#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA8	10351	hgsc.bcm.edu	37	17	66933090	66933090	+	Splice_Site	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr17:66933090A>G	ENST00000269080.2	-	4	604		c.e4+1		ABCA8_ENST00000586539.1_Splice_Site|ABCA8_ENST00000430352.2_Splice_Site	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8						transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CCATAAAATTACCTGTATGGT	0.353																																																	0													133.0	109.0	117.0					17																	66933090		2203	4300	6503	SO:0001630	splice_region_variant	10351			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.466+1T>C	17.37:g.66933090A>G			A1L3U3|C9JQE6|Q86WW0	Splice_Site	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	A	9.952	1.220475	0.22457	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000428549	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9092	0.47099	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA8	64444685	1.000000	0.71417	0.992000	0.48379	0.110000	0.19582	3.930000	0.56522	2.135000	0.66039	0.533000	0.62120	.		0.353	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1		NM_007168	Intron
ADAMTS2	9509	hgsc.bcm.edu	37	5	178559878	178559878	+	Silent	SNP	G	G	A	rs200210415		TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr5:178559878G>A	ENST00000251582.7	-	14	2210	c.2109C>T	c.(2107-2109)atC>atT	p.I703I		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	703	Cys-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGCTGGAGCCGATCACACCGT	0.577																																																	0								G		0,4406		0,0,2203	154.0	95.0	115.0		2109	-3.2	0.9	5		115	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ADAMTS2	NM_014244.4		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		703/1212	178559878	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	9509			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2109C>T	5.37:g.178559878G>A				Silent	SNP	ENST00000251582.7	37	CCDS4444.1																																																																																				0.577	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1		NM_014244	
ALAS2	212	hgsc.bcm.edu	37	X	55051156	55051156	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chrX:55051156T>C	ENST00000330807.5	-	3	436	c.299A>G	c.(298-300)aAg>aGg	p.K100R	ALAS2_ENST00000396198.3_Missense_Mutation_p.K124R|ALAS2_ENST00000335854.4_Missense_Mutation_p.K100R	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	100					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	CCAACCTGTCTTGAAAGCCTT	0.498																																																	0													226.0	136.0	167.0					X																	55051156		2203	4300	6503	SO:0001583	missense	212				CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.299A>G	X.37:g.55051156T>C	ENSP00000332369:p.Lys100Arg		A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	ENST00000330807.5	37	CCDS14366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.45|11.45	1.643640|1.643640	0.29246|0.29246	.|.	.|.	ENSG00000158578|ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854|ENST00000455688	D;D;D|.	0.97114|.	-4.1;-4.25;-4.22|.	4.75|4.75	4.75|4.75	0.60458|0.60458	5-aminolevulinate synthase presequence (1);|.	0.271361|.	0.35013|.	N|.	0.003515|.	T|T	0.56543|0.56543	0.1992|0.1992	L|L	0.39898|0.39898	1.24|1.24	0.36505|0.36505	D|D	0.869251|0.869251	B;B;B|.	0.14012|.	0.005;0.003;0.009|.	B;B;B|.	0.15052|.	0.012;0.012;0.012|.	T|T	0.61778|0.61778	-0.6993|-0.6993	10|5	0.21014|.	T|.	0.42|.	-19.1343|-19.1343	12.6519|12.6519	0.56766|0.56766	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	100;124;100|.	A8K6C4;Q5JZF5;P22557|.	.;.;HEM0_HUMAN|.	R|G	100;124;100|52	ENSP00000332369:K100R;ENSP00000379501:K124R;ENSP00000337131:K100R|.	ENSP00000332369:K100R|.	K|R	-|-	2|1	0|2	ALAS2|ALAS2	55067881|55067881	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.481000|0.481000	0.33189|0.33189	1.863000|1.863000	0.39459|0.39459	1.693000|1.693000	0.51124|0.51124	0.486000|0.486000	0.48141|0.48141	AAG|AGA		0.498	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3		NM_000032	
ALKBH8	91801	hgsc.bcm.edu;ucsc.edu	37	11	107375723	107375723	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr11:107375723G>C	ENST00000428149.2	-	12	1807	c.1656C>G	c.(1654-1656)gaC>gaG	p.D552E	ALKBH8_ENST00000389568.3_Missense_Mutation_p.D552E|ALKBH8_ENST00000417449.2_Missense_Mutation_p.D555E|ALKBH8_ENST00000429370.1_Intron	NM_138775.2	NP_620130.2	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8 (E. coli)	552	Methyltransferase domain.				cellular response to DNA damage stimulus (GO:0006974)|tRNA methylation (GO:0030488)	cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|RNA binding (GO:0003723)|tRNA (uracil) methyltransferase activity (GO:0016300)			breast(2)|large_intestine(2)|lung(5)	9		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		AAGATGCCGAGTCTCGACTGC	0.468																																																	0													158.0	131.0	139.0					11																	107375723		692	1591	2283	SO:0001583	missense	91801			AF086489	CCDS8337.2, CCDS73376.1	11q22.3	2013-10-04			ENSG00000137760	ENSG00000137760	2.1.1.229	"""Alkylation repair homologs"", ""RNA binding motif (RRM) containing"""	25189	protein-coding gene	gene with protein product		613306				20123966	Standard	NM_138775		Approved	MGC10235	uc009yxp.3	Q96BT7	OTTHUMG00000157008	ENST00000428149.2:c.1656C>G	11.37:g.107375723G>C	ENSP00000415885:p.Asp552Glu		B1Q2M0|B4DEF6|Q8N989	Missense_Mutation	SNP	ENST00000428149.2	37	CCDS8337.2	.	.	.	.	.	.	.	.	.	.	G	6.070	0.381275	0.11466	.	.	ENSG00000137760	ENST00000428149;ENST00000389568;ENST00000417449	T;T;T	0.42131	0.98;0.98;0.98	5.07	-3.89	0.04193	.	1.003990	0.08014	N	0.990829	T	0.27866	0.0686	L	0.40543	1.245	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.09377	0.001;0.004	T	0.28776	-1.0033	10	0.25106	T	0.35	-21.7211	6.5154	0.22244	0.4354:0.2169:0.3477:0.0	.	552;555	Q96BT7;Q96BT7-4	ALKB8_HUMAN;.	E	552;552;555	ENSP00000415885:D552E;ENSP00000374219:D552E;ENSP00000397673:D555E	ENSP00000374219:D552E	D	-	3	2	ALKBH8	106880933	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.442000	0.06871	-0.326000	0.08564	0.650000	0.86243	GAC		0.468	ALKBH8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347071.2		NM_138775	
SLC35G3	146861	hgsc.bcm.edu;ucsc.edu	37	17	33520323	33520323	+	Missense_Mutation	SNP	C	C	T	rs369787605		TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr17:33520323C>T	ENST00000297307.5	-	1	1089	c.1004G>A	c.(1003-1005)aGg>aAg	p.R335K	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	335						integral component of membrane (GO:0016021)		p.R335K(4)									CTCCTCCACCCTCCCTGTCCT	0.557																																																	4	Substitution - Missense(4)	lung(2)|urinary_tract(1)|prostate(1)											57.0	57.0	57.0					17																	33520323		2203	4300	6503	SO:0001583	missense	0			AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.1004G>A	17.37:g.33520323C>T	ENSP00000297307:p.Arg335Lys		B9EGE9	Missense_Mutation	SNP	ENST00000297307.5	37	CCDS11293.1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.031780	0.00410	.	.	ENSG00000164729	ENST00000297307	T	0.24723	1.84	.	.	.	.	1.165660	0.06508	N	0.737480	T	0.10723	0.0262	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34378	-0.9831	8	0.07990	T	0.79	0.0	.	.	.	.	335	Q8N808	S35G3_HUMAN	K	335	ENSP00000297307:R335K	ENSP00000297307:R335K	R	-	2	0	SLC35G3	30544436	0.002000	0.14202	0.046000	0.18839	0.046000	0.14306	-1.876000	0.01633	-2.037000	0.00920	-2.088000	0.00374	AGG		0.557	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256445.2		NM_152462	
ANKRD35	148741	hgsc.bcm.edu	37	1	145562502	145562504	+	In_Frame_Del	DEL	GGC	GGC	-	rs146166584	byFrequency	TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	GGC	GGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr1:145562502_145562504delGGC	ENST00000355594.4	+	10	2277_2279	c.2190_2192delGGC	c.(2188-2193)cgggcc>cgc	p.A731del		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	731										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AGGAGCTGCGGGCCTGCATCAGC	0.66																																					Melanoma(9;127 754 22988 51047)												0																																										SO:0001651	inframe_deletion	148741			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.2190_2192delGGC	1.37:g.145562502_145562504delGGC	ENSP00000347802:p.Ala731del		A6NEU0|B4DL62|Q3MJ10|Q96LS3	In_Frame_Del	DEL	ENST00000355594.4	37	CCDS919.1																																																																																				0.660	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1		NM_144698	
SPATA33	124045	hgsc.bcm.edu	37	16	89735835	89735835	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr16:89735835A>C	ENST00000301031.4	+	3	350	c.350A>C	c.(349-351)gAc>gCc	p.D117A	SPATA33_ENST00000579310.1_Missense_Mutation_p.D118A	NM_001271908.1|NM_153025.1	NP_001258837.1|NP_694570.1	Q96N06	SPT33_HUMAN	spermatogenesis associated 33	117						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GAGCCGGAGGACTGGGGCCCC	0.557																																																	0													62.0	70.0	68.0					16																	89735835		2198	4300	6498	SO:0001583	missense	124045			AK056168	CCDS10983.1, CCDS62012.1, CCDS73929.1	16q24.3	2013-07-16	2013-07-05	2013-07-05	ENSG00000167523	ENSG00000167523			26463	protein-coding gene	gene with protein product		615409	"""chromosome 16 open reading frame 55"""	C16orf55		23844118	Standard	NM_153025		Approved	FLJ31606	uc010vpk.2	Q96N06	OTTHUMG00000138048	ENST00000301031.4:c.350A>C	16.37:g.89735835A>C	ENSP00000301031:p.Asp117Ala		A8WFL2|B4DZN8	Missense_Mutation	SNP	ENST00000301031.4	37	CCDS10983.1	.	.	.	.	.	.	.	.	.	.	A	9.618	1.132984	0.21041	.	.	ENSG00000167523	ENST00000301031;ENST00000457689	T	0.56103	0.48	4.5	2.2	0.27929	.	1.159430	0.06517	N	0.739076	T	0.41003	0.1140	L	0.29908	0.895	0.09310	N	1	B;P	0.37101	0.408;0.582	B;B	0.37387	0.15;0.248	T	0.35076	-0.9803	10	0.66056	D	0.02	-11.1496	4.7547	0.13077	0.7066:0.1915:0.1019:0.0	.	118;117	B4DZN8;Q96N06	.;CP055_HUMAN	A	117;118	ENSP00000301031:D117A	ENSP00000301031:D117A	D	+	2	0	C16orf55	88263336	0.000000	0.05858	0.001000	0.08648	0.209000	0.24338	0.284000	0.18864	0.211000	0.20683	0.472000	0.43445	GAC		0.557	SPATA33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269924.2		NM_153025	
C1QL1	10882	hgsc.bcm.edu	37	17	43037729	43037729	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr17:43037729C>T	ENST00000253407.3	-	2	626	c.604G>A	c.(604-606)Gcc>Acc	p.A202T		NM_006688.3	NP_006679.1	O75973	C1QRF_HUMAN	complement component 1, q subcomponent-like 1	202	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				locomotory behavior (GO:0007626)	collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)				lung(1)|prostate(1)	2		Prostate(33;0.155)				ATAGCACTGGCCCGCACCTGC	0.652																																																	0													78.0	66.0	70.0					17																	43037729		2203	4300	6503	SO:0001583	missense	10882			AF410771	CCDS11492.1	17q21	2010-08-18			ENSG00000131094	ENSG00000131094			24182	protein-coding gene	gene with protein product		611586				9878755	Standard	NM_006688		Approved	CRF, C1QRF, C1QTNF14	uc002ihv.3	O75973	OTTHUMG00000162944	ENST00000253407.3:c.604G>A	17.37:g.43037729C>T	ENSP00000253407:p.Ala202Thr			Missense_Mutation	SNP	ENST00000253407.3	37	CCDS11492.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657643	0.88154	.	.	ENSG00000131094	ENST00000253407	T	0.75260	-0.92	4.7	3.73	0.42828	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.85682	D	0.000000	T	0.74114	0.3674	L	0.43646	1.37	0.58432	D	0.999997	P	0.41597	0.756	P	0.51016	0.656	T	0.70769	-0.4782	10	0.30854	T	0.27	.	12.0492	0.53498	0.0:0.914:0.0:0.086	.	202	O75973	C1QRF_HUMAN	T	202	ENSP00000253407:A202T	ENSP00000253407:A202T	A	-	1	0	C1QL1	40393255	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.623000	0.83113	1.201000	0.43203	0.555000	0.69702	GCC		0.652	C1QL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371119.3		NM_006688	
CCNA1	8900	hgsc.bcm.edu	37	13	37015358	37015358	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr13:37015358A>G	ENST00000255465.4	+	7	1466	c.1202A>G	c.(1201-1203)aAg>aGg	p.K401R	CCNA1_ENST00000418263.1_Missense_Mutation_p.K400R|CCNA1_ENST00000440264.1_Missense_Mutation_p.K357R|CCNA1_ENST00000449823.1_Missense_Mutation_p.K357R			P78396	CCNA1_HUMAN	cyclin A1	401					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		ACTGTGAACAAGCACTTTTGG	0.398																																																	0													127.0	113.0	118.0					13																	37015358		2203	4300	6503	SO:0001583	missense	8900			U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.1202A>G	13.37:g.37015358A>G	ENSP00000255465:p.Lys401Arg		B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	ENST00000255465.4	37	CCDS9357.1	.	.	.	.	.	.	.	.	.	.	A	6.796	0.515876	0.12944	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	5.19	2.45	0.29901	Cyclin, C-terminal (1);Cyclin-like (3);	0.420489	0.28187	N	0.016279	T	0.11067	0.0270	N	0.10945	0.07	0.21290	N	0.99973	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.32640	-0.9899	10	0.13470	T	0.59	.	8.0213	0.30410	0.3203:0.0:0.6797:0.0	.	400;401	P78396-2;P78396	.;CCNA1_HUMAN	R	357;357;400;401	ENSP00000400666:K357R;ENSP00000409873:K357R;ENSP00000396479:K400R;ENSP00000255465:K401R	ENSP00000255465:K401R	K	+	2	0	CCNA1	35913358	0.058000	0.20735	1.000000	0.80357	0.931000	0.56810	0.711000	0.25764	0.664000	0.31047	-0.468000	0.05107	AAG		0.398	CCNA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044514.2		NM_003914	
CHRNA7	1139	hgsc.bcm.edu	37	15	32449875	32449876	+	Frame_Shift_Del	DEL	TG	TG	-	rs374603734		TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr15:32449875_32449876delTG	ENST00000306901.3	+	6	594_595	c.497_498delTG	c.(496-498)ctgfs	p.L166fs	CHRNA7_ENST00000454250.3_Frame_Shift_Del_p.L195fs|CHRNA7_ENST00000455693.2_5'UTR	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	166					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	CACTGCAAACTGAAGTTTGGGT	0.505																																					Esophageal Squamous(193;529 2900 40232 43193)												0									,	3,2221		1,1,1110					,	5.0	0.8			13	19,4303		2,15,2144	no	frameshift,frameshift	CHRNA7	NM_001190455.1,NM_000746.4	,	3,16,3254	A1A1,A1R,RR		0.4396,0.1349,0.3361	,	,		22,6524				SO:0001589	frameshift_variant	1139			Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.497_498delTG	15.37:g.32449875_32449876delTG	ENSP00000303727:p.Leu166fs		A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Frame_Shift_Del	DEL	ENST00000306901.3	37	CCDS10027.1																																																																																				0.505	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251410.2			
CNTNAP4	85445	hgsc.bcm.edu;ucsc.edu	37	16	76482716	76482716	+	Missense_Mutation	SNP	C	C	A	rs139295295	byFrequency	TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr16:76482716C>A	ENST00000476707.1	+	5	943	c.804C>A	c.(802-804)agC>agA	p.S268R	CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S240R|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S264R|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S264R|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	265	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CCCTGGGCAGCCTGCTAGATG	0.483																																																	0													118.0	93.0	101.0					16																	76482716		2198	4300	6498	SO:0001583	missense	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.804C>A	16.37:g.76482716C>A	ENSP00000417628:p.Ser268Arg		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	C	18.43	3.621719	0.66787	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1	5.34	2.36	0.29203	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.277746	0.25458	N	0.030529	D	0.86393	0.5922	.	.	.	0.43965	D	0.996646	D;D;D;D	0.89917	1.0;0.993;1.0;1.0	D;D;D;D	0.91635	0.999;0.959;0.999;0.998	D	0.85404	0.1133	9	0.66056	D	0.02	.	10.152	0.42801	0.0:0.7221:0.0:0.2779	.	240;268;240;265	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	R	264;264;240;268	ENSP00000306893:S264R;ENSP00000439733:S264R;ENSP00000418741:S240R;ENSP00000417628:S268R	ENSP00000306893:S264R	S	+	3	2	CNTNAP4	75040217	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.131000	0.42074	0.395000	0.25257	0.655000	0.94253	AGC		0.483	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1		NM_033401	
CRTAM	56253	hgsc.bcm.edu;ucsc.edu	37	11	122733210	122733210	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr11:122733210A>G	ENST00000227348.4	+	6	738	c.691A>G	c.(691-693)Aac>Gac	p.N231D	CRTAM_ENST00000533709.1_Missense_Mutation_p.N32D	NM_019604.2	NP_062550.2			cytotoxic and regulatory T cell molecule											breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|prostate(1)	19		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		TCTGGAGAGAAACTCTCTATC	0.413																																																	0													75.0	72.0	73.0					11																	122733210		2202	4299	6501	SO:0001583	missense	56253			AF001622	CCDS8437.1	11q24.1	2013-01-11			ENSG00000109943	ENSG00000109943		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24313	protein-coding gene	gene with protein product	"""class I MHC restricted T cell associated molecule"""	612597				10811014, 16300832	Standard	NM_019604		Approved	CD355	uc001pyj.3	O95727	OTTHUMG00000166026	ENST00000227348.4:c.691A>G	11.37:g.122733210A>G	ENSP00000227348:p.Asn231Asp			Missense_Mutation	SNP	ENST00000227348.4	37	CCDS8437.1	.	.	.	.	.	.	.	.	.	.	A	8.479	0.859244	0.17178	.	.	ENSG00000109943	ENST00000227348;ENST00000533709	T;T	0.54675	0.56;1.51	4.35	4.35	0.52113	.	0.511140	0.22063	N	0.065143	T	0.29976	0.0750	N	0.08118	0	0.09310	N	1	B;B	0.15141	0.012;0.0	B;B	0.09377	0.004;0.0	T	0.11743	-1.0575	10	0.29301	T	0.29	.	10.1007	0.42502	1.0:0.0:0.0:0.0	.	32;231	O95727-2;O95727	.;CRTAM_HUMAN	D	231;32	ENSP00000227348:N231D;ENSP00000433728:N32D	ENSP00000227348:N231D	N	+	1	0	CRTAM	122238420	0.010000	0.17322	0.007000	0.13788	0.042000	0.13812	2.580000	0.46068	1.971000	0.57363	0.533000	0.62120	AAC		0.413	CRTAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387507.1		NM_019604	
CXorf40B	541578	hgsc.bcm.edu;ucsc.edu	37	X	149100904	149100904	+	Missense_Mutation	SNP	G	G	A	rs151337313		TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chrX:149100904G>A	ENST00000370406.3	-	5	1163	c.335C>T	c.(334-336)gCa>gTa	p.A112V	CXorf40B_ENST00000462691.1_Missense_Mutation_p.A112V|XX-FW81066F1.2_ENST00000457775.1_RNA|CXorf40B_ENST00000355203.2_Missense_Mutation_p.A112V|CXorf40B_ENST00000370404.1_Missense_Mutation_p.A112V			Q96DE9	CX04B_HUMAN	chromosome X open reading frame 40B	112										endometrium(1)|lung(4)	5	Acute lymphoblastic leukemia(192;6.56e-05)					GTTGGTCAGTGCAGCTTGATT	0.473																																																	0													230.0	197.0	208.0					X																	149100904		2199	4297	6496	SO:0001583	missense	541578			BC009523	CCDS35426.1	Xq28	2012-11-28			ENSG00000197021	ENSG00000197021			17402	protein-coding gene	gene with protein product							Standard	XM_005274698		Approved		uc004fdy.3	Q96DE9	OTTHUMG00000034327	ENST00000370406.3:c.335C>T	X.37:g.149100904G>A	ENSP00000359434:p.Ala112Val			Missense_Mutation	SNP	ENST00000370406.3	37	CCDS35426.1	.	.	.	.	.	.	.	.	.	.	a	0.003	-2.398133	0.00198	.	.	ENSG00000197021	ENST00000462691;ENST00000370406;ENST00000355203;ENST00000370404	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	3.4	2.21	0.28008	PUA-like domain (1);	0.502090	0.19920	N	0.103115	T	0.02533	0.0077	N	0.00038	-2.52	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37361	-0.9709	9	0.02654	T	1	-4.6711	6.834	0.23925	0.7878:0.0:0.2122:0.0	.	112	Q96DE9	CX04B_HUMAN	V	112	ENSP00000417546:A112V;ENSP00000359434:A112V;ENSP00000347339:A112V;ENSP00000359432:A112V	ENSP00000347339:A112V	A	-	2	0	CXorf40B	148851562	0.135000	0.22499	0.000000	0.03702	0.022000	0.10575	3.706000	0.54830	-0.124000	0.11724	-0.885000	0.02943	GCA		0.473	CXorf40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082896.2		NP_001013867	
DEFB105A	245908	hgsc.bcm.edu	37	8	7679549	7679549	+	Missense_Mutation	SNP	C	C	T	rs200757797		TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr8:7679549C>T	ENST00000334773.6	-	3	268	c.218G>A	c.(217-219)tGc>tAc	p.C73Y		NM_152250.1	NP_689463.1	Q8NG35	D105A_HUMAN	defensin, beta 105A	73					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				lung(2)|skin(1)	3				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		CTGTCTGCAGCAGAGAAAGTT	0.483																																																	0													2.0	2.0	2.0					8																	7679549		1339	2913	4252	SO:0001583	missense	245908			AB089180	CCDS34832.1	8p23.1	2011-03-29	2005-02-28	2005-03-03	ENSG00000186562	ENSG00000186562		"""Defensins, beta"""	18087	protein-coding gene	gene with protein product			"""defensin, beta 105"""	DEFB105		11854508, 12734011	Standard	NM_152250		Approved	DEFB-5	uc011kwp.2	Q8NG35	OTTHUMG00000150011	ENST00000334773.6:c.218G>A	8.37:g.7679549C>T	ENSP00000334330:p.Cys73Tyr		A1A581|Q8IZN8	Missense_Mutation	SNP	ENST00000334773.6	37	CCDS34832.1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747567	0.30955	.	.	ENSG00000186562	ENST00000334773	D	0.99270	-5.66	3.1	2.16	0.27623	.	0.160540	0.30076	N	0.010461	D	0.98298	0.9436	.	.	.	0.20764	N	0.999856	.	.	.	.	.	.	D	0.96415	0.9307	7	0.87932	D	0	-9.8301	7.9374	0.29937	0.0:0.7452:0.2548:0.0	.	.	.	.	Y	73	ENSP00000334330:C73Y	ENSP00000334330:C73Y	C	-	2	0	DEFB105A	7716959	0.871000	0.30034	0.185000	0.23176	0.020000	0.10135	2.543000	0.45752	0.810000	0.34279	0.543000	0.68304	TGC		0.483	DEFB105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315758.2		NM_152250	
DEFB4A	1673	hgsc.bcm.edu	37	8	7754021	7754021	+	Silent	SNP	T	T	C	rs200885320		TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr8:7754021T>C	ENST00000302247.2	+	2	168	c.84T>C	c.(82-84)ccT>ccC	p.P28P		NM_004942.2	NP_004933.1	O15263	DFB4A_HUMAN	defensin, beta 4A	28					chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				lung(1)	1						TAGGCGATCCTGTTACCTGCC	0.428																																					Ovarian(105;1718 2131 4132 11552)												0													1.0	1.0	1.0					8																	7754021		178	237	415	SO:0001819	synonymous_variant	1673			AJ000152	CCDS5971.1	8p23.1	2014-01-30	2010-03-01	2010-03-01	ENSG00000171711	ENSG00000171711		"""Defensins, beta"", ""Endogenous ligands"""	2767	protein-coding gene	gene with protein product		602215	"""defensin, beta 2"", ""defensin, beta 4"""	DEFB102, DEFB2, DEFB4		9202117	Standard	NM_004942		Approved	SAP1, HBD-2, DEFB-2	uc003wsd.3	O15263	OTTHUMG00000129314	ENST00000302247.2:c.84T>C	8.37:g.7754021T>C			Q52LC0	Silent	SNP	ENST00000302247.2	37	CCDS5971.1																																																																																				0.428	DEFB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251446.1		NM_004942	
DISP1	84976	hgsc.bcm.edu	37	1	223116653	223116653	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr1:223116653A>G	ENST00000284476.6	+	2	652	c.488A>G	c.(487-489)cAa>cGa	p.Q163R	DISP1_ENST00000360254.2_Missense_Mutation_p.Q163R|DISP1_ENST00000495684.1_Intron	NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	163					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		CAGCCTGTGCAACAGCACATA	0.448																																																	0													118.0	93.0	102.0					1																	223116653		2203	4300	6503	SO:0001583	missense	84976			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.488A>G	1.37:g.223116653A>G	ENSP00000284476:p.Gln163Arg		Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	37	CCDS1536.1	.	.	.	.	.	.	.	.	.	.	A	12.09	1.832663	0.32421	.	.	ENSG00000154309	ENST00000360254;ENST00000284476	T;D	0.92911	0.84;-3.13	5.5	-3.35	0.04928	.	0.588465	0.17792	N	0.161843	D	0.84911	0.5577	L	0.39898	1.24	0.09310	N	1	B	0.10296	0.003	B	0.16289	0.015	T	0.69094	-0.5236	10	0.30854	T	0.27	-0.3145	10.0397	0.42151	0.2823:0.5871:0.1306:0.0	.	163	Q96F81	DISP1_HUMAN	R	163	ENSP00000355848:Q163R;ENSP00000284476:Q163R	ENSP00000284476:Q163R	Q	+	2	0	DISP1	221183276	0.003000	0.15002	0.022000	0.16811	0.973000	0.67179	-0.010000	0.12743	-0.956000	0.03631	-0.395000	0.06472	CAA		0.448	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1		NM_032890	
DNAH14	127602	hgsc.bcm.edu;ucsc.edu	37	1	225373072	225373072	+	Missense_Mutation	SNP	C	C	T	rs61851487	byFrequency	TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr1:225373072C>T	ENST00000445597.2	+	24	4334	c.4334C>T	c.(4333-4335)aCg>aTg	p.T1445M	DNAH14_ENST00000430092.1_Missense_Mutation_p.T1850M|DNAH14_ENST00000439375.2_Missense_Mutation_p.T1850M			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1445					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AAAGCATTAACGCTATTACCA	0.338													C|||	877	0.17512	0.1331	0.1902	5008	,	,		14696	0.3125		0.1133	False		,,,				2504	0.1431																0								C	MET/THR	179,1205		11,157,524	132.0	121.0	124.0		5549	-0.1	0.0	1	dbSNP_129	124	381,2801		16,349,1226	yes	missense	DNAH14	NM_001373.1	81	27,506,1750	TT,TC,CC		11.9736,12.9335,12.2646	possibly-damaging	1850/4516	225373072	560,4006	692	1591	2283	SO:0001583	missense	127602			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.4334C>T	1.37:g.225373072C>T	ENSP00000409472:p.Thr1445Met		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		360	0.16483516483516483	57	0.11585365853658537	55	0.15193370165745856	171	0.29895104895104896	77	0.10158311345646438	C	8.763	0.923986	0.18056	0.129335	0.119736	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;T;T;T	0.35048	3.24;1.33;1.33;1.57	4.91	-0.12	0.13539	.	.	.	.	.	T	0.00012	0.0000	M	0.74647	2.275	0.80722	P	0.0	B	0.22276	0.067	B	0.16722	0.016	T	0.16041	-1.0416	8	0.52906	T	0.07	.	8.5999	0.33738	0.0:0.3252:0.0:0.6748	rs61851487	1850	Q0VDD8-4	.	M	1445;1850;1850;944	ENSP00000409472:T1445M;ENSP00000414402:T1850M;ENSP00000392061:T1850M;ENSP00000332424:T944M	ENSP00000332424:T944M	T	+	2	0	DNAH14	223439695	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.204000	0.17335	-0.306000	0.08818	-0.438000	0.05819	ACG		0.338	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3		XM_059166	
ECT2L	345930	hgsc.bcm.edu;ucsc.edu	37	6	139222225	139222225	+	Missense_Mutation	SNP	G	G	A	rs371621945		TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr6:139222225G>A	ENST00000423192.1	+	20	2716	c.2555G>A	c.(2554-2556)cGg>cAg	p.R852Q	ECT2L_ENST00000367682.2_Missense_Mutation_p.R852Q|ECT2L_ENST00000541398.1_Missense_Mutation_p.R706Q			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	852							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R852Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						GCCCTTCATCGGTTACTCATA	0.398			"""N, Splice, Mis"""		ETP ALL																																			Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	1	Substitution - Missense(1)	endometrium(1)											160.0	147.0	151.0					6																	139222225		1846	4110	5956	SO:0001583	missense	345930				CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.2555G>A	6.37:g.139222225G>A	ENSP00000387388:p.Arg852Gln		B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	37	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	G	7.133	0.580284	0.13686	.	.	ENSG00000203734	ENST00000423192;ENST00000367682;ENST00000541398	T;T;T	0.76448	-1.02;-1.02;-1.02	5.5	3.7	0.42460	Pleckstrin homology-type (1);	0.142496	0.25324	U	0.031487	T	0.52741	0.1753	M	0.72118	2.19	0.09310	N	1	B;B	0.28584	0.216;0.079	B;B	0.15870	0.014;0.006	T	0.39078	-0.9631	10	0.19147	T	0.46	-1.4599	8.1268	0.31003	0.2503:0.0:0.7497:0.0	.	706;852	F5H7S9;Q008S8	.;ECT2L_HUMAN	Q	852;852;706	ENSP00000387388:R852Q;ENSP00000356655:R852Q;ENSP00000442307:R706Q	ENSP00000356655:R852Q	R	+	2	0	ECT2L	139263918	0.150000	0.22732	0.042000	0.18584	0.056000	0.15407	1.917000	0.39996	1.325000	0.45301	0.585000	0.79938	CGG		0.398	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3		NM_001077706	
FAIM2	23017	hgsc.bcm.edu	37	12	50284501	50284501	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr12:50284501G>T	ENST00000320634.3	-	7	584	c.490C>A	c.(490-492)Cat>Aat	p.H164N	FAIM2_ENST00000550890.1_Missense_Mutation_p.H118N	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2	164					apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)				endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						CAGGGGAAATGCCTCCTGCAA	0.597																																																	0													84.0	78.0	80.0					12																	50284501		2203	4300	6503	SO:0001583	missense	23017			AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.490C>A	12.37:g.50284501G>T	ENSP00000321951:p.His164Asn		A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Missense_Mutation	SNP	ENST00000320634.3	37	CCDS8791.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.51|13.51	2.257910|2.257910	0.39896|0.39896	.|.	.|.	ENSG00000135472|ENSG00000135472	ENST00000552863|ENST00000320634;ENST00000550890;ENST00000550635;ENST00000552669	.|T;T;T	.|0.39406	.|1.08;1.08;1.08	4.8|4.8	2.66|2.66	0.31614|0.31614	.|.	.|0.374602	.|0.32175	.|N	.|0.006471	T|T	0.19805|0.19805	0.0476|0.0476	N|N	0.08118|0.08118	0|0	0.30203|0.30203	N|N	0.798412|0.798412	.|B	.|0.24317	.|0.101	.|B	.|0.26094	.|0.066	T|T	0.07673|0.07673	-1.0760|-1.0760	5|10	.|0.41790	.|T	.|0.15	-8.8898|-8.8898	4.7661|4.7661	0.13132|0.13132	0.3288:0.0:0.6712:0.0|0.3288:0.0:0.6712:0.0	.|.	.|164	.|Q9BWQ8	.|FAIM2_HUMAN	E|N	32|164;118;164;122	.|ENSP00000321951:H164N;ENSP00000450132:H118N;ENSP00000446771:H122N	.|ENSP00000321951:H164N	A|H	-|-	2|1	0|0	FAIM2|FAIM2	48570768|48570768	0.640000|0.640000	0.27243|0.27243	0.997000|0.997000	0.53966|0.53966	0.963000|0.963000	0.63663|0.63663	1.103000|1.103000	0.31062|0.31062	1.031000|1.031000	0.39867|0.39867	0.462000|0.462000	0.41574|0.41574	GCA|CAT		0.597	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405984.1		NM_012306	
FAM157A	728262	hgsc.bcm.edu	37	3	197894713	197894713	+	lincRNA	SNP	A	A	G	rs61793576		TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr3:197894713A>G	ENST00000437428.2	+	0	874							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						GGGCAGCACGAGGGTCGTGTT	0.582											OREG0016022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													35.0	31.0	32.0					3																	197894713		691	1585	2276			728262					3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197894713A>G		2094		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	5.318	0.243966	0.10077	.	.	ENSG00000236438	ENST00000431569	.	.	.	0.467	-0.934	0.10428	.	.	.	.	.	T	0.18964	0.0455	N	0.08118	0	0.09310	N	1	P	0.42039	0.769	P	0.49332	0.607	T	0.19224	-1.0312	6	.	.	.	.	.	.	.	rs61793576	352	C9JC47	F157A_HUMAN	G	352	.	.	E	+	2	0	FAM157A	199379110	0.008000	0.16893	0.003000	0.11579	0.023000	0.10783	-0.821000	0.04452	-0.410000	0.07542	0.318000	0.21364	GAG		0.582	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2		NM_001145248	
RMDN3	55177	hgsc.bcm.edu	37	15	41037298	41037298	+	Silent	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr15:41037298C>T	ENST00000260385.6	-	4	1751	c.684G>A	c.(682-684)gaG>gaA	p.E228E	RMDN3_ENST00000558560.1_Intron|RMDN3_ENST00000338376.3_Silent_p.E228E			Q96TC7	RMD3_HUMAN	regulator of microtubule dynamics 3	228					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)	integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											AACCTCCAGCCTCCAGGGCAC	0.602																																																	0													90.0	80.0	83.0					15																	41037298		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001441	CCDS10063.1	15q15.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000137824	ENSG00000137824			25550	protein-coding gene	gene with protein product		611873	"""family with sequence similarity 82, member A2"""	FAM82C, FAM82A2		12975309	Standard	XM_005254531		Approved	FLJ10579, PTPIP51, RMD3	uc001zmp.1	Q96TC7	OTTHUMG00000130066	ENST00000260385.6:c.684G>A	15.37:g.41037298C>T			A9UMZ9|B3KRR3|Q6ZWE9|Q96H23|Q96SD6|Q9H6G1|Q9NVQ6	Silent	SNP	ENST00000260385.6	37	CCDS10063.1																																																																																				0.602	RMDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252357.1		NM_018145	
GOLGA3	2802	hgsc.bcm.edu	37	12	133393164	133393164	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr12:133393164G>C	ENST00000450791.2	-	2	551	c.368C>G	c.(367-369)tCt>tGt	p.S123C	GOLGA3_ENST00000537452.1_Missense_Mutation_p.S123C|GOLGA3_ENST00000545875.1_Missense_Mutation_p.S123C|GOLGA3_ENST00000204726.3_Missense_Mutation_p.S123C|GOLGA3_ENST00000456883.2_Missense_Mutation_p.S123C			Q08378	GOGA3_HUMAN	golgin A3	123	Interaction with GOPC.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GAGTCTGAGAGACTGCAAAGC	0.547																																																	0													110.0	93.0	99.0					12																	133393164		2203	4300	6503	SO:0001583	missense	2802			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.368C>G	12.37:g.133393164G>C	ENSP00000410378:p.Ser123Cys		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875676	0.91664	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.52295	1.16;1.16;1.15;0.67;0.67	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.69717	0.3142	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.70695	-0.4801	10	0.87932	D	0	.	20.0591	0.97667	0.0:0.0:1.0:0.0	.	123;123;123	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	C	123	ENSP00000204726:S123C;ENSP00000410378:S123C;ENSP00000409303:S123C;ENSP00000442143:S123C;ENSP00000442603:S123C	ENSP00000204726:S123C	S	-	2	0	GOLGA3	131903237	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.467000	0.97671	2.747000	0.94245	0.462000	0.41574	TCT		0.547	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2		NM_005895	
GREB1L	80000	hgsc.bcm.edu;ucsc.edu	37	18	19088471	19088471	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr18:19088471T>C	ENST00000580732.2	+	27	5035	c.4654T>C	c.(4654-4656)Tat>Cat	p.Y1552H	GREB1L_ENST00000400483.4_3'UTR|GREB1L_ENST00000424526.1_Missense_Mutation_p.Y1552H|GREB1L_ENST00000269218.6_Missense_Mutation_p.Y1443H			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1552						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GGTCAAAGAGTATGAGATGCC	0.552																																																	0													66.0	58.0	60.0					18																	19088471		692	1591	2283	SO:0001583	missense	80000			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.4654T>C	18.37:g.19088471T>C	ENSP00000464162:p.Tyr1552His		A4QN17|Q9H8F1	Missense_Mutation	SNP	ENST00000580732.2	37	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.424248	0.83667	.	.	ENSG00000141449	ENST00000424526;ENST00000269218	T;T	0.54675	0.56;0.56	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000009	T	0.69771	0.3148	M	0.73962	2.25	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.67548	0.952;0.93;0.952	T	0.66846	-0.5820	10	0.19590	T	0.45	-4.0281	16.1905	0.81986	0.0:0.0:0.0:1.0	.	1443;1552;926	Q9C091-3;Q9C091;B4DDS9	.;GRB1L_HUMAN;.	H	1552;1443	ENSP00000412060:Y1552H;ENSP00000269218:Y1443H	ENSP00000269218:Y1443H	Y	+	1	0	GREB1L	17342469	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.853000	0.69496	2.212000	0.71576	0.533000	0.62120	TAT		0.552	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2		NM_024935	
GRIN2C	2905	hgsc.bcm.edu	37	17	72842988	72842988	+	Silent	SNP	G	G	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr17:72842988G>A	ENST00000293190.5	-	10	2219	c.2073C>T	c.(2071-2073)aaC>aaT	p.N691N	GRIN2C_ENST00000347612.4_Silent_p.N691N	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	691					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TACTGCGGATGTTCCGCTCCG	0.622																																																	0													149.0	117.0	128.0					17																	72842988		2203	4300	6503	SO:0001819	synonymous_variant	2905				CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.2073C>T	17.37:g.72842988G>A			B2RTT1	Silent	SNP	ENST00000293190.5	37	CCDS32724.1																																																																																				0.622	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1			
GUF1	60558	hgsc.bcm.edu	37	4	44700675	44700675	+	Silent	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr4:44700675C>T	ENST00000281543.5	+	17	2181	c.1987C>T	c.(1987-1989)Ctg>Ttg	p.L663L	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						TATAAAAGTTCTGAAAACACA	0.308																																																	0													49.0	54.0	53.0					4																	44700675		2203	4300	6503	SO:0001819	synonymous_variant	60558				CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1987C>T	4.37:g.44700675C>T				Silent	SNP	ENST00000281543.5	37	CCDS3468.1																																																																																				0.308	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3		NM_021927	
ITGA6	3655	hgsc.bcm.edu;ucsc.edu	37	2	173349850	173349850	+	Splice_Site	SNP	A	A	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr2:173349850A>T	ENST00000264106.6	+	14	2032	c.1829A>T	c.(1828-1830)gAt>gTt	p.D610V	AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000264107.7_Splice_Site_p.D571V|ITGA6_ENST00000409532.1_Splice_Site_p.D452V|ITGA6_ENST00000343713.4_Splice_Site_p.D566V|ITGA6_ENST00000375221.2_Splice_Site_p.D610V|ITGA6_ENST00000409080.1_Splice_Site_p.D571V			P23229	ITA6_HUMAN	integrin, alpha 6	610					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TTCATGCAGGATAATATCAGA	0.423																																																	0													88.0	83.0	85.0					2																	173349850		2203	4300	6503	SO:0001630	splice_region_variant	3655				CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1828-1A>T	2.37:g.173349850A>T			B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	ENST00000264106.6	37		.	.	.	.	.	.	.	.	.	.	A	17.51	3.408368	0.62399	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64	5.8	5.8	0.92144	.	0.220687	0.53938	D	0.000042	T	0.56441	0.1985	L	0.52905	1.665	0.80722	D	1	B;P;B;P	0.39748	0.014;0.686;0.006;0.534	B;P;B;B	0.48488	0.026;0.579;0.025;0.429	T	0.59511	-0.7441	10	0.87932	D	0	.	15.8284	0.78733	1.0:0.0:0.0:0.0	.	566;610;571;571	P23229-4;P23229-9;G5E9H1;P23229-2	.;.;.;.	V	452;571;610;610;566;571;610;566	ENSP00000386614:D452V;ENSP00000264107:D571V;ENSP00000264106:D610V;ENSP00000364369:D610V;ENSP00000341078:D566V;ENSP00000386896:D571V;ENSP00000406694:D610V;ENSP00000394169:D566V	ENSP00000264106:D610V	D	+	2	0	ITGA6	173058096	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	8.177000	0.89688	2.209000	0.71365	0.533000	0.62120	GAT		0.423	ITGA6-201	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
KLHL40	131377	hgsc.bcm.edu	37	3	42727420	42727420	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr3:42727420T>A	ENST00000287777.4	+	1	410	c.310T>A	c.(310-312)Ttg>Atg	p.L104M		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	104					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											CGTGCAGGATTTGTTCGCCGC	0.617																																																	0													81.0	85.0	84.0					3																	42727420		2203	4299	6502	SO:0001583	missense	0			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.310T>A	3.37:g.42727420T>A	ENSP00000287777:p.Leu104Met		Q86SI1|Q96MR2	Missense_Mutation	SNP	ENST00000287777.4	37	CCDS2703.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.373978	0.42105	.	.	ENSG00000157119	ENST00000287777	T	0.71698	-0.59	4.78	0.542	0.17174	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.057932	0.64402	D	0.000004	T	0.77903	0.4200	M	0.77712	2.385	0.24417	N	0.99464	D	0.60575	0.988	D	0.66979	0.948	T	0.66988	-0.5784	10	0.72032	D	0.01	.	4.1298	0.10144	0.2371:0.4015:0.0:0.3613	.	104	Q2TBA0	KBTB5_HUMAN	M	104	ENSP00000287777:L104M	ENSP00000287777:L104M	L	+	1	2	KBTBD5	42702424	0.103000	0.21917	0.123000	0.21794	0.871000	0.50021	0.747000	0.26290	-0.040000	0.13580	-0.993000	0.02533	TTG		0.617	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256651.1		NM_152393	
KCNH4	23415	hgsc.bcm.edu	37	17	40327694	40327694	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr17:40327694G>T	ENST00000264661.3	-	6	1222	c.890C>A	c.(889-891)cCt>cAt	p.P297H	KCNH4_ENST00000607371.1_Missense_Mutation_p.P297H	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	297					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AATGGAACGAGGAGCAGAGAT	0.542																																					NSCLC(117;707 1703 2300 21308 31858)												0													225.0	182.0	197.0					17																	40327694		2203	4300	6503	SO:0001583	missense	23415			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.890C>A	17.37:g.40327694G>T	ENSP00000264661:p.Pro297His			Missense_Mutation	SNP	ENST00000264661.3	37	CCDS11420.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457601	0.84317	.	.	ENSG00000089558	ENST00000264661	D	0.97138	-4.26	5.4	5.4	0.78164	Ion transport (1);	0.000000	0.40469	N	0.001086	D	0.97807	0.9280	L	0.51914	1.62	0.48975	D	0.999732	D	0.76494	0.999	D	0.70935	0.971	D	0.98528	1.0626	10	0.87932	D	0	.	19.3711	0.94488	0.0:0.0:1.0:0.0	.	297	Q9UQ05	KCNH4_HUMAN	H	297	ENSP00000264661:P297H	ENSP00000264661:P297H	P	-	2	0	KCNH4	37581220	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.381000	0.73163	2.814000	0.96858	0.563000	0.77884	CCT		0.542	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2		NM_012285	
TRAPPC8	22878	hgsc.bcm.edu	37	18	29477770	29477770	+	Silent	SNP	G	G	A	rs17855000	byFrequency	TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr18:29477770G>A	ENST00000283351.4	-	11	1910	c.1575C>T	c.(1573-1575)ctC>ctT	p.L525L	TRAPPC8_ENST00000582513.1_Silent_p.L525L|TRAPPC8_ENST00000582539.1_Silent_p.L471L	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	525					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ACCGTATTAGGAGAGCTGCAG	0.348													G|||	145	0.0289537	0.0023	0.0216	5008	,	,		14984	0.0337		0.0626	False		,,,				2504	0.0307																0								G		62,4344	58.1+/-94.6	0,62,2141	74.0	68.0	70.0		1575	-4.0	0.9	18	dbSNP_123	70	520,8080	146.8+/-202.3	19,482,3799	no	coding-synonymous	TRAPPC8	NM_014939.3		19,544,5940	AA,AG,GG		6.0465,1.4072,4.4749		525/1436	29477770	582,12424	2203	4300	6503	SO:0001819	synonymous_variant	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.1575C>T	18.37:g.29477770G>A			A0JP15|B3KME5|Q9H0L2	Silent	SNP	ENST00000283351.4	37	CCDS11901.1																																																																																				0.348	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1		NM_014939	
NYAP2	57624	hgsc.bcm.edu	37	2	226273688	226273688	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr2:226273688A>G	ENST00000272907.6	+	2	505	c.92A>G	c.(91-93)tAt>tGt	p.Y31C	NYAP2_ENST00000409269.2_Missense_Mutation_p.Y31C	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	31					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												ATGAAGGCCTATGATGGCTTG	0.403																																																	0													146.0	132.0	136.0					2																	226273688		1899	4121	6020	SO:0001583	missense	0			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.92A>G	2.37:g.226273688A>G	ENSP00000272907:p.Tyr31Cys		A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	A	19.67	3.870217	0.72065	.	.	ENSG00000144460	ENST00000272907;ENST00000409269	T	0.62105	0.05	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000003	T	0.79522	0.4460	M	0.74881	2.28	0.52099	D	0.999949	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81835	-0.0750	10	0.87932	D	0	-22.1147	16.3594	0.83251	1.0:0.0:0.0:0.0	.	31;31	Q9P242-2;Q9P242	.;K1486_HUMAN	C	31	ENSP00000272907:Y31C	ENSP00000272907:Y31C	Y	+	2	0	KIAA1486	225981932	1.000000	0.71417	0.344000	0.25628	0.868000	0.49771	8.330000	0.90019	2.266000	0.75297	0.455000	0.32223	TAT		0.403	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1		NM_020864	
CFAP74	85452	hgsc.bcm.edu	37	1	1897857	1897857	+	IGR	SNP	C	C	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr1:1897857C>A								TMEM52 (47145 upstream) : C1orf222 (21705 downstream)																							ATCTCGGGCTCAGCTAACGTT	0.612																																																	0													49.0	56.0	54.0					1																	1897857		1940	4121	6061	SO:0001628	intergenic_variant	85452																															1.37:g.1897857C>A				Nonsense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	c	19.91	3.915037	0.72983	.	.	ENSG00000142609	ENST00000270720	.	.	.	3.87	-1.64	0.08318	.	0.501859	0.19066	N	0.123629	.	.	.	.	.	.	0.20074	N	0.999932	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-4.8261	0.9991	0.01473	0.1436:0.2924:0.2824:0.2816	.	.	.	.	X	452	.	ENSP00000270720:E452X	E	-	1	0	C1orf222	1887717	0.000000	0.05858	0.005000	0.12908	0.223000	0.24884	-0.565000	0.05929	-0.478000	0.06823	0.457000	0.33378	GAG	0	0.612									
KIF2A	3796	hgsc.bcm.edu	37	5	61659522	61659522	+	Splice_Site	SNP	A	A	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr5:61659522A>C	ENST00000401507.3	+	14	1574	c.1263A>C	c.(1261-1263)agA>agC	p.R421S	KIF2A_ENST00000407818.3_Splice_Site_p.R421S|KIF2A_ENST00000381103.2_Splice_Site_p.R401S|KIF2A_ENST00000509663.2_Intron|KIF2A_ENST00000506857.1_Splice_Site_p.R375S	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	421	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		CACATTGTAGAACATCCGGTC	0.338																																																	0													87.0	90.0	89.0					5																	61659522		2203	4300	6503	SO:0001630	splice_region_variant	3796			BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.1263-1A>C	5.37:g.61659522A>C			A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Missense_Mutation	SNP	ENST00000401507.3	37	CCDS3980.2	.	.	.	.	.	.	.	.	.	.	A	16.97	3.267853	0.59540	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000407818;ENST00000506857	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	4.96	2.56	0.30785	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	T	0.73837	0.3638	H	0.98577	4.27	0.80722	D	1	D;D;D;D	0.89917	0.988;0.997;1.0;1.0	D;D;D;D	0.97110	0.994;0.99;1.0;0.996	T	0.75714	-0.3221	9	.	.	.	.	7.7734	0.29021	0.7502:0.0:0.2498:0.0	.	421;421;421;401	B4DM85;O00139-4;O00139;E9PB70	.;.;KIF2A_HUMAN;.	S	421;401;421;375	ENSP00000385622:R421S;ENSP00000370493:R401S;ENSP00000385000:R421S;ENSP00000423772:R375S	.	R	+	3	2	KIF2A	61695279	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	2.106000	0.41835	0.468000	0.27243	0.533000	0.62120	AGA		0.338	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317989.1		NM_004520	Missense_Mutation
KLK10	5655	hgsc.bcm.edu	37	19	51519366	51519366	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr19:51519366C>T	ENST00000309958.3	-	4	534	c.316G>A	c.(316-318)Gga>Aga	p.G106R	KLK10_ENST00000391805.1_Missense_Mutation_p.G106R|CTC-518B2.12_ENST00000596286.1_RNA|KLK10_ENST00000358789.3_Missense_Mutation_p.G106R	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	106	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.G106R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		AGCTGCTCTCCCTGAAGAAGC	0.602																																																	1	Substitution - Missense(1)	lung(1)											42.0	35.0	37.0					19																	51519366		2201	4296	6497	SO:0001583	missense	5655			AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.316G>A	19.37:g.51519366C>T	ENSP00000311746:p.Gly106Arg		A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	ENST00000309958.3	37	CCDS12817.1	.	.	.	.	.	.	.	.	.	.	c	15.30	2.791381	0.50102	.	.	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.90261	-2.64;-2.64;-2.64	4.67	3.32	0.38043	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.685753	0.11990	N	0.509955	D	0.88897	0.6562	L	0.55990	1.75	0.22240	N	0.999265	B	0.32128	0.357	B	0.39503	0.301	T	0.81716	-0.0806	10	0.87932	D	0	.	7.14	0.25550	0.0:0.8291:0.0:0.1709	.	106	O43240	KLK10_HUMAN	R	106	ENSP00000375681:G106R;ENSP00000311746:G106R;ENSP00000351640:G106R	ENSP00000311746:G106R	G	-	1	0	KLK10	56211178	0.023000	0.18921	0.865000	0.33974	0.990000	0.78478	2.163000	0.42377	0.734000	0.32515	0.655000	0.94253	GGA		0.602	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2		NM_002776	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651228	1651228	+	Missense_Mutation	SNP	C	C	G	rs71454096	byFrequency	TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr11:1651228C>G	ENST00000399676.2	+	1	196	c.158C>G	c.(157-159)gCg>gGg	p.A53G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		tccggctgtgcgggctgtggg	0.682													g|||	3279	0.654752	0.7784	0.6225	5008	,	,		5668	0.4157		0.7406	False		,,,				2504	0.6687																0								G	GLY/ALA	3099,1107		1207,685,211	30.0	39.0	36.0		158	2.2	0.4	11	dbSNP_130	36	5885,2399		2219,1447,476	no	missense	KRTAP5-5	NM_001001480.2	60	3426,2132,687	GG,GC,CC		28.9594,26.3195,28.0705	benign	53/238	1651228	8984,3506	2103	4142	6245	SO:0001583	missense	439915			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.158C>G	11.37:g.1651228C>G	ENSP00000382584:p.Ala53Gly		A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	37	CCDS41592.1	1420	0.6501831501831502	378	0.7682926829268293	245	0.6767955801104972	240	0.4195804195804196	557	0.7348284960422163	N	3.130	-0.178731	0.06380	0.736805	0.710406	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01084	5.36	2.19	2.19	0.27852	.	.	.	.	.	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.02925	-1.1093	8	0.46703	T	0.11	.	7.2847	0.26330	0.0:0.2785:0.7215:0.0	.	53	Q701N2	KRA55_HUMAN	G	53;51	ENSP00000382584:A53G	ENSP00000382584:A53G	A	+	2	0	KRTAP5-5	1607804	0.123000	0.22298	0.392000	0.26245	0.247000	0.25773	0.000000	0.12993	0.229000	0.21039	-0.415000	0.06103	GCG		0.682	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1			
LAMA2	3908	hgsc.bcm.edu	37	6	129796548	129796548	+	Splice_Site	SNP	T	T	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr6:129796548T>C	ENST00000421865.2	+	53	7500		c.e53+2			NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GAAAGCAAGGTAAAATTTAAA	0.323																																																	0													66.0	65.0	65.0					6																	129796548		2203	4299	6502	SO:0001630	splice_region_variant	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.7451+2T>C	6.37:g.129796548T>C			Q14736|Q5VUM2|Q93022	Splice_Site	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370283	0.82573	.	.	ENSG00000196569	ENST00000354729;ENST00000421865;ENST00000443169	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5144	0.61533	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	LAMA2	129838241	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.276000	0.58933	2.217000	0.71921	0.528000	0.53228	.		0.323	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			Intron
LCMT2	9836	hgsc.bcm.edu;ucsc.edu	37	15	43621583	43621583	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr15:43621583C>T	ENST00000305641.5	-	1	1220	c.1105G>A	c.(1105-1107)Gtt>Att	p.V369I	ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000544735.1_5'UTR|LCMT2_ENST00000567039.1_3'UTR|ADAL_ENST00000422466.2_5'Flank|ADAL_ENST00000389651.4_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	369					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CTGAGAATAACGTCTGGGCTC	0.552																																																	0													50.0	50.0	50.0					15																	43621583		2201	4299	6500	SO:0001583	missense	9836			AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.1105G>A	15.37:g.43621583C>T	ENSP00000307214:p.Val369Ile		Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	ENST00000305641.5	37	CCDS10094.1	.	.	.	.	.	.	.	.	.	.	C	0.195	-1.050026	0.01981	.	.	ENSG00000168806	ENST00000305641	T	0.73575	-0.76	5.35	-7.91	0.01165	.	1.537050	0.03504	N	0.218544	T	0.51770	0.1694	N	0.11560	0.145	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.40572	-0.9556	10	0.25751	T	0.34	-23.4472	10.4832	0.44706	0.0:0.5635:0.2346:0.2019	.	369	O60294	LCMT2_HUMAN	I	369	ENSP00000307214:V369I	ENSP00000307214:V369I	V	-	1	0	LCMT2	41408875	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-3.095000	0.00607	-1.545000	0.01719	-0.302000	0.09304	GTT		0.552	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253205.1		NM_014793	
MAN2A1	4124	hgsc.bcm.edu;ucsc.edu	37	5	109049281	109049281	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr5:109049281A>G	ENST00000261483.4	+	2	1248	c.196A>G	c.(196-198)Aat>Gat	p.N66D		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	66					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		AGCTGAGAATAATGAGATCAT	0.388																																																	0													90.0	90.0	90.0					5																	109049281		2202	4300	6502	SO:0001583	missense	4124				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.196A>G	5.37:g.109049281A>G	ENSP00000261483:p.Asn66Asp		Q16767	Missense_Mutation	SNP	ENST00000261483.4	37	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	A	18.86	3.713726	0.68730	.	.	ENSG00000112893	ENST00000261483	T	0.77358	-1.09	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.78285	0.4259	M	0.74258	2.255	0.58432	D	0.999999	B	0.27882	0.192	B	0.33690	0.168	T	0.74121	-0.3767	10	0.16420	T	0.52	-30.5856	15.5213	0.75869	1.0:0.0:0.0:0.0	.	66	Q16706	MA2A1_HUMAN	D	66	ENSP00000261483:N66D	ENSP00000261483:N66D	N	+	1	0	MAN2A1	109077180	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.429000	0.59901	2.081000	0.62600	0.477000	0.44152	AAT		0.388	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1			
MAT2A	4144	hgsc.bcm.edu;ucsc.edu	37	2	85768223	85768223	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr2:85768223A>C	ENST00000306434.3	+	2	232	c.109A>C	c.(109-111)Atc>Ctc	p.I37L	MAT2A_ENST00000409017.1_5'UTR	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	37					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TTGTGACCAAATCAGTGATGC	0.418																																																	0													100.0	105.0	103.0					2																	85768223		2203	4300	6503	SO:0001583	missense	4144				CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.109A>C	2.37:g.85768223A>C	ENSP00000303147:p.Ile37Leu		A8K511|B4DN45|D6W5L1|Q53SP5	Missense_Mutation	SNP	ENST00000306434.3	37	CCDS1977.1	.	.	.	.	.	.	.	.	.	.	A	18.25	3.582524	0.65992	.	.	ENSG00000168906	ENST00000306434;ENST00000424323	D	0.87412	-2.25	5.68	5.68	0.88126	S-adenosylmethionine synthetase, N-terminal (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.92211	0.7530	H	0.95004	3.61	0.80722	D	1	B	0.16802	0.019	B	0.34138	0.176	D	0.91164	0.4963	10	0.87932	D	0	-7.7483	14.1785	0.65559	1.0:0.0:0.0:0.0	.	37	P31153	METK2_HUMAN	L	37	ENSP00000303147:I37L	ENSP00000303147:I37L	I	+	1	0	MAT2A	85621734	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	8.962000	0.93254	2.288000	0.76882	0.528000	0.53228	ATC		0.418	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2		NM_005911	
MCPH1	79648	hgsc.bcm.edu	37	8	6312675	6312675	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr8:6312675A>G	ENST00000344683.5	+	9	1913	c.1837A>G	c.(1837-1839)Aga>Gga	p.R613G		NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	613					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TGTTAAAAATAGACCAACAAG	0.353																																					Colon(95;1448 1467 8277 34473 35819)												0													133.0	127.0	129.0					8																	6312675		1845	4088	5933	SO:0001583	missense	79648			AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1837A>G	8.37:g.6312675A>G	ENSP00000342924:p.Arg613Gly		B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	ENST00000344683.5	37	CCDS43689.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-2.892258	0.00060	.	.	ENSG00000147316	ENST00000344683	T	0.03745	3.82	5.61	2.48	0.30137	.	0.742409	0.12316	N	0.479760	T	0.01489	0.0048	N	0.02802	-0.49	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.48210	-0.9055	10	0.07644	T	0.81	-10.8508	5.5039	0.16844	0.2039:0.1566:0.6395:0.0	.	613	Q8NEM0	MCPH1_HUMAN	G	613	ENSP00000342924:R613G	ENSP00000342924:R613G	R	+	1	2	MCPH1	6300083	0.595000	0.26857	0.005000	0.12908	0.001000	0.01503	1.031000	0.30165	0.546000	0.28920	-1.123000	0.02005	AGA		0.353	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2		NM_024596	
HTR2C	3358	hgsc.bcm.edu	37	X	113949683	113949683	+	Intron	SNP	G	G	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chrX:113949683G>T	ENST00000276198.1	+	3	649				HTR2C_ENST00000371950.3_Intron|MIR1298_ENST00000408783.1_RNA|HTR2C_ENST00000371951.1_Intron	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled						behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CGGCTGTCCAGATGTATCCAA	0.433																																																	0													151.0	133.0	139.0					X																	113949683		1568	3582	5150	SO:0001627	intron_variant	100302153				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.-79-11584G>T	X.37:g.113949683G>T			B1AMW4|Q5VUF8|Q9NP28	RNA	SNP	ENST00000276198.1	37	CCDS14564.1																																																																																				0.433	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1		NM_000868	
MLLT4	4301	hgsc.bcm.edu	37	6	168271097	168271097	+	Silent	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr6:168271097A>G	ENST00000447894.2	+	3	333	c.333A>G	c.(331-333)ctA>ctG	p.L111L	MLLT4_ENST00000392108.3_Silent_p.L111L|MLLT4_ENST00000366806.2_Silent_p.L111L|MLLT4_ENST00000392112.1_Silent_p.L111L|MLLT4_ENST00000400822.3_Silent_p.L111L|MLLT4_ENST00000351017.4_Silent_p.L111L|MLLT4_ENST00000344191.4_Silent_p.L111L			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	111	Ras-associating 1. {ECO:0000255|PROSITE- ProRule:PRU00166}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AGAAACCTCTAGTTGTACAAC	0.348			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													204.0	224.0	217.0					6																	168271097		2203	4296	6499	SO:0001819	synonymous_variant	4301			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.333A>G	6.37:g.168271097A>G			O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Silent	SNP	ENST00000447894.2	37																																																																																					0.348	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1		NM_005936	
MOCOS	55034	hgsc.bcm.edu	37	18	33848514	33848514	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr18:33848514C>G	ENST00000261326.5	+	15	2554	c.2533C>G	c.(2533-2535)Ctg>Gtg	p.L845V		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TGGCATGTACCTGATGCATGC	0.368																																																	0													269.0	232.0	245.0					18																	33848514		2203	4300	6503	SO:0001583	missense	55034			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2533C>G	18.37:g.33848514C>G	ENSP00000261326:p.Leu845Val			Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206017	0.58234	.	.	ENSG00000075643	ENST00000261326	T	0.36878	1.23	5.74	3.78	0.43462	Molybdenum cofactor sulfurase, C-terminal (2);	0.070225	0.64402	D	0.000015	T	0.51601	0.1684	M	0.64630	1.985	0.26532	N	0.974242	D	0.76494	0.999	D	0.71656	0.974	T	0.41324	-0.9515	10	0.48119	T	0.1	-19.8111	8.7446	0.34578	0.0:0.8112:0.0:0.1888	.	845	Q96EN8	MOCOS_HUMAN	V	845	ENSP00000261326:L845V	ENSP00000261326:L845V	L	+	1	2	MOCOS	32102512	0.999000	0.42202	1.000000	0.80357	0.904000	0.53231	0.482000	0.22276	0.765000	0.33221	0.650000	0.86243	CTG		0.368	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1			
MTERF4	130916	hgsc.bcm.edu;ucsc.edu	37	2	242038907	242038907	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr2:242038907A>T	ENST00000391980.2	-	2	482	c.424T>A	c.(424-426)Tgt>Agt	p.C142S	MTERFD2_ENST00000407095.3_Missense_Mutation_p.C142S|MTERFD2_ENST00000495694.1_Missense_Mutation_p.C142S|MTERFD2_ENST00000464344.2_Intron|MTERFD2_ENST00000406593.1_Intron	NM_182501.3	NP_872307.2	Q7Z6M4	MTEF4_HUMAN		142					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	rRNA binding (GO:0019843)			endometrium(3)|large_intestine(6)|lung(5)|ovary(1)|skin(2)|urinary_tract(3)	20		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)		AAGACCACACACACAGGCTCT	0.448																																																	0													118.0	121.0	120.0					2																	242038907		2203	4300	6503	SO:0001583	missense	130916																														ENST00000391980.2:c.424T>A	2.37:g.242038907A>T	ENSP00000375840:p.Cys142Ser		A8K6K0|Q9P0E0	Missense_Mutation	SNP	ENST00000391980.2	37	CCDS2544.1	.	.	.	.	.	.	.	.	.	.	A	13.57	2.277986	0.40294	.	.	ENSG00000122085	ENST00000495694;ENST00000401626;ENST00000391980;ENST00000424798;ENST00000407095;ENST00000434791	T;T;T;T;T;T	0.46819	0.86;0.9;2.87;2.87;2.87;0.92	5.03	5.03	0.67393	.	0.713447	0.13149	N	0.410077	T	0.43033	0.1229	L	0.43152	1.355	0.09310	N	0.999999	B;B	0.31274	0.317;0.175	B;B	0.38985	0.283;0.287	T	0.35500	-0.9786	10	0.21540	T	0.41	1.3772	8.4891	0.33089	0.9114:0.0:0.0886:0.0	.	142;142	B4DKD5;Q7Z6M4	.;MTER2_HUMAN	S	142;142;142;135;142;121	ENSP00000419315:C142S;ENSP00000385183:C142S;ENSP00000375840:C142S;ENSP00000409023:C135S;ENSP00000385630:C142S;ENSP00000393063:C121S	ENSP00000241527:C142S	C	-	1	0	MTERFD2	241687580	0.443000	0.25641	0.268000	0.24571	0.983000	0.72400	1.702000	0.37836	1.898000	0.54952	0.482000	0.46254	TGT		0.448	MTERFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323798.4			
MUC2	4583	hgsc.bcm.edu	37	11	1092238	1092238	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr11:1092238C>T	ENST00000441003.2	+	30	4084	c.4057C>T	c.(4057-4059)Cag>Tag	p.Q1353*	MUC2_ENST00000359061.5_Nonsense_Mutation_p.Q1354*|MUC2_ENST00000361558.6_Nonsense_Mutation_p.Q19*|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1353					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCAGCTAGGCCAGAAGGTGCA	0.527																																																	0													129.0	142.0	138.0					11																	1092238		2153	4244	6397	SO:0001587	stop_gained	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4057C>T	11.37:g.1092238C>T	ENSP00000415183:p.Gln1353*		Q14878	Nonsense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	c	22.6	4.308856	0.81247	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000361558	.	.	.	2.87	2.87	0.33458	.	0.650882	0.12293	U	0.481884	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	13.8167	0.63297	0.0:1.0:0.0:0.0	.	.	.	.	X	1353;1354;19	.	ENSP00000351956:Q1354X	Q	+	1	0	MUC2	1082238	1.000000	0.71417	0.032000	0.17829	0.213000	0.24496	6.900000	0.75687	1.637000	0.50538	0.466000	0.42574	CAG		0.527	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	
MUC4	4585	hgsc.bcm.edu	37	3	195509374	195509374	+	Missense_Mutation	SNP	T	T	G	rs573840119	byFrequency	TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr3:195509374T>G	ENST00000463781.3	-	2	9536	c.9077A>C	c.(9076-9078)cAt>cCt	p.H3026P	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H3026P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H3026P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGGTGACATGAAGAGGGGT	0.582													.|||	717	0.143171	0.1808	0.1023	5008	,	,		10228	0.0486		0.2137	False		,,,				2504	0.1462																1	Substitution - Missense(1)	skin(1)											25.0	18.0	20.0					3																	195509374		655	1532	2187	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9077A>C	3.37:g.195509374T>G	ENSP00000417498:p.His3026Pro		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	7.939	0.742287	0.15642	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28454	1.61;1.61	.	.	.	.	.	.	.	.	T	0.13030	0.0316	N	0.19112	0.55	0.26070	N	0.981239	P	0.42993	0.797	B	0.31337	0.128	T	0.12967	-1.0527	7	.	.	.	.	4.198	0.10452	0.0:0.0:0.0:1.0	.	2898	E7ESK3	.	P	3026	ENSP00000417498:H3026P;ENSP00000420243:H3026P	.	H	-	2	0	MUC4	196994153	0.006000	0.16342	0.030000	0.17652	0.000000	0.00434	-0.139000	0.10358	0.402000	0.25451	0.000000	0.15137	CAT		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
NCOA1	8648	hgsc.bcm.edu;ucsc.edu	37	2	24933874	24933874	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr2:24933874T>G	ENST00000406961.1	+	14	3145	c.2493T>G	c.(2491-2493)tgT>tgG	p.C831W	NCOA1_ENST00000407230.1_Missense_Mutation_p.C680W|NCOA1_ENST00000395856.3_Missense_Mutation_p.C831W|NCOA1_ENST00000538539.1_Missense_Mutation_p.C831W|NCOA1_ENST00000348332.3_Missense_Mutation_p.C831W|NCOA1_ENST00000405141.1_Missense_Mutation_p.C831W|NCOA1_ENST00000288599.5_Missense_Mutation_p.C831W			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	831	Interaction with CREBBP.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGCTTATGTGAGACAGACA	0.522			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0													118.0	104.0	109.0					2																	24933874		2203	4300	6503	SO:0001583	missense	8648			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.2493T>G	2.37:g.24933874T>G	ENSP00000385216:p.Cys831Trp		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	T	19.40	3.819428	0.71028	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.02067	4.58;4.58;4.47;4.58;4.58;4.58;4.58	5.95	3.48	0.39840	.	0.327788	0.32769	N	0.005664	T	0.03608	0.0103	N	0.08118	0	0.58432	D	0.999991	D;D;D;D	0.76494	0.999;0.999;0.99;0.999	D;D;P;D	0.81914	0.995;0.99;0.852;0.99	T	0.63283	-0.6672	10	0.38643	T	0.18	.	9.061	0.36433	0.0:0.2105:0.0:0.7895	.	831;831;831;680	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	W	831;831;680;831;831;831;831	ENSP00000385216:C831W;ENSP00000385097:C831W;ENSP00000385195:C680W;ENSP00000444039:C831W;ENSP00000320940:C831W;ENSP00000288599:C831W;ENSP00000379197:C831W	ENSP00000288599:C831W	C	+	3	2	NCOA1	24787378	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	0.034000	0.13776	1.025000	0.39708	0.460000	0.39030	TGT		0.522	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3		NM_147223	
NR2C2	7182	hgsc.bcm.edu;ucsc.edu	37	3	15076190	15076190	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr3:15076190A>C	ENST00000425241.1	+	11	1608	c.1246A>C	c.(1246-1248)Acc>Ccc	p.T416P	NR2C2_ENST00000478572.1_3'UTR|NR2C2_ENST00000393102.3_Missense_Mutation_p.T416P|NR2C2_ENST00000323373.6_Missense_Mutation_p.T435P|NR2C2_ENST00000406272.2_Missense_Mutation_p.T416P			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	416	Ligand-binding. {ECO:0000250}.				cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGACTGCAACACCAGCCTTGT	0.557																																																	0													71.0	65.0	67.0					3																	15076190		2203	4300	6503	SO:0001583	missense	7182			L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.1246A>C	3.37:g.15076190A>C	ENSP00000388387:p.Thr416Pro		A8K3H5|B6ZGT8|P55092	Missense_Mutation	SNP	ENST00000425241.1	37		.	.	.	.	.	.	.	.	.	.	A	19.40	3.821004	0.71028	.	.	ENSG00000177463	ENST00000425241;ENST00000323373;ENST00000393102;ENST00000406272;ENST00000439011;ENST00000413194	D;D;D;D;D;D	0.98701	-4.1;-4.1;-4.1;-4.1;-5.08;-5.08	4.96	3.8	0.43715	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98692	0.9561	M	0.67953	2.075	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.87578	0.957;0.998	D	0.99060	1.0830	10	0.87932	D	0	.	10.7673	0.46301	0.9248:0.0:0.0752:0.0	.	416;435	P49116;F2YGU2	NR2C2_HUMAN;.	P	416;435;416;416;30;11	ENSP00000388387:T416P;ENSP00000320447:T435P;ENSP00000376814:T416P;ENSP00000384463:T416P;ENSP00000412473:T30P;ENSP00000413438:T11P	ENSP00000320447:T435P	T	+	1	0	NR2C2	15051194	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.282000	0.95840	0.849000	0.35215	0.402000	0.26972	ACC		0.557	NR2C2-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000340729.1		NM_003298	
NUDCD2	134492	hgsc.bcm.edu;ucsc.edu	37	5	162881024	162881024	+	Silent	SNP	G	G	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr5:162881024G>T	ENST00000302764.4	-	4	512	c.423C>A	c.(421-423)atC>atA	p.I141I	NUDCD2_ENST00000519395.1_5'Flank|NUDCD2_ENST00000517501.1_Silent_p.I116I	NM_145266.4	NP_660309.1	Q8WVJ2	NUDC2_HUMAN	NudC domain containing 2	141						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)				large_intestine(1)|prostate(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.0207)|all_neural(177;0.0966)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0981)|OV - Ovarian serous cystadenocarcinoma(192;0.183)|Epithelial(171;0.247)		AGTTTCCTGAGATTTCTGCTC	0.338																																																	0													99.0	89.0	93.0					5																	162881024		2203	4300	6503	SO:0001819	synonymous_variant	134492			BX538290	CCDS4361.1	5q34	2008-02-05			ENSG00000170584	ENSG00000170584			30535	protein-coding gene	gene with protein product							Standard	NM_145266		Approved	DKFZp686E10109	uc003lze.3	Q8WVJ2	OTTHUMG00000130378	ENST00000302764.4:c.423C>A	5.37:g.162881024G>T			B2R4V0	Silent	SNP	ENST00000302764.4	37	CCDS4361.1																																																																																				0.338	NUDCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252747.3		NM_145266	
NUDT9	53343	hgsc.bcm.edu;ucsc.edu	37	4	88359433	88359433	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr4:88359433A>C	ENST00000302174.4	+	3	676	c.352A>C	c.(352-354)Agt>Cgt	p.S118R	NUDT9_ENST00000473942.1_Missense_Mutation_p.S68R	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	118				S -> G (in Ref. 4; AAM46068). {ECO:0000305}.	ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		TTACAGTGAAAGTAATTTTTC	0.338																																																	0													79.0	78.0	79.0					4																	88359433		2203	4300	6503	SO:0001583	missense	53343			AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.352A>C	4.37:g.88359433A>C	ENSP00000303575:p.Ser118Arg		Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000302174.4	37	CCDS3620.1	.	.	.	.	.	.	.	.	.	.	A	8.739	0.918577	0.17982	.	.	ENSG00000170502	ENST00000302174;ENST00000512216;ENST00000473942	T;T;T	0.74842	-0.88;-0.88;-0.88	5.49	4.29	0.51040	NUDIX hydrolase domain-like (1);	0.368712	0.31370	N	0.007775	T	0.54351	0.1853	N	0.20685	0.6	0.31324	N	0.685611	B	0.02656	0.0	B	0.01281	0.0	T	0.50250	-0.8850	10	0.17832	T	0.49	-1.8925	7.0725	0.25187	0.7739:0.1489:0.0771:0.0	.	118	Q9BW91	NUDT9_HUMAN	R	118;68;68	ENSP00000303575:S118R;ENSP00000424702:S68R;ENSP00000421811:S68R	ENSP00000303575:S118R	S	+	1	0	NUDT9	88578457	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.852000	0.55934	1.025000	0.39708	-0.328000	0.08392	AGT		0.338	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253035.2			
OTOF	9381	hgsc.bcm.edu	37	2	26687848	26687848	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr2:26687848T>G	ENST00000272371.2	-	39	4975	c.4849A>C	c.(4849-4851)Acc>Ccc	p.T1617P	OTOF_ENST00000338581.6_Missense_Mutation_p.T850P|OTOF_ENST00000402415.3_Missense_Mutation_p.T927P|OTOF_ENST00000403946.3_Missense_Mutation_p.T1617P|OTOF_ENST00000339598.3_Missense_Mutation_p.T850P	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1617					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGAGGCGGGTCAGGATCTGG	0.622																																					GBM(102;732 1451 20652 24062 31372)												0													40.0	49.0	46.0					2																	26687848		2203	4300	6503	SO:0001583	missense	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4849A>C	2.37:g.26687848T>G	ENSP00000272371:p.Thr1617Pro		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.777431	0.49786	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21	4.95	0.985	0.19779	.	0.278339	0.40728	N	0.001026	T	0.50017	0.1591	M	0.76002	2.32	0.32791	N	0.501107	B;B;B;B	0.29270	0.134;0.021;0.24;0.021	B;B;B;B	0.32022	0.058;0.139;0.128;0.139	T	0.49688	-0.8913	10	0.32370	T	0.25	-23.6185	3.5597	0.07877	0.3812:0.2126:0.0:0.4061	.	1617;850;927;850	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	P	850;850;927;1617;1617	ENSP00000345137:T850P;ENSP00000344521:T850P;ENSP00000383906:T927P;ENSP00000272371:T1617P;ENSP00000385255:T1617P	ENSP00000272371:T1617P	T	-	1	0	OTOF	26541352	0.974000	0.33945	1.000000	0.80357	0.998000	0.95712	0.780000	0.26760	0.260000	0.21731	0.459000	0.35465	ACC		0.622	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			
PABPC3	5042	hgsc.bcm.edu	37	13	25670907	25670907	+	Missense_Mutation	SNP	C	C	A	rs76264750	byFrequency	TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr13:25670907C>A	ENST00000281589.3	+	1	608	c.571C>A	c.(571-573)Ccc>Acc	p.P191T		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	191	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AAAAGAGTTCCCCAATGTTTA	0.428																																																	0													100.0	93.0	95.0					13																	25670907		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.571C>A	13.37:g.25670907C>A	ENSP00000281589:p.Pro191Thr		Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.725491	0.00694	.	.	ENSG00000151846	ENST00000281589	D	0.85411	-1.98	1.27	-2.55	0.06288	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.127499	0.32769	N	0.005664	T	0.42245	0.1194	N	0.00170	-1.935	0.25196	N	0.99009	B	0.02656	0.0	B	0.01281	0.0	T	0.58896	-0.7555	10	0.02654	T	1	.	6.4602	0.21952	0.5046:0.4954:0.0:0.0	.	191	Q9H361	PABP3_HUMAN	T	191	ENSP00000281589:P191T	ENSP00000281589:P191T	P	+	1	0	PABPC3	24568907	1.000000	0.71417	0.927000	0.36925	0.792000	0.44763	4.521000	0.60532	-0.661000	0.05345	-0.738000	0.03535	CCC		0.428	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2		NM_030979	
PBRM1	55193	hgsc.bcm.edu;ucsc.edu	37	3	52610695	52610695	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr3:52610695G>A	ENST00000296302.7	-	22	3554	c.3553C>T	c.(3553-3555)Cga>Tga	p.R1185*	PBRM1_ENST00000409057.1_Nonsense_Mutation_p.R1185*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.R1185*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.R1200*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.R1200*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.R1160*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.R1153*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.R1160*|SMIM4_ENST00000476842.1_Intron			Q86U86	PB1_HUMAN	polybromo 1	1185	BAH 2. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R1185*(3)|p.R1153*(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GCTCCATCTCGAACCCATACT	0.338			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	4	Substitution - Nonsense(4)	kidney(4)											76.0	73.0	74.0					3																	52610695		2202	4300	6502	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3553C>T	3.37:g.52610695G>A	ENSP00000296302:p.Arg1185*		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	G	41	8.826239	0.98968	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351	.	.	.	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.1593	15.0475	0.71838	0.0:0.0:0.8573:0.1427	.	.	.	.	X	1153;1160;1185;1185;1185;1160;1200;1200;1184	.	ENSP00000296302:R1185X	R	-	1	2	PBRM1	52585735	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.391000	0.66266	2.664000	0.90586	0.591000	0.81541	CGA		0.338	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCDH15	65217	hgsc.bcm.edu	37	10	55849761	55849761	+	Silent	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr10:55849761A>G	ENST00000320301.6	-	16	2374	c.1980T>C	c.(1978-1980)gtT>gtC	p.V660V	PCDH15_ENST00000395445.1_Silent_p.V667V|PCDH15_ENST00000361849.3_Silent_p.V660V|PCDH15_ENST00000373965.2_Silent_p.V667V|PCDH15_ENST00000373955.1_Silent_p.V660V|PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000395430.1_Silent_p.V660V|PCDH15_ENST00000395432.2_Silent_p.V623V|PCDH15_ENST00000409834.1_Silent_p.V271V|PCDH15_ENST00000395433.1_Silent_p.V638V|PCDH15_ENST00000395446.1_Silent_p.V660V|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000414778.1_Silent_p.V665V|PCDH15_ENST00000373957.3_Silent_p.V638V|PCDH15_ENST00000395438.1_Silent_p.V660V|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	660	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AAAGATTAAAAACTCTCTGAG	0.338										HNSCC(58;0.16)																																							0													62.0	64.0	63.0					10																	55849761		2203	4297	6500	SO:0001819	synonymous_variant	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1980T>C	10.37:g.55849761A>G			A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																				0.338	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2		NM_033056	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144864284	144864284	+	Silent	SNP	C	C	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr1:144864284C>G	ENST00000369354.3	-	36	6000	c.5811G>C	c.(5809-5811)ctG>ctC	p.L1937L	PDE4DIP_ENST00000530740.1_Silent_p.L2022L|PDE4DIP_ENST00000313382.9_Silent_p.L1831L|PDE4DIP_ENST00000369356.4_Silent_p.L1937L|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000369359.4_Silent_p.L2073L|PDE4DIP_ENST00000524974.1_5'UTR			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1937					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATCGAGAGGACAGCAGAGCCT	0.532			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													107.0	115.0	113.0					1																	144864284		2203	4298	6501	SO:0001819	synonymous_variant	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5811G>C	1.37:g.144864284C>G			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	C	1.214	-0.628822	0.03610	.	.	ENSG00000178104	ENST00000530130	.	.	.	4.52	-5.36	0.02689	.	.	.	.	.	T	0.14013	0.0339	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31052	-0.9957	4	.	.	.	.	10.6496	0.45640	0.0944:0.1679:0.6638:0.0739	.	.	.	.	S	94	.	.	C	-	2	0	PDE4DIP	143575641	0.002000	0.14202	0.001000	0.08648	0.395000	0.30598	-0.546000	0.06062	-1.150000	0.02840	-0.182000	0.12963	TGT		0.532	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2		NM_022359	
PDIA6	10130	hgsc.bcm.edu;ucsc.edu	37	2	10924442	10924442	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr2:10924442T>A	ENST00000272227.3	-	13	1412	c.1265A>T	c.(1264-1266)gAg>gTg	p.E422V	PDIA6_ENST00000404824.2_Missense_Mutation_p.E470V|PDIA6_ENST00000381611.4_Missense_Mutation_p.E427V|PDIA6_ENST00000404371.2_Missense_Mutation_p.E474V|ATP6V1C2_ENST00000381661.3_3'UTR|PDIA6_ENST00000540494.1_Missense_Mutation_p.E419V	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	422	Asp/Glu-rich (acidic).				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		AATGTCATCCTCCACGGGAAG	0.493																																					GBM(73;509 1219 34219 41343 41551)												0													97.0	87.0	91.0					2																	10924442		2203	4300	6503	SO:0001583	missense	10130			BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.1265A>T	2.37:g.10924442T>A	ENSP00000272227:p.Glu422Val		B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Missense_Mutation	SNP	ENST00000272227.3	37	CCDS1675.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.711373	0.89112	.	.	ENSG00000143870	ENST00000272227;ENST00000404371;ENST00000404824;ENST00000540494;ENST00000381611	T;T;T;T;T	0.05925	3.41;3.39;3.37;3.44;3.41	5.57	5.57	0.84162	.	0.044828	0.85682	D	0.000000	T	0.28699	0.0711	M	0.82923	2.615	0.80722	D	1	D;P;P;B	0.76494	0.999;0.928;0.928;0.241	D;P;P;B	0.83275	0.996;0.714;0.714;0.211	T	0.02837	-1.1104	10	0.62326	D	0.03	.	15.74	0.77887	0.0:0.0:0.0:1.0	.	419;470;474;422	B7Z254;B5MCQ5;Q15084-2;Q15084	.;.;.;PDIA6_HUMAN	V	422;474;470;419;427	ENSP00000272227:E422V;ENSP00000385385:E474V;ENSP00000384459:E470V;ENSP00000438778:E419V;ENSP00000371024:E427V	ENSP00000272227:E422V	E	-	2	0	PDIA6	10841893	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.922000	0.87538	2.133000	0.65898	0.533000	0.62120	GAG		0.493	PDIA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206933.1		NM_005742	
RASGEF1C	255426	hgsc.bcm.edu	37	5	179555487	179555487	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr5:179555487C>T	ENST00000393371.2	-	4	858	c.562G>A	c.(562-564)Gcc>Acc	p.A188T	RASGEF1C_ENST00000519883.1_5'UTR|RASGEF1C_ENST00000361132.4_Missense_Mutation_p.A188T|RASGEF1C_ENST00000522500.1_Missense_Mutation_p.A37T			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	188					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGATGGAGGCTGGTGGCTTG	0.642																																																	0													112.0	95.0	101.0					5																	179555487		2203	4300	6503	SO:0001583	missense	255426			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.562G>A	5.37:g.179555487C>T	ENSP00000377037:p.Ala188Thr		D3DWQ7|Q7Z4T0|Q8NA49	Missense_Mutation	SNP	ENST00000393371.2	37	CCDS4452.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827001	0.50739	.	.	ENSG00000146090	ENST00000361132;ENST00000393371;ENST00000522500	T;T;T	0.28895	1.59;1.59;1.59	3.92	2.96	0.34315	Ras guanine nucleotide exchange factor, domain (1);	0.136088	0.34025	N	0.004334	T	0.15435	0.0372	N	0.14661	0.345	0.29568	N	0.850134	B	0.11235	0.004	B	0.10450	0.005	T	0.10613	-1.0622	10	0.19147	T	0.46	.	8.8992	0.35484	0.0:0.7705:0.2295:0.0	.	188	Q8N431	RGF1C_HUMAN	T	188;188;37	ENSP00000354963:A188T;ENSP00000377037:A188T;ENSP00000429114:A37T	ENSP00000354963:A188T	A	-	1	0	RASGEF1C	179488093	0.773000	0.28580	0.919000	0.36401	0.921000	0.55340	1.011000	0.29911	2.196000	0.70406	0.491000	0.48974	GCC		0.642	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2		NM_175062	
RBP4	5950	hgsc.bcm.edu	37	10	95353602	95353602	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr10:95353602C>G	ENST00000371467.1	-	5	865	c.546G>C	c.(544-546)caG>caC	p.Q182H	FFAR4_ENST00000604414.1_Intron|RBP4_ENST00000371469.2_Missense_Mutation_p.Q180H|RBP4_ENST00000371464.3_Missense_Mutation_p.Q182H			P02753	RET4_HUMAN	retinol binding protein 4, plasma	182					cardiac muscle tissue development (GO:0048738)|detection of light stimulus involved in visual perception (GO:0050908)|embryonic organ morphogenesis (GO:0048562)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic skeletal system development (GO:0048706)|eye development (GO:0001654)|female genitalia morphogenesis (GO:0048807)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|lung development (GO:0030324)|maintenance of gastrointestinal epithelium (GO:0030277)|male gonad development (GO:0008584)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|phototransduction, visible light (GO:0007603)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of insulin secretion (GO:0032024)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to retinoic acid (GO:0032526)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|retinol transport (GO:0034633)|spermatogenesis (GO:0007283)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	retinal binding (GO:0016918)|retinol binding (GO:0019841)|retinol transporter activity (GO:0034632)			large_intestine(1)|lung(3)|skin(1)	5		Colorectal(252;0.122)			Vitamin A(DB00162)	TCAGCCTGTACTGCCTGGCCA	0.612																																					Pancreas(5;160 256 1117 46697 50185)												0													89.0	88.0	89.0					10																	95353602		2203	4300	6503	SO:0001583	missense	5950			BC020633	CCDS31249.1	10q23.33	2014-01-22	2001-11-28		ENSG00000138207	ENSG00000138207		"""Lipocalins"""	9922	protein-coding gene	gene with protein product		180250	"""retinol-binding protein 4, plasma"""				Standard	XM_005270023		Approved		uc001kit.3	P02753	OTTHUMG00000018773	ENST00000371467.1:c.546G>C	10.37:g.95353602C>G	ENSP00000360522:p.Gln182His		D3DR38|O43478|O43479|Q5VY24|Q8WWA3|Q9P178	Missense_Mutation	SNP	ENST00000371467.1	37	CCDS31249.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083314	0.76642	.	.	ENSG00000138207	ENST00000371464;ENST00000371469;ENST00000371467;ENST00000371463	D;D	0.82893	-1.66;-1.66	5.95	5.04	0.67666	Calycin-like (1);Calycin (1);	0.092500	0.64402	D	0.000001	D	0.84266	0.5434	L	0.40543	1.245	0.42745	D	0.993759	D	0.65815	0.995	P	0.58873	0.847	D	0.84516	0.0625	10	0.56958	D	0.05	-23.3902	11.7296	0.51728	0.0:0.8689:0.0:0.1311	.	182	P02753	RET4_HUMAN	H	182;180;182;180	ENSP00000360519:Q182H;ENSP00000360522:Q182H	ENSP00000360518:Q180H	Q	-	3	2	RBP4	95343592	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.149000	0.50655	2.811000	0.96726	0.655000	0.94253	CAG		0.612	RBP4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049431.1		NM_006744	
RPGR	6103	hgsc.bcm.edu;ucsc.edu	37	X	38180284	38180284	+	Silent	SNP	T	T	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chrX:38180284T>G	ENST00000339363.3	-	4	473	c.306A>C	c.(304-306)tcA>tcC	p.S102S	RPGR_ENST00000338898.3_Silent_p.S102S|RPGR_ENST00000378505.2_Silent_p.S102S|RPGR_ENST00000342811.3_Silent_p.S102S|RPGR_ENST00000318842.7_Silent_p.S102S|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Silent_p.S102S			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	102					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CTATACCTGTTGACACCAGGG	0.363																																																	0													101.0	90.0	94.0					X																	38180284		2202	4300	6502	SO:0001819	synonymous_variant	6103			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.306A>C	X.37:g.38180284T>G			B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Silent	SNP	ENST00000339363.3	37																																																																																					0.363	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_000328	
RPP21	79897	hgsc.bcm.edu	37	6	30314294	30314294	+	Silent	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr6:30314294C>T	ENST00000442966.2	+	4	340	c.327C>T	c.(325-327)ctC>ctT	p.L109L	RPP21_ENST00000428040.2_Silent_p.L132L|RPP21_ENST00000436442.2_Silent_p.L109L|RPP21_ENST00000433076.2_Silent_p.L117L|TRIM39-RPP21_ENST00000513556.1_Silent_p.L370L			Q9H633	RPP21_HUMAN	ribonuclease P/MRP 21kDa subunit	109					response to drug (GO:0042493)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonuclease P activity (GO:0004526)	p.L109L(1)		endometrium(2)|ovary(1)|prostate(1)	4						GGCATTTACTCTGGGGAGACA	0.597																																																	1	Substitution - coding silent(1)	ovary(1)											58.0	55.0	56.0					6																	30314294		2203	4300	6503	SO:0001819	synonymous_variant	79897			AK026291	CCDS4679.1, CCDS56409.1, CCDS56410.1	6p21.32	2012-05-21	2007-06-26	2004-03-19	ENSG00000241370	ENSG00000241370			21300	protein-coding gene	gene with protein product		612524	"""chromosome 6 open reading frame 135"", ""ribonuclease P 21kDa subunit"""	C6orf135			Standard	NM_001199120		Approved	FLJ22638, Em:AB014085.3		Q9H633	OTTHUMG00000031220	ENST00000442966.2:c.327C>T	6.37:g.30314294C>T			A2AAZ8|B0S834|B0S835|Q5JPL9|Q5JPM1|Q5STF8|Q5STF9|Q5STG2|Q5SU41|Q5SU42|Q86Y49|Q86Y50|Q86Y51|Q96F16	Silent	SNP	ENST00000442966.2	37	CCDS4679.1																																																																																				0.597	RPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076451.2		NM_024839	
PNISR	25957	hgsc.bcm.edu	37	6	99860572	99860572	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr6:99860572T>A	ENST00000369239.5	-	4	336	c.132A>T	c.(130-132)caA>caT	p.Q44H	PNISR_ENST00000466057.1_5'UTR|PNISR_ENST00000438806.1_Missense_Mutation_p.Q44H	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	44	Gln-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						AAGCTTCTCTTTGGGCAATCC	0.428																																																	0													139.0	125.0	129.0					6																	99860572		2203	4300	6503	SO:0001583	missense	0			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.132A>T	6.37:g.99860572T>A	ENSP00000358242:p.Gln44His		A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	ENST00000369239.5	37	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	T	16.01	3.002736	0.54254	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	T;T	0.49139	0.79;0.79	5.82	2.2	0.27929	.	0.000000	0.85682	D	0.000000	T	0.39226	0.1070	L	0.29908	0.895	0.51482	D	0.999926	D;D	0.69078	0.988;0.997	D;D	0.81914	0.977;0.995	T	0.36286	-0.9754	10	0.59425	D	0.04	.	8.2788	0.31887	0.0:0.3393:0.0:0.6606	.	44;44	E1P5D4;Q8TF01	.;PNISR_HUMAN	H	44	ENSP00000358242:Q44H;ENSP00000387997:Q44H	ENSP00000358242:Q44H	Q	-	3	2	PNISR	99967293	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.128000	0.31369	0.485000	0.27652	-0.256000	0.11100	CAA		0.428	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1		NM_032870	
MKL1	57591	hgsc.bcm.edu;ucsc.edu	37	22	40803848	40803848	+	IGR	SNP	G	G	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr22:40803848G>C	ENST00000355630.3	-	0	4496				SGSM3_ENST00000454798.2_Splice_Site|SGSM3_ENST00000248929.9_Splice_Site	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GGCCTGCGAGGTGGGGTCCTT	0.612			T	RBM15	acute megakaryocytic leukemia																																			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	0													49.0	52.0	51.0					22																	40803848		2203	4300	6503	SO:0001628	intergenic_variant	27352			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		22.37:g.40803848G>C			Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Splice_Site	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700443	0.48307	.	.	ENSG00000100359	ENST00000248929;ENST00000454798	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8066	0.92040	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SGSM3	39133794	1.000000	0.71417	1.000000	0.80357	0.327000	0.28475	7.304000	0.78882	2.527000	0.85204	0.561000	0.74099	.		0.612	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1		NM_020831	
SLC4A3	6508	hgsc.bcm.edu	37	2	220497112	220497112	+	Silent	SNP	T	T	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr2:220497112T>C	ENST00000358055.3	+	8	1601	c.1089T>C	c.(1087-1089)gtT>gtC	p.V363V	SLC4A3_ENST00000497589.1_3'UTR|SLC4A3_ENST00000273063.6_Silent_p.V390V|SLC4A3_ENST00000317151.3_Silent_p.V363V|SLC4A3_ENST00000373760.2_Silent_p.V363V|SLC4A3_ENST00000373762.3_Silent_p.V390V			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	363					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCCCCATGTTGCCTCGCTCT	0.667																																																	0													59.0	56.0	57.0					2																	220497112		2203	4300	6503	SO:0001819	synonymous_variant	6508				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.1089T>C	2.37:g.220497112T>C			A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Silent	SNP	ENST00000358055.3	37	CCDS2445.1																																																																																				0.667	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1		NM_005070	
SLC4A8	9498	hgsc.bcm.edu	37	12	51851247	51851247	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr12:51851247C>G	ENST00000453097.2	+	6	904	c.687C>G	c.(685-687)aaC>aaG	p.N229K	SLC4A8_ENST00000358657.3_Missense_Mutation_p.N256K|SLC4A8_ENST00000394856.1_Missense_Mutation_p.N176K|SLC4A8_ENST00000514353.3_Missense_Mutation_p.N176K|SLC4A8_ENST00000535225.2_Missense_Mutation_p.N176K	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		AGAAGAGAAACAACCTCATTC	0.418																																																	0													166.0	147.0	154.0					12																	51851247		2203	4300	6503	SO:0001583	missense	9498			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.687C>G	12.37:g.51851247C>G	ENSP00000405812:p.Asn229Lys			Missense_Mutation	SNP	ENST00000453097.2	37	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	C	8.228	0.804024	0.16467	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000547697;ENST00000551071	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.29	2.05	0.26809	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.432610	0.24922	N	0.034530	T	0.29716	0.0742	N	0.05078	-0.115	0.48040	D	0.999573	B;B;B;B;B;B;B	0.30563	0.285;0.001;0.026;0.002;0.005;0.001;0.082	B;B;B;B;B;B;B	0.31946	0.138;0.007;0.025;0.027;0.016;0.005;0.041	T	0.27191	-1.0081	10	0.02654	T	1	.	3.9372	0.09311	0.0:0.5219:0.2018:0.2763	.	176;256;176;229;229;229;176	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6;F8VSA8	.;.;.;S4A8_HUMAN;.;.;.	K	176;256;229;176;229;176;176;176	ENSP00000441520:N176K;ENSP00000351483:N256K;ENSP00000405812:N229K;ENSP00000378325:N176K;ENSP00000442561:N176K	ENSP00000315789:N229K	N	+	3	2	SLC4A8	50137514	0.721000	0.28007	1.000000	0.80357	0.997000	0.91878	0.159000	0.16442	0.607000	0.29982	0.655000	0.94253	AAC		0.418	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1		NM_004858	
SMPD2	6610	hgsc.bcm.edu	37	6	109764751	109764751	+	Silent	SNP	G	G	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr6:109764751G>T	ENST00000258052.3	+	10	1274	c.915G>T	c.(913-915)gtG>gtT	p.V305V	PPIL6_ENST00000440797.2_5'Flank|PPIL6_ENST00000424445.2_5'Flank|PPIL6_ENST00000521072.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	305					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		TGATGTGTGTGCTAAAGGAGG	0.622																																																	0													45.0	45.0	45.0					6																	109764751		2203	4300	6503	SO:0001819	synonymous_variant	6610			AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.915G>T	6.37:g.109764751G>T			Q5TED1|Q9BWR3	Silent	SNP	ENST00000258052.3	37	CCDS5075.1	.	.	.	.	.	.	.	.	.	.	G	0.035	-1.313586	0.01331	.	.	ENSG00000135587	ENST00000458487	.	.	.	5.95	3.2	0.36748	.	.	.	.	.	T	0.40145	0.1105	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27640	-1.0068	4	.	.	.	-11.4744	6.4333	0.21809	0.1605:0.1492:0.6903:0.0	.	.	.	.	F	202	.	.	C	+	2	0	SMPD2	109871444	0.999000	0.42202	0.489000	0.27452	0.044000	0.14063	1.347000	0.33975	0.407000	0.25591	-0.140000	0.14226	TGC		0.622	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1			
SNRNP200	23020	hgsc.bcm.edu;ucsc.edu	37	2	96959208	96959208	+	Silent	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr2:96959208A>G	ENST00000323853.5	-	15	1959	c.1882T>C	c.(1882-1884)Tta>Cta	p.L628L	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	628	Helicase ATP-binding 1. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						AAAGCTTCTAAGACAGGACCT	0.478																																																	0													146.0	147.0	147.0					2																	96959208		2203	4300	6503	SO:0001819	synonymous_variant	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.1882T>C	2.37:g.96959208A>G			O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Silent	SNP	ENST00000323853.5	37	CCDS2020.1																																																																																				0.478	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2		NM_014014	
SREBF2	6721	hgsc.bcm.edu	37	22	42269953	42269953	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr22:42269953A>T	ENST00000361204.4	+	5	1185	c.1019A>T	c.(1018-1020)aAa>aTa	p.K340I		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	340	Interaction with LMNA. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ATCATTGAGAAACGATATCGC	0.483																																																	0													105.0	84.0	91.0					22																	42269953		2203	4300	6503	SO:0001583	missense	6721			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1019A>T	22.37:g.42269953A>T	ENSP00000354476:p.Lys340Ile		Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	ENST00000361204.4	37	CCDS14023.1	.	.	.	.	.	.	.	.	.	.	A	35	5.466286	0.96257	.	.	ENSG00000198911	ENST00000361204;ENST00000444813;ENST00000457567	D	0.98666	-5.06	6.17	6.17	0.99709	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99378	0.9781	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98740	1.0716	10	0.87932	D	0	-27.0642	16.8222	0.85835	1.0:0.0:0.0:0.0	.	340	Q12772	SRBP2_HUMAN	I	340	ENSP00000354476:K340I	ENSP00000354476:K340I	K	+	2	0	SREBF2	40599899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.329000	0.96413	2.371000	0.80710	0.533000	0.62120	AAA		0.483	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1		NM_004599	
SREK1IP1	285672	hgsc.bcm.edu	37	5	64020311	64020311	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr5:64020311C>A	ENST00000513458.4	-	5	535	c.368G>T	c.(367-369)aGt>aTt	p.S123I		NM_173829.3	NP_776190.1	Q8N9Q2	SR1IP_HUMAN	SREK1-interacting protein 1	123	Lys-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)		nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6						ttttgatttactctttttttc	0.299																																																	0													40.0	34.0	36.0					5																	64020311		2188	4276	6464	SO:0001583	missense	285672			AK094073	CCDS34171.1	5q12.3	2010-09-20	2010-09-20	2010-09-20	ENSG00000153006	ENSG00000153006			26716	protein-coding gene	gene with protein product	"""p18 splicing regulatory protein"""		"""SFRS12-interacting protein 1"""	SFRS12IP1		15456940	Standard	NM_173829		Approved	FLJ36754, P18SRP	uc003jtk.3	Q8N9Q2	OTTHUMG00000162291	ENST00000513458.4:c.368G>T	5.37:g.64020311C>A	ENSP00000427401:p.Ser123Ile		Q32NC8	Missense_Mutation	SNP	ENST00000513458.4	37	CCDS34171.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.227187	0.39399	.	.	ENSG00000153006	ENST00000513458	.	.	.	6.07	-0.274	0.12910	.	0.882658	0.10237	N	0.698886	T	0.29491	0.0735	L	0.36672	1.1	0.24271	N	0.99525	B	0.19445	0.036	B	0.18871	0.023	T	0.22556	-1.0213	9	0.44086	T	0.13	-6.6043	5.8847	0.18874	0.0:0.5137:0.1508:0.3355	.	123	Q8N9Q2	SR1IP_HUMAN	I	123	.	ENSP00000427401:S123I	S	-	2	0	SREK1IP1	64056067	0.797000	0.28877	0.937000	0.37676	0.960000	0.62799	-0.640000	0.05440	-0.378000	0.07918	0.655000	0.94253	AGT		0.299	SREK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368457.4		NM_173829	
STAT2	6773	hgsc.bcm.edu	37	12	56744656	56744656	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr12:56744656G>A	ENST00000314128.4	-	11	1074	c.1051C>T	c.(1051-1053)Cag>Tag	p.Q351*	STAT2_ENST00000557235.1_Nonsense_Mutation_p.Q347*|STAT2_ENST00000556539.1_5'Flank|RNU7-40P_ENST00000516397.1_RNA|STAT2_ENST00000418572.2_Nonsense_Mutation_p.Q347*			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	351					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						TTGCCTTCCTGGAGTCTCACC	0.532																																																	0													103.0	98.0	100.0					12																	56744656		2203	4300	6503	SO:0001587	stop_gained	6773			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1051C>T	12.37:g.56744656G>A	ENSP00000315768:p.Gln351*		B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Nonsense_Mutation	SNP	ENST00000314128.4	37	CCDS8917.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.972628	0.92919	.	.	ENSG00000170581	ENST00000314128;ENST00000557235;ENST00000418572	.	.	.	4.92	4.0	0.46444	.	0.062767	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-16.3467	9.9778	0.41795	0.0:0.1504:0.6942:0.1554	.	.	.	.	X	351;347;347	.	ENSP00000315768:Q351X	Q	-	1	0	STAT2	55030923	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	5.132000	0.64758	1.150000	0.42419	0.462000	0.41574	CAG		0.532	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410277.1		NM_005419	
SYNE2	23224	hgsc.bcm.edu	37	14	64554560	64554560	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr14:64554560C>A	ENST00000344113.4	+	58	11868	c.11656C>A	c.(11656-11658)Cag>Aag	p.Q3886K	SYNE2_ENST00000555002.1_Missense_Mutation_p.Q520K|SYNE2_ENST00000358025.3_Missense_Mutation_p.Q3886K|SYNE2_ENST00000357395.3_Missense_Mutation_p.Q271K|SYNE2_ENST00000394768.2_Missense_Mutation_p.Q271K|SYNE2_ENST00000554584.1_Missense_Mutation_p.Q3919K|ESR2_ENST00000542956.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3886					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCCACAGATTCAGCGAATGGC	0.358																																																	0													58.0	59.0	59.0					14																	64554560		2203	4300	6503	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.11656C>A	14.37:g.64554560C>A	ENSP00000341781:p.Gln3886Lys		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155342	0.57259	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.62232	0.42;3.67;0.43;0.04;3.8;3.67	5.36	5.36	0.76844	.	0.000000	0.50627	D	0.000101	T	0.78483	0.4290	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.76494	0.994;0.983;0.983;0.999	P;P;D;D	0.75484	0.879;0.858;0.909;0.986	T	0.76531	-0.2925	10	0.35671	T	0.21	.	18.6869	0.91568	0.0:1.0:0.0:0.0	.	271;3920;3886;3886	Q8WXH0-7;D4YW74;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	K	3886;271;3886;3919;3919;520;271	ENSP00000350719:Q3886K;ENSP00000349969:Q271K;ENSP00000341781:Q3886K;ENSP00000452570:Q3919K;ENSP00000450831:Q520K;ENSP00000378249:Q271K	ENSP00000261678:Q3919K	Q	+	1	0	SYNE2	63624313	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.248000	0.65421	2.503000	0.84419	0.591000	0.81541	CAG		0.358	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2		NM_182914	
SYNJ1	8867	hgsc.bcm.edu;ucsc.edu	37	21	34053894	34053894	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr21:34053894T>G	ENST00000322229.7	-	10	1264	c.1265A>C	c.(1264-1266)cAa>cCa	p.Q422P	SYNJ1_ENST00000382499.2_Missense_Mutation_p.Q461P|SYNJ1_ENST00000433931.2_Missense_Mutation_p.Q461P|SYNJ1_ENST00000382491.3_Missense_Mutation_p.Q422P|SYNJ1_ENST00000357345.3_Missense_Mutation_p.Q422P			O43426	SYNJ1_HUMAN	synaptojanin 1	422	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						AAAAACTTCTTGAAAGCGAGT	0.383																																																	0													116.0	112.0	114.0					21																	34053894		2203	4300	6503	SO:0001583	missense	8867			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.1265A>C	21.37:g.34053894T>G	ENSP00000322234:p.Gln422Pro		O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.793079	0.50102	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236	T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92	5.83	3.34	0.38264	Synaptojanin, N-terminal (1);	0.101085	0.64402	D	0.000001	T	0.32315	0.0825	M	0.76170	2.325	0.58432	D	0.999996	P;P;P;B;P	0.37038	0.457;0.459;0.579;0.43;0.467	B;B;B;B;B	0.41299	0.124;0.122;0.353;0.122;0.202	T	0.08764	-1.0706	10	0.36615	T	0.2	.	11.3016	0.49309	0.2423:0.0:0.0:0.7577	.	422;461;422;422;422	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	P	422;422;461;461;422;422	ENSP00000371931:Q422P;ENSP00000349903:Q422P;ENSP00000371939:Q461P;ENSP00000409667:Q461P;ENSP00000322234:Q422P;ENSP00000413649:Q422P	ENSP00000322234:Q422P	Q	-	2	0	SYNJ1	32975765	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.102000	0.64572	1.008000	0.39264	0.477000	0.44152	CAA		0.383	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				
TBC1D14	57533	hgsc.bcm.edu	37	4	7012491	7012491	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr4:7012491A>G	ENST00000409757.4	+	11	1754	c.1630A>G	c.(1630-1632)Aga>Gga	p.R544G	TBC1D14_ENST00000410031.1_Missense_Mutation_p.R316G|TBC1D14_ENST00000446947.2_Missense_Mutation_p.R191G|TBC1D14_ENST00000451522.2_Missense_Mutation_p.R264G|TBC1D14_ENST00000448507.1_Missense_Mutation_p.R544G	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	544	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						GGCGTTTTTTAGAGTGGACCA	0.438																																																	0													218.0	198.0	205.0					4																	7012491		2203	4300	6503	SO:0001583	missense	57533			AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1630A>G	4.37:g.7012491A>G	ENSP00000386921:p.Arg544Gly		B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	ENST00000409757.4	37	CCDS3394.2	.	.	.	.	.	.	.	.	.	.	A	14.54	2.565631	0.45694	.	.	ENSG00000132405	ENST00000448507;ENST00000409757;ENST00000410031;ENST00000451522;ENST00000439515;ENST00000446947	T;T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;3.68;2.77	5.45	4.6	0.57074	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.13628	0.0330	L	0.38649	1.16	0.80722	D	1	B;B;B	0.33549	0.178;0.095;0.417	B;B;B	0.40982	0.169;0.135;0.345	T	0.05517	-1.0880	10	0.45353	T	0.12	-10.6829	14.4306	0.67246	0.1539:0.8461:0.0:0.0	.	191;264;544	F5GXK4;Q9P2M4-2;Q9P2M4	.;.;TBC14_HUMAN	G	544;544;316;264;197;191	ENSP00000404041:R544G;ENSP00000386921:R544G;ENSP00000386343:R316G;ENSP00000388886:R264G;ENSP00000389082:R197G;ENSP00000405875:R191G	ENSP00000386921:R544G	R	+	1	2	TBC1D14	7063392	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.753000	0.55180	1.288000	0.44600	-0.418000	0.06021	AGA		0.438	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206981.3		NM_020773	
TCEA3	6920	hgsc.bcm.edu;ucsc.edu	37	1	23751094	23751094	+	Silent	SNP	G	G	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr1:23751094G>A	ENST00000450454.2	-	1	139	c.33C>T	c.(31-33)gcC>gcT	p.A11A	TCEA3_ENST00000374601.3_Silent_p.A11A	NM_003196.1	NP_003187.1	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3	11	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		CCAGCTTTTTGGCGATCCTCA	0.711																																																	0													85.0	90.0	88.0					1																	23751094		2026	4207	6233	SO:0001819	synonymous_variant	6920			AJ223473	CCDS44086.1	1p36.11	2011-01-25			ENSG00000204219	ENSG00000204219			11615	protein-coding gene	gene with protein product		604128				9790746	Standard	NM_003196		Approved	TFIIS.H	uc021oig.1	O75764	OTTHUMG00000003233	ENST00000450454.2:c.33C>T	1.37:g.23751094G>A			A8K2K7|Q5DR83	Silent	SNP	ENST00000450454.2	37	CCDS44086.1																																																																																				0.711	TCEA3-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008911.2		NM_003196	
TCF20	6942	hgsc.bcm.edu;ucsc.edu	37	22	42609902	42609902	+	Silent	SNP	G	G	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr22:42609902G>T	ENST00000359486.3	-	1	1546	c.1410C>A	c.(1408-1410)gtC>gtA	p.V470V	TCF20_ENST00000335626.4_Silent_p.V470V	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	470					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						ACATGTGCTGGACAGTGTTAG	0.483																																																	0													113.0	116.0	115.0					22																	42609902		2203	4300	6503	SO:0001819	synonymous_variant	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.1410C>A	22.37:g.42609902G>T			A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Silent	SNP	ENST00000359486.3	37	CCDS14033.1																																																																																				0.483	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1		NM_181492	
TDRD6	221400	hgsc.bcm.edu	37	6	46659688	46659688	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr6:46659688A>C	ENST00000316081.6	+	1	3823	c.3823A>C	c.(3823-3825)Act>Cct	p.T1275P	TDRD6_ENST00000544460.1_Missense_Mutation_p.T1275P	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1275					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			AGTAGAAGCTACTCTTTCAGA	0.358																																																	0													41.0	47.0	45.0					6																	46659688		2201	4296	6497	SO:0001583	missense	221400			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.3823A>C	6.37:g.46659688A>C	ENSP00000346065:p.Thr1275Pro		B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	1.989	-0.432144	0.04669	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.15487	2.42;2.42	5.01	-3.82	0.04281	.	1.355130	0.04368	N	0.358597	T	0.05135	0.0137	L	0.40543	1.245	0.09310	N	1	P;P	0.47106	0.89;0.824	P;B	0.46796	0.527;0.327	T	0.14924	-1.0455	10	0.27082	T	0.32	1.1067	1.8385	0.03144	0.3946:0.1379:0.3334:0.1341	.	1275;1275	F5H5M3;O60522	.;TDRD6_HUMAN	P	1275	ENSP00000443299:T1275P;ENSP00000346065:T1275P	ENSP00000346065:T1275P	T	+	1	0	TDRD6	46767647	0.000000	0.05858	0.000000	0.03702	0.306000	0.27790	-0.505000	0.06367	-0.750000	0.04740	-0.316000	0.08728	ACT		0.358	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1		XM_166443	
TMEM33	55161	hgsc.bcm.edu	37	4	41941346	41941346	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr4:41941346A>G	ENST00000504986.1	+	3	639	c.274A>G	c.(274-276)Agc>Ggc	p.S92G	TMEM33_ENST00000325094.5_Missense_Mutation_p.S92G|TMEM33_ENST00000513702.1_Missense_Mutation_p.S92G	NM_018126.2	NP_060596.2	P57088	TMM33_HUMAN	transmembrane protein 33	92						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)				endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9						GTTAGAGGACAGCTGCCACTA	0.423																																																	0													104.0	103.0	103.0					4																	41941346		2203	4300	6503	SO:0001583	missense	55161			BC000948	CCDS3464.1	4p14	2008-02-05			ENSG00000109133	ENSG00000109133			25541	protein-coding gene	gene with protein product						12477932	Standard	NM_018126		Approved	FLJ10525	uc003gwi.2	P57088	OTTHUMG00000099381	ENST00000504986.1:c.274A>G	4.37:g.41941346A>G	ENSP00000422473:p.Ser92Gly		B3KSS8|Q9H953	Missense_Mutation	SNP	ENST00000504986.1	37	CCDS3464.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.977673	0.74360	.	.	ENSG00000109133	ENST00000504986;ENST00000508448;ENST00000513702;ENST00000325094	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.80849	0.4702	M	0.84585	2.705	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	D	0.83866	0.0271	9	0.59425	D	0.04	-8.5193	15.1692	0.72858	1.0:0.0:0.0:0.0	.	92	P57088	TMM33_HUMAN	G	92	.	ENSP00000441455:S92G	S	+	1	0	TMEM33	41636103	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.032000	0.70918	1.993000	0.58246	0.482000	0.46254	AGC		0.423	TMEM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216834.2		NM_018126	
TRIM2	23321	hgsc.bcm.edu;ucsc.edu	37	4	154197264	154197264	+	Silent	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr4:154197264C>T	ENST00000437508.2	+	3	555	c.354C>T	c.(352-354)tgC>tgT	p.C118C	TRIM2_ENST00000494872.1_3'UTR|TRIM2_ENST00000338700.5_Silent_p.C145C	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	118					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		CTCTCTCTTGCCCAAACCACG	0.567																																																	0													81.0	73.0	75.0					4																	154197264		2203	4300	6503	SO:0001819	synonymous_variant	23321			AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.354C>T	4.37:g.154197264C>T			D3DP09|O60272|Q9BSI9|Q9UFZ1	Silent	SNP	ENST00000437508.2	37	CCDS47147.1																																																																																				0.567	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1			
TYR	7299	hgsc.bcm.edu;ucsc.edu	37	11	88911155	88911155	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr11:88911155A>T	ENST00000263321.5	+	1	536	c.34A>T	c.(34-36)Agt>Tgt	p.S12C	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	12					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CCTGCTGTGGAGTTTCCAGAC	0.537																																																	0													88.0	88.0	88.0					11																	88911155		2201	4299	6500	SO:0001583	missense	7299			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.34A>T	11.37:g.88911155A>T	ENSP00000263321:p.Ser12Cys		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.418925	0.42918	.	.	ENSG00000077498	ENST00000263321	D	0.99158	-5.5	6.07	0.86	0.19042	.	0.824534	0.11922	N	0.516564	D	0.95915	0.8670	N	0.21545	0.675	0.09310	N	0.999997	P	0.46578	0.88	P	0.46076	0.503	D	0.92592	0.6084	9	.	.	.	.	1.2606	0.02001	0.5088:0.1224:0.1328:0.2359	.	12	P14679	TYRO_HUMAN	C	12	ENSP00000263321:S12C	.	S	+	1	0	TYR	88550803	0.598000	0.26882	0.763000	0.31416	0.949000	0.60115	1.354000	0.34056	0.133000	0.18654	0.533000	0.62120	AGT		0.537	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2		NM_000372	
VTN	7448	hgsc.bcm.edu;ucsc.edu	37	17	26697201	26697201	+	Silent	SNP	G	G	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr17:26697201G>T	ENST00000226218.4	-	1	642	c.24C>A	c.(22-24)ctC>ctA	p.L8L	CTB-96E2.3_ENST00000591482.1_RNA|CTB-96E2.2_ENST00000555059.2_5'Flank|SARM1_ENST00000457710.3_5'Flank|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|VTN_ENST00000536498.1_5'UTR|VTN_ENST00000438614.1_5'Flank	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	8					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	GGGCCAGTATGAGAAGGGGTC	0.622																																																	0													115.0	115.0	115.0					17																	26697201		2203	4300	6503	SO:0001819	synonymous_variant	7448			BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.24C>A	17.37:g.26697201G>T			B2R7G0|P01141|Q9BSH7	Silent	SNP	ENST00000226218.4	37	CCDS11229.1																																																																																				0.622	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2		NM_000638	
ZHX2	22882	hgsc.bcm.edu	37	8	123964182	123964182	+	Silent	SNP	T	T	A			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr8:123964182T>A	ENST00000314393.4	+	3	1267	c.432T>A	c.(430-432)atT>atA	p.I144I		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	144					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			TGAAGTTAATTAAACGCAATA	0.478																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)												0													93.0	90.0	91.0					8																	123964182		2203	4300	6503	SO:0001819	synonymous_variant	22882			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.432T>A	8.37:g.123964182T>A				Silent	SNP	ENST00000314393.4	37	CCDS6336.1																																																																																				0.478	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1		NM_014943	
ZKSCAN2	342357	hgsc.bcm.edu;ucsc.edu	37	16	25264266	25264266	+	Splice_Site	SNP	C	C	T			TCGA-AK-3434-01A-02D-1361-10	TCGA-AK-3434-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d2b9053e-2461-4bd1-b205-ae2c7b9c5289	d2ac612a-347f-4541-b95d-973e85021530	g.chr16:25264266C>T	ENST00000328086.7	-	3	1482		c.e3+1			NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2						regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		TTACAATGTACCTGGGACCCA	0.517																																																	0													142.0	141.0	141.0					16																	25264266		2197	4300	6497	SO:0001630	splice_region_variant	342357			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.678+1G>A	16.37:g.25264266C>T			A1L3B4|Q6ZN77	Splice_Site	SNP	ENST00000328086.7	37	CCDS32410.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446852	0.43429	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9778	0.80083	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZKSCAN2	25171767	1.000000	0.71417	0.998000	0.56505	0.304000	0.27724	3.473000	0.53122	2.840000	0.97914	0.655000	0.94253	.		0.517	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1		NM_001012981	Intron
