMAN	V	298	ENSP00000359490:E298V	ENSP00000359490:E298V	E	-	2	0	GBP4	89429555	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.387000	0.20718	-0.517000	0.06461	-0.250000	0.11733	GAG		0.433	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1		NM_052941	
GTF2IRD2B	389524	hgsc.bcm.edu	37	7	74563753	74563753	+	Silent	SNP	G	G	A	rs202156190	byFrequency	TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:74563753G>A	ENST00000312575.7	+	16	1675	c.1500G>A	c.(1498-1500)tcG>tcA	p.S500S	GTF2IRD2B_ENST00000418185.2_Silent_p.S47S	NM_001003795.2	NP_001003795.1	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B	500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S500S(1)		endometrium(1)|ovary(2)|prostate(1)	4						tcttaggctcgtcagacaccg	0.488																																																	1	Substitution - coding silent(1)	ovary(1)											2.0	1.0	1.0					7																	74563753		845	1893	2738	SO:0001819	synonymous_variant	389524			AY312850	CCDS34659.1	7q11.23	2014-05-06			ENSG00000174428	ENSG00000174428			33125	protein-coding gene	gene with protein product		608900				15100712	Standard	XM_005277580		Approved		uc003ubt.3	Q6EKJ0	OTTHUMG00000181534	ENST00000312575.7:c.1500G>A	7.37:g.74563753G>A			B2RNE9|Q69GU6|Q8N979|Q9H739	Silent	SNP	ENST00000312575.7	37	CCDS34659.1																																																																																				0.488	GTF2IRD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342728.1		NM_001003795	
GTPBP10	85865	hgsc.bcm.edu;ucsc.edu	37	7	89983809	89983809	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:89983809G>C	ENST00000222511.6	+	3	331	c.265G>C	c.(265-267)Gaa>Caa	p.E89Q	GTPBP10_ENST00000257659.8_Intron	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	89					ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						AAAAGACTGTGAAATCCCTGT	0.338																																																	0													81.0	86.0	84.0					7																	89983809		2203	4299	6502	SO:0001583	missense	85865				CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.265G>C	7.37:g.89983809G>C	ENSP00000222511:p.Glu89Gln		B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Missense_Mutation	SNP	ENST00000222511.6	37	CCDS5617.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.161803	0.38217	.	.	ENSG00000105793	ENST00000426366;ENST00000450619;ENST00000222511;ENST00000417207	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.75	5.75	0.90469	GTP1/OBG subdomain (3);	0.052768	0.85682	D	0.000000	T	0.27278	0.0669	M	0.73319	2.225	0.46823	D	0.999216	B;B;B	0.23990	0.045;0.095;0.034	B;B;B	0.26614	0.071;0.071;0.063	T	0.02365	-1.1170	9	.	.	.	-6.342	15.0936	0.72217	0.0:0.1413:0.8587:0.0	.	89;80;106	A4D1E9;C9J8R7;C9JNI1	GTPBA_HUMAN;.;.	Q	80;106;89;89	ENSP00000405697:E80Q;ENSP00000389510:E106Q;ENSP00000222511:E89Q;ENSP00000416596:E89Q	.	E	+	1	0	GTPBP10	89821745	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	5.990000	0.70595	2.701000	0.92244	0.650000	0.86243	GAA		0.338	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059976.3		NM_033107	
IFNA8	3445	hgsc.bcm.edu	37	9	21409246	21409246	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr9:21409246G>C	ENST00000380205.1	+	1	101	c.71G>C	c.(70-72)tGt>tCt	p.C24S		NM_002170.3	NP_002161.2	P32881	IFNA8_HUMAN	interferon, alpha 8	24					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0174)		TCTCTGGGCTGTGATCTGCCT	0.507																																																	0													140.0	134.0	136.0					9																	21409246		2203	4300	6503	SO:0001583	missense	3445				CCDS6507.1	9p22	2010-08-24			ENSG00000120242	ENSG00000120242		"""Interferons"""	5429	protein-coding gene	gene with protein product	"""interferon alpha-B''"", ""interferon alpha type 201"""	147568				1385305	Standard	NM_002170		Approved	IFN-alphaB	uc003zpc.1	P32881	OTTHUMG00000019677	ENST00000380205.1:c.71G>C	9.37:g.21409246G>C	ENSP00000369553:p.Cys24Ser		P01565|P09236|Q5VWV7|Q5VYQ3	Missense_Mutation	SNP	ENST00000380205.1	37	CCDS6507.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163981	0.57476	.	.	ENSG00000120242	ENST00000380205	T	0.05139	3.49	3.43	3.43	0.39272	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	M	0.92880	3.355	0.38592	D	0.950458	D	0.89917	1.0	D	0.80764	0.994	T	0.46062	-0.9218	10	0.87932	D	0	.	12.2327	0.54497	0.0:0.0:1.0:0.0	.	24	P32881	IFNA8_HUMAN	S	24	ENSP00000369553:C24S	ENSP00000369553:C24S	C	+	2	0	IFNA8	21399246	0.895000	0.30542	0.887000	0.34795	0.837000	0.47467	1.508000	0.35769	1.914000	0.55421	0.561000	0.74099	TGT		0.507	IFNA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051906.1		NM_002170	
KIAA1549	57670	hgsc.bcm.edu;ucsc.edu	37	7	138603070	138603070	+	Silent	SNP	G	G	T	rs372588818		TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:138603070G>T	ENST00000422774.1	-	2	1350	c.1302C>A	c.(1300-1302)gcC>gcA	p.A434A	KIAA1549_ENST00000242365.4_Silent_p.A384A|KIAA1549_ENST00000440172.1_Silent_p.A434A			Q9HCM3	K1549_HUMAN	KIAA1549	434						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						TGAGGCTCGTGGCCAGAACTT	0.557			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0													92.0	91.0	91.0					7																	138603070		2087	4217	6304	SO:0001819	synonymous_variant	57670				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1302C>A	7.37:g.138603070G>T			B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	ENST00000422774.1	37	CCDS56513.1																																																																																				0.557	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1			
LPIN1	23175	hgsc.bcm.edu;ucsc.edu	37	2	11932122	11932122	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr2:11932122C>T	ENST00000256720.2	+	12	1781	c.1688C>T	c.(1687-1689)aCa>aTa	p.T563I	LPIN1_ENST00000425416.2_Missense_Mutation_p.T569I|LPIN1_ENST00000396097.1_Missense_Mutation_p.T293I|LPIN1_ENST00000396099.1_Missense_Mutation_p.T605I|LPIN1_ENST00000404113.2_Missense_Mutation_p.T64I|LPIN1_ENST00000449576.2_Missense_Mutation_p.T648I	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	563					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		AGAAACACCACAATCAAGGAG	0.423																																																	0													81.0	76.0	77.0					2																	11932122		2203	4300	6503	SO:0001583	missense	23175			D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.1688C>T	2.37:g.11932122C>T	ENSP00000256720:p.Thr563Ile		A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	37	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	C	8.285	0.816388	0.16607	.	.	ENSG00000134324	ENST00000449576;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097;ENST00000404113;ENST00000454151	T;T;T;T;T;T;T	0.81078	-1.45;-1.44;-1.43;-1.43;-1.27;-0.4;0.47	5.09	5.09	0.68999	.	0.182212	0.56097	D	0.000021	T	0.69842	0.3156	L	0.40543	1.245	0.33129	D	0.542874	B;P;B	0.36315	0.0;0.547;0.047	B;B;B	0.36244	0.002;0.22;0.042	T	0.73531	-0.3953	10	0.24483	T	0.36	-21.7919	8.0372	0.30499	0.1589:0.7612:0.0:0.0798	.	64;648;563	B4DET9;F5GY24;Q14693	.;.;LPIN1_HUMAN	I	648;605;569;563;293;64;90	ENSP00000397908:T648I;ENSP00000379406:T605I;ENSP00000401522:T569I;ENSP00000256720:T563I;ENSP00000379404:T293I;ENSP00000386120:T64I;ENSP00000413714:T90I	ENSP00000256720:T563I	T	+	2	0	LPIN1	11849573	0.840000	0.29493	0.970000	0.41538	0.872000	0.50106	1.356000	0.34079	2.368000	0.80403	0.561000	0.74099	ACA		0.423	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3		NM_145693	
MED18	54797	hgsc.bcm.edu;ucsc.edu	37	1	28657186	28657186	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr1:28657186C>A	ENST00000373842.4	+	2	222	c.13C>A	c.(13-15)Cca>Aca	p.P5T	MED18_ENST00000398997.2_Missense_Mutation_p.P5T|MED18_ENST00000479574.1_3'UTR	NM_001127350.1|NM_017638.2	NP_001120822.1|NP_060108.2	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	5						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		GGAGGCACCTCCAGTCACCAT	0.488																																																	0													138.0	118.0	124.0					1																	28657186		2203	4300	6503	SO:0001583	missense	54797			BC002694	CCDS322.1	1p35.3	2007-07-30	2007-07-30		ENSG00000130772	ENSG00000130772			25944	protein-coding gene	gene with protein product		612384	"""mediator of RNA polymerase II transcription, subunit 18 homolog (S. cerevisiae)"""			15175163	Standard	NM_001127350		Approved	FLJ20045, p28b	uc009vtg.3	Q9BUE0	OTTHUMG00000003537	ENST00000373842.4:c.13C>A	1.37:g.28657186C>A	ENSP00000362948:p.Pro5Thr		D3DPM1|Q9NXU9	Missense_Mutation	SNP	ENST00000373842.4	37	CCDS322.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967069	0.92855	.	.	ENSG00000130772	ENST00000373842;ENST00000398997	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	L	0.36672	1.1	0.36637	D	0.876611	P	0.48911	0.917	P	0.54238	0.746	T	0.61797	-0.6989	9	0.25751	T	0.34	-9.4002	18.05	0.89344	0.0:1.0:0.0:0.0	.	5	Q9BUE0	MED18_HUMAN	T	5	.	ENSP00000362948:P5T	P	+	1	0	MED18	28529773	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.900000	0.75687	2.563000	0.86464	0.655000	0.94253	CCA		0.488	MED18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009856.1		NM_017638	
MICAL3	57553	hgsc.bcm.edu	37	22	18389489	18389489	+	Silent	SNP	C	C	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr22:18389489C>T	ENST00000441493.2	-	2	442	c.90G>A	c.(88-90)aaG>aaA	p.K30K	MICAL3_ENST00000444520.1_Silent_p.K30K|MICAL3_ENST00000429452.1_Silent_p.K30K|MICAL3_ENST00000207726.7_Silent_p.K30K|MICAL3_ENST00000383094.3_Silent_p.K30K|MICAL3_ENST00000400561.2_Silent_p.K30K|MICAL3_ENST00000414725.2_Silent_p.K30K|MICAL3_ENST00000585038.1_Silent_p.K30K	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	30	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CCTGGAAAGCCTTGAGGGTTC	0.527																																																	0													152.0	142.0	145.0					22																	18389489		1568	3582	5150	SO:0001819	synonymous_variant	57553			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.90G>A	22.37:g.18389489C>T			B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	37	CCDS46659.1																																																																																				0.527	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			
MOB4	25843	hgsc.bcm.edu	37	2	198380863	198380863	+	Missense_Mutation	SNP	A	A	T	rs200842222		TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr2:198380863A>T	ENST00000323303.4	+	1	308	c.53A>T	c.(52-54)aAg>aTg	p.K18M	MOB4_ENST00000448447.2_Missense_Mutation_p.K18M|HSPE1-MOB4_ENST00000604458.1_Intron|MOB4_ENST00000233892.4_Intron|MOB4_ENST00000409360.1_5'Flank|MOB4_ENST00000409916.1_Intron|MOB4_ENST00000497443.1_3'UTR	NM_001202485.1|NM_015387.4	NP_001189414.1|NP_056202.2	Q9Y3A3	PHOCN_HUMAN	MOB family member 4, phocein	18					transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	metal ion binding (GO:0046872)										CCGGGCACCAAGGCGCAGGTA	0.672																																																	0													47.0	47.0	47.0					2																	198380863		2202	4297	6499	SO:0001583	missense	0			AF151853	CCDS2321.1, CCDS2322.1, CCDS46480.1	2q33.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000115540	ENSG00000115540		"""MOB kinase activators"""	17261	protein-coding gene	gene with protein product	"""phocein"", ""phocein, Mob-like protein"""	609361	"""preimplantation protein 3"", ""MOB1, Mps One Binder kinase activator-like 3 (yeast)"""	PREI3, MOBKL3		17853115, 10810093, 11230166, 11319234	Standard	NM_199482		Approved	MOB3, DKFZP564M112, CGI-95, 2C4D, PHOCN		Q9Y3A3	OTTHUMG00000132748	ENST00000323303.4:c.53A>T	2.37:g.198380863A>T	ENSP00000315702:p.Lys18Met		B4DML0|Q53SE0|Q7Z4Y6|Q9H2P3|Q9H5J1|Q9Y4T8	Missense_Mutation	SNP	ENST00000323303.4	37	CCDS2321.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.936236	0.92458	.	.	ENSG00000115540	ENST00000323303;ENST00000448447	.	.	.	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.77445	0.4131	.	.	.	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.65773	0.938;0.815	T	0.81274	-0.1007	8	0.87932	D	0	.	14.0844	0.64947	1.0:0.0:0.0:0.0	.	18;18	Q9Y3A3-3;Q9Y3A3	.;PHOCN_HUMAN	M	18	.	ENSP00000315702:K18M	K	+	2	0	PHOCN	198089108	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.840000	0.62817	2.056000	0.61249	0.533000	0.62120	AAG		0.672	MOB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256110.4		NM_015387	
MTMR3	8897	hgsc.bcm.edu	37	22	30403925	30403925	+	Silent	SNP	T	T	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr22:30403925T>C	ENST00000401950.2	+	11	1255	c.913T>C	c.(913-915)Tta>Cta	p.L305L	MTMR3_ENST00000351488.3_Silent_p.L305L|MTMR3_ENST00000333027.3_Silent_p.L305L|MTMR3_ENST00000406629.1_Silent_p.L305L|MTMR3_ENST00000323630.5_Silent_p.L169L|CTA-85E5.10_ENST00000429350.1_RNA	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	305	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			AGCAGAGAGTTTAGCCATCCA	0.517																																																	0													102.0	95.0	97.0					22																	30403925		2203	4300	6503	SO:0001819	synonymous_variant	8897			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.913T>C	22.37:g.30403925T>C			A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Silent	SNP	ENST00000401950.2	37	CCDS13870.1																																																																																				0.517	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1		NM_021090	
MYO1E	4643	hgsc.bcm.edu	37	15	59528837	59528837	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr15:59528837T>C	ENST00000288235.4	-	5	766	c.367A>G	c.(367-369)Aaa>Gaa	p.K123E	MYO1E_ENST00000558814.1_5'UTR	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	123	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		ATGATATATTTGGCAGCCACT	0.478																																																	0													105.0	99.0	101.0					15																	59528837		2190	4290	6480	SO:0001583	missense	4643			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.367A>G	15.37:g.59528837T>C	ENSP00000288235:p.Lys123Glu		Q14778	Missense_Mutation	SNP	ENST00000288235.4	37	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	T	35	5.494486	0.96339	.	.	ENSG00000157483	ENST00000288235	D	0.90900	-2.75	6.06	6.06	0.98353	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.97269	0.9107	H	0.99820	4.81	0.80722	D	1	P	0.51057	0.941	P	0.54924	0.764	D	0.98705	1.0702	10	0.72032	D	0.01	.	16.6093	0.84858	0.0:0.0:0.0:1.0	.	123	Q12965	MYO1E_HUMAN	E	123	ENSP00000288235:K123E	ENSP00000288235:K123E	K	-	1	0	MYO1E	57316129	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.933000	0.87642	2.324000	0.78689	0.533000	0.62120	AAA		0.478	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1		NM_004998	
MYOM2	9172	hgsc.bcm.edu	37	8	2064039	2064039	+	Missense_Mutation	SNP	T	T	C	rs199787589		TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr8:2064039T>C	ENST00000262113.4	+	27	3496	c.3355T>C	c.(3355-3357)Ttt>Ctt	p.F1119L	MYOM2_ENST00000523438.1_Missense_Mutation_p.F544L	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1119					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGAGGCTGAGTTTCAAAGGAA	0.383																																																	0													44.0	44.0	44.0					8																	2064039		2203	4300	6503	SO:0001583	missense	9172				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3355T>C	8.37:g.2064039T>C	ENSP00000262113:p.Phe1119Leu		Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	48	0.02197802197802198	4	0.008130081300813009	0	0.0	9	0.015734265734265736	35	0.04617414248021108	T	13.35	2.211838	0.39102	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.50548	0.74;0.88	5.44	4.28	0.50868	.	0.213339	0.49916	N	0.000124	T	0.06325	0.0163	L	0.28400	0.85	0.36940	D	0.892342	B	0.09022	0.002	B	0.10450	0.005	T	0.08126	-1.0737	10	0.24483	T	0.36	.	9.1004	0.36664	0.0:0.1607:0.0:0.8393	.	1119	P54296	MYOM2_HUMAN	L	1119;544	ENSP00000262113:F1119L;ENSP00000428396:F544L	ENSP00000262113:F1119L	F	+	1	0	MYOM2	2051446	1.000000	0.71417	0.984000	0.44739	0.484000	0.33280	3.674000	0.54598	0.898000	0.36418	0.528000	0.53228	TTT		0.383	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1		NM_003970	
NCOA6	23054	hgsc.bcm.edu	37	20	33356290	33356290	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr20:33356290C>T	ENST00000374796.2	-	6	3061	c.491G>A	c.(490-492)gGa>gAa	p.G164E	NCOA6_ENST00000359003.2_Missense_Mutation_p.G164E			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	164	CREBBP-binding region.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						CATAGGAAATCCCGCCTCCAT	0.463																																																	0													145.0	128.0	134.0					20																	33356290		2203	4300	6503	SO:0001583	missense	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.491G>A	20.37:g.33356290C>T	ENSP00000363929:p.Gly164Glu		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.935247	0.52866	.	.	ENSG00000198646	ENST00000374796;ENST00000359003;ENST00000397675	T;T	0.35421	1.31;1.31	5.56	2.39	0.29439	.	0.319686	0.27622	N	0.018552	T	0.30603	0.0770	L	0.50333	1.59	0.45035	D	0.998054	B;B	0.18968	0.018;0.032	B;B	0.26202	0.027;0.067	T	0.10870	-1.0611	10	0.49607	T	0.09	-1.1939	7.0037	0.24823	0.0:0.5869:0.2705:0.1426	.	164;164	F6M2K2;Q14686	.;NCOA6_HUMAN	E	164	ENSP00000363929:G164E;ENSP00000351894:G164E	ENSP00000351894:G164E	G	-	2	0	NCOA6	32819951	1.000000	0.71417	0.978000	0.43139	0.067000	0.16453	2.503000	0.45407	0.704000	0.31869	-0.229000	0.12294	GGA		0.463	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2		NM_014071	
NCSTN	23385	hgsc.bcm.edu	37	1	160313253	160313253	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr1:160313253T>A	ENST00000294785.5	+	1	192	c.67T>A	c.(67-69)Ttc>Atc	p.F23I	NCSTN_ENST00000368063.1_5'UTR|NCSTN_ENST00000535857.1_Missense_Mutation_p.F23I|COPA_ENST00000368069.3_5'Flank|COPA_ENST00000241704.7_5'Flank|NCSTN_ENST00000392212.4_5'Flank	NM_015331.2	NP_056146.1	Q92542	NICA_HUMAN	nicastrin	23					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)|proteolysis (GO:0006508)|T cell proliferation (GO:0042098)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(2)	34	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCTTCTGTCTTTCTGCGTCCT	0.667																																																	0													32.0	41.0	38.0					1																	160313253		2203	4300	6503	SO:0001583	missense	23385			AF240468	CCDS1203.1	1q22-q23	2014-09-17			ENSG00000162736	ENSG00000162736			17091	protein-coding gene	gene with protein product		605254				9039502, 10993067	Standard	XM_005245053		Approved	KIAA0253, APH2	uc001fvx.3	Q92542	OTTHUMG00000033110	ENST00000294785.5:c.67T>A	1.37:g.160313253T>A	ENSP00000294785:p.Phe23Ile		Q5T207|Q5T208|Q86VV5	Missense_Mutation	SNP	ENST00000294785.5	37	CCDS1203.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.220326	0.39201	.	.	ENSG00000162736	ENST00000294785;ENST00000437169;ENST00000421914;ENST00000535857;ENST00000438008	T;T;T;T;T	0.79033	-1.01;-0.17;-0.03;-0.03;-1.23	5.08	5.08	0.68730	.	0.140373	0.46145	D	0.000311	T	0.36166	0.0957	N	0.14661	0.345	0.80722	D	1	B;B	0.28291	0.206;0.075	B;B	0.28011	0.085;0.016	T	0.42865	-0.9426	10	0.05833	T	0.94	-12.6194	7.4666	0.27324	0.0:0.0939:0.0:0.9061	.	23;23	F6Y097;Q92542	.;NICA_HUMAN	I	23	ENSP00000294785:F23I;ENSP00000415442:F23I;ENSP00000390409:F23I;ENSP00000442605:F23I;ENSP00000389370:F23I	ENSP00000294785:F23I	F	+	1	0	NCSTN	158579877	0.828000	0.29307	1.000000	0.80357	0.854000	0.48673	1.599000	0.36751	2.124000	0.65301	0.533000	0.62120	TTC		0.667	NCSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080622.1		NM_015331	
NDC80	10403	hgsc.bcm.edu	37	18	2587917	2587917	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr18:2587917A>G	ENST00000261597.4	+	8	940	c.758A>G	c.(757-759)aAa>aGa	p.K253R		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	253	Interaction with NEK2 and ZWINT.|Interaction with SMC1A.|Interaction with the N-terminus of CDCA1.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						CTGCAGTCAAAACTGAGTAAG	0.403																																																	0													110.0	99.0	103.0					18																	2587917		2203	4300	6503	SO:0001583	missense	10403			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.758A>G	18.37:g.2587917A>G	ENSP00000261597:p.Lys253Arg		Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	37	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	A	11.27	1.588496	0.28357	.	.	ENSG00000080986	ENST00000261597;ENST00000543946	T	0.56103	0.48	5.71	5.71	0.89125	.	0.042881	0.85682	D	0.000000	T	0.44623	0.1302	L	0.52364	1.645	0.48975	D	0.999739	B	0.21905	0.062	B	0.17722	0.019	T	0.34625	-0.9821	10	0.23891	T	0.37	-19.0159	10.3494	0.43924	0.927:0.0:0.073:0.0	.	253	O14777	NDC80_HUMAN	R	253	ENSP00000261597:K253R	ENSP00000261597:K253R	K	+	2	0	NDC80	2577917	1.000000	0.71417	0.993000	0.49108	0.276000	0.26787	4.351000	0.59398	2.180000	0.69256	0.533000	0.62120	AAA		0.403	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1		NM_006101	
NFATC3	4775	hgsc.bcm.edu;ucsc.edu	37	16	68200896	68200896	+	Silent	SNP	A	A	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr16:68200896A>T	ENST00000346183.3	+	5	1776	c.1752A>T	c.(1750-1752)atA>atT	p.I584I	NFATC3_ENST00000329524.4_Silent_p.I584I|NFATC3_ENST00000349223.5_Silent_p.I584I|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Silent_p.I584I	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	584	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CTCTGCAGATAGCCTCTATAC	0.378																																																	0													230.0	220.0	223.0					16																	68200896		2198	4300	6498	SO:0001819	synonymous_variant	4775			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.1752A>T	16.37:g.68200896A>T			O75211|Q14516|Q99840|Q99841|Q99842	Silent	SNP	ENST00000346183.3	37	CCDS10860.1																																																																																				0.378	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2		NM_004555	
NFAT5	10725	hgsc.bcm.edu	37	16	69726498	69726498	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr16:69726498C>G	ENST00000354436.2	+	12	3034	c.2716C>G	c.(2716-2718)Cag>Gag	p.Q906E	NFAT5_ENST00000566899.1_Missense_Mutation_p.Q830E|NFAT5_ENST00000393742.2_Missense_Mutation_p.Q830E|NFAT5_ENST00000567239.1_Missense_Mutation_p.Q923E|NFAT5_ENST00000432919.1_Missense_Mutation_p.Q924E|NFAT5_ENST00000349945.1_Missense_Mutation_p.Q830E	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	906					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GAGTATCTGCCAGGCAGCTGC	0.473																																																	0													59.0	57.0	58.0					16																	69726498		2198	4300	6498	SO:0001583	missense	10725			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2716C>G	16.37:g.69726498C>G	ENSP00000346420:p.Gln906Glu		A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	C	11.49	1.653237	0.29425	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.42900	0.96;0.96;0.97;0.96	5.49	5.49	0.81192	.	0.189057	0.47455	D	0.000232	T	0.36166	0.0957	L	0.41236	1.265	0.47476	D	0.999434	P;B;P	0.39131	0.661;0.432;0.635	B;B;B	0.36464	0.147;0.104;0.225	T	0.08659	-1.0711	10	0.14252	T	0.57	-0.9472	19.7404	0.96228	0.0:1.0:0.0:0.0	.	923;906;924	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	E	924;923;830;906;830	ENSP00000396538:Q924E;ENSP00000338806:Q830E;ENSP00000346420:Q906E;ENSP00000377343:Q830E	ENSP00000338806:Q830E	Q	+	1	0	NFAT5	68283999	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.747000	0.68689	2.734000	0.93682	0.655000	0.94253	CAG		0.473	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2		NM_138714	
NOTCH1	4851	hgsc.bcm.edu	37	9	139401233	139401233	+	Missense_Mutation	SNP	C	C	T	rs61751543	byFrequency	TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr9:139401233C>T	ENST00000277541.6	-	23	3911	c.3836G>A	c.(3835-3837)cGt>cAt	p.R1279H		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1279	EGF-like 33. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CTGGGTGCCACGGGCGTCGCA	0.697			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)			C|||	36	0.0071885	0.0015	0.0173	5008	,	,		15350	0.006		0.0129	False		,,,				2504	0.0031							Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0								C	HIS/ARG	17,4251		0,17,2117	26.0	36.0	33.0		3836	4.0	0.9	9	dbSNP_129	33	196,8274		6,184,4045	yes	missense	NOTCH1	NM_017617.3	29	6,201,6162	TT,TC,CC		2.314,0.3983,1.6722	probably-damaging	1279/2556	139401233	213,12525	2134	4235	6369	SO:0001583	missense	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.3836G>A	9.37:g.139401233C>T	ENSP00000277541:p.Arg1279His		Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	22	0.010073260073260074	0	0.0	5	0.013812154696132596	5	0.008741258741258742	12	0.0158311345646438	C	16.23	3.065828	0.55539	0.003983	0.02314	ENSG00000148400	ENST00000277541	T	0.62788	-0.0	5.14	4.03	0.46877	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.065193	0.64402	D	0.000008	T	0.26085	0.0636	N	0.05330	-0.07	0.53005	D	0.999965	B	0.16802	0.019	B	0.18263	0.021	T	0.25572	-1.0128	10	0.45353	T	0.12	.	13.6364	0.62225	0.0:0.9104:0.0:0.0896	rs61751543	1279	P46531	NOTC1_HUMAN	H	1279	ENSP00000277541:R1279H	ENSP00000277541:R1279H	R	-	2	0	NOTCH1	138521054	0.990000	0.36364	0.949000	0.38748	0.618000	0.37518	2.851000	0.48302	2.397000	0.81536	0.655000	0.94253	CGT		0.697	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1		NM_017617	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144864284	144864284	+	Silent	SNP	C	C	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr1:144864284C>G	ENST00000369354.3	-	36	6000	c.5811G>C	c.(5809-5811)ctG>ctC	p.L1937L	PDE4DIP_ENST00000369356.4_Silent_p.L1937L|PDE4DIP_ENST00000313382.9_Silent_p.L1831L|PDE4DIP_ENST00000369359.4_Silent_p.L2073L|PDE4DIP_ENST00000524974.1_5'UTR|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000530740.1_Silent_p.L2022L			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1937					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATCGAGAGGACAGCAGAGCCT	0.532			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													107.0	115.0	113.0					1																	144864284		2203	4298	6501	SO:0001819	synonymous_variant	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5811G>C	1.37:g.144864284C>G			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	C	1.214	-0.628822	0.03610	.	.	ENSG00000178104	ENST00000530130	.	.	.	4.52	-5.36	0.02689	.	.	.	.	.	T	0.14013	0.0339	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31052	-0.9957	4	.	.	.	.	10.6496	0.45640	0.0944:0.1679:0.6638:0.0739	.	.	.	.	S	94	.	.	C	-	2	0	PDE4DIP	143575641	0.002000	0.14202	0.001000	0.08648	0.395000	0.30598	-0.546000	0.06062	-1.150000	0.02840	-0.182000	0.12963	TGT		0.532	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2		NM_022359	
PDE6B	5158	hgsc.bcm.edu;ucsc.edu	37	4	628559	628559	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr4:628559G>T	ENST00000496514.1	+	2	583	c.562G>T	c.(562-564)Gcg>Tcg	p.A188S	PDE6B_ENST00000255622.6_Missense_Mutation_p.A188S			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	188	GAF 1.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	AGACGTCGTGGCGGTGATCAT	0.572																																					GBM(71;463 1194 9848 25922 46834)												0													150.0	117.0	129.0					4																	628559		2203	4300	6503	SO:0001583	missense	5158			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.562G>T	4.37:g.628559G>T	ENSP00000420295:p.Ala188Ser		B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425884	0.62733	.	.	ENSG00000133256	ENST00000255622;ENST00000496514	T;T	0.68479	-0.33;-0.33	4.5	4.5	0.54988	GAF (2);	0.000000	0.85682	D	0.000000	D	0.84727	0.5536	M	0.92738	3.34	0.80722	D	1	D;D	0.65815	0.995;0.994	D;D	0.68483	0.958;0.929	D	0.88744	0.3245	10	0.72032	D	0.01	.	14.6966	0.69126	0.0:0.0:1.0:0.0	.	188;188	P35913;P35913-2	PDE6B_HUMAN;.	S	188	ENSP00000255622:A188S;ENSP00000420295:A188S	ENSP00000255622:A188S	A	+	1	0	PDE6B	618559	1.000000	0.71417	0.072000	0.20136	0.263000	0.26337	9.105000	0.94246	2.059000	0.61396	0.486000	0.48141	GCG		0.572	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1		NM_000283	
PEX3	8504	hgsc.bcm.edu;ucsc.edu	37	6	143780242	143780242	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr6:143780242T>C	ENST00000367591.4	+	2	157	c.94T>C	c.(94-96)Tat>Cat	p.Y32H		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	32	Targeting to peroxisomes.				peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)			endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		TCTGGGGAAATATGGACAGAA	0.338																																																	0													73.0	72.0	72.0					6																	143780242		2203	4300	6503	SO:0001583	missense	8504			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.94T>C	6.37:g.143780242T>C	ENSP00000356563:p.Tyr32His		Q6FGP5	Missense_Mutation	SNP	ENST00000367591.4	37	CCDS5199.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.262348	0.80358	.	.	ENSG00000034693	ENST00000367591	T	0.54866	0.55	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.62417	0.2426	M	0.71036	2.16	0.80722	D	1	D;D	0.59767	0.986;0.981	P;P	0.61658	0.892;0.745	T	0.65792	-0.6082	10	0.52906	T	0.07	-13.0484	16.0711	0.80936	0.0:0.0:0.0:1.0	.	32;32	B4DV31;P56589	.;PEX3_HUMAN	H	32	ENSP00000356563:Y32H	ENSP00000356563:Y32H	Y	+	1	0	PEX3	143821935	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.638000	0.83328	2.197000	0.70478	0.482000	0.46254	TAT		0.338	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042525.1			
PIK3C2B	5287	hgsc.bcm.edu	37	1	204399130	204399130	+	Silent	SNP	T	T	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr1:204399130T>G	ENST00000367187.3	-	30	4873	c.4317A>C	c.(4315-4317)ggA>ggC	p.G1439G	PIK3C2B_ENST00000424712.2_Silent_p.G1411G|RP11-739N20.2_ENST00000443515.1_RNA	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1439	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CCACCGCCTCTCCCCGGGAGC	0.642																																																	0													40.0	38.0	39.0					1																	204399130		2203	4299	6502	SO:0001819	synonymous_variant	5287			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4317A>C	1.37:g.204399130T>G			O95666|Q5SW99	Silent	SNP	ENST00000367187.3	37	CCDS1446.1																																																																																				0.642	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1		NM_002646	
PLXNA3	55558	hgsc.bcm.edu;ucsc.edu	37	X	153699964	153699964	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chrX:153699964A>G	ENST00000369682.3	+	32	5678	c.5503A>G	c.(5503-5505)Acc>Gcc	p.T1835A		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1835					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTTCTATGTCACCAAGTACCG	0.592																																																	0													86.0	66.0	73.0					X																	153699964		2203	4300	6503	SO:0001583	missense	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.5503A>G	X.37:g.153699964A>G	ENSP00000358696:p.Thr1835Ala		Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	.	.	.	.	.	.	.	.	.	.	A	11.45	1.642637	0.29246	.	.	ENSG00000130827	ENST00000369682	T	0.17054	2.3	4.93	3.76	0.43208	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.056293	0.64402	D	0.000002	T	0.11879	0.0289	L	0.45581	1.43	0.27109	N	0.96242	B	0.02656	0.0	B	0.08055	0.003	T	0.39643	-0.9604	10	0.06494	T	0.89	.	7.0722	0.25185	0.8077:0.0:0.1923:0.0	.	1835	P51805	PLXA3_HUMAN	A	1835	ENSP00000358696:T1835A	ENSP00000358696:T1835A	T	+	1	0	PLXNA3	153353158	1.000000	0.71417	1.000000	0.80357	0.578000	0.36192	2.692000	0.47018	0.571000	0.29365	0.356000	0.21956	ACC		0.592	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1		NM_017514	
POLR3A	11128	hgsc.bcm.edu	37	10	79781733	79781733	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr10:79781733A>C	ENST00000372371.3	-	7	1070	c.933T>G	c.(931-933)gaT>gaG	p.D311E	POLR3A_ENST00000484760.1_5'Flank	NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	311					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			GCTGCAGGAAATCCCAGTCCT	0.522																																																	0													85.0	75.0	78.0					10																	79781733		2203	4300	6503	SO:0001583	missense	11128			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.933T>G	10.37:g.79781733A>C	ENSP00000361446:p.Asp311Glu		Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	A	14.44	2.536102	0.45176	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.20069	2.1	5.45	-7.15	0.01521	RNA polymerase, N-terminal (1);RNA polymerase Rpb1, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.15825	0.0381	L	0.31804	0.96	0.48511	D	0.999663	B	0.25772	0.134	B	0.31337	0.128	T	0.02275	-1.1184	9	.	.	.	-27.7894	22.9448	0.99978	0.1851:0.0:0.8149:0.0	.	311	O14802	RPC1_HUMAN	E	311	ENSP00000361446:D311E	.	D	-	3	2	POLR3A	79451739	0.855000	0.29742	0.788000	0.31933	0.977000	0.68977	-0.073000	0.11468	-1.441000	0.01958	-0.280000	0.10049	GAT		0.522	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1		NM_007055	
PRB1	5542	hgsc.bcm.edu	37	12	11506473	11506473	+	Intron	SNP	C	C	G	rs61930109	byFrequency	TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr12:11506473C>G	ENST00000500254.2	-	4	351				PRB1_ENST00000546254.1_Intron|PRB1_ENST00000545626.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			CCTGAGGTTTCTTGCCTCCTT	0.597													N|||	2853	0.569688	0.4743	0.5922	5008	,	,		7205	0.753		0.6292	False		,,,				2504	0.4325																0													8.0	6.0	7.0					12																	11506473		932	1323	2255	SO:0001627	intron_variant	5542				CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.314-149G>C	12.37:g.11506473C>G			Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Missense_Mutation	SNP	ENST00000500254.2	37	CCDS8642.1																																																																																				0.597	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1		NM_005039	
RAB11FIP2	22841	hgsc.bcm.edu;ucsc.edu	37	10	119798634	119798634	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr10:119798634A>C	ENST00000355624.3	-	3	1553	c.1114T>G	c.(1114-1116)Tct>Gct	p.S372A	RP11-354M20.3_ENST00000451610.2_RNA|RP11-354M20.3_ENST00000417968.4_RNA|RAB11FIP2_ENST00000369199.3_Missense_Mutation_p.S372A	NM_014904.2	NP_055719.1	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2 (class I)	372					establishment of cell polarity (GO:0030010)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(8)	19		Colorectal(252;0.235)		all cancers(201;0.0238)		AGTTTATCAGATCTTCTGCTA	0.338																																																	0													192.0	209.0	203.0					10																	119798634		2203	4300	6503	SO:0001583	missense	22841			AY037299	CCDS7602.1	10q26.12	2004-07-22			ENSG00000107560	ENSG00000107560			29152	protein-coding gene	gene with protein product		608599				11994279, 10231032	Standard	NM_014904		Approved	KIAA0941, nRip11, Rab11-FIP2	uc001ldj.2	Q7L804	OTTHUMG00000019128	ENST00000355624.3:c.1114T>G	10.37:g.119798634A>C	ENSP00000347839:p.Ser372Ala		A6NEI4|Q3I768|Q9Y2F0	Missense_Mutation	SNP	ENST00000355624.3	37	CCDS7602.1	.	.	.	.	.	.	.	.	.	.	A	10.56	1.383948	0.25031	.	.	ENSG00000107560	ENST00000355624;ENST00000369199	T;T	0.64803	-0.12;-0.09	5.76	0.426	0.16479	.	0.462197	0.26792	N	0.022461	T	0.45438	0.1342	L	0.44542	1.39	0.27185	N	0.960566	B;B	0.17852	0.024;0.002	B;B	0.18263	0.021;0.006	T	0.27157	-1.0082	10	0.14656	T	0.56	-2.8065	6.8427	0.23971	0.5086:0.3628:0.1286:0.0	.	372;372	Q3I768;Q7L804	.;RFIP2_HUMAN	A	372	ENSP00000347839:S372A;ENSP00000358200:S372A	ENSP00000347839:S372A	S	-	1	0	RAB11FIP2	119788624	1.000000	0.71417	0.989000	0.46669	0.999000	0.98932	2.093000	0.41710	-0.096000	0.12329	0.528000	0.53228	TCT		0.338	RAB11FIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050583.1		NM_014904	
SDK2	54549	hgsc.bcm.edu	37	17	71418510	71418510	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr17:71418510C>T	ENST00000392650.3	-	15	1961	c.1961G>A	c.(1960-1962)gGc>gAc	p.G654D	SDK2_ENST00000388726.3_Missense_Mutation_p.G654D	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	654	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						AGGAACCAGGCCCTTGACTGT	0.592																																																	0													177.0	143.0	155.0					17																	71418510		2203	4300	6503	SO:0001583	missense	54549			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1961G>A	17.37:g.71418510C>T	ENSP00000376421:p.Gly654Asp		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.642696	0.47153	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.56275	0.47;0.47	5.12	4.15	0.48705	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.061278	0.64402	D	0.000003	T	0.41236	0.1150	L	0.39245	1.2	0.53005	D	0.999968	B;B	0.13594	0.007;0.008	B;B	0.25614	0.036;0.062	T	0.22661	-1.0210	10	0.22706	T	0.39	.	9.1849	0.37165	0.0:0.8349:0.0:0.1651	.	654;654	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	D	278;654;654;654	ENSP00000376421:G654D;ENSP00000373378:G654D	ENSP00000324967:G654D	G	-	2	0	SDK2	68930105	0.997000	0.39634	0.986000	0.45419	0.835000	0.47333	3.009000	0.49552	2.373000	0.80994	0.462000	0.41574	GGC		0.592	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2		NM_019064	
SLC12A9	56996	hgsc.bcm.edu	37	7	100459532	100459532	+	Splice_Site	SNP	C	C	T	rs201332376	byFrequency	TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:100459532C>T	ENST00000354161.3	+	12	1835	c.1710C>T	c.(1708-1710)ctC>ctT	p.L570L	SLC12A9_ENST00000428758.1_Splice_Site_p.L570L|SLC12A9_ENST00000540482.1_Splice_Site_p.L570L|SLC12A9_ENST00000275729.3_Splice_Site_p.L481L|SLC12A9_ENST00000415287.1_Splice_Site_p.L481L	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	570					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGGGAGACCTCGGTGAGCTGC	0.602													C|||	4	0.000798722	0.0	0.0	5008	,	,		14042	0.003		0.0	False		,,,				2504	0.001																0								C		0,4406		0,0,2203	22.0	25.0	24.0		1710	-10.9	0.8	7		24	4,8596	3.0+/-9.4	0,4,4296	yes	coding-synonymous-near-splice	SLC12A9	NM_020246.2		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		570/915	100459532	4,13002	2203	4300	6503	SO:0001630	splice_region_variant	56996			AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1711+1C>T	7.37:g.100459532C>T			B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Silent	SNP	ENST00000354161.3	37	CCDS5707.1																																																																																				0.602	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1		NM_020246	Silent
SLFN5	162394	hgsc.bcm.edu;ucsc.edu	37	17	33586478	33586478	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr17:33586478G>T	ENST00000299977.4	+	2	917	c.769G>T	c.(769-771)Ggc>Tgc	p.G257C	SLFN5_ENST00000542451.1_Missense_Mutation_p.G257C|SLFN5_ENST00000592325.1_Missense_Mutation_p.G257C	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	257					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		TTCTATTGATGGCTGTATTAA	0.423																																																	0													132.0	134.0	133.0					17																	33586478		2203	4300	6503	SO:0001583	missense	162394			BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.769G>T	17.37:g.33586478G>T	ENSP00000299977:p.Gly257Cys		Q08AF2|Q8WU54|Q96A82	Missense_Mutation	SNP	ENST00000299977.4	37	CCDS32619.1	.	.	.	.	.	.	.	.	.	.	G	2.388	-0.340594	0.05243	.	.	ENSG00000166750	ENST00000299977;ENST00000542451	T;T	0.59772	0.24;0.24	3.68	-7.36	0.01417	.	2.499900	0.01828	N	0.034491	T	0.41190	0.1148	L	0.34521	1.04	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.10450	0.001;0.001;0.005	T	0.26608	-1.0098	10	0.62326	D	0.03	.	2.2456	0.04031	0.4596:0.1009:0.1038:0.3357	.	257;257;257	B4E128;Q08AF3;Q08AF3-2	.;SLFN5_HUMAN;.	C	257	ENSP00000299977:G257C;ENSP00000440537:G257C	ENSP00000299977:G257C	G	+	1	0	SLFN5	30610591	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-6.898000	0.00050	-3.972000	0.00086	-1.686000	0.00732	GGC		0.423	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448649.2		NM_144975	
SNAPC3	6619	hgsc.bcm.edu;ucsc.edu	37	9	15453105	15453105	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr9:15453105A>T	ENST00000380821.3	+	7	1058	c.882A>T	c.(880-882)gaA>gaT	p.E294D	SNAPC3_ENST00000380799.1_Missense_Mutation_p.E91D	NM_001039697.1	NP_001034786.1	Q92966	SNPC3_HUMAN	small nuclear RNA activating complex, polypeptide 3, 50kDa	294					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription (GO:0009301)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(6)|lung(2)	12				GBM - Glioblastoma multiforme(50;2.15e-06)		CTAGAATGGAAGATTTCACCT	0.393																																																	0													197.0	190.0	192.0					9																	15453105		2203	4300	6503	SO:0001583	missense	6619			U71300	CCDS6478.1	9p22.3	2008-07-21	2002-08-29		ENSG00000164975	ENSG00000164975			11136	protein-coding gene	gene with protein product		602348	"""small nuclear RNA activating complex, polypeptide 3, 50kD"""			9003788	Standard	XR_428427		Approved	SNAP50, PTFbeta, MGC33124, MGC132011	uc003zlt.3	Q92966	OTTHUMG00000019583	ENST00000380821.3:c.882A>T	9.37:g.15453105A>T	ENSP00000370200:p.Glu294Asp		D3DRI8|Q2VPI6|Q5T285	Missense_Mutation	SNP	ENST00000380821.3	37	CCDS6478.1	.	.	.	.	.	.	.	.	.	.	A	19.32	3.805510	0.70682	.	.	ENSG00000164975	ENST00000380821;ENST00000380799	T;T	0.45668	0.89;0.89	5.06	2.69	0.31865	.	0.000000	0.85682	D	0.000000	T	0.44329	0.1288	L	0.60904	1.88	0.58432	D	0.999999	P	0.48834	0.916	P	0.49683	0.619	T	0.30268	-0.9984	10	0.44086	T	0.13	-12.6915	8.2654	0.31810	0.7619:0.0:0.2381:0.0	.	294	Q92966	SNPC3_HUMAN	D	294;91	ENSP00000370200:E294D;ENSP00000370177:E91D	ENSP00000370177:E91D	E	+	3	2	SNAPC3	15443105	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.367000	0.52350	0.751000	0.32900	0.459000	0.35465	GAA		0.393	SNAPC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051763.2		NM_001039697	
SNX13	23161	hgsc.bcm.edu;ucsc.edu	37	7	17915357	17915357	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr7:17915357C>A	ENST00000409389.1	-	6	669	c.497G>T	c.(496-498)gGc>gTc	p.G166V	SNX13_ENST00000428135.3_Missense_Mutation_p.G166V			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	166	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TAAGTGTGTGCCAAAGTCATC	0.308																																																	0													140.0	124.0	129.0					7																	17915357		1831	4085	5916	SO:0001583	missense	23161			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.497G>T	7.37:g.17915357C>A	ENSP00000386705:p.Gly166Val		B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	ENST00000409389.1	37		.	.	.	.	.	.	.	.	.	.	C	14.72	2.620050	0.46736	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	T;T	0.17213	2.29;2.55	5.5	5.5	0.81552	Phox-associated domain (2);PX-associated, sorting nexin 13 (1);	0.049431	0.85682	D	0.000000	T	0.10035	0.0246	N	0.11201	0.11	0.80722	D	1	B;B;B	0.16802	0.008;0.004;0.019	B;B;B	0.21151	0.033;0.012;0.019	T	0.26430	-1.0103	10	0.15952	T	0.53	-6.7756	14.3423	0.66636	0.0:0.7284:0.2716:0.0	.	166;166;166	Q9Y5W8;B8ZZT9;Q9Y5W8-2	SNX13_HUMAN;.;.	V	166;166;214	ENSP00000386705:G166V;ENSP00000398789:G166V	ENSP00000242044:G214V	G	-	2	0	SNX13	17881882	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.486000	0.60286	2.565000	0.86533	0.655000	0.94253	GGC		0.308	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1		NM_015132	
SRRM2	23524	hgsc.bcm.edu	37	16	2816400	2816400	+	Silent	SNP	G	G	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr16:2816400G>A	ENST00000301740.8	+	11	6420	c.5871G>A	c.(5869-5871)agG>agA	p.R1957R		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1957	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CTCGCAGAAGGTCCAGATCCA	0.567																																																	0													68.0	70.0	70.0					16																	2816400		2198	4300	6498	SO:0001819	synonymous_variant	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5871G>A	16.37:g.2816400G>A			A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																				0.567	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			
STRADB	55437	hgsc.bcm.edu;ucsc.edu	37	2	202340447	202340447	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr2:202340447A>T	ENST00000194530.3	+	7	895	c.530A>T	c.(529-531)cAa>cTa	p.Q177L	STRADB_ENST00000392249.2_Missense_Mutation_p.Q177L	NM_001206864.1|NM_018571.5	NP_001193793.1|NP_061041.2	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	177	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cell morphogenesis (GO:0000902)|insulin receptor signaling pathway (GO:0008286)|JNK cascade (GO:0007254)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|lung(5)|prostate(1)|skin(3)|stomach(1)	13						TATCTGCACCAAAATGGCTGT	0.353																																																	0													116.0	118.0	117.0					2																	202340447		2203	4300	6503	SO:0001583	missense	55437			AB038950	CCDS2348.1, CCDS56161.1	2q33.1	2010-09-30	2008-09-15	2008-09-15	ENSG00000082146	ENSG00000082146			13205	protein-coding gene	gene with protein product		607333	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2"""	ALS2CR2		11161814, 14511394	Standard	NM_018571		Approved	CALS-21, PAPK, ILPIPA, ILPIP	uc002uyd.4	Q9C0K7	OTTHUMG00000132831	ENST00000194530.3:c.530A>T	2.37:g.202340447A>T	ENSP00000194530:p.Gln177Leu		Q5BKY7|Q9P1L0	Missense_Mutation	SNP	ENST00000194530.3	37	CCDS2348.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.823834	0.71143	.	.	ENSG00000082146	ENST00000458269;ENST00000194530;ENST00000539670;ENST00000392249;ENST00000392866	T;T;T	0.65916	-0.18;2.72;2.72	5.65	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.055417	0.85682	D	0.000000	T	0.66237	0.2769	L	0.54908	1.71	0.51012	D	0.999906	D	0.57257	0.979	P	0.52343	0.696	T	0.67991	-0.5527	10	0.59425	D	0.04	.	11.7461	0.51821	0.9309:0.0:0.0691:0.0	.	177	Q9C0K7	STRAB_HUMAN	L	122;177;177;177;39	ENSP00000409552:Q122L;ENSP00000194530:Q177L;ENSP00000376080:Q177L	ENSP00000194530:Q177L	Q	+	2	0	STRADB	202048692	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.761000	0.62243	1.076000	0.40961	0.460000	0.39030	CAA		0.353	STRADB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256297.1		NM_018571	
SYTL2	54843	hgsc.bcm.edu;ucsc.edu	37	11	85435949	85435949	+	Intron	SNP	C	C	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr11:85435949C>A	ENST00000528231.1	-	7	1737				SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000354566.3_Missense_Mutation_p.R517S|SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000525423.1_Missense_Mutation_p.R517S|SYTL2_ENST00000359152.5_Missense_Mutation_p.R1041S	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CAATTGTTTCCCTCACAATTT	0.433																																																	0													114.0	111.0	112.0					11																	85435949		2203	4299	6502	SO:0001627	intron_variant	54843			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1459+2989G>T	11.37:g.85435949C>A			B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.253120	0.39797	.	.	ENSG00000137501	ENST00000359152;ENST00000354566;ENST00000525423	T;T;T	0.33216	1.44;1.42;1.43	5.58	3.6	0.41247	.	0.311758	0.28219	N	0.016146	T	0.23410	0.0566	L	0.32530	0.975	0.09310	N	1	P;P;P	0.42296	0.775;0.617;0.617	B;B;B	0.43916	0.436;0.306;0.306	T	0.06092	-1.0846	9	.	.	.	-2.1265	6.0279	0.19665	0.0:0.7463:0.0:0.2537	.	517;517;517	Q9HCH5-11;Q9HCH5-7;Q9HCH5-8	.;.;.	S	1041;517;517	ENSP00000352065:R1041S;ENSP00000346576:R517S;ENSP00000432694:R517S	.	R	-	3	2	SYTL2	85113597	0.006000	0.16342	0.734000	0.30879	0.884000	0.51177	0.448000	0.21726	1.605000	0.50152	0.655000	0.94253	AGG		0.433	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1		NM_206927	
TAF4	6874	hgsc.bcm.edu	37	20	60551323	60551323	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr20:60551323T>A	ENST00000252996.4	-	15	3158	c.3159A>T	c.(3157-3159)caA>caT	p.Q1053H		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	1053					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			GCGTGATTCTTTGTCGCGTGA	0.522																																																	0													105.0	112.0	110.0					20																	60551323		2203	4300	6503	SO:0001583	missense	6874			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.3159A>T	20.37:g.60551323T>A	ENSP00000252996:p.Gln1053His		A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	37	CCDS33500.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.502330	0.44455	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.26373	1.74;1.74	5.35	-0.35	0.12606	Transcription initiation factor TFIID component TAF4 (1);	0.000000	0.85682	D	0.000000	T	0.41419	0.1158	M	0.64997	1.995	0.49915	D	0.999832	D	0.89917	1.0	D	0.91635	0.999	T	0.07028	-1.0794	10	0.45353	T	0.12	-8.1595	9.5135	0.39091	0.0:0.2852:0.0:0.7148	.	1053	O00268	TAF4_HUMAN	H	1053;917	ENSP00000252996:Q1053H;ENSP00000399091:Q917H	ENSP00000252996:Q1053H	Q	-	3	2	TAF4	59984718	1.000000	0.71417	0.970000	0.41538	0.203000	0.24098	0.968000	0.29357	-0.351000	0.08249	-0.290000	0.09829	CAA		0.522	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2		NM_003185	
UNC5B	219699	hgsc.bcm.edu	37	10	73057821	73057821	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr10:73057821G>A	ENST00000335350.6	+	16	3062	c.2646G>A	c.(2644-2646)atG>atA	p.M882I	UNC5B_ENST00000373192.4_Missense_Mutation_p.M871I	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	882	Death.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						ACTGGCGGATGTTAGCACAGA	0.582																																																	0													112.0	82.0	92.0					10																	73057821		2203	4300	6503	SO:0001583	missense	219699			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.2646G>A	10.37:g.73057821G>A	ENSP00000334329:p.Met882Ile		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.793604	0.31685	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	D;D	0.84800	-1.9;-1.9	5.73	-0.05	0.13832	Death (2);DEATH-like (2);	0.078767	0.52532	D	0.000072	T	0.74199	0.3685	L	0.50333	1.59	0.26331	N	0.977522	B;B	0.17667	0.018;0.023	B;B	0.17979	0.011;0.02	T	0.59910	-0.7365	10	0.40728	T	0.16	-6.6994	0.6753	0.00865	0.2677:0.2612:0.2846:0.1866	.	871;882	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	I	882;871	ENSP00000334329:M882I;ENSP00000362288:M871I	ENSP00000334329:M882I	M	+	3	0	UNC5B	72727827	0.057000	0.20700	0.256000	0.24389	0.793000	0.44817	-0.411000	0.07142	-0.277000	0.09193	0.655000	0.94253	ATG		0.582	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1		NM_170744	
USH1C	10083	hgsc.bcm.edu;ucsc.edu	37	11	17523523	17523523	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr11:17523523A>G	ENST00000318024.4	-	16	1397	c.1289T>C	c.(1288-1290)tTc>tCc	p.F430S	USH1C_ENST00000527720.1_Missense_Mutation_p.F399S|USH1C_ENST00000527020.1_Missense_Mutation_p.F411S|USH1C_ENST00000529563.1_5'UTR|USH1C_ENST00000005226.7_Missense_Mutation_p.F730S	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	430					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)	p.F730S(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						ATATTTCCGGAAATCCTGGAA	0.537																																																	1	Substitution - Missense(1)	large_intestine(1)											91.0	84.0	86.0					11																	17523523		2200	4293	6493	SO:0001583	missense	10083			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1289T>C	11.37:g.17523523A>G	ENSP00000317018:p.Phe430Ser		A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	37	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.213540	0.79352	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	T;T;T;T	0.36157	1.27;1.27;1.62;1.64	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.48150	0.1484	L	0.32530	0.975	0.39073	D	0.960753	P;P;D	0.71674	0.763;0.651;0.998	B;B;D	0.75484	0.229;0.115;0.986	T	0.52815	-0.8525	10	0.62326	D	0.03	.	12.9057	0.58152	1.0:0.0:0.0:0.0	.	411;430;730	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	S	430;399;411;730	ENSP00000317018:F430S;ENSP00000432944:F399S;ENSP00000436934:F411S;ENSP00000005226:F730S	ENSP00000005226:F730S	F	-	2	0	USH1C	17480099	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.625000	0.74248	2.042000	0.60477	0.528000	0.53228	TTC		0.537	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1		NM_005709	
VPS13C	54832	hgsc.bcm.edu	37	15	62238606	62238606	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr15:62238606A>G	ENST00000261517.5	-	44	4953	c.4880T>C	c.(4879-4881)aTg>aCg	p.M1627T	VPS13C_ENST00000395896.4_Missense_Mutation_p.M1627T|VPS13C_ENST00000395898.3_Missense_Mutation_p.M1584T|VPS13C_ENST00000249837.3_Missense_Mutation_p.M1584T	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						AGAGGCATCCATTCCTATAGG	0.333																																																	0													52.0	49.0	50.0					15																	62238606		2203	4294	6497	SO:0001583	missense	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.4880T>C	15.37:g.62238606A>G	ENSP00000261517:p.Met1627Thr			Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.027503	0.54683	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.40756	1.02;1.02;1.02	5.47	5.47	0.80525	.	0.148459	0.64402	D	0.000016	T	0.51856	0.1699	M	0.72479	2.2	0.54753	D	0.999985	P;P;P;P	0.37708	0.606;0.606;0.606;0.603	B;B;B;B	0.43728	0.429;0.429;0.429;0.247	T	0.57201	-0.7852	10	0.72032	D	0.01	.	15.5539	0.76177	1.0:0.0:0.0:0.0	.	1584;1627;1584;1627	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	T	1584;1627;1627;1627	ENSP00000249837:M1584T;ENSP00000261517:M1627T;ENSP00000379233:M1627T	ENSP00000249837:M1584T	M	-	2	0	VPS13C	60025898	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	6.169000	0.71913	2.077000	0.62373	0.528000	0.53228	ATG		0.333	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1		NM_017684	
ZC3H6	376940	hgsc.bcm.edu;ucsc.edu	37	2	113080286	113080286	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr2:113080286A>G	ENST00000409871.1	+	9	1548	c.1147A>G	c.(1147-1149)Aag>Gag	p.K383E	ZC3H6_ENST00000343936.4_Missense_Mutation_p.K383E	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	383							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						GGAACTTAGAAAGCGTGGCAT	0.413																																																	0													106.0	106.0	106.0					2																	113080286		1819	4070	5889	SO:0001583	missense	376940			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.1147A>G	2.37:g.113080286A>G	ENSP00000386764:p.Lys383Glu		A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	37	CCDS46393.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.783648	0.90282	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.55234	0.53;0.53	5.73	5.73	0.89815	.	0.094359	0.64402	D	0.000001	T	0.56031	0.1958	M	0.64404	1.975	0.49687	D	0.999813	P	0.52316	0.952	P	0.44518	0.452	T	0.63202	-0.6690	10	0.87932	D	0	-11.5848	16.0209	0.80493	1.0:0.0:0.0:0.0	.	383	P61129	ZC3H6_HUMAN	E	383;383;360	ENSP00000386764:K383E;ENSP00000340298:K383E	ENSP00000340298:K383E	K	+	1	0	ZC3H6	112796757	1.000000	0.71417	0.259000	0.24435	0.997000	0.91878	8.730000	0.91510	2.186000	0.69663	0.459000	0.35465	AAG		0.413	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1		NM_198581	
ZNF142	7701	hgsc.bcm.edu;ucsc.edu	37	2	219508795	219508795	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr2:219508795G>C	ENST00000449707.1	-	8	2865	c.2444C>G	c.(2443-2445)gCa>gGa	p.A815G	ZNF142_ENST00000411696.2_Missense_Mutation_p.A815G	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	815					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CAATGCCTCTGCTTGTTCTTT	0.572																																					Colon(170;867 1942 8995 15834 18053)												0													204.0	217.0	213.0					2																	219508795		2110	4227	6337	SO:0001583	missense	7701			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.2444C>G	2.37:g.219508795G>C	ENSP00000408643:p.Ala815Gly		Q92510	Missense_Mutation	SNP	ENST00000449707.1	37	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320452	0.81469	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.23950	1.88;1.88	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.40932	0.1137	L	0.34521	1.04	0.58432	D	0.999994	D;D	0.69078	0.997;0.997	D;D	0.75020	0.985;0.985	T	0.04752	-1.0929	10	0.30854	T	0.27	-32.6013	18.9765	0.92738	0.0:0.0:1.0:0.0	.	815;652	P52746;A8MWU9	ZN142_HUMAN;.	G	815	ENSP00000408643:A815G;ENSP00000398798:A815G	ENSP00000398798:A815G	A	-	2	0	ZNF142	219217039	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.816000	0.86201	2.720000	0.93068	0.655000	0.94253	GCA		0.572	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1		NM_005081	
ZNF577	84765	hgsc.bcm.edu;ucsc.edu	37	19	52376920	52376920	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr19:52376920G>C	ENST00000301399.5	-	7	688	c.323C>G	c.(322-324)tCt>tGt	p.S108C	ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000412216.1_Intron|ZNF577_ENST00000420592.1_Intron|ZNF577_ENST00000451628.2_Intron	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	108					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		AAATGCATCAGAATCTTTTCC	0.378																																																	0													63.0	57.0	59.0					19																	52376920		2203	4300	6503	SO:0001583	missense	84765			AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.323C>G	19.37:g.52376920G>C	ENSP00000301399:p.Ser108Cys		A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	37	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	10.61	1.398434	0.25205	.	.	ENSG00000161551	ENST00000301399;ENST00000458390	T;T	0.07216	3.21;3.21	2.68	-0.977	0.10282	.	.	.	.	.	T	0.09247	0.0228	M	0.75615	2.305	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.34875	-0.9811	9	0.35671	T	0.21	.	3.3884	0.07280	0.1059:0.1686:0.5524:0.1731	.	108	Q9BSK1	ZN577_HUMAN	C	108	ENSP00000301399:S108C;ENSP00000404509:S108C	ENSP00000301399:S108C	S	-	2	0	ZNF577	57068732	0.077000	0.21312	0.000000	0.03702	0.062000	0.15995	2.858000	0.48356	-0.113000	0.11958	-0.518000	0.04402	TCT		0.378	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1		NM_032679	
ZNF804A	91752	hgsc.bcm.edu;ucsc.edu	37	2	185800961	185800961	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr2:185800961C>A	ENST00000302277.6	+	4	1432	c.838C>A	c.(838-840)Cca>Aca	p.P280T		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	280							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CTCTTTTCATCCACCAGAGGC	0.368																																																	0													65.0	61.0	62.0					2																	185800961		2203	4299	6502	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.838C>A	2.37:g.185800961C>A	ENSP00000303252:p.Pro280Thr		A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223484	0.39300	.	.	ENSG00000170396	ENST00000302277	T	0.07800	3.16	5.57	0.745	0.18359	.	0.628414	0.15042	N	0.283795	T	0.06826	0.0174	L	0.47716	1.5	0.09310	N	1	B	0.24132	0.098	B	0.24006	0.05	T	0.31392	-0.9945	10	0.52906	T	0.07	-5.3944	2.3685	0.04324	0.1222:0.4554:0.2092:0.2133	.	280	Q7Z570	Z804A_HUMAN	T	280	ENSP00000303252:P280T	ENSP00000303252:P280T	P	+	1	0	ZNF804A	185509206	0.002000	0.14202	0.286000	0.24833	0.815000	0.46073	-0.024000	0.12435	0.702000	0.31825	0.591000	0.81541	CCA		0.368	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1		NM_194250	
SETD2	29072	ucsc.edu	37	3	47058655	47058661	+	Frame_Shift_Del	DEL	CTTGGTT	CTTGGTT	-			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	CTTGGTT	CTTGGTT	CTTGGTT	-	CTTGGTT	CTTGGTT	Unknown	Valid	Somatic	.	WXS	PGM	.		SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr3:47058655_47058661delCTTGGTT	ENST00000409792.3	-	21	7659_7665	c.7617_7623delAACCAAG	c.(7615-7623)aaaaccaagfs	p.KTK2539fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2539	Interaction with POLR2A.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TAATGTACTCCTTGGTTTTGTGTTTCA	0.473			"""N, F, S, Mis"""		clear cell renal carcinoma																																	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0																																										SO:0001589	frameshift_variant	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7617_7623delAACCAAG	3.37:g.47058655_47058661delCTTGGTT	ENSP00000386759:p.Lys2539fs		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	37	CCDS2749.2																																																																																				0.473	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
PBRM1	55193	ucsc.edu	37	3	52702574	52702574	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AK-3431-01A-02D-1361-10	TCGA-AK-3431-10A-01D-1361-10	A	A	A	-	A	A	Unknown	Valid	Somatic	.	WXS	PGM	.		SOLID	3edc98c2-fa19-4304-b755-eaa3c7977058	bcfea68f-0d4d-44f2-8d20-41bd03b717cb	g.chr3:52702574delA	ENST00000296302.7	-	3	325	c.324delT	c.(322-324)gatfs	p.D108fs	PBRM1_ENST00000409057.1_Frame_Shift_Del_p.D108fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.D108fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.D108fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.D108fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.D108fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.D108fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.D108fs			Q86U86	PB1_HUMAN	polybromo 1	108	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GCAAATTAACATCATCATACT	0.318			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	.		Rec	yes		3	3p21	55193	polybromo 1		E	0													90.0	83.0	85.0					3																	52702574		2203	4297	6500	SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.324delT	3.37:g.52702574delA	ENSP00000296302:p.Asp108fs		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.318	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
